WorldWideScience

Sample records for acads gene variation

  1. The ACADS gene variation spectrum in 114 patients with short-chain acyl-CoA dehydrogenase (SCAD) deficiency is dominated by missense variations leading to protein misfolding at the cellular level

    DEFF Research Database (Denmark)

    Pedersen, Christina Bak; Kølvrå, Steen; Kølvraa, Agnete;

    2008-01-01

    , 26 missense, one start codon, and two stop codon variations. In vitro import studies of variant SCAD proteins in isolated mitochondria from SCAD deficient (SCAD-/-) mice demonstrated an increased tendency of the abnormal proteins to misfold and aggregate compared to the wild-type, a phenomenon that...... often leads to gain-of-function cellular phenotypes. However, no correlation was found between the clinical phenotype and the degree of SCAD dysfunction. We propose that SCAD deficiency should be considered as a disorder of protein folding that can lead to clinical disease in combination with other...

  2. Variations in IBD (ACAD8) in children with elevated C4-carnitine detected by tandem mass spectrometry newborn screening

    DEFF Research Database (Denmark)

    Pedersen, Christina B; Bischoff, Claus; Christensen, Ernst;

    2006-01-01

    The isobutyryl-CoA dehydrogenase (IBD) enzyme is involved in the degradation of valine. IBD deficiency was first reported in 1998 and subsequent genetic investigations identified acyl-CoA dehydrogenase (ACAD) 8, now IBD, as the gene responsible for IBD deficiency. Only three individuals homozygous...... or compound heterozygous for variations in the IBD gene have been reported. We present IBD deficiency in an additional four newborns with elevated C(4)-carnitine identified by tandem mass spectrometry (MS/MS) screening in Denmark and the United States. Three showed urinary excretions of isobutyryl......-glycine, and in vitro probe analysis of fibroblasts from two newborns indicated enzymatic IBD defect. Molecular genetic analysis revealed seven new rare variations in the IBD gene (c.348C>A, c.400G>T, c.409G>A, c.455T>C, c.958G>A, c.1000C>T and c.1154G>A). Furthermore, sequence analysis of the short-chain acyl...

  3. Variations in IBD (ACAD8) in children with elevated C-4-carnitine detected by tandem mass spectrometry newborn screening

    NARCIS (Netherlands)

    C.B. Pedersen; C. Bischoff; E. Christensen; H. Simonsen; A.M. Lund; S.P. Young; D.D. Koeberl; D.S. Millington; C.R. Roe; D.S. Roe; R.J.A. Wanders; J.P.N. Ruiter; L.D. Keppen; Q. Stein; I. Knudsen; N. Gregersen; B.S. Andresen

    2006-01-01

    The isobutyryl-CoA dehydrogenase (IBD) enzyme is involved in the degradation of valine. IBD deficiency was first reported in 1998 and subsequent genetic investigations identified acyl-CoA dehydrogenase (ACAD) 8, now IBD, as the gene responsible for IBD deficiency. Only three individuals homozygous o

  4. Riboflavin-responsive oxidative phosphorylation complex I deficiency caused by defective ACAD9: new function for an old gene.

    Science.gov (United States)

    Gerards, Mike; van den Bosch, Bianca J C; Danhauser, Katharina; Serre, Valérie; van Weeghel, Michel; Wanders, Ronald J A; Nicolaes, Gerry A F; Sluiter, Wim; Schoonderwoerd, Kees; Scholte, Hans R; Prokisch, Holger; Rötig, Agnès; de Coo, Irenaeus F M; Smeets, Hubert J M

    2011-01-01

    Mitochondrial complex I deficiency is the most common oxidative phosphorylation defect. Mutations have been detected in mitochondrial and nuclear genes, but the genetics of many patients remain unresolved and new genes are probably involved. In a consanguineous family, patients presented easy fatigability, exercise intolerance and lactic acidosis in blood from early childhood. In muscle, subsarcolemmal mitochondrial proliferation and a severe complex I deficiency were observed. Exercise intolerance and complex I activity was improved by a supplement of riboflavin at high dosage. Homozygosity mapping revealed a candidate region on chromosome three containing six mitochondria-related genes. Four genes were screened for mutations and a homozygous substitution was identified in ACAD9 (c.1594 C>T), changing the highly conserved arginine-532 into tryptophan. This mutation was absent in 188 ethnically matched controls. Protein modelling suggested a functional effect due to the loss of a stabilizing hydrogen bond in an α-helix and a local flexibility change. To test whether the ACAD9 mutation caused the complex I deficiency, we transduced fibroblasts of patients with wild-type and mutant ACAD9. Wild-type, but not mutant, ACAD9 restored complex I activity. An unrelated patient with the same phenotype was compound heterozygous for c.380 G>A and c.1405 C>T, changing arginine-127 into glutamine and arginine-469 into tryptophan, respectively. These amino acids were highly conserved and the substitutions were not present in controls, making them very probably pathogenic. Our data support a new function for ACAD9 in complex I function, making this gene an important new candidate for patients with complex I deficiency, which could be improved by riboflavin treatment. PMID:20929961

  5. Novela académica: reflexiones sobre sus orígenes en Inglaterra y Estados Unidos

    OpenAIRE

    Castagnino, María Inés

    2011-01-01

    Intentar definir la novela académica como género presenta algunas dificultades. Como características básicas, no puede decirse mucho más que que se trata de novelas protagonizadas por académicos (docentes, investigadores o ambas condiciones a la vez) que se desempeñan generalmente en el área de las humanidades, a menudo en la de literatura, y cuya acción suele transcurrir en las dependencias de una universidad. Más allá de estos denominadores comunes, y a pesar de la tendencia de algunos sect...

  6. Parkinson's disease and mitochondrial gene variations

    DEFF Research Database (Denmark)

    Andalib, Sasan; Vafaee, Manouchehr Seyedi; Gjedde, Albert

    2014-01-01

    Parkinson's disease (PD) is a common disorder of the central nervous system in the elderly. The pathogenesis of PD is a complex process, with genetics as an important contributing factor. This factor may stem from mitochondrial gene variations and mutations as well as from nuclear gene variations...

  7. Riboflavin-responsive oxidative phosphorylation complex I deficiency caused by defective ACAD9: new function for an old gene

    NARCIS (Netherlands)

    M. Gerards; B.J.C. van den Bosch; K. Danhauser; V. Serre; M. van Weeghel; R.J.A. Wanders; G.A.F. Nicolaes; W. Sluiter; K. Schoonderwoerd; H.R. Scholte; H. Prokisch; A. Rötig; I.F.M. de Coo; H.J.M. Smeets

    2011-01-01

    Mitochondrial complex I deficiency is the most common oxidative phosphorylation defect. Mutations have been detected in mitochondrial and nuclear genes, but the genetics of many patients remain unresolved and new genes are probably involved. In a consanguineous family, patients presented easy fatiga

  8. Variations in Antioxidant Genes and Male Infertility

    Directory of Open Access Journals (Sweden)

    Bolan Yu

    2015-01-01

    Full Text Available Oxidative stress and reactive oxygen species (ROS are generated from both endogenous and environmental resources, which in turn may cause defective spermatogenesis and male infertility. Antioxidant genes, which include catalase (CAT, glutathione peroxidase (GPX, glutathione S-transferase (GST, nitric oxide synthase (NOS, nuclear factor erythroid 2-related factor 2 (NRF2, and superoxide dismutase (SOD, play important roles in spermatogenesis and normal sperm function. In this review, we discuss the association between variations in major antioxidant genes and male infertility. Numerous studies have suggested that genetic disruption or functional polymorphisms in these antioxidant genes are associated with a higher risk for male infertility, which include low sperm quality, oligoasthenoteratozoospermia, oligozoospermia, and subfertility. The synergistic effects of environmental ROS and functional polymorphisms on antioxidant genes that result in male infertility have also been reported. Therefore, variants in antioxidant genes, which independently or synergistically occur with environmental ROS, affect spermatogenesis and contribute to the occurrence of male infertility. Large cohort and multiple center-based population studies to identify new antioxidant genetic variants that increase susceptibility to male infertility as well as validate its potential as genetic markers for diagnosis and risk assessment for male infertility for precise clinical approaches are warranted.

  9. Variations in Antioxidant Genes and Male Infertility.

    Science.gov (United States)

    Yu, Bolan; Huang, Zhaofeng

    2015-01-01

    Oxidative stress and reactive oxygen species (ROS) are generated from both endogenous and environmental resources, which in turn may cause defective spermatogenesis and male infertility. Antioxidant genes, which include catalase (CAT), glutathione peroxidase (GPX), glutathione S-transferase (GST), nitric oxide synthase (NOS), nuclear factor erythroid 2-related factor 2 (NRF2), and superoxide dismutase (SOD), play important roles in spermatogenesis and normal sperm function. In this review, we discuss the association between variations in major antioxidant genes and male infertility. Numerous studies have suggested that genetic disruption or functional polymorphisms in these antioxidant genes are associated with a higher risk for male infertility, which include low sperm quality, oligoasthenoteratozoospermia, oligozoospermia, and subfertility. The synergistic effects of environmental ROS and functional polymorphisms on antioxidant genes that result in male infertility have also been reported. Therefore, variants in antioxidant genes, which independently or synergistically occur with environmental ROS, affect spermatogenesis and contribute to the occurrence of male infertility. Large cohort and multiple center-based population studies to identify new antioxidant genetic variants that increase susceptibility to male infertility as well as validate its potential as genetic markers for diagnosis and risk assessment for male infertility for precise clinical approaches are warranted. PMID:26618172

  10. académico

    Directory of Open Access Journals (Sweden)

    Josefina Quintero Corzo

    2006-01-01

    Full Text Available Este artículo somete a discusión algunas ideas sobre reforma curricular universitaria surgidas de la crítica al discurso teórico y empírico que caracteriza los esquemas tradicionales. Se demuestra que la manera como se ha venido implementando, no satisface las políticas institucionales de cambio y mejoramiento académico. Se analiza el vínculo entre currículo e investigaci ón y su importancia para el proceso de reforma y mejoramiento académico.

  11. Genetic variation in genes affecting milk composition and quality

    DEFF Research Database (Denmark)

    Bertelsen, Henriette Pasgaard

    In the past decade major advances in next generation sequencing technologies have provided new opportuneties for the detection of genetic variation. Combining the knowlegde of genetic variation with phenotypic distributions provides considerable possibilites for detection of candidate genes...

  12. Plagio Académico

    OpenAIRE

    Campos, Rosalynn

    2015-01-01

    Concepto y ejemplo de plagio académico. Normas APA. Tratamiento de la información. Recurso educativo digital, en forma de Objeto de Aprendizaje. Diseñado para la difusión del plagio académico, sus consecuencias y cómo evitarlo. La estructura del diseño instruccional está dirigido al estilo de aprendizaje activo; aun así se puede aplicar en cualquier espacio académico.

  13. Genomic variation in Salmonella enterica core genes for epidemiological typing

    Directory of Open Access Journals (Sweden)

    Leekitcharoenphon Pimlapas

    2012-03-01

    Full Text Available Abstract Background Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over time. The core genes--the genes that are conserved in all (or most members of a genus or species--are potentially good candidates for investigating genomic variation in phylogeny and epidemiology. Results We identify a set of 2,882 core genes clusters based on 73 publicly available Salmonella enterica genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher confidence. The core genes can be divided into two categories: a few highly variable genes and a larger set of conserved core genes, with low variance. For the most variable core genes, the variance in amino acid sequences is higher than for the corresponding nucleotide sequences, suggesting that there is a positive selection towards mutations leading to amino acid changes. Conclusions Genomic variation within the core genome is useful for investigating molecular evolution and providing candidate genes for bacterial genome typing. Identification of genes with different degrees of variation is important especially in trend analysis.

  14. Inherited variation in immune genes and pathways and glioblastoma risk

    OpenAIRE

    Schwartzbaum, Judith A.; Xiao, Yuanyuan; Liu, Yanhong; Tsavachidis, Spyros; Berger, Mitchel S.; Bondy, Melissa L,; Chang, Jeffrey S.; Chang, Susan M.; Decker, Paul A.; Ding, Bo; Hepworth, Sarah J; Richard S. Houlston; Hosking, Fay J; Jenkins, Robert B.; Kosel, Matthew L.

    2010-01-01

    To determine whether inherited variations in immune function single-nucleotide polymorphisms (SNPs), genes or pathways affect glioblastoma risk, we analyzed data from recent genome-wide association studies in conjunction with predefined immune function genes and pathways. Gene and pathway analyses were conducted on two independent data sets using 6629 SNPs in 911 genes on 17 immune pathways from 525 glioblastoma cases and 602 controls from the University of California, San Francisco (UCSF) an...

  15. Population genetic variation in gene expression is associated withphenotypic variation in Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Fay, Justin C.; McCullough, Heather L.; Sniegowski, Paul D.; Eisen, Michael B.

    2004-02-25

    The relationship between genetic variation in gene expression and phenotypic variation observable in nature is not well understood. Identifying how many phenotypes are associated with differences in gene expression and how many gene-expression differences are associated with a phenotype is important to understanding the molecular basis and evolution of complex traits. Results: We compared levels of gene expression among nine natural isolates of Saccharomyces cerevisiae grown either in the presence or absence of copper sulfate. Of the nine strains, two show a reduced growth rate and two others are rust colored in the presence of copper sulfate. We identified 633 genes that show significant differences in expression among strains. Of these genes,20 were correlated with resistance to copper sulfate and 24 were correlated with rust coloration. The function of these genes in combination with their expression pattern suggests the presence of both correlative and causative expression differences. But the majority of differentially expressed genes were not correlated with either phenotype and showed the same expression pattern both in the presence and absence of copper sulfate. To determine whether these expression differences may contribute to phenotypic variation under other environmental conditions, we examined one phenotype, freeze tolerance, predicted by the differential expression of the aquaporin gene AQY2. We found freeze tolerance is associated with the expression of AQY2. Conclusions: Gene expression differences provide substantial insight into the molecular basis of naturally occurring traits and can be used to predict environment dependent phenotypic variation.

  16. Genomic variation in Salmonella enterica core genes for epidemiological typing

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Lukjancenko, Oksana; Rundsten, Carsten Friis;

    2012-01-01

    genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher......Background: Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS) available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over...... time. The core genes-the genes that are conserved in all (or most) members of a genus or species-are potentially good candidates for investigating genomic variation in phylogeny and epidemiology. Results: We identify a set of 2,882 core genes clusters based on 73 publicly available Salmonella enterica...

  17. Propagation of genetic variation in gene regulatory networks

    OpenAIRE

    Plahte, Erik; Gjuvsland, Arne B; Omholt, Stig W.

    2013-01-01

    A future quantitative genetics theory should link genetic variation to phenotypic variation in a causally cohesive way based on how genes actually work and interact. We provide a theoretical framework for predicting and understanding the manifestation of genetic variation in haploid and diploid regulatory networks with arbitrary feedback structures and intra-locus and inter-locus functional dependencies. Using results from network and graph theory, we define propagation functions describing h...

  18. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  19. Host genetic variation influences gene expression response to rhinovirus infection.

    Directory of Open Access Journals (Sweden)

    Minal Çalışkan

    2015-04-01

    Full Text Available Rhinovirus (RV is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs, namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5 and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3. The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.

  20. Epigenetic variation in the Egfr gene generates quantitative variation in a complex trait in ants.

    Science.gov (United States)

    Alvarado, Sebastian; Rajakumar, Rajendhran; Abouheif, Ehab; Szyf, Moshe

    2015-01-01

    Complex quantitative traits, like size and behaviour, are a pervasive feature of natural populations. Quantitative trait variation is the product of both genetic and environmental factors, yet little is known about the mechanisms through which their interaction generates this variation. Epigenetic processes, such as DNA methylation, can mediate gene-by-environment interactions during development to generate discrete phenotypic variation. We therefore investigated the developmental role of DNA methylation in generating continuous size variation of workers in an ant colony, a key trait associated with division of labour. Here we show that, in the carpenter ant Camponotus floridanus, global (genome-wide) DNA methylation indirectly regulates quantitative methylation of the conserved cell-signalling gene Epidermal growth factor receptor to generate continuous size variation of workers. DNA methylation can therefore generate quantitative variation in a complex trait by quantitatively regulating the transcription of a gene. This mechanism, alongside genetic variation, may determine the phenotypic possibilities of loci for generating quantitative trait variation in natural populations. PMID:25758336

  1. Epigenetic variation in the Egfr gene generates quantitative variation in a complex trait in ants.

    Science.gov (United States)

    Alvarado, Sebastian; Rajakumar, Rajendhran; Abouheif, Ehab; Szyf, Moshe

    2015-03-11

    Complex quantitative traits, like size and behaviour, are a pervasive feature of natural populations. Quantitative trait variation is the product of both genetic and environmental factors, yet little is known about the mechanisms through which their interaction generates this variation. Epigenetic processes, such as DNA methylation, can mediate gene-by-environment interactions during development to generate discrete phenotypic variation. We therefore investigated the developmental role of DNA methylation in generating continuous size variation of workers in an ant colony, a key trait associated with division of labour. Here we show that, in the carpenter ant Camponotus floridanus, global (genome-wide) DNA methylation indirectly regulates quantitative methylation of the conserved cell-signalling gene Epidermal growth factor receptor to generate continuous size variation of workers. DNA methylation can therefore generate quantitative variation in a complex trait by quantitatively regulating the transcription of a gene. This mechanism, alongside genetic variation, may determine the phenotypic possibilities of loci for generating quantitative trait variation in natural populations.

  2. rendimiento académico

    Directory of Open Access Journals (Sweden)

    Ernesto Barceló Martínez

    2006-01-01

    Full Text Available Esta investigación se propuso encontrar la posible relación entre el rendimiento académico y la ausencia de ciertas habilidades cognoscitivas denominadas desde la neuropsicología como funciones ejecutivas, en un grupo de estudiantes universitarios. Se exploró entonces el estado de las funciones ejecutivas en estudiantes universitarios que presentaban bajo y alto rendimiento académico. El diseño utilizado en esta investigación fue el transeccional descriptivo. El análisis de los resultados se hizo utilizando el paquete estadístico Statistical Package for Social Sciences (spss. Estos mostraron que, en general, no existen diferencias significativas entre los estudiantes de bajo y alto rendimiento académico. Es decir, mostraron que el rendimiento académico no está directamente relacionado con déficits a nivel de las habilidades ejecutivas, pero sí podría estarlo a nivel del lenguaje y de los antecedentes familiares, psicológicos y académicos en estos estudiantes.

  3. Genetic Variation in Candidate Genes Like the HMGA2 Gene in the Extremely Tall

    NARCIS (Netherlands)

    Hendriks, A. E. J.; Brown, M. R.; Boot, A. M.; Oostra, B. A.; Drop, S. L. S.; Parks, J. S.

    2011-01-01

    Background/Aims: Genetic variation in several candidate genes has been associated with short stature. Recently, a high-mobility group A2 (HMGA2) gene SNP has been robustly associated with height in the general population. Only few have attempted to study these genes in extremely tall stature. We the

  4. Propagation of genetic variation in gene regulatory networks.

    Science.gov (United States)

    Plahte, Erik; Gjuvsland, Arne B; Omholt, Stig W

    2013-08-01

    A future quantitative genetics theory should link genetic variation to phenotypic variation in a causally cohesive way based on how genes actually work and interact. We provide a theoretical framework for predicting and understanding the manifestation of genetic variation in haploid and diploid regulatory networks with arbitrary feedback structures and intra-locus and inter-locus functional dependencies. Using results from network and graph theory, we define propagation functions describing how genetic variation in a locus is propagated through the network, and show how their derivatives are related to the network's feedback structure. Similarly, feedback functions describe the effect of genotypic variation of a locus on itself, either directly or mediated by the network. A simple sign rule relates the sign of the derivative of the feedback function of any locus to the feedback loops involving that particular locus. We show that the sign of the phenotypically manifested interaction between alleles at a diploid locus is equal to the sign of the dominant feedback loop involving that particular locus, in accordance with recent results for a single locus system. Our results provide tools by which one can use observable equilibrium concentrations of gene products to disclose structural properties of the network architecture. Our work is a step towards a theory capable of explaining the pleiotropy and epistasis features of genetic variation in complex regulatory networks as functions of regulatory anatomy and functional location of the genetic variation.

  5. Expanding the Boundaries of Gene Variation for Crop Improvement

    International Nuclear Information System (INIS)

    Directed and undirected mutagenesis continues to offer unique opportunities for crop improvement. Mutations also occur naturally and different forms are present in each strain of plants within and among species. Modifying genes affect the expression of all mutants and examples exist where the deleterious features of a mutant can be significantly changed by selection. New technologies, including those associated with genomics such as re-sequencing, TILLING, and RNA interference, allow the detection of gene variation at an unprecedented frequency. Knowledge of genes that affect recombination among homoeologous chromosomes may lead to inducible methods regulating the exchange among chromosomes in a polyploid species. Forward and reverse genetic methods are readily available in many species, including model plant species. There are an estimated one million sites in the japonica rice genome tagged via Tos17, Ac/Ds, T-DNA, and other insertion elements. Site-specific mutagenesis and gene replacement methods may replace the need for transgenic technology in some cases. Transcriptome modification occurs via mutagen treatment, aneuploidy, and uniparental chromosome loss, and sometimes results in a mutant phenotype. The boundaries of gene variation appear to be more expansive as plant genetics knowledge and technologies increase. (author)

  6. Inherited variation in immune genes and pathways and glioblastoma risk.

    Science.gov (United States)

    Schwartzbaum, Judith A; Xiao, Yuanyuan; Liu, Yanhong; Tsavachidis, Spyros; Berger, Mitchel S; Bondy, Melissa L; Chang, Jeffrey S; Chang, Susan M; Decker, Paul A; Ding, Bo; Hepworth, Sarah J; Houlston, Richard S; Hosking, Fay J; Jenkins, Robert B; Kosel, Matthew L; McCoy, Lucie S; McKinney, Patricia A; Muir, Kenneth; Patoka, Joe S; Prados, Michael; Rice, Terri; Robertson, Lindsay B; Schoemaker, Minouk J; Shete, Sanjay; Swerdlow, Anthony J; Wiemels, Joe L; Wiencke, John K; Yang, Ping; Wrensch, Margaret R

    2010-10-01

    To determine whether inherited variations in immune function single-nucleotide polymorphisms (SNPs), genes or pathways affect glioblastoma risk, we analyzed data from recent genome-wide association studies in conjunction with predefined immune function genes and pathways. Gene and pathway analyses were conducted on two independent data sets using 6629 SNPs in 911 genes on 17 immune pathways from 525 glioblastoma cases and 602 controls from the University of California, San Francisco (UCSF) and a subset of 6029 SNPs in 893 genes from 531 cases and 1782 controls from MD Anderson (MDA). To further assess consistency of SNP-level associations, we also compared data from the UK (266 cases and 2482 controls) and the Mayo Clinic (114 cases and 111 controls). Although three correlated epidermal growth factor receptor (EGFR) SNPs were consistently associated with glioblastoma in all four data sets (Mantel-Haenzel P values = 1 × 10⁻⁵ to 4 × 10⁻³), independent replication is required as genome-wide significance was not attained. In gene-level analyses, eight immune function genes were significantly (minP < 0.05) associated with glioblastoma; the IL-2RA (CD25) cytokine gene had the smallest minP values in both UCSF (minP = 0.01) and MDA (minP = 0.001) data sets. The IL-2RA receptor is found on the surface of regulatory T cells potentially contributing to immunosuppression characteristic of the glioblastoma microenvironment. In pathway correlation analyses, cytokine signaling and adhesion-extravasation-migration pathways showed similar associations with glioblastoma risk in both MDA and UCSF data sets. Our findings represent the first systematic description of immune genes and pathways that characterize glioblastoma risk. PMID:20668009

  7. Genomic and gene variation in Mycoplasma hominis strains

    DEFF Research Database (Denmark)

    Christiansen, Gunna; Andersen, H; Birkelund, Svend;

    1987-01-01

    DNAs from 14 strains of Mycoplasma hominis isolated from various habitats, including strain PG21, were analyzed for genomic heterogeneity. DNA-DNA filter hybridization values were from 51 to 91%. Restriction endonuclease digestion patterns, analyzed by agarose gel electrophoresis, revealed no...... identity or cluster formation between strains. Variation within M. hominis rRNA genes was analyzed by Southern hybridization of EcoRI-cleaved DNA hybridized with a cloned fragment of the rRNA gene from the mycoplasma strain PG50. Five of the M. hominis strains showed identical hybridization patterns. These...... hybridization patterns were compared with those of 12 other mycoplasma species, which showed a much more complex band pattern. Cloned nonribosomal RNA gene fragments of M. hominis PG21 DNA were analyzed, and the fragments were used to demonstrate heterogeneity among the strains. A monoclonal antibody against...

  8. Gene conversion and purifying selection shape nucleotide variation in gibbon L/M opsin genes

    Directory of Open Access Journals (Sweden)

    Siriaroonrat Boripat

    2011-10-01

    Full Text Available Abstract Background Routine trichromatic color vision is a characteristic feature of catarrhines (humans, apes and Old World monkeys. This is enabled by L and M opsin genes arrayed on the X chromosome and an autosomal S opsin gene. In non-human catarrhines, genetic variation affecting the color vision phenotype is reported to be absent or rare in both L and M opsin genes, despite the suggestion that gene conversion has homogenized the two genes. However, nucleotide variation of both introns and exons among catarrhines has only been examined in detail for the L opsin gene of humans and chimpanzees. In the present study, we examined the nucleotide variation of gibbon (Catarrhini, Hylobatidae L and M opsin genes. Specifically, we focused on the 3.6~3.9-kb region that encompasses the centrally located exon 3 through exon 5, which encode the amino acid sites functional for the spectral tuning of the genes. Results Among 152 individuals representing three genera (Hylobates, Nomascus and Symphalangus, all had both L and M opsin genes and no L/M hybrid genes. Among 94 individuals subjected to the detailed DNA sequencing, the nucleotide divergence between L and M opsin genes in the exons was significantly higher than the divergence in introns in each species. The ratio of the inter-LM divergence to the intra-L/M polymorphism was significantly lower in the introns than that in synonymous sites. When we reconstructed the phylogenetic tree using the exon sequences, the L/M gene duplication was placed in the common ancestor of catarrhines, whereas when intron sequences were used, the gene duplications appeared multiple times in different species. Using the GENECONV program, we also detected that tracts of gene conversions between L and M opsin genes occurred mostly within the intron regions. Conclusions These results indicate the historical accumulation of gene conversions between L and M opsin genes in the introns in gibbons. Our study provides further

  9. Diurnal variation of hepatic antioxidant gene expression in mice.

    Directory of Open Access Journals (Sweden)

    Yi-Qiao Xu

    Full Text Available BACKGROUND: This study was aimed to examine circadian variations of hepatic antioxidant components, including the Nrf2- pathway, the glutathione (GSH system, antioxidant enzymes and metallothionein in mouse liver. METHODS AND RESULTS: Adult mice were housed in light- and temperature-controlled facilities for 2 weeks, and livers were collected every 4 h during the 24 h period. Total RNA was isolated, purified, and subjected to real-time RT-PCR analysis. Hepatic mRNA levels of Nrf2, Keap1, Nqo1 and Gclc were higher in the light-phase than the dark-phase, and were female-predominant. Hepatic GSH presented marked circadian fluctuations, along with glutathione S-transferases (GST-α1, GST-µ, GST-π and glutathione peroxidase (GPx1. The expressions of GPx1, GST-µ and GST-π mRNA were also higher in females. Antioxidant enzymes Cu/Zn superoxide dismutase (Sod1, catalase (CAT, cyclooxygenase-2 (Cox-2 and heme oxygenase-1 (Ho-1 showed circadian rhythms, with higher expressions of Cox-2 and CAT in females. Metallothionein, a small non-enzymatic antioxidant protein, showed dramatic circadian variation in males, but higher expression in females. The circadian variations of the clock gene Brain and Muscle Arnt-like Protein-1(Bmal1, albumin site D-binding protein (Dbp, nuclear receptor Rev-Erbα (Nr1d1, period protein (Per1 and Per2 and cryptochrome 1(Cry1 were in agreement with the literature. Furthermore, acetaminophen hepatotoxicity is more severe when administered in the afternoon when hepatic GSH was lowest. CONCLUSIONS: Circadian variations and gender differences in transcript levels of antioxidant genes exist in mouse liver, which could affect body responses to oxidative stress at different times of the day.

  10. Genome Editing of Structural Variations: Modeling and Gene Correction.

    Science.gov (United States)

    Park, Chul-Yong; Sung, Jin Jea; Kim, Dong-Wook

    2016-07-01

    The analysis of chromosomal structural variations (SVs), such as inversions and translocations, was made possible by the completion of the human genome project and the development of genome-wide sequencing technologies. SVs contribute to genetic diversity and evolution, although some SVs can cause diseases such as hemophilia A in humans. Genome engineering technology using programmable nucleases (e.g., ZFNs, TALENs, and CRISPR/Cas9) has been rapidly developed, enabling precise and efficient genome editing for SV research. Here, we review advances in modeling and gene correction of SVs, focusing on inversion, translocation, and nucleotide repeat expansion. PMID:27016031

  11. Landscape-scale variation in an anthropogenic factor shapes immune gene variation within a wild population.

    Science.gov (United States)

    Gonzalez-Quevedo, Catalina; Davies, Richard G; Phillips, Karl P; Spurgin, Lewis G; Richardson, David S

    2016-09-01

    Understanding the spatial scale at which selection acts upon adaptive genetic variation in natural populations is fundamental to our understanding of evolutionary ecology, and has important ramifications for conservation. The environmental factors to which individuals of a population are exposed can vary at fine spatial scales, potentially generating localized patterns of adaptation. Here, we compared patterns of neutral and major histocompatibility complex (MHC) variation within an island population of Berthelot's pipit (Anthus berthelotii) to assess whether landscape-level differences in pathogen-mediated selection generate fine-scale spatial structuring in these immune genes. Specifically, we tested for spatial associations between the distribution of avian malaria, and the factors previously shown to influence that distribution, and MHC variation within resident individuals. Although we found no overall genetic structure across the population for either neutral or MHC loci, we did find localized associations between environmental factors and MHC variation. One MHC class I allele (ANBE48) was directly associated with malaria infection risk, while the presence of the ANBE48 and ANBE38 alleles within individuals correlated (positively and negatively, respectively) with distance to the nearest poultry farm, an anthropogenic factor previously shown to be an important determinant of disease distribution in the study population. Our findings highlight the importance of considering small spatial scales when studying the patterns and processes involved in evolution at adaptive loci. PMID:27411090

  12. Sequence variations in the FAD2 gene in seeded pumpkins.

    Science.gov (United States)

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-12-21

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

  13. Evidence of a wide spectrum of cardiac involvement due to ACAD9 mutations: Report on nine patients.

    Science.gov (United States)

    Dewulf, Joseph P; Barrea, Catherine; Vincent, Marie-Françoise; De Laet, Corinne; Van Coster, Rudy; Seneca, Sara; Marie, Sandrine; Nassogne, Marie-Cécile

    2016-07-01

    Acyl-CoA dehydrogenase 9 (ACAD9) is a mitochondrial protein involved in oxidative phosphorylation complex I biogenesis. This protein also exhibits acyl-CoA dehydrogenase (ACAD) activity. ACAD9-mutated patients have been reported to suffer from primarily heart, muscle, liver, and nervous system disorders. ACAD9 mutation is suspected in cases of elevated lactic acid levels combined with complex I deficiency, and confirmed by ACAD9 gene analysis. At least 18 ACAD9-mutated patients have previously been reported, usually displaying severe cardiac involvement. We retrospectively studied nine additional patients from three unrelated families with a wide spectrum of cardiac involvement between the families as well as the patients from the same families. All patients exhibited elevated lactate levels. Deleterious ACAD9 mutations were identified in all patients except one for whom it was not possible to recover DNA. To our knowledge, this is one of the first reports on isolated mild ventricular hypertrophy due to ACAD9 mutation in a family with moderate symptoms during adolescence. This report also confirms that dilated cardiomyopathy may occur in conjunction with ACAD9 mutation and that some patients may respond clinically to riboflavin treatment. Of note, several patients suffered from patent ductus arteriosus (PDA), with one exhibiting a complex congenital heart defect. It is yet unknown whether these cardiac manifestations were related to ACAD9 mutation. In conclusion, this disorder should be suspected in the presence of lactic acidosis, complex I deficiency, and any cardiac involvement, even mild.

  14. Evidence of a wide spectrum of cardiac involvement due to ACAD9 mutations: Report on nine patients.

    Science.gov (United States)

    Dewulf, Joseph P; Barrea, Catherine; Vincent, Marie-Françoise; De Laet, Corinne; Van Coster, Rudy; Seneca, Sara; Marie, Sandrine; Nassogne, Marie-Cécile

    2016-07-01

    Acyl-CoA dehydrogenase 9 (ACAD9) is a mitochondrial protein involved in oxidative phosphorylation complex I biogenesis. This protein also exhibits acyl-CoA dehydrogenase (ACAD) activity. ACAD9-mutated patients have been reported to suffer from primarily heart, muscle, liver, and nervous system disorders. ACAD9 mutation is suspected in cases of elevated lactic acid levels combined with complex I deficiency, and confirmed by ACAD9 gene analysis. At least 18 ACAD9-mutated patients have previously been reported, usually displaying severe cardiac involvement. We retrospectively studied nine additional patients from three unrelated families with a wide spectrum of cardiac involvement between the families as well as the patients from the same families. All patients exhibited elevated lactate levels. Deleterious ACAD9 mutations were identified in all patients except one for whom it was not possible to recover DNA. To our knowledge, this is one of the first reports on isolated mild ventricular hypertrophy due to ACAD9 mutation in a family with moderate symptoms during adolescence. This report also confirms that dilated cardiomyopathy may occur in conjunction with ACAD9 mutation and that some patients may respond clinically to riboflavin treatment. Of note, several patients suffered from patent ductus arteriosus (PDA), with one exhibiting a complex congenital heart defect. It is yet unknown whether these cardiac manifestations were related to ACAD9 mutation. In conclusion, this disorder should be suspected in the presence of lactic acidosis, complex I deficiency, and any cardiac involvement, even mild. PMID:27233227

  15. Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

    Directory of Open Access Journals (Sweden)

    Edberg Jeffrey C

    2010-03-01

    Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

  16. Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ

    Directory of Open Access Journals (Sweden)

    Qing-Ming An

    2015-11-01

    Full Text Available The adiponectin gene (ADIPOQ plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5 of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2 were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3 and three SNPs were observed. Two patterns (A4-B4, A5-B5 and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg. In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits.

  17. Variations in ORAI1 Gene Associated with Kawasaki Disease.

    Science.gov (United States)

    Onouchi, Yoshihiro; Fukazawa, Ryuji; Yamamura, Kenichiro; Suzuki, Hiroyuki; Kakimoto, Nobuyuki; Suenaga, Tomohiro; Takeuchi, Takashi; Hamada, Hiromichi; Honda, Takafumi; Yasukawa, Kumi; Terai, Masaru; Ebata, Ryota; Higashi, Kouji; Saji, Tsutomu; Kemmotsu, Yasushi; Takatsuki, Shinichi; Ouchi, Kazunobu; Kishi, Fumio; Yoshikawa, Tetsushi; Nagai, Toshiro; Hamamoto, Kunihiro; Sato, Yoshitake; Honda, Akihito; Kobayashi, Hironobu; Sato, Junichi; Shibuta, Shoichi; Miyawaki, Masakazu; Oishi, Ko; Yamaga, Hironobu; Aoyagi, Noriyuki; Yoshiyama, Megumi; Miyashita, Ritsuko; Murata, Yuji; Fujino, Akihiro; Ozaki, Kouichi; Kawasaki, Tomisaku; Abe, Jun; Seki, Mitsuru; Kobayashi, Tohru; Arakawa, Hirokazu; Ogawa, Shunichi; Hara, Toshiro; Hata, Akira; Tanaka, Toshihiro

    2016-01-01

    Kawasaki disease (KD; MIM#61175) is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca(2+)/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca(2+) release activated Ca(2+) (CRAC) channel mediating store-operated Ca(2+) entry (SOCE) on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596) was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls), P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls) and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method). Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012). These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca(2+)/NFAT pathway in the pathogenesis of this disorder. PMID:26789410

  18. Human beta-defensin gene copy number variation and consequences in disease and evolution

    OpenAIRE

    Pala, Raquel Rodrigues

    2012-01-01

    Research on human genetic variation has shown that the human genome is not a fixed, invariant framework, but that there can be extensive structural variation. This variation includes copy number variation (CNV), which can lead to changes in DNA dosage contributing significantly to variation between individual human genomes and heritable traits. Human beta-defensins are small, secreted antimicrobial peptides encoded by DEFB genes located in a cluster of at least seven genes on 8p23.1. These...

  19. Quantitative gene-gene and gene-environment mapping for leaf shape variation using tree-based models

    Science.gov (United States)

    Leaf shape traits have long been a focus of many disciplines, but searching for complex genetic and environmental interactive mechanisms regulating leaf shape variation has not yet been well developed. The question of the respective roles of gene and environment and how they interplay to modulate l...

  20. Copy number variations in alternative splicing gene networks impact lifespan.

    Directory of Open Access Journals (Sweden)

    Joseph T Glessner

    Full Text Available Longevity has a strong genetic component evidenced by family-based studies. Lipoprotein metabolism, FOXO proteins, and insulin/IGF-1 signaling pathways in model systems have shown polygenic variations predisposing to shorter lifespan. To test the hypothesis that rare variants could influence lifespan, we compared the rates of CNVs in healthy children (0-18 years of age with individuals 67 years or older. CNVs at a significantly higher frequency in the pediatric cohort were considered risk variants impacting lifespan, while those enriched in the geriatric cohort were considered longevity protective variants. We performed a whole-genome CNV analysis on 7,313 children and 2,701 adults of European ancestry genotyped with 302,108 SNP probes. Positive findings were evaluated in an independent cohort of 2,079 pediatric and 4,692 geriatric subjects. We detected 8 deletions and 10 duplications that were enriched in the pediatric group (P=3.33×10(-8-1.6×10(-2 unadjusted, while only one duplication was enriched in the geriatric cohort (P=6.3×10(-4. Population stratification correction resulted in 5 deletions and 3 duplications remaining significant (P=5.16×10(-5-4.26×10(-2 in the replication cohort. Three deletions and four duplications were significant combined (combined P=3.7×10(-4-3.9×10(-2. All associated loci were experimentally validated using qPCR. Evaluation of these genes for pathway enrichment demonstrated ~50% are involved in alternative splicing (P=0.0077 Benjamini and Hochberg corrected. We conclude that genetic variations disrupting RNA splicing could have long-term biological effects impacting lifespan.

  1. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2014-01-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is…

  2. Serotonergic gene variation: implications for personality traits and psychopathology.

    Science.gov (United States)

    Lesch, K P

    1999-06-01

    Serotonin 5-hydroxytryptamine (5-HT) is an important regulator of morphogenetic activities during early central nervous system development, including cell proliferation, migration, and differentiation as well as synapto-genesis. Serotonergic raphe neurons diffusely project to a variety of brain regions (e.g. cortex, amygdala, hippocampus) and play known roles in integrating emotion, cognition, motor function as well as in food intake, sleep, pain, and sexual activity. The diversity of physiologic functions is due to the fact that 5-HT acts as a master control neurotransmitter within a highly complex system of neural communication mediated by multiple pre- and postsynaptic 5-HT receptors, thus orchestrating the activity and interaction of several other neurotransmitter systems. Since proteins involved in the regulation of central serotonergic activity (e.g. enzymes, receptors, transporter) play pivotal role in brain 5-HT homeostasis, polymorphisms in the regulatory regions of their genes resulting in variation of expression and function are likely to influence complex traits, such as temperament/personality and psychopathology.

  3. Components of Genetic Variation Associated with Second and Third Chromosome Gene Arrangements in Drosophila melanogaster

    OpenAIRE

    Ferrari, James A.

    1987-01-01

    The effects of naturally occuring combinations of second and third chromosome gene arrangements of Drosophila melanogaster on two quantitative traits were partitioned into parameters of additive, dominance and interaction components of genetic variation. Development time and preadult survival of the gene arrangement genotypes were measured under four experimental conditions. Gene arrangement effects, when significant, were predominantly additive under all conditions. Experimental conditions, ...

  4. Natural variation in abiotic stress responsive gene expression and local adaptation to climate in Arabidopsis thaliana.

    Science.gov (United States)

    Lasky, Jesse R; Des Marais, David L; Lowry, David B; Povolotskaya, Inna; McKay, John K; Richards, James H; Keitt, Timothy H; Juenger, Thomas E

    2014-09-01

    Gene expression varies widely in natural populations, yet the proximate and ultimate causes of this variation are poorly known. Understanding how variation in gene expression affects abiotic stress tolerance, fitness, and adaptation is central to the field of evolutionary genetics. We tested the hypothesis that genes with natural genetic variation in their expression responses to abiotic stress are likely to be involved in local adaptation to climate in Arabidopsis thaliana. Specifically, we compared genes with consistent expression responses to environmental stress (expression stress responsive, "eSR") to genes with genetically variable responses to abiotic stress (expression genotype-by-environment interaction, "eGEI"). We found that on average genes that exhibited eGEI in response to drought or cold had greater polymorphism in promoter regions and stronger associations with climate than those of eSR genes or genomic controls. We also found that transcription factor binding sites known to respond to environmental stressors, especially abscisic acid responsive elements, showed significantly higher polymorphism in drought eGEI genes in comparison to eSR genes. By contrast, eSR genes tended to exhibit relatively greater pairwise haplotype sharing, lower promoter diversity, and fewer nonsynonymous polymorphisms, suggesting purifying selection or selective sweeps. Our results indicate that cis-regulatory evolution and genetic variation in stress responsive gene expression may be important mechanisms of local adaptation to climatic selective gradients.

  5. Variation in the Trichothecene Mycotoxin Biosynthetic Gene Cluster in Fusarium

    Science.gov (United States)

    Trichothecene mycotoxins are produced by some plant pathogenic species of the fungus Fusarium and can contribute to its virulence on some plants. In Fusarium graminearum and F. sporotrichioides trichothecene biosynthetic enzymes are encoded at three loci: the single-gene TRI101 locus; the two-gene ...

  6. Genetic variation in a member of the laminin gene family affects variation in body composition in Drosophila and humans

    Directory of Open Access Journals (Sweden)

    Hunter Gary R

    2008-08-01

    Full Text Available Abstract Background The objective of the present study was to map candidate loci influencing naturally occurring variation in triacylglycerol (TAG storage using quantitative complementation procedures in Drosophila melanogaster. Based on our results from Drosophila, we performed a human population-based association study to investigate the effect of natural variation in LAMA5 gene on body composition in humans. Results We identified four candidate genes that contributed to differences in TAG storage between two strains of D. melanogaster, including Laminin A (LanA, which is a member of the α subfamily of laminin chains. We confirmed the effects of this gene using a viable LanA mutant and showed that female flies homozygous for the mutation had significantly lower TAG storage, body weight, and total protein content than control flies. Drosophila LanA is closely related to human LAMA5 gene, which maps to the well-replicated obesity-linkage region on chromosome 20q13.2-q13.3. We tested for association between three common single nucleotide polymorphisms (SNPs in the human LAMA5 gene and variation in body composition and lipid profile traits in a cohort of unrelated women of European American (EA and African American (AA descent. In both ethnic groups, we found that SNP rs659822 was associated with weight (EA: P = 0.008; AA: P = 0.05 and lean mass (EA: P= 0.003; AA: P = 0.03. We also found this SNP to be associated with height (P = 0.01, total fat mass (P = 0.01, and HDL-cholesterol (P = 0.003 but only in EA women. Finally, significant associations of SNP rs944895 with serum TAG levels (P = 0.02 and HDL-cholesterol (P = 0.03 were observed in AA women. Conclusion Our results suggest an evolutionarily conserved role of a member of the laminin gene family in contributing to variation in weight and body composition.

  7. Transcriptome analysis reveals novel patterning and pigmentation genes underlying Heliconius butterfly wing pattern variation

    Directory of Open Access Journals (Sweden)

    Hines Heather M

    2012-06-01

    Full Text Available Abstract Background Heliconius butterfly wing pattern diversity offers a unique opportunity to investigate how natural genetic variation can drive the evolution of complex adaptive phenotypes. Positional cloning and candidate gene studies have identified a handful of regulatory and pigmentation genes implicated in Heliconius wing pattern variation, but little is known about the greater developmental networks within which these genes interact to pattern a wing. Here we took a large-scale transcriptomic approach to identify the network of genes involved in Heliconius wing pattern development and variation. This included applying over 140 transcriptome microarrays to assay gene expression in dissected wing pattern elements across a range of developmental stages and wing pattern morphs of Heliconius erato. Results We identified a number of putative early prepattern genes with color-pattern related expression domains. We also identified 51 genes differentially expressed in association with natural color pattern variation. Of these, the previously identified color pattern “switch gene” optix was recovered as the first transcript to show color-specific differential expression. Most differentially expressed genes were transcribed late in pupal development and have roles in cuticle formation or pigment synthesis. These include previously undescribed transporter genes associated with ommochrome pigmentation. Furthermore, we observed upregulation of melanin-repressing genes such as ebony and Dat1 in non-melanic patterns. Conclusions This study identifies many new genes implicated in butterfly wing pattern development and provides a glimpse into the number and types of genes affected by variation in genes that drive color pattern evolution.

  8. cuidador e de acadêmicos

    Directory of Open Access Journals (Sweden)

    Márcia Gabriela Gomes Nascimento

    2015-01-01

    Full Text Available Objetivo: comprender las experiencias del cuidador y académicas multidisciplinarios de la salud para el desarrollo de autocuidado a ancianos después del accidente cerebrovascular en hogar. Métodos: estudio cualitativo, se utilizaron entrevistas semiestructuradas con seis cuidadores y ocho académicos, cuyos datos fueron analizados a la luz de la Fenomenología. Resultados: tres categorías emergieron: viviendo con los rectos y las limitaciones impuestas al cuidador y al ser cuidado; el ser profesional y el conservadurismo tecnicista; el equipo multidisciplinar en el hogar: experiencias con el ser cuidado y su cuidador. Conclusión: aprehendió que los cuidadores de ancianos después del accidente cerebrovascular necesitan de más apoyo y orientación para la realización de cuidados en el hogar, un plan de atención para facilitar y estimular el autocuidado, minimizando la sobrecarga del cuidador. Los académicos multiprofesionales señalaron visión tecnicista, evidenciándose necesidad de cambios Necesidad en la formación académica, basada en la atención humanista e integral.

  9. Theoretical studies of gene substitution, geographic variation, and speciation

    Energy Technology Data Exchange (ETDEWEB)

    Felsenstein, J.

    1977-07-31

    Brief comments are given on the results of a research program dealing with population genetics of evolutionary processes. The various subjects studied included genetic variation in clines; speciation and disruptive selection; parapatric speciation in clines; macroevolutionary laws in a model ecosystem; migration matrices; lethal allelism; estimation of number of loci in quantitative inheritance; numerical taxonomy methods; and new mutants in Lesch-Nyhan disease.

  10. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    Science.gov (United States)

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  11. Copy number variation analysis identifies novel CAKUT candidate genes in children with a solitary functioning kidney

    NARCIS (Netherlands)

    Westland, R.; Verbitsky, M.; Vukojevic, K.; Perry, B.J.; Fasel, D.A.; Zwijnenburg, P.J.; Bokenkamp, A.; Gille, J.J.P.; Saraga-Babic, M.; Ghiggeri, G.M.; D'Agati, V.D.; Schreuder, M.F.; Gharavi, A.G.; Wijk, J.A. van; Sanna-Cherchi, S.

    2015-01-01

    Copy number variations associate with different developmental phenotypes and represent a major cause of congenital anomalies of the kidney and urinary tract (CAKUT). Because rare pathogenic copy number variations are often large and contain multiple genes, identification of the underlying genetic dr

  12. Intra- and interspecific variation in primate gene expression patterns.

    Science.gov (United States)

    Enard, Wolfgang; Khaitovich, Philipp; Klose, Joachim; Zöllner, Sebastian; Heissig, Florian; Giavalisco, Patrick; Nieselt-Struwe, Kay; Muchmore, Elaine; Varki, Ajit; Ravid, Rivka; Doxiadis, Gaby M; Bontrop, Ronald E; Pääbo, Svante

    2002-04-12

    Although humans and their closest evolutionary relatives, the chimpanzees, are 98.7% identical in their genomic DNA sequences, they differ in many morphological, behavioral, and cognitive aspects. The underlying genetic basis of many of these differences may be altered gene expression. We have compared the transcriptome in blood leukocytes, liver, and brain of humans, chimpanzees, orangutans, and macaques using microarrays, as well as protein expression patterns of humans and chimpanzees using two-dimensional gel electrophoresis. We also studied three mouse species that are approximately as related to each other as are humans, chimpanzees, and orangutans. We identified species-specific gene expression patterns indicating that changes in protein and gene expression have been particularly pronounced in the human brain. PMID:11951044

  13. Drd4 gene polymorphisms are associated with personality variation in a passerine bird

    NARCIS (Netherlands)

    Fidler, A.E.; Van Oers, K.; Drent, P.J.; Kuhn, S.; Mueller, J.C.; Kempenaers, B.

    2007-01-01

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, gen

  14. Population transcriptomics uncovers the regulation of gene expression variation in adaptation to changing environment

    Science.gov (United States)

    Xu, Qin; Zhu, Caiyun; Fan, Yangyang; Song, Zhihong; Xing, Shilai; Liu, Wei; Yan, Juan; Sang, Tao

    2016-01-01

    Expression variation plays an important role in plant adaptation, but little is known about the factors impacting the expression variation when population adapts to changing environment. We used RNA-seq data from 80 individuals in 14 Miscanthus lutarioriparius populations, which were transplanted into a harsh environment from native habitat, to investigate the expression level, expression diversity and genetic diversity for genes expressed in both environments. The expression level of genes with lower expression level or without SNP tended to be more changeable in new environment, which suggested highly expressed genes experienced stronger purifying selection than those at lower level. Low proportion of genes with population effect confirmed the weak population structure and frequent gene flow in these populations. Meanwhile, the number of genes with environment effect was the most frequent compared with that with population effect. Our results showed that environment and genetic diversity were the main factors determining gene expression variation in population. This study could facilitate understanding the mechanisms of global gene expression variation when plant population adapts to changing environment. PMID:27150248

  15. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    DEFF Research Database (Denmark)

    Purrington, Kristen S; Slettedahl, Seth; Bolla, Manjeet K;

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymor...

  16. Analysis of human genetic variation in candidate genes under positive selections on the human linage

    OpenAIRE

    Moreno Estrada, Andr??s

    2009-01-01

    Natural selection has played an important role in shaping human genetic variation, thus, finding variants that have been targeted by positive selection can provide insights about which genes influence human phenotypic variability. In this work we conduct a genome-wide survey of protein-coding genes comparing humans, chimpanzees, and closely related species in order to detect the fraction of genes undergoing positive selection on the human lineage, and further investigate intraspecific variati...

  17. Indexing Effects of Copy Number Variation on Genes Involved in Developmental Delay

    OpenAIRE

    Mohammed Uddin; Giovanna Pellecchia; Bhooma Thiruvahindrapuram; Lia D’Abate; Daniele Merico; Ada Chan; Mehdi Zarrei; Kristiina Tammimies; Susan Walker; Gazzellone, Matthew J.; Thomas Nalpathamkalam; Yuen, Ryan K.C.; Koenraad Devriendt; Géraldine Mathonnet; Emmanuelle Lemyre

    2016-01-01

    A challenge in clinical genomics is to predict whether copy number variation (CNV) affecting a gene or multiple genes will manifest as disease. Increasing recognition of gene dosage effects in neurodevelopmental disorders prompted us to develop a computational approach based on critical-exon (highly expressed in brain, highly conserved) examination for potential etiologic effects. Using a large CNV dataset, our updated analyses revealed significant (P 

  18. Intraspecific DNA variation in nuclear genes of the mosquito Aedes aegypti.

    Science.gov (United States)

    Morlais, I; Severson, D W

    2003-12-01

    Single nucleotide polymorphisms (SNPs) are an abundant source of genetic variation among individual organisms. To assess the usefulness of SNPs for genome analysis in the yellow fever mosquito, Aedes aegypti, we sequenced 25 nuclear genes in each of three strains and analysed nucleotide diversity. The average frequency of nucleotide variation was 12 SNPs per kilobase, indicating that nucleotide variation in Ae. aegypti is similar to that in other organisms, including Drosophila and the malaria vector Anopheles gambiae. Transition polymorphisms outnumbered transversion polymorphisms, at a ratio of about 2:1. We examined codon usage and confirmed that mutational bias favours G and C ending codons. Codon bias was most pronounced in highly expressed genes. Nucleotide diversity estimates indicated that substitution rates are positively correlated in coding and non-coding regions. Nucleotide diversity varied from one gene to another. The unequal distribution of SNPs among Ae. aegypti nuclear genes suggests that single base variations are non-neutral and are subject to selective constraints. Our analysis showed that ubiquitously expressed genes have lower polymorphism rates and are likely under strong purifying selection, whereas tissue specific genes and genes with a putative role in parasite defence exhibit higher levels of polymorphism that may be associated with diversifying selection. PMID:14986924

  19. Divergent selection for opsin gene variation in guppy (Poecilia reticulata) populations of Trinidad and Tobago.

    Science.gov (United States)

    Tezuka, A; Kasagi, S; van Oosterhout, C; McMullan, M; Iwasaki, W M; Kasai, D; Yamamichi, M; Innan, H; Kawamura, S; Kawata, M

    2014-11-01

    The guppy is known to exhibit remarkable interindividual variations in spectral sensitivity of middle to long wavelength-sensitive (M/LWS) cone photoreceptor cells. The guppy has four M/LWS-type opsin genes (LWS-1, LWS-2, LWS-3 and LWS-4) that are considered to be responsible for this sensory variation. However, the allelic variation of the opsin genes, particularly in terms of their absorption spectrum, has not been explored in wild populations. Thus, we examined nucleotide variations in the four M/LWS opsin genes as well as blue-sensitive SWS2-B and ultraviolet-sensitive SWS1 opsin genes for comparison and seven non-opsin nuclear loci as reference genes in 10 guppy populations from various light environments in Trinidad and Tobago. For the first time, we discovered a potential spectral variation (180 Ser/Ala) in LWS-1 that differed at an amino acid site known to affect the absorption spectra of opsins. Based on a coalescent simulation of the nucleotide variation of the reference genes, we showed that the interpopulation genetic differentiation of two opsin genes was significantly larger than the neutral expectation. Furthermore, this genetic differentiation was significantly related to differences in dissolved oxygen (DO) level, and it was not explained by the spatial distance between populations. The DO levels are correlated with eutrophication that possibly affects the color of aquatic environments. These results suggest that the population diversity of opsin genes is significantly driven by natural selection and that the guppy could adapt to various light environments through color vision changes.

  20. Diel variation in gene expression of the CO2-concentrating mechanism during a harmful cyanobacterial bloom

    Directory of Open Access Journals (Sweden)

    Giovanni eSandrini

    2016-04-01

    Full Text Available Dense phytoplankton blooms in eutrophic waters often experience large daily fluctuations in environmental conditions. We investigated how this diel variation affects in situ gene expression of the CO2-concentrating mechanism (CCM and other selected genes of the harmful cyanobacterium Microcystis aeruginosa. Photosynthetic activity of the cyanobacterial bloom depleted the dissolved CO2 concentration, raised pH to 10, and caused large diel fluctuations in the bicarbonate and O2 concentration. The Microcystis population consisted of three Ci uptake genotypes that differed in the presence of the low-affinity and high-affinity bicarbonate uptake genes bicA and sbtA. Expression of the bicarbonate uptake genes bicA, sbtA and cmpA (encoding a subunit of the high-affinity bicarbonate uptake system BCT1, the CCM transcriptional regulator gene ccmR and the photoprotection gene flv4 increased at first daylight and was negatively correlated with the bicarbonate concentration. In contrast, genes of the two CO2 uptake systems were constitutively expressed, whereas expression of the RuBisCO chaperone gene rbcX, the carboxysome gene ccmM, and the photoprotection gene isiA was highest at night and down-regulated during daytime. In total, our results show that the harmful cyanobacterium Microcystis is very responsive to the large diel variations in carbon and light availability often encountered in dense cyanobacterial blooms.

  1. Natural Genetic Variation and Candidate Genes for Morphological Traits in Drosophila melanogaster.

    Science.gov (United States)

    Carreira, Valeria Paula; Mensch, Julián; Hasson, Esteban; Fanara, Juan José

    2016-01-01

    Body size is a complex character associated to several fitness related traits that vary within and between species as a consequence of environmental and genetic factors. Latitudinal and altitudinal clines for different morphological traits have been described in several species of Drosophila and previous work identified genomic regions associated with such variation in D. melanogaster. However, the genetic factors that orchestrate morphological variation have been barely studied. Here, our main objective was to investigate genetic variation for different morphological traits associated to the second chromosome in natural populations of D. melanogaster along latitudinal and altitudinal gradients in Argentina. Our results revealed weak clinal signals and a strong population effect on morphological variation. Moreover, most pairwise comparisons between populations were significant. Our study also showed important within-population genetic variation, which must be associated to the second chromosome, as the lines are otherwise genetically identical. Next, we examined the contribution of different candidate genes to natural variation for these traits. We performed quantitative complementation tests using a battery of lines bearing mutated alleles at candidate genes located in the second chromosome and six second chromosome substitution lines derived from natural populations which exhibited divergent phenotypes. Results of complementation tests revealed that natural variation at all candidate genes studied, invected, Fasciclin 3, toucan, Reticulon-like1, jing and CG14478, affects the studied characters, suggesting that they are Quantitative Trait Genes for morphological traits. Finally, the phenotypic patterns observed suggest that different alleles of each gene might contribute to natural variation for morphological traits. However, non-additive effects cannot be ruled out, as wild-derived strains differ at myriads of second chromosome loci that may interact

  2. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.

    Science.gov (United States)

    Ruifu, Y; Minli, Z; Guo, Z; Wang, X

    1997-01-01

    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum. PMID:9310943

  3. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.

    Science.gov (United States)

    Ruifu, Y; Minli, Z; Guo, Z; Wang, X

    1997-01-01

    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum.

  4. Genetic variation in V gene of class II Newcastle disease virus.

    Science.gov (United States)

    Hao, Huafang; Chen, Shengli; Liu, Peng; Ren, Shanhui; Gao, Xiaolong; Wang, Yanping; Wang, Xinglong; Zhang, Shuxia; Yang, Zengqi

    2016-01-01

    The genetic variation and molecular evolution of the V gene of the class II Newcastle disease virus (NDV) isolates with genotypes I-XVIII were determined using bioinformatics. Results indicated that low homology existed in different genotype viruses, whereas high homology often for the same genotypes, exception may be existed within genotypes I, V, VI, and XII. Sequence analysis showed that the genetic variation of V protein was consistent with virus genotype, and specific signatures on the V protein for nine genotypes were identified. Phylogenetic analysis demonstrated that the phylogenetic trees were highly consistent between the V and F genes, with slight discrepancies in the sub-genotypes. Evolutionary rate analyses based on V and F genes revealed the evolution rates varied in genotypes. These data indicate that the genetic variation of V protein is genotype-related and will help in elucidating the molecular evolution of NDV.

  5. Gene diversity and genetic variation in lung flukes (genus Paragonimus).

    Science.gov (United States)

    Blair, David; Nawa, Yukifumi; Mitreva, Makedonka; Doanh, Pham Ngoc

    2016-01-01

    Paragonimiasis caused by lung flukes (genus Paragonimus) is a neglected disease occurring in Asia, Africa and the Americas. The genus is species-rich, ancient and widespread. Genetic diversity is likely to be considerable, but investigation of this remains confined to a few populations of a few species. In recent years, studies of genetic diversity have moved from isoenzyme analysis to molecular phylogenetic analysis based on selected DNA sequences. The former offered better resolution of questions relating to allelic diversity and gene flow, whereas the latter is more suitable for questions relating to molecular taxonomy and phylogeny. A picture is emerging of a highly diverse taxon of parasites, with the greatest diversity found in eastern and southern Asia where ongoing speciation might be indicated by the presence of several species complexes. Diversity of lung flukes in Africa and the Americas is very poorly sampled. Functional molecules that might be of value for immunodiagnosis, or as targets for medical intervention, are of great interest. Characterisation of these from Paragonimus species has been ongoing for a number of years. However, the imminent release of genomic and transcriptomic data for several species of Paragonimus will dramatically increase the rate of discovery of such molecules, and illuminate their diversity within and between species.

  6. Individual variation of adipose gene expression and identification of covariated genes by cDNA microarrays

    NARCIS (Netherlands)

    Boeuf, S.; Keijer, J.; Franssen-Hal, van N.L.W.; Klaus, S.

    2002-01-01

    Gene expression profiling through the application of microarrays provides comprehensive assessment of gene expression levels in a given tissue or cell population, as well as information on changes of gene expression in altered physiological or pathological situations. Microarrays are particularly su

  7. Variation of vlhA gene in Mycoplasma synoviae clones isolated from chickens.

    Science.gov (United States)

    Slavec, Brigita; Berčič, Rebeka Lucijana; Cizelj, Ivanka; Narat, Mojca; Zorman-Rojs, Olga; Dovč, Peter; Benčina, Dušan

    2011-10-01

    Mycoplasma synoviae synthesizes haemagglutinin VlhA, which cleaves into the N-terminal part, a lipoprotein MSPB, and a C-terminal part MSPA. Previous studies have shown that the 3'-end of the expressed vlhA gene can recombine with vlhA pseudogenes in a process called gene conversion, but there have been no data about diversification of the expressed vlhA gene in M. synoviae populations replicating in chickens. Following intratracheal inoculation with the M. synoviae strain ULB 02/T6, which showed only minor vlhA gene variation prior to inoculation, we investigated temporal changes in MSPB epitopes defined by monoclonal antibodies (mAbs) 3B4 and 50, as well as diversification of the vlhA gene sequence in M. synoviae populations recovered from chicken tracheas. In cultures isolated 8 and 18 days post inoculation (p.i.), most colonies showed variation of MSPB epitopes for mAbs 3B4 and 50. They also changed 3'-end vlhA gene sequences. Further diversity of the vlhA gene occurred in cultures isolated 8 weeks and 5 months p.i. The vlhA gene sequences from isolated cultures shared only 65 to 80% sequence identity with vlhA gene of the inoculated ULB 02/T6 culture. Notably, in most of those cultures their vlhA gene sequences contained stop codons potentially causing premature terminations of translation. Interestingly, in one culture isolated 8 weeks p.i. (clone T6-8W/IT2A) the 3'-vlhA gene sequence was identical in the last 1140 bases to that of the first vlhA pseudogene positioned the most far (upstream) of the expressed vlhA gene. This is the first demonstration of temporal diversity of the vlhA gene in M. synoviae populations isolated from chicken tracheas. PMID:21830862

  8. Extensive Copy-Number Variation of the Human Olfactory Receptor Gene Family

    OpenAIRE

    Janet M Young; Endicott, RaeLynn M.; Parghi, Sean S; Walker, Megan; Kidd, Jeffrey M.; Trask, Barbara J.

    2008-01-01

    As much as a quarter of the human genome has been reported to vary in copy number between individuals, including regions containing about half of the members of the olfactory receptor (OR) gene family. We have undertaken a detailed study of copy-number variation of ORs to elucidate the selective and mechanistic forces acting on this gene family and the true impact of copy-number variation on human OR repertoires. We argue that the properties of copy-number variants (CNVs) and other sets of la...

  9. Positive Association of Vitamin D Receptor Gene Variations with Multiple Sclerosis in South East Iranian Population

    OpenAIRE

    Mehrnaz Narooie-Nejad; Maryam Moossavi; Adam Torkamanzehi; Ali Moghtaderi

    2015-01-01

    Among the factors postulated to play a role in MS susceptibility, the role of vitamin D is outstanding. Since the function of vitamin D receptor (VDR) represents the effect of vitamin D on the body and genetic variations in VDR gene may affect its function, we aim to highlight the association of two VDR gene polymorphisms with MS susceptibility. In current study, we recruited 113 MS patients and 122 healthy controls. TaqI (rs731236) and ApaI (rs7975232) genetic variations in these two groups ...

  10. Genetic variation in telomere maintenance genes in relation to ovarian cancer survival.

    Science.gov (United States)

    Harris, Holly R; Vivo, Immaculata De; Titus, Linda J; Vitonis, Allison F; Wong, Jason Y Y; Cramer, Daniel W; Terry, Kathryn L

    2012-01-01

    Telomeres are repetitive non-coding DNA sequences at the ends of chromosomes that provide protection against chromosomal instability. Telomere length and stability are influenced by proteins, including telomerase which is partially encoded by the TERT gene. Genetic variation in the TERT gene is associated with ovarian cancer risk, and predicts survival in lung cancer and glioma. We investigated whether genetic variation in five telomere maintenance genes was associated with survival among 1480 cases of invasive epithelial ovarian cancer in the population-based New England Case-Control Study. Cox proportional hazard models were used to calculate hazard ratios and 95% confidence intervals. Overall we observed no significant associations between SNPs in telomere maintenance genes and mortality using a significance threshold of p=0.001. However, we observed some suggestive associations in subgroup analyses. Future studies with larger populations may further our understanding of what role telomeres play in ovarian cancer survival.

  11. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity.

    Science.gov (United States)

    Porto-Neto, Laercio R; Fortes, Marina R S; McWilliam, Sean M; Lehnert, Sigrid A; Reverter, Antonio

    2014-01-01

    We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2112) and Tropical Composite (n = 2550). We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases) and 99 (chromatin remodeling factors) genes. A total of 3091 SNP mapped to positions within 3000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10(-5)). A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r (2) > 0.84). To further characterize the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05) enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterize the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes. PMID:24795751

  12. Variation in genes involved in epigenetic processes offers insights into tropically adapted cattle diversity

    Directory of Open Access Journals (Sweden)

    Laercio R Porto-Neto

    2014-04-01

    Full Text Available We evaluated the relevance of the BovineHD Illumina SNP chip with respect to genes involved in epigenetic processes. Genotypes for 729,068 SNP on two tropical cattle breeds of Australia were used: Brahman (n = 2,112 and Tropical Composite (n = 2,550. We used data mining approaches to compile a list of bovine protein-coding genes involved in epigenetic processes. These genes represent 9 functional categories that contain between one (histone demethylases and 99 (chromatin remodelling factors genes. A total of 3,091 SNP mapped to positions within 3,000 bp of the 193 coding regions of those genes, including 113 SNP in transcribed regions, 2,738 in intronic regions and 240 in up- or down-stream regions. For all these SNP categories, we observed differences in the allelic frequencies between Brahman and Tropical Composite cattle. These differences were larger than those observed for the entire set of 729,068 SNP (P = 1.79 x 10-5. A multidimensional scaling analysis using only the 113 SNP in transcribed regions allowed for the separation of the two populations and this separation was comparable to the one obtained with a random set of 113 SNP (Principal Component 1 r2 > 0.84. To further characterise the differences between the breeds we defined a gene-differentiation metric based on the average genotypic frequencies of SNP connected to each gene and compared both cattle populations. The 10% most differentiated genes were distributed across 10 chromosomes, with significant (P < 0.05 enrichment on BTA 3 and 10. The 10% most conserved genes were located in 12 chromosomes. We conclude that there is variation between cattle populations in genes connected to epigenetic processes, and this variation can be used to differentiate cattle breeds. More research is needed to fully characterise the use of these SNP and its potential as means to further our understanding of biological variation and epigenetic processes.

  13. Candidate gene study to investigate the genetic determinants of normal variation in central corneal thickness

    OpenAIRE

    Dimasi, David P.; Kathryn P Burdon; Hewitt, Alex W; Savarirayan, Ravi; Healey, Paul R.; Mitchell, Paul; Mackey, David A.; Craig, Jamie E

    2010-01-01

    Purpose The genetic component underlying variation in central corneal thickness (CCT) in the normal population remains largely unknown. As CCT is an identified risk factor for open-angle glaucoma, understanding the genes involved in CCT determination could improve our understanding of the mechanisms involved in this association. Methods To identify novel CCT genes, we selected eight different candidates based on a range of criteria. These included; aquaporin 1 (AQ1), aquaporin 5 (AQ5), decori...

  14. Natural variation in CBF gene sequence, gene expression and freezing tolerance in the Versailles core collection of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Brunel Dominique

    2008-10-01

    Full Text Available Abstract Background Plants from temperate regions are able to withstand freezing temperatures due to a process known as cold acclimation, which is a prior exposure to low, but non-freezing temperatures. During acclimation, a large number of genes are induced, bringing about biochemical changes in the plant, thought to be responsible for the subsequent increase in freezing tolerance. Key regulatory proteins in this process are the CBF1, 2 and 3 transcription factors which control the expression of a set of target genes referred to as the "CBF regulon". Results To assess the role of the CBF genes in cold acclimation and freezing tolerance of Arabidopsis thaliana, the CBF genes and their promoters were sequenced in the Versailles core collection, a set of 48 accessions that maximizes the naturally-occurring genetic diversity, as well as in the commonly used accessions Col-0 and WS. Extensive polymorphism was found in all three genes. Freezing tolerance was measured in all accessions to assess the variability in acclimated freezing tolerance. The effect of sequence polymorphism was investigated by evaluating the kinetics of CBF gene expression, as well as that of a subset of the target COR genes, in a set of eight accessions with contrasting freezing tolerance. Our data indicate that CBF genes as well as the selected COR genes are cold induced in all accessions, irrespective of their freezing tolerance. Although we observed different levels of expression in different accessions, CBF or COR gene expression was not closely correlated with freezing tolerance. Conclusion Our results indicate that the Versailles core collection contains significant natural variation with respect to freezing tolerance, polymorphism in the CBF genes and CBF and COR gene expression. Although there tends to be more CBF and COR gene expression in tolerant accessions, there are exceptions, reinforcing the idea that a complex network of genes is involved in freezing tolerance

  15. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    Directory of Open Access Journals (Sweden)

    Kaas Rolf S

    2012-10-01

    Full Text Available Abstract Background Escherichia coli exists in commensal and pathogenic forms. By measuring the variation of individual genes across more than a hundred sequenced genomes, gene variation can be studied in detail, including the number of mutations found for any given gene. This knowledge will be useful for creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps more biologically relevant, especially considering that many of these genome sequences are draft quality. The E. coli pan-genome for this set of isolates contains 16,373 gene clusters. A core-gene tree, based on alignment and a pan-genome tree based on gene presence/absence, maps the relatedness of the 186 sequenced E. coli genomes. The core-gene tree displays high confidence and divides the E. coli strains into the observed MLST type clades and also separates defined phylotypes. Conclusion The results of comparing a large and diverse E. coli dataset support the theory that reliable and good resolution phylogenies can be inferred from the core-genome. The results further suggest that the resolution at the isolate level may, subsequently be improved by targeting more variable genes. The use of whole genome sequencing will make it possible to eliminate, or at least reduce, the need for several typing steps used in traditional epidemiology.

  16. Structural variation of the ribosomal gene cluster within the class Insecta

    Energy Technology Data Exchange (ETDEWEB)

    Mukha, D.V.; Sidorenko, A.P.; Lazebnaya, I.V. [Vavilov Institute of General Genetics, Moscow (Russian Federation)] [and others

    1995-09-01

    General estimation of ribosomal DNA variation within the class Insecta is presented. It is shown that, using blot-hybridization, one can detect differences in the structure of the ribosomal gene cluster not only between genera within an order, but also between species within a genera, including sibling species. Structure of the ribosomal gene cluster of the Coccinellidae family (ladybirds) is analyzed. It is shown that cloned highly conservative regions of ribosomal DNA of Tetrahymena pyriformis can be used as probes for analyzing ribosomal genes in insects. 24 refs., 4 figs.

  17. Evaluando el rendimiento académico

    OpenAIRE

    Correa, Adriana; Chahar, Berta; Nieva, María Esther; Figueroa, Gregorio; Gallo, Ricardo Raúl; Holgado, Lisa

    2009-01-01

    En las universidades la deserción estudiantil ha originado numerosos estudios y no pocos debates. El informe de la Comisión ad hoc (2005) de la UNT, revela excesiva permanencia y alta deserción. En una primera etapa, se analizó el rendimiento académico en el ciclo básico de la Facultad de Bioquímica de la UNT (Correa Zeballos, Chahar, Holgado, Figueroa, Sued, Nieva, 2006) identificándose factores asociados a esta problemática. En una segunda etapa se plantea como objetivo mostrar una metodolo...

  18. Interaction of 5-HTTLPR and a variation on the oxytocin receptor gene influences negative emotionality

    NARCIS (Netherlands)

    Montag, C.; Fiebach, C.J.; Kirsch, P.; Reuter, M.

    2011-01-01

    Background Pharmacological studies indicate a functional interaction between the serotonergic and oxytocinergic system. Methods This study tested for an interaction of the prominent serotonin transporter polymorphism (SLC6A4) and an oxytocin receptor gene variation on individual differences in negat

  19. Heritable genome-wide variation of gene expression and promoter methylation between wild and domesticated chickens

    Directory of Open Access Journals (Sweden)

    Nätt Daniel

    2012-02-01

    Full Text Available Abstract Background Variations in gene expression, mediated by epigenetic mechanisms, may cause broad phenotypic effects in animals. However, it has been debated to what extent expression variation and epigenetic modifications, such as patterns of DNA methylation, are transferred across generations, and therefore it is uncertain what role epigenetic variation may play in adaptation. Results In Red Junglefowl, ancestor of domestic chickens, gene expression and methylation profiles in thalamus/hypothalamus differed substantially from that of a domesticated egg laying breed. Expression as well as methylation differences were largely maintained in the offspring, demonstrating reliable inheritance of epigenetic variation. Some of the inherited methylation differences were tissue-specific, and the differential methylation at specific loci were little changed after eight generations of intercrossing between Red Junglefowl and domesticated laying hens. There was an over-representation of differentially expressed and methylated genes in selective sweep regions associated with chicken domestication. Conclusions Our results show that epigenetic variation is inherited in chickens, and we suggest that selection of favourable epigenomes, either by selection of genotypes affecting epigenetic states, or by selection of methylation states which are inherited independently of sequence differences, may have been an important aspect of chicken domestication.

  20. Geographic variation in advertisement calls in a tree frog species: gene flow and selection hypotheses.

    Directory of Open Access Journals (Sweden)

    Yikweon Jang

    Full Text Available BACKGROUND: In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. METHODOLOGY: We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR, note duration (ND, and dominant frequency (DF, along with snout-to-vent length. RESULTS: The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. CONCLUSIONS: Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japonica. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with

  1. Geographic Variation in Advertisement Calls in a Tree Frog Species: Gene Flow and Selection Hypotheses

    Science.gov (United States)

    Jang, Yikweon; Hahm, Eun Hye; Lee, Hyun-Jung; Park, Soyeon; Won, Yong-Jin; Choe, Jae C.

    2011-01-01

    Background In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD) or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. Methodology We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR), note duration (ND), and dominant frequency (DF), along with snout-to-vent length. Results The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. Conclusions Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japoinca. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with restricted gene

  2. Copy number variation of microRNA genes in the human genome

    Directory of Open Access Journals (Sweden)

    Krzyzosiak Wlodzimierz J

    2011-04-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are important genetic elements that regulate the expression of thousands of human genes. Polymorphisms affecting miRNA biogenesis, dosage and target recognition may represent potentially functional variants. The functional consequences of single nucleotide polymorphisms (SNPs within critical miRNA sequences and outside of miRNA genes were previously demonstrated using both experimental and computational methods. However, little is known about how copy number variations (CNVs affect miRNA genes. Results In this study, we analyzed the co-localization of all miRNA loci with known CNV regions. Using bioinformatic tools we identified and validated 209 copy number variable miRNA genes (CNV-miRNAs in CNV regions deposited in Database of Genomic Variations (DGV and 11 CNV-miRNAs in two sets of CNVs defined as highly polymorphic. We propose potential mechanisms of CNV-mediated variation of functional copies of miRNAs (dosage for different types of CNVs overlapping miRNA genes. We also showed that, consistent with their essential biological functions, miRNA loci are underrepresented in highly polymorphic and well-validated CNV regions. Conclusion We postulate that CNV-miRNAs are potential functional variants and should be considered high priority candidate variants in genotype-phenotype association studies.

  3. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  4. Patterns of variation among distinct alleles of the Flag silk gene from Nephila clavipes.

    Science.gov (United States)

    Higgins, Linden E; White, Sheryl; Nuñez-Farfán, Juan; Vargas, Jesus

    2007-02-20

    Spider silk proteins and their genes are very attractive to researchers in a wide range of disciplines because they permit linking many levels of organization. However, hypotheses of silk gene evolution have been built primarily upon single sequences of each gene each species, and little is known about allelic variation within a species. Silk genes are known for their repeat structure with high levels of homogenization of nucleotide and amino acid sequence among repeated units. One common explanation for this homogeneity is gene convergence. To test this model, we sequenced multiple alleles of one intron-exon segment from the Flag gene from four populations of the spider Nephila clavipes and compared the new sequences to a published sequence. Our analysis revealed very high levels of heterozygosity in this gene, with no pattern of population differentiation. There was no evidence of gene convergence within any of these alleles, with high levels of nucleotide and amino acid substitution among the repeating motifs. Our data suggest that minimally, there is relaxed selection on mutations in this gene and that there may actually be positive selection for heterozygosity.

  5. Gene co-expression network analysis identifies porcine genes associated with variation in Salmonella shedding

    OpenAIRE

    Kommadath, Arun; Bao, Hua; Arantes, Adriano S; Plastow, Graham S.; Christopher K Tuggle; Bearson, Shawn MD; Luo Guan, Le; Stothard, Paul

    2014-01-01

    Background Salmonella enterica serovar Typhimurium is a gram-negative bacterium that can colonise the gut of humans and several species of food producing farm animals to cause enteric or septicaemic salmonellosis. While many studies have looked into the host genetic response to Salmonella infection, relatively few have used correlation of shedding traits with gene expression patterns to identify genes whose variable expression among different individuals may be associated with differences in ...

  6. Identifying the genetic variation of gene expression using gene sets: application of novel gene Set eQTL approach to PharmGKB and KEGG.

    Directory of Open Access Journals (Sweden)

    Ryan Abo

    Full Text Available Genetic variation underlying the regulation of mRNA gene expression in humans may provide key insights into the molecular mechanisms of human traits and complex diseases. Current statistical methods to map genetic variation associated with mRNA gene expression have typically applied standard linkage and/or association methods; however, when genome-wide SNP and mRNA expression data are available performing all pair wise comparisons is computationally burdensome and may not provide optimal power to detect associations. Consideration of different approaches to account for the high dimensionality and multiple testing issues may provide increased efficiency and statistical power. Here we present a novel approach to model and test the association between genetic variation and mRNA gene expression levels in the context of gene sets (GSs and pathways, referred to as gene set - expression quantitative trait loci analysis (GS-eQTL. The method uses GSs to initially group SNPs and mRNA expression, followed by the application of principal components analysis (PCA to collapse the variation and reduce the dimensionality within the GSs. We applied GS-eQTL to assess the association between SNP and mRNA expression level data collected from a cell-based model system using PharmGKB and KEGG defined GSs. We observed a large number of significant GS-eQTL associations, in which the most significant associations arose between genetic variation and mRNA expression from the same GS. However, a number of associations involving genetic variation and mRNA expression from different GSs were also identified. Our proposed GS-eQTL method effectively addresses the multiple testing limitations in eQTL studies and provides biological context for SNP-expression associations.

  7. Gene expression and variation in social aggression by queens of the harvester ant Pogonomyrmex californicus.

    Science.gov (United States)

    Helmkampf, Martin; Mikheyev, Alexander S; Kang, Yun; Fewell, Jennifer; Gadau, Jürgen

    2016-08-01

    A key requirement for social cooperation is the mitigation and/or social regulation of aggression towards other group members. Populations of the harvester ant Pogonomyrmex californicus show the alternate social phenotypes of queens founding nests alone (haplometrosis) or in groups of unrelated yet cooperative individuals (pleometrosis). Pleometrotic queens display an associated reduction in aggression. To understand the proximate drivers behind this variation, we placed foundresses of the two populations into social environments with queens from the same or the alternate population, and measured their behaviour and head gene expression profiles. A proportion of queens from both populations behaved aggressively, but haplometrotic queens were significantly more likely to perform aggressive acts, and conflict escalated more frequently in pairs of haplometrotic queens. Whole-head RNA sequencing revealed variation in gene expression patterns, with the two populations showing moderate differentiation in overall transcriptional profile, suggesting that genetic differences underlie the two founding strategies. The largest detected difference, however, was associated with aggression, regardless of queen founding type. Several modules of coregulated genes, involved in metabolism, immune system and neuronal function, were found to be upregulated in highly aggressive queens. Conversely, nonaggressive queens exhibited a striking pattern of upregulation in chemosensory genes. Our results highlight that the social phenotypes of cooperative vs. solitary nest founding tap into a set of gene regulatory networks that seem to govern aggression level. We also present a number of highly connected hub genes associated with aggression, providing opportunity to further study the genetic underpinnings of social conflict and tolerance.

  8. Sequence Variation in Toxoplasma gondii rop17 Gene among Strains from Different Hosts and Geographical Locations

    Directory of Open Access Journals (Sweden)

    Nian-Zhang Zhang

    2014-01-01

    Full Text Available Genetic diversity of T. gondii is a concern of many studies, due to the biological and epidemiological diversity of this parasite. The present study examined sequence variation in rhoptry protein 17 (ROP17 gene among T. gondii isolates from different hosts and geographical regions. The rop17 gene was amplified and sequenced from 10 T. gondii strains, and phylogenetic relationship among these T. gondii strains was reconstructed using maximum parsimony (MP, neighbor-joining (NJ, and maximum likelihood (ML analyses. The partial rop17 gene sequences were 1375 bp in length and A+T contents varied from 49.45% to 50.11% among all examined T. gondii strains. Sequence analysis identified 33 variable nucleotide positions (2.1%, 16 of which were identified as transitions. Phylogeny reconstruction based on rop17 gene data revealed two major clusters which could readily distinguish Type I and Type II strains. Analyses of sequence variations in nucleotides and amino acids among these strains revealed high ratio of nonsynonymous to synonymous polymorphisms (>1, indicating that rop17 shows signs of positive selection. This study demonstrated the existence of slightly high sequence variability in the rop17 gene sequences among T. gondii strains from different hosts and geographical regions, suggesting that rop17 gene may represent a new genetic marker for population genetic studies of T. gondii isolates.

  9. Splice site and Germline variations of the MGMT gene in Esophageal cancer from Kashmir Valley: India

    Science.gov (United States)

    Shah, Mohd Amin; Shaffi, Sheikh M.; Lone, Ghulam Nabi; Jan, Syed Mudassar

    2013-01-01

    Objectives The aim of our investigation was to detect mutation or genetic polymorphisms in MGMT gene of esophageal cancer patients from Kashmir Valley (India) Methodology The genetic polymorphisms or mutations in the coding exons 2, 3, 4 and 5 of MGMT gene were searched for in DNA samples from the frozen tumor tissues of 30 esophageal cancer patients from Kashmir. The PCR products were sequenced with fluorescently labelled terminators and separated on automatic sequencer. We developed a new PCR based RFLP approach for genotyping c.459A>G (p.Gly153Gly) variation in 71 esophageal cancer patients and 60 healthy controls. Results Two somatic variations c.274 +4G>A and c.274 + 22G>A were identified in Exon3-intron 4 boundary. A novel germline variation c.459A>G (p.Gly153Gly) was found in the exon 5 of an esophageal cancer patient. This germline variation was not found in any of the studied esophageal cancer patients and healthy controls except the patient where it has been found by direct sequencing. Conclusion We identified novel sequence variants of the MGMT gene in esophageal cancer patients from Kashmir valley-India. PMID:24533020

  10. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Science.gov (United States)

    Mayer, Melanie G; Rödelsperger, Christian; Witte, Hanh; Riebesell, Metta; Sommer, Ralf J

    2015-06-01

    Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as major target for

  11. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  12. Detection of allelic variations of human gene expression by polymerase colonies

    Directory of Open Access Journals (Sweden)

    Mikkilineni Venugopal

    2004-02-01

    Full Text Available Abstract Background Quantification of variations of human gene expression is complicated by the small differences between different alleles. Recent work has shown that variations do exist in the relative allelic expression levels in certain genes of heterozygous individuals. Herein, we describe the application of an immobilized polymerase chain reaction technique as an alternative approach to measure relative allelic differential expression. Results Herein, we report a novel assay, based on immobilized polymerase colonies, that accurately quantifies the relative expression levels of two alleles in a given sample. Mechanistically, this was accomplished by PCR amplifying a gene in a cDNA library in a thin polyacrylamide gel. By immobilizing the PCR, it is ensured that each transcript gives rise to only a single immobilized PCR colony, or "polony". Once polony amplified, the two alleles of the gene were differentially labeled by performing in situ sequencing with fluorescently labeled nucleotides. For these sets of experiments, silent single nucleotide polymorphisms (SNPs were used to discriminate the two alleles. Finally, a simple count was then performed on the differentially labeled polonies in order to determine the relative expression levels of the two alleles. To validate this technique, the relative expression levels of PKD2 in a family of heterozygous patients bearing the 4208G/A SNP were examined and compared to the literature. Conclusions We were able to reproduce the results of allelic variation in gene expression using an accurate technology known as polymerase colonies. Therefore, we have demonstrated the utility of this method in human gene expression analysis.

  13. Understanding gene sequence variation in the context of transcription regulation in yeast.

    Directory of Open Access Journals (Sweden)

    Irit Gat-Viks

    2010-01-01

    Full Text Available DNA sequence polymorphism in a regulatory protein can have a widespread transcriptional effect. Here we present a computational approach for analyzing modules of genes with a common regulation that are affected by specific DNA polymorphisms. We identify such regulatory-linkage modules by integrating genotypic and expression data for individuals in a segregating population with complementary expression data of strains mutated in a variety of regulatory proteins. Our procedure searches simultaneously for groups of co-expressed genes, for their common underlying linkage interval, and for their shared regulatory proteins. We applied the method to a cross between laboratory and wild strains of S. cerevisiae, demonstrating its ability to correctly suggest modules and to outperform extant approaches. Our results suggest that middle sporulation genes are under the control of polymorphism in the sporulation-specific tertiary complex Sum1p/Rfm1p/Hst1p. In another example, our analysis reveals novel inter-relations between Swi3 and two mitochondrial inner membrane proteins underlying variation in a module of aerobic cellular respiration genes. Overall, our findings demonstrate that this approach provides a useful framework for the systematic mapping of quantitative trait loci and their role in gene expression variation.

  14. Personalidad y rendimiento académico

    OpenAIRE

    Nácher Carda, Verónica

    1996-01-01

    Segones Jornades de Foment de la Investigació de la FCHS (Any 1996-1997) Cincuenta y siete sujetos (31 niños y 26 niñas) de 8º curso de E.G.B. participaron en un estudio diseñado para investigar la relación que existe entre personalidad y rendimiento académico. Para la evaluación de la personalidad se utilizó el cuestionario de personalidad EPQ-J de Eysenck. La evaluación del rendimiento se realizó a través de las calificaciones escolares del curso anterior: 7º de E.G.B. En genera...

  15. A relative variation-based method to unraveling gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Yali Wang

    Full Text Available Gene regulatory network (GRN reconstruction is essential in understanding the functioning and pathology of a biological system. Extensive models and algorithms have been developed to unravel a GRN. The DREAM project aims to clarify both advantages and disadvantages of these methods from an application viewpoint. An interesting yet surprising observation is that compared with complicated methods like those based on nonlinear differential equations, etc., methods based on a simple statistics, such as the so-called Z-score, usually perform better. A fundamental problem with the Z-score, however, is that direct and indirect regulations can not be easily distinguished. To overcome this drawback, a relative expression level variation (RELV based GRN inference algorithm is suggested in this paper, which consists of three major steps. Firstly, on the basis of wild type and single gene knockout/knockdown experimental data, the magnitude of RELV of a gene is estimated. Secondly, probability for the existence of a direct regulation from a perturbed gene to a measured gene is estimated, which is further utilized to estimate whether a gene can be regulated by other genes. Finally, the normalized RELVs are modified to make genes with an estimated zero in-degree have smaller RELVs in magnitude than the other genes, which is used afterwards in queuing possibilities of the existence of direct regulations among genes and therefore leads to an estimate on the GRN topology. This method can in principle avoid the so-called cascade errors under certain situations. Computational results with the Size 100 sub-challenges of DREAM3 and DREAM4 show that, compared with the Z-score based method, prediction performances can be substantially improved, especially the AUPR specification. Moreover, it can even outperform the best team of both DREAM3 and DREAM4. Furthermore, the high precision of the obtained most reliable predictions shows that the suggested algorithm may be

  16. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation.

    OpenAIRE

    Macke, J. P.; Hu, N; S. Hu; Bailey, M.; King, V L; Brown, T.; Hamer, D; Nathans, J

    1993-01-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, we have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the the entire androgen receptor cod...

  17. Sequence variation of the amelogenin gene on the Y-chromosome / by Irma Ferreira

    OpenAIRE

    Ferreira, Irma

    2010-01-01

    The accurate determination of gender of biological samples has valuable applications in medical and forensic investigations. Gender determination based on length variations in the X-Y homologous amelogenin gene, is part of most commercial multiplex DNA profiling kits. The first report of a failure of the amelogenin sex test was in 1998 when two normal males were typed as female. Subsequently, several amelogenin Y (AMELY) negative males have been reported. This study repre...

  18. Melanopsin Gene Variations Interact With Season to Predict Sleep Onset and Chronotype

    OpenAIRE

    Roecklein, Kathryn A.; Wong, Patricia M.; Franzen, Peter L.; HASLER, BRANT P.; Wood-Vasey, W. Michael; Nimgaonkar, Vishwajit L.; Miller, Megan A.; Kepreos, Kyle M.; Ferrell, Robert E.; Manuck, Stephen B.

    2012-01-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are asso...

  19. Sex bias in copy number variation of olfactory receptor gene family depends on ethnicity

    OpenAIRE

    Farideh eShadravan

    2013-01-01

    Gender plays a pivotal role in the human genetic identity and is also manifested in many genetic disorders particularly mental retardation. In this study its effect on copy number variation (CNV), known to cause genetic disorders was explored. As the olfactory receptor (OR) repertoire comprises the largest human gene family, it was selected for this study, which was carried out within and between three populations, derived from 150 individuals from the 1000 Genome Project. Analysis of 3872 CN...

  20. Genetic Variation in Cell Cycle Regulatory Gene AURKA and Association With Intrinsic Breast Cancer Subtype

    OpenAIRE

    Taylor, Nicholas J.; Bensen, Jeannette T.; Poole, Charles; Troester, Melissa A.; Gammon, Marilie D.; Luo, Jingchun; Millikan, Robert C.; Olshan, Andrew F.

    2014-01-01

    AURKA is a putative low-penetrance tumor susceptibility gene due to its prominent role in cell cycle regulation and centrosomal function. Germline variation in AURKA was evaluated for association with breast cancer and intrinsic breast cancer subtypes in the Carolina Breast Cancer Study (CBCS), a population-based case-control study of African Americans (AA) and Caucasians (Cau). Tag and candidate single nucleotide polymorphisms (SNPs) on AURKA were genotyped in 1946 cases and 1747 controls. I...

  1. Constitutional genetic variation at the human aromatase gene (Cyp19) and breast cancer risk

    OpenAIRE

    Siegelmann-Danieli, N; Buetow, K H

    1999-01-01

    The activity of the aromatase enzyme, which converts androgens into oestrogens and has a major role in regulating oestrogen levels in the breast, is thought to be a contributing factor in the development of breast cancer. We undertook this study to assess the role of constitutional genetic variation in the human aromatase gene (Cyp19) in the development of this disease. Our genotyping of 348 cases with breast cancer and 145 controls (all Caucasian women) for a published tetranucleotide repeat...

  2. Identification of QTL genes for BMD variation using both linkage and gene-based association approaches

    OpenAIRE

    Li, Gloria Hoi-Yee; Cheung, Ching-Lung; Xiao, Su-Mei; Lau, Kam-Shing; Gao, Yi; Bow, Cora H.; Huang, Qing-Yang; Sham, Pak-Chung; Kung, Annie Wai-Chee

    2011-01-01

    Low bone mineral density (BMD) is a risk factor for osteoporotic fracture with a high heritability. Previous large scale linkage study in Northern Chinese has identified four significant quantitative trait loci (QTL) for BMD variation on chromosome 2q24, 5q21, 7p21 and 13q21. We performed a replication study of these four QTL in 1,459 Southern Chinese from 306 pedigrees. Successful replication was observed on chromosome 5q21 for femoral neck BMD with a LOD score of 1.38 (nominal p value = 0.0...

  3. Mentalidades de gobierno, subjetividad y conocimiento académico: nuevas formas de gobierno de la producción de conocimiento académico en la universidad pública española

    OpenAIRE

    Reyes Lara, Daniel

    2012-01-01

    Este trabajo es acerca de los cambios en el Gobierno de la producción de conocimiento académico y su relación con los procesos de formación de subjetividades, que suponen la aplicación de las reformas universitarias en el sistema universitario español para la integración del Espacio Europeo de Educación Superior. A partir de una descripción sobre las condiciones actuales de la producción de conocimiento académico, plantea la revisión del curso del proceso Bolonia desde una perspectiva gene...

  4. Effects of abhydrolase domain containing 5 gene (ABHD5) expression and variations on chicken fat metabolism.

    Science.gov (United States)

    Ouyang, Hongjia; Liu, Qing; Xu, Jiguo; Zeng, Fang; Pang, Xiaolin; Jebessa, Endashaw; Liang, Shaodong; Nie, Qinghua; Zhang, Xiquan

    2016-01-01

    Abhydrolase domain containing 5 gene (ABHD5), also known as comparative gene identification 58 (CGI-58), is a member of the α/β-hydrolase family as a protein cofactor of ATGL stimulating its triacylglycerol hydrolase activity. In this study, we aim to characterize the expression and variations of ABHD5 and to study their functions in chicken fat metabolism. We compared the ABHD5 expression level in various tissues and under different nutrition conditions, identified the variations of ABHD5, and associated them with production traits in an F2 resource population of chickens. Overexpression analysis with two different genotypes and siRNA interfering analysis of ABHD5 were performed in chicken preadipocytes. Chicken ABDH5 was expressed widely and most predominantly in adipose tissue. Five SNPs of the ABHD5 gene were identified and genotyped in the F2 resource population. The c.490C > T SNP was associated with subcutaneous fat thickness (P  C SNP was also associated with chicken body weight (P chicken preadipocytes, overexpression of wild type ABDH5 did not affect the mRNA level of ATGL (adipose triglyceride lipase) but markedly decreased (P chickens with a high fat diet. These results suggest that expression and variations of ABHD5 may affect fat metabolism through regulating the activity of ATGL in chickens.

  5. Contribution of haplotypes across the fibrinogen gene cluster to variation in risk of myocardial infarction.

    Science.gov (United States)

    Mannila, Maria Nastase; Eriksson, Per; Lundman, Pia; Samnegård, Ann; Boquist, Susanna; Ericsson, Carl-Göran; Tornvall, Per; Hamsten, Anders; Silveira, Angela

    2005-03-01

    Fibrinogen has consistently been recognized as an independent predictor of myocardial infarction (MI). Multiple mechanisms link fibrinogen to MI; therefore disentangling the factors underlying variation in plasma fibrinogen concentration is essential. Candidate regions in the fibrinogen gamma (FGG), alpha (FGA) and beta (FGB) genes were screened for single nucleotide polymorphisms (SNPs). Several novel SNPs were detected in the FGG and FGA genes in addition to the previously known SNPs in the fibrinogen genes. Tight linkage disequilibrium extending over various physical distances was observed between most SNPs. Consequently, eight SNPs were chosen and determined in 377 postinfarction patients and 387 healthy individuals. None of the SNPs were associated with plasma fibrinogen concentration or MI. Haplotype analyses revealed a consistent pattern of haplotypes associated with variation in risk of MI. Of the four haplotypes inferred using the FGA -58G>A and FGG 1299 +79T>C SNPs, the most frequent haplotype, FGG-FGA*1 (prevalence 46.6%), was associated with increased risk of MI (OR 1.51; 95%CI 1.18, 1.93), whereas the least frequent haplotype, FGG-FGA*4 (11.8%), was associated with lower risk of MI (OR 0.79 95%CI 0.64, 0.98). In conclusion, fibrinogen haplotypes, but not SNPs in isolation, are associated with variation in risk of MI.

  6. Genetic variations of glycinin subunit genes among cultivated and wild type soybean species

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Glycinin is a predominant storage protein in most soybean accessions. It is a hexamer constituted by five major subunits, which can be classified into two groups. Group Ⅰ contains Gl, G2 and G3, and Group Ⅱ contains G4 and G5. The genes encoding these subunits have been designated from Gyl to Gy5, respectively. In the present study, Gyl genomic fragments were cloned from wild accessions of subgenera Glycine glycine, Glycine soja and a cultivar of Glycine max. Their sequences and the deduced amino acid sequences were compared. The residues critical for assembling of G1 subunits from the wild perennial accession were conservative. The Gy4 fragments were cloned from two wild perennial accessions and compared with that from subgenus Soja. The intron 3 of Gy4 had abundant variations between the subgenera G. Soja and G. Glycine as well as within the subgenus G. Glycine. Abundant variations existed in the disordered regions 3 and 4 of G4 subunits from two wild perennial accessions. The genomic organization of glycinin genes was analyzed in 19 accessions from subgenera Soja and Glycine. The hybridization patterns were identical among the accessions of subgenus Soja. On the contrary, abundant polymorphisms existed between the accessions from subgenus Glycine. These results indicated that glycinin genes have high degree of conservation within subgenus Soja but more variations within subgenus Glycine.

  7. Tissue-specific effects of genetic and epigenetic variation on gene regulation and splicing.

    Directory of Open Access Journals (Sweden)

    Maria Gutierrez-Arcelus

    2015-01-01

    Full Text Available Understanding how genetic variation affects distinct cellular phenotypes, such as gene expression levels, alternative splicing and DNA methylation levels, is essential for better understanding of complex diseases and traits. Furthermore, how inter-individual variation of DNA methylation is associated to gene expression is just starting to be studied. In this study, we use the GenCord cohort of 204 newborn Europeans' lymphoblastoid cell lines, T-cells and fibroblasts derived from umbilical cords. The samples were previously genotyped for 2.5 million SNPs, mRNA-sequenced, and assayed for methylation levels in 482,421 CpG sites. We observe that methylation sites associated to expression levels are enriched in enhancers, gene bodies and CpG island shores. We show that while the correlation between DNA methylation and gene expression can be positive or negative, it is very consistent across cell-types. However, this epigenetic association to gene expression appears more tissue-specific than the genetic effects on gene expression or DNA methylation (observed in both sharing estimations based on P-values and effect size correlations between cell-types. This predominance of genetic effects can also be reflected by the observation that allele specific expression differences between individuals dominate over tissue-specific effects. Additionally, we discover genetic effects on alternative splicing and interestingly, a large amount of DNA methylation correlating to alternative splicing, both in a tissue-specific manner. The locations of the SNPs and methylation sites involved in these associations highlight the participation of promoter proximal and distant regulatory regions on alternative splicing. Overall, our results provide high-resolution analyses showing how genome sequence variation has a broad effect on cellular phenotypes across cell-types, whereas epigenetic factors provide a secondary layer of variation that is more tissue-specific. Furthermore

  8. Associations between dopamine D4 receptor gene variation with both infidelity and sexual promiscuity.

    Directory of Open Access Journals (Sweden)

    Justin R Garcia

    Full Text Available BACKGROUND: Human sexual behavior is highly variable both within and between populations. While sex-related characteristics and sexual behavior are central to evolutionary theory (sexual selection, little is known about the genetic bases of individual variation in sexual behavior. The variable number tandem repeats (VNTR polymorphism in exon III of the human dopamine D4 receptor gene (DRD4 has been correlated with an array of behavioral phenotypes and may be predicatively responsible for variation in motivating some sexual behaviors, particularly promiscuity and infidelity. METHODOLOGY/PRINCIPAL FINDINGS: We administered an anonymous survey on personal history of sexual behavior and intimate relationships to 181 young adults. We also collected buccal wash samples and genotyped the DRD4 VNTR. Here we show that individuals with at least one 7-repeat allele (7R+ report a greater categorical rate of promiscuous sexual behavior (i.e., having ever had a "one-night stand" and report a more than 50% increase in instances of sexual infidelity. CONCLUSIONS/SIGNIFICANCE: DRD4 VNTR genotype varies considerably within and among populations and has been subject to relatively recent, local selective pressures. Individual differences in sexual behavior are likely partially mediated by individual genetic variation in genes coding for motivation and reward in the brain. Conceptualizing these findings in terms of r/K selection theory suggests a mechanism for selective pressure for and against the 7R+ genotype that may explain the considerable global allelic variation for this polymorphism.

  9. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Energy Technology Data Exchange (ETDEWEB)

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  10. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    Science.gov (United States)

    Jim, Heather S.L.; Lin, Hui-Yi; Tyrer, Jonathan P.; Lawrenson, Kate; Dennis, Joe; Chornokur, Ganna; Chen, Zhihua; Chen, Ann Y.; Permuth-Wey, Jennifer; Aben, Katja KH.; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V.; Bean, Yukie T.; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bunker, Clareann H.; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Sieh, Weiva; Doherty, Jennifer A.; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F.; Eccles, Diana M.; Edwards, Robert P.; Ekici, Arif B.; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goodman, Marc T.; Gronwald, Jacek; Harter, Philipp; Hasmad, Hanis N.; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A.T.; Hillemanns, Peter; Hogdall, Claus K.; Hogdall, Estrid; Hosono, Satoyo; Iversen, Edwin S.; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y.; Kellar, Melissa; Kiemeney, Lambertus A.; Krakstad, Camilla; Kjaer, Susanne K.; Kupryjanczyk, Jolanta; Vierkant, Robert A.; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F.A.G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; McNeish, Ian; Menon, Usha; Milne, Roger L.; Modugno, Francesmary; Thomsen, Lotte; Moysich, Kirsten B.; Ness, Roberta B.; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Palmieri Weber, Rachel; Paul, James; Pearce, Celeste L.; Pejovic, Tanja; Pelttari, Liisa M.; Pike, Malcolm C.; Poole, Elizabeth M.; Schernhammer, Eva; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B.; Siddiqui, Nadeem; Song, Honglin; Southey, Melissa C.; Spiewankiewicz, Beata; Sucheston-Campbell, Lara; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Tangen, Ingvild L.; Tworoger, Shelley S.; van Altena, Anne M.; Vergote, Ignace; Walsh, Christine S.; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Wu, Anna H.; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Amankwah, Ernest; Berchuck, Andrew; Schildkraut, Joellen M.; Kelemen, Linda E.; Ramus, Susan J.; Monteiro, Alvaro N.A.; Goode, Ellen L.; Narod, Steven A.; Gayther, Simon A.; Pharoah, Paul D. P.; Sellers, Thomas A.; Phelan, Catherine M.

    2016-01-01

    Disruption in circadian gene expression, whether due to genetic variation or environmental factors (e.g., light at night, shiftwork), is associated with increased incidence of breast, prostate, gastrointestinal and hematologic cancers and gliomas. Circadian genes are highly expressed in the ovaries where they regulate ovulation; circadian disruption is associated with several ovarian cancer risk factors (e.g., endometriosis). However, no studies have examined variation in germline circadian genes as predictors of ovarian cancer risk and invasiveness. The goal of the current study was to examine single nucleotide polymorphisms (SNPs) in circadian genes BMAL1, CRY2, CSNK1E, NPAS2, PER3, REV1 and TIMELESS and downstream transcription factors KLF10 and SENP3 as predictors of risk of epithelial ovarian cancer (EOC) and histopathologic subtypes. The study included a test set of 3,761 EOC cases and 2,722 controls and a validation set of 44,308 samples including 18,174 (10,316 serous) cases and 26,134 controls from 43 studies participating in the Ovarian Cancer Association Consortium (OCAC). Analysis of genotype data from 36 genotyped SNPs and 4600 imputed SNPs indicated that the most significant association was rs117104877 in BMAL1 (OR = 0.79, 95% CI = 0.68–0.90, p = 5.59 × 10−4]. Functional analysis revealed a significant down regulation of BMAL1 expression following cMYC overexpression and increasing transformation in ovarian surface epithelial (OSE) cells as well as alternative splicing of BMAL1 exons in ovarian and granulosa cells. These results suggest that variation in circadian genes, and specifically BMAL1, may be associated with risk of ovarian cancer, likely through disruption of hormonal pathways. PMID:26807442

  11. Redefining the expressed prototype SICAvar gene involved in Plasmodium knowlesi antigenic variation

    Directory of Open Access Journals (Sweden)

    Galinski Mary R

    2009-07-01

    Full Text Available Abstract Background The SICAvar gene family, expressed at the surface of infected erythrocytes, is critical for antigenic variation in Plasmodium knowlesi. When this family was discovered, a prototypic SICAvar gene was characterized and defined by a 10-exon structure. The predicted 205-kDa protein lacked a convincing signal peptide, but included a series of variable cysteine-rich modules, a transmembrane domain encoded by the penultimate exon, and a cytoplasmic domain encoded by the final highly conserved exon. The 205 SICAvar gene and its family with up to 108 possible family members, was identified prior to the sequencing of the P. knowlesi genome. However, in the published P. knowlesi database this gene remains disjointed in five fragments. This study addresses a number of structural and functional questions that are critical for understanding SICAvar gene expression. Methods Database mining, bioinformatics, and traditional genomic and post-genomic experimental methods including proteomic technologies are used here to confirm the genomic context and expressed structure of the prototype 205 SICAvar gene. Results This study reveals that the 205 SICAvar gene reported previously to have a 10-exon expressed gene structure has, in fact, 12 exons, with an unusually large and repeat-laden intron separating two newly defined upstream exons and the bona fide 5'UTR from the remainder of the gene sequence. The initial exon encodes a PEXEL motif, which may function to localize the SICA protein in the infected erythrocyte membrane. This newly defined start of the 205 SICAvar sequence is positioned on chromosome 5, over 340 kb upstream from the rest of the telomerically positioned SICAvar gene sequence in the published genome assembly. This study, however, verifies the continuity of these sequences, a 9.5 kb transcript, and provides evidence that the 205 SICAvar gene is located centrally on chromosome 5. Conclusion The prototype 205 SICAvar gene has been

  12. Unlocking naturally occurring variation for starch quality by gene-tagged markers in rice

    International Nuclear Information System (INIS)

    Quantitative trait loci (QTLs) mapping and association mapping are currently used to dissect the natural occurring variations for traits of agronomical importance. We found that the major QTLs for starch quality co-locate at the starch-synthesizing gene loci, e.g. Wx locus controls the genetic basis of amylose content, pasting viscosity, gel texture and retrogradation properties, while starch synthase IIa (SSIIa) locus controls the gelatinization temperature (GT) and amylopectin structure. Some of other genes involved in starch biosynthesis and other minor QTLs were also detected. Gene tagged markers such as simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) that were inside or close to those starch-synthesizing genes were designed. Among 499 nonwaxy rice accessions, polymorphisms of SSR in the Waxy gene, soluble starch synthase I gene (SS1) and starch branching enzyme I gene (SBE1), SNPs in Waxy and starch branching enzyme III gene (SBE3) and SSIIa, and a sequence tagged site (STS) in SBEI were surveyed. Ten SSR alleles were found at the Wx locus and four SSR alleles were found at the SBE1 and SS1, respectively. Two continuous SNPs (GC/TT) alone can differentiate rice with high or intermediate GT (possessing GC SNPs) from those with low GT (possessing the TT SNPs). Association test was conducted using all starch gene markers, results indicated that Wx SSR and SNPs were strongly associated with amylose content, pasting viscosities, gel hardness, and retrogradation properties, whereas the SSIIa GC/TT SNPs were strongly associated with the pasting temperature and retrogradation properties, which confirmed the findings from QTL mapping. These markers are useful in molecular breeding for improvement of rice eating and cooking qualities. This study was jointly supported by funds from NSFC (30771327), 863 project (2006AA10Z193), Science and Technology Department of Zhejiang Province (2007C32014) and IAEA (12847). (author)

  13. Indexing Effects of Copy Number Variation on Genes Involved in Developmental Delay.

    Science.gov (United States)

    Uddin, Mohammed; Pellecchia, Giovanna; Thiruvahindrapuram, Bhooma; D'Abate, Lia; Merico, Daniele; Chan, Ada; Zarrei, Mehdi; Tammimies, Kristiina; Walker, Susan; Gazzellone, Matthew J; Nalpathamkalam, Thomas; Yuen, Ryan K C; Devriendt, Koenraad; Mathonnet, Géraldine; Lemyre, Emmanuelle; Nizard, Sonia; Shago, Mary; Joseph-George, Ann M; Noor, Abdul; Carter, Melissa T; Yoon, Grace; Kannu, Peter; Tihy, Frédérique; Thorland, Erik C; Marshall, Christian R; Buchanan, Janet A; Speevak, Marsha; Stavropoulos, Dimitri J; Scherer, Stephen W

    2016-01-01

    A challenge in clinical genomics is to predict whether copy number variation (CNV) affecting a gene or multiple genes will manifest as disease. Increasing recognition of gene dosage effects in neurodevelopmental disorders prompted us to develop a computational approach based on critical-exon (highly expressed in brain, highly conserved) examination for potential etiologic effects. Using a large CNV dataset, our updated analyses revealed significant (P < 1.64 × 10(-15)) enrichment of critical-exons within rare CNVs in cases compared to controls. Separately, we used a weighted gene co-expression network analysis (WGCNA) to construct an unbiased protein module from prenatal and adult tissues and found it significantly enriched for critical exons in prenatal (P < 1.15 × 10(-50), OR = 2.11) and adult (P < 6.03 × 10(-18), OR = 1.55) tissues. WGCNA yielded 1,206 proteins for which we prioritized the corresponding genes as likely to have a role in neurodevelopmental disorders. We compared the gene lists obtained from critical-exon and WGCNA analysis and found 438 candidate genes associated with CNVs annotated as pathogenic, or as variants of uncertain significance (VOUS), from among 10,619 developmental delay cases. We identified genes containing CNVs previously considered to be VOUS to be new candidate genes for neurodevelopmental disorders (GIT1, MVB12B and PPP1R9A) demonstrating the utility of this strategy to index the clinical effects of CNVs. PMID:27363808

  14. Diversity and population-genetic properties of copy number variations and multicopy genes in cattle.

    Science.gov (United States)

    Bickhart, Derek M; Xu, Lingyang; Hutchison, Jana L; Cole, John B; Null, Daniel J; Schroeder, Steven G; Song, Jiuzhou; Garcia, Jose Fernando; Sonstegard, Tad S; Van Tassell, Curtis P; Schnabel, Robert D; Taylor, Jeremy F; Lewin, Harris A; Liu, George E

    2016-06-01

    The diversity and population genetics of copy number variation (CNV) in domesticated animals are not well understood. In this study, we analysed 75 genomes of major taurine and indicine cattle breeds (including Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, and Romagnola), sequenced to 11-fold coverage to identify 1,853 non-redundant CNV regions. Supported by high validation rates in array comparative genomic hybridization (CGH) and qPCR experiments, these CNV regions accounted for 3.1% (87.5 Mb) of the cattle reference genome, representing a significant increase over previous estimates of the area of the genome that is copy number variable (∼2%). Further population genetics and evolutionary genomics analyses based on these CNVs revealed the population structures of the cattle taurine and indicine breeds and uncovered potential diversely selected CNVs near important functional genes, including AOX1, ASZ1, GAT, GLYAT, and KRTAP9-1 Additionally, 121 CNV gene regions were found to be either breed specific or differentially variable across breeds, such as RICTOR in dairy breeds and PNPLA3 in beef breeds. In contrast, clusters of the PRP and PAG genes were found to be duplicated in all sequenced animals, suggesting that subfunctionalization, neofunctionalization, or overdominance play roles in diversifying those fertility-related genes. These CNV results provide a new glimpse into the diverse selection histories of cattle breeds and a basis for correlating structural variation with complex traits in the future. PMID:27085184

  15. Sweet taste receptor gene variation and aspartame taste in primates and other species.

    Science.gov (United States)

    Li, Xia; Bachmanov, Alexander A; Maehashi, Kenji; Li, Weihua; Lim, Raymond; Brand, Joseph G; Beauchamp, Gary K; Reed, Danielle R; Thai, Chloe; Floriano, Wely B

    2011-06-01

    Aspartame is a sweetener added to foods and beverages as a low-calorie sugar replacement. Unlike sugars, which are apparently perceived as sweet and desirable by a range of mammals, the ability to taste aspartame varies, with humans, apes, and Old World monkeys perceiving aspartame as sweet but not other primate species. To investigate whether the ability to perceive the sweetness of aspartame correlates with variations in the DNA sequence of the genes encoding sweet taste receptor proteins, T1R2 and T1R3, we sequenced these genes in 9 aspartame taster and nontaster primate species. We then compared these sequences with sequences of their orthologs in 4 other nontasters species. We identified 9 variant sites in the gene encoding T1R2 and 32 variant sites in the gene encoding T1R3 that distinguish aspartame tasters and nontasters. Molecular docking of aspartame to computer-generated models of the T1R2 + T1R3 receptor dimer suggests that species variation at a secondary, allosteric binding site in the T1R2 protein is the most likely origin of differences in perception of the sweetness of aspartame. These results identified a previously unknown site of aspartame interaction with the sweet receptor and suggest that the ability to taste aspartame might have developed during evolution to exploit a specialized food niche.

  16. Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

    Directory of Open Access Journals (Sweden)

    Kathiravan Periasamy

    Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

  17. Candidate Gene Approach for Parasite Resistance in Sheep – Variation in Immune Pathway Genes and Association with Fecal Egg Count

    Science.gov (United States)

    Periasamy, Kathiravan; Pichler, Rudolf; Poli, Mario; Cristel, Silvina; Cetrá, Bibiana; Medus, Daniel; Basar, Muladno; A. K., Thiruvenkadan; Ramasamy, Saravanan; Ellahi, Masroor Babbar; Mohammed, Faruque; Teneva, Atanaska; Shamsuddin, Mohammed; Podesta, Mario Garcia; Diallo, Adama

    2014-01-01

    Sheep chromosome 3 (Oar3) has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs) within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF) did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05) in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have potential for

  18. Genetic variation in the immunosuppression pathway genes and breast cancer susceptibility

    DEFF Research Database (Denmark)

    Lei, Jieping; Rudolph, Anja; Moysich, Kirsten B;

    2016-01-01

    and 40,577 controls of European ancestry from 37 studies in the Breast Cancer Association Consortium (2015) with available genotype data for 3595 single nucleotide polymorphisms (SNPs) in 133 candidate genes. Associations between genotyped SNPs and overall breast cancer risk, and secondarily according...... matched normal tissue samples. SNP rs1905339 (A>G) in the STAT3 region was associated with an increased breast cancer risk (per allele odds ratio 1.05, 95 % confidence interval 1.03-1.08; p value = 1.4 × 10(-6)). The association did not differ significantly by ER status. On the gene level, in addition......Immunosuppression plays a pivotal role in assisting tumors to evade immune destruction and promoting tumor development. We hypothesized that genetic variation in the immunosuppression pathway genes may be implicated in breast cancer tumorigenesis. We included 42,510 female breast cancer cases...

  19. Variation in Telangiectasia Predisposing Genes Is Associated With Overall Radiation Toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Tanteles, George A. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Murray, Robert J.S. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Mills, Jamie [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Barwell, Julian [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Chakraborti, Prabir [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Chan, Steve [Department of Clinical Oncology, Nottingham University Hospitals NHS Trust, Nottingham (United Kingdom); Cheung, Kwok-Leung [Division of Breast Surgery, University of Nottingham, Nottingham (United Kingdom); Ennis, Dawn [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Khurshid, Nazish [Department of Genetics, University of Leicester, Leicester (United Kingdom); Lambert, Kelly [Department of Breast Surgery, University Hospitals of Leicester, Glenfield Hospital, Leicester (United Kingdom); Machhar, Rohan; Meisuria, Mitul [Department of Genetics, University of Leicester, Leicester (United Kingdom); Osman, Ahmed; Peat, Irene [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Sahota, Harjinder [Department of Genetics, University of Leicester, Leicester (United Kingdom); Woodings, Pamela [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Talbot, Christopher J., E-mail: cjt14@le.ac.uk [Department of Genetics, University of Leicester, Leicester (United Kingdom); and others

    2012-11-15

    Purpose: In patients receiving radiotherapy for breast cancer where the heart is within the radiation field, cutaneous telangiectasiae could be a marker of potential radiation-induced heart disease. We hypothesized that single nucleotide polymorphisms (SNPs) in genes known to cause heritable telangiectasia-associated disorders could predispose to such late, normal tissue vascular damage. Methods and Materials: The relationship between cutaneous telangiectasia as a late normal tissue radiation injury phenotype in 633 breast cancer patients treated with radiotherapy was examined. Patients were clinically assessed for the presence of cutaneous telangiectasia and genotyped at nine SNPs in three candidate genes. Candidate SNPs were within the endoglin (ENG) and activin A receptor, type II-like 1 (ACVRL1) genes, mutations in which cause hereditary hemorrhagic telangiectasia and the ataxia-telangiectasia mutated (ATM) gene associated with ataxia-telangiectasia. Results: A total of 121 (19.1%) patients exhibited a degree of cutaneous telangiectasiae on clinical examination. Regression was used to examine the associations between the presence of telangiectasiae in patients who underwent breast-conserving surgery, controlling for the effects of boost and known brassiere size (n=388), and individual geno- or haplotypes. Inheritance of ACVRL1 SNPs marginally contributed to the risk of cutaneous telangiectasiae. Haplotypic analysis revealed a stronger association between inheritance of a ATM haplotype and the presence of cutaneous telangiectasiae, fibrosis and overall toxicity. No significant association was observed between telangiectasiae and the coinheritance of the candidate ENG SNPs. Conclusions: Genetic variation in the ATM gene influences reaction to radiotherapy through both vascular damage and increased fibrosis. The predisposing variation in the ATM gene will need to be better defined to optimize it as a predictive marker for assessing radiotherapy late effects.

  20. Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Richards Eric J

    2008-09-01

    Full Text Available Abstract Background DNA methylation is an important biochemical mark that silences repetitive sequences, such as transposons, and reinforces epigenetic gene expression states. An important class of repetitive genes under epigenetic control in eukaryotic genomes encodes ribosomal RNA (rRNA transcripts. The ribosomal genes coding for the 45S rRNA precursor of the three largest eukaryotic ribosomal RNAs (18S, 5.8S, and 25–28S are found in nucleolus organizer regions (NORs, comprised of hundreds to thousands of repeats, only some of which are expressed in any given cell. An epigenetic switch, mediated by DNA methylation and histone modification, turns rRNA genes on and off. However, little is known about the mechanisms that specify and maintain the patterns of NOR DNA methylation. Results Here, we explored the extent of naturally-occurring variation in NOR DNA methylation among accessions of the flowering plant Arabidopsis thaliana. DNA methylation in coding regions of rRNA genes was positively correlated with copy number of 45S rRNA gene and DNA methylation in the intergenic spacer regions. We investigated the inheritance of NOR DNA methylation patterns in natural accessions with hypomethylated NORs in inter-strain crosses and defined three different categories of inheritance in F1 hybrids. In addition, subsequent analysis of F2 segregation for NOR DNA methylation patterns uncovered different patterns of inheritance. We also revealed that NOR DNA methylation in the Arabidopsis accession Bor-4 is influenced by the vim1-1 (variant in methylation 1-1 mutation, but the primary effect is specified by the NORs themselves. Conclusion Our results indicate that the NORs themselves are the most significant determinants of natural variation in NOR DNA methylation. However, the inheritance of NOR DNA methylation suggests the operation of a diverse set of mechanisms, including inheritance of parental methylation patterns, reconfiguration of parental NOR DNA

  1. Copy number variation of age-related macular degeneration relevant genes in the Korean population.

    Directory of Open Access Journals (Sweden)

    Jung Hyun Park

    Full Text Available PURPOSE: Studies that analyzed single nucleotide polymorphisms (SNP in various genes have shown that genetic factors are strongly associated with age-related macular degeneration (AMD susceptibility. Copy number variation (CNV may be an additional type of genetic variation that contributes to AMD pathogenesis. This study investigated CNV in 4 AMD-relevant genes in Korean AMD patients and control subjects. METHODS: Four CNV candidate regions located in AMD-relevant genes (VEGFA, ARMS2/HTRA1, CFH and VLDLR, were selected based on the outcomes of our previous study which elucidated common CNVs in the Asian populations. Real-time PCR based TaqMan Copy Number Assays were performed on CNV candidates in 273 AMD patients and 257 control subjects. RESULTS: The predicted copy number (PCN, 0, 1, 2 or 3+ of each region was called using the CopyCaller program. All candidate genes except ARMS2/HTRA1 showed CNV in at least one individual, in which losses of VEGFA and VLDLR represent novel findings in the Asian population. When the frequencies of PCN were compared, only the gain in VLDLR showed significant differences between AMD patients and control subjects (p = 0.025. Comparisons of the raw copy values (RCV revealed that 3 of 4 candidate genes showed significant differences (2.03 vs. 1.92 for VEGFA, p<0.01; 2.01 vs. 1.97 for CFH, p<0.01; 1.97 vs. 2.01, p<0.01 for ARMS2/HTRA1. CONCLUSION: CNVs located in AMD-relevant genes may be associated with AMD susceptibility. Further investigations encompassing larger patient cohorts are needed to elucidate the role of CNV in AMD pathogenesis.

  2. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    Science.gov (United States)

    Purrington, Kristen S.; Slettedahl, Seth; Bolla, Manjeet K.; Michailidou, Kyriaki; Czene, Kamila; Nevanlinna, Heli; Bojesen, Stig E.; Andrulis, Irene L.; Cox, Angela; Hall, Per; Carpenter, Jane; Yannoukakos, Drakoulis; Haiman, Christopher A.; Fasching, Peter A.; Mannermaa, Arto; Winqvist, Robert; Brenner, Hermann; Lindblom, Annika; Chenevix-Trench, Georgia; Benitez, Javier; Swerdlow, Anthony; Kristensen, Vessela; Guénel, Pascal; Meindl, Alfons; Darabi, Hatef; Eriksson, Mikael; Fagerholm, Rainer; Aittomäki, Kristiina; Blomqvist, Carl; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Wang, Xianshu; Olswold, Curtis; Olson, Janet E.; Mulligan, Anna Marie; Knight, Julia A.; Tchatchou, Sandrine; Reed, Malcolm W.R.; Cross, Simon S.; Liu, Jianjun; Li, Jingmei; Humphreys, Keith; Clarke, Christine; Scott, Rodney; Fostira, Florentia; Fountzilas, George; Konstantopoulou, Irene; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Ekici, Arif B.; Hartmann, Arndt; Beckmann, Matthias W.; Hartikainen, Jaana M.; Kosma, Veli-Matti; Kataja, Vesa; Jukkola-Vuorinen, Arja; Pylkäs, Katri; Kauppila, Saila; Dieffenbach, Aida Karina; Stegmaier, Christa; Arndt, Volker; Margolin, Sara; Balleine, Rosemary; Arias Perez, Jose Ignacio; Pilar Zamora, M.; Menéndez, Primitiva; Ashworth, Alan; Jones, Michael; Orr, Nick; Arveux, Patrick; Kerbrat, Pierre; Truong, Thérèse; Bugert, Peter; Toland, Amanda E.; Ambrosone, Christine B.; Labrèche, France; Goldberg, Mark S.; Dumont, Martine; Ziogas, Argyrios; Lee, Eunjung; Dite, Gillian S.; Apicella, Carmel; Southey, Melissa C.; Long, Jirong; Shrubsole, Martha; Deming-Halverson, Sandra; Ficarazzi, Filomena; Barile, Monica; Peterlongo, Paolo; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Tollenaar, Robert A.E.M.; Seynaeve, Caroline; Brüning, Thomas; Ko, Yon-Dschun; Van Deurzen, Carolien H.M.; Martens, John W.M.; Kriege, Mieke; Figueroa, Jonine D.; Chanock, Stephen J.; Lissowska, Jolanta; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Schneeweiss, Andreas; Tapper, William J.; Gerty, Susan M.; Durcan, Lorraine; Mclean, Catriona; Milne, Roger L.; Baglietto, Laura; dos Santos Silva, Isabel; Fletcher, Olivia; Johnson, Nichola; Van'T Veer, Laura J.; Cornelissen, Sten; Försti, Asta; Torres, Diana; Rüdiger, Thomas; Rudolph, Anja; Flesch-Janys, Dieter; Nickels, Stefan; Weltens, Caroline; Floris, Giuseppe; Moisse, Matthieu; Dennis, Joe; Wang, Qin; Dunning, Alison M.; Shah, Mitul; Brown, Judith; Simard, Jacques; Anton-Culver, Hoda; Neuhausen, Susan L.; Hopper, John L.; Bogdanova, Natalia; Dörk, Thilo; Zheng, Wei; Radice, Paolo; Jakubowska, Anna; Lubinski, Jan; Devillee, Peter; Brauch, Hiltrud; Hooning, Maartje; García-Closas, Montserrat; Sawyer, Elinor; Burwinkel, Barbara; Marmee, Frederick; Eccles, Diana M.; Giles, Graham G.; Peto, Julian; Schmidt, Marjanka; Broeks, Annegien; Hamann, Ute; Chang-Claude, Jenny; Lambrechts, Diether; Pharoah, Paul D.P.; Easton, Douglas; Pankratz, V. Shane; Slager, Susan; Vachon, Celine M.; Couch, Fergus J.

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymorphisms (SNPs) from 194 mitotic genes and breast cancer risk, overall and by histologic grade, in the Breast Cancer Association Consortium (BCAC) iCOGS study (n = 39 067 cases; n = 42 106 controls). SNPs in TACC2 [rs17550038: odds ratio (OR) = 1.24, 95% confidence interval (CI) 1.16–1.33, P = 4.2 × 10−10) and EIF3H (rs799890: OR = 1.07, 95% CI 1.04–1.11, P = 8.7 × 10−6) were significantly associated with risk of low-grade breast cancer. The TACC2 signal was retained (rs17550038: OR = 1.15, 95% CI 1.07–1.23, P = 7.9 × 10−5) after adjustment for breast cancer risk SNPs in the nearby FGFR2 gene, suggesting that TACC2 is a novel, independent genome-wide significant genetic risk locus for low-grade breast cancer. While no SNPs were individually associated with high-grade disease, a pathway-level gene set analysis showed that variation across the 194 mitotic genes was associated with high-grade breast cancer risk (P = 2.1 × 10−3). These observations will provide insight into the contribution of mitotic defects to histological grade and the etiology of breast cancer. PMID:24927736

  3. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Directory of Open Access Journals (Sweden)

    Mark T Anderson

    Full Text Available Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae

  4. A general scenario of Hox gene inventory variation among major sarcopterygian lineages

    Directory of Open Access Journals (Sweden)

    Wang Chaolin

    2011-01-01

    Full Text Available Abstract Background Hox genes are known to play a key role in shaping the body plan of metazoans. Evolutionary dynamics of these genes is therefore essential in explaining patterns of evolutionary diversity. Among extant sarcopterygians comprising both lobe-finned fishes and tetrapods, our knowledge of the Hox genes and clusters has largely been restricted in several model organisms such as frogs, birds and mammals. Some evolutionary gaps still exist, especially for those groups with derived body morphology or occupying key positions on the tree of life, hindering our understanding of how Hox gene inventory varied along the sarcopterygian lineage. Results We determined the Hox gene inventory for six sarcopterygian groups: lungfishes, caecilians, salamanders, snakes, turtles and crocodiles by comprehensive PCR survey and genome walking. Variable Hox genes in each of the six sarcopterygian group representatives, compared to the human Hox gene inventory, were further validated for their presence/absence by PCR survey in a number of related species representing a broad evolutionary coverage of the group. Turtles, crocodiles, birds and placental mammals possess the same 39 Hox genes. HoxD12 is absent in snakes, amphibians and probably lungfishes. HoxB13 is lost in frogs and caecilians. Lobe-finned fishes, amphibians and squamate reptiles possess HoxC3. HoxC1 is only present in caecilians and lobe-finned fishes. Similar to coelacanths, lungfishes also possess HoxA14, which is only found in lobe-finned fishes to date. Our Hox gene variation data favor the lungfish-tetrapod, turtle-archosaur and frog-salamander relationships and imply that the loss of HoxD12 is not directly related to digit reduction. Conclusions Our newly determined Hox inventory data provide a more complete scenario for evolutionary dynamics of Hox genes along the sarcopterygian lineage. Limbless, worm-like caecilians and snakes possess similar Hox gene inventories to animals with

  5. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Directory of Open Access Journals (Sweden)

    Taylor Reiter

    Full Text Available Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR, phytanol-CoA 2-hydroxylase (PHYH, and pancreatic α-amylase 2B (AMY2B. These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  6. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Science.gov (United States)

    Reiter, Taylor; Jagoda, Evelyn; Capellini, Terence D

    2016-01-01

    Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR), phytanol-CoA 2-hydroxylase (PHYH), and pancreatic α-amylase 2B (AMY2B). These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  7. Recombination in pe/ppe genes contributes to genetic variation in Mycobacterium tuberculosis lineages

    KAUST Repository

    Phelan, Jody E.

    2016-02-29

    Background Approximately 10 % of the Mycobacterium tuberculosis genome is made up of two families of genes that are poorly characterized due to their high GC content and highly repetitive nature. The PE and PPE families are typified by their highly conserved N-terminal domains that incorporate proline-glutamate (PE) and proline-proline-glutamate (PPE) signature motifs. They are hypothesised to be important virulence factors involved with host-pathogen interactions, but their high genetic variability and complexity of analysis means they are typically disregarded in genome studies. Results To elucidate the structure of these genes, 518 genomes from a diverse international collection of clinical isolates were de novo assembled. A further 21 reference M. tuberculosis complex genomes and long read sequence data were used to validate the approach. SNP analysis revealed that variation in the majority of the 168 pe/ppe genes studied was consistent with lineage. Several recombination hotspots were identified, notably pe_pgrs3 and pe_pgrs17. Evidence of positive selection was revealed in 65 pe/ppe genes, including epitopes potentially binding to major histocompatibility complex molecules. Conclusions This, the first comprehensive study of the pe and ppe genes, provides important insight into M. tuberculosis diversity and has significant implications for vaccine development.

  8. Systematic variation in gene expression patterns in human cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Ross, Douglas T.; Scherf, Uwe; Eisen, Michael B.; Perou, Charles M.; Rees, Christian; Spellman, Paul; Iyer, Vishwanath; Jeffrey, Stefanie S.; Van de Rijn, Matt; Waltham, Mark; Pergamenschikov, Alexander; Lee, Jeffrey C.F.; Lashkari, Deval; Shalon, Dari; Myers, Timothy G.; Weinstein, John N.; Botstein, David; Brown, Patrick O.

    2000-01-01

    We used cDNA micro arrays to explore the variation in expression of approximately 8,000 unique genes among the 60 cell lines used in the National Cancer Institute s screen for anti-cancer drugs. Classification of the cell lines based solely on the observed patterns of gene expression revealed a correspondence to the ostensible origins of the tumors from which the cell lines were derived. The consistent relationship between the gene expression patterns and the tissue of origin allowed us to recognize outliers whose previous classification appeared incorrect. Specific features of the gene expression patterns appeared to be related to physiological properties of the cell lines, such as their doubling time in culture, drug metabolism or the interferon response. Comparison of gene expression patterns in the cell lines to those observed in normal breast tissue or in breast tumor specimens revealed features of the expression patterns in the tumors that had recognizable counterparts in specific cell lines, reflecting the tumor, stromal and inflammatory components of the tumor tissue. These results provided a novel molecular characterization of this important group of human cell lines and their relationships to tumors in vivo.

  9. Evaluation of bovine chemerin (RARRES2 gene variation on beef cattle production traits

    Directory of Open Access Journals (Sweden)

    Amanda K Lindholm-Perry

    2012-03-01

    Full Text Available A previous study in cattle based on >48,000 markers identified markers on chromosome 4 near the chemerin gene associated with average daily feed intake (ADFI in steers (P<0.008. Chemerin is an adipokine associated with obesity and metabolic syndrome in humans, representing a strong candidate gene potentially underlying the observed association. To evaluate whether the bovine chemerin gene is involved in feed intake, 16 markers within and around the gene were tested for association in the same resource population. Eleven were nominally significant for ADFI (P<0.05 and two were significant after Bonferroni correction. Two and five SNP in this region were nominally significant for the related traits of average daily gain (ADG and residual feed intake (RFI, respectively. All markers were evaluated for effects on meat quality and carcass phenotypes. Many of the markers associated with ADFI were associated with hot carcass weight (HCW, adjusted fat thickness (AFT, and marbling (P<0.05. Marker alleles that were associated with lower ADFI were also associated with lower HCW, AFT, and marbling. Markers associated with ADFI were genotyped in a validation population of steers representing 14 breeds to determine predictive merit across populations. No consistent relationships for ADFI were detected. To determine whether cattle feed intake or growth phenotypes might be related to chemerin transcript abundance, the expression of chemerin was evaluated in adipose of 114 heifers that were siblings of the steers in the discovery population. Relative chemerin transcript abundance was not correlated with ADFI, ADG, or RFI, but associations with body condition score and yearling weight were observed. We conclude that variation in the chemerin gene may underlie observed association in the resource population, but that additional research is required to determine if this variation is widespread among breeds and to develop robust markers with predictive merit across

  10. Adaptive variation regulates the expression of the human SGK1 gene in response to stress.

    Directory of Open Access Journals (Sweden)

    Francesca Luca

    2009-05-01

    Full Text Available The Serum and Glucocorticoid-regulated Kinase1 (SGK1 gene is a target of the glucocorticoid receptor (GR and is central to the stress response in many human tissues. Because environmental stress varies across habitats, we hypothesized that natural selection shaped the geographic distribution of genetic variants regulating the level of SGK1 expression following GR activation. By combining population genetics and molecular biology methods, we identified a variant (rs9493857 with marked allele frequency differences between populations of African and European ancestry and with a strong correlation between allele frequency and latitude in worldwide population samples. This SNP is located in a GR-binding region upstream of SGK1 that was identified using a GR ChIP-chip. SNP rs9493857 also lies within a predicted binding site for Oct1, a transcription factor known to cooperate with the GR in the transactivation of target genes. Using ChIP assays, we show that both GR and Oct1 bind to this region and that the ancestral allele at rs9493857 binds the GR-Oct1 complex more efficiently than the derived allele. Finally, using a reporter gene assay, we demonstrate that the ancestral allele is associated with increased glucocorticoid-dependent gene expression when compared to the derived allele. Our results suggest a novel paradigm in which hormonal responsiveness is modulated by sequence variation in the regulatory regions of nuclear receptor target genes. Identifying such functional variants may shed light on the mechanisms underlying inter-individual variation in response to environmental stressors and to hormonal therapy, as well as in the susceptibility to hormone-dependent diseases.

  11. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought

    Directory of Open Access Journals (Sweden)

    Pei eXu

    2015-10-01

    Full Text Available Asparagus bean (Vigna unguiculata ssp. sesquipedalis is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS. Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding.

  12. Common Variation in the DOPA Decarboxylase (DDC) Gene and Human Striatal DDC Activity In Vivo.

    Science.gov (United States)

    Eisenberg, Daniel P; Kohn, Philip D; Hegarty, Catherine E; Ianni, Angela M; Kolachana, Bhaskar; Gregory, Michael D; Masdeu, Joseph C; Berman, Karen F

    2016-08-01

    The synthesis of multiple amine neurotransmitters, such as dopamine, norepinephrine, serotonin, and trace amines, relies in part on DOPA decarboxylase (DDC, AADC), an enzyme that is required for normative neural operations. Because rare, loss-of-function mutations in the DDC gene result in severe enzymatic deficiency and devastating autonomic, motor, and cognitive impairment, DDC common genetic polymorphisms have been proposed as a source of more moderate, but clinically important, alterations in DDC function that may contribute to risk, course, or treatment response in complex, heritable neuropsychiatric illnesses. However, a direct link between common genetic variation in DDC and DDC activity in the living human brain has never been established. We therefore tested for this association by conducting extensive genotyping across the DDC gene in a large cohort of 120 healthy individuals, for whom DDC activity was then quantified with [(18)F]-FDOPA positron emission tomography (PET). The specific uptake constant, Ki, a measure of DDC activity, was estimated for striatal regions of interest and found to be predicted by one of five tested haplotypes, particularly in the ventral striatum. These data provide evidence for cis-acting, functional common polymorphisms in the DDC gene and support future work to determine whether such variation might meaningfully contribute to DDC-mediated neural processes relevant to neuropsychiatric illness and treatment. PMID:26924680

  13. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought.

    Science.gov (United States)

    Xu, Pei; Moshelion, Menachem; Wu, XiaoHua; Halperin, Ofer; Wang, BaoGen; Luo, Jie; Wallach, Rony; Wu, Xinyi; Lu, Zhongfu; Li, Guojing

    2015-01-01

    Asparagus bean (Vigna unguiculata ssp. sesquipedalis) is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS). Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between different genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding. PMID:26579145

  14. Genetic variation in telomere maintenance genes, telomere length, and lung cancer susceptibility.

    Science.gov (United States)

    Hosgood, H Dean; Cawthon, Richard; He, Xingzhou; Chanock, Stephen; Lan, Qing

    2009-11-01

    Telomeres are responsible for the protection of the chromosome ends and shortened telomere length has been associated with risk of multiple cancers. Genetic variation in telomere-related genes may alter cancer risk associated with telomere length. Using lung cancer cases (n=120) and population-based controls (n=110) from Xuanwei, China, we analyzed telomere length separately and in conjunction with single nucleotide polymorphisms in the telomere maintenance genes POT1, TERT, and TERF2, which we have previously reported were associated with risk of lung cancer in this study. POT1 rs10244817, TERT rs2075786, and TERF2 rs251796 were significantly associated with lung cancer (p(trend)telomere length was not significantly associated with risk of lung cancer (OR=1.58; 95% CI=0.79-3.18) when compared to the longest tertile of telomere length. When stratified by genotype, there was a suggestion of a dose-response relationship between tertiles of telomere length and risk of lung cancer among the POT1 rs10244817 common variant carriers (OR (95% CI)=1.33 (0.47-3.75), 3.30 (1.14-9.56), respectively) but not among variant genotype carriers (p(interaction)=0.05). Our findings provide evidence that telomere length and genetic variation in telomere maintenance genes may be associated with risk of lung cancer susceptibility and warrant replication in larger studies.

  15. The identification of additional zebrafish DICP genes reveals haplotype variation and linkage to MHC class I genes.

    Science.gov (United States)

    Rodriguez-Nunez, Ivan; Wcisel, Dustin J; Litman, Ronda T; Litman, Gary W; Yoder, Jeffrey A

    2016-04-01

    Bony fish encode multiple multi-gene families of membrane receptors that are comprised of immunoglobulin (Ig) domains and are predicted to function in innate immunity. One of these families, the diverse immunoglobulin (Ig) domain-containing protein (DICP) genes, maps to three chromosomal loci in zebrafish. Most DICPs possess one or two Ig ectodomains and include membrane-bound and secreted forms. Membrane-bound DICPs include putative inhibitory and activating receptors. Recombinant DICP Ig domains bind lipids with varying specificity, a characteristic shared with mammalian CD300 and TREM family members. Numerous DICP transcripts amplified from different lines of zebrafish did not match the zebrafish reference genome sequence suggesting polymorphic and haplotypic variation. The expression of DICPs in three different lines of zebrafish has been characterized employing PCR-based strategies. Certain DICPs exhibit restricted expression in adult tissues whereas others are expressed ubiquitously. Transcripts of a subset of DICPs can be detected during embryonic development suggesting roles in embryonic immunity or other developmental processes. Transcripts representing 11 previously uncharacterized DICP sequences were identified. The assignment of two of these sequences to an unplaced genomic scaffold resulted in the identification of an alternative DICP haplotype that is linked to a MHC class I Z lineage haplotype on zebrafish chromosome 3. The linkage of DICP and MHC class I genes also is observable in the genomes of the related grass carp (Ctenopharyngodon idellus) and common carp (Cyprinus carpio) suggesting that this is a shared character with the last common Cyprinidae ancestor. PMID:26801775

  16. The Role of Genetic Variation in the Lamin A/C Gene in the Etiology of Polycystic Ovary Syndrome

    OpenAIRE

    Urbanek, Margrit; Nampiaparampil, Geetha; D'Souza, Janine; Sefton, Elizabeth; Ackerman, Christine; Legro, Richard S.; Dunaif, Andrea

    2009-01-01

    Objective: We performed this study to test the hypothesis that variation in the lamin a/c gene (LMNA) contributes to milder phenotypes of insulin resistance, hyperandrogenism, and/or metabolic syndrome associated with polycystic ovary syndrome (PCOS).

  17. De académico o vernacular a lo vernacular y lo académico

    OpenAIRE

    Ferrarese, José Francisco

    2007-01-01

    Existe un desarrollo paralelo entre el mobiliario, y objetos en general, fundamentado y producido académicamente y aquel producido y apropiado fuera de estos ámbitos. Ahora ¿cómo se da la evolución del mobiliario vernacular1 en paralelo a lo legitimado por vanguardias y la academia?, ¿cuál/es son los lineamientos para su creación y características? A partir del análisis, en principio de objetos situados en el living, que luego, por razones prácticas, se puntualizó en los sillones y aquello...

  18. Assortative mating and gene flow generate clinal phenological variation in trees

    Directory of Open Access Journals (Sweden)

    Soularue Jean-Paul

    2012-06-01

    Full Text Available Abstract Background On-going climate change is shifting the timing of bud burst (TBB of broad leaf and conifer trees in temperate areas, raising concerns about the abilities of natural populations to respond to these shifts. The level of expected evolutionary change depends on the level and distribution of genetic variation of TBB. While numerous experimental studies have highlighted the role of divergent selection in promoting clinal TBB differentiation, we explored whether the observed patterns of variation could be generated by the joint effects of assortative mating for TBB and gene flow among natural populations. We tested this hypothesis using an in silico approach based on quantitative genetic models. Results Our simulations showed that genetic clines can develop even without divergent selection. Assortative mating in association with environmental gradients substantially shifted the mean genetic values of populations. Owing to assortative mating, immigrant alleles were screened for proximal or distant populations depending on the strength of the environmental cline. Furthermore, we confirmed that assortative mating increases the additive genetic variance within populations. However, we observed also a rapid decline of the additive genetic variance caused by restricted gene flow between neighboring populations resulting from preferential matings between phenologically-matching phenotypes. Conclusions We provided evidence that the patterns of genetic variation of phenological traits observed in forest trees can be generated solely by the effects of assortative mating and gene flow. We anticipate that predicted temperature increases due to climate change will further enhance genetic differentiation across the landscape. These trends are likely to be reinforced or counteracted by natural selection if phenological traits are correlated to fitness.

  19. Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces

    Directory of Open Access Journals (Sweden)

    Chakrabarti Bhismadev

    2011-06-01

    Full Text Available Abstract Background From an early age, humans look longer at preferred stimuli and also typically look longer at facial expressions of emotion, particularly happy faces. Atypical gaze patterns towards social stimuli are common in autism spectrum conditions (ASC. However, it is unknown whether gaze fixation patterns have any genetic basis. In this study, we tested whether variations in the cannabinoid receptor 1 (CNR1 gene are associated with gaze duration towards happy faces. This gene was selected because CNR1 is a key component of the endocannabinoid system, which is involved in processing reward, and in our previous functional magnetic resonance imaging (fMRI study, we found that variations in CNR1 modulate the striatal response to happy (but not disgust faces. The striatum is involved in guiding gaze to rewarding aspects of a visual scene. We aimed to validate and extend this result in another sample using a different technique (gaze tracking. Methods A total of 30 volunteers (13 males and 17 females from the general population observed dynamic emotional expressions on a screen while their eye movements were recorded. They were genotyped for the identical four single-nucleotide polymorphisms (SNPs in the CNR1 gene tested in our earlier fMRI study. Results Two SNPs (rs806377 and rs806380 were associated with differential gaze duration for happy (but not disgust faces. Importantly, the allelic groups associated with a greater striatal response to happy faces in the fMRI study were associated with longer gaze duration at happy faces. Conclusions These results suggest that CNR1 variations modulate the striatal function that underlies the perception of signals of social reward, such as happy faces. This suggests that CNR1 is a key element in the molecular architecture of perception of certain basic emotions. This may have implications for understanding neurodevelopmental conditions marked by atypical eye contact and facial emotion processing

  20. La voz en el discurso académico

    Directory of Open Access Journals (Sweden)

    Nicolás Polo Figueroa

    2012-01-01

    Full Text Available En aras del positivismo imperante en las aulas académicas, el término voz estaba proscrito del discurso académico. El escritor solo podía hablar en la forma impersonal se; la voz del colectivo científico al que le prestaba la voz. Gracias a renovados vientos en las ciencias humanas, la intersubjetividad en el discurso académico ha salido del clóset; los académicos están dejando oír su propia voz, aunque son muy conscientes de que tras esta hay una sinfonía de voces: la colectiva, la intersubjetiva, la social y la discursiva. Una mirada a estas es el objeto de esta comunicación.

  1. Gene regulatory variation mediates flowering responses to vernalization along an altitudinal gradient in Arabidopsis.

    Science.gov (United States)

    Suter, Léonie; Rüegg, Marlene; Zemp, Niklaus; Hennig, Lars; Widmer, Alex

    2014-12-01

    Steep environmental gradients provide ideal settings for studies of potentially adaptive phenotypic and genetic variation in plants. The accurate timing of flowering is crucial for reproductive success and is regulated by several pathways, including the vernalization pathway. Among the numerous genes known to enable flowering in response to vernalization, the most prominent is FLOWERING LOCUS C (FLC). FLC and other genes of the vernalization pathway vary extensively among natural populations and are thus candidates for the adaptation of flowering time to environmental gradients such as altitude. We used 15 natural Arabidopsis (Arabidopsis thaliana) genotypes originating from an altitudinal gradient (800-2,700 m above sea level) in the Swiss Alps to test whether flowering time correlated with altitude under different vernalization scenarios. Additionally, we measured the expression of 12 genes of the vernalization pathway and its downstream targets. Flowering time correlated with altitude in a nonlinear manner for vernalized plants. Flowering time could be explained by the expression and regulation of the vernalization pathway, most notably by AGAMOUS LIKE19 (AGL19), FLOWERING LOCUS T (FT), and FLC. The expression of AGL19, FT, and VERNALIZATION INSENSITIVE3 was associated with altitude, and the regulation of MADS AFFECTING FLOWERING2 (MAF2) and MAF3 differed between low- and high-altitude genotypes. In conclusion, we found clinal variation across an altitudinal gradient both in flowering time and the expression and regulation of genes in the flowering time control network, often independent of FLC, suggesting that the timing of flowering may contribute to altitudinal adaptation. PMID:25339407

  2. Sequence variation and differential splicing of the midgut cadherin gene in Trichoplusia ni.

    Science.gov (United States)

    Zhang, Xin; Kain, Wendy; Wang, Ping

    2013-08-01

    The insect midgut cadherin serves as an important receptor for the Cry toxins from Bacillus thuringiensis (Bt). Variation of the cadherin in insect populations provides a genetic potential for development of cadherin-based Bt resistance in insect populations. Sequence analysis of the cadherin from the cabbage looper, Trichoplusia ni, together with cadherins from 18 other lepidopterans showed a similar phylogenetic relationship of the cadherins to the phylogeny of Lepidoptera. The midgut cadherin in three laboratory populations of T. ni exhibited high variability, although the resistance to Bt toxin Cry1Ac in the T. ni strain is not genetically associated with cadherin gene mutations. A total of 142 single nucleotide polymorphisms (SNPs) were identified in the cadherin cDNAs from the T. ni strains, including 20 missense mutations. In addition, insertion and deletion polymorphisms (indels) were also identified in the cadherin alleles in T. ni. More interestingly, the results from this study reveal that differential splicing of mRNA also occurs in the cadherin gene expression. Therefore, variation of the midgut cadherin in insects may not only be caused by cadherin gene mutations, but could also result from alternative splicing of its mRNA regulated by factors acting in trans. Analysis of cadherin gene alleles in F2, F3 and F4 progenies from the cross between the Cry1Ac resistant and the susceptible strain after consecutive selections with Cry1Ac for three generations showed that selection with Cry1Ac did not result in an increase of frequencies of the cadherin alleles originated from the resistant strain. PMID:23743444

  3. Genetic Variation and Population Structure in Jamunapari Goats Using Microsatellites, Mitochondrial DNA, and Milk Protein Genes

    Directory of Open Access Journals (Sweden)

    P. K. Rout

    2012-01-01

    Full Text Available Jamunapari, a dairy goat breed of India, has been gradually declining in numbers in its home tract over the years. We have analysed genetic variation and population history in Jamunapari goats based on 17 microsatellite loci, 2 milk protein loci, mitochondrial hypervariable region I (HVRI sequencing, and three Y-chromosomal gene sequencing. We used the mitochondrial DNA (mtDNA mismatch distribution, microsatellite data, and bottleneck tests to infer the population history and demography. The mean number of alleles per locus was 9.0 indicating that the allelic variation was high in all the loci and the mean heterozygosity was 0.769 at nuclear loci. Although the population size is smaller than 8,000 individuals, the amount of variability both in terms of allelic richness and gene diversity was high in all the microsatellite loci except ILST 005. The gene diversity and effective number of alleles at milk protein loci were higher than the 10 other Indian goat breeds that they were compared to. Mismatch analysis was carried out and the analysis revealed that the population curve was unimodal indicating the expansion of population. The genetic diversity of Y-chromosome genes was low in the present study. The observed mean M ratio in the population was above the critical significance value (Mc and close to one indicating that it has maintained a slowly changing population size. The mode-shift test did not detect any distortion of allele frequency and the heterozygosity excess method showed that there was no significant departure from mutation-drift equilibrium detected in the population. However, the effects of genetic bottlenecks were observed in some loci due to decreased heterozygosity and lower level of M ratio. There were two observed genetic subdivisions in the population supporting the observations of farmers in different areas. This base line information on genetic diversity, bottleneck analysis, and mismatch analysis was obtained to assist the

  4. Clinal variation at phenology-related genes in spruce: parallel evolution in FTL2 and Gigantea?

    Science.gov (United States)

    Chen, Jun; Tsuda, Yoshiaki; Stocks, Michael; Källman, Thomas; Xu, Nannan; Kärkkäinen, Katri; Huotari, Tea; Semerikov, Vladimir L; Vendramin, Giovanni G; Lascoux, Martin

    2014-07-01

    Parallel clines in different species, or in different geographical regions of the same species, are an important source of information on the genetic basis of local adaptation. We recently detected latitudinal clines in SNPs frequencies and gene expression of candidate genes for growth cessation in Scandinavian populations of Norway spruce (Picea abies). Here we test whether the same clines are also present in Siberian spruce (P. obovata), a close relative of Norway spruce with a different Quaternary history. We sequenced nine candidate genes and 27 control loci and genotyped 14 SSR loci in six populations of P. obovata located along the Yenisei river from latitude 56°N to latitude 67°N. In contrast to Scandinavian Norway spruce that both departs from the standard neutral model (SNM) and shows a clear population structure, Siberian spruce populations along the Yenisei do not depart from the SNM and are genetically unstructured. Nonetheless, as in Norway spruce, growth cessation is significantly clinal. Polymorphisms in photoperiodic (FTL2) and circadian clock (Gigantea, GI, PRR3) genes also show significant clinal variation and/or evidence of local selection. In GI, one of the variants is the same as in Norway spruce. Finally, a strong cline in gene expression is observed for FTL2, but not for GI. These results, together with recent physiological studies, confirm the key role played by FTL2 and circadian clock genes in the control of growth cessation in spruce species and suggest the presence of parallel adaptation in these two species. PMID:24814465

  5. Molecular cloning and daily variations of the Period gene in a reef fish Siganus guttatus.

    Science.gov (United States)

    Park, Ji-Gweon; Park, Yong-Ju; Sugama, Nozomi; Kim, Se-Jae; Takemura, Akihiro

    2007-04-01

    As the first step in understanding the molecular oscillation of the circa rhythms in the golden rabbitfish Siganus guttatus--a reef fish with a definite lunar-related rhythmicity--we cloned and sequenced a Period gene (rfPer). The rfPer gene contained an open reading frame that encodes a protein consisting of 1,452 amino acids; this protein is highly homologous to PER proteins of vertebrates including zebrafish. Phylogenetic analyses indicated that the rfPER protein is related to the zebrafish PER1 and PER4. The expression of rfPer mRNA in the whole brain, retina, and liver under light/dark (LD) conditions increased at 06:00 h and decreased at 18:00 h, suggesting that its robust circadian rhythm occurs in neural and peripheral tissues. When daily variation in the expression in rfPer mRNA in the whole brain and cultured pineal gland were examined under LD conditions, similar expression patterns of the gene were observed with an increase around dawn. Under constant light condition, the increased expression of rfPer mRNA in the whole brain disappeared around dawn. The present results demonstrate that rfPer is related to zPer4 and possibly zPer1. The present study is the first report on the Period gene from a marine fish.

  6. MHC class II genes in the European badger (Meles meles) : characterization, patterns of variation, and transcription analysis

    NARCIS (Netherlands)

    Sin, Yung Wa; Dugdale, Hannah L.; Newman, Chris; Macdonald, David W.; Burke, Terry

    2012-01-01

    The major histocompatibility complex (MHC) comprises many genes, some of which are polymorphic with numerous alleles. Sequence variation among alleles is most pronounced in exon 2 of the class II genes, which encodes the alpha 1 and beta 1 domains that form the antigen-binding site (ABS) for the pre

  7. Genetic variation and population structure of interleukin genes among seven ethnic populations from Karnataka, India

    Indian Academy of Sciences (India)

    Srilakshmi M. Raj; Diddahally R. Govindaraju; Ranajit Chakraborty

    2007-12-01

    The extent of genetic variation and the degree of genetic differentiation among seven ethnic populations from Karnataka, India (Bunt, Havyak, Iyengar, Lingayath, Smartha, Vaishya, Vokkaliga), was investigated using four single nucleotide polymorphisms (SNPs: IL-1A 4845, IL-1B 3954, IL-1B 511 and IL-1RA 2018) of the interleukin gene cluster. Allele frequencies varied by threefold among these populations, which also differed for gene diversity and heterozygosity levels. The average degree of population subdivision among these castes was low ($F_{ST} = 0.02$). However, pair-wise interpopulation differentiation ranged from 0–7%, indicating no detectable differentiation to moderate differentiation between specific populations. The results of phylogenetic analysis based on genetic distances between populations agreed with known social and cultural data on these ethnic groups. Variation in the allele frequencies, as well as differentiation, may be attributed to differential selection and demographic factors including consanguinity among the ethnic groups. Information on the distribution of functionally relevant polymorphisms among ethnic populations may be important towards developing community medicine and public health policies.

  8. Variations of the perforin gene in patients with autoimmunity/lymphoproliferation and defective Fas function.

    Science.gov (United States)

    Clementi, Rita; Chiocchetti, Annalisa; Cappellano, Giuseppe; Cerutti, Elisa; Ferretti, Massimo; Orilieri, Elisabetta; Dianzani, Irma; Ferrarini, Marina; Bregni, Marco; Danesino, Cesare; Bozzi, Valeria; Putti, Maria Caterina; Cerutti, Franco; Cometa, Angela; Locatelli, Franco; Maccario, Rita; Ramenghi, Ugo; Dianzani, Umberto

    2006-11-01

    Mutations decreasing function of the Fas death receptor cause the autoimmune lymphoproliferative syndrome (ALPS) with autoimmune manifestations, spleen/lymph node enlargement, and expansion of CD4/CD8-negative T cells. Dianzani Autoimmune Lymphoproliferative Disease (DALD) is a variant lacking this expansion. Perforin is involved in cell-mediated cytotoxicity and its biallelic mutations cause familial hemophagocytic lymphohistiocytosis (HLH). We previously described an ALPS patient carrying heterozygous mutations of the Fas and perforin genes and suggested that they concurred in ALPS. This work extends the analysis to 14 ALPS, 28 DALD, and 816 controls, and detects an N252S amino acid substitution in 2 ALPS, and an A91V amino acid substitution in 6 DALD. N252S conferred an OR = 62.7 (P = .0016) for ALPS and A91V conferred an OR = 3 (P = .016) for DALD. Copresence of A91V and variations of the osteopontin gene previously associated with DALD conferred an OR = 17 (P = .0007) for DALD. In one N252S patient, NK activity was strikingly defective in early childhood, but became normal in late childhood. A91V patients displayed lower NK activity than controls. These data suggest that perforin variations are a susceptibility factor for ALPS/DALD development in subjects with defective Fas function and may influence disease expression. PMID:16720836

  9. Nucleotide variation at the dopa decarboxylase (Ddc) gene in natural populations of Drosophila melanogaster

    Indian Academy of Sciences (India)

    Andrey Tatarenkov; Francisco J. Ayala

    2007-08-01

    We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in strong positive association, whereas a large number of sites in the Raleigh population are associated nonrandomly but the association is not strong. Linkage disequilibrium analysis shows presence of two groups of haplotypes in the populations, each of which is fairly diverged, suggesting epistasis or inversion polymorphism. There is evidence of two forms of natural selection acting on Ddc. The McDonald–Kreitman test indicates a deficit of fixed amino acid differences between D. melanogaster and D. simulans, which may be due to negative selection. An excess of derived alleles at high frequency, significant according to the -test, is consistent with the effect of hitchhiking. The hitchhiking may have been caused by directional selection downstream of the locus studied, as suggested by a gradual decrease of the polymorphism-to-divergence ratio. Altogether, the Ddc locus exhibits a complicated pattern of variation apparently due to several evolutionary forces. Such a complex pattern may be a result of an unusually high density of functionally important genes.

  10. Allelic variation of bile salt hydrolase genes in Lactobacillus salivarius does not determine bile resistance levels.

    LENUS (Irish Health Repository)

    Fang, Fang

    2009-09-01

    Commensal lactobacilli frequently produce bile salt hydrolase (Bsh) enzymes whose roles in intestinal survival are unclear. Twenty-six Lactobacillus salivarius strains from different sources all harbored a bsh1 allele on their respective megaplasmids. This allele was related to the plasmid-borne bsh1 gene of the probiotic strain UCC118. A second locus (bsh2) was found in the chromosomes of two strains that had higher bile resistance levels. Four Bsh1-encoding allele groups were identified, defined by truncations or deletions involving a conserved residue. In vitro analyses showed that this allelic variation was correlated with widely varying bile deconjugation phenotypes. Despite very low activity of the UCC118 Bsh1 enzyme, a mutant lacking this protein had significantly lower bile resistance, both in vitro and during intestinal transit in mice. However, the overall bile resistance phenotype of this and other strains was independent of the bsh1 allele type. Analysis of the L. salivarius transcriptome upon exposure to bile and cholate identified a multiplicity of stress response proteins and putative efflux proteins that appear to broadly compensate for, or mask, the effects of allelic variation of bsh genes. Bsh enzymes with different bile-degrading kinetics, though apparently not the primary determinants of bile resistance in L. salivarius, may have additional biological importance because of varying effects upon bile as a signaling molecule in the host.

  11. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    Science.gov (United States)

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P.; Lawrenson, Kate; Dennis, Joe; Amankwah, Ernest K.; Qu, Xiaotao; Tsai, Ya-Yu; Jim, Heather S. L.; Chen, Zhihua; Chen, Ann Y.; Permuth-Wey, Jennifer; Aben, Katja KH.; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V.; Bean, Yukie T.; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bunker, Clareann H.; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Dicks, Ed; Doherty, Jennifer A.; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F.; Eccles, Diana M.; Edwards, Robert P.; Ekici, Arif B.; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goodman, Marc T.; Gronwald, Jacek; Harrington, Patricia; Harter, Philipp; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A. T.; Hillemanns, Peter; Hogdall, Claus K.; Hogdall, Estrid; Hosono, Satoyo; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y.; Kelemen, Linda E.; Kellar, Mellissa; Kiemeney, Lambertus A.; Krakstad, Camilla; Kjaer, Susanne K.; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F. A. G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; McNeish, Iain; Menon, Usha; Milne, Roger L.; Modugno, Francesmary; Moysich, Kirsten B.; Ness, Roberta B.; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste L.; Pejovic, Tanja; Pelttari, Liisa M.; Pike, Malcolm C.; Poole, Elizabeth M.; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schernhammer, Eva; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B.; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C.; Spiewankiewicz, Beata; Sucheston, Lara; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Thomsen, Lotte; Tangen, Ingvild L.; Tworoger, Shelley S.; van Altena, Anne M.; Vierkant, Robert A.; Vergote, Ignace; Walsh, Christine S.; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Wu, Anna H.; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Hasmad, Hanis N.; Berchuck, Andrew; Iversen, Edwin S.; Schildkraut, Joellen M.; Ramus, Susan J.; Goode, Ellen L.; Monteiro, Alvaro N. A.; Gayther, Simon A.; Narod, Steven A.; Pharoah, Paul D. P.; Sellers, Thomas A.; Phelan, Catherine M.

    2015-01-01

    Background Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. Methods In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC). Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS). SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons. Results The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020); this SNP was also associated with the borderline/low malignant potential (LMP) tumors (P = 0.021). Other genes significantly associated with EOC histological subtypes (p<0.05) included the UGT1A (endometrioid), SLC25A45 (mucinous), SLC39A11 (low malignant potential), and SERPINA7 (clear cell carcinoma). In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A) were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). Conclusion These results, generated on a large cohort of women, revealed associations

  12. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC Risk.

    Directory of Open Access Journals (Sweden)

    Ganna Chornokur

    Full Text Available Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC, we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk.In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC. Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS. SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons.The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020; this SNP was also associated with the borderline/low malignant potential (LMP tumors (P = 0.021. Other genes significantly associated with EOC histological subtypes (p<0.05 included the UGT1A (endometrioid, SLC25A45 (mucinous, SLC39A11 (low malignant potential, and SERPINA7 (clear cell carcinoma. In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4.These results, generated on a large cohort of women, revealed associations between inherited cellular

  13. Variation in the autism candidate gene GABRB3 modulates tactile sensitivity in typically developing children

    Directory of Open Access Journals (Sweden)

    Tavassoli Teresa

    2012-07-01

    Full Text Available Abstract Background Autism spectrum conditions have a strong genetic component. Atypical sensory sensitivities are one of the core but neglected features of autism spectrum conditions. GABRB3 is a well-characterised candidate gene for autism spectrum conditions. In mice, heterozygous Gabrb3 deletion is associated with increased tactile sensitivity. However, no study has examined if tactile sensitivity is associated with GABRB3 genetic variation in humans. To test this, we conducted two pilot genetic association studies in the general population, analysing two phenotypic measures of tactile sensitivity (a parent-report and a behavioural measure for association with 43 SNPs in GABRB3. Findings Across both tactile sensitivity measures, three SNPs (rs11636966, rs8023959 and rs2162241 were nominally associated with both phenotypes, providing a measure of internal validation. Parent-report scores were nominally associated with six SNPs (P Conclusions This is the first human study to show an association between GABRB3 variation and tactile sensitivity. This provides support for the evidence from animal models implicating the role of GABRB3 variation in the atypical sensory sensitivity in autism spectrum conditions. Future research is underway to directly test this association in cases of autism spectrum conditions.

  14. Identification of additive, dominant, and epistatic variation conferred by key genes in cellulose biosynthesis pathway in Populus tomentosa

    OpenAIRE

    Du, Qingzhang; Tian, Jiaxing; Yang, Xiaohui; Pan, Wei; Xu, Baohua; Li, Bailian; Pär K Ingvarsson; Zhang, Deqiang

    2015-01-01

    Economically important traits in many species generally show polygenic, quantitative inheritance. The components of genetic variation (additive, dominant and epistatic effects) of these traits conferred by multiple genes in shared biological pathways remain to be defined. Here, we investigated 11 full-length genes in cellulose biosynthesis, on 10 growth and wood-property traits, within a population of 460 unrelated Populus tomentosa individuals, via multi-gene association. To validate positiv...

  15. SNP variation in ADRB3 gene reflects the breed difference of sheep populations.

    Science.gov (United States)

    Wu, Jianliang; Qiao, Liying; Liu, Jianhua; Yuan, Yanan; Liu, Wenzhong

    2012-08-01

    The β3-adrenergic receptor (ADRB3), a G-protein coupled receptor, plays a major role in energy metabolism and regulation of lipolysis and homeostasis. We detect the single nucleotide polymorphism (SNP) variation in full-length sequence of ovine ADRB3 gene in 12 domestic sheep populations within four types by polymerase chain reaction-single strand conformation polymorphism and sequencing to reveal the breed difference. Twenty-two SNPs, 12 of which in the exon 1 and ten in the intron, were detected, and 12 new exonic and four new intronic SNPs were found. Most SNPs presented in Shanxi Dam Line and least ones in Dorset. The average SNP number in both meat and dual purpose for meat and wool breeds was significantly higher than general and dual purpose breeds for wool and meat. Frequency of each SNP in studied breeds or types was different. The 18C Del and 1617T Ins majorly existed in dual purpose breeds for wool and meat. The 25A Del, 119C>G and 130C>T were mostly found in the meat and dual purpose for meat and wool breeds. The 1764C>A more frequently presented in meat than in other types. The majority of variations came from within the populations as suggested by analysis of molecular variance. Close relationship presented among the Chinese and western breeds, respectively. In conclusion, SNPs of ovine ADRB3 gene can reflect the breed difference and within- and between-population variations, and to a great extent, the breed relationship. PMID:22711302

  16. Stage-specific effects of candidate heterochronic genes on variation in developmental time along an altitudinal cline of Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Julián Mensch

    Full Text Available BACKGROUND: Previously, we have shown there is clinal variation for egg-to-adult developmental time along geographic gradients in Drosophila melanogaster. Further, we also have identified mutations in genes involved in metabolic and neurogenic pathways that affect development time (heterochronic genes. However, we do not know whether these loci affect variation in developmental time in natural populations. METHODOLOGY/PRINCIPAL FINDINGS: Here, we constructed second chromosome substitution lines from natural populations of Drosophila melanogaster from an altitudinal cline, and measured egg-adult development time for each line. We found not only a large amount of genetic variation for developmental time, but also positive associations of the development time with thermal amplitude and altitude. We performed genetic complementation tests using substitution lines with the longest and shortest developmental times and heterochronic mutations. We identified segregating variation for neurogenic and metabolic genes that largely affected the duration of the larval stages but had no impact on the timing of metamorphosis. CONCLUSIONS/SIGNIFICANCE: Altitudinal clinal variation in developmental time for natural chromosome substitution lines provides a unique opportunity to dissect the response of heterochronic genes to environmental gradients. Ontogenetic stage-specific variation in invected, mastermind, cricklet and CG14591 may affect natural variation in development time and thermal evolution.

  17. Genetic Variation Analyses of nsp2 Gene of PRRSV in Ningxia Hui Autonomous Region of China

    Institute of Scientific and Technical Information of China (English)

    Hong TIAN; Jing-yan WU; Shuang-hui YIN; You-jun SHANG; Zi-ping MAN; Na ZHAO; Ye JIN; Xiang-tao LIU

    2009-01-01

    To gain a better understanding of the genetic diversity and evolution of PRRSV in the Ningxia Hui Nationality Autonomous Region (Ningxia) of China, the nsp2 genes from a series of PRRSV strains collected from the region in 2007 were partially sequenced. These sequences were then analyzed along with the classical strain (ch-la) and two other epidemic strains SD (3) and SD2006. Comparison of the nucleotide sequence with ch-la indicated that nsp2 genes of seventeen Ningxia isolates (NX strain) have deletions of 87 nucleotides. Sequence analysis indicated that homology between the Ningxia strain and ch-la was 60.3%-79.9% in the nucleotide sequence, and homology between the NX strains and SD strains was 80.3%-98.8% in the nucleotide sequence. The nsp2 genes of the seventeen isolates had 74.9%-100% nucleotide sequence identities with each other. This study was undertaken to assess the regional variation of prevalent PRRSV and to establish a sequence database for PRRSV molecular epidemiological studies.

  18. Adaptive variation in beach mice produced by two interacting pigmentation genes.

    Directory of Open Access Journals (Sweden)

    Cynthia C Steiner

    2007-09-01

    Full Text Available Little is known about the genetic basis of ecologically important morphological variation such as the diverse color patterns of mammals. Here we identify genetic changes contributing to an adaptive difference in color pattern between two subspecies of oldfield mice (Peromyscus polionotus. One mainland subspecies has a cryptic dark brown dorsal coat, while a younger beach-dwelling subspecies has a lighter coat produced by natural selection for camouflage on pale coastal sand dunes. Using genome-wide linkage mapping, we identified three chromosomal regions (two of major and one of minor effect associated with differences in pigmentation traits. Two candidate genes, the melanocortin-1 receptor (Mc1r and its antagonist, the Agouti signaling protein (Agouti, map to independent regions that together are responsible for most of the difference in pigmentation between subspecies. A derived mutation in the coding region of Mc1r, rather than change in its expression level, contributes to light pigmentation. Conversely, beach mice have a derived increase in Agouti mRNA expression but no changes in protein sequence. These two genes also interact epistatically: the phenotypic effects of Mc1r are visible only in genetic backgrounds containing the derived Agouti allele. These results demonstrate that cryptic coloration can be based largely on a few interacting genes of major effect.

  19. A Molecular Epidemiology Analysis of HIV in Shenzhen and HIV Env Gene Variation Replication Analysis

    Institute of Scientific and Technical Information of China (English)

    CHEN Lin(陈琳); FENG Tiejian(冯铁建); LI Liangcheng(李良成); HE Jianfan(何建凡)

    2002-01-01

    Objective: To analyze molecular trends of the HIV epidemic in Shenzhen.Methods: Serum collected from Shenzhen AIDS patientsbetween 1992-1999 was analyzed using molecular techniques.DNA fragments of the HIV-1 Env gene were amplified bynested PCR from uncultured peripheral blood mononuclearcells (PBMCs) from these serum samples. The C2-C3 region ofthe Env gene was sequenced and analyzed. Specific high-riskbehaviors were also analyzed.Results: We found that the transmission of HIV in the citywas mainly through sexual behaviors (46.0%). There werefour HIV-1 subtypes: B', B, C and E with 6.31%, 7.95%,3.09% and 8.92% gene divergence inside each subtype inShenzhen. These results suggested that epidemic times were 6,8, 3 and 9 respectively. The main epidemic subtypes were Eand B strains. AIDS patient's antigenic variation was slightlyhigher than that of HIV infected individuals.Conclusion: Surveillance data reflect trends and theepidemic time of HIV, which will be useful for policy makersto formulate effective strategies of HIV/AIDS prevention andcontrol in Shenzhen.

  20. Molecular variation at a candidate gene implicated in the regulation of fire ant social behavior.

    Directory of Open Access Journals (Sweden)

    Dietrich Gotzek

    Full Text Available The fire ant Solenopsis invicta and its close relatives display an important social polymorphism involving differences in colony queen number. Colonies are headed by either a single reproductive queen (monogyne form or multiple queens (polygyne form. This variation in social organization is associated with variation at the gene Gp-9, with monogyne colonies harboring only B-like allelic variants and polygyne colonies always containing b-like variants as well. We describe naturally occurring variation at Gp-9 in fire ants based on 185 full-length sequences, 136 of which were obtained from S. invicta collected over much of its native range. While there is little overall differentiation between most of the numerous alleles observed, a surprising amount is found in the coding regions of the gene, with such substitutions usually causing amino acid replacements. This elevated coding-region variation may result from a lack of negative selection acting to constrain amino acid replacements over much of the protein, different mutation rates or biases in coding and non-coding sequences, negative selection acting with greater strength on non-coding than coding regions, and/or positive selection acting on the protein. Formal selection analyses provide evidence that the latter force played an important role in the basal b-like lineages coincident with the emergence of polygyny. While our data set reveals considerable paraphyly and polyphyly of S. invicta sequences with respect to those of other fire ant species, the b-like alleles of the socially polymorphic species are monophyletic. An expanded analysis of colonies containing alleles of this clade confirmed the invariant link between their presence and expression of polygyny. Finally, our discovery of several unique alleles bearing various combinations of b-like and B-like codons allows us to conclude that no single b-like residue is completely predictive of polygyne behavior and, thus, potentially causally

  1. Genomic variation in the vomeronasal receptor gene repertoires of inbred mice

    Directory of Open Access Journals (Sweden)

    Wynn Elizabeth H

    2012-08-01

    Full Text Available Abstract Background Vomeronasal receptors (VRs, expressed in sensory neurons of the vomeronasal organ, are thought to bind pheromones and mediate innate behaviours. The mouse reference genome has over 360 functional VRs arranged in highly homologous clusters, but the vast majority are of unknown function. Differences in these receptors within and between closely related species of mice are likely to underpin a range of behavioural responses. To investigate these differences, we interrogated the VR gene repertoire from 17 inbred strains of mice using massively parallel sequencing. Results Approximately half of the 6222 VR genes that we investigated could be successfully resolved, and those that were unambiguously mapped resulted in an extremely accurate dataset. Collectively VRs have over twice the coding sequence variation of the genome average; but we identify striking non-random distribution of these variants within and between genes, clusters, clades and functional classes of VRs. We show that functional VR gene repertoires differ considerably between different Mus subspecies and species, suggesting these receptors may play a role in mediating behavioural adaptations. Finally, we provide evidence that widely-used, highly inbred laboratory-derived strains have a greatly reduced, but not entirely redundant capacity for differential pheromone-mediated behaviours. Conclusions Together our results suggest that the unusually variable VR repertoires of mice have a significant role in encoding differences in olfactory-mediated responses and behaviours. Our dataset has expanded over nine fold the known number of mouse VR alleles, and will enable mechanistic analyses into the genetics of innate behavioural differences in mice.

  2. Variation in fibrinogen FGG and FGA genes and risk of stroke: the Rotterdam Study.

    Science.gov (United States)

    Cheung, Elim Y L; Bos, Michiel J; Leebeek, Frank W G; Koudstaal, Peter J; Hofman, Albert; de Maat, Moniek P M; Breteler, Monique M B

    2008-08-01

    Haplotypes of the fibrinogen gamma and alpha (FGG and FGA) genes are associated with the structure of the fibrin network and may therefore influence the risk of stroke. We investigated the relationship between common variation in these genes with ischemic and haemorrhagic stroke. The study was based on 6,275 participants of the prospective population-based Rotterdam Study who at baseline (1990-1993) were aged 55 years or over, free from stroke, and had successful assessment of at least one FGG or FGA single nucleotide polymorphisms (SNP). Common haplotypes were estimated using seven tagging SNPs across a 30 kb region containing the FGG and FGA genes. Follow-up for incident stroke was complete until January 1, 2005. Associations between constructed haplotypes and risk of stroke were estimated with an age- and sex-adjusted logistic regression model. We observed 668 strokes, of which 393 were ischemic and 62 haemorrhagic, during a median follow-up time of 10.1 years. FGG + FGA haplotype 3 (H3) was associated with an increased risk of ischemic stroke (odds ratio [OR] 1.36, 95% confidence interval [CI] 1.09-1.69) and the risk estimate for hemorrhagic stroke was 0.71 (95% CI 0.46-1.09) compared to the most frequent H1. The FGG and FGA genes were not associated with stroke or its subtypes when analyzed separately. In conclusion, risk of ischemic stroke was higher in FGG + FGA H3 than in H1. The results suggested that an opposite association may exist for haemorrhagic stroke.

  3. Telomere length and variation in telomere biology genes in individuals with osteosarcoma.

    Science.gov (United States)

    Mirabello, Lisa; Richards, Elliott G; Duong, Linh M; Yu, Kai; Wang, Zhaoming; Cawthon, Richard; Berndt, Sonja I; Burdett, Laurie; Chowdhury, Salma; Teshome, Kedest; Douglass, Chester; Savage, Sharon A

    2011-01-01

    Osteosarcoma, the most common primary bone tumor, occurs most frequently in adolescents. Chromosomal aneuploidy is common in osteosarcoma cells, suggesting underlying chromosomal instability. Telomeres, located at chromosome ends, are essential for genomic stability; several studies have suggested that germline telomere length (TL) is associated with cancer risk. We hypothesized that TL and/or common genetic variation in telomere biology genes may be associated with risk of osteosarcoma. We investigated TL in peripheral blood DNA and 713 single nucleotide polymorphisms (SNPs) from 39 telomere biology genes in 98 osteosarcoma cases and 69 orthopedic controls. For the genotyping component, we added 1363 controls from the Prostate, Lung, Colorectal, and Ovarian Cancer ScreeningTrial. Short TL was not associated with osteosarcoma risk overall (OR 1.39, P=0.67), although there was a statistically significant association in females (OR 4.35, 95% Cl 1.20-15.74, P=0.03). Genotype analyses identified seven SNPs in TERF1 significantly associated with osteosarcoma risk after Bonferroni correction by gene. These SNPs were highly linked and associated with a reduced risk of osteosarcoma (OR 0.48-0.53, P=0.0001-0.0006). We also investigated associations between TL and telomere gene SNPs in osteosarcoma cases and orthopedic controls. Several SNPs were associated with TL prior to Bonferroni correction; one SNP in NOLA2 and one in MEN1 were marginally non-significant after correction (P(adj)=0.057 and 0.066, respectively). This pilot-study suggests that females with short telomeres may be at increased risk of osteosarcoma, and that SNPs in TERF1 are inversely associated with osteosarcoma risk.

  4. Genetic variation at hair length candidate genes in elephants and the extinct woolly mammoth

    Directory of Open Access Journals (Sweden)

    Tisdale Michele

    2009-09-01

    Full Text Available Abstract Background Like humans, the living elephants are unusual among mammals in being sparsely covered with hair. Relative to extant elephants, the extinct woolly mammoth, Mammuthus primigenius, had a dense hair cover and extremely long hair, which likely were adaptations to its subarctic habitat. The fibroblast growth factor 5 (FGF5 gene affects hair length in a diverse set of mammalian species. Mutations in FGF5 lead to recessive long hair phenotypes in mice, dogs, and cats; and the gene has been implicated in hair length variation in rabbits. Thus, FGF5 represents a leading candidate gene for the phenotypic differences in hair length notable between extant elephants and the woolly mammoth. We therefore sequenced the three exons (except for the 3' UTR and a portion of the promoter of FGF5 from the living elephantid species (Asian, African savanna and African forest elephants and, using protocols for ancient DNA, from a woolly mammoth. Results Between the extant elephants and the mammoth, two single base substitutions were observed in FGF5, neither of which alters the amino acid sequence. Modeling of the protein structure suggests that the elephantid proteins fold similarly to the human FGF5 protein. Bioinformatics analyses and DNA sequencing of another locus that has been implicated in hair cover in humans, type I hair keratin pseudogene (KRTHAP1, also yielded negative results. Interestingly, KRTHAP1 is a pseudogene in elephantids as in humans (although fully functional in non-human primates. Conclusion The data suggest that the coding sequence of the FGF5 gene is not the critical determinant of hair length differences among elephantids. The results are discussed in the context of hairlessness among mammals and in terms of the potential impact of large body size, subarctic conditions, and an aquatic ancestor on hair cover in the Proboscidea.

  5. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  6. Novel sequence variations in LAMA2 and SGCG genes modulating cis-acting regulatory elements and RNA secondary structure

    Directory of Open Access Journals (Sweden)

    Olfa Siala

    2010-01-01

    Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.

  7. Considerations in the construction of an instrument to assess attitudes regarding critical illness gene variation research.

    Science.gov (United States)

    Freeman, Bradley D; Kennedy, Carie R; Bolcic-Jankovic, Dragana; Eastman, Alexander; Iverson, Ellen; Shehane, Erica; Celious, Aaron; Barillas, Jennifer; Clarridge, Brian

    2012-02-01

    Clinical studies conducted in intensive care units are associated with logistical and ethical challenges. Diseases investigated are precipitous and life-threatening, care is highly technological, and patients are often incapacitated and decision-making is provided by surrogates. These investigations increasingly involve collection of genetic data. The manner in which the exigencies of critical illness impact attitudes regarding genetic data collection is unstudied. Given interest in understanding stakeholder preferences as a foundation for the ethical conduct of research, filling this knowledge gap is timely. The conduct of opinion research in the critical care arena is novel. This brief report describes the development of parallel patient/surrogate decision-maker quantitative survey instruments for use in this environment. Future research employing this instrument or a variant of it with diverse populations promises to inform research practices in critical illness gene variation research. PMID:22378135

  8. Association of Variation in the MC4R Gene with Meat Quality Traits in a Commercial Pig Population

    OpenAIRE

    Kwon, Kang; Cahyadi, Muhammad; Park, Hee–Bok; Seo, Dong Won; Jin, Shil; Kim, Sang–Wook; Choi, Yang–Il; Kim, Kwan Suk; Gotoh, Takafumi; Goto, Takafumi; Lee, Jun Heon

    2015-01-01

    The melanocortin–4 receptor (MC4R) gene is known to encode a membrane–bound receptor protein and is a member of the melanocortin receptor family of genes. In mammals, these genes are involved in energy homeostasis and in regulating feeding behavior and body weight. The objective of the present study was to examine if there were any associations between variations in the MC4R gene with meat quality traits in a commercial pig population in Korea. Among the total of 593 commercial pigs, sire inf...

  9. The architecture of gene regulatory variation across multiple human tissues: the MuTHER study.

    Directory of Open Access Journals (Sweden)

    Alexandra C Nica

    Full Text Available While there have been studies exploring regulatory variation in one or more tissues, the complexity of tissue-specificity in multiple primary tissues is not yet well understood. We explore in depth the role of cis-regulatory variation in three human tissues: lymphoblastoid cell lines (LCL, skin, and fat. The samples (156 LCL, 160 skin, 166 fat were derived simultaneously from a subset of well-phenotyped healthy female twins of the MuTHER resource. We discover an abundance of cis-eQTLs in each tissue similar to previous estimates (858 or 4.7% of genes. In addition, we apply factor analysis (FA to remove effects of latent variables, thus more than doubling the number of our discoveries (1,822 eQTL genes. The unique study design (Matched Co-Twin Analysis--MCTA permits immediate replication of eQTLs using co-twins (93%-98% and validation of the considerable gain in eQTL discovery after FA correction. We highlight the challenges of comparing eQTLs between tissues. After verifying previous significance threshold-based estimates of tissue-specificity, we show their limitations given their dependency on statistical power. We propose that continuous estimates of the proportion of tissue-shared signals and direct comparison of the magnitude of effect on the fold change in expression are essential properties that jointly provide a biologically realistic view of tissue-specificity. Under this framework we demonstrate that 30% of eQTLs are shared among the three tissues studied, while another 29% appear exclusively tissue-specific. However, even among the shared eQTLs, a substantial proportion (10%-20% have significant differences in the magnitude of fold change between genotypic classes across tissues. Our results underline the need to account for the complexity of eQTL tissue-specificity in an effort to assess consequences of such variants for complex traits.

  10. Variation at genes influencing facial morphology are not associated with developmental imprecision in human faces.

    Directory of Open Access Journals (Sweden)

    Sonja Windhager

    Full Text Available Facial asymmetries are commonly used as a proxy for human developmental imprecision resulting from inbreeding, and thus reduced genetic heterozygosity. Several environmental factors influence human facial asymmetry (e.g., health care, parasites, but the generalizability of findings on genetic stressors has been limited in humans by sample characteristics (island populations, endogamy and indirect genetic assessment (inference from pedigrees. In a sample of 3215 adult humans from the Rotterdam Study, we therefore studied the relationship of facial asymmetry, estimated from nine mid-facial landmarks, with genetic variation at 102 single nucleotide polymorphism (SNP loci recently associated with facial shape variation. We further tested whether the degree of individual heterozygosity is negatively correlated with facial asymmetry. An ANOVA tree regression did not identify any SNP relating to either fluctuating asymmetry or total asymmetry. In a general linear model, only age and sex--but neither heterozygosity nor any SNP previously reported to covary with facial shape--was significantly related to total or fluctuating asymmetry of the midface. Our study does not corroborate the common assumption in evolutionary and behavioral biology that morphological asymmetries reflect heterozygosity. Our results, however, may be affected by a relatively small degree of inbreeding, a relatively stable environment, and an advanced age in the Rotterdam sample. Further large-scale genetic studies, including gene expression studies, are necessary to validate the genetic and developmental origin of morphological asymmetries.

  11. Intra-retinal variation of opsin gene expression in the guppy (Poecilia reticulata).

    Science.gov (United States)

    Rennison, Diana J; Owens, Gregory L; Allison, W Ted; Taylor, John S

    2011-10-01

    Although behavioural experiments demonstrate that colouration influences mate choice in many species, a complete understanding of this form of signalling requires information about colour vision in the species under investigation. The guppy (Poecilia reticulata) has become a model species for the study of colour-based sexual selection. To investigate the role of opsin gene duplication and divergence in the evolution of colour-based mate choice, we used in situ hybridization to determine where the guppy's nine cone opsins are expressed in the retina. Long wavelength-sensitive (LWS) opsins were more abundant in the dorsal retina than in the ventral retina. One of the middle wavelength-sensitive opsins (RH2-1) exhibited the opposite pattern, while the other middle wavelength-sensitive opsin (RH2-2) and the short wavelength-sensitive opsins (SWS1, SWS2A and SWS2B) were expressed throughout the retina. We also found variation in LWS opsin expression among individuals. These observations suggest that regions of the guppy retina are specialized with respect to wavelength discrimination and/or sensitivity. Intra-retinal variability in opsin expression, which has been observed in several fish species, might be an adaptation to variation in the strength and spectral composition of light entering the eye from above and below. The discovery that opsin expression varies in the guppy retina may motivate new behavioural experiments designed to study its role in mate choice.

  12. Genetic variations in the KIR gene family may contribute to susceptibility to ankylosing spondylitis: a meta-analysis.

    Science.gov (United States)

    Zuo, Hai-Ning; Wang, Zhi-Long; Cui, Dao-Ran; Xin, Da-Jiang

    2014-08-01

    The present meta-analysis of relevant case-control studies was conducted to investigate the possible relationships between genetic variations in the killer cell immunoglobulin-like receptor (KIR) gene clusters of the human KIR gene family and susceptibility to ankylosing spondylitis (AS). The following electronic databases were searched for relevant articles without language restrictions: the Web of Science, the Cochrane Library Database, PubMed, EMBASE, CINAHL, the Chinese Biomedical Database (CBM) and Chinese National Knowledge Infrastructure (CNKI) databases, covering all papers published until 2013. STATA statistical software was adopted in this meta-analysis as well. We also calculated the crude odds ratios (OR) and its 95% confidence intervals (95 % CI). Seven case-control studies with 1,004 patients diagnosed with AS and 2,138 healthy cases were implicated in our meta-analysis, and 15 genes in the KIR gene family were also evaluated. The results of our meta-analysis show statistical significance between the genetic variations in the KIR2DL1, KIR2DS4, KIR2DS5 and KIR3DS1 genes and an increased susceptibility to AS (KIR2DL1: OR 7.82, 95% CI 3.87-15.81, P0.05). The current meta-analysis provides reliable evidence that genetic variations in the KIR gene family may contribute to susceptibility to AS, especially for the KIR2DL1, KIR2DS4, KIR2DS5 and KIR3DS1 genes.

  13. Evidence that Natural Selection is the Primary Cause of the Guanine-cytosine Content Variation in Rice Genes

    Institute of Scientific and Technical Information of China (English)

    Xiaoli Shi; Xiyin Wang; Zhe Li; Qihui Zhu; Ji Yang; Song Ge; Jingchu Luo

    2007-01-01

    Cereal genes are classified into two distinct classes according to the guanine-cytosine (GC) content at the third codon sites (GC3). Natural selection and mutation bias have been proposed to affect the GC content. However, there has been controversy about the cause of GC variation. Here, we characterized the GC content of 1 092 paralogs and other single-copy genes in the duplicated chromosomal regions of the rice genome (ssp. indica) and classified the paralogs into GC3-rich and GC3-poor groups. By referring to out-group sequences from Arabidopsis and maize, we confirmed that the average synonymous substitution rate of the GC3-rich genes is significantly lower than that of the GC3-poor genes. Furthermore,we explored the other possible factors corresponding to the GC variation including the length of coding sequences, the number of exons in each gene, the number of genes in each family, the location of genes on chromosomes and the protein functions. Consequently, we propose that natural selection rather than mutation bias was the primary cause of the GC variation.

  14. Effects of common germ-line genetic variation in cell cycle genes on ovarian cancer survival

    DEFF Research Database (Denmark)

    Song, H.; Hogdall, E.; Ramus, S.J.;

    2008-01-01

    plausibly influence clinical characteristics of multiple tumors types. EXPERIMENTAL DESIGN: We examined associations between common germ-line genetic variation in 14 genes involved in cell cycle pathway (CCND1, CCND2, CCND3, CCNE1, CDKN1A, CDKN1B, CDKN2A, CDKN2B, CDKN2C, CDKN2D, CDK2, CDK4, CDK6, and RB1.......05) in these genes. The genotypes of each polymorphism were tested for association with survival by Cox regression analysis. RESULTS: A nominally statistically significant association between genotype and ovarian cancer survival was observed for polymorphisms in CCND2 and CCNE1. The per-allele hazard ratios (95......% confidence intervals) were 1.16 (1.03-1.31; P = 0.02) for rs3217933, 1.14 (1.02-1.27; P = 0.024) for rs3217901, and 0.85 (0.73-1.00; P = 0.043) for rs3217862 in CCND2 and 1.39 (1.04-1.85; P = 0.033) for rs3218038 in CCNE1. However, these were not significant after adjusting for multiple hypothesis tests...

  15. The association between ace gene variation and aerobic capacity in winter endurance disciplines.

    Science.gov (United States)

    Orysiak, J; Zmijewski, P; Klusiewicz, A; Kaliszewski, P; Malczewska-Lenczowska, J; Gajewski, J; Pokrywka, A

    2013-12-01

    The aim of the study was to examine the possible relationship between I/D polymorphism of ACE gene and selected indices of aerobic capacity among male and female athletes practising winter endurance sports. Sixty-six well-trained athletes (female n = 26, male n = 40), aged 18.4 ± 2.8 years, representing winter endurance sports (cross-country skiing, n = 48; biathlon, n = 8; Nordic combined, n = 10) participated in the study. Genotyping for ACE I/D polymorphism was performed using polymerase chain reaction. Maximal oxygen consumption (VO2max), maximal running velocity (Vmax) and running velocity at anaerobic threshold (VAT4) were determined in an incremental test to volitional exhaustion on a motorized treadmill. The ACE genotype had no significant effect on absolute VO2max, relative VO2max (divided by body mass or fat free body mass), VAT4 or Vmax. No interaction effect of gender x ACE genotype was found for each of the examined aerobic capacity indices. ACE gene variation was not found to be a determinant of aerobic capacity in either female or male Polish, well-trained endurance athletes participating in winter sports.

  16. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    Directory of Open Access Journals (Sweden)

    DWINITA WIKAN UTAMI

    2011-09-01

    Full Text Available Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufipogon and CT13432 crossing. DNA of five rice lines were amplified using the spesific primer for Pi33, G1010. Amplification results purified through Exonuclease 1 and Shrimp Alkaline Phosphatase protocols. Labelling using fluorescent dyes done before sequencing nucleotide base using CEQ8000 instrument. The results showed that lines number 28 showed introgesion of the three control parent genome (subspecies of Indica, subspecies of Japonica, and O. rufipogon while the Lines number 79, 136, and 143 were identical to Indica genome. Strain number 195 was identical to Japonica genome. These broad genetic background lines promise as durable performance to attack the expansion of the dynamic nature of the pathogen to blast. The result of ortholog sequence analysis found conserved nucleotide base sequence (CAGCAGCC which involved in heterotrimeric G-protein group. This protein has role as plant receptor for recognizing pathogen elicitor in interaction of rice and blast pathogen.

  17. Capturing sequence variation among flowering-time regulatory gene homologues in the allopolyploid crop species Brassica napus

    Directory of Open Access Journals (Sweden)

    Sarah eSchiessl

    2014-08-01

    Full Text Available Flowering, the transition from the vegetative to the generative phase, is a decisive time point in the lifecycle of a plant. Flowering is controlled by a complex network of transcription factors, photoreceptors, enzymes and miRNAs. In recent years, several studies gave rise to the hypothesis that this network is also strongly involved in the regulation of other important lifecycle processes ranging from germination and seed development through to fundamental developmental and yield-related traits. In the allopolyploid crop species Brassica napus, (genome AACC, homoeologous copies of flowering time regulatory genes are implicated in major phenological variation within the species, however the extent and control of intraspecific and intergenomic variation among flowering-time regulators is still unclear. To investigate differences among B. napus morphotypes in relation to flowering-time gene variation, we performed targeted deep sequencing of 29 regulatory flowering-time genes in four genetically and phenologically diverse B. napus accessions. The genotype panel included a winter-type oilseed rape, a winter fodder rape, a spring-type oilseed rape (all B. napus ssp. napus and a swede (B. napus ssp. napobrassica, which show extreme differences in winter-hardiness, vernalization requirement and flowering behaviour. A broad range of genetic variation was detected in the targeted genes for the different morphotypes, including non-synonymous SNPs, copy number variation and presence-absence variation. The results suggest that this broad variation in vernalisation, clock and signaling genes could be a key driver of morphological differentiation for flowering-related traits in this recent allopolyploid crop species.

  18. Genetic variations of the porcine PRKAG3 gene in Chinese indigenous pig breeds

    Directory of Open Access Journals (Sweden)

    Zhou Li-Hua

    2004-07-01

    Full Text Available Abstract Four missense substitutions (T30N, G52S, V199I and R200Q in the porcine PRKAG3 gene were considered as the likely candidate loci affecting meat quality. In this study, the R200Q substitution was investigated in a sample of 62 individuals from Hampshire, Chinese Min and Erhualian pigs, and the genetic variations of T30N, G52S and V199I substitutions were detected in 1505 individuals from 21 Chinese indigenous breeds, 5 Western commercial pig breeds, and the wild pig. Allele 200R was fixed in Chinese Min and Erhualian pigs. Haplotypes II-QQ and IV-QQ were not observed in the Hampshire population, supporting the hypothesis that allele 200Q is tightly linked with allele 199V. Significant differences in allele frequencies of the three substitutions (T30N, G52S and V199I between Chinese indigenous pigs and Western commercial pigs were observed. Obvious high frequencies of the "favorable" alleles 30T and 52G in terms of meat quality were detected in Chinese indigenous pigs, which are well known for high meat quality. However, the frequency of the "favorable" allele 199I, which was reported to have a greater effect on meat quality in comparison with 30T and 52G, was very low in all of the Chinese indigenous pigs except for the Min pig. The reasons accounting for this discrepancy remain to be addressed. The presence of the three substitutions in purebred Chinese Tibetan pigs indicates that the three substitutions were ancestral mutations. A novel A/G substitution at position 51 in exon 1 was identified. The results suggest that further studies are required to investigate the associations of these substitutions in the PRKAG3 gene with meat quality of Chinese indigenous pigs, and to uncover other polymorphisms in the PRKAG3 gene with potential effects on meat quality in Chinese indigenous pigs.

  19. Extensive sequence variation in rice blast resistance gene Pi54 makes it broad spectrum in nature

    Directory of Open Access Journals (Sweden)

    Shallu eThakur

    2015-05-01

    Full Text Available Rice blast resistant gene, Pi54 cloned from rice line, Tetep, is effective against diverse isolates of Magnaporthe oryzae. In this study, we prospected the allelic variants of the dominant blast resistance gene from a set of 92 rice lines to determine the nucleotide diversity, pattern of its molecular evolution, phylogenetic relationships and evolutionary dynamics, and to develop allele specific markers. High quality sequences were generated for homologs of Pi54 gene. Using comparative sequence analysis, InDels of variable sizes in all the alleles were observed. Profiling of the selected sites of SNP (Single Nucleotide Polymorphism and amino acids (N sites ≥ 10 exhibited constant frequency distribution of mutational and substitutional sites between the resistance and susceptible rice lines, respectively. A total of 50 new haplotypes based on the nucleotide polymorphism was also identified. A unique haplotype (H_3 was found to be linked to all the resistant alleles isolated from indica rice lines. Unique leucine zipper and tyrosine sulfation sites were identified in the predicted Pi54 proteins. Selection signals were observed in entire coding sequence of resistance alleles, as compared to LRR domains for susceptible alleles. This is a maiden report of extensive variability of Pi54 alleles in different landraces and cultivated varieties, possibly, attributing broad-spectrum resistance to Magnaporthe oryzae. The sequence variation in two consensus region: 163 bp and 144 bp were used for the development of allele specific DNA markers. Validated markers can be used for the selection and identification of better allele(s and their introgression in commercial rice cultivars employing marker assisted selection.

  20. Gene-related strain variation of Staphylococcus aureus for homologous resistance response to acid stress.

    Science.gov (United States)

    Lee, Soomin; Ahn, Sooyeon; Lee, Heeyoung; Kim, Won-Il; Kim, Hwang-Yong; Ryu, Jae-Gee; Kim, Se-Ri; Choi, Kyoung-Hee; Yoon, Yohan

    2014-10-01

    This study investigated the effect of adaptation of Staphylococcus aureus strains to the acidic condition of tomato in response to environmental stresses, such as heat and acid. S. aureus ATCC 13565, ATCC 14458, ATCC 23235, ATCC 27664, and NCCP10826 habituated in tomato extract at 35°C for 24 h were inoculated in tryptic soy broth. The culture suspensions were then subjected to heat challenge or acid challenge at 60°C and pH 3.0, respectively, for 60 min. In addition, transcriptional analysis using quantitative real-time PCR was performed to evaluate the expression level of acid-shock genes, such as clpB, zwf, nuoF, and gnd, from five S. aureus strains after the acid habituation of strains in tomato at 35°C for 15 min and 60 min in comparison with that of the nonhabituated strains. In comparison with the nonhabituated strains, the five tomato-habituated S. aureus strains did not show cross protection to heat, but tomato-habituated S. aureus ATCC 23235 showed acid resistance. In quantitative real-time-PCR analysis, the relative expression levels of acid-shock genes (clpB, zwf, nuoF, and gnd) were increased the most in S. aureus ATCC 23235 after 60 min of tomato habituation, but there was little difference in the expression levels among the five S. aureus strains after 15 min of tomato habituation. These results indicate that the variation of acid resistance of S. aureus is related to the expression of acid-shock genes during acid habituation. PMID:25285500

  1. Drug Metabolizing Enzyme and Transporter Gene Variation, Nicotine Metabolism, Prospective Abstinence, and Cigarette Consumption.

    Directory of Open Access Journals (Sweden)

    Andrew W Bergen

    Full Text Available The Nicotine Metabolite Ratio (NMR, ratio of trans-3'-hydroxycotinine and cotinine, has previously been associated with CYP2A6 activity, response to smoking cessation treatments, and cigarette consumption. We searched for drug metabolizing enzyme and transporter (DMET gene variation associated with the NMR and prospective abstinence in 2,946 participants of laboratory studies of nicotine metabolism and of clinical trials of smoking cessation therapies. Stage I was a meta-analysis of the association of 507 common single nucleotide polymorphisms (SNPs at 173 DMET genes with the NMR in 449 participants of two laboratory studies. Nominally significant associations were identified in ten genes after adjustment for intragenic SNPs; CYP2A6 and two CYP2A6 SNPs attained experiment-wide significance adjusted for correlated SNPs (CYP2A6 PACT=4.1E-7, rs4803381 PACT=4.5E-5, rs1137115, PACT=1.2E-3. Stage II was mega-regression analyses of 10 DMET SNPs with pretreatment NMR and prospective abstinence in up to 2,497 participants from eight trials. rs4803381 and rs1137115 SNPs were associated with pretreatment NMR at genome-wide significance. In post-hoc analyses of CYP2A6 SNPs, we observed nominally significant association with: abstinence in one pharmacotherapy arm; cigarette consumption among all trial participants; and lung cancer in four case:control studies. CYP2A6 minor alleles were associated with reduced NMR, CPD, and lung cancer risk. We confirmed the major role that CYP2A6 plays in nicotine metabolism, and made novel findings with respect to genome-wide significance and associations with CPD, abstinence and lung cancer risk. Additional multivariate analyses with patient variables and genetic modeling will improve prediction of nicotine metabolism, disease risk and smoking cessation treatment prognosis.

  2. Lateralidad, procesos perceptivos y rendimiento académico.

    OpenAIRE

    Mera-Tapia, Guadalupe

    2013-01-01

    Es frecuente que factores neuropsicológicos alterados sean responsables en casos de alumnos con bajo rendimiento académico que fracasan en nuestro sistema educativo. En este trabajo se estudia si existen diferencias, entre alumnos con alto y bajo rendimiento académico en relación con los procesos perceptivos y la lateralidad. Se evalúan los procesos perceptivos (visión, y audición) y la lateralidad en dos muestras de 30 alumnos cada una, de alto y bajo rendimento respectivamente. Los alumnos ...

  3. Spin-offs académicas em Portugal

    OpenAIRE

    Valente, Fernando Manuel

    2015-01-01

    Doutoramento em Gestão A literatura de empreendedorismo académico tem abordado uma grande diversidade de temas, nomeadamente: (i) estudos sobre o papel dos governos em processos de spin-off incluindo formas de apoiar a sua criação e desenvolvimento como mecanismo para transferir conhecimento para o mercado; (ii) estudos sobre o papel das universidades no processo de transferência de conhecimento, tais como as formas de incentivar a criação e desenvolvimento de novas empresas pelos académic...

  4. Polymorphisms in the WNK1 Gene Are Associated with Blood Pressure Variation and Urinary Potassium Excretion

    Science.gov (United States)

    Newhouse, Stephen; Farrall, Martin; Wallace, Chris; Hoti, Mimoza; Burke, Beverley; Howard, Philip; Onipinla, Abiodun; Lee, Kate; Shaw-Hawkins, Sue; Dobson, Richard; Brown, Morris; Samani, Nilesh J.; Dominiczak, Anna F.; Connell, John M.; Lathrop, G. Mark; Kooner, Jaspal; Chambers, John; Elliott, Paul; Clarke, Robert; Collins, Rory; Laan, Maris; Org, Elin; Juhanson, Peeter; Veldre, Gudrun; Viigimaa, Margus; Eyheramendy, Susana; Cappuccio, Francesco P.; Ji, Chen; Iacone, Roberto; Strazzullo, Pasquale; Kumari, Meena; Marmot, Michael; Brunner, Eric; Caulfield, Mark; Munroe, Patricia B.

    2009-01-01

    WNK1 - a serine/threonine kinase involved in electrolyte homeostasis and blood pressure (BP) control - is an excellent candidate gene for essential hypertension (EH). We and others have previously reported association between WNK1 and BP variation. Using tag SNPs (tSNPs) that capture 100% of common WNK1 variation in HapMap, we aimed to replicate our findings with BP and to test for association with phenotypes relating to WNK1 function in the British Genetics of Hypertension (BRIGHT) study case-control resource (1700 hypertensive cases and 1700 normotensive controls). We found multiple variants to be associated with systolic blood pressure, SBP (7/28 tSNPs min-p = 0.0005), diastolic blood pressure, DBP (7/28 tSNPs min-p = 0.002) and 24 hour urinary potassium excretion (10/28 tSNPs min-p = 0.0004). Associations with SBP and urine potassium remained significant after correction for multiple testing (p = 0.02 and p = 0.01 respectively). The major allele (A) of rs765250, located in intron 1, demonstrated the strongest evidence for association with SBP, effect size 3.14 mmHg (95%CI:1.23–4.9), DBP 1.9 mmHg (95%CI:0.7–3.2) and hypertension, odds ratio (OR: 1.3 [95%CI: 1.0–1.7]).We genotyped this variant in six independent populations (n = 14,451) and replicated the association between rs765250 and SBP in a meta-analysis (p = 7×10−3, combined with BRIGHT data-set p = 2×10−4, n = 17,851). The associations of WNK1 with DBP and EH were not confirmed. Haplotype analysis revealed striking associations with hypertension and BP variation (global permutation p10 mmHg reduction) and risk for hypertension (OR<0.60). Our data indicates that multiple rare and common WNK1 variants contribute to BP variation and hypertension, and provide compelling evidence to initiate further genetic and functional studies to explore the role of WNK1 in BP regulation and EH. PMID:19347040

  5. Polymorphisms in the WNK1 gene are associated with blood pressure variation and urinary potassium excretion.

    Directory of Open Access Journals (Sweden)

    Stephen Newhouse

    Full Text Available WNK1--a serine/threonine kinase involved in electrolyte homeostasis and blood pressure (BP control--is an excellent candidate gene for essential hypertension (EH. We and others have previously reported association between WNK1 and BP variation. Using tag SNPs (tSNPs that capture 100% of common WNK1 variation in HapMap, we aimed to replicate our findings with BP and to test for association with phenotypes relating to WNK1 function in the British Genetics of Hypertension (BRIGHT study case-control resource (1700 hypertensive cases and 1700 normotensive controls. We found multiple variants to be associated with systolic blood pressure, SBP (7/28 tSNPs min-p = 0.0005, diastolic blood pressure, DBP (7/28 tSNPs min-p = 0.002 and 24 hour urinary potassium excretion (10/28 tSNPs min-p = 0.0004. Associations with SBP and urine potassium remained significant after correction for multiple testing (p = 0.02 and p = 0.01 respectively. The major allele (A of rs765250, located in intron 1, demonstrated the strongest evidence for association with SBP, effect size 3.14 mmHg (95%CI:1.23-4.9, DBP 1.9 mmHg (95%CI:0.7-3.2 and hypertension, odds ratio (OR: 1.3 [95%CI: 1.0-1.7].We genotyped this variant in six independent populations (n = 14,451 and replicated the association between rs765250 and SBP in a meta-analysis (p = 7 x 10(-3, combined with BRIGHT data-set p = 2 x 10(-4, n = 17,851. The associations of WNK1 with DBP and EH were not confirmed. Haplotype analysis revealed striking associations with hypertension and BP variation (global permutation p10 mmHg reduction and risk for hypertension (OR<0.60. Our data indicates that multiple rare and common WNK1 variants contribute to BP variation and hypertension, and provide compelling evidence to initiate further genetic and functional studies to explore the role of WNK1 in BP regulation and EH.

  6. Identification of genes related to the phenotypic variations of a synthesized Paulownia (Paulownia tomentosa×Paulownia fortunei) autotetraploid.

    Science.gov (United States)

    Li, Yongsheng; Fan, Guoqiang; Dong, Yanpeng; Zhao, Zhenli; Deng, Minjie; Cao, Xibing; Xu, Enkai; Niu, Suyan

    2014-12-15

    Paulownia is a fast-growing deciduous tree native to China. It has great economic importance for the pulp and paper industries, as well as ecological prominence in forest ecosystems. Paulownia is of much interest to plant breeder keen to explore new plant varieties by selecting on the basis of phenotype. A newly synthesized autotetraploid Paulownia exhibited advanced characteristics, such as greater yield, and higher resistance than the diploid tree. However, tissue-specific transcriptome and genomic data in public databases are not sufficient to understand the molecular mechanisms associated with genome duplication. To evaluate the effects of genome duplication on the phenotypic variations in Paulownia tomentosa×Paulownia fortunei, the transcriptomes of the autotetraploid and diploid Paulownia were compared. Using Illumina sequencing technology, a total of 82,934 All-unigenes with a mean length of 1109 bp were assembled. The data revealed numerous differences in gene expression between the two transcriptomes, including 718 up-regulated and 667 down-regulated differentially expressed genes between the two Paulownia trees. An analysis of the pathway and gene annotations revealed that genes involved in nucleotide sugar metabolism in plant cell walls were down-regulated, and genes involved in the light signal pathway and the biosynthesis of structural polymers were up-regulated in autotetraploid Paulownia. The differentially expressed genes may contribute to the observed phenotypic variations between diploid and autotetraploid Paulownia. These results provide a significant resource for understanding the variations in Paulownia polyploidization and will benefit future breeding work. PMID:25300252

  7. Association between a variation in the phosphodiesterase 4D gene and bone mineral density

    Directory of Open Access Journals (Sweden)

    Sambrook Philip N

    2005-03-01

    Full Text Available Abstract Background Fragility fractures caused by osteoporosis are a major cause of morbidity and mortality in aging populations. Bone mineral density (BMD is a useful surrogate marker for risk of fracture and is a highly heritable trait. The genetic variants underlying this genetic contribution are largely unknown. Methods We performed a large-scale association study investigating more than 25,000 single nucleotide polymorphisms (SNPs located within 16,000 genes. Allele frequencies were estimated in contrasting DNA pools from white females selected for low (2, n = 319 and high (> 1.11 g/cm2, n = 321 BMD at the lumbar spine. Significant findings were verified in two additional sample collections. Results Based on allele frequency differences between DNA pools and subsequent individual genotyping, one of the candidate loci indicated was the phosphodiesterase 4D (PDE4D gene region on chromosome 5q12. We subsequently tested the marker SNP, rs1498608, in a second sample of 138 white females with low (2 and 138 females with high (>1.04 g/cm2 lumbar spine BMD. Odds ratios were 1.5 (P = 0.035 in the original sample and 2.1 (P = 0.018 in the replication sample. Association fine mapping with 80 SNPs located within 50 kilobases of the marker SNP identified a 20 kilobase region of association containing exon 6 of PDE4D. In a second, family-based replication sample with a preponderance of females with low BMD, rs1498608 showed an opposite relationship with BMD at different sites (p = 0.00044-0.09. We also replicated the previously reported association of the Ser37Ala polymorphism in BMP2, known to interact biologically with PDE4D, with BMD. Conclusion This study indicates that variants in the gene encoding PDE4D account for some of the genetic contribution to bone mineral density variation in humans. The contrasting results from different samples indicate that the effect may be context-dependent. PDE4 inhibitors have been shown to increase bone mass in

  8. Association of genetic variations of the prostasin gene with essential hypertension in the Xinjiang Kazakh population

    Institute of Scientific and Technical Information of China (English)

    LI Nan-fang; ZHANG Ju-hong; CHANG Jian-hang; YANG Jin; WANG Hong-mei; ZHOU Ling; LUO Wen-li

    2011-01-01

    Background Transgenic overexpression of human prostasin in rats disturbs salt balance and causes hypertension. We investigated whether genetic variations in prostasin were implicated in hypertension or related phenotypes in the Xinjiang Kazakh population.Methods We sequenced all exons and the promoter regions of the prostasin gene in 94 hypertensive individuals, and the genotype identification was performed by the TaqMan polymerase chain reaction method. Case-control studies were conducted in 938 Kazakh subjects.Results E342K and 2827G>A, which are novel variants, were successfully genotyped in the general Xinjiang Kazakh population with a sample size of 938 individuals (406 men and 532 women). Only one hypertensive patient was identified with the E342K mutation. No significant association was observed between 2827G>A and hypertension. However,quantitative traits of hypertensive intermediate phenotypes were significantly associated with the A allele; P=-0.041 and 0.034 for body mass index (BMI) in the additive and recessive models, P=0.042 and 0.018 for OGTT-2h glucose in the additive and recessive models, P=0.031 for IRT-3h insulin in the recessive model, and P=0.038 for serum potassium in the dominant model.Conclusions This study does not provide evidence of a major role of prostasin variation in blood pressure modulation.However, association of prostasin polymorphisms with hypertension and metabolic effects can be observed in our population. Further investigation is warranted to clarify the relevance of prostasin polymorphisms to blood pressure regulation.

  9. Allelic variation in the squirrel monkey x-linked color vision gene: biogeographical and behavioral correlates.

    Science.gov (United States)

    Cropp, Susan; Boinski, Sue; Li, Wen-Hsiung

    2002-06-01

    Most Neotropical primate species possess a polymorphic X-linked and a monomorphic autosomal color vision gene. Consequently, populations are composed of both dichromatics and trichromatics. Most theories on the maintenance of this genetic system revolve around possible advantages for foraging ecology. To examine the issue from a different angle, we compared the numbers and relative frequencies of alleles at the X-linked locus among three species of Saimiri representing a wide range of geographical and behavioral variation in the genus. Exons 3, 4, and 5 of the X-linked opsin gene were sequenced for a large number of X chromosomes for all three species. Several synonymous mutations were detected in exons 4 and 5 for the originally reported alleles but only a single nonsynonymous change was detected. Two alleles were found that appeared to be the result of recombination events. The low occurrence of recombinant alleles and absence of mutations in the amino acids critical for spectral tuning indicates that stabilizing selection acts to maintain the combinations of critical sites specific to each allele. Allele frequencies were approximately the same for all Saimiri species, with a slight but significant difference between S. boliviensis and S. oerstedii. No apparent correlation exists between allele frequencies and behavioral or biogeographical differences between species, casting doubt on the speculation that the spectral sensitivities of the alleles have been maintained because they are specifically well-tuned to Saimiri visual ecology. Rather, the spectral tuning peaks might have been maintained because they are as widely spaced as possible within the limited range of middlewave to longwave spectra useful to all primates. This arrangement creates a balance between maximizing the distance between spectral tuning peaks (allowing the color opponency of the visual system to distinguish between peaks) and maximizing the number of alleles within a limited range (yielding

  10. Clinical associations of host genetic variations in the genes of cytokines in critically ill patients

    Science.gov (United States)

    Belopolskaya, O B; Smelaya, T V; Moroz, V V; Golubev, A M; Salnikova, L E

    2015-01-01

    Host genetic variations may influence a changing profile of biochemical markers and outcome in patients with trauma/injury. The objective of this study was to assess clinical associations of single nucleotide polymorphisms (SNPs) in the genes of cytokines in critically ill patients. A total of 430 patients were genotyped for SNPs in the genes of pro- (IL1B, IL6, IL8) and anti-inflammatory (IL4, IL10, IL13) cytokines. The main end-points were sepsis, mortality and adult respiratory distress syndrome (ARDS). We evaluated the dynamic levels of bilirubin, blood urea nitrogen, creatine kinase, creatinine and lactate dehydrogenase in five points of measurements (between 1 and 14 days after admission) and correlated them with SNPs. High-producing alleles of proinflammatory cytokines protected patients against sepsis (IL1B −511A and IL8 —251A) and mortality (IL1B −511A). High-producing alleles of anti-inflammatory cytokines IL4 —589T and IL13 431A (144Gln) were less frequent in ARDS patients. The carriers of IL6 —174C/C genotypes were prone to the increased levels of biochemical markers and acute kidney and liver insufficiency. Genotype-dependent differences in the levels of biochemical indicators gradually increased to a maximal value on the 14th day after admission. These findings suggest that genetic variability in pro- and anti-inflammatory cytokines may contribute to different clinical phenotypes in patients at high risk of critical illness. PMID:25619315

  11. The association between common genetic variation in the FTO gene and metabolic syndrome in Han Chinese

    Institute of Scientific and Technical Information of China (English)

    WANG Tong; ZHANG Li-li; ZHANG Yun; SUN Xiao-fang; ZHANG Qian; HUANG Yi; XIAO Xin-hua; WANG Duen-mei; DIAO Cheng-ming; ZHANG Feng; XU Ling-ling; ZHANG Yong-biao; LI Wen-hui

    2010-01-01

    Background Genome-wide association studies for type 2 diabetes mellitus (T2DM) identified FTO gene as a locus conferring increased risk for common obesity in many populations with European ancestry. However, the involvement of FTO gene in obesity or T2DM related metabolic traits has not been consistently established in Chinese populations. The objective of this study was to investigate the association of FTO genetic polymorphisms with metabolic syndrome (MetS) in Han Chinese.Methods We tested 41 FTO single nucleotide polymorphisms (SNPs) for association between FTO and MetS-related traits. There were a total of 236 unrelated subjects (108 cases and 128 controls), grouped according to the International Diabetes Federation (IDF) criteria.Results Of the 41 SNPs examined, only SNP rs8047395 exhibited statistical significance (P=0.026) under a recessive model, after Bonferroni adjustment for multiple testing (OR 1.64, 95% CI 1.11-2.42; P=0.014). The common distributions of this polymorphism among Chinese-with a minor allele frequency (MAF) of 36% in the control group versus 48% in the MetS group-greatly improved our test power in a relatively small sample size for an association study. Previously identified obesity-(or T2DM-) associated FTO SNPs were less common in Han Chinese and were not associated with MetS in this study. No significant associations were found between our FTO SNPs and any endophenotypes of MetS.Conclusions A more common risk-conferring variant of FTO for MetS was identified in Han Chinese. Our study substantiated that genetic variations in FTO locus are involved in the pathogenesis of MetS.

  12. Natural variation in rosette size under salt stress conditions corresponds to developmental differences between Arabidopsis accessions and allelic variation in the LRR-KISS gene

    KAUST Repository

    Julkowska, Magdalena M.

    2016-02-11

    Natural variation among Arabidopsis accessions is an important genetic resource to identify mechanisms underlying plant development and stress tolerance. To evaluate the natural variation in salinity stress tolerance, two large-scale experiments were performed on two populations consisting of 160 Arabidopsis accessions each. Multiple traits, including projected rosette area, and fresh and dry weight were collected as an estimate for salinity tolerance. Our results reveal a correlation between rosette size under salt stress conditions and developmental differences between the accessions grown in control conditions, suggesting that in general larger plants were more salt tolerant. This correlation was less pronounced when plants were grown under severe salt stress conditions. Subsequent genome wide association study (GWAS) revealed associations with novel candidate genes for salinity tolerance such as LRR-KISS (At4g08850), flowering locus KH-domain containing protein and a DUF1639-containing protein. Accessions with high LRR-KISS expression developed larger rosettes under salt stress conditions. Further characterization of allelic variation in candidate genes identified in this study will provide more insight into mechanisms of salt stress tolerance due to enhanced shoot growth.

  13. Ovine leukocyte profiles do not associate with variation in the prion gene, but are breed-dependent

    Science.gov (United States)

    Prion genotype in sheep confer resistance to scrapie. In cattle, lymphocyte profile has been found to be associated with prion genotype. Therefore, the aim of this study was to determine if variations in the sheep prion gene were associated with leukocyte populations as measured by complete blood ce...

  14. Common genetic variation in the Estrogen Receptor Beta (ESR2) gene and osteoarthritis: Results of a meta-analysis

    NARCIS (Netherlands)

    J.M. Kerkhof (Hanneke); I. Meulenbelt (Ingrid); A. Gonzalez (Antonio); D.J. Hart (Deborah); A. Hofman (Albert); M. Kloppenburg (Margreet); N.E. Lane; J. Loughlin (John); M.C. Nevitt (Michael); H.A.P. Pols (Huib); F. Rivadeneira Ramirez (Fernando); E. Slagboom (Eline); T.D. Spector (Tim); L. Stolk (Lisette); A. Tsezou (Aspasia); A.G. Uitterlinden (André); A.M. Valdes (Ana Maria); J.B.J. van Meurs (Joyce); A.J. Carr (Andrew Jonathan)

    2010-01-01

    textabstractBackground: The objective of this study was to examine the relationship between common genetic variation of the ESR2 gene and osteoarthritis.Methods: In the discovery study, the Rotterdam Study-I, 7 single nucleotide polymorphisms (SNPs) were genotyped and tested for association with hip

  15. Genome-Wide Detection of SNP and SV Variations to Reveal Early Ripening-Related Genes in Grape.

    Directory of Open Access Journals (Sweden)

    Yanshuai Xu

    Full Text Available Early ripening in grape (Vitis vinifera L. is a crucial agronomic trait. The fruits of the grape line 'Summer Black' (SBBM, which contains a bud mutation, can be harvested approximately one week earlier than the 'Summer Black' (SBCcontrol. To investigate the molecular mechanism of the bud mutation related to early ripening, we detected genome-wide genetic variations based on re-sequencing. In total, 3,692,777 single nucleotide polymorphisms (SNPs and 81,223 structure variations (SVs in the SBC genome and 3,823,464 SNPs and 85,801 SVs in the SBBM genome were detected compared with the reference grape sequence. Of these, 635 SBC-specific genes and 665 SBBM-specific genes were screened. Ripening and colour-associated unigenes with non-synonymous mutations (NS, SVs or frame-shift mutations (F were analysed. The results showed that 90 unigenes in SBC, 76 unigenes in SBBM and 13 genes that mapped to large fragment indels were filtered. The expression patterns of eight genes were confirmed using quantitative reverse transcription-polymerase chain reaction (qRT-PCR.The re-sequencing data showed that 635 SBC-specific genes and 665 SBBM-specific genes associated with early ripening were screened. Among these, NCED6 expression appears to be related to NCED1 and is involved in ABA biosynthesis in grape, which might play a role in the onset of anthocyanin accumulation. The SEP and ERF genes probably play roles in ethylene response.

  16. Genetic variation in selenoprotein genes, lifestyle, and risk of colon and rectal cancer.

    Directory of Open Access Journals (Sweden)

    Martha L Slattery

    Full Text Available BACKGROUND: Associations between selenium and cancer have directed attention to role of selenoproteins in the carcinogenic process. METHODS: We used data from two population-based case-control studies of colon (n = 1555 cases, 1956 controls and rectal (n = 754 cases, 959 controls cancer. We evaluated the association between genetic variation in TXNRD1, TXNRD2, TXNRD3, C11orf31 (SelH, SelW, SelN1, SelS, SepX, and SeP15 with colorectal cancer risk. RESULTS: After adjustment for multiple comparisons, several associations were observed. Two SNPs in TXNRD3 were associated with rectal cancer (rs11718498 dominant OR 1.42 95% CI 1.16,1.74 pACT 0.0036 and rs9637365 recessive 0.70 95% CI 0.55,0.90 pACT 0.0208. Four SNPs in SepN1 were associated with rectal cancer (rs11247735 recessive OR 1.30 95% CI 1.04,1.63 pACT 0.0410; rs2072749 GGvsAA OR 0.53 95% CI 0.36,0.80 pACT 0.0159; rs4659382 recessive OR 0.58 95% CI 0.39,0.86 pACT 0.0247; rs718391 dominant OR 0.76 95% CI 0.62,0.94 pACT 0.0300. Interaction between these genes and exposures that could influence these genes showed numerous significant associations after adjustment for multiple comparisons. Two SNPs in TXNRD1 and four SNPs in TXNRD2 interacted with aspirin/NSAID to influence colon cancer; one SNP in TXNRD1, two SNPs in TXNRD2, and one SNP in TXNRD3 interacted with aspirin/NSAIDs to influence rectal cancer. Five SNPs in TXNRD2 and one in SelS, SeP15, and SelW1 interacted with estrogen to modify colon cancer risk; one SNP in SelW1 interacted with estrogen to alter rectal cancer risk. Several SNPs in this candidate pathway influenced survival after diagnosis with colon cancer (SeP15 and SepX1 increased HRR and rectal cancer (SepX1 increased HRR. CONCLUSIONS: Findings support an association between selenoprotein genes and colon and rectal cancer development and survival after diagnosis. Given the interactions observed, it is likely that the impact of cancer susceptibility from genotype is

  17. Variations in host genes encoding adhesion molecules and susceptibility to falciparum malaria in India

    Directory of Open Access Journals (Sweden)

    Tyagi Prajesh K

    2008-12-01

    Full Text Available Abstract Background Host adhesion molecules play a significant role in the pathogenesis of Plasmodium falciparum malaria and changes in their structure or levels in individuals can influence the outcome of infection. The aim of this study was to investigate the association of SNPs of three adhesion molecule genes, ICAM1, PECAM1 and CD36, with severity of falciparum malaria in a malaria-endemic and a non-endemic region of India. Methods The frequency distribution of seven selected SNPs of ICAM1, PECAM1 and CD36 was determined in 552 individuals drawn from 24 populations across India. SNP-disease association was analysed in a case-control study format. Genotyping of the population panel was performed by Sequenom mass spectroscopy and patient/control samples were genotyped by SNaPshot method. Haplotypes and linkage disequilibrium (LD plots were generated using PHASE and Haploview, respectively. Odds-ratio (OR for risk assessment was estimated using EpiInfo™ version 3.4. Results Association of the ICAM1 rs5498 (exon 6 G allele and the CD36 exon 1a A allele with increased risk of severe malaria was observed (severe versus control, OR = 1.91 and 2.66, P = 0.02 and 0.0012, respectively. The CD36 rs1334512 (-53 T allele as well as the TT genotype associated with protection from severe disease (severe versus control, TT versus GG, OR = 0.37, P = 0.004. Interestingly, a SNP of the PECAM1 gene (rs668, exon 3, C/G with low minor allele frequency in populations of the endemic region compared to the non-endemic region exhibited differential association with disease in these regions; the G allele was a risk factor for malaria in the endemic region, but exhibited significant association with protection from disease in the non-endemic region. Conclusion The data highlights the significance of variations in the ICAM1, PECAM1 and CD36 genes in the manifestation of falciparum malaria in India. The PECAM1 exon 3 SNP exhibits altered association with disease in the

  18. Assessment of PD-1 gene variation in patients with multiple sclerosis

    Directory of Open Access Journals (Sweden)

    Shadmehri AA

    2010-05-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Multiple sclerosis (MS is a chronic inflammatory demyelinating disease of the central nervous system with presumed autoimmune origin. T cells are considered to play a pivotal role in orchestrating the self-reactive immune responses in multiple sclerosis (MS. This study was performed to investigate the role of polymorphisms of the programmed cell death 1 (PD-1 gene on susceptibility to ankylosing spondylitis. This gene codes an immunoreceptor named PD-1, which has a cytoplasmic domain containing two tyrosine residues located within immunoreceptor tyrosine-based inhibitory and switch motifs (ITIM and ITSM, suggesting that PD-1 is predominantly inhibitory which responsible for the negative regulation in T cell activation and peripheral tolerance. We investigated whether PD-1 gene polymorphism is a genetic modifier for risk and progression of MS."n"n Methods: Blood samples from 150 Iranian Relapsing-Remitting MS patients (mean age, 34.98 years and 202 healthy controls (mean age, 30 years were enrolled in this study. The PD-1.3 (7146 G/A Intron 4 and PD-1.9 (7625 C/T Exon 5 polymorphisms were detected by Polymerase Chain Reaction and Restriction Enzyme digestion or Restriction Fragment Length Polymorphism (PCR

  19. Heritable variation in heat shock gene expression: a potential mechanism for adaptation to thermal stress in embryos of sea turtles.

    Science.gov (United States)

    Tedeschi, J N; Kennington, W J; Tomkins, J L; Berry, O; Whiting, S; Meekan, M G; Mitchell, N J

    2016-01-13

    The capacity of species to respond adaptively to warming temperatures will be key to their survival in the Anthropocene. The embryos of egg-laying species such as sea turtles have limited behavioural means for avoiding high nest temperatures, and responses at the physiological level may be critical to coping with predicted global temperature increases. Using the loggerhead sea turtle (Caretta caretta) as a model, we used quantitative PCR to characterise variation in the expression response of heat-shock genes (hsp60, hsp70 and hsp90; molecular chaperones involved in cellular stress response) to an acute non-lethal heat shock. We show significant variation in gene expression at the clutch and population levels for some, but not all hsp genes. Using pedigree information, we estimated heritabilities of the expression response of hsp genes to heat shock and demonstrated both maternal and additive genetic effects. This is the first evidence that the heat-shock response is heritable in sea turtles and operates at the embryonic stage in any reptile. The presence of heritable variation in the expression of key thermotolerance genes is necessary for sea turtles to adapt at a molecular level to warming incubation environments. PMID:26763709

  20. Heritable variation in heat shock gene expression: a potential mechanism for adaptation to thermal stress in embryos of sea turtles.

    Science.gov (United States)

    Tedeschi, J N; Kennington, W J; Tomkins, J L; Berry, O; Whiting, S; Meekan, M G; Mitchell, N J

    2016-01-13

    The capacity of species to respond adaptively to warming temperatures will be key to their survival in the Anthropocene. The embryos of egg-laying species such as sea turtles have limited behavioural means for avoiding high nest temperatures, and responses at the physiological level may be critical to coping with predicted global temperature increases. Using the loggerhead sea turtle (Caretta caretta) as a model, we used quantitative PCR to characterise variation in the expression response of heat-shock genes (hsp60, hsp70 and hsp90; molecular chaperones involved in cellular stress response) to an acute non-lethal heat shock. We show significant variation in gene expression at the clutch and population levels for some, but not all hsp genes. Using pedigree information, we estimated heritabilities of the expression response of hsp genes to heat shock and demonstrated both maternal and additive genetic effects. This is the first evidence that the heat-shock response is heritable in sea turtles and operates at the embryonic stage in any reptile. The presence of heritable variation in the expression of key thermotolerance genes is necessary for sea turtles to adapt at a molecular level to warming incubation environments.

  1. Common Variation in the LRRK2 Gene is a Risk Factor for Parkinson’s Disease

    Science.gov (United States)

    Mata, Ignacio F.; Checkoway, Harvey; Hutter, Carolyn M.; Samii, Ali; Roberts, John W.; Kim, Hojoong M.; Agarwal, Pinky; Alvarez, Victoria; Ribacoba, Renee; Pastor, Pau; Lorenzo-Betancor, Oswaldo; Infante, Jon; Sierra, María; Gómez-Garre, Pilar; Mir, Pablo; Ritz, Beate; Rhodes, Shannon L; Colcher, Amy; Van Deerlin, Vivianna; Chung, Kathryn A.; Quinn, Joseph F.; Yearout, Dora; Martinez, Erica; Farin, Federico M.; Wan, Jia Y.; Edwards, Karen L.; Zabetian, Cyrus P.

    2012-01-01

    Background Common variants in the LRRK2 gene influence risk of Parkinson’s disease (PD) in Asians, but whether the same is true in European-derived populations is less clear. Methods We genotyped 66 LRRK2 tagging single nucleotide polymorphisms (SNPs) in 575 PD patients and 689 controls from the Northwestern U.S. (Tier 1). PD-associated SNPs (p<0.05) were then genotyped in an independent sample of 3617 cases and 2512 controls from the U.S. and Spain (Tier 2). Logistic regression was used to model additive SNP genotype effects adjusted for age and sex among white individuals. Results Two regions showed independent association with PD in Tier 1, and SNPs in both regions were successfully replicated in Tier 2 (rs10878226, combined odds ratio [OR], 1.20; 95% confidence interval [CI], 1.08-1.33; p=6.3×10−4; rs11176013, OR, 0.89; CI, 0.83-0.95; p=4.6×10−4). Conclusions Our data suggest that common variation within LRRK2 conveys susceptibility for PD in individuals of European ancestry. PMID:23115130

  2. Haplotype variation of Green Revolution gene Rht-D1 during wheat domestication and improvement

    Institute of Scientific and Technical Information of China (English)

    Chihong Zhang; Lifeng Gao; Jiaqiang Sun; Jizeng Jia; Zhenglong Ren

    2014-01-01

    Green Revolution made a substantial contribution to wheat yields worldwide in the 1960s and 1970s. It is of great importance to analyze the haplotype variation of Rht-D1, the Green Revolution gene, during wheat (Triticum aestivum L.) domestication and breeding to understand its evolution and function in wheat breeding history. In this study, the Rht-D1 and its flanking regions were sequenced and single nucleotide polymorphisms were detected based on a panel of 45 accessions of Aegilops tauschi , 51 accessions of landraces and 80 accessions of commercial varieties. Genetic diversity in the wild accessions was much higher than that in the varieties and higher than that reported previously. Seven haplotypes (Hapl I to Hapl VII) of Rht-D1 were identified and their evolutionary relationships were proposed. In addition to the wel-known Green Revolution al ele Rht-D1b, Hapl VII (an al ele Rht-D1k) was identified in early breeding varieties, which reduced plant height by 16%. The results suggested that Rht-D1k had been used in breeding before the Green Revolution and made a great contribution to wheat production worldwide. Based on the breeding history and molecular evidence, we proposed that the wheat Green Revolution in China and International Maize and Wheat Improvement Center (CIMMYT) occurred independently.

  3. Tissue Specificity and Sex-Specific Regulatory Variation Permit the Evolution of Sex-Biased Gene Expression.

    Science.gov (United States)

    Dean, Rebecca; Mank, Judith E

    2016-09-01

    Genetic correlations between males and females are often thought to constrain the evolution of sexual dimorphism. However, sexually dimorphic traits and the underlying sexually dimorphic gene expression patterns are often rapidly evolving. We explore this apparent paradox by measuring the genetic correlation in gene expression between males and females (Cmf) across broad evolutionary timescales, using two RNA-sequencing data sets spanning multiple populations and multiple species. We find that unbiased genes have higher Cmf than sex-biased genes, consistent with intersexual genetic correlations constraining the evolution of sexual dimorphism. However, we found that highly sex-biased genes (both male and female biased) also had higher tissue specificity, and unbiased genes had greater expression breadth, suggesting that pleiotropy may constrain the breakdown of intersexual genetic correlations. Finally, we show that genes with high Cmf showed some degree of sex-specific changes in gene expression in males and females. Together, our results suggest that genetic correlations between males and females may be less important in constraining the evolution of sex-biased gene expression than pleiotropy. Sex-specific regulatory variation and tissue specificity may resolve the paradox of widespread sex bias within a largely shared genome.

  4. Context-dependent associations between variation in risk of ischemic heart disease and variation in the 5' promoter region of the apolipoprotein E gene in Danish women

    DEFF Research Database (Denmark)

    Stengård, Jari H; Dyson, Greg; Frikke-Schmidt, Ruth;

    2010-01-01

    OBJECTIVE: Variations in the noncoding single-nucleotide polymorphisms (SNPs) at positions 560 and 832 in the 5' promoter region of the apolipoprotein E gene define genotypes that distinguish between high and low concentrations of plasma total and high-density lipoprotein cholesterol...... and triglycerides. We addressed whether these genotypes improve the prediction of ischemic heart disease (IHD) in subsamples of individuals defined by traditional risk factors and the genotypes defined by the epsilon(2), epsilon(3), and epsilon(4) alleles in exon 4 of the apolipoprotein E gene. METHODS AND RESULTS......: In a sample of 3686 female and 2772 male participants of the Copenhagen City Heart Study who were free of IHD events, 576 individuals (257 women, 7.0% and 319 men, 11.5%) were diagnosed as having developed IHD in 6.5 years of follow-up. Using a stepwise Patient Rule-Induction Method modeling strategy...

  5. Allelic distributions of CYP2D6 gene copy number variation in the Eastern Han Chinese population

    Institute of Scientific and Technical Information of China (English)

    Hai-hui SHENG; Yun-lan DU; Jian SUN; Hua-sheng XIAO; Ai-ping ZENG; Wen-xiang ZHU; Ren-fang ZHU; Hong-mei LI; Zhi-dong ZHU; Ying QIN; Wei JIN; Yan LIU

    2007-01-01

    Aim: The human cytochrome P450 2D6 (CYP2D6) gene copy number variation, involving CYP2D6 gene deletion (CYP2D6*5) and duplication or multiduplication (CYP2D6*×N), can result in reduced or increased metabolism of many clinically used drugs. The identification of CYP2D6*5 and CYP2D6*×N and the investigation of their allelic distributions in ethnic populations can be important in deter-mining the right drug and dosage for each patient. Methods: The CYP2D6*5 andCYP2D6 genes, and CYP2D6 gene duplication were identified by 2 modified long PCR, respectively. To determine duplicated alleles, a novel long PCR was developed to amplify the entire duplicated CYP2D6 gene which was used as template for subsequent PCR amplification. A total of 363 unrelated Eastern Han Chinese individuals were analyzed for CYP2D6 gene copy number variation. Results: The frequency of CYP2D6*5 and CYP2D6*×N were 4.82% (n=35) and 0.69% (n=5) in the Eastern Han Chinese population, respectively. Of the 5 duplicated alleles, 3were CYP2D6*1×N and 2 were CYP2D6*10×N. One individual was a carrier of both CYP2D6*5 and CYP2D6*1×N. Taken together, the CYP2D6 gene rear-rangements were present in 10.74% of subjects. Conclusion: Allelic distributions of the CYP2D6 gene copy number variation differ among Chinese from different regions, indicating ethnic variety in Chinese. Long PCR are convenient, cost effective, specific and semiquantitative for the detection of the CYP2D6 gene copy number variation, and amplification of the entire duplicated CYP2D6 gene is necessary for the accurate identification of duplicated alleles.

  6. Variation in the MC4R gene is associated with bone phenotypes in elderly Swedish women.

    Directory of Open Access Journals (Sweden)

    Gaurav Garg

    Full Text Available Osteoporosis is characterized by reduced bone mineral density (BMD and increased fracture risk. Fat mass is a determinant of bone strength and both phenotypes have a strong genetic component. In this study, we examined the association between obesity associated polymorphisms (SNPs with body composition, BMD, Ultrasound (QUS, fracture and biomarkers (Homocysteine (Hcy, folate, Vitamin D and Vitamin B12 for obesity and osteoporosis. Five common variants: rs17782313 and rs1770633 (melanocortin 4 receptor (MC4R; rs7566605 (insulin induced gene 2 (INSIG2; rs9939609 and rs1121980 (fat mass and obesity associated (FTO were genotyped in 2 cohorts of Swedish women: PEAK-25 (age 25, n = 1061 and OPRA (age 75, n = 1044. Body mass index (BMI, total body fat and lean mass were strongly positively correlated with QUS and BMD in both cohorts (r(2 = 0.2-0.6. MC4R rs17782313 was associated with QUS in the OPRA cohort and individuals with the minor C-allele had higher values compared to T-allele homozygotes (TT vs. CT vs.100 vs. 103 vs. 103; p = 0.002; (SOS: 1521 vs. 1526 vs. 1524; p = 0.008; (Stiffness index: 69 vs. 73 vs. 74; p = 0.0006 after adjustment for confounders. They also had low folate (18 vs. 17 vs. 16; p = 0.03 and vitamin D (93 vs. 91 vs. 90; p = 0.03 and high Hcy levels (13.7 vs 14.4 vs. 14.5; p = 0.06. Fracture incidence was lower among women with the C-allele, (52% vs. 58%; p = 0.067. Variation in MC4R was not associated with BMD or body composition in either OPRA or PEAK-25. SNPs close to FTO and INSIG2 were not associated with any bone phenotypes in either cohort and FTO SNPs were only associated with body composition in PEAK-25 (p≤0.001. Our results suggest that genetic variation close to MC4R is associated with quantitative ultrasound and risk of fracture.

  7. Genetic variation in the HSD17B1 gene and risk of prostate cancer.

    Directory of Open Access Journals (Sweden)

    Peter Kraft

    2005-11-01

    Full Text Available Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17beta-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Delta5-androsterone-3beta,17beta-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002 inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes

  8. Genetic variation in the HSD17B1 gene and risk of prostate cancer.

    Science.gov (United States)

    Kraft, Peter; Pharoah, Paul; Chanock, Stephen J; Albanes, Demetrius; Kolonel, Laurence N; Hayes, Richard B; Altshuler, David; Andriole, Gerald; Berg, Christine; Boeing, Heiner; Burtt, Noel P; Bueno-de-Mesquita, Bas; Calle, Eugenia E; Cann, Howard; Canzian, Federico; Chen, Yen-Ching; Crawford, David E; Dunning, Alison M; Feigelson, Heather S; Freedman, Matthew L; Gaziano, John M; Giovannucci, Ed; Gonzalez, Carlos Alberto; Haiman, Christopher A; Hallmans, Goran; Henderson, Brian E; Hirschhorn, Joel N; Hunter, David J; Kaaks, Rudolf; Key, Timothy; Le Marchand, Loic; Ma, Jing; Overvad, Kim; Palli, Domenico; Pike, Malcolm C; Riboli, Elio; Rodriguez, Carmen; Setiawan, Wendy V; Stampfer, Meir J; Stram, Daniel O; Thomas, Gilles; Thun, Michael J; Travis, Ruth; Trichopoulou, Antonia; Virtamo, Jarmo; Wacholder, Sholom

    2005-11-01

    Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17beta-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Delta5-androsterone-3beta,17beta-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs) that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G) or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002) inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes these subgroup

  9. Immune gene expression in Bombus terrestris: signatures of infection despite strong variation among populations, colonies, and sister workers.

    Directory of Open Access Journals (Sweden)

    Franziska S Brunner

    Full Text Available Ecological immunology relies on variation in resistance to parasites. Colonies of the bumblebee Bombus terrestris vary in their susceptibility to the trypanosome gut parasite Crithidia bombi, which reduces colony fitness. To understand the possible origin of this variation in resistance we assayed the expression of 28 immunologically important genes in foraging workers. We deliberately included natural variation of the host "environment" by using bees from colonies collected in two locations and sampling active foraging workers that were not age controlled. Immune gene expression patterns in response to C. bombi showed remarkable variability even among genetically similar sisters. Nevertheless, expression varied with parasite exposure, among colonies and, perhaps surprisingly, strongly among populations (collection sites. While only the antimicrobial peptide abaecin is universally up regulated upon exposure, linear discriminant analysis suggests that the overall exposure effect is driven by a combination of several immune pathways and further immune functions such as ROS regulation. Also, the differences among colonies in their immune gene expression profiles provide clues to the mechanistic basis of well-known inter-colony variation in susceptibility to this parasite. Our results show that transcriptional responses to parasite exposure can be detected in ecologically heterogeneous groups despite strong background noise.

  10. Variations and classification of toxic epitopes related to celiac disease among α-gliadin genes from four Aegilops genomes.

    Science.gov (United States)

    Li, Jie; Wang, Shunli; Li, Shanshan; Ge, Pei; Li, Xiaohui; Ma, Wujun; Zeller, F J; Hsam, Sai L K; Yan, Yueming

    2012-07-01

    The α-gliadins are associated with human celiac disease. A total of 23 noninterrupted full open reading frame α-gliadin genes and 19 pseudogenes were cloned and sequenced from C, M, N, and U genomes of four diploid Aegilops species. Sequence comparison of α-gliadin genes from Aegilops and Triticum species demonstrated an existence of extensive allelic variations in Gli-2 loci of the four Aegilops genomes. Specific structural features were found including the compositions and variations of two polyglutamine domains (QI and QII) and four T cell stimulatory toxic epitopes. The mean numbers of glutamine residues in the QI domain in C and N genomes and the QII domain in C, N, and U genomes were much higher than those in Triticum genomes, and the QI domain in C and N genomes and the QII domain in C, M, N, and U genomes displayed greater length variations. Interestingly, the types and numbers of four T cell stimulatory toxic epitopes in α-gliadins from the four Aegilops genomes were significantly less than those from Triticum A, B, D, and their progenitor genomes. Relationships between the structural variations of the two polyglutamine domains and the distributions of four T cell stimulatory toxic epitopes were found, resulting in the α-gliadin genes from the Aegilops and Triticum genomes to be classified into three groups.

  11. Natural variations in expression of regulatory and detoxification related genes under limiting phosphate and arsenate stress in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Tapsi eShukla

    2015-10-01

    Full Text Available Abiotic stress including nutrient deficiency and heavy metal toxicity severely affects plant growth, development, and productivity. Genetic variations within and in between species are one of the important factors in establishing interactions and responses of plants with the environment. In the recent past, natural variations in Arabidopsis thaliana have been used to understand plant development and response towards different stresses at genetic level. Phosphorus (Pi deficiency negatively affects plant growth and metabolism and modulates expression of the genes involved in Pi homeostasis. Arsenate, As(V, a chemical analogue of Pi, is taken up by the plants via phosphate transport system. Studies suggest that during Pi deficiency, enhanced As(V uptake leads to increased toxicity in plants. Here, the natural variations in Arabidopsis have been utilized to study the As(V stress response under limiting Pi condition. The primary root length was compared to identify differential response of three Arabidopsis accessions (Col-0, Sij-1 and Slavi-1 under limiting Pi and As(V stress. To study the molecular mechanisms responsible for the differential response, comprehensive expression profiling of the genes involved in uptake, detoxification and regulatory mechanisms was carried out. Analysis suggests genetic variation-dependent regulatory mechanisms may affect differential response of Arabidopsis natural variants towards As(V stress under limiting Pi condition. Therefore, it is hypothesized that detailed analysis of the natural variations under multiple stress conditions might help in the better understanding of the biological processes involved in stress tolerance and adaptation.

  12. Quantitative variation in obesity-related traits and insulin precursors linked to the OB gene region on human chromosome 7

    Energy Technology Data Exchange (ETDEWEB)

    Duggirala, R.; Stern, M.P.; Reinhart, L.J. [Univ. of Texas Health Science Center, San Antonio, TX (United States)] [and others

    1996-09-01

    Despite the evidence that human obesity has strong genetic determinants, efforts at identifying specific genes that influence human obesity have largely been unsuccessful. Using the sibship data obtained from 32 low-income Mexican American pedigrees ascertained on a type II diabetic proband and a multipoint variance-components method, we tested for linkage between various obesity-related traits plus associated metabolic traits and 15 markers on human chromosome 7. We found evidence for linkage between markers in the OB gene region and various traits, as follows: D7S514 and extremity skinfolds (LOD = 3.1), human carboxypeptidase A1 (HCPA1) and 32,33-split proinsulin level (LOD = 4.2), and HCPA1 and proinsulin level (LOD = 3.2). A putative susceptibility locus linked to the marker D7S514 explained 56% of the total phenotypic variation in extremity skinfolds. Variation at the HCPA1 locus explained 64% of phenotypic variation in proinsulin level and {approximately}73% of phenotypic variation in split proinsulin concentration, respectively. Weaker evidence for linkage to several other obesity-related traits (e.g., waist circumference, body-mass index, fat mass by bioimpedance, etc.) was observed for a genetic location, which is {approximately}15 cM telomeric to OB. In conclusion, our study reveals that the OB region plays a significant role in determining the phenotypic variation of both insulin precursors and obesity-related traits, at least in Mexican Americans. 66 refs., 3 figs., 4 tabs.

  13. Variation of PRLR gene copy number in duck%鸭PRLR基因拷贝数的变异

    Institute of Scientific and Technical Information of China (English)

    叶炎; 汪稳; 张金耀; 黄守婷; 钟志新; 周世业; 肖天放

    2016-01-01

    Copy number variation ( CNV) merges to be an effective tool in poultry breeding. To elucidate the correlation between productive performance and polymorphism, gene of Brown Tsaiya ducks were amplified by fluorescence quantitative PCR, and fol-lowed by being transferred into CNV via 2-ΔΔCt method. Subsequent production traits responses to different CNV of PRLR gene were investigated. Results showed that correlation coefficients of standard curve for PRLR and Ldh-B were 0.991 and 0.990, with slopes of standard curves being-3.070 and-3.135, respectively. Amplification efficiency of PRLR and Ldh-B target gene were 111.68% and 108.429%, which were approximately at the same level with reference gene. Traits of Brown Tsaiya ducks were correlated with CNV ( P0.05).因此,PRLR基因拷贝变异区域可能影响蛋壳厚度和蛋形指数.

  14. Social Media marketing nas bibliotecas académicas portuguesas

    OpenAIRE

    Armanda Salgado, Maria; Pacios Lozano, Ana Reyes

    2016-01-01

    Apresentam-se as perceções dos profissionais da informação das bibliotecas académicas portuguesas face à adoção do conceito social media marketing. Os resultados foram obtidos, através da aplicação de um questionário online à Rede de Informação do Instituto Nacional de Estatística em Bibliotecas do Ensino Superior (Portugal). Conclui-se que apesar dos profissionais da informação reconhecerem o valor da participação das bibliotecas académicas na web social e da sua utilização visando o marketi...

  15. In vitro resistance to 5-nitroimidazoles and benzimidazoles in Giardia duodenalis: variability and variation in gene expression.

    Science.gov (United States)

    Argüello-García, Raúl; Cruz-Soto, Maricela; Romero-Montoya, Lydia; Ortega-Pierres, Guadalupe

    2009-12-01

    The susceptibility of Giardia duodenalis trophozoites exposed in vitro to sublethal concentrations of metronidazole (MTZ) and albendazole (ABZ) may exhibit inter-culture (variability) and intra-culture (variation) differences in drug susceptibility. It was previously reported that MTZ-resistant trophozoites may display changes in pyruvate:ferredoxin oxidoreductase (PFOR) expression while changes at the beta-tubulin molecule are apparently absent in ABZ-resistant cultures. To assess the levels of gene expression of these molecules, we obtained cloned cultures growing at concentrations up to 23 microM MTZ (WBRM23) and up to 8muM ABZ (WBRA8) and gene sequence and expression of pfor and beta-tubulin loci were compared with these of drug-susceptible clone WB1. Neither the pfor nor the beta-tubulin genes showed changes at sequence level but the MTZ-resistant clones WBRM21 and WBRM23 showed up-regulation of the pfor RNA using the gdh gene as reference. By using WB1 and WBRA8 clones in representational difference analyses of gene expression (RDA) an insert referred to as ARR-VSP was selected and sequenced. It showed the highest homology to one VSP molecule in the Giardia Genome Database (orf GL50803_101765). This isogene was up-regulated in five ABZ-resistant clones and the clone WBRA8 exhibited the highest RNA expression level. When successive progenies of clones WB1, WBRM23 and WBRA8 were analyzed in Northern blot assays to detect pfor and ARR-VSP RNAs respectively, the expression patterns showed variation for both genes but it was much lower in the clone WBRA8. These results suggest that G. duodenalis cultures either susceptible or resistant to MTZ and ABZ may display variability and variation at RNA expression levels albeit these were more marked in the MTZ-resistant parasites. These data might have further implications defining major mechanisms involved in drug resistance of Giardia. PMID:19481175

  16. Mos1-mediated transgenesis to probe consequences of single gene mutations in variation-rich isolates of Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Maja Tarailo-Graovac

    Full Text Available Caenorhabditis elegans, especially the N2 isolate, is an invaluable biological model system. Numerous additional natural C. elegans isolates have been shown to have unexpected genotypic and phenotypic variations which has encouraged researchers to use next generation sequencing methodology to develop a more complete picture of genotypic variations among the isolates. To understand the phenotypic effects of a genomic variation (GV on a single gene, in a variation-rich genetic background, one should analyze that particular GV in a well understood genetic background. In C. elegans, the analysis is usually done in N2, which requires extensive crossing to bring in the GV. This can be a very time consuming procedure thus it is important to establish a fast and efficient approach to test the effect of GVs from different isolates in N2. Here we use a Mos1-mediated single-copy insertion (MosSCI method for phenotypic assessments of GVs from the variation-rich Hawaiian strain CB4856 in N2. Specifically, we investigate effects of variations identified in the CB4856 strain on tac-1 which is an essential gene that is necessary for mitotic spindle elongation and pronuclear migration. We show the usefulness of the MosSCI method by using EU1004 tac-1(or402 as a control. or402 is a temperature sensitive lethal allele within a well-conserved TACC domain (transforming acidic coiled-coil that results in a leucine to phenylalanine change at amino acid 229. CB4856 contains a variation that affects the second exon of tac-1 causing a cysteine to tryptophan change at amino acid 94 also within the TACC domain. Using the MosSCI method, we analyze tac-1 from CB4856 in the N2 background and demonstrate that the C94W change, albeit significant, does not cause any obvious decrease in viability. This MosSCI method has proven to be a rapid and efficient way to analyze GVs.

  17. Plagio e integridad académica en Alemania

    Directory of Open Access Journals (Sweden)

    2016-07-01

    Full Text Available Alemania es quizá uno de los países europeos que, ya desde el siglo XVIII, ha mantenido un debate público más intenso sobre prácticas científicas y académicas deshonestas, relacionadas especialmente con tesis doctorales. Este debate fue especialmente productivo a finales del siglo XIX, dando lugar desde entonces, para evitar estas prácticas inaceptables, a la obligatoriedad de publicar todas las tesis doctorales, como requisito previo a la expedición del título de doctor por cualquier universidad alemana. Este trabajo analiza los avances más importantes en plagio e integridad académica en Alemania, especialmente después del escándalo surgido en 2011 a raíz del plagio de la tesis doctoral del Ministro de Defensa Guttenberg, como son la creación de una eficaz metodología colaborativa de investigación del plagio en trabajos científicos o académicos utilizando Internet y las redes sociales, materializada en la Wiki «VroniPlag». También se describe someramente en este trabajo la consolidación definitiva de la figura del «Defensor de la Ciencia», como instrumento de ámbito nacional para prevenir, gestionar y combatir la deshonestidad científica, aparte de la publicación en 2013 de una nueva versión del manual de referencia al respecto «Sicherung guter wissenschaftlicher Praxis». Por último se analizan las conclusiones de la experiencia alemana relacionada con la ética académica, también desde una perspectiva histórica, pues sus recientes logros y avances pueden servir de referencia a otros países europeos.

  18. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl;

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  19. Investigation of the effect of ionizing radiation on gene expression variation by the 'DNA chips': feasibility of a biological dosimeter

    International Nuclear Information System (INIS)

    After having described the different biological effects of ionizing radiation and the different approaches to biological dosimetry, and introduced 'DNA chips' or DNA micro-arrays, the author reports the characterization of gene expression variations in the response of cells to a gamma irradiation. Both main aspects of the use DNA chips are investigated: fundamental research and diagnosis. This research thesis thus proposes an analysis of the effect of ionizing radiation using DNA chips, notably by comparing gene expression modifications measured in mouse irradiated lung, heart and kidney. It reports a feasibility study of bio-dosimeter based on expression profiles

  20. rendimiento académico en estudiantes de secundaria

    Directory of Open Access Journals (Sweden)

    Francisco Javier Tejedor-Tejedor

    2008-01-01

    Full Text Available Este trabajo tenía como objetivos comprobar la relación entre variables atencionales y rendimiento académico en la Educación Secundaria Obligatoria y averiguar si el uso de estrategias atencionales varía en función de la edad, grado académico o género de los alumnos. Se aplicó la Escala de Estrategias de Aprendizaje (ACRA a una muestra de 602 sujetos, y se recogieron sus notas finales en junio. Los resultados confirman que las variables atencionales exploración, subrayado lineal, fragmentación y atención, son las que parecen influir más en el rendimiento académico. El análisis correlacional señala un ligero decremento en el uso de las estrategias atencionales a lo largo de esta etapa educativa; y las comparaciones por género, indican que las chicas las utilizan más frecuentemente.

  1. Natural variation of rice blast resistant gene Pi-ta in Oryza species

    Science.gov (United States)

    The Pi-ta gene in rice is a putative NBS type cytoplasmic receptor conferring resistance to races of Magnaporthe oryzae in a gene-for-gene manner. A Functional Nucleotide Polymorphism (FNP) change resulting in an amino acid substitution of Alanine to Serine at position 918 (nucleotide G to T at posi...

  2. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    DEFF Research Database (Denmark)

    Kaas, Rolf Sommer; Rundsten, Carsten Friis; Ussery, David;

    2012-01-01

    for creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps...

  3. Y-linked variation for autosomal immune gene regulation has the potential to shape sexually dimorphic immunity.

    Science.gov (United States)

    Kutch, Ian C; Fedorka, Kenneth M

    2015-12-01

    Sexually dimorphic phenotypes arise from the differential expression of male and female shared genes throughout the genome. Unfortunately, the underlying molecular mechanisms by which dimorphic regulation manifests and evolves are unclear. Recent work suggests that Y-chromosomes may play an important role, given that Drosophila melanogaster Ys were shown to influence the regulation of hundreds of X and autosomal genes. For Y-linked regulatory variation (YRV) to facilitate sexually dimorphic evolution, however, it must exist within populations (where selection operates) and influence male fitness. These criteria have seldom been investigated, leaving the potential for dimorphic evolution via YRV unclear. Interestingly, male and female D. melanogaster differ in immune gene regulation. Furthermore, immune gene regulation appears to be influenced by the Y-chromosome, suggesting it may contribute to dimorphic immune evolution. We address this possibility by introgressing Y-chromosomes from a single wild population into an isogenic background (to create Y-lines) and assessing immune gene regulation and bacterial defence. We found that Y-line males differed in their immune gene regulation and their ability to defend against Serratia marcescens. Moreover, gene expression and bacterial defence were positively genetically correlated. These data indicate that the Y-chromosome has the potential to shape the evolution of sexually dimorphic immunity in this system.

  4. DNA sequence and haplotype variation in two candidate genes for dilated cardiomyopathy in the turkey Meleagris gallopavo.

    Science.gov (United States)

    Lin, Kuan-chin; Xu, Jun; Kamara, Davida; Geng, Tuoyu; Gyenai, Kwaku; Reed, Kent M; Smith, Edward J

    2007-05-01

    Determining variation in genes is fundamental to understanding their function in the disease state. Cardiac troponin T (cTnT) and phospholamban (PLN) genes have been implicated in dilated cardiomyopathy (DCM) in human and model species. To investigate the role of these 2 candidate genes in DCM in the turkey Meleagris gallopavo, understanding sequence variants and map position distribution is necessary. To this end, a total of 1854 and 1771 bp of cTnT and PLN gene sequences, respectively, were scanned for single nucleotide polymorphisms (SNPs) in a randomly bred population. A total of 15 SNPs was identified in the cTnT and PLN genomic sequences. Nine haplotypes, 5 in cTnT and 4 in PLN, were identified. Observed heterozygosities (0.02-0.39) in the turkey population were low for both genes. Within each gene, 1 SNP corresponding to a restriction enzyme site was identified and used to develop a PCR-restriction fragment length polymorphism (RFLP) genotyping assay. The PLN gene was genetically mapped to turkey chromosome 2, equivalent to Gallus gallus chromosome 3, and cTnT mapped to a turkey microchromosome. Although limited because of the relatively small sample size of 55 birds, the data from this SNP analysis of PLN and cTnT provide a foundation from which to evaluate the function of cTnT and PLN in the turkey. Information about the distribution of the SNPs and haplotypes will facilitate future association and linkage studies.

  5. Robust assignment of cancer subtypes from expression data using a uni-variate gene expression average as classifier

    International Nuclear Information System (INIS)

    Genome wide gene expression data is a rich source for the identification of gene signatures suitable for clinical purposes and a number of statistical algorithms have been described for both identification and evaluation of such signatures. Some employed algorithms are fairly complex and hence sensitive to over-fitting whereas others are more simple and straight forward. Here we present a new type of simple algorithm based on ROC analysis and the use of metagenes that we believe will be a good complement to existing algorithms. The basis for the proposed approach is the use of metagenes, instead of collections of individual genes, and a feature selection using AUC values obtained by ROC analysis. Each gene in a data set is assigned an AUC value relative to the tumor class under investigation and the genes are ranked according to these values. Metagenes are then formed by calculating the mean expression level for an increasing number of ranked genes, and the metagene expression value that optimally discriminates tumor classes in the training set is used for classification of new samples. The performance of the metagene is then evaluated using LOOCV and balanced accuracies. We show that the simple uni-variate gene expression average algorithm performs as well as several alternative algorithms such as discriminant analysis and the more complex approaches such as SVM and neural networks. The R package rocc is freely available at http://cran.r-project.org/web/packages/rocc/index.html

  6. Robust assignment of cancer subtypes from expression data using a uni-variate gene expression average as classifier

    Directory of Open Access Journals (Sweden)

    Ryden Tobias

    2010-10-01

    Full Text Available Abstract Background Genome wide gene expression data is a rich source for the identification of gene signatures suitable for clinical purposes and a number of statistical algorithms have been described for both identification and evaluation of such signatures. Some employed algorithms are fairly complex and hence sensitive to over-fitting whereas others are more simple and straight forward. Here we present a new type of simple algorithm based on ROC analysis and the use of metagenes that we believe will be a good complement to existing algorithms. Results The basis for the proposed approach is the use of metagenes, instead of collections of individual genes, and a feature selection using AUC values obtained by ROC analysis. Each gene in a data set is assigned an AUC value relative to the tumor class under investigation and the genes are ranked according to these values. Metagenes are then formed by calculating the mean expression level for an increasing number of ranked genes, and the metagene expression value that optimally discriminates tumor classes in the training set is used for classification of new samples. The performance of the metagene is then evaluated using LOOCV and balanced accuracies. Conclusions We show that the simple uni-variate gene expression average algorithm performs as well as several alternative algorithms such as discriminant analysis and the more complex approaches such as SVM and neural networks. The R package rocc is freely available at http://cran.r-project.org/web/packages/rocc/index.html.

  7. Genetic Variation and Divergence of Genes Involved in Leaf Adaxial-Abaxial Polarity Establishment in Brassica rapa.

    Science.gov (United States)

    Liang, Jianli; Liu, Bo; Wu, Jian; Cheng, Feng; Wang, Xiaowu

    2016-01-01

    Alterations in leaf adaxial-abaxial (ad-ab) polarity are one of the main factors that influence leaf curvature. In Chinese cabbage, leaf incurvature is an essential prerequisite to the formation of a leafy head. Identifying ad-ab patterning genes and investigating their genetic variation may facilitate elucidation of the mechanisms underlying leaf incurvature during head formation. Comparative genomic analysis of 45 leaf ad-ab patterning genes in Brassica rapa based on 26 homologs of Arabidopsis thaliana indicated that these genes underwent expansion and were retained after whole genome triplication (WGT). We also assessed the nucleotide diversity and selection footprints of these 45 genes in a collection of 94 Brassica rapa accessions that were composed of heading and non-heading morphotypes. Six of the 45 genes showed significant negative Tajima's D indices and nucleotide diversity reduction in heading accessions compared to those in non-heading accessions, indicating that they underwent purifying selection. Further testing of the BrARF3.1 gene, which was one of the selection signals from a larger collection, confirmed that purifying selection did occur. Our results provide genetic evidence that ad-ab patterning genes are involved in leaf incurvature, which is associated with formation of a leafy head, as well as promote an understanding of the genetic mechanism underlying leafy head formation in Chinese cabbage. PMID:26904064

  8. Genetic Variation and Divergence of Genes Involved in Leaf Adaxial-abaxial Polarity Establishment in Brassica rapa

    Directory of Open Access Journals (Sweden)

    Jianli eLiang

    2016-02-01

    Full Text Available Alterations in leaf adaxial–abaxial (ad-ab polarity are one of the main factors that are responsible for leaf curvature. In Chinese cabbage, to form a leafy head, leaf incurvature is an essential prerequisite. Identifying ad-ab patterning genes and investigating its genetic variations will facilitate in elucidating the mechanism underlying leaf incurvature during head formation. In the present study we conducted comparative genomic analysis of the identification of 45 leaf ad-ab patterning genes in Brassica rapa based on 26 homologs in Arabidopsis thaliana, indicating that these genes underwent expansion and were retained after whole genome triplication (WGT. We also assessed the nucleotide diversity and selection footprints of these 45 genes in a collection of 94 Brassica rapa accessions that were composed of heading and non-heading morphotypes. Six of the 45 genes showed significant negative Tajima’s D indices and nucleotide diversity reduction in heading accessions compared to that in non-heading accessions, indicating that these underwent purifying selection. Further testing of the BrARF3.1 gene, which was one of the selection signals from a larger collection, confirmed that purifying selection did occur. Our results provide genetic evidence that ad-ab patterning genes are involved in leaf incurvature that is associated in the formation of a leafy head, as well as promote an understanding of the genetic mechanism underlying leafy head formation in Chinese cabbage.

  9. Screening of the FcεRI-β-Gene in a Swiss Population of Asthmatic Children: No Association with E237G and Identification of New Sequence Variations

    Directory of Open Access Journals (Sweden)

    M. Rohrbach

    1998-01-01

    Full Text Available Background: The gene of the beta subunit of the high affinity receptor for IgE (FcεRI-β encoded on chromosome 11q13 has recently been identified as a candidate gene for asthma and atopy. Two coding variations, E237G and I181L have been described as being associated with asthma and atopy. Our aim was to investigate a Swiss population of atopic and asthmatic children for variations in this gene.

  10. SNP and gene networks construction and analysis from classification of copy number variations data

    OpenAIRE

    Liu, Yang; Lee, Yiu Fai; Ng, Michael K.

    2011-01-01

    Background Detection of genomic DNA copy number variations (CNVs) can provide a complete and more comprehensive view of human disease. It is interesting to identify and represent relevant CNVs from a genome-wide data due to high data volume and the complexity of interactions. Results In this paper, we incorporate the DNA copy number variation data derived from SNP arrays into a computational shrunken model and formalize the detection of copy number variations as a case-control classification ...

  11. S-SCAM, A Rare Copy Number Variation Gene, Induces Schizophrenia-Related Endophenotypes in Transgenic Mouse Model

    OpenAIRE

    Zhang, Nanyan; Zhong, PENG; Shin, Seung Min; Metallo, Jacob; Danielson, Eric; Olsen, Christopher M.; Liu, Qing-song; Lee, Sang H.

    2015-01-01

    Accumulating genetic evidence suggests that schizophrenia (SZ) is associated with individually rare copy number variations (CNVs) of diverse genes, often specific to single cases. However, the causality of these rare mutations remains unknown. One of the rare CNVs found in SZ cohorts is the duplication of Synaptic Scaffolding Molecule (S-SCAM, also called MAGI-2), which encodes a postsynaptic scaffolding protein controlling synaptic AMPA receptor levels, and thus the strength of excitatory sy...

  12. Genetic Variations in Xenobiotic Metabolic Pathway Genes, Personal Hair Dye Use, and Risk of Non-Hodgkin Lymphoma

    OpenAIRE

    Zhang, Yawei; Hughes, Kathryn J.; Zahm, Shelia Hoar; Zhang, Yaqun; Holford, Theodore R.; Dai, Li; Bai, Yana; Han, Xuesong; Qin, Qin; Lan, Qing; Rothman, Nathaniel; Zhu, Yong; Leaderer, Brian; Zheng, Tongzhang

    2009-01-01

    From 1996 to 2000, the authors conducted a population-based case-control study among Connecticut women to test the hypothesis that genetic variation in xenobiotic metabolic pathway genes modifies the relation between hair dye use and risk of non-Hodgkin lymphoma. No effect modifications were found for women who started using hair dyes in 1980 or afterward. For women who started using hair dye before 1980 as compared with never users, a statistically significantly increased risk of non-Hodgkin...

  13. Genome-wide association implicates numerous genes and pleiotropy underlying ecological trait variation in natural populations of Populus trichocarpa

    Energy Technology Data Exchange (ETDEWEB)

    McKown, Athena [University of British Columbia, Vancouver; Klapste, Jaroslav [University of British Columbia, Vancouver; Guy, Robert [University of British Columbia, Vancouver; Geraldes, Armando [University of British Columbia, Vancouver; Porth, Ilga [University of British Columbia, Vancouver; Hannemann, Jan [University of Victoria, Canada; Friedmann, Michael [University of British Columbia, Vancouver; Muchero, Wellington [ORNL; Tuskan, Gerald A [ORNL; Ehlting, Juergen [University of Victoria, Canada; Cronk, Quentin [University of British Columbia, Vancouver; El-Kassaby, Yousry [University of British Columbia, Vancouver; Mansfield, Shawn [University of British Columbia, Vancouver; Douglas, Carl [University of British Columbia, Vancouver

    2014-01-01

    To uncover the genetic basis of phenotypic trait variation, we used 448 unrelated wild accessions of black cottonwood (Populus trichocarpa Torr. & Gray) from natural populations throughout western North America. Extensive information from large-scale trait phenotyping (with spatial and temporal replications within a common garden) and genotyping (with a 34K Populus SNP array) of all accessions were used for gene discovery in a genome-wide association study (GWAS).

  14. Genetic Variation of the Borrelia burgdorferi Gene vlsE Involves Cassette-Specific, Segmental Gene Conversion

    OpenAIRE

    Zhang, Jing-Ren; Norris, Steven J

    1998-01-01

    The Lyme disease spirochete Borrelia burgdorferi possesses 15 silent vls cassettes and a vls expression site (vlsE) encoding a surface-exposed lipoprotein. Segments of the silent vls cassettes have been shown to recombine with the vlsE cassette region in the mammalian host, resulting in combinatorial antigenic variation. Despite promiscuous recombination within the vlsE cassette region, the 5′ and 3′ coding sequences of vlsE that flank the cassette region are not subject to sequence variation...

  15. Identification of a New Variable Sequence in the P1 Cytadhesin Gene of Mycoplasma pneumoniae: Evidence for the Generation of Antigenic Variation by DNA Recombination between Repetitive Sequences

    OpenAIRE

    Kenri, Tsuyoshi; Taniguchi, Rie; Sasaki, Yuko; Okazaki, Norio; Narita, Mitsuo; Izumikawa, Kinichi; Umetsu, Masao; Sasaki, Tsuguo

    1999-01-01

    A Mycoplasma pneumoniae cytadhesin P1 gene with novel nucleotide sequence variation has been identified. Four clinical strains of M. pneumoniae were found to carry this type of P1 gene. This new P1 gene is similar to the known group II P1 genes but possesses novel sequence variation of approximately 300 bp in the RepMP2/3 region. The position of the new variable region is distant from the previously reported variable regions known to differ between group I and II P1 genes. Two sequences close...

  16. Molecular Evolution and Genetic Variation of G2-Like Transcription Factor Genes in Maize.

    Science.gov (United States)

    Liu, Fang; Xu, Yunjian; Han, Guomin; Zhou, Lingyan; Ali, Asif; Zhu, Suwen; Li, Xiaoyu

    2016-01-01

    The productivity of maize (Zea mays L.) depends on the development of chloroplasts, and G2-like transcription factors play a central role in regulating chloroplast development. In this study, we identified 59 G2-like genes in the B73 maize genome and systematically analyzed these genes at the molecular and evolutionary levels. Based on gene structure character, motif compositions and phylogenetic analysis, maize G2-like genes (ZmG1- ZmG59) were divided into seven groups (I-VII). By synteny analysis, 18 collinear gene pairs and strongly conserved microsyntny among regions hosting G2-like genes across maize and sorghum were found. Here, we showed that the vast majority of ZmG gene duplications resulted from whole genome duplication events rather than tandem duplications. After gene duplication events, some ZmG genes were silenced. The functions of G2-like genes were multifarious and most genes that are expressed in green tissues may relate to maize photosynthesis. The qRT-PCR showed that the expression of these genes was sensitive to low temperature and drought. Furthermore, we analyzed differences of ZmGs specific to cultivars in temperate and tropical regions at the population level. Interestingly, the single nucleotide polymorphism (SNP) analysis revealed that nucleotide polymorphism associated with different temperature zones. Above all, G2-like genes were highly conserved during evolution, but polymorphism could be caused due to a different geographical location. Moreover, G2-like genes might be related to cold and drought stresses. PMID:27560803

  17. Gene Expression Variation Resolves Species and Individual Strains among Coral-Associated Dinoflagellates within the Genus Symbiodinium.

    Science.gov (United States)

    Parkinson, John E; Baumgarten, Sebastian; Michell, Craig T; Baums, Iliana B; LaJeunesse, Todd C; Voolstra, Christian R

    2016-03-01

    Reef-building corals depend on symbiotic mutualisms with photosynthetic dinoflagellates in the genus Symbiodinium. This large microalgal group comprises many highly divergent lineages ("Clades A-I") and hundreds of undescribed species. Given their ecological importance, efforts have turned to genomic approaches to characterize the functional ecology of Symbiodinium. To date, investigators have only compared gene expression between representatives from separate clades-the equivalent of contrasting genera or families in other dinoflagellate groups-making it impossible to distinguish between clade-level and species-level functional differences. Here, we examined the transcriptomes of four species within one Symbiodinium clade (Clade B) at ∼20,000 orthologous genes, as well as multiple isoclonal cell lines within species (i.e., cultured strains). These species span two major adaptive radiations within Clade B, each encompassing both host-specialized and ecologically cryptic taxa. Species-specific expression differences were consistently enriched for photosynthesis-related genes, likely reflecting selection pressures driving niche diversification. Transcriptional variation among strains involved fatty acid metabolism and biosynthesis pathways. Such differences among individuals are potentially a major source of physiological variation, contributing to the functional diversity of coral holobionts composed of unique host-symbiont genotype pairings. Our findings expand the genomic resources available for this important symbiont group and emphasize the power of comparative transcriptomics as a method for studying speciation processes and interindividual variation in nonmodel organisms. PMID:26868597

  18. Gene Expression Variation Resolves Species and Individual Strains among Coral-Associated Dinoflagellates within the Genus Symbiodinium.

    Science.gov (United States)

    Parkinson, John E; Baumgarten, Sebastian; Michell, Craig T; Baums, Iliana B; LaJeunesse, Todd C; Voolstra, Christian R

    2016-03-01

    Reef-building corals depend on symbiotic mutualisms with photosynthetic dinoflagellates in the genus Symbiodinium. This large microalgal group comprises many highly divergent lineages ("Clades A-I") and hundreds of undescribed species. Given their ecological importance, efforts have turned to genomic approaches to characterize the functional ecology of Symbiodinium. To date, investigators have only compared gene expression between representatives from separate clades-the equivalent of contrasting genera or families in other dinoflagellate groups-making it impossible to distinguish between clade-level and species-level functional differences. Here, we examined the transcriptomes of four species within one Symbiodinium clade (Clade B) at ∼20,000 orthologous genes, as well as multiple isoclonal cell lines within species (i.e., cultured strains). These species span two major adaptive radiations within Clade B, each encompassing both host-specialized and ecologically cryptic taxa. Species-specific expression differences were consistently enriched for photosynthesis-related genes, likely reflecting selection pressures driving niche diversification. Transcriptional variation among strains involved fatty acid metabolism and biosynthesis pathways. Such differences among individuals are potentially a major source of physiological variation, contributing to the functional diversity of coral holobionts composed of unique host-symbiont genotype pairings. Our findings expand the genomic resources available for this important symbiont group and emphasize the power of comparative transcriptomics as a method for studying speciation processes and interindividual variation in nonmodel organisms.

  19. Gene expression variation resolves species and individual strains among coral-associated dinoflagellates within the genus Symbiodinium

    KAUST Repository

    Parkinson, John Everett

    2016-02-11

    Reef-building corals depend on symbiotic mutualisms with photosynthetic dinoflagellates in the genus Symbiodinium. This large microalgal group comprises many highly divergent lineages (“Clades A-I”) and hundreds of undescribed species. Given their ecological importance, efforts have turned to genomic approaches to characterize the functional ecology of Symbiodinium. To date, investigators have only compared gene expression between representatives from separate clades—the equivalent of contrasting genera or families in other dinoflagellate groups—making it impossible to distinguish between clade-level and species-level functional differences. Here, we examined the transcriptomes of four species within one Symbiodinium clade (Clade B) at ~20,000 orthologous genes, as well as multiple isoclonal cell lines within species (i.e. cultured strains). These species span two major adaptive radiations within Clade B, each encompassing both host-specialized and ecologically cryptic taxa. Species-specific expression differences were consistently enriched for photosynthesis-related genes, likely reflecting selection pressures driving niche diversification. Transcriptional variation among strains involved fatty acid metabolism and biosynthesis pathways. Such differences among individuals are potentially a major source of physiological variation, contributing to the functional diversity of coral holobionts composed of unique host-symbiont genotype pairings. Our findings expand the genomic resources available for this important symbiont group and emphasize the power of comparative transcriptomics as a method for studying speciation processes and inter-individual variation in non-model organisms.

  20. Differentially expressed genes linked to natural variation in long-term memory formation in Cotesia parasitic wasps

    Directory of Open Access Journals (Sweden)

    Joke J. F. A. Van Vugt

    2015-09-01

    Full Text Available Even though learning and memory are universal traits in the Animal Kingdom, closely related species reveal substantial variation in learning rate and memory dynamics. To determine the genetic background of this natural variation, we studied two congeneric parasitic wasp species, Cotesia glomerata and C. rubecula, which lay their eggs in caterpillars of the large and small cabbage white butterfly. A successful egg laying event serves as an unconditioned stimulus in a classical conditioning paradigm, where plant odors become associated to the encounter of a suitable host caterpillar. Depending on the host species, the number of conditioning trials and the parasitic wasp species, three different types of transcription-dependent long-term memory (LTM and one type of transcription-independent, anesthesia-resistant memory (ARM can be distinguished. To identify transcripts underlying these differences in memory formation, we isolated mRNA from parasitic wasp heads at three different time points between induction and consolidation of each of the four memory types, and for each sample three biological replicates, where after strand-specific paired-end 100 bp deep sequencing. Transcriptomes were assembled de novo and differential expression was determined for each memory type and time point after conditioning, compared to unconditioned wasps. Most differentially expressed (DE genes and antisense transcripts were only DE in one of the LTM types. Among the DE genes that were DE in two or more LTM types, were many protein kinases and phosphatases, small GTPases, receptors and ion channels. Some genes were DE in opposing directions between any of the LTM memory types and ARM, suggesting that ARM in Cotesia requires the transcription of genes inhibiting LTM or vice versa. We discuss our findings in the context of neuronal functioning, including RNA splicing and transport, epigenetic regulation, neurotransmitter/peptide synthesis and antisense transcription. In

  1. Multi-allelic major effect genes interact with minor effect QTLs to control adaptive color pattern variation in Heliconius erato.

    Directory of Open Access Journals (Sweden)

    Riccardo Papa

    Full Text Available Recent studies indicate that relatively few genomic regions are repeatedly involved in the evolution of Heliconius butterfly wing patterns. Although this work demonstrates a number of cases where homologous loci underlie both convergent and divergent wing pattern change among different Heliconius species, it is still unclear exactly how many loci underlie pattern variation across the genus. To address this question for Heliconius erato, we created fifteen independent crosses utilizing the four most distinct color pattern races and analyzed color pattern segregation across a total of 1271 F2 and backcross offspring. Additionally, we used the most variable brood, an F2 cross between H. himera and the east Ecuadorian H. erato notabilis, to perform a quantitative genetic analysis of color pattern variation and produce a detailed map of the loci likely involved in the H. erato color pattern radiation. Using AFLP and gene based markers, we show that fewer major genes than previously envisioned control the color pattern variation in H. erato. We describe for the first time the genetic architecture of H. erato wing color pattern by assessing quantitative variation in addition to traditional linkage mapping. In particular, our data suggest three genomic intervals modulate the bulk of the observed variation in color. Furthermore, we also identify several modifier loci of moderate effect size that contribute to the quantitative wing pattern variation. Our results are consistent with the two-step model for the evolution of mimetic wing patterns in Heliconius and support a growing body of empirical data demonstrating the importance of major effect loci in adaptive change.

  2. Social context-induced song variation affects female behavior and gene expression.

    Directory of Open Access Journals (Sweden)

    Sarah C Woolley

    2008-03-01

    Full Text Available Social cues modulate the performance of communicative behaviors in a range of species, including humans, and such changes can make the communication signal more salient. In songbirds, males use song to attract females, and song organization can differ depending on the audience to which a male sings. For example, male zebra finches (Taeniopygia guttata change their songs in subtle ways when singing to a female (directed song compared with when they sing in isolation (undirected song, and some of these changes depend on altered neural activity from a specialized forebrain-basal ganglia circuit, the anterior forebrain pathway (AFP. In particular, variable activity in the AFP during undirected song is thought to actively enable syllable variability, whereas the lower and less-variable AFP firing during directed singing is associated with more stereotyped song. Consequently, directed song has been suggested to reflect a "performance" state, and undirected song a form of vocal motor "exploration." However, this hypothesis predicts that directed-undirected song differences, despite their subtlety, should matter to female zebra finches, which is a question that has not been investigated. We tested female preferences for this natural variation in song in a behavioral approach assay, and we found that both mated and socially naive females could discriminate between directed and undirected song-and strongly preferred directed song. These preferences, which appeared to reflect attention especially to aspects of song variability controlled by the AFP, were enhanced by experience, as they were strongest for mated females responding to their mate's directed songs. We then measured neural activity using expression of the immediate early gene product ZENK, and found that social context and song familiarity differentially modulated the number of ZENK-expressing cells in telencephalic auditory areas. Specifically, the number of ZENK-expressing cells in the

  3. Neonatal multiorgan failure due to ACAD9 mutation and complex I deficiency with mitochondrial hyperplasia in liver, cardiac myocytes, skeletal muscle, and renal tubules.

    Science.gov (United States)

    Leslie, Nancy; Wang, Xinjian; Peng, Yanyan; Valencia, C Alexander; Khuchua, Zaza; Hata, Jessica; Witte, David; Huang, Taosheng; Bove, Kevin E

    2016-03-01

    Complex I deficiency causes Leigh syndrome, fatal infant lactic acidosis, and neonatal cardiomyopathy. Mutations in more than 100 nuclear DNA and mitochondrial DNA genes miscode for complex I subunits or assembly factors. ACAD9 is an acyl-CoA dehydrogenase with a novel function in assembly of complex I; biallelic mutations cause progressive encephalomyopathy, recurrent Reye syndrome, and fatal cardiomyopathy. We describe the first autopsy in fatal neonatal lethal lactic acidosis due to mutations in ACAD9 that reduced complex I activity. We identified mitochondrial hyperplasia in cardiac myocytes, diaphragm muscle, and liver and renal tubules in formalin-fixed, paraffin-embedded tissue using immunohistochemistry for mitochondrial antigens. Whole-exome sequencing revealed compound heterozygous variants in the ACAD9 gene: c.187G>T (p.E63*) and c.941T>C (p.L314P). The nonsense mutation causes late infantile lethality; the missense variant is novel. Autopsy-derived fibroblasts had reduced complex I activity (53% of control) with normal activity in complexes II to IV, similar to reported cases of ACAD9 deficiency.

  4. No Association between Variation in Longevity Candidate Genes and Aging-related Phenotypes in Oldest-old Danes

    DEFF Research Database (Denmark)

    Thinggaard, Mette Sørensen; Nygaard, Marianne; Debrabant, Birgit;

    2016-01-01

    In this study we explored the association between aging-related phenotypes previously reported to predict survival in old age and variation in 77 genes from the DNA repair pathway, 32 genes from the growth hormone 1/ insulin-like growth factor 1/insulin (GH/IGF-1/INS) signalling pathway and 16...... additional genes repeatedly considered as candidates for human longevity: APOE, APOA4, APOC3, ACE, CETP, HFE, IL6, IL6R, MTHFR, TGFB1, SIRTs 1, 3, 6; and HSPAs 1A, 1L, 14. Altogether, 1,049 single nucleotide polymorphisms (SNPs) were genotyped in 1,088 oldest-old (age 92-93 years) Danes and analysed...... in the relevant phenotype over time (7 years of follow-up) and none of the SNPs could be confirmed in a replication sample of 1,281 oldest-old Danes (age 94-100). Hence, our study does not support association between common variation in the investigated longevity candidate genes and aging-related phenotypes...

  5. Genetic Variation in Cell Death Genes and Risk of Non-Hodgkin Lymphoma

    OpenAIRE

    Johanna M. Schuetz; Denise Daley; Jinko Graham; Berry, Brian R.; Gallagher, Richard P.; Connors, Joseph M; Gascoyne, Randy D.; Spinelli, John J.; Angela R Brooks-Wilson

    2012-01-01

    BACKGROUND: Non-Hodgkin lymphomas are a heterogeneous group of solid tumours that constitute the 5(th) highest cause of cancer mortality in the United States and Canada. Poor control of cell death in lymphocytes can lead to autoimmune disease or cancer, making genes involved in programmed cell death of lymphocytes logical candidate genes for lymphoma susceptibility. MATERIALS AND METHODS: We tested for genetic association with NHL and NHL subtypes, of SNPs in lymphocyte cell death genes using...

  6. Variations of the perforin gene in patients with chronic inflammatory demyelinating polyradiculoneuropathy.

    Science.gov (United States)

    Buttini, S; Cappellano, G; Ripellino, P; Briani, C; Cocito, D; Osio, M; Cantello, R; Dianzani, U; Comi, C

    2015-01-01

    Perforin (PRF) has a key role in the function of cytotoxic T and natural killer cells. Rare variations of PRF1 predispose to autoimmunity. Chronic inflammatory demyelinating polyradiculoneuropathy (CIDP) is an autoimmune disease of the peripheral nervous system, involving defective lymphocyte apoptosis. The aim of this study was to investigate the role of PRF1 in CIDP. The entire coding region of PRF1 was sequenced in 94 patients and 158 controls. We found three missense variations leading to amino acid substitutions and one nonsense variation resulting in a premature stop codon. All variations would decrease PRF activity. Their overall frequency was significantly higher in patients than in controls (odds ratio (OR)=4.47). The most frequent variation was p.Ala91Val (OR=3.92) previously associated with other autoimmune diseases. Clinical analysis showed that PRF1 variations were more frequent in relapsing patients and in patients displaying axonal damage. These data suggest that PRF1 variations may influence CIDP development and course.

  7. Balancing selection at the tomato RCR3 Guardee gene family maintains variation in strength of pathogen defense.

    Directory of Open Access Journals (Sweden)

    Anja C Hörger

    Full Text Available Coevolution between hosts and pathogens is thought to occur between interacting molecules of both species. This results in the maintenance of genetic diversity at pathogen antigens (or so-called effectors and host resistance genes such as the major histocompatibility complex (MHC in mammals or resistance (R genes in plants. In plant-pathogen interactions, the current paradigm posits that a specific defense response is activated upon recognition of pathogen effectors via interaction with their corresponding R proteins. According to the "Guard-Hypothesis," R proteins (the "guards" can sense modification of target molecules in the host (the "guardees" by pathogen effectors and subsequently trigger the defense response. Multiple studies have reported high genetic diversity at R genes maintained by balancing selection. In contrast, little is known about the evolutionary mechanisms shaping the guardee, which may be subject to contrasting evolutionary forces. Here we show that the evolution of the guardee RCR3 is characterized by gene duplication, frequent gene conversion, and balancing selection in the wild tomato species Solanum peruvianum. Investigating the functional characteristics of 54 natural variants through in vitro and in planta assays, we detected differences in recognition of the pathogen effector through interaction with the guardee, as well as substantial variation in the strength of the defense response. This variation is maintained by balancing selection at each copy of the RCR3 gene. Our analyses pinpoint three amino acid polymorphisms with key functional consequences for the coevolution between the guardee (RCR3 and its guard (Cf-2. We conclude that, in addition to coevolution at the "guardee-effector" interface for pathogen recognition, natural selection acts on the "guard-guardee" interface. Guardee evolution may be governed by a counterbalance between improved activation in the presence and prevention of auto-immune responses in

  8. Looking at the origin of phenotypic variation from pattern formation gene networks

    Indian Academy of Sciences (India)

    Isaac Salazar-Ciudad

    2009-10-01

    This article critically reviews some widespread views about the overall functioning of development. Special attention is devoted to views in developmental genetics about the superstructure of developmental gene networks. According to these views gene networks are hierarchic and multilayered. The highest layers partition the embryo in large coarse areas and control downstream genes that subsequently subdivide the embryo into smaller and smaller areas. These views are criticized on the bases of developmental and evolutionary arguments. First, these views, although detailed at the level of gene identities, do not incorporate morphogenetic mechanisms nor do they try to explain how morphology changes during development. Often, they assume that morphogenetic mechanisms are subordinate to cell signaling events. This is in contradiction to the evidence reviewed herein. Experimental evidence on pattern formation also contradicts the view that developmental gene networks are hierarchically multilayered and that their functioning is decodable from promoter analysis. Simple evolutionary arguments suggest that, indeed, developmental gene networks tend to be non-hierarchic. Re-use leads to extensive modularity in gene networks while developmental drift blurs this modularity. Evolutionary opportunism makes developmental gene networks very dependent on epigenetic factors.

  9. Association between genetic variation in the oxytocin receptor gene and emotional withdrawal, but not between oxytocin pathway genes and diagnosis in psychotic disorders.

    Directory of Open Access Journals (Sweden)

    Marit eHaram

    2015-01-01

    Full Text Available Social dysfunction is common in patients with psychotic disorders. Oxytocin is a neuropeptide with a central role in social behaviour. This study aims to explore the relationship between oxytocin pathway genes and symptoms related to social dysfunction in patients with psychotic disorders. We performed association analyses between four oxytocin pathway genes (OXT, OXTR, AVP, CD38 and four areas of social behaviour-related psychopathology as measured by Positive and Negative Syndrome Scale (PANSS. For this purpose, we used both a polygenic risk score (PGRS and single OXTR candidate SNPs previously reported in the literature (rs53576, rs237902, rs2254298. A total of 734 subjects with DSM-IV psychotic spectrum disorders and 420 healthy controls were included. Oxytocin pathway PGRSs were calculated based on the independent Psychiatric Genomics Consortium study sample. There was a significant association between symptom of Emotional Withdrawal and the previously reported OXTR risk allele A in rs53576. No significant associations between oxytocin pathway gene variants and a diagnosis of psychotic disorder were found. Our findings indicate that while oxytocin pathway genes do not appear to contribute to the susceptibility to psychotic disorders, variations in the OXTR gene might play a role in the development of impaired social behaviour.

  10. Effects of Genetic Drift and Gene Flow on the Selective Maintenance of Genetic Variation

    OpenAIRE

    Star, Bastiaan; Spencer, Hamish G.

    2013-01-01

    Explanations for the genetic variation ubiquitous in natural populations are often classified by the population–genetic processes they emphasize: natural selection or mutation and genetic drift. Here we investigate models that incorporate all three processes in a spatially structured population, using what we call a construction approach, simulating finite populations under selection that are bombarded with a steady stream of novel mutations. As expected, the amount of genetic variation compa...

  11. Natural Genetic Variation in Cassava (Manihot esculenta Crantz) Landraces: A Tool for Gene Discovery

    International Nuclear Information System (INIS)

    Cassava landraces are the earliest form of the modern cultivars and represent the first step in cassava domestication. Our forward genetic analysis uses this resource to discover spontaneous mutations in the sucrose/ starch and carotenoid synthesis/accumulation and to develop both an evolutionary and breeding perspective of gene function related to those traits. Biochemical phenotype variants for the synthesis and accumulation of carotenoid, free sugar and starch were identified. Six subtractive cDNA libraries were prepared to construct a high quality (phred > 20) EST database with 1,645 entries. Macroarray and micro-array analysis was performed to identify differentially expressed genes aiming to identify candidate genes related to sugary phenotype and carotenoid diversity. cDNA sequence for gene coding for specific enzymes in the two pathways was obtained. Gene expression analysis for coding specific enzymes was performed by RNA blot and Real Time PCR analysis. Chromoplast-associated proteins of yellow storage root were fractionated and a peptide sequence database with 906 entries sequences (MASCOT validated) was constructed. For the sucrose/starch, metabolism a sugary class of cassava was identified, carrying a mutation in the BEI and GBSS genes. For the pigmented cassava, a pink color phenotype showed absence of expression of the gene CasLYB, while an intense yellow phenotype showed a down regulation of the gene CasHYb. Heat shock proteins were identified as the major proteins associated with carotenoid. Genetic diversity for the GBSS gene in the natural population identified 22 haplotypes and a large nucleotide diversity in four subsets of population. Single segregating population derived from F2, half-sibling and S1 population showed segregation for sugary phenotype (93% of individuals), waxy phenotype (38% of individuals) and glycogen like starch (2% of individuals). Here we summarize our current results for the genetic analysis of these variants and recent

  12. Spatial and temporal variation in selection of genes associated with pearl millet varietal quantitative traits in situ

    Directory of Open Access Journals (Sweden)

    Cedric Mariac

    2016-07-01

    Full Text Available Ongoing global climate changes imply new challenges for agriculture. Whether plants and crops can adapt to such rapid changes is still a widely debated question. We previously showed adaptation in the form of earlier flowering in pearl millet at the scale of a whole country over three decades. However, this analysis did not deal with variability of year to year selection. To understand and possibly manage plant and crop adaptation, we need more knowledge of how selection acts in situ. Is selection gradual, abrupt, and does it vary in space and over time? In the present study, we tracked the evolution of allele frequency in two genes associated with pearl millet phenotypic variation in situ. We sampled 17 populations of cultivated pearl millet over a period of two years. We tracked changes in allele frequencies in these populations by genotyping more than seven thousand individuals. We demonstrate that several allele frequencies changes are compatible with selection, by correcting allele frequency changes associated with genetic drift. We found marked variation in allele frequencies from year to year, suggesting a variable selection effect in space and over time. We estimated the strength of selection associated with variations in allele frequency. Our results suggest that the polymorphism maintained at the genes we studied is partially explained by the spatial and temporal variability of selection. In response to environmental changes, traditional pearl millet varieties could rapidly adapt thanks to this available functional variability.

  13. [Nucleotide variation in the mitochondrial DNA cytochrome oxidase 1 gene in the Siberian sucker (Catostomus catostomus rostratus) from Kolyma River].

    Science.gov (United States)

    Bachevskaja, L T; Pereverzeva, V V; Ivanova, G D; Agapova, G A

    2014-10-01

    This study presents the data of the first molecular genetic analysis of the Siberian sucker from Kolyma River. Polymorphism of the mtDNA cytochrome oxidase 1 gene was established. Comparative sequence analysis of the gene examined and the GenBank variants characterizing suckers from the rivers of Canada enabled the suggestion that the sucker penetrated to Asia from North America approximately at the end of Early and the beginning of the Middle Pleistocene. It was demonstrated that intrapopulation genetic variation in the Siberian sucker accounted for 11.63% of total variation, while the proportion of the intergroup, component (Fst) constituted 88.37%. It seems likely that a considerable proportion of intergroup variation was caused by the long period of isolation of the Siberian sucker in Kolyma River. The prevalence of one common haplotype, CH-COI 1, in the sample examined indicates that the founder effect played an importaht role in the history of the formation of the Kolyma population. PMID:25720253

  14. Multiple Cis-Acting Sequences Contribute to Evolved Regulatory Variation for Drosophila Adh Genes

    Science.gov (United States)

    Fang, X. M.; Brennan, M. D.

    1992-01-01

    Drosophila affinidisjuncta and Drosophila hawaiiensis are closely related species that display distinct tissue-specific expression patterns for their homologous alcohol dehydrogenase genes (Adh genes). In Drosophila melanogaster transformants, both genes are expressed at high levels in the larval and adult fat bodies, but the D. affinidisjuncta gene is expressed 10-50-fold more strongly in the larval and adult midguts and Malpighian tubules. The present study reports the mapping of cis-acting sequences contributing to the regulatory differences between these two genes in transformants. Chimeric genes were constructed and introduced into the germ line of D. melanogaster. Stage- and tissue-specific expression patterns were determined by measuring steady-state RNA levels in larvae and adults. Three portions of the promoter region make distinct contributions to the tissue-specific regulatory differences between the native genes. Sequences immediately upstream of the distal promoter have a strong effect in the adult Malpighian tubules, while sequences between the two promoters are relatively important in the larval Malpighian tubules. A third gene segment, immediately upstream of the proximal promoter, influences levels of the proximal Adh transcript in all tissues and developmental stages examined, and largely accounts for the regulatory difference in the larval and adult midguts. However, these as well as other sequences make smaller contributions to various aspects of the tissue-specific regulatory differences. In addition, some chimeric genes display aberrant RNA levels for the whole organism, suggesting close physical association between sequences involved in tissue-specific regulatory differences and those important for Adh expression in the larval and adult fat bodies. PMID:1644276

  15. Natural genetic variation in cassava (Manihot esculenta Crantz) landraces as a tool for gene discovery

    International Nuclear Information System (INIS)

    Cassava landraces are the earliest form of the modern cultivars and represents the first step in cassava domestication. Our forward genetic analysis uses this resource to discover spontaneous mutations in the sucrose/starch and carotenoid synthesis/accumulation and to develop both evolutionary and breeding perspective of gene function related to those traits. Biochemical phenotype variants for the synthesis and accumulation of carotenoid, free sugar and starch were identified. Six subtractive cDNA libraries were prepared to construct a high quality (phred > 20) EST database with 1645 entries. Macroarray analysis was performed to identify differentially expressed gene aiming to identify candidate gene related to sugary phenotype. cDNA sequence for gene coding for specific enzymes in the two pathways were obtained. Gene expression analysis for coding specific enzymes was performed by RNA blot and Real Time PCR analysis. Chromoplastassociated proteins of yellow storage root were fractionated and a peptide sequence data base with 906 entries sequences (MASCOT validated) was constructed. For the sucrose/starch metabolism a sugary class of cassava was identified carrying mutation in the BEI and GBSS mutation. For the pigmented cassava a pink color phenotype showed absence of expression of the gene CasLYB while an intense yellow phenotype showed a down regulation of the gene CasHYb. Heat shock proteins were identified as the major proteins associated with chromoplast. Genetic diversity for the GBSS gene in the natural population identified 22 haplotype and a large nucleotide diversity in four subset of population. Single segregating population derived from F2, half sib and S1 population showed segregation for sugary phenotype (93% of the individuals), waxy phenotype (38% of the individuals) and glycogen like starch (2% of the individuals). Here we summarize our current results for the genetic analysis of this variants and recent progress in the direction of mapping of

  16. Genome-wide copy number variation study associates metabotropic glutamate receptor gene networks with attention deficit hyperactivity disorder

    Science.gov (United States)

    Elia, Josephine; Glessner, Joseph T; Wang, Kai; Takahashi, Nagahide; Shtir, Corina J; Hadley, Dexter; Sleiman, Patrick M A; Zhang, Haitao; Kim, Cecilia E; Robison, Reid; Lyon, Gholson J; Flory, James H; Bradfield, Jonathan P; Imielinski, Marcin; Hou, Cuiping; Frackelton, Edward C; Chiavacci, Rosetta M; Sakurai, Takeshi; Rabin, Cara; Middleton, Frank A; Thomas, Kelly A; Garris, Maria; Mentch, Frank; Freitag, Christine M; Steinhausen, Hans-Christoph; Todorov, Alexandre A; Reif, Andreas; Rothenberger, Aribert; Franke, Barbara; Mick, Eric O; Roeyers, Herbert; Buitelaar, Jan; Lesch, Klaus-Peter; Banaschewski, Tobias; Ebstein, Richard P; Mulas, Fernando; Oades, Robert D; Sergeant, Joseph; Sonuga-Barke, Edmund; Renner, Tobias J; Romanos, Marcel; Romanos, Jasmin; Warnke, Andreas; Walitza, Susanne; Meyer, Jobst; Pálmason, Haukur; Seitz, Christiane; Loo, Sandra K; Smalley, Susan L; Biederman, Joseph; Kent, Lindsey; Asherson, Philip; Anney, Richard J L; Gaynor, J William; Shaw, Philip; Devoto, Marcella; White, Peter S; Grant, Struan F A; Buxbaum, Joseph D; Rapoport, Judith L; Williams, Nigel M; Nelson, Stanley F; Faraone, Stephen V; Hakonarson, Hakon

    2014-01-01

    Attention deficit hyperactivity disorder (ADHD) is a common, heritable neuropsychiatric disorder of unknown etiology. We performed a whole-genome copy number variation (CNV) study on 1,013 cases with ADHD and 4,105 healthy children of European ancestry using 550,000 SNPs. We evaluated statistically significant findings in multiple independent cohorts, with a total of 2,493 cases with ADHD and 9,222 controls of European ancestry, using matched platforms. CNVs affecting metabotropic glutamate receptor genes were enriched across all cohorts (P = 2.1 × 10−9). We saw GRM5 (encoding glutamate receptor, metabotropic 5) deletions in ten cases and one control (P = 1.36 × 10−6). We saw GRM7 deletions in six cases, and we saw GRM8 deletions in eight cases and no controls. GRM1 was duplicated in eight cases. We experimentally validated the observed variants using quantitative RT-PCR. A gene network analysis showed that genes interacting with the genes in the GRM family are enriched for CNVs in ~10% of the cases (P = 4.38 × 10−10) after correction for occurrence in the controls. We identified rare recurrent CNVs affecting glutamatergic neurotransmission genes that were overrepresented in multiple ADHD cohorts. PMID:22138692

  17. Revistas académicas mexicanas: panorama y prospectiva

    OpenAIRE

    José Octavio Alonso Gamboa; Felipe Rafael Reyna Espinosa

    2015-01-01

    Se analiza un conjunto de revistas académicas mexicanas registradas en Latindex con el objetivo de conocer sus caracteristicas principales y plantear una prospectiva. Se revisan datos proporcionados por el Directorio, de calidad editorial, identificados en el Catálogo, así como las formas de acceso y distribución para las revistas en linea. Los principales resultados destacan una proliferación de revistas, el papel de las instituciones de educación superior como editoras, la preeminencia de r...

  18. Plagio e integridad académica en Alemania

    OpenAIRE

    2016-01-01

    Alemania es quizá uno de los países europeos que, ya desde el siglo XVIII, ha mantenido un debate público más intenso sobre prácticas científicas y académicas deshonestas, relacionadas especialmente con tesis doctorales. Este debate fue especialmente productivo a finales del siglo XIX, dando lugar desde entonces, para evitar estas prácticas inaceptables, a la obligatoriedad de publicar todas las tesis doctorales, como requisito previo a la expedición del título de doctor por cualquier univers...

  19. Estilo intelectual y rendimiento académico

    OpenAIRE

    Sternberg, Robert J.; Castejón, Juan L.; María R. Bermejo

    2015-01-01

    El trabajo presenta los resultados de un estudio acerca del papel que juegan los estilos intelectuales en el rendimiento académico en distintas áreas de la Educación Primaria (Primary School) obligatoria. Como variables predictoras se incluyen: una medida de la inteligencia abstracta de tipo analítico, el cociente intelectual en el Sternberg Triarchic Abilities Test (STAT-forma E), y cada uno de los trece estilos intelectuales definidos por Sternberg y colaboradores. Los resultados, obtenidos...

  20. Genetic variation in the oxytocin receptor gene is associated with a social phenotype in autism spectrum disorders.

    Science.gov (United States)

    Harrison, Ashley J; Gamsiz, Ece D; Berkowitz, Isaac C; Nagpal, Shailender; Jerskey, Beth A

    2015-12-01

    Oxytocin regulates social behavior in animal models. Research supports an association between genetic variation in the oxytocin receptor gene (OXTR) and autism spectrum disorders (ASD). In this study, we examine the association between the OXTR gene and a specific social phenotype within ASD. This genotype-phenotype investigation may provide insight into how OXTR conveys risk for social impairment. The current study investigated 10 SNPS in the OXTR gene that have been previously shown to be associated with ASD. We examine the association of these SNPs with both a social phenotype and a repetitive behavior phenotype comprised of behaviors commonly impaired in ASD in the Simons simplex collection (SSC). Using a large sample to examine the association between OXTR and ASD (n = range: 485-1002), we find evidence to support a relation between two OXTR SNPs and the examined social phenotype among children diagnosed with ASD. Greater impairment on the social responsiveness scale standardized total score and on several subdomains was observed among individuals with one or more copies of the minor frequency allele in both rs7632287 and rs237884. Linkage disequilibrium (LD) mapping suggests that these two SNPs are in LD within and overlapping the 3' untranslated region (3'-UTR) of the OXTR gene. These two SNPs were also associated with greater impairment on the repetitive behavior scale. Results of this study indicate that social impairment and repetitive behaviors in ASD are associated with genomic variation in the 3'UTR of the OXTR gene. These variants may be linked to an allele that alters stability of the mRNA message although further work is necessary to test this hypothesis. PMID:26365303

  1. Common variation in oxidative phosphorylation genes is not a major cause of insulin resistance or type 2 diabetes

    DEFF Research Database (Denmark)

    Snogdal, L S; Wod, M; Grarup, N;

    2012-01-01

    AIMS/HYPOTHESIS: There is substantial evidence that mitochondrial dysfunction is linked to insulin resistance and is present in several tissues relevant to the pathogenesis of type 2 diabetes. Here, we examined whether common variation in genes involved in oxidative phosphorylation (OxPhos) contr......AIMS/HYPOTHESIS: There is substantial evidence that mitochondrial dysfunction is linked to insulin resistance and is present in several tissues relevant to the pathogenesis of type 2 diabetes. Here, we examined whether common variation in genes involved in oxidative phosphorylation (Ox......Phos) contributes to type 2 diabetes susceptibility or influences diabetes-related metabolic traits. METHODS: OxPhos gene variants (n = 10) that had been nominally associated (p ...,956 glucose-tolerant Danish individuals. A meta-analysis of these variants was performed in 11,729 type 2 diabetic patients and 43,943 non-diabetic individuals. The impact on OGTT-derived metabolic traits was evaluated in 5,869 treatment-naive individuals from the Danish Inter99 study. RESULTS: The minor...

  2. Variation in extracellular matrix genes is associated with weight regain after weight loss in a sex-specific manner

    DEFF Research Database (Denmark)

    Roumans, Nadia J T; Vink, Roel G; Gielen, Marij;

    2015-01-01

    The extracellular matrix (ECM) of adipocytes is important for body weight regulation. Here, we investigated whether genetic variation in ECM-related genes is associated with weight regain among participants of the European DiOGenes study. Overweight and obese subjects (n = 469, 310 females, 159 m.......40-5.63). Concluding, variants of ECM genes are associated with weight regain after weight loss in a sex-specific manner.......The extracellular matrix (ECM) of adipocytes is important for body weight regulation. Here, we investigated whether genetic variation in ECM-related genes is associated with weight regain among participants of the European DiOGenes study. Overweight and obese subjects (n = 469, 310 females, 159...... males) were on an 8-week low-calorie diet with a 6-month follow-up. Body weight was measured before and after the diet, and after follow-up. Weight maintenance scores (WMS, regained weight as percentage of lost weight) were calculated based on the weight data. Genotype data were retrieved for 2903 SNPs...

  3. Unraveling the effects of selection and demography on immune gene variation in free-ranging plains zebra (Equus quagga populations.

    Directory of Open Access Journals (Sweden)

    Pauline L Kamath

    Full Text Available Demography, migration and natural selection are predominant processes affecting the distribution of genetic variation among natural populations. Many studies use neutral genetic markers to make inferences about population history. However, the investigation of functional coding loci, which directly reflect fitness, is critical to our understanding of species' ecology and evolution. Immune genes, such as those of the Major Histocompatibility Complex (MHC, play an important role in pathogen recognition and provide a potent model system for studying selection. We contrasted diversity patterns of neutral data with MHC loci, ELA-DRA and -DQA, in two southern African plains zebra (Equus quagga populations: Etosha National Park, Namibia, and Kruger National Park, South Africa. Results from neutrality tests, along with observations of elevated diversity and low differentiation across populations, supported previous genus-level evidence for balancing selection at these loci. Despite being low, MHC divergence across populations was significant and may be attributed to drift effects typical of geographically separated populations experiencing little to no gene flow, or alternatively to shifting allele frequency distributions driven by spatially variable and fluctuating pathogen communities. At the DRA, zebra exhibited geographic differentiation concordant with microsatellites and reduced levels of diversity in Etosha due to highly skewed allele frequencies that could not be explained by demography, suggestive of spatially heterogeneous selection and local adaptation. This study highlights the complexity in which selection affects immune gene diversity and warrants the need for further research on the ecological mechanisms shaping patterns of adaptive variation among natural populations.

  4. SLC26A4 gene copy number variations in Chinese patients with non-syndromic enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Zhao Jiandong

    2012-05-01

    Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.

  5. Occupational solvent exposure, genetic variation of DNA repair genes, and the risk of non-Hodgkin's lymphoma.

    Science.gov (United States)

    Jiao, Jie; Zheng, Tongzhang; Lan, Qing; Chen, Yingtai; Deng, Qian; Bi, Xiaofeng; Kim, Christopher; Holford, Theodore; Leaderer, Brian; Boyle, Peter; Ba, Yue; Xia, Zhaolin; Chanock, Stephen J; Rothman, Nathaniel; Zhang, Yawei

    2012-11-01

    The main objective of this study was to test the hypothesis that genetic variations in DNA repair genes may modify the association between occupational exposure to solvents and the risk of non-Hodgkin's lymphoma (NHL). A population-based case-control study was conducted on Connecticut women including 518 histologically confirmed incident NHL cases and 597 controls. Unconditional logistic regression models were used to estimate the odds ratios and effect modification from the 30 single nucleotide polymorphisms in 16 DNA repair genes of the association between solvent exposure and the risk of NHL overall and subtypes. Single nucleotide polymorphisms in MGMT (rs12917) and NBS1 (rs1805794) significantly modified the association between exposure to chlorinated solvents and the risk of NHL (Pfor interaction=0.0003 and 0.0048, respectively). After stratification by major NHL histological subtypes, MGMT (rs12917) modified the association between chlorinated solvents and the risk of diffuse large B-cell lymphoma (Pfor interaction=0.0027) and follicular lymphoma (Pfor interaction=0.0024). A significant interaction was also observed between occupational exposure to benzene and BRCA2 (rs144848) for NHL overall (Pfor interaction=0.0042). Our study results suggest that genetic variations in DNA repair genes modify the association between occupational exposure to solvents and the risk of NHL. PMID:22430443

  6. Variation in the IGF2 gene promoter region is associated with intramuscular fat content in porcine skeletal muscle.

    Science.gov (United States)

    Aslan, Ozlem; Hamill, Ruth M; Davey, Grace; McBryan, Jean; Mullen, Anne Maria; Gispert, Marina; Sweeney, Torres

    2012-04-01

    Intramuscular fat (IMF) and subcutaneous fat (back fat-BF) are two of the major fat depots in livestock. A QTN located in the insulin-like growth factor 2 gene (IGF2) has been associated with a desirable reduction in BF depth in pigs. Given that the lipid metabolism of intramuscular adipocytes differs from that of subcutaneous fat adipocytes, this study aimed to search for genetic variation in the IGF2 gene that may be associated with IMF, as well as BF, in diverse pig breeds. Four proximal promoter regions of the IGF2 gene were characterised and the association of IGF2 genetic variation with IMF and BF was assessed. Six promoter SNPs were identified in four promoter regions (P1-P4; sequence coverage 945, 866, 784 and 864 bp, respectively) in phenotypically diverse F1 cross populations. Three promoter SNPs were subsequently genotyped in three pure breeds (Pietrain = 98, Duroc = 99 and Large White = 98). All three SNPs were >95% monomorphic in the Pietrain and Duroc breeds but minor alleles were at moderate frequencies in the Large White breed. These SNPs were linked and one was located in a putative transcription factor binding site. Five haplotypes were inferred and three combined diplotypes tested for association with IMF and BF in the Large White. As expected haplotype 1 (likely in LD with the beneficial QTN allele) was superior for BF level. In contrast, the heterozygote diplotype of the most common haplotypes (1 and 2) was associated with higher IMF and marbling scores compared to either homozygote. Gene expression analysis of divergent animals showed that IGF2 was 1.89 fold up-regulated in muscle with higher compared to lower IMF content. These findings suggest that genetic variation in the promoter region of the IGF2 gene is associated with IMF content in porcine skeletal muscle and that greater expression of the IGF2 gene is associated with higher IMF content. PMID:21779802

  7. Themes and Variations: Regulation of RpoN-Dependent Flagellar Genes across Diverse Bacterial Species

    Directory of Open Access Journals (Sweden)

    Jennifer Tsang

    2014-01-01

    Full Text Available Flagellar biogenesis in bacteria is a complex process in which the transcription of dozens of structural and regulatory genes is coordinated with the assembly of the flagellum. Although the overall process of flagellar biogenesis is conserved among bacteria, the mechanisms used to regulate flagellar gene expression vary greatly among different bacterial species. Many bacteria use the alternative sigma factor σ54 (also known as RpoN to transcribe specific sets of flagellar genes. These bacteria include members of the Epsilonproteobacteria (e.g., Helicobacter pylori and Campylobacter jejuni, Gammaproteobacteria (e.g., Vibrio and Pseudomonas species, and Alphaproteobacteria (e.g., Caulobacter crescentus. This review characterizes the flagellar transcriptional hierarchies in these bacteria and examines what is known about how flagellar gene regulation is linked with other processes including growth phase, quorum sensing, and host colonization.

  8. Clinal Variation at Phenology-Related Genes in Spruce: Parallel Evolution in FTL2 and Gigantea?

    OpenAIRE

    Chen, Jun; Tsuda, Yoshiaki; Stocks, Michael; Källman, Thomas; Xu, Nannan; Kärkkäinen, Katri; Huotari, Tea; Semerikov, Vladimir L.; Vendramin, Giovanni G.; Lascoux, Martin

    2014-01-01

    Parallel clines in different species, or in different geographical regions of the same species, are an important source of information on the genetic basis of local adaptation. We recently detected latitudinal clines in SNPs frequencies and gene expression of candidate genes for growth cessation in Scandinavian populations of Norway spruce (Picea abies). Here we test whether the same clines are also present in Siberian spruce (P. obovata), a close relative of Norway spruce with a different Qu...

  9. INSR gene variation is associated with decreased insulin sensitivity in Iraqi women with PCOs

    OpenAIRE

    Manal T. Mutib; Farqad B. Hamdan; Anam R. Al-Salihi

    2014-01-01

    Background: Polycystic ovarian syndrome (PCOS) is a complex, heterogeneous disorder of uncertain etiology with strong genetic background. Insulin resistance is present in the majority of PCOS cases with linkage and association between single nucleotide polymorphisms of insulin receptor (INSR) gene and PCOS. Objective: To examine whether the exon 17 of INSR gene contributes to genetic susceptibility to PCOS in Iraqi women and its effects on glucose tolerance test and lipid profile. Mater...

  10. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    Science.gov (United States)

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  11. The association of telomere length and genetic variation in telomere biology genes.

    Science.gov (United States)

    Mirabello, Lisa; Yu, Kai; Kraft, Peter; De Vivo, Immaculata; Hunter, David J; Prescott, Jennifer; Wong, Jason Y Y; Chatterjee, Nilanjan; Hayes, Richard B; Savage, Sharon A

    2010-09-01

    Telomeres cap chromosome ends and are critical for genomic stability. Many telomere-associated proteins are important for telomere length maintenance. Recent genome-wide association studies (GWAS) have identified single nucleotide polymorphisms (SNPs) in genes encoding telomere-associated proteins (RTEL1 and TERT-CLPTM1) as markers of cancer risk. We conducted an association study of telomere length and 743 SNPs in 43 telomere biology genes. Telomere length in peripheral blood DNA was determined by Q-PCR in 3,646 participants from the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial and Nurses' Health Study. We investigated associations by SNP, gene, and pathway (functional group). We found no associations between telomere length and SNPs in TERT-CLPTM1L or RTEL1. Telomere length was not significantly associated with specific functional groups. Thirteen SNPs from four genes (MEN1, MRE11A, RECQL5, and TNKS) were significantly associated with telomere length. The strongest findings were in MEN1 (gene-based P=0.006), menin, which associates with the telomerase promoter and may negatively regulate telomerase. This large association study did not find strong associations with telomere length. The combination of limited diversity and evolutionary conservation suggest that these genes may be under selective pressure. More work is needed to explore the role of genetic variants in telomere length regulation.

  12. Expression profiles of sugarcane under drought conditions: Variation in gene regulation

    Directory of Open Access Journals (Sweden)

    Júlio César Farias de Andrade

    2015-01-01

    Full Text Available AbstractDrought is a major factor in decreased sugarcane productivity because of the resulting morphophysiological effects that it causes. Gene expression studies that have examined the influence of water stress in sugarcane have yielded divergent results, indicating the absence of a fixed pattern of changes in gene expression. In this work, we investigated the expression profiles of 12 genes in the leaves of a drought-tolerant genotype (RB72910 of sugarcane and compared the results with those of other studies. The genotype was subjected to 80–100% water availability (control condition and 0–20% water availability (simulated drought. To analyze the physiological status, the SPAD index, Fv/Fm ratio, net photosynthesis (A, stomatal conductance (gs and stomatal transpiration (E were measured. Total RNA was extracted from leaves and the expression of SAMDC, ZmPIP2-1 protein, ZmTIP4-2 protein, WIP protein, LTP protein, histone H3, DNAj, ferredoxin I, β-tubulin, photosystem I, gene 1 and gene 2 was analyzed by quantitative real-time PCR (RT-PCR. Important differences in the expression profiles of these genes were observed when compared with other genotypes, suggesting that complex defense mechanisms are activated in response to water stress. However, there was no recognizable pattern for the changes in expression of the different proteins associated with tolerance to drought stress.

  13. A Multiple Interaction Analysis Reveals ADRB3 as a Potential Candidate for Gallbladder Cancer Predisposition via a Complex Interaction with Other Candidate Gene Variations

    OpenAIRE

    Rajani Rai; Jong Joo Kim; Sanjeev Misra; Ashok Kumar; Balraj Mittal

    2015-01-01

    Gallbladder cancer is the most common and a highly aggressive biliary tract malignancy with a dismal outcome. The pathogenesis of the disease is multifactorial, comprising the combined effect of multiple genetic variations of mild consequence along with numerous dietary and environmental risk factors. Previously, we demonstrated the association of several candidate gene variations with GBC risk. In this study, we aimed to identify the combination of gene variants and their possible interactio...

  14. Contribution of Myostatin gene polymorphisms to normal variation in lean mass, fat mass and peak BMD in Chinese male offspring

    Institute of Scientific and Technical Information of China (English)

    Hua YUE; Miao LI; Yu-juan LIU; Song-hua WU; Zhen-lin ZHANG; Jin-wei HE; Hao ZHANG; Chun WANG; Wei-wei HU; Jie-mei GU; Yao-hua KE; Wen-zhen FU; Yun-qiu HU

    2012-01-01

    Myostatin gene is a member of the transforming growth factor-β (TGF-β) family that negatively regulates skeletal muscle growth.Genetic polymorphisms in Myostatin were found to be associated with the peak bone mineral density (BMD) in Chinese women.The purpose of this study was to investigate whether Myostatin played a role in the normal variation in peak BMD,lean mass (LM),and fat mass (FM) of Chinese men.Methods:Four hundred male-offspring nuclear families of Chinese Han ethnic group were recruited.Anthropometric measurements,includingthe peak BMD,body LM and FM were measured using dual-energy X-ray absorptiometry (DXA).The single nucleotide polymorphisms (SNPs) studied were tag-SNPs selected by sequencing.Both rs2293284 and +2278G>A were genotyped using TaqMan assay,and rs3791783 was genotyped with PCR-restriction fragment length polymorphism (RFLP) analysis.The associations of the SNPs with anthropometfic variations were analyzed using the quantitative transmission disequilibrium test (QTDT).Results:Using QTDT to detect within-family associations,neither single SNP nor haplotype was found to be associated with peak BMD at any bone site.However,rs3791783 was found to be significantly associated with fat mass of the trunk (P<0.001).Moreover,for within-family associations,haplotypes AGG,AAA,and TGG were found to be significantly associated with the trunk fat mass (all P<0.001).Conclusion:Our results suggest that genetic variation within Myostatin may play a role in regulating the variation in fat mass in Chinese males.Additionally,the Myostatin gene may be a candidate that determines body fat mass in Chinese men.

  15. Genetic variation in cell death genes and risk of non-Hodgkin lymphoma.

    Directory of Open Access Journals (Sweden)

    Johanna M Schuetz

    Full Text Available BACKGROUND: Non-Hodgkin lymphomas are a heterogeneous group of solid tumours that constitute the 5(th highest cause of cancer mortality in the United States and Canada. Poor control of cell death in lymphocytes can lead to autoimmune disease or cancer, making genes involved in programmed cell death of lymphocytes logical candidate genes for lymphoma susceptibility. MATERIALS AND METHODS: We tested for genetic association with NHL and NHL subtypes, of SNPs in lymphocyte cell death genes using an established population-based study. 17 candidate genes were chosen based on biological function, with 123 SNPs tested. These included tagSNPs from HapMap and novel SNPs discovered by re-sequencing 47 cases in genes for which SNP representation was judged to be low. The main analysis, which estimated odds ratios by fitting data to an additive logistic regression model, used European ancestry samples that passed quality control measures (569 cases and 547 controls. A two-tiered approach for multiple testing correction was used: correction for number of tests within each gene by permutation-based methodology, followed by correction for the number of genes tested using the false discovery rate. RESULTS: Variant rs928883, near miR-155, showed an association (OR per A-allele: 2.80 [95% CI: 1.63-4.82]; p(F = 0.027 with marginal zone lymphoma that is significant after correction for multiple testing. CONCLUSIONS: This is the first reported association between a germline polymorphism at a miRNA locus and lymphoma.

  16. género y rendimiento académico

    Directory of Open Access Journals (Sweden)

    Elberto Antonio Plazas

    2006-01-01

    Full Text Available Se pretendió establecer si existía un efecto de interacción entre el estatus sociométrico y el género sobre el rendimiento académico en una muestra de 156 estudiantes (88 niñas y 68 varones de educación secundaria de un reconocido colegio público de Valledupar (Colombia. El estatus sociométrico se evaluó según las nominaciones de los pares para categorizar a los estudiantes en seis grupos: popular, rechazado, excluido, controvertido, promedio y no clasificado. El análisis de varianza no reveló un efecto significativo de la interacción del estatus sociométrico y el género sobre el rendimiento académico, aunque sí mostró un efecto significativo independiente de las dos variables principales. En la prueba post hoc, se presentó una relación directa entre el rendimiento y la Preferencia Social, así como entre el rendimiento y el Impacto Social, y una diferencia significativa entre niñas y varones controvertidos.

  17. Schooling and Variation in the "COMT" Gene: The Devil Is in the Details

    Science.gov (United States)

    Campbell, Daniel; Bick, Johanna; Yrigollen, Carolyn M.; Lee, Maria; Joseph, Antony; Chang, Joseph T.; Grigorenko, Elena L.

    2013-01-01

    Background: Schooling is considered one of the major contributors to the development of intelligence within societies and individuals. Genetic variation might modulate the impact of schooling and explain, at least partially, the presence of individual differences in classrooms. Method: We studied a sample of 1,502 children (mean age = 11.7 years)…

  18. Variation in the oxytocin receptor gene is associated with behavioral and neural correlates of empathic accuracy

    DEFF Research Database (Denmark)

    Laursen, Helle Ruff; Siebner, Hartwig Roman; Haren, Tina;

    2014-01-01

    sulcus (STS). In OXTR rs2268498 CC-carriers, high empathic accuracy was associated with stronger responsiveness of the right STS to the observed pain. Together, the results show that genetic variation in the OXTR has significant influence on empathic accuracy and that this may be linked to variable...

  19. Intra- and interindividual variation in gene expression in human adipose tissue

    NARCIS (Netherlands)

    van Beek, Esther A.; Bakker, Arjen H.; Kruyt, Philip M.; Hofker, Marten H.; Saris, Wim H.; Keijer, Jaap

    2007-01-01

    Adipose tissue is a highly plastic tissue with an important endocrine and metabolic function. To understand its role in human health and disease, it is necessary to understand the extent of variation and the specific differences within and between different depots and subjects. We employed cDNA micr

  20. Whole-genome sequencing reveals the diversity of cattle copy number variations and multicopy genes

    Science.gov (United States)

    Structural and functional impacts of copy number variations (CNVs) on livestock genomes are not yet well understood. We identified 1853 CNV regions using population-scale sequencing data generated from 75 cattle representing 8 breeds (Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, Romagnol...

  1. Variation of the McKusick-Kaufman gene and studies of relationships with common forms of obesity

    DEFF Research Database (Denmark)

    Andersen, Kirstine Lynge; Echwald, Søren Morgenthaler; Larsen, Lesli Hingstrup;

    2005-01-01

    was identified in two families and showed partial cosegregation with obesity. The Pro(39)Pro, Ile(178)Ile, and Arg(517)Cys variants are in complete linkage disequilibrium and defined a prevalent haplotype. In a case-control study, the Arg(517)Cys polymorphism allele prevalence was 11.4% [95% confidence interval......Obesity is a prominent feature of the Bardet-Biedl syndrome (BBS), one subset of which, BBS6, is due to mutations in the chaperonin-like gene termed the McKusick-Kaufman syndrome (MKKS) gene. We tested whether variation in MKKS contributes to common and probably polygenic forms of obesity...... by performing mutation analysis of the coding region in 60 Danish white men with juvenile-onset obesity. Five variants were identified, including two synonymous mutations (Pro(39)Pro and Ile(178)Ile) and three nonsynonymous variants (Ala(242)Ser, Arg(517)Cys, and Gly(532)Val). Furthermore, the rare Ala(242)Ser...

  2. Sequence Variation and Expression of the Gimap Gene Family in the BB Rat

    Directory of Open Access Journals (Sweden)

    Elizabeth A. Rutledge

    2009-01-01

    Full Text Available Positional cloning of lymphopenia (lyp in the BB rat revealed a frameshift mutation in Gimap5, a member of at least seven related GTPase Immune Associated Protein genes located on rat chromosome 4q24. Our aim was to clone and sequence the cDNA of the BB diabetes prone (DP and diabetes resistant (DR alleles of all seven Gimap genes in the congenic DR.lyp rat line with 2 Mb of BB DP DNA introgressed onto the DR genetic background. All (100% DR.lyp/lyp rats are lymphopenic and develop type 1 diabetes (T1D by 84 days of age while DR.+/+ rats remain T1D and lyp resistant. Among the seven Gimap genes, the Gimap5 frameshift mutation, a mutant allele that produces no protein, had the greatest impact on lymphopenia in the DR.lyp/lyp rat. Gimap4 and Gimap1 each had one amino acid substitution of unlikely significance for lymphopenia. Quantitative RT-PCR analysis showed a reduction in expression of all seven Gimap genes in DR.lyp/lyp spleen and mesenteric lymph nodes when compared to DR.+/+. Only four; Gimap1, Gimap4, Gimap5, and Gimap9 were reduced in thymus. Our data substantiates the Gimap5 frameshift mutation as the primary defect with only limited contributions to lymphopenia from the remaining Gimap genes.

  3. Refining analyses of copy number variation identifies specific genes associated with developmental delay.

    Science.gov (United States)

    Coe, Bradley P; Witherspoon, Kali; Rosenfeld, Jill A; van Bon, Bregje W M; Vulto-van Silfhout, Anneke T; Bosco, Paolo; Friend, Kathryn L; Baker, Carl; Buono, Serafino; Vissers, Lisenka E L M; Schuurs-Hoeijmakers, Janneke H; Hoischen, Alex; Pfundt, Rolph; Krumm, Nik; Carvill, Gemma L; Li, Deana; Amaral, David; Brown, Natasha; Lockhart, Paul J; Scheffer, Ingrid E; Alberti, Antonino; Shaw, Marie; Pettinato, Rosa; Tervo, Raymond; de Leeuw, Nicole; Reijnders, Margot R F; Torchia, Beth S; Peeters, Hilde; O'Roak, Brian J; Fichera, Marco; Hehir-Kwa, Jayne Y; Shendure, Jay; Mefford, Heather C; Haan, Eric; Gécz, Jozef; de Vries, Bert B A; Romano, Corrado; Eichler, Evan E

    2014-10-01

    Copy number variants (CNVs) are associated with many neurocognitive disorders; however, these events are typically large, and the underlying causative genes are unclear. We created an expanded CNV morbidity map from 29,085 children with developmental delay in comparison to 19,584 healthy controls, identifying 70 significant CNVs. We resequenced 26 candidate genes in 4,716 additional cases with developmental delay or autism and 2,193 controls. An integrated analysis of CNV and single-nucleotide variant (SNV) data pinpointed 10 genes enriched for putative loss of function. Follow-up of a subset of affected individuals identified new clinical subtypes of pediatric disease and the genes responsible for disease-associated CNVs. These genetic changes include haploinsufficiency of SETBP1 associated with intellectual disability and loss of expressive language and truncations of ZMYND11 in individuals with autism, aggression and complex neuropsychiatric features. This combined CNV and SNV approach facilitates the rapid discovery of new syndromes and genes involved in neuropsychiatric disease despite extensive genetic heterogeneity. PMID:25217958

  4. Genetic variation in genes involved in hormones, inflammation and energetic factors and breast cancer risk in an admixed population.

    Science.gov (United States)

    Slattery, Martha L; John, Esther M; Torres-Mejia, Gabriela; Lundgreen, Abbie; Herrick, Jennifer S; Baumgartner, Kathy B; Hines, Lisa M; Stern, Mariana C; Wolff, Roger K

    2012-08-01

    Breast cancer incidence rates are characterized by unique racial and ethnic differences. Native American ancestry has been associated with reduced breast cancer risk. We explore the biological basis of disparities in breast cancer risk in Hispanic and non-Hispanic white women by evaluating genetic variation in genes involved in inflammation, insulin and energy homeostasis in conjunction with genetic ancestry. Hispanic (2111 cases, 2597 controls) and non-Hispanic white (1481 cases, 1586 controls) women enrolled in the 4-Corner's Breast Cancer Study, the Mexico Breast Cancer Study and the San Francisco Bay Area Breast Cancer Study were included. Genetic admixture was determined from 104 ancestral informative markers that discriminate between European and Native American ancestry. Twenty-one genes in the CHIEF candidate pathway were evaluated. Higher Native American ancestry was associated with reduced risk of breast cancer (odds ratio = 0.79, 95% confidence interval 0.65, 0.95) but was limited to postmenopausal women (odds ratio = 0.66, 95% confidence interval 0.52, 0.85). After adjusting for genetic ancestry and multiple comparisons, four genes were significantly associated with breast cancer risk, NFκB1, NFκB1A, PTEN and STK11. Within admixture strata, breast cancer risk among women with low Native American ancestry was associated with IkBKB, NFκB1, PTEN and RPS6KA2, whereas among women with high Native American ancestry, breast cancer risk was associated with IkBKB, mTOR, PDK2, PRKAA1, RPS6KA2 and TSC1. Higher Native American ancestry was associated with reduced breast cancer risk. Breast cancer risk differed by genetic ancestry along with genetic variation in genes involved in inflammation, insulin, and energy homeostasis. PMID:22562547

  5. Serotonin and Early Cognitive Development: Variation in the Tryptophan Hydroxylase 2 Gene Is Associated with Visual Attention in 7-Month-Old Infants

    Science.gov (United States)

    Leppanen, Jukka M.; Peltola, Mikko J.; Puura, Kaija; Mantymaa, Mirjami; Mononen, Nina; Lehtimaki, Terho

    2011-01-01

    Background: Allelic variation in the promoter region of a gene that encodes tryptophan hydroxylase isoform 2 (TPH2), a rate-limiting enzyme of serotonin synthesis in the central nervous system, has been associated with variations in cognitive function and vulnerability to affective spectrum disorders. Little is known about the effects of this gene…

  6. Variations in Multiple Syndromic Deafness Genes Mimic Non-syndromic Hearing Loss.

    Science.gov (United States)

    Bademci, G; Cengiz, F B; Foster Ii, J; Duman, D; Sennaroglu, L; Diaz-Horta, O; Atik, T; Kirazli, T; Olgun, L; Alper, H; Menendez, I; Loclar, I; Sennaroglu, G; Tokgoz-Yilmaz, S; Guo, S; Olgun, Y; Mahdieh, N; Bonyadi, M; Bozan, N; Ayral, A; Ozkinay, F; Yildirim-Baylan, M; Blanton, S H; Tekin, M

    2016-01-01

    The genetics of both syndromic (SHL) and non-syndromic hearing loss (NSHL) is characterized by a high degree of genetic heterogeneity. We analyzed whole exome sequencing data of 102 unrelated probands with apparently NSHL without a causative variant in known NSHL genes. We detected five causative variants in different SHL genes (SOX10, MITF, PTPN11, CHD7, and KMT2D) in five (4.9%) probands. Clinical re-evaluation of these probands shows that some of them have subtle syndromic findings, while none of them meets clinical criteria for the diagnosis of the associated syndrome (Waardenburg (SOX10 and MITF), Kallmann (CHD7 and SOX10), Noonan/LEOPARD (PTPN11), CHARGE (CHD7), or Kabuki (KMT2D). This study demonstrates that individuals who are evaluated for NSHL can have pathogenic variants in SHL genes that are not usually considered for etiologic studies. PMID:27562378

  7. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    DEFF Research Database (Denmark)

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P;

    2015-01-01

    and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC). Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS). SNP analyses were conducted...... using unconditional logistic regression under a log-additive model, and the FDR qcancers combined and for the serous subtype was observed for SNP rs17216603 in the iron......BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes...

  8. Variation at the Calpain 3 gene is associated with meat tenderness in zebu and composite breeds of cattle

    Directory of Open Access Journals (Sweden)

    Bunch Rowan J

    2008-07-01

    Full Text Available Abstract Background Quantitative Trait Loci (QTL affecting meat tenderness have been reported on Bovine chromosome 10. Here we examine variation at the Calpain 3 (CAPN3 gene in cattle, a gene located within the confidence interval of the QTL, and which is a positional candidate gene based on the biochemical activity of the protein. Results We identified single nucleotide polymorphisms (SNP in the genomic sequence of the CAPN3 gene and tested three of these in a sample of 2189 cattle. Of the three SNP genotyped, the CAPN3:c.1538+225G>T had the largest significant additive effect, with an allele substitution effect in the Brahman of α = -0.144 kg, SE = 0.060, P = 0.016, and the polymorphism explained 1.7% of the residual phenotypic variance in that sample of the breed. Significant haplotype substitution effects were found for all three breeds, the Brahman, the Belmont Red, and the Santa Gertrudis. For the common haplotype, the haplotype substitution effect in the Brahman was α = 0.169 kg, SE = 0.056, P = 0.003. The effect of this gene was compared to Calpastatin in the same sample. The SNP show negligible frequencies in taurine breeds and low to moderate minor allele frequencies in zebu or composite animals. Conclusion These associations confirm the location of a QTL for meat tenderness in this region of bovine chromosome 10. SNP in or near this gene may be responsible for part of the overall difference between taurine and zebu breeds in meat tenderness, and the greater variability in meat tenderness found in zebu and composite breeds. The evidence provided so far suggests that none of these tested SNP are causative mutations.

  9. Genetic variation of the major histocompatibility complex (MHC class II B gene in the threatened Hume's pheasant, Syrmaticus humiae.

    Directory of Open Access Journals (Sweden)

    Weicai Chen

    Full Text Available Major histocompatibility complex (MHC genes are the most polymorphic genes in vertebrates and encode molecules that play a crucial role in pathogen resistance. As a result of their diversity, they have received much attention in the fields of evolutionary and conservation biology. Here, we described the genetic variation of MHC class II B (MHCIIB exon 2 in a wild population of Hume's pheasant (Syrmaticus humiae, which has suffered a dramatic decline in population over the last three decades across its ranges in the face of heavy exploitation and habitat loss. Twenty-four distinct alleles were found in 73 S. humiae specimens. We found seven shared alleles among four geographical groups as well as six rare MHCIIB alleles. Most individuals displayed between one to five alleles, suggesting that there are at least three MHCIIB loci of the Hume's pheasant. The dN ⁄ dS ratio at putative antigen-binding sites (ABS was significantly greater than one, indicating balancing selection is acting on MHCIIB exon 2. Additionally, recombination and gene conversion contributed to generating MHCIIB diversity in the Hume's pheasant. One to three recombination events and seventy-five significant gene conversion events were observed within the Hume's pheasant MHCIIB loci. The phylogenetic tree and network analysis revealed that the Hume's pheasant alleles do not cluster together, but are scattered through the tree or network indicating a trans-species evolutionary mode. These findings revealed the evolution of the Hume's pheasant MHC after suffering extreme habitat fragmentation.

  10. The thermostable direct hemolysin-related hemolysin (trh) gene of Vibrio parahaemolyticus: Sequence variation and implications for detection and function.

    Science.gov (United States)

    Nilsson, William B; Turner, Jeffrey W

    2016-07-01

    Vibrio parahaemolyticus is a leading cause of bacterial food-related illness associated with the consumption of undercooked seafood. Only a small subset of strains is pathogenic. Most clinical strains encode for the thermostable direct hemolysin (TDH) and/or the TDH-related hemolysin (TRH). In this work, we amplify and sequence the trh gene from over 80 trh+strains of this bacterium and identify thirteen genetically distinct alleles, most of which have not been deposited in GenBank previously. Sequence data was used to design new primers for more reliable detection of trh by endpoint PCR. We also designed a new quantitative PCR assay to target a more conserved gene that is genetically-linked to trh. This gene, ureR, encodes the transcriptional regulator for the urease gene cluster immediately upstream of trh. We propose that this ureR assay can be a useful screening tool as a surrogate for direct detection of trh that circumvents challenges associated with trh sequence variation.

  11. Molecular phylogenetic and sequence variation analysis of dimeric α-amylase inhibitor genes in wheat and its wild relative species

    Directory of Open Access Journals (Sweden)

    Bharati Pandey

    2016-06-01

    Full Text Available Dimeric alpha-amylase inhibitors serve protection against insects that are highly dependent on starch for their energy. In order to study the molecular evolution and sequence variation, we have sequenced dimeric α-amylase inhibitors gene from different genomes in Triticeae including Indian bread and durum wheat genotypes. Using BLAST, obtained sequences show very high homology with other inhibitors available at GenBank database and had common conserved 10 cysteine residues. Investigated frequency of significant SNPs in the α-amylase inhibitor gene was 1 out of 60 bases. The phylogenetic analysis based on deduced amino acid sequences revealed that the genes encoding dimeric α-amylase inhibitors formed three groups and genes isolated from Indian bread wheat clustered with 0.19 inhibitors. In addition, we predicted that dimeric α-amylase inhibitors co-localized into chloroplast and mitochondria expect for the sequences isolated from Aegilops tauschii. Fingerprinting analysis done with ScanProsite confirmed biologically meaningful signatures. Multiple sequence alignment of dimeric α-amylase proteins from different plant species revealed a conserved secondary structure region, indicating homology at the sequence and structural levels. Analysis of the protein sequences obtained from wheat and its wild related species are very similar, indicates a highest conservation of these proteins.

  12. Natural variation in four human collagen genes across an ethnically diverse population

    OpenAIRE

    Chan, Ting-Fung; Poon, Annie; Basu, Analabha; Addleman, Nick R.; Chen, Justin; Phong, Angie; Byers, Peter H; Klein, Teri E.; Kwok, Pui-Yan

    2008-01-01

    Collagens are members of one of the most important families of structural proteins in higher organisms. There are 28 types of collagens encoded by 43 genes in humans that fall into several different functional protein classes. Mutations in the major fibrillar collagen genes lead to osteogenesis imperfecta (COL1A1 and COL1A2 encoding the chains of Type I collagen), chondrodysplasias (COL2A1 encoding the chains of Type II collagen), and vascular Ehlers-Danlos syndrome (COL3A1 encoding the chain...

  13. Genetic Variation of Goat Interferon Regulatory Factor 3 Gene and Its Implication in Goat Evolution.

    Science.gov (United States)

    Okpeku, Moses; Esmailizadeh, Ali; Adeola, Adeniyi C; Shu, Liping; Zhang, Yesheng; Wang, Yangzi; Sanni, Timothy M; Imumorin, Ikhide G; Peters, Sunday O; Zhang, Jiajin; Dong, Yang; Wang, Wen

    2016-01-01

    The immune systems are fundamentally vital for evolution and survival of species; as such, selection patterns in innate immune loci are of special interest in molecular evolutionary research. The interferon regulatory factor (IRF) gene family control many different aspects of the innate and adaptive immune responses in vertebrates. Among these, IRF3 is known to take active part in very many biological processes. We assembled and evaluated 1356 base pairs of the IRF3 gene coding region in domesticated goats from Africa (Nigeria, Ethiopia and South Africa) and Asia (Iran and China) and the wild goat (Capra aegagrus). Five segregating sites with θ value of 0.0009 for this gene demonstrated a low diversity across the goats' populations. Fu and Li tests were significantly positive but Tajima's D test was significantly negative, suggesting its deviation from neutrality. Neighbor joining tree of IRF3 gene in domesticated goats, wild goat and sheep showed that all domesticated goats have a closer relationship than with the wild goat and sheep. Maximum likelihood tree of the gene showed that different domesticated goats share a common ancestor and suggest single origin. Four unique haplotypes were observed across all the sequences, of which, one was particularly common to African goats (MOCH-K14-0425, Poitou and WAD). In assessing the evolution mode of the gene, we found that the codon model dN/dS ratio for all goats was greater than one. Phylogenetic Analysis by Maximum Likelihood (PAML) gave a ω0 (dN/dS) value of 0.067 with LnL value of -6900.3 for the first Model (M1) while ω2 = 1.667 in model M2 with LnL value of -6900.3 with positive selection inferred in 3 codon sites. Mechanistic empirical combination (MEC) model for evaluating adaptive selection pressure on particular codons also confirmed adaptive selection pressure in three codons (207, 358 and 408) in IRF3 gene. Positive diversifying selection inferred with recent evolutionary changes in domesticated goat IRF3

  14. Dopamine Receptor D4 Gene Variation Predicts Preschoolers' Developing Theory of Mind

    Science.gov (United States)

    Lackner, Christine; Sabbagh, Mark A.; Hallinan, Elizabeth; Liu, Xudong; Holden, Jeanette J. A.

    2012-01-01

    Individual differences in preschoolers' understanding that human action is caused by internal mental states, or representational theory of mind (RTM), are heritable, as are developmental disorders such as autism in which RTM is particularly impaired. We investigated whether polymorphisms of genes affecting dopamine (DA) utilization and metabolism…

  15. Proteomic changes resulting from gene copy number variations in cancer cells.

    Directory of Open Access Journals (Sweden)

    Tamar Geiger

    2010-09-01

    Full Text Available Along the transformation process, cells accumulate DNA aberrations, including mutations, translocations, amplifications, and deletions. Despite numerous studies, the overall effects of amplifications and deletions on the end point of gene expression--the level of proteins--is generally unknown. Here we use large-scale and high-resolution proteomics combined with gene copy number analysis to investigate in a global manner to what extent these genomic changes have a proteomic output and therefore the ability to affect cellular transformation. We accurately measure expression levels of 6,735 proteins and directly compare them to the gene copy number. We find that the average effect of these alterations on the protein expression is only a few percent. Nevertheless, by using a novel algorithm, we find the combined impact that many of these regional chromosomal aberrations have at the protein level. We show that proteins encoded by amplified oncogenes are often overexpressed, while adjacent amplified genes, which presumably do not promote growth and survival, are attenuated. Furthermore, regulation of biological processes and molecular complexes is independent of general copy number changes. By connecting the primary genome alteration to their proteomic consequences, this approach helps to interpret the data from large-scale cancer genomics efforts.

  16. Transcriptional regulation of the VEGF gene in dependence of individual genomic variations.

    Science.gov (United States)

    Metzger, Carmen S; Koutsimpelas, Dimitrios; Brieger, Juergen

    2015-12-01

    Overexpression of the vascular endothelial growth factor (VEGF) gene has been associated with advanced stage and poor survival in several cancers. The majority of disease-associated VEGF-single nucleotide polymorphisms (SNPs) locate within regulatory regions. Therefore, an influence of SNPs located in the promoter/5'-untranslated region (5'UTR) on transcription factor binding (TFB) and gene expression seems feasible. We reviewed the literature investigating a potential connection of VEGF-SNPs and transcriptional regulation of the VEGF gene. In addition, we employed transcription factor databases to search for VEGF-SNPs which have already been associated with diseases. The objective of this review is to gain an overview about an association of VEGF-SNPs and the transcription factor dependent regulation of the VEGF gene. A decreasing binding specificity of the transcription factor MZF1 in presence of the VEGF-SNP +405 C-allele has been reported. TF databases indicated a potential HIF binding site for the -2578 C-allele representing an important potential inducer of VEGF expression. Additionally, linkage disequilibrium of the -2578 A-allele and an 18 bp insertion increases the number of potential TFB sites. For the VEGF promoter SNP -1154 A/G an interaction with the HRE under participation of the SNP +405 C/G was supposed. The comprehension of the association of specific SNPs and TFB could be an essential part in our understanding of individual differences of VEGF regulation and course of diseases. PMID:26209503

  17. Genetic variation in genes of the fatty acid synthesis pathway and breast cancer risk

    NARCIS (Netherlands)

    Campa, Daniele; McKay, James; Sinilnikova, Olga; Huesing, Anika; Vogel, Ulla; Hansen, Rikke Dalgaard; Overvad, Kim; Witt, Petra Mariann; Clavel-Chapelon, Francoise; Boutron-Ruault, Marie-Christine; Chajes, Veronique; Rohrmann, Sabine; Chang-Claude, Jenny; Boeing, Heiner; Fisher, Eva; Trichopoulou, Antonia; Trichopoulos, Dimitrios; Palli, Domenico; Villarini, Anna; Sacerdote, Carlotta; Mattiello, Amalia; Tumino, Rosario; Peeters, Petra H. M.; van Gils, Carla H.; Bueno-de-Mesquita, H. Bas; Lund, Eiliv; Dolores Chirlaque, Maria; Sala, Nuria; Rodriguez Suarez, Laudina; Barricarte, Aurelio; Dorronsoro, Miren; Sanchez, Maria-Jose; Lenner, Per; Hallmans, Goeran; Tsilidis, Kostas; Bingham, Sheila; Khaw, Kay-Tee; Gallo, Valentina; Norat, Teresa; Riboli, Elio; Rinaldi, Sabina; Lenoir, Gilbert; Tavtigian, Sean V.; Canzian, Federico; Kaaks, Rudolf

    2009-01-01

    Fatty acid synthase (FAS) is the major enzyme of lipogenesis. It catalyzes the NADPH-dependent condensation of acetyl-CoA and malonyl-CoA to produce palmitic acid. Transcription of the FAS gene is controlled synergistically by the transcription factors ChREBP (carbohydrate response element-binding p

  18. Genetic variation of Aflatoxin B(1) aldehyde reductase genes (AFAR) in human tumour cells

    DEFF Research Database (Denmark)

    Praml, Christian; Schulz, Wolfgang; Claas, Andreas;

    2008-01-01

    AFAR genes play a key role in the detoxification of the carcinogen Aflatoxin B(1) (AFB(1)). In the rat, Afar1 induction can prevent AFB(1)-induced liver cancer. It has been proposed that AFAR enzymes can metabolise endogenous diketones and dialdehydes that may be cytotoxic and/or genotoxic...

  19. Genetic variation in genes of the fatty acid synthesis pathway and breast cancer risk

    DEFF Research Database (Denmark)

    Campa, Daniele; McKay, James; Sinilnikova, Olga;

    2009-01-01

    Fatty acid synthase (FAS) is the major enzyme of lipogenesis. It catalyzes the NADPH-dependent condensation of acetyl-CoA and malonyl-CoA to produce palmitic acid. Transcription of the FAS gene is controlled synergistically by the transcription factors ChREBP (carbohydrate response element-bindin...

  20. CNTNAP2 gene dosage variation is associated with schizophrenia and epilepsy

    NARCIS (Netherlands)

    Friedman, J. I.; Vrijenhoek, T.; Markx, S.; Janssen, I. M.; Van der Vliet, W. A.; Faas, B. H. W.; Knoers, N. V.; Cahn, W.; Kahn, R. S.; Edelmann, L.; Davis, K. L.; Silverman, J. M.; Brunner, H. G.; Van Kessel, A. Geurts; Wijmenga, C.; Ophoff, R. A.; Veltman, J. A.

    2008-01-01

    A homozygous mutation of the CNTNAP2 gene has been associated with a syndrome of focal epilepsy, mental retardation, language regression and other neuropsychiatric problems in children of the Old Order Amish community. Here we report genomic rearrangements resulting in haploinsufficiency of the CNTN

  1. Genetic variation of the prion protein gene (PRNP) in alpaca (Vicugna pacos)

    Science.gov (United States)

    Transmissible spongiform encephalopathies (TSE) are caused by accumulation of a misfolded form of the prion protein (PrP). The normal cellular isoform of PrP is produced by the prion gene (PRNP) and is highly expressed in the central nervous system. Currently, there is an absence of information rega...

  2. Variation in genes related to hepatic lipid metabolism and changes in waist circumference and body weight

    DEFF Research Database (Denmark)

    Meidtner, Karina; Fisher, Eva; Angquist, Lars;

    2014-01-01

    We analysed single nucleotide polymorphisms (SNPs) tagging the genetic variability of six candidate genes (ATF6, FABP1, LPIN2, LPIN3, MLXIPL and MTTP) involved in the regulation of hepatic lipid metabolism, an important regulatory site of energy balance for associations with body mass index (BMI...

  3. Genetic Variation in the Leptin Receptor Gene, Leptin, and Weight Gain in Young Dutch Adults

    NARCIS (Netherlands)

    Rossum, van C.T.M.; Hoebee, B.; Baak, van M.A.; Mars, M.; Saris, W.H.M.; Seidell, J.C.

    2003-01-01

    Objective: To investigate the association between leptin levels, polymorphisms in the leptin receptor (LEPR) gene, and weight gain. Research Methods and Procedures: From two large prospective cohorts in The Netherlands (n = 17, 500), we compared the baseline leptin of 259 subjects who had gained an

  4. Variation in the purinergic P2RX(7) receptor gene and schizophrenia

    DEFF Research Database (Denmark)

    Hansen, Thomas; Jakobsen, Klaus D; Fenger, Mogens;

    2008-01-01

    The purinergic receptor gene P2RX(7) is located in a major linkage hotspot for schizophrenia and bipolar disorders, 12q21-33. It has previously been associated with bipolar disorder but has never been analysed in relation to schizophrenia, although it is involved in several neuronal processes...... associated with schizophrenia....

  5. Assortative mating and gene flow generate clinal phenological variation in trees

    OpenAIRE

    Soularue Jean-Paul; Kremer Antoine

    2012-01-01

    Abstract Background On-going climate change is shifting the timing of bud burst (TBB) of broad leaf and conifer trees in temperate areas, raising concerns about the abilities of natural populations to respond to these shifts. The level of expected evolutionary change depends on the level and distribution of genetic variation of TBB. While numerous experimental studies have highlighted the role of divergent selection in promoting clinal TBB differentiation, we explored whether the observed pat...

  6. Interplay Between Environment and Genes on Morphological Variation in Perch – Implications for Resource Polymorphisms

    OpenAIRE

    Olsson, Jens

    2006-01-01

    Recent research has suggested that individual specialization within populations could be substantial and more common than previously acknowledged. Eurasian perch is one of many species of fish in lakes of postglacial origin that displays a morphological and dietary variation tightly coupled to the littoral and pelagic habitats of the lake. The occurrence of such resource polymorphisms might have important consequences for local adaptation and might also be an important initial step in speciat...

  7. Expression of flavonoid biosynthesis genes vis-à-vis rutin content variation in different growth stages of Fagopyrum species.

    Science.gov (United States)

    Gupta, Nidhi; Sharma, Sunil K; Rana, Jai C; Chauhan, Rajinder S

    2011-11-15

    Buckwheat is one of the field crops with the highest concentration of rutin, an important flavonoid of medicinal value. Two species of buckwheat, Fagopyrum esculentum and Fagopyrum tataricum, are the major sources of rutin. Seeds of latter contain 40-50× higher rutin compared to the former. The physiological and molecular bases of rutin content variation between Fagopyrum species are not known. The current study investigated the differences in rutin content in seeds and in other tissues and growth stages of two Fagopyrum species, and also correlated those differences with the expression of flavonoid pathway genes. The analysis of rutin content dynamics at different growth stages, S1-S9 (from seed germination to mature seed formation) of Fagopyrum species revealed that rutin content was higher during seedling stages of F. tataricum (3.5 to 4.6-fold) compared to F. esculentum and then increased exponentially from stages S3 to S6 (different leaf maturing stages and inflorescence) of F. esculentum, whereas it fluctuated in F. tataricum. The rutin content was highest in the inflorescence stage (S6) of both species, with a relatively higher biosynthesis and accumulation during post-flowering stages of F. tataricum compared to F. esculentum. The expression of flavonoid pathway genes, through qRT-PCR, in different growth stages vis-à-vis rutin content variation showed differential expression for four genes, PAL, CHS, CHI and FLS with the amounts of transcripts relatively higher in F. tataricum compared to F. esculentum, thereby, correlating these genes with the biosynthesis and accumulation of rutin. The expression of PAL was highest, 7.69 and 8.96-fold in Stages 2 (seedling stage) and 9 (fully developed seeds) of F. tataricum compared to F. esculentum, respectively. The expression of the CHS gene correlated with the rutin content because it was highest in the flowers (S6) and fully developed seeds (S9) of both Fagopyrum species, with relatively higher transcript amounts

  8. Investigating the potential role of genetic and epigenetic variation of DNA methyltransferase genes in hyperplastic polyposis syndrome.

    Directory of Open Access Journals (Sweden)

    Musa Drini

    Full Text Available BACKGROUND: Hyperplastic Polyposis Syndrome (HPS is a condition associated with multiple serrated polyps, and an increased risk of colorectal cancer (CRC. At least half of CRCs arising in HPS show a CpG island methylator phenotype (CIMP, potentially linked to aberrant DNA methyltransferase (DNMT activity. CIMP is associated with methylation of tumor suppressor genes including regulators of DNA mismatch repair (such as MLH1, MGMT, and negative regulators of Wnt signaling (such as WIF1. In this study, we investigated the potential for interaction of genetic and epigenetic variation in DNMT genes, in the aetiology of HPS. METHODS: We utilized high resolution melting (HRM analysis to screen 45 cases with HPS for novel sequence variants in DNMT1, DNMT3A, DNMT3B, and DNMT3L. 21 polyps from 13 patients were screened for BRAF and KRAS mutations, with assessment of promoter methylation in the DNMT1, DNMT3A, DNMT3B, DNMT3L MLH1, MGMT, and WIF1 gene promoters. RESULTS: No pathologic germline mutations were observed in any DNA-methyltransferase gene. However, the T allele of rs62106244 (intron 10 of DNMT1 gene was over-represented in cases with HPS (p<0.01 compared with population controls. The DNMT1, DNMT3A and DNMT3B promoters were unmethylated in all instances. Interestingly, the DNMT3L promoter showed low levels of methylation in polyps and normal colonic mucosa relative to matched disease free cells with methylation level negatively correlated to expression level in normal colonic tissue. DNMT3L promoter hypomethylation was more often found in polyps harbouring KRAS mutations (p = 0.0053. BRAF mutations were common (11 out of 21 polyps, whilst KRAS mutations were identified in 4 of 21 polyps. CONCLUSIONS: Genetic or epigenetic alterations in DNMT genes do not appear to be associated with HPS, but further investigation of genetic variation at rs62106244 is justified given the high frequency of the minor allele in this case series.

  9. Variation in the Dicer and RAN Genes Are Associated with Survival in Patients with Hepatocellular Carcinoma.

    Science.gov (United States)

    Kim, Mi Na; Kim, Jung Oh; Lee, Seung Min; Park, Hana; Lee, Ju Ho; Rim, Kyu Sung; Hwang, Seong Gyu; Kim, Nam Keun

    2016-01-01

    Single-nucleotide polymorphisms (SNPs) in microRNA machinery genes might affect microRNA processing and subsequently impact tumorigenesis. The aim of this study was to investigate the associations between SNPs in microRNA machinery genes and hepatocellular carcinoma (HCC) in a Korean population. Genotyping of six SNPs in microRNA machinery genes was performed using blood samples from 147 patients with HCC and 209 healthy control subjects. None of the six SNPs in microRNA machinery genes were significantly associated with HCC development. However, among the models for six polymorphic loci-DICER (rs3742330 and rs13078), DROSHA (rs10719 and rs6877842), RAN (rs14035) and XPO5 (rs11077)-one allele combination (A-A-T-C-C-C) showed synergistic effects in terms of an increased risk of HCC development (odds ratio = 8.881, 95% confidence interval [CI] = 1.889-41.750; P = 0.002). Multivariate Cox proportional hazard regression analysis showed a significant survival benefit for the DICER rs3742330 GG compared with the AA type (hazard ratio [HR], 0.314; 95% CI, 0.135-0.730; P = 0.007) and for the RAN rs14035 CT compared with the CC genotype (HR, 0.587; 95% CI, 0.349-0.987; P = 0.044). Although we found no direct association between DICER (rs3742330 and rs13078), DROSHA (rs10719 and rs6877842), RAN (rs14035) or XPO5 (rs11077) polymorphisms and HCC risk, we demonstrated that DICER (rs3742330) and RAN (rs14035) were associated with the survival of HCC patients. Future studies with larger samples are needed to determine associations of SNPs in microRNA machinery genes with HCC risk and prognosis. PMID:27611467

  10. Mechanism and Effect of Temperature on Variations in Antibiotic Resistance Genes during Anaerobic Digestion of Dairy Manure

    Science.gov (United States)

    Sun, Wei; Qian, Xun; Gu, Jie; Wang, Xiao-Juan; Duan, Man-Li

    2016-07-01

    Animal manure comprises an important reservoir for antibiotic resistance genes (ARGs), but the variation in ARGs during anaerobic digestion at various temperatures and its underlying mechanism remain unclear. Thus, we performed anaerobic digestion using dairy manure at three temperature levels (moderate: 20 °C, mesophilic: 35 °C, and thermophilic: 55 °C), to analyze the dynamics of ARGs and bacterial communities by quantitative PCR and 16S rRNA gene sequencing. We found that 8/10 detected ARGs declined and 5/10 decreased more than 1.0 log during thermophilic digestion, whereas only four and five ARGs decreased during moderate and mesophilic digestion, respectively. The changes in ARGs and bacterial communities were similar under the moderate and mesophilic treatments, but distinct from those in the thermophilic system. Potential pathogens such as Bacteroidetes, Proteobacteria, and Corynebacterium were removed by thermophilic digestion but not by moderate and mesophilic digestion. The bacterial community succession was the dominant mechanism that influenced the variation in ARGs and integrons during anaerobic digestion. Thermophilic digestion decreased the amount of mesophilic bacteria (Bacteroidetes and Proteobacteria) carrying ARGs. Anaerobic digestion generally decreased the abundance of integrons by eliminating the aerobic hosts of integrons (Actinomycetales and Bacilli). Thermophilic anaerobic digestion is recommended for the treatment and reuse of animal manure.

  11. Variations among Japanese of the factor IX gene (F9) detected by PCR-denaturing gradient gel electrophoresis

    Energy Technology Data Exchange (ETDEWEB)

    Satoh, Chiyoko; Takahashi, Norio; Asakawa, Junichi; Hiyama, Keiko; Kodaira, Meiko (Radiation Effects Research Foundation, Hiroshima (Japan))

    1993-01-01

    In the course of feasibility studies to examine the efficiencies and practicalities of various techniques for screening for genetic variations, the human coagulation factor IX (F9) genes of 63 Japanese families were examined by PCR-denaturing gradient gel electrophoresis (PCR-DGGE). Four target sequences with lengths of 983-2,891 bp from the F9 genes of 126 unrelated individuals from Hiroshima and their 100 children were amplified by PCR, digested with restriction enzymes to approximately 500-bp fragments, and examined by DGGE - a total of 6,724 bp being examined per individual. GC-rich sequences (GC-clamps) of 40 bp were attached to both ends of the target sequences, as far as was feasible. Eleven types of new nucleotide substitutions were detected in the population, none of which produced RFLPs or caused hemophilia B. By examining two target sequences in a single lane, approximately 8,000 bp in a diploid individual could be examined. This approach is very effective for the detection of variations in DNA and is applicable to large-scale population studies. 46 refs., 3 figs., 1 tab.

  12. The Effects of Sequence Variation on Genome-wide NRF2 Binding—New Target Genes and Regulatory SNPs

    Science.gov (United States)

    Kuosmanen, Suvi M.; Viitala, Sari; Laitinen, Tuomo; Peräkylä, Mikael; Pölönen, Petri; Kansanen, Emilia; Leinonen, Hanna; Raju, Suresh; Wienecke-Baldacchino, Anke; Närvänen, Ale; Poso, Antti; Heinäniemi, Merja; Heikkinen, Sami; Levonen, Anna-Liisa

    2016-01-01

    Transcription factor binding specificity is crucial for proper target gene regulation. Motif discovery algorithms identify the main features of the binding patterns, but the accuracy on the lower affinity sites is often poor. Nuclear factor E2-related factor 2 (NRF2) is a ubiquitous redox-activated transcription factor having a key protective role against endogenous and exogenous oxidant and electrophile stress. Herein, we decipher the effects of sequence variation on the DNA binding sequence of NRF2, in order to identify both genome-wide binding sites for NRF2 and disease-associated regulatory SNPs (rSNPs) with drastic effects on NRF2 binding. Interactions between NRF2 and DNA were studied using molecular modelling, and NRF2 chromatin immunoprecipitation-sequence datasets together with protein binding microarray measurements were utilized to study binding sequence variation in detail. The binding model thus generated was used to identify genome-wide binding sites for NRF2, and genomic binding sites with rSNPs that have strong effects on NRF2 binding and reside on active regulatory elements in human cells. As a proof of concept, miR-126–3p and -5p were identified as NRF2 target microRNAs, and a rSNP (rs113067944) residing on NRF2 target gene (Ferritin, light polypeptide, FTL) promoter was experimentally verified to decrease NRF2 binding and result in decreased transcriptional activity. PMID:26826707

  13. Gene expression variation between distinct areas of breast cancer measured from paraffin-embedded tissue cores

    Directory of Open Access Journals (Sweden)

    Gugger Mathias

    2008-11-01

    Full Text Available Abstract Background Diagnosis and prognosis in breast cancer are mainly based on histology and immunohistochemistry of formalin-fixed, paraffin-embedded (FFPE material. Recently, gene expression analysis was shown to elucidate the biological variance between tumors and molecular markers were identified that led to new classification systems that provided better prognostic and predictive parameters. Archived FFPE samples represent an ideal source of tissue for translational research, as millions of tissue blocks exist from routine diagnostics and from clinical studies. These should be exploited to provide clinicians with more accurate prognostic and predictive information. Unfortunately, RNA derived from FFPE material is partially degraded and chemically modified and reliable gene expression measurement has only become successful after implementing novel and optimized procedures for RNA isolation, demodification and detection. Methods In this study we used tissue cylinders as known from the construction of tissue microarrays. RNA was isolated with a robust protocol recently developed for RNA derived from FFPE material. Gene expression was measured by quantitative reverse transcription PCR. Results Sixteen tissue blocks from 7 patients diagnosed with multiple histological subtypes of breast cancer were available for this study. After verification of appropriate localization, sufficient RNA yield and quality, 30 tissue cores were available for gene expression measurement on TaqMan® Low Density Arrays (16 invasive ductal carcinoma (IDC, 8 ductal carcinoma in situ (DCIS and 6 normal tissue, and 14 tissue cores were lost. Gene expression values were used to calculate scores representing the proliferation status (PRO, the estrogen receptor status and the HER2 status. The PRO scores measured from entire sections were similar to PRO scores determined from IDC tissue cores. Scores determined from normal tissue cores consistently revealed lower PRO scores

  14. Association of variation in the LAMA3 gene, encoding the alpha-chain of laminin 5, with atopic dermatitis in a German case-control cohort

    OpenAIRE

    Stemmler, Susanne; Parwez, Qumar; Petrasch-Parwez, Elisabeth; Epplen, Jörg T; Hoffjan, Sabine

    2014-01-01

    Background Atopic dermatitis (AD) is a chronic inflammatory skin disorder caused by complex interaction of genetic and environmental factors. Besides mutations in the filaggrin gene, leading to impaired skin barrier function, variation in genes encoding additional skin proteins has been suggested to contribute to disease risk. Laminin 5, playing an important role in skin integrity, is composed of three subunits encoded by the LAMA3, LAMB3 and LAMC2 genes in which biallelic mutations cause epi...

  15. Genetic variations and haplotype diversity of the UGT1 gene cluster in the Chinese population.

    Directory of Open Access Journals (Sweden)

    Jing Yang

    Full Text Available Vertebrates require tremendous molecular diversity to defend against numerous small hydrophobic chemicals. UDP-glucuronosyltransferases (UGTs are a large family of detoxification enzymes that glucuronidate xenobiotics and endobiotics, facilitating their excretion from the body. The UGT1 gene cluster contains a tandem array of variable first exons, each preceded by a specific promoter, and a common set of downstream constant exons, similar to the genomic organization of the protocadherin (Pcdh, immunoglobulin, and T-cell receptor gene clusters. To assist pharmacogenomics studies in Chinese, we sequenced nine first exons, promoter and intronic regions, and five common exons of the UGT1 gene cluster in a population sample of 253 unrelated Chinese individuals. We identified 101 polymorphisms and found 15 novel SNPs. We then computed allele frequencies for each polymorphism and reconstructed their linkage disequilibrium (LD map. The UGT1 cluster can be divided into five linkage blocks: Block 9 (UGT1A9, Block 9/7/6 (UGT1A9, UGT1A7, and UGT1A6, Block 5 (UGT1A5, Block 4/3 (UGT1A4 and UGT1A3, and Block 3' UTR. Furthermore, we inferred haplotypes and selected their tagSNPs. Finally, comparing our data with those of three other populations of the HapMap project revealed ethnic specificity of the UGT1 genetic diversity in Chinese. These findings have important implications for future molecular genetic studies of the UGT1 gene cluster as well as for personalized medical therapies in Chinese.

  16. Autism Risk Gene MET Variation and Cortical Thickness in Typically Developing Children and Adolescents

    OpenAIRE

    Hedrick, Alexis; Lee, Yohan; Wallace, Gregory L.; Greenstein, Deanna; Clasen, Liv; Giedd, Jay N.; Raznahan, Armin

    2012-01-01

    MET receptor tyrosine kinase (MET) has been proposed as a candidate risk gene for autism spectrum disorder (ASD) based on associations between MET polymorphisms and ASD diagnosis, as well as evidence from animal studies that MET protein may regulate early development of cortical regions implicated in the neurobiology of ASD. The relevance of differences in MET signaling for human cortical development remains unexamined, however. We sought to address this issue by relating genotype at a functi...

  17. Seasonal variations in developmental competence and relative abundance of gene transcripts in buffalo (Bubalus bubalis) oocytes.

    Science.gov (United States)

    Abdoon, Ahmed S; Gabler, Christoph; Holder, Christoph; Kandil, Omaima M; Einspanier, Ralf

    2014-11-01

    Hot season is a major constraint to production and reproduction in buffaloes. The present work aimed to investigate the effect of season on ovarian function, developmental competence, and the relative abundance of gene expression in buffalo oocytes. Three experiments were conducted. In experiment 1, pairs of buffalo ovaries were collected during cold season (CS, autumn and winter) and hot season (HS, spring and summer), and the number of antral follicles was recorded. Cumulus oocyte complexes (COCs) were aspirated and evaluated according to their morphology into four Grades. In experiment 2, Grade A and B COCs collected during CS and HS were in vitro matured (IVM) for 24 hours under standard conditions at 38.5 °C in a humidified air of 5% CO2. After IVM, cumulus cells were removed and oocytes were fixed, stained with 1% aceto-orcein, and evaluated for nuclear configuration. In vitro matured buffalo oocytes harvested during CS or HS were in vitro fertilized (IVF) using frozen-thawed buffalo semen and cultured in vitro to the blastocyst stage. In experiment 3, buffalo COCs and in vitro matured oocytes were collected during CS and HS, and then snap frozen in liquid nitrogen for gene expression analysis. Total RNA was extracted from COCs and in vitro matured oocytes, and complementary DNA was synthesized; quantitative Reverse Transcription-Polymerase Chain Reaction was performed for eight candidate genes including GAPDH, ACTB, B2M, GDF9, BMP15, HSP70, and SOD2. The results indicated that HS significantly (P ovary. The number of Grade A, B, and C COCs was lower (P quality. In vitro maturation of buffalo oocytes during HS impairs their nuclear and cytoplasmic maturation, fertilization, and subsequent embryo development to the morula and blastocyst stages. This could be in part because of the altered gene expression found in COCs and in vitro matured oocytes. PMID:25156970

  18. Variation in genes that regulate blood pressure are associated with glomerular filtration rate in Chinese.

    Directory of Open Access Journals (Sweden)

    May E Montasser

    Full Text Available Chronic kidney disease (CKD can be a consequence of diabetes, hypertension, immunologic disorders, and other exposures, as well as genetic factors that are still largely unknown. Glomerular filtration rate (GFR, which is widely used to measure kidney function, has a heritability ranging from 25% to 75%, but only 1.5% of this heritability is explained by genetic loci that have been identified to date. In this study we tested for associations between GFR and 234 SNPs in 26 genes from pathways of blood pressure regulation in 3,025 rural Chinese participants of the "Genetic Epidemiology Network of Salt Sensitivity" (GenSalt study. We estimated GFR (eGFR using baseline serum creatinine measurements obtained prior to dietary intervention. We identified significant associations between eGFR and 12 SNPs in 6 genes (ACE, ADD1, AGT, GRK4, HSD11B1, and SCNN1G. The cumulative effect of the protective alleles was an increase in mean eGFR of 4 mL/min per 1.73 m2, while the cumulative effect of the risk alleles was a decrease in mean eGFR of 3 mL/min per 1.73 m2. In addition, we identified a significant interaction between SNPs in CYP11B1 and ADRB2. We have identified common variants in genes from pathways that regulate blood pressure and influence kidney function as measured by eGFR, providing new insights into the genetic determinants of kidney function. Complex genetic effects on kidney function likely involve interactions among genes as we observed for CYP11B1 and ADRB2.

  19. Variation in dopamine genes influences responsivity of the human reward system

    OpenAIRE

    Dreher, Jean-Claude; Kohn, Philip; Kolachana, Bhaskar; Weinberger, Daniel R.; Berman, Karen Faith

    2008-01-01

    In humans, dopamine neurotransmission is influenced by functional polymorphisms in the dopamine transporter (DAT1) and catechol-O-methyltransferase (COMT) genes. Here, we used event-related functional magnetic resonance imaging to directly investigate the neurofunctional effects of the Val158Met COMT and variable number of tandem repeat DAT1 polymorphisms on distinct components of the reward system in humans. The results revealed a main effect of COMT genotype in the ventral striatum and late...

  20. Rapid Detection of Positive Selection in Genes and Genomes Through Variation Clusters

    OpenAIRE

    Wagner, Andreas

    2007-01-01

    Positive selection in genes and genomes can point to the evolutionary basis for differences among species and among races within a species. The detection of positive selection can also help identify functionally important protein regions and thus guide protein engineering. Many existing tests for positive selection are excessively conservative, vulnerable to artifacts caused by demographic population history, or computationally very intensive. I here propose a simple and rapid test that is co...

  1. Association of interleukin-1 gene variations with moderate to severe chronic periodontitis in multiple ethnicities

    OpenAIRE

    Wu, X.; Offenbacher, S; Lόpez, N J; Chen, D.; Wang, H-Y; Rogus, J.; Zhou, J.; Beck, J.; Jiang, S; X. Bao; Wilkins, L; Doucette-Stamm, L.; Kornman, K

    2014-01-01

    Background and Objective Genetic markers associated with disease are often non-functional and generally tag one or more functional “causative” variants in linkage disequilibrium. Markers may not show tight linkage to the causative variants across multiple ethnicities due to evolutionary divergence, and therefore may not be informative across different population groups. Validated markers of disease suggest causative variants exist in the gene and, if the causative variants can be identified, ...

  2. Gene Transfer Efficiency in Gonococcal Biofilms: Role of Biofilm Age, Architecture, and Pilin Antigenic Variation

    OpenAIRE

    Kouzel, Nadzeya; Oldewurtel, Enno R.; Maier, Berenike

    2015-01-01

    Extracellular DNA is an important structural component of many bacterial biofilms. It is unknown, however, to which extent external DNA is used to transfer genes by means of transformation. Here, we quantified the acquisition of multidrug resistance and visualized its spread under selective and nonselective conditions in biofilms formed by Neisseria gonorrhoeae. The density and architecture of the biofilms were controlled by microstructuring the substratum for bacterial adhesion. Horizontal t...

  3. Metagenomic approach reveals variation of microbes with arsenic and antimony metabolism genes from highly contaminated soil.

    Directory of Open Access Journals (Sweden)

    Jinming Luo

    Full Text Available Microbes have great potential for arsenic (As and antimony (Sb bioremediation in heavily contaminated soil because they have the ability to biotransform As and Sb to species that have less toxicity or are more easily removed. In this study, we integrated a metagenomic method with physicochemical characterization to elucidate the composition of microbial community and functional genes (related to As and Sb in a high As (range from 34.11 to 821.23 mg kg-1 and Sb (range from 226.67 to 3923.07 mg kg-1 contaminated mine field. Metagenomic analysis revealed that microbes from 18 phyla were present in the 5 samples of soil contaminated with high As and Sb. Moreover, redundancy analysis (RDA of the relationship between the 18 phyla and the concentration of As and Sb demonstrated that 5 phyla of microbes, i.e. Actinobacteria, Firmicutes, Nitrospirae, Tenericutes and Gemmatimonadetes were positively correlated with As and Sb concentration. The distribution, diversity and abundance of functional genes (including arsC, arrA, aioA, arsB and ACR3 were much higher for the samples containing higher As and Sb concentrations. Based on correlation analysis, the results showed a positive relationship between arsC-like (R2 = 0.871 and aioA-like (R2 = 0.675 gene abundance and As concentration, and indicated that intracellular As(V reduction and As(III oxidation could be the dominant As detoxification mechanism enabling the microbes to survive in the environment. This study provides a direct and reliable reference on the diversity of microbial community and functional genes in an extremely high concentration As- and Sb-contaminated environment.

  4. Genetic variation of the transthyretin gene in wild-type transthyretin amyloidosis (ATTRwt)

    OpenAIRE

    Sikora, Jacquelyn L.; Logue, Mark W.; Chan, Gloria G.; Spencer, Brian H.; Prokaeva, Tatiana B.; Baldwin, Clinton T.; Seldin, David C.; Connors, Lawreen H.

    2014-01-01

    Wild-type transthyretin amyloidosis (ATTRwt), typically diagnosed as congestive heart failure in elderly Caucasian men, features myocardial amyloid deposits of wild-type plasma protein transthyretin (TTR). ATTRwt is sporadic, its pathogenesis is poorly understood, and currently there are no biomarkers for diagnosis or prognosis. Genetic studies of variant-associated transthyretin amyloidosis (ATTRm) have suggested that non-coding TTR gene variants modulate disease. We hypothesized that cis-ac...

  5. A Common Variation in the Promoter Region of Interleukin-6 Gene Shows Association with Exercise Performance

    OpenAIRE

    Antti Huuskonen; Minna Tanskanen; Jani Lappalainen; Niku Oksala; Heikki Kyröläinen; Mustafa Atalay

    2009-01-01

    Skeletal muscle-derived interleukin-6 (IL-6) is a pleiotropic cytokine which regulates body metabolism during strenuous physical exercise. OBJECTIVE: The effect of a potentially functional single nucleotide polymorphism (SNP) -174G/C of the IL6 gene (rs1800795) promoter was examined on maximal oxygen uptake (VO2max), body mass index (BMI) and plasma IL-6 levels in response to physical training. Fifty four male military conscripts were studied for 8 weeks during their basic training. At weeks ...

  6. Adaptive variation regulates the expression of the human SGK1 gene in response to stress.

    OpenAIRE

    Francesca Luca; Sonal Kashyap; Catherine Southard; Min Zou; David Witonsky; Anna Di Rienzo; Conzen, Suzanne D.

    2009-01-01

    The Serum and Glucocorticoid-regulated Kinase1 (SGK1) gene is a target of the glucocorticoid receptor (GR) and is central to the stress response in many human tissues. Because environmental stress varies across habitats, we hypothesized that natural selection shaped the geographic distribution of genetic variants regulating the level of SGK1 expression following GR activation. By combining population genetics and molecular biology methods, we identified a variant (rs9493857) with marked allel...

  7. Gene expression profiling in the Cynomolgus macaque Macaca fascicularis shows variation within the normal birth range

    Directory of Open Access Journals (Sweden)

    Vickers Mark H

    2011-10-01

    Full Text Available Abstract Background Although an adverse early-life environment has been linked to an increased risk of developing the metabolic syndrome, the molecular mechanisms underlying altered disease susceptibility as well as their relevance to humans are largely unknown. Importantly, emerging evidence suggests that these effects operate within the normal range of birth weights and involve mechanisms of developmental palsticity rather than pathology. Method To explore this further, we utilised a non-human primate model Macaca fascicularis (Cynomolgus macaque which shares with humans the same progressive history of the metabolic syndrome. Using microarray we compared tissues from neonates in the average birth weight (50-75th centile to those of lower birth weight (5-25th centile and studied the effect of different growth trajectories within the normal range on gene expression levels in the umbilical cord, neonatal liver and skeletal muscle. Results We identified 1973 genes which were differentially expressed in the three tissue types between average and low birth weight animals (P Conclusion These differences in gene expression levels between animals in the upper and lower percentiles of the normal birth weight range may point towards early life metabolic adaptations that in later life result in differences in disease risk.

  8. Nicotinic Acetylcholine Receptor α4 Subunit Gene Variation Associated with Attention Deficit Hyperactivity Disorder

    Institute of Scientific and Technical Information of China (English)

    HUANG Xuezhu; XU Yong; LI Qianqian; LIU Pozi; YANG Yuan; ZHANG Fuquan; GUO Tianyou; YANG Chuang; GUO Lanting

    2009-01-01

    Previous pharmacological, human genetics, and animal models have implicated the nicotinic ace-tylcholine receptor a4 subunit (CHRNA4) gene in the pathogenesis of attention deficit/hyperactivity disorder (ADHD). The objective of this study is to examine the genetic association between single nucleotide poly-morphisms in the CHRNA4 gene (rs2273502, rs1044396, rs1044397, and rs3827020 loci) and ADHD. Both case-control and family-based designs are used. Children aged 6 to 16 years were interviewed and as-sessed with the children behavior checklist and the revised conner' parent rating scale to identify probands. No significant differences in the frequency distribution of genotypes or alleles were found between the case and control groups. However, further haplotype analyses showed the CCGG haplotype on dsk for ADHD in 164 case-control samples and the standard transmission disequilibrium test analyses suggest that the allele C of rs2273502 was over-transferred in 98 ADHD parent-offspring tdos. These findings suggest that the CHRNA4 gene may play a role in the pathogenesis of ADHD.

  9. Genetic Variation in Selenoprotein Genes, Lifestyle, and Risk of Colon and Rectal Cancer

    OpenAIRE

    Martha L Slattery; Lundgreen, Abbie; Welbourn, Bill; Corcoran, Christopher; Wolff, Roger K.

    2012-01-01

    Background Associations between selenium and cancer have directed attention to role of selenoproteins in the carcinogenic process. Methods We used data from two population-based case-control studies of colon (n = 1555 cases, 1956 controls) and rectal (n = 754 cases, 959 controls) cancer. We evaluated the association between genetic variation in TXNRD1, TXNRD2, TXNRD3, C11orf31 (SelH), SelW, SelN1, SelS, SepX, and SeP15 with colorectal cancer risk. Results After adjustment for multiple compari...

  10. Mouse Models of Mutations and Variations in Autism Spectrum Disorder-Associated Genes: Mice Expressing Caps2/Cadps2 Copy Number and Alternative Splicing Variants

    Directory of Open Access Journals (Sweden)

    Tetsushi Sadakata

    2013-11-01

    Full Text Available Autism spectrum disorder (ASD is a neurodevelopmental disorder characterized by disturbances in interpersonal relationships and behavior. Although the prevalence of autism is high, effective treatments have not yet been identified. Recently, genome-wide association studies have identified many mutations or variations associated with ASD risk on many chromosome loci and genes. Identification of the biological roles of these mutations or variations is necessary to identify the mechanisms underlying ASD pathogenesis and to develop clinical treatments. At present, mice harboring genetic modifications of ASD-associated gene candidates are the best animal models to analyze hereditary factors involved in autism. In this report, the biological significance of ASD-associated genes is discussed by examining the phenotypes of mouse models with ASD-associated mutations or variations in mouse homologs, with a focus on mice harboring genetic modifications of the Caps2/Cadps2 (Ca2+-dependent activator protein for secretion 2 gene.

  11. Aula de videojuegos, un proyecto académico

    OpenAIRE

    Navarrete Cardero, José Luis; Barrientos Bueno, Mónica

    2012-01-01

    Aula de Videojuegos es un proyecto académico multidisciplinar de investigación, formación y desarro­llo de la Facultad de Comunicación de la Universidad de Sevilla, en el que también participan la de Be­llas Artes y la Escuela Técnica Superior de Ingeniería Informática. Las variadas actividades desempeñadas se expanden más allá de los límites característicos de un proyecto de investigación al uso; tienen por propósito la formación práctica de sus integrantes en destrezas relacionadas con el d...

  12. Association between genetic variations in tumor necrosis factor receptor genes and survival of patients with T-cell lymphoma

    Institute of Scientific and Technical Information of China (English)

    Kan Zhai; Jiang Chang; Chen Wu; Ning Lu; Li-Ming Huang; Tong-Wen Zhang; Dian-Ke Yu; Wen Tan; Dong-Xin Lin

    2012-01-01

    The prognosis of T-cell lymphoma (TCL) has been shown to be associated with the clinical characteristics of patients.However,there is little knowledge of whether genetic variations also affect the prognosis of TCL.This study investigated the associations between single nucleotide polymorphisms (SNPs) in tumor necrosis factor receptor superfamily (TNFRSF) genes and the survival of patients with TCL.A total of 38tag SNPs in 18 TNFRSF genes were genotyped using Sequenom platform in 150 patients with TCL.Kaplan-Meier survival estimates were plotted and significance was assessed using log-rank tests.Cox proportional hazard models were used to analyze each of these 38 SNPs with adjustment for covariates that might influence patient survival,including sex and international prognostic Index score.Hazard ratios (HRs) and their 95% confidence intervals (Cls) were calculated.Among the 38 SNPs tested,3 were significantly associated with the survival of patients with TCL.These SNPs were located at LTβR (rs3759333C>T) and TNFRSF17 (rs2017662C >T and rs2071336C>T).The 5-year survival rates were significantly different among patients carrying different genotypes and the HRs for death between the different genotypes ranged from 0.45 to 2.46.These findings suggest that the SNPs in TNFRSF genes might be important determinants for the survival of TCL patients.

  13. Nucleotide variation and balancing selection at the Ckma gene in Atlantic cod: analysis with multiple merger coalescent models

    Directory of Open Access Journals (Sweden)

    Einar Árnason

    2015-02-01

    Full Text Available High-fecundity organisms, such as Atlantic cod, can withstand substantial natural selection and the entailing genetic load of replacing alleles at a number of loci due to their excess reproductive capacity. High-fecundity organisms may reproduce by sweepstakes leading to highly skewed heavy-tailed offspring distribution. Under such reproduction the Kingman coalescent of binary mergers breaks down and models of multiple merger coalescent are more appropriate. Here we study nucleotide variation at the Ckma (Creatine Kinase Muscle type A gene in Atlantic cod. The gene shows extreme differentiation between the North (Canada, Greenland, Iceland, Norway, Barents Sea and the South (Faroe Islands, North-, Baltic-, Celtic-, and Irish Seas with FST > 0.8 between regions whereas neutral loci show no differentiation. This is evidence of natural selection. The protein sequence is conserved by purifying selection whereas silent and non-coding sites show extreme differentiation. The unfolded site-frequency spectrum has three modes, a mode at singleton sites and two high frequency modes at opposite frequencies representing divergent branches of the gene genealogy that is evidence for balancing selection. Analysis with multiple-merger coalescent models can account for the high frequency of singleton sites and indicate reproductive sweepstakes. Coalescent time scales vary with population size and with the inverse of variance in offspring number. Parameter estimates using multiple-merger coalescent models show that times scales are faster than under the Kingman coalescent.

  14. Genetic variation in the NBS1, MRE11, RAD50 and BLM genes and susceptibility to non-Hodgkin lymphoma

    Directory of Open Access Journals (Sweden)

    Gascoyne Randy D

    2009-11-01

    Full Text Available Abstract Background Translocations are hallmarks of non-Hodgkin lymphoma (NHL genomes. Because lymphoid cell development processes require the creation and repair of double stranded breaks, it is not surprising that disruption of this type of DNA repair can cause cancer. The members of the MRE11-RAD50-NBS1 (MRN complex and BLM have central roles in maintenance of DNA integrity. Severe mutations in any of these genes cause genetic disorders, some of which are characterized by increased risk of lymphoma. Methods We surveyed the genetic variation in these genes in constitutional DNA of NHL patients by means of gene re-sequencing, then conducted genetic association tests for susceptibility to NHL in a population-based collection of 797 NHL cases and 793 controls. Results 114 SNPs were discovered in our sequenced samples, 61% of which were novel and not previously reported in dbSNP. Although four variants, two in RAD50 and two in NBS1, showed association results suggestive of an effect on NHL, they were not significant after correction for multiple tests. Conclusion These results suggest an influence of RAD50 and NBS1 on susceptibility to diffuse large B-cell lymphoma and marginal zone lymphoma. Larger association and functional studies could confirm such a role.

  15. De Novo Assembly of Bitter Gourd Transcriptomes: Gene Expression and Sequence Variations in Gynoecious and Monoecious Lines.

    Science.gov (United States)

    Shukla, Anjali; Singh, V K; Bharadwaj, D R; Kumar, Rajesh; Rai, Ashutosh; Rai, A K; Mugasimangalam, Raja; Parameswaran, Sriram; Singh, Major; Naik, P S

    2015-01-01

    Bitter gourd (Momordica charantia L.) is a nutritious vegetable crop of Asian origin, used as a medicinal herb in Indian and Chinese traditional medicine. Molecular breeding in bitter gourd is in its infancy, due to limited molecular resources, particularly on functional markers for traits such as gynoecy. We performed de novo transcriptome sequencing of bitter gourd using Illumina next-generation sequencer, from root, flower buds, stem and leaf samples of gynoecious line (Gy323) and a monoecious line (DRAR1). A total of 65,540 transcripts for Gy323 and 61,490 for DRAR1 were obtained. Comparisons revealed SNP and SSR variations between these lines and, identification of gene classes. Based on available transcripts we identified 80 WRKY transcription factors, several reported in responses to biotic and abiotic stresses; 56 ARF genes which play a pivotal role in auxin-regulated gene expression and development. The data presented will be useful in both functions studies and breeding programs in bitter gourd. PMID:26047102

  16. Genetic variations in the human cannabinoid receptor gene are associated with happiness.

    Directory of Open Access Journals (Sweden)

    Masahiro Matsunaga

    Full Text Available Happiness has been viewed as a temporary emotional state (e.g., pleasure and a relatively stable state of being happy (subjective happiness level. As previous studies demonstrated that individuals with high subjective happiness level rated their current affective states more positively when they experience positive events, these two aspects of happiness are interrelated. According to a recent neuroimaging study, the cytosine to thymine single-nucleotide polymorphism of the human cannabinoid receptor 1 gene is associated with sensitivity to positive emotional stimuli. Thus, we hypothesized that our genetic traits, such as the human cannabinoid receptor 1 genotypes, are closely related to the two aspects of happiness. In Experiment 1, 198 healthy volunteers were used to compare the subjective happiness level between cytosine allele carriers and thymine-thymine carriers of the human cannabinoid receptor 1 gene. In Experiment 2, we used positron emission tomography with 20 healthy participants to compare the brain responses to positive emotional stimuli of cytosine allele carriers to that of thymine-thymine carriers. Compared to thymine-thymine carriers, cytosine allele carriers have a higher subjective happiness level. Regression analysis indicated that the cytosine allele is significantly associated with subjective happiness level. The positive mood after watching a positive film was significantly higher for the cytosine allele carriers compared to the thymine-thymine carriers. Positive emotion-related brain region such as the medial prefrontal cortex was significantly activated when the cytosine allele carriers watched the positive film compared to the thymine-thymine carriers. Thus, the human cannabinoid receptor 1 genotypes are closely related to two aspects of happiness. Compared to thymine-thymine carriers, the cytosine allele carriers of the human cannabinoid receptor 1 gene, who are sensitive to positive emotional stimuli, exhibited greater

  17. Genetic variations in the human cannabinoid receptor gene are associated with happiness.

    Science.gov (United States)

    Matsunaga, Masahiro; Isowa, Tokiko; Yamakawa, Kaori; Fukuyama, Seisuke; Shinoda, Jun; Yamada, Jitsuhiro; Ohira, Hideki

    2014-01-01

    Happiness has been viewed as a temporary emotional state (e.g., pleasure) and a relatively stable state of being happy (subjective happiness level). As previous studies demonstrated that individuals with high subjective happiness level rated their current affective states more positively when they experience positive events, these two aspects of happiness are interrelated. According to a recent neuroimaging study, the cytosine to thymine single-nucleotide polymorphism of the human cannabinoid receptor 1 gene is associated with sensitivity to positive emotional stimuli. Thus, we hypothesized that our genetic traits, such as the human cannabinoid receptor 1 genotypes, are closely related to the two aspects of happiness. In Experiment 1, 198 healthy volunteers were used to compare the subjective happiness level between cytosine allele carriers and thymine-thymine carriers of the human cannabinoid receptor 1 gene. In Experiment 2, we used positron emission tomography with 20 healthy participants to compare the brain responses to positive emotional stimuli of cytosine allele carriers to that of thymine-thymine carriers. Compared to thymine-thymine carriers, cytosine allele carriers have a higher subjective happiness level. Regression analysis indicated that the cytosine allele is significantly associated with subjective happiness level. The positive mood after watching a positive film was significantly higher for the cytosine allele carriers compared to the thymine-thymine carriers. Positive emotion-related brain region such as the medial prefrontal cortex was significantly activated when the cytosine allele carriers watched the positive film compared to the thymine-thymine carriers. Thus, the human cannabinoid receptor 1 genotypes are closely related to two aspects of happiness. Compared to thymine-thymine carriers, the cytosine allele carriers of the human cannabinoid receptor 1 gene, who are sensitive to positive emotional stimuli, exhibited greater magnitude

  18. Genetic variation of the transthyretin gene in wild-type transthyretin amyloidosis (ATTRwt).

    Science.gov (United States)

    Sikora, Jacquelyn L; Logue, Mark W; Chan, Gloria G; Spencer, Brian H; Prokaeva, Tatiana B; Baldwin, Clinton T; Seldin, David C; Connors, Lawreen H

    2015-01-01

    Wild-type transthyretin amyloidosis (ATTRwt), typically diagnosed as congestive heart failure in elderly Caucasian men, features myocardial amyloid deposits of wild-type plasma protein transthyretin (TTR). ATTRwt is sporadic, its pathogenesis is poorly understood, and currently there are no biomarkers for diagnosis or prognosis. Genetic studies of variant-associated transthyretin amyloidosis have suggested that non-coding TTR gene variants modulate disease. We hypothesized that cis-acting regulatory elements in the TTR gene non-coding regions may modify expression, affecting ATTRwt onset and progression. We studied an ATTRwt cohort consisting of 108 Caucasian males ranging in age from 59 to 87 years with cardiomyopathy due to wild-type TTR deposition; results were compared to 118 anonymous controls matched by age, sex, and race. Four predicted non-coding regulatory regions and all exons in the TTR gene were sequenced using the Sanger method. Eleven common variants were identified; three variants were significantly associated with ATTRwt (p < 0.05), though only one, rs72922940, remained near significance (p corrected = 0.083) after multiple testing correction. Exon analyses demonstrated the occurrence of the p.G26S (G6S) polymorphism in 7 % of ATTRwt subjects and 12 % of controls; this variant was predicted to be a protective factor (p = 0.051). Four variants were significantly associated with age at onset and survival. In this first genetic study of a large, well-characterized cohort of ATTRwt, non-coding and coding variants associated with disease, age at onset, and survival were identified. Further investigation is warranted to determine the prevalence of these variants in ATTRwt, their regulatory function, and potential role in assessing disease risk. PMID:25367359

  19. Non-Steroidal Anti-Inflammatory Drugs, Variation in Inflammatory Genes, and Aggressive Prostate Cancer

    Directory of Open Access Journals (Sweden)

    John S. Witte

    2010-10-01

    Full Text Available Increasing evidence suggests that prostatic inflammation plays a key role in the development of prostate cancer. It remains controversial whether non-steroidal anti-inflammatory drugs (NSAIDs reduce the risk of prostate cancer. Here, we investigate how a previously reported inverse association between NSAID use and the risk of aggressive prostate cancer is modulated by variants in several inflammatory genes. We found that NSAIDs may have differential effects on prostate cancer development, depending on one’s genetic makeup. Further study of these inflammatory pathways may clarify the mechanisms through which NSAIDs impact prostate cancer risk.

  20. C-reactive protein levels are influenced by common IL-1 gene variations.

    Science.gov (United States)

    Berger, Peter; McConnell, Joseph P; Nunn, Martha; Kornman, Kenneth S; Sorrell, Julian; Stephenson, Katherine; Duff, Gordon W

    2002-02-21

    Elevated markers of systemic inflammation are associated with the development of acute coronary syndromes, but there is no current explanation for increased inflammation in overtly healthy individuals. The influence of genetic control of the inflammatory response on the observed variability is unknown. We studied the frequency of four polymorphisms in interleukin (IL) 1 genes, known to modulate inflammation, in 454 individuals undergoing coronary angiography and analysed their influence on plasma C-reactive protein (CRP) and fibrinogen levels. Females and smokers had higher levels of CRP than males (Pi = 0.001) and non-smokers (Pi = 0.001). Patients with genotype 2.2 for the IL-1B(+3954) polymorphism had twice the median CRP levels of patients who were genotype 1.1 (4.33 vs 2.01 mg/l; P = 0.001). Patients with genotype 1.2 or 2.2 at the IL-1A(+4845) polymorphism also had higher median CRP (2.92 vs 2.05 mg/l, Pi = 0.023). In multivariate analyses, CRP levels remained significantly associated with IL-1 polymorphisms after adjustment for smoking, gender and age. Fibrinogen levels had similar associations with the IL-1 genotypes. These data indicate that IL-1 gene polymorphisms known to affect the inflammatory response are highly related to plasma levels of CRP and fibrinogen in patients referred for coronary angiography.

  1. Seasonal variations in antibiotic resistance gene transport in the Almendares River, Havana, Cuba

    Directory of Open Access Journals (Sweden)

    Charles W Knapp

    2012-11-01

    Full Text Available Numerous studies have quantified antibiotic resistance genes (ARG in rivers and streams around the world, and significant relationships have been shown that relate different pollutant outputs and increased local ARG levels. However, most studies have not considered ambient flow conditions, which can vary dramatically especially in tropical countries. Here, ARG were quantified in water-column and sediment samples during the dry-and wet-seasons to assess how seasonal and other factors influence ARG transport down the Almendares River (Havana, Cuba. Eight locations were sampled and stream flow estimated during both seasons; qPCR was used to quantify four tetracycline, two erythromycin, and three beta-lactam resistance genes. ARG concentrations were higher in wet-season versus dry-season samples, which combined with higher flows, indicated greater ARG transport downstream during the wet season. Water-column ARG levels were more spatially variable in the dry-season than the wet-season, with the proximity of waste outfalls strongly influencing local ARG levels. Results confirm that dry-season sampling provides a useful picture of the impact of individual waste inputs on local stream ARG levels, whereas, the majority of ARGs in this tropical river were transported downstream during the wet season, possibly due to re-entrainment of ARG from sediments.

  2. Genetic Variation of Myeloperoxidase Gene Contributes to Aggressive Periodontitis: A Preliminary Association Study in Turkish Population

    Directory of Open Access Journals (Sweden)

    Kamile Erciyas

    2010-01-01

    Full Text Available Myeloperoxidase (MPO is a lysosomal enzyme found in the azurophilic granules of polymorphonuclear leukocytes. It is involved in the defense against periodontal bacteria, and is also able to mediate inflammatory tissue destruction in aggressive and chronic periodontitis. The aim of this study was to explore the association between MPO-463G/A gene polymorphism and aggressive periodontitis (AgP and chronic periodontitis (CP. The study included 147 subjects. Probing depth (PD, clinical attachment loss (CAL, plaque index (PI, and gingival index (GI were recorded as the clinical parameters. Genomic DNA was obtained from the peripheral blood of 32 subjects with AgP, 25 with CP, and 90 reference controls. We genotyped the MPO-463G/A polymorphism using the PCR-RFLP method. All data were analyzed using SPSS version 13.0 for windows. There were no significant differences between the CP patients and controls regarding MPO-463A/G gene polymorphism either in terms of allele frequency or genotype frequency of MPO-463A/G. However, either in terms of allele frequency or genotype frequency of MPO-463A/G, there were significant differences between the AgP patients and the controls. In conclusion, our data suggest that MPO-463G/A may be associated with increased risk of aggressive periodontitis in Turkish patients.

  3. Variation in the Coat Protein Gene of Papaya ringspot Virus Isolates from Multiple Locations of China

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The potyvirus Papaya ringspot virus (PRSV) is an important pathogen of papaya that causes severe losses in economic crops for papaya production globally. The coat protein (CP) genes of five PRSV isolates originating from different locations in China were cloned and sequenced. The CP-coding region varied in size from 864-873 nucleotides, encoding proteins of 288-291 amino acids. The five Chinese isolates of PRSV have been characterized as papaya-infecting (PRSV-P). The CP sequences of the Chinese isolates were compared with those of previously published PRSV isolates originating from different countries at amino acid levels. A number of KE repeat boxes in the N terminus of the PRSV-CP were found in all Chinese isolates. The phylogenetic branching pattern revealed that there was certain extended grouping between geographic locations, and the Asian type probably represents the oldest population of PRSV. The information of CP genes will be useful in designing and developing durable virus resistant-PRSV transgenic papaya in China. Meanwhile broad-spectrum-virus resistant, strongly resistant-PRSV and good safe papaya lines are required.

  4. Sequence Variation of the Pertussis Toxin S1 Subunit Encoding Gene in the Clinical Isolates of Bordetella pertussis in Iran

    Directory of Open Access Journals (Sweden)

    Hosseinpour

    2015-08-01

    Full Text Available Background Whooping cough (pertussis is an acute respiratory disease caused by Bordetella pertussis (B. pertussis. Pertussis toxin is an important virulence factor of B. pertussis and plays a major role in the immune and inflammatory responses. Likewise, allelic variations in the genes of virulence factors have led to the non-responsiveness of the new strains to both whole-cell and acellular vaccines. Given the importance of pertussis vaccine, we sought to address the lack of fundamental studies on the polymorphisms of the virulence genes of B. pertussis in Iran. Objectives The aim of this study was to identify the polymorphisms of the pertussis toxin S1 subunit (ptxS1 gene in the circulating strains and compare them to the vaccine strain. Patients and Methods In this study, 50 strains of B. pertussis isolated from patients with pertussis were investigated in the pertussis reference laboratory of Pasteur institute of Iran. Cultivation, biochemical tests, and the specific antisera were used to confirm B. pertussis. The sequencing of the polymerase chain reaction products was performed to determine the ptxS1 alleles, and B. pertussis 134 was studied as the vaccine strain. Results The results showed that all the strains had the dominant allele ptxS1A. There were differences between the alleles of the clinical strains and the vaccine strain. Conclusions In recent years, a significant increase in the incidence of pertussis has been reported worldwide. Our findings regarding the allelic shift of the ptxS1 gene are similar to those reported in many European and American countries showing the difference of the dominant allele of ptxS1 between the circulating isolates and the vaccine strains.

  5. The Relationship Between Genetic Variations of the Cholesteryl Ester Transfer Protein Gene and Coronary Artery Disease in Turkish Subjects

    Science.gov (United States)

    Gundogdu, Fuat; Gurlertop, Yekta; Pirim, Ibrahim; Sevimli, Serdar; Dogan, Hasan; Arslan, Sakir; Aksoy, Hulya; Karakelloglu, Sule; Senocak, Huseyin

    2009-01-01

    Objective Although the relationship between cholesteryl ester transfer protein (CETP) and cholesterol metabolism has been characterized in recent years, the effect of CETP genetic variants associated with coronary artery disease (CAD) is still unclear. Therefore, we investigated the association between CETP gene polymorphism and levels of lipid in patients with CAD. Materials and Methods We conducted a case-control study that included 194 unrelated subjects who underwent coronary angiography for suspected ischemic heart disease. This group was divided into 96 patients with angiographically documented CAD and 98 subjects (individuals matched for age and gender) without angiographically documented CAD (CAD-free subjects), all of whom were studied to examine the genotypic distribution of the CETP gene polymorphism in CAD. Genotyping was performed via polymerase chain reaction. Results Of the 96 patients with CAD, 38 (40%) were B1B1, 42 (44%) B1B2 and 16 (16%) B2B2, compared with the control subjects, of which 35 (36%) were B1B1, 44 (45%) B1B2 and 19 (19%) B2B2. There were no significant differences between patients with CAD and control subjects in the distribution of the CETP gene polymorphism. Patients with the B1B1 genotype had lower high-density lipoprotein-cholesterol (HDL-C) and higher triglyceride (TG) levels than patients with the B2B2 genotype (p<0.05). In addition, among control subjects HDL-C levels were significantly higher in subjects with the B2B2 genotype than in subjects with the B1B1 genotype (p<0.01). Conclusion Our results suggest that genetic variations of the CTEP gene may be responsible for low HDL-C levels but may not be considered as a risk factor for CAD in the Turkish population. PMID:25610061

  6. Differential Shannon entropy and differential coefficient of variation: alternatives and augmentations to differential expression in the search for disease-related genes.

    Science.gov (United States)

    Wang, Kai; Phillips, Charles A; Rogers, Gary L; Barrenas, Fredrik; Benson, Mikael; Langston, Michael A

    2014-01-01

    Differential expression has been a standard tool for analysing case-control transcriptomic data since the advent of microarray technology. It has proved invaluable in characterising the molecular mechanisms of disease. Nevertheless, the expression profile of a gene across samples can be perturbed in ways that leave the expression level unaltered, while a biological effect is nonetheless present. This paper describes and analyses differential Shannon entropy and differential coefficient of variation, two alternate techniques for identifying genes of interest. Ontological analysis across 16 human disease datasets demonstrates that these alternatives are effective at identifying disease-related genes not found by mere differential expression alone. Because the two alternate techniques are based on somewhat different mathematical formulations, they tend to produce somewhat different gene lists. Moreover, each may pinpoint genes completely overlooked by the other. Thus, measures of entropy and variation can be used to replace or better yet augment standard differential expression computations.

  7. Allelic variation at a single gene increases food value in a drought-tolerant staple cereal.

    Science.gov (United States)

    Gilding, Edward K; Frère, Celine H; Cruickshank, Alan; Rada, Anna K; Prentis, Peter J; Mudge, Agnieszka M; Mace, Emma S; Jordan, David R; Godwin, Ian D

    2013-01-01

    The production of adequate agricultural outputs to support the growing human population places great demands on agriculture, especially in light of ever-greater restrictions on input resources. Sorghum is a drought-adapted cereal capable of reliable production where other cereals fail, and thus represents a good candidate to address food security as agricultural inputs of water and arable land grow scarce. A long-standing issue with sorghum grain is that it has an inherently lower digestibility. Here we show that a low-frequency allele type in the starch metabolic gene, pullulanase, is associated with increased digestibility, regardless of genotypic background. We also provide evidence that the beneficial allele type is not associated with deleterious pleiotropic effects in the modern field environment. We argue that increasing the digestibility of an adapted crop is a viable way forward towards addressing food security while maximizing water and land-use efficiency. PMID:23403584

  8. Variation and Characterization Analysis of Partial Fragment of Fibroin Gene From Silkworm, Antheraea pernyi

    Institute of Scientific and Technical Information of China (English)

    Li Wenli(李文利); Jin Liji; An Lijia

    2003-01-01

    A 1.4Kb DNA fragment containing 3' flanking sequence of fibroin gene of silkworm, Antheraea pernyi, was obtained from the silk gland's mRNA of 5th larva. Analysis of this sequence with another A.pernyi fibroin protein (accession No. D83241) revealed that it consists of a completely open reading frame (ORF), which includes 14 polyalanine-containing units (motifs) and 100bp 3'-UTR. The sequence of the predicted amino acid reveals the highest level of overall identity (90%) with D83241. It was found that it loses a repeat region at the upstream of TAA codon and some mutations. A putative polyadenylation signal AATAAA tail was found in position 1300, which follows the termination codon.

  9. Impact of Common Variation in Bone-Related Genes on Type 2 Diabetes and Related Traits

    DEFF Research Database (Denmark)

    Billings, Liana K; Hsu, Yi-Hsiang; Ackerman, Rachel J;

    2012-01-01

    candidate genes. SNP rs6867040, at the ITGA1 locus, was associated with a 0.0166 mmol/L (0.004) increase in fasting glucose per C allele in the combined analysis. Genetic variants in the ITGA1 locus were associated with its expression in the liver but not in adipose tissue. ITGA1 variants appeared among......Exploring genetic pleiotropy can provide clues to a mechanism underlying the observed epidemiological association between type 2 diabetes and heightened fracture risk. We examined genetic variants associated with bone mineral density (BMD) for association with type 2 diabetes and glycemic traits...... the top loci associated with type 2 diabetes, fasting insulin, β-cell function by homeostasis model assessment, and 2-h post-oral glucose tolerance test glucose and insulin levels. ITGA1 has demonstrated genetic pleiotropy in prior studies, and its suggested role in liver fibrosis, insulin secretion...

  10. Sequence variation at the phenylalanine hydroxylase gene in the British Isles

    Energy Technology Data Exchange (ETDEWEB)

    Tyfield, L.A. [Southmead Hospital, Bristol (United Kingdom)]|[Univ. of Bristol (United Kingdom); Stephenson, A. [Southmead Hospital, Bristol (United Kingdom); Cockburn, F. [Royal Hospital for Sick Children, Glasgow (United Kingdom)] [and others

    1997-02-01

    Using mutation and haplotype analysis, we have examined the phenylalanine hydroxylase gene in the phenylketonuria populations of four geographical areas of the British Isles: the west of Scotland, southern Wales, and southwestern and southeastern England. The enormous genetic diversity of this locus within the British Isles is demonstrated in the large number of different mutations characterized and in the variety of genetic backgrounds on which individual mutations are found. Allele frequencies of the more common mutations exhibited significant nonrandom distribution in a north/south differentiation. Differences between the west of Scotland and southwestern England may be related to different events in the recent and past histories of their respective populations. Similarities between southern Wales and southeastern England are likely to reflect the heterogeneity that is seen in and around two large capital cities. Finally, comparison with more recently colonized areas of the world corroborates the genealogical origin by range expansion of several mutations. 38 refs., 2 tabs.

  11. Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population

    DEFF Research Database (Denmark)

    Frikke-Schmidt, Ruth

    2010-01-01

    Epidemiological studies consistently demonstrate a strong inverse association between low levels of high-density lipoprotein (HDL) cholesterol and increased risk of ischemic heart disease (IHD). This review focuses on whether both rare and common genetic variation in ABCA1 contributes to plasma...... levels of HDL cholesterol and to risk of IHD in the general population, and further seeks to understand whether low levels of HDL cholesterol per se are causally related to IHD. Studies of the ABCA1 gene demonstrate a general strategy for detecting functional genetic variants, and show that both common...... and rare ABCA1 variants contribute to levels of HDL cholesterol and risk of IHD in the general population. The association between ABCA1 variants and risk of IHD appears, however, to be independent of plasma levels of HDL cholesterol. With the recent identification of the largest number of individuals...

  12. Association between common germline genetic variation in 94 candidate genes or regions and risks of invasive epithelial ovarian cancer

    DEFF Research Database (Denmark)

    Quaye, Lydia; Tyrer, Jonathan; Ramus, Susan J;

    2009-01-01

    BACKGROUND: Recent studies have identified several single nucleotide polymorphisms (SNPs) in the population that are associated with variations in the risks of many different diseases including cancers such as breast, prostate and colorectal. For ovarian cancer, the known highly penetrant....... To date, we have genotyped 340 SNPs from 94 candidate genes or regions, in up to 1,491 invasive epithelial ovarian cancer cases and 3,145 unaffected controls from three different population based studies from the UK, Denmark and USA. RESULTS: After adjusting for population stratification by genomic...... control, 18 SNPs (5.3%) were significant at the 5% level, and 5 SNPs (1.5%) were significant at the 1% level. The most significant association was for the SNP rs2107425, located on chromosome 11p15.5, which has previously been identified as a susceptibility allele for breast cancer from a genome wide...

  13. Variations of mitochondrial D-loop region plus downstream gene 12S rRNA-tRNAphe and gastric carcinomas

    Institute of Scientific and Technical Information of China (English)

    Cheng-Bo Han; Fan Li; Yu-Jie Zhao; Jia-Ming Ma; Dong-Ying Wu; Yu-Kui Zhang; Yan Xin

    2003-01-01

    AIM: To explore the instabilities, polymorphisms and other variations of mitochondrial D-loop region and downstream gene 12S rRNA-tRNAPhe in gastric cancers, and to study their relationship with gastric cancer.METHODS: Three adjacent regions (D-loop, tRNAphe and 12S rRNA) were detected for instabilities, polymorphisms and other variations via PCR amplification followed by direct DNA sequencing in 22 matched gastric cancerous tissues and para-cancerous normal tissues.RESULTS: PolyC or (CA)n instabilities were detected in 13/22(59.1%) gastric cancers and 9/22(40.9 %) in the control (P>0.05). There existed 2/12(16.7%) and 6/10(60%)alterations of 12S rR NA-tRNAphe in well differentiated gastric cancers and poorly differentiated ones, respectively(P0.05).Some new variations were found, among which np 318 and np 321 C-T transitions in D-loop region were two of the five bases for H-strand replication primer. Np 523 AC-deletion and np 527 C-T transition occurred at mtTF1 binding site (mtTFBS), which were associated with the transcription of downstream mitochondrial genome. Seven samples showed the np 16 182 polyC instabilities, five of which simultaneously showed np 16 189 T-C transitions.CONCLUSION: There is no statistic significance of instabilities and polymorphisms in mitochondrial D-loop region between gastric cancerous and para-cancerous normal tissues, which suggests that the instability might relate to heredity or be dependent on aging. There is asignificant correlation between differentiation degree of gastric cancer and variant frequencies of 12S rRNA-tRNAphe. The poorly differentiated gastric cancers are more prone to 12S rRNAtRNAphe variations, or gastric cancers with 12S rRNA-tRNAphe variations are more likely to be poorly differentiated, np 16189 T-C transition may be one of the important reasons for polyC instability in gastric cancer.

  14. Evolutionary variations in the expression of dorso-ventral patterning genes and the conservation of pioneer neurons in Tribolium castaneum.

    Science.gov (United States)

    Biffar, Lucia; Stollewerk, Angelika

    2015-04-01

    Insects are ideally suited for gaining insight into the evolutionary developmental mechanisms that have led to adaptive changes of the nervous system since the specific structure of the nervous system can be directly linked to the neural stem cell (neuroblast) lineages, which in turn can be traced back to the last common ancestor of insects. The recent comparative analysis of the Drosophila melanogaster and Tribolium castaneum neuroblast maps revealed substantial differences in the expression profiles of neuroblasts. Here we show that despite the overall conservation of the dorso-ventral expression domains of muscle segment homeobox, intermediate neuroblasts defective and ventral nervous system defective, the expression of these genes relative to the neuroblasts in the respective domains has changed considerably during insect evolution. Furthermore, functional studies show evolutionary changes in the requirement of ventral nervous system defective in the formation of neuroblast 1-1 and the correct differentiation of its presumptive progeny, the pioneer neurons aCC and pCC. The inclusion of the expression data of the dorso-ventral genes into the recently established T. castaneum neuroblast map further increases the differences in the neuroblast expression profiles between D. melanogaster and T. castaneum. Despite these molecular variations, the Even-skipped positive pioneer neurons show an invariant arrangement, except for an additional Even-skipped positive cluster that we discovered in T. castaneum. Given the importance of these pioneer neurons in establishing the intersegmental nerves and the longitudinal tracts, which are part of the conserved axonal scaffold of arthropods, we discuss internal buffering mechanisms that might ensure that neuroblast lineages invariantly generate pioneer neurons over a wide range of molecular variations.

  15. Common genetic variation in the Estrogen Receptor Beta (ESR2 gene and osteoarthritis: results of a meta-analysis

    Directory of Open Access Journals (Sweden)

    Rivadeneira Fernando

    2010-11-01

    Full Text Available Abstract Background The objective of this study was to examine the relationship between common genetic variation of the ESR2 gene and osteoarthritis. Methods In the discovery study, the Rotterdam Study-I, 7 single nucleotide polymorphisms (SNPs were genotyped and tested for association with hip (284 cases, 2772 controls, knee (665 cases, 2075 controls, and hand OA (874 cases, 2184 controls using an additive model. In the replication stage one SNP (rs1256031 was tested in an additional 2080 hip, 1318 knee and 557 hand OA cases and 4001, 2631 and 1699 controls respectively. Fixed- and random-effects meta-analyses were performed over the complete dataset including 2364 hip, 1983 knee and 1431 hand OA cases and approximately 6000 controls. Results The C allele of rs1256031 was associated with a 36% increased odds of hip OA in women of the Rotterdam Study-I (OR 1.36, 95% CI 1.08-1.70, p = 0.009. Haplotype analysis and analysis of knee- and hand OA did not give additional information. With the replication studies, the meta-analysis did not show a significant effect of this SNP on hip OA in the total population (OR 1.06, 95% CI 0.99-1.15, p = 0.10. Stratification according to gender did not change the results. In this study, we had 80% power to detect an odds ratio of at least 1.14 for hip OA (α = 0.05. Conclusion This study showed that common genetic variation in the ESR2 gene is not likely to influence the risk of osteoarthritis with effects smaller than a 13% increase.

  16. Strategies for integrated analysis of genetic, epigenetic and gene expression variation in cancer: addressing the challenges

    Directory of Open Access Journals (Sweden)

    Louise Bruun Thingholm

    2016-02-01

    Full Text Available The development and progression of cancer, a collection of diseases with complex genetic architectures, is facilitated by the interplay of multiple etiological factors. This complexity challenges the traditional single-platform study design and calls for an integrated approach to data analysis. However, integration of heterogeneous measurements of biological variation is a non-trivial exercise due to the diversity of the human genome and the variety of output data formats and genome coverage obtained from the commonly used molecular platforms. This review article will provide an introduction to integration strategies used for analyzing genetic risk factors for cancer. We critically examine the ability of these strategies to handle the complexity of the human genome and also accommodate information about the biological and functional interactions between the elements that have been measured – making the assessment of disease risk against a composite genomic factor possible. The focus of this review is to provide an overview and introduction to the main strategies and to discuss where there is a need for further development.

  17. Paraoxonase gene cluster variations associated with coronary heart disease in Chinese Han women

    Institute of Scientific and Technical Information of China (English)

    SU Shao-yong; CHEN Jian-hong; HUANG Jian-feng; WANG Xiao-ling; ZHAO Jian-gong; SHEN Yan; QIANG Bo-qin; GU Dong-feng

    2005-01-01

    Background The oxidative modification of low-density lipoprotein in the artery wall is currently believed to be central to the pathogenesis of atherosclerosis. Paraoxonase (PON1), an enzyme located on high-density lipoprotein (HDL), can prevent low-density lipoprotein (LDL) from oxidation at a certain extent. Recent studies show two other members of paraoxonase gene family, PON2 and PON3, possess antioxidant properties similar to PON1. The aim of the present study was to explore the role of PON gene cluster on coronary heart disease (CHD) in Chinese Han women.Methods Seven polymorphisms including PON1 -107C>T, -162G>A, -831G>A, R160G, Q192R, PON2 S311C, and PON3 -133C>A were genotyped in 184 female patients with CHD and 239 female controls. The plasma PON1 activity toward phenylacetate was determined in 50 cases and 50 controls randomly selected. Results The plasma PON1 activities were significantly lower in cases than in controls. Individual SNP analysis showed that cases had significantly higher frequencies of PON1 -107T, -831G and PON2 311S alleles than controls. The genotype distributions of -107C>T were also significantly different between two groups. The odds ratios for the development of CHD were 1.66 for -107TC carriers and 2.0 for -107TT carriers, compared with -107CC carriers. Haplotype analyses showed that the distributions of haplotypes comprised of PON1 -107C>T and PON2 S311C were significantly different between cases and controls, with cases having higher frequency of T-S haplotype (44.8% vs. 36.3%, P=0.013). The T-S haplotype remained significantly associated with CHD after adjusting environmental risk factors (P=0.0069).Conclusions This association study suggested that lower plasma PON1 activity increased the risk of CHD in Chinese woman, which may be mediated by the higher frequency of -107T allele in cases. Haplotype analyses indicated that there might be some synergistic effects between the PON1 -107C>T and PON2 S311C polymorphisms.

  18. Increased Variation in Adh Enzyme Activity in Drosophila Mutation-Accumulation Experiment Is Not Due to Transposable Elements at the Adh Structural Gene

    Science.gov (United States)

    Aquadro, C. F.; Tachida, H.; Langley, C. H.; Harada, K.; Mukai, T.

    1990-01-01

    We present here a molecular analysis of the region surrounding the structural gene encoding alcohol dehydrogenase (Adh) in 47 lines of Drosophila melanogaster that have each accumulated mutations for 300 generations. While these lines show a significant increase in variation of alcohol dehydrogenase enzyme activity compared to control lines, we found no restriction map variation in a 13-kb region including the complete Adh structural gene and roughly 5 kb of both 5' and 3' sequences. Thus, the rapid accumulation of ADH activity variation after 28,200 allele generations does not appear to have been due to the mobilization of transposable elements into or out of the Adh structural gene region. PMID:1963870

  19. Variation in the interleukin-6 receptor gene associates with type 2 diabetes in Danish whites

    DEFF Research Database (Denmark)

    Hamid, Yasmin H; Urhammer, Søren A; Jensen, Dorit P;

    2004-01-01

    Interleukin-6 (IL-6) is a pleiotropic cytokine involved in the pathophysiology of various human diseases such as type 2 diabetes and obesity. IL-6 signals via a heterodimeric receptor complex consisting of a soluble IL-6 alpha-subunit (IL-6 receptor [IL6R]) and a signal transducing subunit (gp130......). The IL6R gene maps to an important candidate locus for type 2 diabetes on chromosome 1q21. An Asp358Ala polymorphism of the IL6R has been reported to associate with obesity in Pima Indians. We investigated the Asp358Ala polymorphism in relation to type 2 diabetes, obesity, and other pre.......5-40.1] in diabetic subjects vs. 41.2% [40.2-42.2] in control subjects; P = 0.007). The odds ratio for the Asp/Asp carriers versus Ala/Ala carriers was 1.38 (1.09-1.71). Among 4,251 middle-aged glucose-tolerant subjects, the Asp358Ala polymorphism was not associated with estimates of obesity, post-oral glucose...

  20. Varenicline for smoking cessation: nausea severity and variation in nicotinic receptor genes.

    Science.gov (United States)

    Swan, G E; Javitz, H S; Jack, L M; Wessel, J; Michel, M; Hinds, D A; Stokowksi, R P; McClure, J B; Catz, S L; Richards, J; Zbikowski, S M; Deprey, M; McAfee, T; Conti, D V; Bergen, A W

    2012-08-01

    This study evaluated association between common and rare sequence variants in 10 nicotinic acetylcholine receptor subunit genes and the severity of nausea 21 days after initiating the standard, Food and Drug Administration-approved varenicline regimen for smoking cessation. A total of 397 participants from a randomized clinical effectiveness trial with complete clinical and DNA resequencing data were included in the analysis (mean age=49.2 years; 68.0% female). Evidence for significant association between common sequence variants in CHRNB2 and nausea severity was obtained after adjusting for age, gender and correlated tests (all P(ACT)<0.05). Individuals with the minor allele of CHRNB2 variants experienced less nausea than did those without the minor allele, consistent with previously reported findings for CHRNB2 and the occurrence of nausea and dizziness as a consequence of first smoking attempt in adolescents, and with the known neurophysiology of nausea. As nausea is the most common reason for discontinuance of varenicline, further pharmacogenetic investigations are warranted.

  1. Genes: Interactions with Language on Three Levels—Inter-Individual Variation, Historical Correlations and Genetic Biasing

    Science.gov (United States)

    Dediu, Dan

    The complex inter-relationships between genetics and linguistics encompass all four scales highlighted by the contributions to this book and, together with cultural transmission, the genetics of language holds the promise to offer a unitary understanding of this fascinating phenomenon. There are inter-individual differences in genetic makeup which contribute to the obvious fact that we are not identical in the way we understand and use language and, by studying them, we will be able to both better treat and enhance ourselves. There are correlations between the genetic configuration of human groups and their languages, reflecting the historical processes shaping them, and there also seem to exist genes which can influence some characteristics of language, biasing it towards or against certain states by altering the way language is transmitted across generations. Besides the joys of pure knowledge, the understanding of these three aspects of genetics relevant to language will potentially trigger advances in medicine, linguistics, psychology or the understanding of our own past and, last but not least, a profound change in the way we regard one of the emblems of being human: our capacity for language.

  2. A COMMON VARIATION IN THE PROMOTER REGION OF INTERLEUKIN-6 GENE SHOWS ASSOCIATION WITH EXERCISE PERFORMANCE

    Directory of Open Access Journals (Sweden)

    Antti Huuskonen

    2009-06-01

    Full Text Available Skeletal muscle-derived interleukin-6 (IL-6 is a pleiotropic cytokine which regulates body metabolism during strenuous physical exercise. OBJECTIVE: The effect of a potentially functional single nucleotide polymorphism (SNP -174G/C of the IL6 gene (rs1800795 promoter was examined on maximal oxygen uptake (VO2max, body mass index (BMI and plasma IL-6 levels in response to physical training. Fifty four male military conscripts were studied for 8 weeks during their basic training. At weeks 1, 5 and 8, VO2max and anthropometrics were measured, and blood samples collected before and after acute aerobic exercise. Acute exercise increased plasma IL-6 in subjects with genotype CG. Moreover, during the 8-week training period, a tendency for increased plasma IL-6 was observed in subjects with this genotype. VO2max values increased in all genotype groups, but subjects with genotype CG made the greatest gains in VO2max. Training significantly decreased BMI only in subjects with genotype CG. Our findings suggest that the allele C may have an effect on plasma IL-6 response to acute exercise in healthy male subjects. Exercise training has a favourable effect on VO2max and BMI, with the most prominent effects in subjects with genotype CG. Thus we conclude that this SNP may account for individual response to exercise training.

  3. Variation in the vitamin D receptor gene is not associated with risk of colorectal cancer in the Czech Republic.

    LENUS (Irish Health Repository)

    Hughes, David J

    2012-02-01

    PURPOSE: Increased levels of vitamin D may protect against colorectal cancer (CRC) development and recurrence. Accumulating epidemiologic evidence suggests these effects may be partly mediated by genetic variants of the vitamin D receptor (VDR) proposed to be associated with altered risk of CRC. We wished to determine if common VDR polymorphisms affected CRC risk in the Czech Republic, a homogenous European population with a high CRC incidence rate. METHODS: Frequencies of the common VDR gene polymorphisms rs2238136, rs1544410 (BsmI), rs7975232 (ApaI), and rs731236 (TaqI) were determined using allele-specific PCR in a case control analysis of a series of 754 CRC patients and 627 patients without malignant disease recruited from centers throughout the Czech Republic. Unconditional logistic regression was used to calculate odds ratios and 95% confidence intervals for the association between these variants and risk of CRC. RESULTS: None of the four polymorphisms tested had any significant effect on CRC risk. No significant differences were observed in susceptibility when the population was stratified by anatomical sub-site, sex, BMI, smoking, alcohol, or presence of polyps. CONCLUSIONS: We conclude that common variation in the VDR gene had little effect on its own on predisposition to sporadic CRC in the Czech population.

  4. Copy number variation of a gene cluster encoding endopolygalacturonase mediates flesh texture and stone adhesion in peach.

    Science.gov (United States)

    Gu, Chao; Wang, Lu; Wang, Wei; Zhou, Hui; Ma, Baiquan; Zheng, Hongyu; Fang, Ting; Ogutu, Collins; Vimolmangkang, Sornkanok; Han, Yuepeng

    2016-03-01

    Texture is an important attribute affecting consumer perception of fruit quality. Peach melting flesh and flesh adhesion to stone (endocarp) are simply inherited and controlled by the F-M locus on linkage group (LG) 4. Here, we report that two genes encoding endopolygalacturonase (endoPG) in the F-M locus, designated PpendoPGF and PpendoPGM, are associated with the melting flesh and stone adhesion traits. PpendoPGM controls melting flesh while PpendoPGF has pleiotropic effects on both melting flesh and stone adhesion. The F-M locus has three allelic copy number variants of endoPG, H1 (PpendoPGF and PpendoPGM), H2 (PpendoPGM), and H3 (null). The H2 haplotype represents the ancestral one while the H1 and H3 haplotypes are two variants due to duplication and deletion of PpendoPGM, respectively. Accessions with H1H1, H1H2, or H1H3 genotypes show the freestone or semi-freestone and melting flesh phenotype, while both H2H2 and H2H3 accessions have the clingstone and melting flesh phenotype. The H3H3 accessions have the clingstone and non-melting flesh phenotype. Our study not only demonstrates a driving role of gene copy number variations in flesh texture diversification in fruit trees, but also provides a useful diagnostic tool for early seedling selection in peach breeding programmes. PMID:26850878

  5. SSADH variation in primates: intra- and interspecific data on a gene with a potential role in human cognitive functions.

    Science.gov (United States)

    Blasi, Paola; Palmerio, Francesca; Aiello, Aurora; Rocchi, Mariano; Malaspina, Patrizia; Novelletto, Andrea

    2006-07-01

    In the present study we focus on the nucleotide and the inferred amino acid variation occurring in humans and other primate species for mitochondrial NAD(+)-dependent succinic semialdehyde dehydrogenase, a gene recently supposed to contribute to cognitive performance in humans. We determined 2527 bp of coding, intronic, and flanking sequences from chimpanzee, bonobo, gorilla, orangutan, gibbon, and macaque. We also resequenced the entire coding sequence on 39 independent chromosomes from Italian families. Four variable coding sites were genotyped in additional populations from Europe, Africa, and Asia. A test for constancy of the nonsynonymous vs. synonymous rates of nucleotide changes revealed that primates are characterized by largely variable d(N)/d(S) ratios. On a background of strong conservation, probably controlled by selective constraints, the lineage leading to humans showed a ratio increased to 0.42. Human polymorphic levels fall in the range reported for other genes, with a pattern of frequency and haplotype structure strongly suggestive of nonneutrality. The comparison with the primate sequences allowed inferring the ancestral state at all variable positions, suggesting that the c.538(C) allele and the associated functional variant is indeed a derived state that is proceeding to fixation. The unexpected pattern of human polymorphism compared to interspecific findings outlines the possibility of a recent positive selection on some variants relevant to new cognitive capabilities unique to humans. PMID:16786440

  6. Seasonal variations of gene expression biomarkers in Mytilus galloprovincialis cultured populations: temperature, oxidative stress and reproductive cycle as major modulators.

    Science.gov (United States)

    Jarque, Sergio; Prats, Eva; Olivares, Alba; Casado, Marta; Ramón, Montserrat; Piña, Benjamin

    2014-11-15

    The blue mussel Mytilus galloprovincialis has been used as monitoring organism in many biomonitoring programs because of its broad distribution in South European sea waters and its physiological characteristics. Different pollution-stress biomarkers, including gene expression biomarkers, have been developed to determine its physiological response to the presence of different pollutants. However, the existing information about basal expression profiles is very limited, as very few biomarker-based studies were designed to reflect the natural seasonal variations. In the present study, we analyzed the natural expression patterns of several genes commonly used in biomonitoring, namely ferritin, metallothionein, cytochrome P450, glutathione S-transferase, heat shock protein and the kinase responsive to stress KRS, during an annual life cycle. Analysis of mantle-gonad samples of cultured populations of M. galloprovincialis from the Delta del Ebro (North East Spain) showed natural seasonal variability of these biomarkers, pointing to temperature and oxidative stress as major abiotic modulators. In turn, the reproductive cycle, a process that can be tracked by VCLM7 expression, and known to be influenced by temperature, seems to be the major biotic factor involved in seasonality. Our results illustrate the influence of environmental factors in the physiology of mussels through their annual cycle, a crucial information for the correct interpretation of responses under stress conditions.

  7. Genetic Variation ofEPAS1Gene in Tibetan Pigs and ThreeLow-Altitude Pig Breeds in China

    Institute of Scientific and Technical Information of China (English)

    DONG Kun-zhe; KANG Ye; YAO Na; SHU Guo-tao; ZUO Qing-qing; ZHAO Qian-jun; MA Yue-hui

    2014-01-01

    Endothelial PAS domain protein 1 (EPAS1), also called hypoxia-inducible factor-2, is a key regulatory factor of hypoxic responses and plays an essential role in high-altitude adaptation in mammalian species. In this study, polymorphisms of EPAS1 were detected in 217 individuals from 2 Tibetan pig populations and 3 low-altitude pig breeds by DNA pooling, PCR-SSCP, PCR-RFLP and DNA sequencing methods. A total of 14 synonymous polymorphisms were identiifed in the coding region. The analysis suggested that SNP1 (G963A), SNP7 (C1632T), SNP10 (G1929A) and SNP11 (G1947A) showed potential association with high-altitude environment because of their particular variation patterns in Tibetan pigs. Linkage disequilibrium (LD) of these SNPs was analyzed. One common LD block including 5 SNPs clustering in exon 12 was identiifed in all studied pig populations. Haplotype H1 (AGGTC) in LD block was dominant in Tibetan pigs (76.6 and 74.2% in Linzhi (LZ) and Chayu (CY) pigs, respectively) and segregated at higher frequency than that in low-altitude pig breeds (52.3, 58.7 and 56.2% in Wuzhishan (WZS), Min (M) and Laiwu (LW) pigs, respectively), indicating that H1 may relate to adaptation to high altitude in Tibetan pigs. These ifndings raise hope thatEPAS1gene can be a candidate gene that involved in adaptation of high altitude in Tibetan pigs.

  8. Escala de Estresores Académicos para la evaluación de los estresores académicos en estudiantes universitarios

    Directory of Open Access Journals (Sweden)

    Ramón G. Cabanach

    2016-07-01

    Full Text Available Este estudio tiene por objeto la evaluación de los estresores en el entorno académico. Los instrumentos empleados con este objetivo no siempre están adecuadamente adaptados al contexto universitario o son lo suficientemente exhaustivos como para englobar el elevado número de fuentes generadoras de estrés académico. El presente estudio utiliza una muestra de 1.196 estudiantes universitarios de diferentes titulaciones para describir y analizar la fiabilidad y validez de la Escala de Estresores Académicos, que forma parte del Cuestionario de Estrés Académico. Los resultados mostraron una escala compuesta por 54 ítems y 8 factores, que explican un 66% de la varianza, y que se mostró fiable tanto para el total de la escala ( = 0,96 como para cada uno de los factores, oscilando entre 0,81 y 0,94. Los factores identificados fueron deficiencias metodológicas del profesorado, sobrecarga académica, creencias sobre el rendimiento, intervenciones en público, clima social negativo, exámenes, carencia de valor de los contenidos y dificultades de participación.

  9. Copy number variation and missense mutations of the agouti signaling protein (ASIP) gene in goat breeds with different coat colors.

    Science.gov (United States)

    Fontanesi, L; Beretti, F; Riggio, V; Gómez González, E; Dall'Olio, S; Davoli, R; Russo, V; Portolano, B

    2009-01-01

    In goats, classical genetic studies reported a large number of alleles at the Agouti locus with effects on coat color and pattern distribution. From these early studies, the dominant A(Wt) (white/tan) allele was suggested to cause the white color of the Saanen breed. Here, we sequenced the coding region of the goat ASIP gene in 6 goat breeds (Girgentana, Maltese, Derivata di Siria, Murciano-Granadina, Camosciata delle Alpi, and Saanen), with different coat colors and patterns. Five single nucleotide polymorphisms (SNPs) were identified, 3 of which caused missense mutations in conserved positions of the cysteine-rich carboxy-terminal domain of the protein (p.Ala96Gly, p.Cys126Gly, and p.Val128Gly). Allele and genotype frequencies suggested that these mutations are not associated or not completely associated with coat color in the investigated goat breeds. Moreover, genotyping and sequencing results, deviation from Hardy-Weinberg equilibrium, as well as allele copy number evaluation from semiquantitative fluorescent multiplex PCR, indicated the presence of copy number variation (CNV) in all investigated breeds. To confirm the presence of CNV and evaluate its extension, we applied a bovine-goat cross-species array comparative genome hybridization (aCGH) experiment using a custom tiling array based on bovine chromosome 13. aCGH results obtained for 8 goat DNA samples confirmed the presence of CNV affecting a region of less that 100 kb including the ASIP and AHCY genes. In Girgentana and Saanen breeds, this CNV might cause the A(Wt) allele, as already suggested for a similar structural mutation in sheep affecting the ASIP and AHCY genes, providing evidence for a recurrent interspecies CNV. However, other mechanisms may also be involved in determining coat color in these 2 breeds.

  10. The association of adiponectin gene promoter variations with non-small cell lung cancer in a Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Yingfu Li

    Full Text Available Recently, in vitro studies have demonstrated that adiponectin has antiangiogenic and tumor growth-limiting properties. Additionally, serum adiponectin levels have been associated with the risk of several cancers; specifically, serum adiponectin was significantly lower in lung cancer patients with advanced-stage disease. In this study, we examined the association of adiponectin gene promoter variations associated with adiponectin gene expression and plasma levels in non-small cell lung cancer (NSCLC in a Han Chinese population. A total of 319 patients with NSCLC and 489 healthy individuals were recruited to evaluate the association of four adiponectin gene promoter single-nucleotide polymorphisms (SNPs (SNP-12140G>A, SNP-11426A>G, SNP-11391G>A and SNP-11377C>G with NSCLS risk. Additionally, we constructed haplotypes of these four SNPs and evaluated the association of these haplotypes with NSCLS risk. Our results showed that among these four SNPs, only SNP-12140G>A was associated with NSCLC risk (P0.05. Additionally, an association analysis of the four SNPs stratified into pathologic stages I+II and III+IV showed that these SNPs did not exhibit significant differences between pathologic stages I+II and III+IV. Moreover, we did not observe any differences in allele and genotype frequency for these SNPs between adenocarcinoma and squamous cell carcinoma. Our results indicated that the G allele of SNP-12140 may be a risk factor for NSCLC (OR = 1.516; 95% CI: 1.098-2.094 in this Han Chinese population.

  11. Association between cholesteryl ester transfer protein gene polymorphisms and variations in lipid levels in patients with coronary heart disease

    Institute of Scientific and Technical Information of China (English)

    郑克勤; 张思仲; 贺勇; 张立; 张克兰; 黄德嘉; 孙岩

    2004-01-01

    Background The TaqⅠB, MspⅠ and I405V polymorphisms of cholesteryl ester transfer protein (CETP), an important regulatory factor of lipid metabolism, have been attracted much more attention by the researchers. In this study, we investigated the associations between these 3 polymorphisms of CETP gene and variations in plasma lipid and lipoprotein levels in patients with coronary heart disease (CHD).Methods Genomic DNA was extracted from leukocytes of 203 CHD patients and 100 control subjects using the salting out method. Genotyping of the CETP gene was performed using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) techniques. Statistical analysis was conducted using the SPSS 10.0 software package.Results The distribution of allele and genotype frequencies of the TaqⅠB, MspⅠ, and I405V polymorphisms was similar in the CHD patient group and the control group. The B1B1 genotype of the TaqⅠB polymorphism was associated with significantly higher TC (P=0.039) and LDL-C (P=0.044) levels than the B2B2 genotype in CHD patients, and with significantly higher LDL-C (P=0.034) levels than the B2B2 genotype in controls. Homozygotes of the I405V polymorphism exhibited significantly higher HDL-C levels than VV homozygotes among control subjects (P=0.023). In male CHD patients with unambiguously assigned haplotypes, B2-M2-V/B2-M2-I patients demonstrated significantly higher HDL-C concentrations than B1-M2-V/B1-M2-I (P=0.023) and B1-M2-V/B1-M2-V patients (P=0.047). Conclusions Genetic variations in the CETP gene may account for a significant proportion of the differences in plasma lipid and lipoprotein concentrations among the general population. The B1B1 genotype of the TaqⅠB polymorphism is probably a genetic risk factor for CHD in the study population.

  12. A common variation within the STEAP4 gene exons is associated with obesity in Uygur general population

    Institute of Scientific and Technical Information of China (English)

    GUO Yan-ying; LI Nan-fang; ZHOU Ling; YAO Xiao-guang; WANG Hong-mei; ZHANG Ju-hong; LUO Wen-li

    2011-01-01

    Background Coordinated regulation of nutrient and inflammatory responses by six transmembrane epithelial antigen of prostate 4 (STEAP4) was essential for metabolic homeostasis. STEAP4 expression in human white adipose tissuewas associated with obesity. This study aimed to evaluate association between STEAP4 genetic polymorphisms and obesity in Uygur Chinese general population.Methods The functional regions of STEAP4 gene were sequenced in 96 Uygur with obesity (body mass index (BMI)>30 kg/m2). Representative variations were selected according to the function and linkage disequilibrium and genotyped in 1507 obesity (BMI ≥25 kg/m2) and 825 non-obesity control (BMI <25 kg/m2), all of whom were selected from epidemiology study of obesity-related diseases during January to February 2007 among Uygur population in Hetian area of Xinjiang Uygur Autonomous Region.Results Fourteen novel and 6 known single nucleotide polymorphism (SNPs), including 2 nonsynonymous SNPs (nsSNPs), in the STEAP4 gene were identified. Of the 3 representative SNPs, the nsSNP rs1981529 (Gly75Asp, 224A/G)was significantly associated with obesity phenotype (additive P/Pc=0.001/0.006, dominant P/Pc=0.003/0.018, odds ratio (OR) and 95% confidence interval (CI) adjusted for age, gender and drinking 0.755 (0.641-0.890) and 0.750(0.621-0.907), respectively). By the multiple linear regression analysis, the quantitative phenotypes of BMI (P/Pc=0.002/0.004) and waist circumference (P/Pc=0.004/0.008) were found to be significantly associated with the genotypes of rs1981529 (Gly75Asp, 224A/G) in Uygur general population, and effect size (beta value) of one allele G of rs1981529 (Gly75Asp, 224A/G) was-0.553 kg/m2 for BMI and -1.311 cm for waist circumference after controlling age,gender and drinking factors.Conclusions The present study shows an association of the common variation rs1981529 (Gly75Asp, 224A/G) in the STEAP4 gene with obesity in Uygur general population. Further studies should replicate the

  13. Inteligencia Emocional y rendimiento académico: análisis de variables mediadoras

    OpenAIRE

    Alonso Tamayo, Leticia

    2015-01-01

    [ES]Este trabajo se centra en la Inteligencia Emocional y su relación con el Rendimiento Académico en adolescentes. Sabemos que la Inteligencia Emocional guarda relación con unas adecuadas relaciones personales, bienestar psicológico y menores conductas disruptivas y de riesgo; sin embargo dentro del rendimiento académico quedan algunas cuestiones por resolver, ¿La IE está directamente relacionada con el rendimiento? o el hecho de que en el rendimiento académico sea un resultado complejo en e...

  14. Competencias profesionales de los académicos en la educación superior

    OpenAIRE

    Guillermo Yáber Oltra; Carmen Alfonzo

    2011-01-01

    El desarrollo profesional de los profesores y los líderes universitarios es un proceso continuo en la educación superior. Docencia, investigación, servicio, desarrollo personal y gestión son las competencias profesionales que un académico puede desarrollar durante su carrera. Se desarrolló un instrumento de auto-reporte que permite analizar la discrepancia entre la maestría que el personal académico y directivo aprecia de sus competencias académicas, personales y de gestión así como la import...

  15. Actividades extraescolares y rendimiento académico: diferencias en autoncocepto y género

    OpenAIRE

    Sánchez Delgado, María Purificación; Carmona Rodríguez, Carmen; Bakieva, Margarita

    2011-01-01

    El propósito de este estudio fue examinar la relación entre tipo de autoconcepto (académico y general) y realización de actividades extraescolares en el rendimiento académico en alumnos de Educación Primaria (N = 1708), así como determinar las diferencias de esta relación en cuanto al género. Se utilizó un sistema de muestreo por conglomerados y estratificado en dos etapas, administrando pruebas estandarizadas de rendimiento y un instrumento diseñado ad-hoc para autoconcepto académico, genera...

  16. Actividades extraescolares y rendimiento académico: diferencias en autoconcepto y género

    OpenAIRE

    Carmona Rodríguez, Carmen; Sánchez Delgado, María Purificación; Bakieva, Margarita

    2011-01-01

    El propósito de este estudio fue examinar la relación entre tipo de autoconcepto (académico y general) y realización de actividades extraescolares en el rendimiento académico en alumnos de Educación Primaria (N = 1708), así como determinar las diferencias de esta relación en cuanto al género. Se utilizó un sistema de muestreo por conglomerados y estratificado en dos etapas, administrando pruebas estandarizadas de rendimiento y un instrumento diseñado ad-hoc para autoconcepto académico, genera...

  17. Ansiedad, personalidad y rendimiento académico en alumnado de Educación primaria

    OpenAIRE

    Domblas García, Andrés

    2016-01-01

    La investigación que se presenta en esta tesis doctoral es un estudio descriptivo y correlacional situado en el ámbito escolar. En primer lugar, se lleva a cabo un análisis minucioso de cada una de las variables objeto de estudio: la ansiedad, la personalidad y el rendimiento académico. En segundo lugar, se analizan las interacciones entre las variables estudiadas: ansiedad y personalidad, ansiedad y rendimiento académico, personalidad y rendimiento académico. En tercer luga...

  18. Variation in siderophore biosynthetic gene distribution and production across environmental and faecal populations of Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Laura J Searle

    Full Text Available Iron is essential for Escherichia coli growth and survival in the host and the external environment, but its availability is generally low due to the poor solubility of its ferric form in aqueous environments and the presence of iron-withholding proteins in the host. Most E. coli can increase access to iron by excreting siderophores such as enterobactin, which have a very strong affinity for Fe3+. A smaller proportion of isolates can generate up to 3 additional siderophores linked with pathogenesis; aerobactin, salmochelin, and yersiniabactin. However, non-pathogenic E. coli are also able to synthesise these virulence-associated siderophores. This raises questions about their role in the ecology of E. coli, beyond virulence, and whether specific siderophores might be linked with persistence in the external environment. Under the assumption that selection favours phenotypes that confer a fitness advantage, we compared siderophore production and gene distribution in E. coli isolated either from agricultural plants or the faeces of healthy mammals. This population-level comparison has revealed that under iron limiting growth conditions plant-associated isolates produced lower amounts of siderophores than faecal isolates. Additionally, multiplex PCR showed that environmental isolates were less likely to contain loci associated with aerobactin and yersiniabactin synthesis. Although aerobactin was linked with strong siderophore excretion, a significant difference in production was still observed between plant and faecal isolates when the analysis was restricted to strains only able to synthesise enterobactin. This finding suggests that the regulatory response to iron limitation may be an important trait associated with adaptation to the non-host environment. Our findings are consistent with the hypothesis that the ability to produce multiple siderophores facilitates E. coli gut colonisation and plays an important role in E. coli commensalism.

  19. Variation in the interleukin-6 receptor gene associates with type 2 diabetes in Danish whites.

    Science.gov (United States)

    Hamid, Yasmin H; Urhammer, Søren A; Jensen, Dorit P; Glümer, Charlotte; Borch-Johnsen, Knut; Jørgensen, Torben; Hansen, Torben; Pedersen, Oluf

    2004-12-01

    Interleukin-6 (IL-6) is a pleiotropic cytokine involved in the pathophysiology of various human diseases such as type 2 diabetes and obesity. IL-6 signals via a heterodimeric receptor complex consisting of a soluble IL-6 alpha-subunit (IL-6 receptor [IL6R]) and a signal transducing subunit (gp130). The IL6R gene maps to an important candidate locus for type 2 diabetes on chromosome 1q21. An Asp358Ala polymorphism of the IL6R has been reported to associate with obesity in Pima Indians. We investigated the Asp358Ala polymorphism in relation to type 2 diabetes, obesity, and other pre-diabetic quantitative traits among Danish whites. By applying a recessive genetic model in a case-control study of 1,349 type 2 diabetic patients and 4,596 glucose-tolerant control subjects, we found a significant difference in genotype distribution (P = 0.008) and in allele frequency (Ala-allele 38.3% [95% CI 36.5-40.1] in diabetic subjects vs. 41.2% [40.2-42.2] in control subjects; P = 0.007). The odds ratio for the Asp/Asp carriers versus Ala/Ala carriers was 1.38 (1.09-1.71). Among 4,251 middle-aged glucose-tolerant subjects, the Asp358Ala polymorphism was not associated with estimates of obesity, post-oral glucose tolerance test serum insulin release, or the homeostasis model assessment of insulin resistance index. In conclusion, the Asp358Ala polymorphism of the IL6R associates with type 2 diabetes in Danish whites.

  20. Genes belonging to the insulin and ecdysone signaling pathways can contribute to developmental time, lifespan and abdominal size variation in Drosophila americana.

    Directory of Open Access Journals (Sweden)

    Micael Reis

    Full Text Available Even within a single genus, such as Drosophila, cases of lineage-specific adaptive evolution have been found. Therefore, the molecular basis of phenotypic variation must be addressed in more than one species group, in order to infer general patterns. In this work, we used D. americana, a species distantly-related to D. melanogaster, to perform an F2 association study for developmental time (DT, chill-coma recovery time (CRT, abdominal size (AS and lifespan (LS involving the two strains (H5 and W11 whose genomes have been previously sequenced. Significant associations were found between the 43 large indel markers developed here and DT, AS and LS but not with CRT. Significant correlations are also found between DT and LS, and between AS and LS, that might be explained by variation at genes belonging to the insulin and ecdysone signaling pathways. Since, in this F2 association study a single marker, located close to the Ecdysone receptor (EcR gene, explained as much as 32.6% of the total variation in DT, we performed a second F2 association study, to determine whether large differences in DT are always due to variation in this genome region. No overlapping signal was observed between the two F2 association studies. Overall, these results illustrate that, in D. americana, pleiotropic genes involved in the highly-conserved insulin and ecdysone signaling pathways are likely responsible for variation observed in ecologically relevant phenotypic traits, although other genes are also involved.

  1. Capacidad predictiva de la autoeficacia académica sobre las dimensiones del autoconcepto en una muestra de adolescentes chilenos

    OpenAIRE

    García-Fernández, J.M.; Díaz-Herrero, A. (Ángela); Inglés, C.J. (Cándido J.); Torregrosa, M.S. (María Soledad); Lagos-San-Martín, N. (Nelly); Gonzálvez, C. (Carolina)

    2016-01-01

    El objetivo de este estudio fue analizar la capacidad predictiva de la autoefi cacia académica sobre las dimensiones del autoconcepto en una muestra de 860 estudiantes chilenos. El análisis de regresión logística reveló que la autoefi cacia académica fue un predictor positivo y signifi cativo de las escalas académicas (Matemáticas, Verbal y Académica General), no académicas (Habilidades Físicas, Apariencia Física, Relaciones con el Sexo Opuesto, Relaciones con el Mi...

  2. entorno virtual de red académica

    Directory of Open Access Journals (Sweden)

    CLAUDIA JIMÉNEZ

    2007-01-01

    Full Text Available Este trabajo presenta un modelo conceptual para el armado de cursos flexibles, donde al estudiante se le permite realizar diferentes actividades para cumplir con los objetivos educativos de los mismos. El caso de estudio es la plataforma virtual de la red académica FORHUM (acrónimo de FORmación HUMana. Dicha plataforma fue concebida para facilitar el intercambio de conocimiento y la colaboración entre los miembros de una red de instituciones de Perú, Ecuador, Bolivia y Colombia que trabajan en temáticas del Hábitat. El modelo propuesto surgió de la evaluación del diseño de la central de ensamblaje de cursos en la plataforma virtual, en su primera versión, y del estudio de este proceso en otros entornos virtuales para la educación. El modelo de ensamblaje de cursos, aquí propuesto, permite la personalización de los mismos según diferentes estilos de aprendizaje, transferir el control del aprendizaje al estudiante y facilita la reutilización de objetos de aprendizaje creados por otros miembros de la red.

  3. Las nuevas comunidades académicas de historiadores

    Directory of Open Access Journals (Sweden)

    Sanmartín, Israel

    2008-06-01

    Full Text Available The article analyzes the new forms of sociability of the historians by the New Technologies of the Communication. From the history of science and “science wars” the article work for explaining the ideas of Community, Network and “private army” and the new topics of interrelation of the historians through the discussion networks, and his modalities. At he end, the work explain some desirable lines for the future of new academic communities of historians.El artículo analiza las nuevas formas de sociabilidad de los historiadores gracias a la utilización de las Nuevas Tecnologías de la Comunicación. Tomando como marco la historia de la ciencia y las “science wars” se estudia a partir de las ideas de Comunidad, Red y “private army” las nuevas formas de interrelación de los historiadores a través de las listas de discusión, de las cuales se muestran sus diferentes tipos y modalidades. Por último se establece un breve argumentario propositivo en que se establecen algunas matrices deseables para el futuro de las nuevas comunidades académicas de historiadores.

  4. Indirect Effect of Corticotropin-Releasing Hormone Receptor 1 Gene Variation on Negative Emotionality and Alcohol Use via Right Ventrolateral Prefrontal Cortex

    OpenAIRE

    Glaser, Yi G.; Zubieta, Jon-Kar; Hsu, David T.; Villafuerte, Sandra; Mickey, Brian J.; Trucco, Elisa M.; Burmeister, Margit; ZUCKER, ROBERT A.; Heitzeg, Mary M.

    2014-01-01

    Variations in the corticotropin-releasing hormone receptor 1 (CRHR1) gene have been found to interact with stress in modulating excessive alcohol consumption. However, the neural mechanisms through which CRHR1 influences this risk in humans is largely unknown. This study examined the influence of an intronic CRHR1 gene variant, rs110402, on brain responses to negative emotional words, negative emotional traits, and alcohol use in adolescents and young adults at high risk for alcoholism. Child...

  5. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-03-01

    Background: Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multi-gene family. Although the function of the members of the PE_PGRS multi-gene family is not yet known, it is hypothesized that the PE_PGRS genes may be associated with genetic variability. Material and methods: Whole genome sequencing analysis was performed on (n= 37) extensively drug resistant (XDR) MTB strains from Pakistan which included Central Asian (n= 23), East African Indian (n= 2), X3 (n= 1), T group (n= 3) and Orphan (n= 8) MTB strains. Results: By analyzing 42 PE_PGRS genes, 111 SNPs were identified, of which 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in the PE_PGRS genes were as follows: 6, 9, 10 and 55 present in each of the CAS, EAI, Orphan, T1 and X3 XDR MTB strains studied. Deletions in PE_PGRS genes: 19, 21 and 23 were observed in 7 (35.0%) CAS1 and 3 (37.5%) in Orphan XDR MTB strains, while deletions in the PE_PGRS genes: 49 and 50 were observed in 36 (95.0%) CAS1 and all CAS, CAS2 and Orphan XDR MTB strains. An insertion in PE_PGRS6 gene was observed in all CAS, EAI3 and Orphan, while insertions in the PE_PGRS genes 19 and 33 were observed in 19 (95%) CAS1 and all CAS, CAS2, EAI3 and Orphan XDR MTB strains. Conclusion: Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs, Insertions and Deletions in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  6. Low Variation in the Polymorphic Clock Gene Poly-Q Region Despite Population Genetic Structure across Barn Swallow (Hirundo rustica) Populations

    Science.gov (United States)

    Dor, Roi; Lovette, Irby J.; Safran, Rebecca J.; Billerman, Shawn M.; Huber, Gernot H.; Vortman, Yoni; Lotem, Arnon; McGowan, Andrew; Evans, Matthew R.; Cooper, Caren B.; Winkler, David W.

    2011-01-01

    Recent studies of several species have reported a latitudinal cline in the circadian clock gene, Clock, which influences rhythms in both physiology and behavior. Latitudinal variation in this gene may hence reflect local adaptation to seasonal variation. In some bird populations, there is also an among-individual association between Clock poly-Q genotype and clutch initiation date and incubation period. We examined Clock poly-Q allele variation in the Barn Swallow (Hirundo rustica), a species with a cosmopolitan geographic distribution and considerable variation in life-history traits that may be influenced by the circadian clock. We genotyped Barn Swallows from five populations (from three subspecies) and compared variation at the Clock locus to that at microsatellite loci and mitochondrial DNA (mtDNA). We found very low variation in the Clock poly-Q region, as >96% of individuals were homozygous, and the two other alleles at this locus were globally rare. Genetic differentiation based on the Clock poly-Q locus was not correlated with genetic differentiation based on either microsatellite loci or mtDNA sequences. Our results show that high diversity in Clock poly-Q is not general across avian species. The low Clock variation in the background of heterogeneity in microsatellite and mtDNA loci in Barn Swallows may be an outcome of stabilizing selection on the Clock locus. PMID:22216124

  7. Low variation in the polymorphic Clock gene poly-Q region despite population genetic structure across barn swallow (Hirundo rustica populations.

    Directory of Open Access Journals (Sweden)

    Roi Dor

    Full Text Available Recent studies of several species have reported a latitudinal cline in the circadian clock gene, Clock, which influences rhythms in both physiology and behavior. Latitudinal variation in this gene may hence reflect local adaptation to seasonal variation. In some bird populations, there is also an among-individual association between Clock poly-Q genotype and clutch initiation date and incubation period. We examined Clock poly-Q allele variation in the Barn Swallow (Hirundo rustica, a species with a cosmopolitan geographic distribution and considerable variation in life-history traits that may be influenced by the circadian clock. We genotyped Barn Swallows from five populations (from three subspecies and compared variation at the Clock locus to that at microsatellite loci and mitochondrial DNA (mtDNA. We found very low variation in the Clock poly-Q region, as >96% of individuals were homozygous, and the two other alleles at this locus were globally rare. Genetic differentiation based on the Clock poly-Q locus was not correlated with genetic differentiation based on either microsatellite loci or mtDNA sequences. Our results show that high diversity in Clock poly-Q is not general across avian species. The low Clock variation in the background of heterogeneity in microsatellite and mtDNA loci in Barn Swallows may be an outcome of stabilizing selection on the Clock locus.

  8. Factores que intervienen en el rendimiento académico universitario: Un estudio de caso

    Directory of Open Access Journals (Sweden)

    Raúl Tomás Mora García

    2015-01-01

    Full Text Available Conocer los factores intervinientes en el rendimiento académico de los estudiantes es de vital importancia para mejorar el proceso de ense- ñanza-aprendizaje y la calidad universitaria. Esta investigación busca identificar los posibles factores que intervienen en el rendimiento acadé- mico de los estudiantes universitarios del grado en Arquitectura Técnica de la Universidad de Alicante. El estudio pretende determinar el poder explicativo y predictivo de nueve variables para pronosticar el rendi- miento académico de los estudiantes mediante regresión lineal múltiple. Se ha identificado que seis de las variables estudiadas son estadística- mente significativas y que dos de ellas tienen una gran influencia sobre el rendimiento académico.

  9. Escala de Estresores Académicos para la evaluación de los estresores académicos en estudiantes universitarios

    OpenAIRE

    Cabanach, Ramón G.; Antonio Souto-Gestal; Victoria Franco

    2016-01-01

    Este estudio tiene por objeto la evaluación de los estresores en el entorno académico. Los instrumentos empleados con este objetivo no siempre están adecuadamente adaptados al contexto universitario o son lo suficientemente exhaustivos como para englobar el elevado número de fuentes generadoras de estrés académico. El presente estudio utiliza una muestra de 1.196 estudiantes universitarios de diferentes titulaciones para describir y analizar la fiabilidad y validez de la Escala de Estresores ...

  10. Variation in regulator of G-protein signaling 17 gene (RGS17 is associated with multiple substance dependence diagnoses

    Directory of Open Access Journals (Sweden)

    Zhang Huiping

    2012-05-01

    Full Text Available Abstract Background RGS17 and RGS20 encode two members of the regulator of G-protein signaling RGS-Rz subfamily. Variation in these genes may alter their transcription and thereby influence the function of G protein-coupled receptors, including opioid receptors, and modify risk for substance dependence. Methods The association of 13 RGS17 and eight RGS20 tag single nucleotide polymorphisms (SNPs was examined with four substance dependence diagnoses (alcohol (AD, cocaine (CD, opioid (OD or marijuana (MjD] in 1,905 African Americans (AAs: 1,562 cases and 343 controls and 1,332 European Americans (EAs: 981 cases and 351 controls. Analyses were performed using both χ2 tests and logistic regression analyses that covaried sex, age, and ancestry proportion. Correlation of genotypes and mRNA expression levels was assessed by linear regression analyses. Results Seven RGS17 SNPs showed a significant association with at least one of the four dependence traits after a permutation-based correction for multiple testing (0.003≤Pempirical≤0.037. The G allele of SNP rs596359, in the RGS17 promoter region, was associated with AD, CD, OD, or MjD in both populations (0.005≤Pempirical≤0.019. This allele was also associated with significantly lower mRNA expression levels of RGS17 in YRI subjects (P = 0.002 and non-significantly lower mRNA expression levels of RGS17 in CEU subjects (P = 0.185. No RGS20 SNPs were associated with any of the four dependence traits in either population. Conclusions This study demonstrated that variation in RGS17 was associated with risk for substance dependence diagnoses in both AA and EA populations.

  11. Child maltreatment, inflammation, and internalizing symptoms: Investigating the roles of C-reactive protein, gene variation, and neuroendocrine regulation.

    Science.gov (United States)

    Cicchetti, Dante; Handley, Elizabeth D; Rogosch, Fred A

    2015-05-01

    Prior research has found inconsistent evidence regarding the association among childhood adversity, inflammation, and internalizing symptoms, perhaps because previous studies have yet to adequately integrate important factors such as the timing of the adversity, genetic variation, and other relevant processes such as neuroendocrine regulation. The aims of the present study were threefold: (a) to determine whether the effect of the timing of child maltreatment on C-reactive protein (CRP), an inflammatory marker, varies by CRP gene variation; (b) to explore whether links between salivary CRP and childhood internalizing symptoms depend on the presence and timing of maltreatment experiences; and (c) to investigate the role of CRP in the relations between child neuroendocrine regulation and internalizing symptoms and examine whether these associations are moderated by the presence and timing of child maltreatment. Participants included a sample of 267 maltreated and 222 nonmaltreated children (M age = 9.72, SD = 0.99; 52.4% male; 66% African American) who attended a summer day camp research program designed for school-aged low-income children. Department of Human Services records were examined to determine the onset and recency of maltreatment for children in the maltreated group. The results indicated that among children with recent onset maltreatment, those with at least one A allele from CRP single nucleotide polymorphism rs1417938 evidenced significantly higher CRP levels compared to recently maltreated children carrying the TT genotype. Moreover, higher levels of CRP were associated with higher levels of internalizing symptoms only for recently maltreated children. Finally, we did not find support for salivary CRP as a mechanism in the relation between neuroendocrine regulation and childhood internalizing symptoms. Our findings highlight the importance of the timing of child maltreatment and have important implications for characterizing variability in inflammation

  12. An LTR Retrotransposon-Derived Gene Displays Lineage-Specific Structural and Putative Species-Specific Functional Variations in Eutherians.

    Science.gov (United States)

    Irie, Masahito; Koga, Akihiko; Kaneko-Ishino, Tomoko; Ishino, Fumitoshi

    2016-01-01

    Amongst the 11 eutherian-specific genes acquired from a sushi-ichi retrotransposon is the CCHC type zinc-finger protein-encoding gene SIRH11/ZCCHC16. Its contribution to eutherian brain evolution is implied because of its involvement in cognitive function in mice, possibly via the noradrenergic system. Although, the possibility that Sirh11/Zcchc16 functions as a non-coding RNA still remains, dN/dS ratios in pairwise comparisons between its orthologs have provided supportive evidence that it acts as a protein. It became a pseudogene in armadillos (Cingulata) and sloths (Pilosa), the only two extant orders of xenarthra, which prompted us to examine the lineage-specific variations of SIRH11/ZCCHC16 in eutherians. We examined the predicted SIRH11/ZCCHC16 open reading frame (ORF) in 95 eutherian species based on the genomic DNA information in GenBank. A large variation in the SIRH11/ZCCHC16 ORF was detected in several lineages. These include a lack of a CCHC RNA-binding domain in its C-terminus, observed in gibbons (Hylobatidae: Primates) and megabats (Megachiroptera: Chiroptera). A lack of the N-terminal half, on the other hand, was observed in New World monkeys (Platyrrhini: Primates) and species belonging to New World and African Hystricognaths (Caviomorpha and Bathyergidae: Rodents) along with Cetacea and Ruminantia (Cetartiodactyla). Among the hominoids, interestingly, three out of four genera of gibbons have lost normal SIRH11/ZCCHC16 function by deletion or the lack of the CCHC RNA-binding domain. Our extensive dN/dS analysis suggests that such truncated SIRH11/ZCCHC16 ORFs are functionally diversified even within lineages. Combined, our results show that SIRH11/ZCCHC16 may contribute to the diversification of eutherians by lineage-specific structural changes after its domestication in the common eutherian ancestor, followed by putative species-specific functional changes that enhanced fitness and occurred as a consequence of complex natural selection events

  13. Inteligencia emocional y creatividad : factores predictores del rendimiento académico.

    OpenAIRE

    Belmonte Lillo, Víctor Manuel

    2013-01-01

    El objetivo del trabajo, “Inteligencia emocional y creatividad: factores predictores del rendimiento académico”, es estudiar la validez predictiva de la inteligencia emocional desde sus diferentes modelos (habilidad, competencia socioemocional y autoeficacia emocional) y la creatividad respecto al rendimiento académico tanto en general como por ámbitos en alumnado de ESO. En las dos primeras partes se analizan los constructos en estudio. En la tercera, se aborda las implicaciones de la creati...

  14. Genetic variation in FADS genes and plasma cholesterol levels in 2-year-old infants: KOALA Birth Cohort Study.

    Directory of Open Access Journals (Sweden)

    Carolina Moltó-Puigmartí

    Full Text Available OBJECTIVE: Single nucleotide polymorphisms (SNPs in genes involved in fatty acid metabolism (FADS1 FADS2 gene cluster are associated with plasma lipid levels. We aimed to investigate whether these associations are already present early in life and compare the relative contribution of FADS SNPs vs traditional (non-genetic factors as determinants of plasma lipid levels. METHODS: Information on infants' plasma total cholesterol levels, genotypes of five FADS SNPs (rs174545, rs174546, rs174556, rs174561, and rs3834458, anthropometric data, maternal characteristics, and breastfeeding history was available for 521 2-year-old children from the KOALA Birth Cohort Study. For 295 of these 521 children, plasma HDLc and non-HDLc levels were also known. Multivariable linear regression analysis was used to study the associations of genetic and non-genetic determinants with cholesterol levels. RESULTS: All FADS SNPs were significantly associated with total cholesterol levels. Heterozygous and homozygous for the minor allele children had about 4% and 8% lower total cholesterol levels than major allele homozygotes. In addition, homozygous for the minor allele children had about 7% lower HDLc levels. This difference reached significance for the SNPs rs174546 and rs3834458. The associations went in the same direction for non-HDLc, but statistical significance was not reached. The percentage of total variance of total cholesterol levels explained by FADS SNPs was relatively low (lower than 3% but of the same order as that explained by gender and the non-genetic determinants together. CONCLUSIONS: FADS SNPs are associated with plasma total cholesterol and HDLc levels in preschool children. This brings a new piece of evidence to explain how blood lipid levels may track from childhood to adulthood. Moreover, the finding that these SNPs explain a similar amount of variance in total cholesterol levels as the non-genetic determinants studied reveals the potential

  15. Clock gene variation is associated with breeding phenology and maybe under directional selection in the migratory barn swallow.

    Directory of Open Access Journals (Sweden)

    Manuela Caprioli

    Full Text Available BACKGROUND: In diverse taxa, photoperiodic responses that cause seasonal physiological and behavioural shifts are controlled by genes, including the vertebrate Clock orthologues, that encode for circadian oscillator mechanisms. While the genetic network behind circadian rhythms is well described, relatively few reports exist of the phenological consequences of and selection on Clock genes in the wild. Here, we investigated variation in breeding phenology in relation to Clock genetic diversity in a long-distance migratory bird, the barn swallow (Hirundo rustica. METHODOLOGY/PRINCIPAL FINDINGS: In a sample of 922 adult barn swallows from a single population breeding in Italy we found one very common (Q(7 and three rare (Q(5, Q(6, Q(8 length variants of a functionally significant polyglutamine repeat. Rare (2.9% Q(7/Q(8 heterozygous females, but not males, bred significantly later than common (91.5% Q(7/Q(7 females, consistent with the expectation that 'long' alleles cause late breeding, as observed in a resident population of another bird species. Because breeding date depends on arrival date from migration, present results suggest that the association between breeding date and Clock might be mediated by migration phenology. In addition, fecundity selection appears to be operating against Q(7/Q(8 because late migrating/breeding swallows have fewer clutches per season, and late breeding has additional negative selection effects via reduced offspring longevity. Genotype frequencies varied marginally non-significantly with age, as Q(7/Q(8 frequency showed a 4-fold reduction in old individuals. This result suggests negative viability selection against Q(7/Q(8, possibly mediated by costs of late breeding. CONCLUSIONS/SIGNIFICANCE: This is the first study of migratory birds showing an association between breeding phenology and Clock genotype and suggesting that negative selection occurs on a phenologically deviant genotype. Low polymorphism at Clock may

  16. Copy number variation of lipocalin family genes for male-specific proteins in tilapia and its association with gender.

    Science.gov (United States)

    Shirak, A; Golik, M; Lee, B-Y; Howe, A E; Kocher, T D; Hulata, G; Ron, M; Seroussi, E

    2008-11-01

    Lipocalins are involved in the binding of small molecules like sex steroids. We show here that the previously reported tilapia male-specific protein (MSP) is a lipocalin encoded by a variety of paralogous and homologous genes in different tilapia species. Exon-intron boundaries of MSP genes were typical of the six-exon genomic structure of lipocalins, and the transcripts were capable of encoding 200 amino-acid polypeptides that consisted of a putative signal peptide and a lipocalin domain. Cysteine residues are conserved in positions analogous to those forming the three disulfide bonds characteristic of the ligand pocket. The calculated molecular mass of the secreted MSP (20.4 kDa) was less than half of that observed, suggesting that it is highly glycosylated like its homologue tributyltin-binding protein. Analysis of sequence variations revealed three types of paralogs MSPA, MSPB and MSPC. Expression of both MSPA and MSPB was detected in testis. In haploid Oreochromis niloticus embryos, each of these types consisted of two closely related paralogs, and asymmetry between MSP copy numbers on the maternal (six copies) and the paternal (three copies) chromosomes was observed. Using this polymorphism we mapped MSPA and MSPC to linkage group 12 of an F(2) mapping family derived from a cross between O. niloticus and Oreochromis aureus. Females with high MSP copy number were more frequent by more than twofold than males. Gender-MSPC combinations showed significant deviation from expected Mendelian segregation (P=0.009) suggesting elimination of males with MSPC copies. We discuss different hypotheses to explain this elimination, including possibility for allelic conflict resulted by the hybridization. PMID:18648387

  17. Growth Hormone (GH1) Gene Variation, the Growth Hormone Receptor (GHR) Exon 3 Deletion Polymorphism in a West-African Population

    OpenAIRE

    Millar, David S.; Lewis, Mark D.; Horan, Martin; Newsway, Vicky; Rees, D Aled; Easter, Tammy E.; Pepe, Guglielmina; Rickards, Olga; Norin, Martin; Scanlon, Maurice F.; Krawczak, Michael; Cooper, David N.

    2008-01-01

    Growth Hormone (GH1) Gene Variation, the Growth Hormone Receptor (GHR) Exon 3 Deletion Polymorphism in a West-African Population UNITED KINGDOM (Millar, David S.) UNITED KINGDOM Received: 2008-05-29 Revised: 2008-08-21 Accepted: 2008-09-22

  18. Variations of SOST mRNA expression in human bone are associated with DNA polymorphism and DNA methylation in the SOST gene

    DEFF Research Database (Denmark)

    Lhaneche, Leila; Domingues, Aline; Hannouche, Didier;

    2016-01-01

    SOST encodes sclerostin, an inhibitor of bone formation that antagonizes canonical Wnt signaling. Variations of SOST expression have an impact on bone mineral density (BMD) and bone strength. We hypothesized that genetic and epigenetic DNA modifications have an impact on SOST gene expression. By ...

  19. C-B3-01: Variation in Seven Obesity-Related Genes and Risk of Postmenopausal Breast Cancer

    Science.gov (United States)

    Feigelson, Heather S; Teras, Lauren R; Diver, W Ryan; Tang, Weining; Patel, Alpa V; Calle, Eugenia E; Bouzyk, Mark

    2010-01-01

    Background/Aims: Obesity has been consistently associated with postmenopausal breast cancer risk. Proteins secreted by adipose tissue or involved in regulating obesity may play a role in breast tumor development. We conducted a nested case- control study among white, postmenopausal women from the American Cancer Society Cancer Prevention Study II (CPS -II) Nutrition Cohort to determine whether genes associated with obesity increase risk of breast cancer. Methods: Tagging single nucleotide polymorphisms (tagSNPs) were selected to capture common variation across seven candidate genes that encode adipose- related proteins: ADRB2, ADRB3, GHRL, HSD11B1, IRS1, IRS2, SHC1. Thirty-nine SNPs were genotyped in 648 cases and 659 controls. Logistic regression models and haplotype analysis were used to examine the association between each tagSNP and risk of breast cancer while adjusting for matching factors and potential confounders. We also examined whether these SNPs were associated with measures of adult adiposity. Results: Two of five tagSNPs in HSD11B1 were associated with breast cancer (rs11807619, P=0.006; rs932335, P=0.0002). The rs932335 C allele was associated with a nearly two-fold increased risk of breast cancer (OR=1.83; 95% CI: 1.01–3.33 for C/C versus G/G). The rs11807619 and rs932335 were highly correlated (r2=0.74), and when modeled as a haplotype, only haplotypes containing the rs932335 C allele were associated with breast cancer. Three of the eleven SNPs for IRS2 were associated with breast cancer (rs4773082, P=0.007; rs2289046, P=0.016; rs754204, P=0.03). When these 3 SNPs were examined as a haplotype, only the haplotype that included the G allele of rs2289046 was associated with breast cancer (OR=0.74, 95% CI: 0.62–0.90 for TGC compared to CAT). IRS2 rs2289046 and rs754204 were also associated with adult weight gain. None of the other SNPs in any gene investigated were associated with breast cancer or adiposity. Conclusions: Our results suggest that

  20. Large-Scale Evaluation of Common Variation in Regulatory T Cell–Related Genes and Ovarian Cancer Outcome

    DEFF Research Database (Denmark)

    Charbonneau, Bridget; Moysich, Kirsten B; Kalli, Kimberly R;

    2014-01-01

    The presence of regulatory T cells (Treg) in solid tumors is known to play a role in patient survival in ovarian cancer and other malignancies. We assessed inherited genetic variations via 749 tag single-nucleotide polymorphisms (SNP) in 25 Treg-associated genes (CD28, CTLA4, FOXP3, IDO1, IL10, IL......10RA, IL15, 1L17RA, IL23A, IL23R, IL2RA, IL6, IL6R, IL8, LGALS1, LGALS9, MAP3K8, STAT5A, STAT5B, TGFB1, TGFB2, TGFB3, TGFBR1, TGRBR2, and TGFBR3) in relation to ovarian cancer survival. We analyzed genotype and overall survival in 10,084 women with invasive epithelial ovarian cancer, including 5...... interval (CI), 1.22-1.64; P = 5.7 × 10(-6)], rs791587 (HR, 1.36; 95% CI, 1.17-1.57; P = 6.2 × 10(-5)), rs2476491 (HR, = 1.40; 95% CI, 1.19-1.64; P = 5.6 × 10(-5)), and rs10795763 (HR, 1.35; 95% CI, 1.17-1.57; P = 7.9 × 10(-5)), and for clear cell carcinoma and CTLA4 SNP rs231775 (HR, 0.67; 95% CI, 0...

  1. Nucleotide sequence variation of the VP7 gene of two G3-type rotaviruses isolated from dogs.

    Science.gov (United States)

    Martella, V; Pratelli, A; Greco, G; Gentile, M; Fiorente, P; Tempesta, M; Buonavoglia, C

    2001-04-01

    The sequence of the VP7 gene of two rotaviruses isolated from dogs in southern Italy was determined and the inferred amino acid sequence was compared with that of other rotavirus strains. There was very high nucleotide and amino acid identity between canine strain RV198/95 and other canine strains, and to the human strain HCR3A. Strain RV52/96, however, was found to have about 95% identity to the G3 serotype canine strains K9, A79-10 and CU-1 and 96% identity to strain RV198/95 and to the simian strain RRV. Therefore both of the canine strains belong to the G3 serotype. Nevertheless, detailed analysis of the VP7 variable regions revealed that RV52/96 possesses amino acid substitutions uncommon to the other canine isolates. In addition, strain RV52/96 exhibited a nucleotide divergence greater than 16% from all the other canine strains studied; however, it revealed the closest identity (90.4%) to the simian strain RRV. With only a few exceptions, phylogenetic analysis allowed clear differentiation of the G3 rotaviruses on the basis of the species of origin. The nucleotide and amino acid variations observed in strain RV52/96 could account for the existence of a canine rotavirus G3 sub-type. PMID:11226570

  2. Variation of 184C→T of goat callipyge gene in different populations and its effect on body weight

    Institute of Scientific and Technical Information of China (English)

    Xianglong LI; Hailiang WANG; Rongyan ZHOU; Guiru ZHENG; Lanhui LI; Zunan SHEN

    2009-01-01

    In order to investigate its distribution in different goat populations, one SNP (184C→T, corresponding to AY850925) of goat callipyge (CLPG) gene recognized by Fork I was identified after sequencing 23 individuals from 10 breeds. PCR-RFLP was carried out according to the variation site in 584 goats of 14 populations from 11 provinces and autonomous regions in China. An interesting result was found that the Boer goat having the characteristics of double muscle had significantly higher T allele (0.2465) frequency and lower C allele (0.7535) frequency compared to other breeds. It could be inferred that the 184C→T mutation might be related to the double muscle characteristics of the Boer goat. The general linear model analysis showed that parental genotype had significant effect on the body weight of their offspring at different ages. It could be inferred that transition of 184C→T might be a paternal imprinting form, a polar over-dominance, in which only individuals that received the allele from their mother expressed the callipyge phenotype. The double muscle characteristics of the Boer goat might be related to its maternal genotype. More data with detailed information need to be investigated in order to confirm this assumption.

  3. Genetic diversity and its seasonal variation of Jiaozhou Bay phytoplankton determined by rbcL gene sequencing

    Institute of Scientific and Technical Information of China (English)

    LIU Yongjian; YANG Guanpin; GUAN Xiaojing; MEN Rongxin

    2006-01-01

    Ribulose-1, 5-bisphosphate carboxynase/oxygenase large subunit gene (rbcL) of Jiaozhou Bay phytoplankton was amplified from spring, summer and autumn surface seawater DNAs and cloned respectively. About 50 clones were randomly selected from each library and sequenced. If identical amino acid sequences are considered as the same operational taxonomy unit (OTU), 61 OTUs are identified according to inferred amino acid sequences, among them, 21 from spring seawater, 15 from summer seawater and 25 from autumn seawater. Shannon index calculated from OTU abundances reflects the genetic diversity of a community. The indexes of spring, summer and autumn surface seawater phytoplankton are 2.69, 2.44 and 2.76 respectively, indicating that phytoplankton genetic diversity of autumn seawater is the richest. Seasonal variation of phytoplankton community is significant; the community compositions of three seasons are almost completely different except for the two OTUs shared by summer and autumn. Surface seawater phytoplankton communities are possibly metacommunities different spatially and temporally.

  4. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-01-21

    Background Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multigene family. Although the function of PE_PGRS genes is unknown, it is hypothesized that the PE_PGRS genes may be associated with antigenic variability in MTB. Material and methods Whole genome sequencing analysis was performed on (n = 37) extensively drug-resistant (XDR) MTB strains from Pakistan, which included Lineage 1 (East African Indian, n = 2); Other lineage 1 (n = 3); Lineage 3 (Central Asian, n = 24); Other lineage 3 (n = 4); Lineage 4 (X3, n = 1) and T group (n = 3) MTB strains. Results There were 107 SNPs identified from the analysis of 42 PE_PGRS genes; of these, 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in PE_PGRS genes – 6, 9 and 10 – were common in all EAI, CAS, Other lineages (1 and 3), T1 and X3. Deletions (DELs) in PE_PGRS genes – 3 and 19 – were observed in 17 (80.9%) CAS1 and 6 (85.7%) in Other lineages (1 and 3) XDR MTB strains, while DELs in the PE_PGRS49 were observed in all CAS1, CAS, CAS2 and Other lineages (1 and 3) XDR MTB strains. All CAS, EAI and Other lineages (1 and 3) strains showed insertions (INS) in PE_PGRS6 gene, while INS in the PE_PGRS genes 19 and 33 were observed in 20 (95.2%) CAS1, all CAS, CAS2, EAI and Other lineages (1 and 3) XDR MTB strains. Conclusion Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs and INDELs in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  5. Genome-wide analysis of ZmDREB genes and their association with natural variation in drought tolerance at seedling stage of Zea mays L.

    Directory of Open Access Journals (Sweden)

    Shengxue Liu

    Full Text Available The worldwide production of maize (Zea mays L. is frequently impacted by water scarcity and as a result, increased drought tolerance is a priority target in maize breeding programs. While DREB transcription factors have been demonstrated to play a central role in desiccation tolerance, whether or not natural sequence variations in these genes are associated with the phenotypic variability of this trait is largely unknown. In the present study, eighteen ZmDREB genes present in the maize B73 genome were cloned and systematically analyzed to determine their phylogenetic relationship, synteny with rice, maize and sorghum genomes; pattern of drought-responsive gene expression, and protein transactivation activity. Importantly, the association between the nucleic acid variation of each ZmDREB gene with drought tolerance was evaluated using a diverse population of maize consisting of 368 varieties from tropical and temperate regions. A significant association between the genetic variation of ZmDREB2.7 and drought tolerance at seedling stage was identified. Further analysis found that the DNA polymorphisms in the promoter region of ZmDREB2.7, but not the protein coding region itself, was associated with different levels of drought tolerance among maize varieties, likely due to distinct patterns of gene expression in response to drought stress. In vitro, protein-DNA binding assay demonstrated that ZmDREB2.7 protein could specifically interact with the target DNA sequences. The transgenic Arabidopsis overexpressing ZmDREB2.7 displayed enhanced tolerance to drought stress. Moreover, a favorable allele of ZmDREB2.7, identified in the drought-tolerant maize varieties, was effective in imparting plant tolerance to drought stress. Based upon these findings, we conclude that natural variation in the promoter of ZmDREB2.7 contributes to maize drought tolerance, and that the gene and its favorable allele may be an important genetic resource for the genetic

  6. The minor C-allele of rs2014355 in ACADS is associated with reduced insulin release following an oral glucose load

    Directory of Open Access Journals (Sweden)

    Pisinger Charlotta

    2011-01-01

    Full Text Available Abstract Background A genome-wide association study (GWAS using metabolite concentrations as proxies for enzymatic activity, suggested that two variants: rs2014355 in the gene encoding short-chain acyl-coenzyme A dehydrogenase (ACADS and rs11161510 in the gene encoding medium-chain acyl-coenzyme A dehydrogenase (ACADM impair fatty acid β-oxidation. Chronic exposure to fatty acids due to an impaired β-oxidation may down-regulate the glucose-stimulated insulin release and result in an increased risk of type 2 diabetes (T2D. We aimed to investigate whether the two variants associate with altered insulin release following an oral glucose load or with T2D. Methods The variants were genotyped using KASPar® PCR SNP genotyping system and investigated for associations with estimates of insulin release and insulin sensitivity following an oral glucose tolerance test (OGTT in a random sample of middle-aged Danish individuals (nACADS = 4,324; nACADM = 4,337. The T2D-case-control study involved a total of ~8,300 Danish individuals (nACADS = 8,313; nACADM = 8,344. Results In glucose-tolerant individuals the minor C-allele of rs2014355 of ACADS associated with reduced measures of serum insulin at 30 min following an oral glucose load (per allele effect (β = -3.8% (-6.3%;-1.3%, P = 0.003, reduced incremental area under the insulin curve (β = -3.6% (-6.3%;-0.9%, P = 0.009, reduced acute insulin response (β = -2.2% (-4.2%;0.2%, P = 0.03, and with increased insulin sensitivity ISIMatsuda (β = 2.9% (0.5%;5.2%, P = 0.02. The C-allele did not associate with two other measures of insulin sensitivity or with a derived disposition index. The C-allele was not associated with T2D in the case-control analysis (OR 1.07, 95% CI 0.96-1.18, P = 0.21. rs11161510 of ACADM did not associate with any indices of glucose-stimulated insulin release or with T2D. Conclusions In glucose-tolerant individuals the minor C-allele of rs2014355 of ACADS was associated with reduced

  7. Identification and Characterization of Novel Variations in Platelet G-Protein Coupled Receptor (GPCR Genes in Patients Historically Diagnosed with Type 1 von Willebrand Disease.

    Directory of Open Access Journals (Sweden)

    Jacqueline Stockley

    Full Text Available The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12 could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =, both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =. Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.

  8. Associations of ADH and ALDH2 gene variation with self report alcohol reactions, consumption and dependence: an integrated analysis

    Science.gov (United States)

    Macgregor, Stuart; Lind, Penelope A.; Bucholz, Kathleen K.; Hansell, Narelle K.; Madden, Pamela A.F.; Richter, Melinda M.; Montgomery, Grant W.; Martin, Nicholas G.; Heath, Andrew C.; Whitfield, John B.

    2009-01-01

    Alcohol dependence (AD) is a complex disorder with environmental and genetic origins. The role of two genetic variants in ALDH2 and ADH1B in AD risk has been extensively investigated. This study tested for associations between nine polymorphisms in ALDH2 and 41 in the seven ADH genes, and alcohol-related flushing, alcohol use and dependence symptom scores in 4597 Australian twins. The vast majority (4296) had consumed alcohol in the previous year, with 547 meeting DSM-IIIR criteria for AD. There were study-wide significant associations (P < 2.3 × 10−4) between ADH1B-Arg48His (rs1229984) and flushing and consumption, but only nominally significant associations (P < 0.01) with dependence. Individuals carrying the rs1229984 G-allele (48Arg) reported a lower prevalence of flushing after alcohol (P = 8.2 × 10−7), consumed alcohol on more occasions (P = 2.7 × 10−6), had a higher maximum number of alcoholic drinks in a single day (P = 2.7 × 10−6) and a higher overall alcohol consumption (P = 8.9 × 10−8) in the previous year than those with the less common A-allele (48His). After controlling for rs1229984, an independent association was observed between rs1042026 (ADH1B) and alcohol intake (P = 4.7 × 10−5) and suggestive associations (P < 0.001) between alcohol consumption phenotypes and rs1693482 (ADH1C), rs1230165 (ADH5) and rs3762894 (ADH4). ALDH2 variation was not associated with flushing or alcohol consumption, but was weakly associated with AD measures. These results bridge the gap between DNA sequence variation and alcohol-related behavior, confirming that the ADH1B-Arg48His polymorphism affects both alcohol-related flushing in Europeans and alcohol intake. The absence of study-wide significant effects on AD results from the low P-value required when testing multiple single nucleotide polymorphisms and phenotypes. PMID:18996923

  9. Large-scale evaluation of common variation in regulatory T cell-related genes and ovarian cancer outcome.

    Science.gov (United States)

    Charbonneau, Bridget; Moysich, Kirsten B; Kalli, Kimberly R; Oberg, Ann L; Vierkant, Robert A; Fogarty, Zachary C; Block, Matthew S; Maurer, Matthew J; Goergen, Krista M; Fridley, Brooke L; Cunningham, Julie M; Rider, David N; Preston, Claudia; Hartmann, Lynn C; Lawrenson, Kate; Wang, Chen; Tyrer, Jonathan; Song, Honglin; deFazio, Anna; Johnatty, Sharon E; Doherty, Jennifer A; Phelan, Catherine M; Sellers, Thomas A; Ramirez, Starr M; Vitonis, Allison F; Terry, Kathryn L; Van Den Berg, David; Pike, Malcolm C; Wu, Anna H; Berchuck, Andrew; Gentry-Maharaj, Aleksandra; Ramus, Susan J; Diergaarde, Brenda; Shen, Howard; Jensen, Allan; Menkiszak, Janusz; Cybulski, Cezary; Lubiłski, Jan; Ziogas, Argyrios; Rothstein, Joseph H; McGuire, Valerie; Sieh, Weiva; Lester, Jenny; Walsh, Christine; Vergote, Ignace; Lambrechts, Sandrina; Despierre, Evelyn; Garcia-Closas, Montserrat; Yang, Hannah; Brinton, Louise A; Spiewankiewicz, Beata; Rzepecka, Iwona K; Dansonka-Mieszkowska, Agnieszka; Seibold, Petra; Rudolph, Anja; Paddock, Lisa E; Orlow, Irene; Lundvall, Lene; Olson, Sara H; Hogdall, Claus K; Schwaab, Ira; du Bois, Andreas; Harter, Philipp; Flanagan, James M; Brown, Robert; Paul, James; Ekici, Arif B; Beckmann, Matthias W; Hein, Alexander; Eccles, Diana; Lurie, Galina; Hays, Laura E; Bean, Yukie T; Pejovic, Tanja; Goodman, Marc T; Campbell, Ian; Fasching, Peter A; Konecny, Gottfried; Kaye, Stanley B; Heitz, Florian; Hogdall, Estrid; Bandera, Elisa V; Chang-Claude, Jenny; Kupryjanczyk, Jolanta; Wentzensen, Nicolas; Lambrechts, Diether; Karlan, Beth Y; Whittemore, Alice S; Culver, Hoda Anton; Gronwald, Jacek; Levine, Douglas A; Kjaer, Susanne K; Menon, Usha; Schildkraut, Joellen M; Pearce, Celeste Leigh; Cramer, Daniel W; Rossing, Mary Anne; Chenevix-Trench, Georgia; Pharoah, Paul D P; Gayther, Simon A; Ness, Roberta B; Odunsi, Kunle; Sucheston, Lara E; Knutson, Keith L; Goode, Ellen L

    2014-04-01

    The presence of regulatory T cells (Treg) in solid tumors is known to play a role in patient survival in ovarian cancer and other malignancies. We assessed inherited genetic variations via 749 tag single-nucleotide polymorphisms (SNP) in 25 Treg-associated genes (CD28, CTLA4, FOXP3, IDO1, IL10, IL10RA, IL15, 1L17RA, IL23A, IL23R, IL2RA, IL6, IL6R, IL8, LGALS1, LGALS9, MAP3K8, STAT5A, STAT5B, TGFB1, TGFB2, TGFB3, TGFBR1, TGRBR2, and TGFBR3) in relation to ovarian cancer survival. We analyzed genotype and overall survival in 10,084 women with invasive epithelial ovarian cancer, including 5,248 high-grade serous, 1,452 endometrioid, 795 clear cell, and 661 mucinous carcinoma cases of European descent across 28 studies from the Ovarian Cancer Association Consortium (OCAC). The strongest associations were found for endometrioid carcinoma and IL2RA SNPs rs11256497 [HR, 1.42; 95% confidence interval (CI), 1.22-1.64; P = 5.7 × 10(-6)], rs791587 (HR, 1.36; 95% CI, 1.17-1.57; P = 6.2 × 10(-5)), rs2476491 (HR, = 1.40; 95% CI, 1.19-1.64; P = 5.6 × 10(-5)), and rs10795763 (HR, 1.35; 95% CI, 1.17-1.57; P = 7.9 × 10(-5)), and for clear cell carcinoma and CTLA4 SNP rs231775 (HR, 0.67; 95% CI, 0.54-0.82; P = 9.3 × 10(-5)) after adjustment for age, study site, population stratification, stage, grade, and oral contraceptive use. The rs231775 allele associated with improved survival in our study also results in an amino acid change in CTLA4 and previously has been reported to be associated with autoimmune conditions. Thus, we found evidence that SNPs in genes related to Tregs seem to play a role in ovarian cancer survival, particularly in patients with clear cell and endometrioid epithelial ovarian cancer. PMID:24764580

  10. A combination of PhP typing and β-d-glucuronidase gene sequence variation analysis for differentiation of Escherichia coli from humans and animals.

    Science.gov (United States)

    Masters, N; Christie, M; Katouli, M; Stratton, H

    2015-06-01

    We investigated the usefulness of the β-d-glucuronidase gene variance in Escherichia coli as a microbial source tracking tool using a novel algorithm for comparison of sequences from a prescreened set of host-specific isolates using a high-resolution PhP typing method. A total of 65 common biochemical phenotypes belonging to 318 E. coli strains isolated from humans and domestic and wild animals were analysed for nucleotide variations at 10 loci along a 518 bp fragment of the 1812 bp β-d-glucuronidase gene. Neighbour-joining analysis of loci variations revealed 86 (76.8%) human isolates and 91.2% of animal isolates were correctly identified. Pairwise hierarchical clustering improved assignment; where 92 (82.1%) human and 204 (99%) animal strains were assigned to their respective cluster. Our data show that initial typing of isolates and selection of common types from different hosts prior to analysis of the β-d-glucuronidase gene sequence improves source identification. We also concluded that numerical profiling of the nucleotide variations can be used as a valuable approach to differentiate human from animal E. coli. This study signifies the usefulness of the β-d-glucuronidase gene as a marker for differentiating human faecal pollution from animal sources.

  11. Patterns of nucleotide sequence variation in ICAM1 and TNF genes in twelve ethnic groups of India: roles of demographic history and natural selection

    Indian Academy of Sciences (India)

    Sanghamitra Sengupta; Shabana Farheen; Neelanjana Mukherjee; Partha P. Majumder

    2007-12-01

    We have studied DNA sequence variation in and around the genes ICAM1 and TNF, which play functional and correlated roles in inflammatory processes and immune cell responses, in 12 diverse ethnic groups of India, with a view to investigating the relative roles of demographic history and natural selection in shaping the observed patterns of variation. The total numbers of single nucleotide polymorphisms (SNPs) detected at the ICAM1 and TNF loci were 29 and 12, respectively. Haplotype and allele frequencies differed significantly across populations. The site frequency spectra at these loci were significantly different from those expected under neutrality, and showed an excess of intermediate-frequency variants consistent with balancing selection. However, as expected under balancing selection, there was no significant reduction of $F_{ST}$ values compared to neutral autosomal loci. Mismatch distributions were consistent with population expansion for both loci. On the other hand, the phylogenetic network among haplotypes for the TNF locus was similar to expectations under population expansion, while that for the ICAM1 was as expected under balancing selection. Nucleotide diversity at the ICAM1 locus was an order of magnitude lower in the promoter region, compared to the introns or exons, but no such difference was noted for the TNF gene. Thus, we conclude that the pattern of nucleotide variation in these genes has been modulated by both demographic history and selection. This is not surprising in view of the known allelic associations of several polymorphisms in these genes with various diseases, both infectious and noninfectious.

  12. Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

    Science.gov (United States)

    Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2013-01-16

    The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples.

  13. Variation in Dehydration Tolerance, ABA Sensitivity and Related Gene Expression Patterns in D-Genome Progenitor and Synthetic Hexaploid Wheat Lines

    Directory of Open Access Journals (Sweden)

    Yumeto Kurahashi

    2009-06-01

    Full Text Available The wild wheat Aegilops tauschii Coss. has extensive natural variation available for breeding of common wheat. Drought stress tolerance is closely related to abscisic acid (ABA sensitivity. In this study, 17 synthetic hexaploid wheat lines, produced by crossing the tetraploid wheat cultivar Langdon with 17 accessions of Ae. tauschii, were used for comparative analysis of natural variation in drought tolerance and ABA sensitivity. Ae. tauschii showed wide natural variation, with weak association between the traits. Drought-sensitive accessions of Ae. tauschii exhibited significantly less ABA sensitivity. D-genome variations observed at the diploid genome level were not necessarily reflected in synthetic wheats. However, synthetic wheats derived from the parental Ae. tauschii accessions with high drought tolerance were significantly more tolerant to drought stress than those from drought-sensitive accessions. Moreover, synthetic wheats with high drought tolerance showed significantly higher ABA sensitivity than drought-sensitive synthetic lines. In the hexaploid genetic background, therefore, weak association of ABA sensitivity with drought tolerance wasobserved. To study differences in gene expression patterns between stress-tolerant and -sensitive lines, levels of two Cor/Lea and three transcription factor gene transcripts were compared. The more tolerant accession of Ae. tauschii tended to accumulate more abundant transcripts of the examined genes than the sensitive accession under stress conditions. The expression patterns in the synthetic wheats seemed to be additive for parental lines exposed to drought and ABA treatments. However, the transcript levels of transcription factor genes in the synthetic wheats did not necessarily correspond to the postulated levels based on expression in parental lines. Allopolyploidization altered the expression levels of the stress-responsive genes in synthetic wheats.

  14. S-SCAM, a rare copy number variation gene, induces schizophrenia-related endophenotypes in transgenic mouse model.

    Science.gov (United States)

    Zhang, Nanyan; Zhong, Peng; Shin, Seung Min; Metallo, Jacob; Danielson, Eric; Olsen, Christopher M; Liu, Qing-song; Lee, Sang H

    2015-02-01

    Accumulating genetic evidence suggests that schizophrenia (SZ) is associated with individually rare copy number variations (CNVs) of diverse genes, often specific to single cases. However, the causality of these rare mutations remains unknown. One of the rare CNVs found in SZ cohorts is the duplication of Synaptic Scaffolding Molecule (S-SCAM, also called MAGI-2), which encodes a postsynaptic scaffolding protein controlling synaptic AMPA receptor levels, and thus the strength of excitatory synaptic transmission. Here we report that, in a transgenic mouse model simulating the duplication conditions, elevation of S-SCAM levels in excitatory neurons of the forebrain was sufficient to induce multiple SZ-related endophenotypes. S-SCAM transgenic mice showed an increased number of lateral ventricles and a reduced number of parvalbumin-stained neurons. In addition, the mice exhibited SZ-like behavioral abnormalities, including hyperlocomotor activity, deficits in prepulse inhibition, increased anxiety, impaired social interaction, and working memory deficit. Notably, the S-SCAM transgenic mice showed a unique sex difference in showing these behavioral symptoms, which is reminiscent of human conditions. These behavioral abnormalities were accompanied by hyperglutamatergic function associated with increased synaptic AMPA receptor levels and impaired long-term potentiation. Importantly, reducing glutamate release by the group 2 metabotropic glutamate receptor agonist LY379268 ameliorated the working memory deficits in the transgenic mice, suggesting that hyperglutamatergic function underlies the cognitive functional deficits. Together, these results contribute to validate a causal relationship of the rare S-SCAM CNV and provide supporting evidence for the rare CNV hypothesis in SZ pathogenesis. Furthermore, the S-SCAM transgenic mice provide a valuable new animal model for studying SZ pathogenesis. PMID:25653350

  15. S-SCAM, a rare copy number variation gene, induces schizophrenia-related endophenotypes in transgenic mouse model.

    Science.gov (United States)

    Zhang, Nanyan; Zhong, Peng; Shin, Seung Min; Metallo, Jacob; Danielson, Eric; Olsen, Christopher M; Liu, Qing-song; Lee, Sang H

    2015-02-01

    Accumulating genetic evidence suggests that schizophrenia (SZ) is associated with individually rare copy number variations (CNVs) of diverse genes, often specific to single cases. However, the causality of these rare mutations remains unknown. One of the rare CNVs found in SZ cohorts is the duplication of Synaptic Scaffolding Molecule (S-SCAM, also called MAGI-2), which encodes a postsynaptic scaffolding protein controlling synaptic AMPA receptor levels, and thus the strength of excitatory synaptic transmission. Here we report that, in a transgenic mouse model simulating the duplication conditions, elevation of S-SCAM levels in excitatory neurons of the forebrain was sufficient to induce multiple SZ-related endophenotypes. S-SCAM transgenic mice showed an increased number of lateral ventricles and a reduced number of parvalbumin-stained neurons. In addition, the mice exhibited SZ-like behavioral abnormalities, including hyperlocomotor activity, deficits in prepulse inhibition, increased anxiety, impaired social interaction, and working memory deficit. Notably, the S-SCAM transgenic mice showed a unique sex difference in showing these behavioral symptoms, which is reminiscent of human conditions. These behavioral abnormalities were accompanied by hyperglutamatergic function associated with increased synaptic AMPA receptor levels and impaired long-term potentiation. Importantly, reducing glutamate release by the group 2 metabotropic glutamate receptor agonist LY379268 ameliorated the working memory deficits in the transgenic mice, suggesting that hyperglutamatergic function underlies the cognitive functional deficits. Together, these results contribute to validate a causal relationship of the rare S-SCAM CNV and provide supporting evidence for the rare CNV hypothesis in SZ pathogenesis. Furthermore, the S-SCAM transgenic mice provide a valuable new animal model for studying SZ pathogenesis.

  16. Genetic variation in the CYP1A1 gene is related to circulating PCB118 levels in a population-based sample

    International Nuclear Information System (INIS)

    Several of the polychlorinated biphenyls (PCBs), i.e. the dioxin-like PCBs, are known to induce the P450 enzymes CYP1A1, CYP1A2 and CYP1B1 by activating the aryl hydrocarbon receptor (Ah)-receptor. We evaluated if circulating levels of PCBs in a population sample were related to genetic variation in the genes encoding these CYPs. In the population-based Prospective Investigation of the Vasculature in Uppsala Seniors (PIVUS) study (1016 subjects all aged 70), 21 SNPs in the CYP1A1, CYP1A2 and CYP1B1 genes were genotyped. Sixteen PCB congeners were analysed by high-resolution chromatography coupled to high-resolution mass spectrometry (HRGC/ HRMS). Of the investigated relationships between SNPs in the CYP1A1, CYP1A2 and CYP1B1 and six PCBs (congeners 118, 126, 156, 169, 170 and 206) that captures >80% of the variation of all PCBs measured, only the relationship between CYP1A1 rs2470893 was significantly related to PCB118 levels following strict adjustment for multiple testing (p=0.00011). However, there were several additional SNPs in the CYP1A2 and CYP1B1 that showed nominally significant associations with PCB118 levels (p-values in the 0.003–0.05 range). Further, several SNPs in the CYP1B1 gene were related to both PCB156 and PCB206 with p-values in the 0.005–0.05 range. Very few associations with p<0.05 were seen for PCB126, PCB169 or PCB170. Genetic variation in the CYP1A1 was related to circulating PCB118 levels in the general elderly population. Genetic variation in CYP1A2 and CYP1B1 might also be associated with other PCBs. - Highlights: • We studied the relationship between PCBs and the genetic variation in the CYP genes. • Cross sectional data from a cohort of elderly were analysed. • The PCB levels were evaluated versus 21 SNPs in three CYP genes. • PCB 118 was related to variation in the CYP1A1 gene

  17. Genetic variation in the CYP1A1 gene is related to circulating PCB118 levels in a population-based sample

    Energy Technology Data Exchange (ETDEWEB)

    Lind, Lars [Department of Medical Sciences, Cardiovascular Epidemiology, Uppsala University, Uppsala (Sweden); Penell, Johanna [Department of Medical Sciences, Occupational and Environmental Medicine, Uppsala University, Uppsala (Sweden); Syvänen, Anne-Christine; Axelsson, Tomas [Department of Medical Sciences, Molecular Medicine and Science for Life Laboratory, Uppsala University, Uppsala (Sweden); Ingelsson, Erik [Department of Medical Sciences, Molecular Epidemiology and Science for Life Laboratory, Uppsala University, Uppsala (Sweden); Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford (United Kingdom); Morris, Andrew P.; Lindgren, Cecilia [Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford (United Kingdom); Salihovic, Samira; Bavel, Bert van [MTM Research Centre, School of Science and Technology, Örebro University, Örebro (Sweden); Lind, P. Monica, E-mail: monica.lind@medsci.uu.se [Department of Medical Sciences, Occupational and Environmental Medicine, Uppsala University, Uppsala (Sweden)

    2014-08-15

    Several of the polychlorinated biphenyls (PCBs), i.e. the dioxin-like PCBs, are known to induce the P450 enzymes CYP1A1, CYP1A2 and CYP1B1 by activating the aryl hydrocarbon receptor (Ah)-receptor. We evaluated if circulating levels of PCBs in a population sample were related to genetic variation in the genes encoding these CYPs. In the population-based Prospective Investigation of the Vasculature in Uppsala Seniors (PIVUS) study (1016 subjects all aged 70), 21 SNPs in the CYP1A1, CYP1A2 and CYP1B1 genes were genotyped. Sixteen PCB congeners were analysed by high-resolution chromatography coupled to high-resolution mass spectrometry (HRGC/ HRMS). Of the investigated relationships between SNPs in the CYP1A1, CYP1A2 and CYP1B1 and six PCBs (congeners 118, 126, 156, 169, 170 and 206) that captures >80% of the variation of all PCBs measured, only the relationship between CYP1A1 rs2470893 was significantly related to PCB118 levels following strict adjustment for multiple testing (p=0.00011). However, there were several additional SNPs in the CYP1A2 and CYP1B1 that showed nominally significant associations with PCB118 levels (p-values in the 0.003–0.05 range). Further, several SNPs in the CYP1B1 gene were related to both PCB156 and PCB206 with p-values in the 0.005–0.05 range. Very few associations with p<0.05 were seen for PCB126, PCB169 or PCB170. Genetic variation in the CYP1A1 was related to circulating PCB118 levels in the general elderly population. Genetic variation in CYP1A2 and CYP1B1 might also be associated with other PCBs. - Highlights: • We studied the relationship between PCBs and the genetic variation in the CYP genes. • Cross sectional data from a cohort of elderly were analysed. • The PCB levels were evaluated versus 21 SNPs in three CYP genes. • PCB 118 was related to variation in the CYP1A1 gene.

  18. Sequence variation and expression analysis of seed dormancy- and germination-associated ABA- and GA-related genes in rice cultivars

    Directory of Open Access Journals (Sweden)

    Fei eLiu

    2011-06-01

    Full Text Available Abscisic acid (ABA and Gibberellic acid (GA play key roles in regulating seed dormancy and germination. First, when examining germination of different rice cultivars, we found that their germination timing and dormancy status are rather distinct, coupled with different GA/ABA ratio. Second, we studied genomic sequences of ABA and GA dormancy- and germination-associated genes in rice and discovered single nucleotide polymorphisms (SNPs and insertions/deletions (Indels in both coding and regulatory sequences. We aligned all these variations to the genome assemblies of 9311 and PA64s and demonstrated their relevance to seed dormancy both quantitatively and qualitatively based on gene expression data. Third, we surveyed and compared differentially-expressed genes in dry seeds between 9311 and PA64s to show that these differentially-expressed genes may play roles in seed dormancy and germination.

  19. Increased brain size in mammals is associated with size variations in gene families with cell signalling, chemotaxis and immune-related functions.

    Science.gov (United States)

    Castillo-Morales, Atahualpa; Monzón-Sandoval, Jimena; Urrutia, Araxi O; Gutiérrez, Humberto

    2014-01-22

    Genomic determinants underlying increased encephalization across mammalian lineages are unknown. Whole genome comparisons have revealed large and frequent changes in the size of gene families, and it has been proposed that these variations could play a major role in shaping morphological and physiological differences among species. Using a genome-wide comparative approach, we examined changes in gene family size (GFS) and degree of encephalization in 39 fully sequenced mammalian species and found a significant over-representation of GFS variations in line with increased encephalization in mammals. We found that this relationship is not accounted for by known correlates of brain size such as maximum lifespan or body size and is not explained by phylogenetic relatedness. Genes involved in chemotaxis, immune regulation and cell signalling-related functions are significantly over-represented among those gene families most highly correlated with encephalization. Genes within these families are prominently expressed in the human brain, particularly the cortex, and organized in co-expression modules that display distinct temporal patterns of expression in the developing cortex. Our results suggest that changes in GFS associated with encephalization represent an evolutionary response to the specific functional requirements underlying increased brain size in mammals.

  20. Cylindrotheca closterium Is a Species Complex as Was Evidenced by the Variations of rbcL Gene and SSU rDNA

    Institute of Scientific and Technical Information of China (English)

    LI Haitao; YANG Guanpin; SUN Ying; WU Suihan; ZHANG Xiufang

    2007-01-01

    The genus Cylindrotheca consists of a small group of marine diatoms with a few species described. Eleven isolates of diatoms identified as Cylindrotheca closterium morphologically were obtained from Jiaozhou Bay with their nuclear-encoded small-subunit ribosomal RNA (SSU rDNA) and chloroplast-encoded rbcL gene sequences determined in this study. Interestingly, very high sequence divergences of SSU rDNA and rbcL gene were found among these isolates, and numerous nucleotide variation of rbcL gene caused relatively few variation of deduced amino acid sequence. Phylogenetic analyses based on SSU rDNA and rbcL gene, respectively, grouped the isolates into 6 clades. Phylogenetic tree of SSU rDNA placed all the Cylindrotheca isolates together, separating them into two lineages clearly. LineageⅠ was composed of the eleven C. closterium isolates obtained in this study together with another C. closterium isolate, but some clades were not well supported. LineageⅡ contained two C. closterium isolates and one C. fusiformis isolate. Phylogenetic analysis of rbcL gene also separated the Cylindrotheca isolates into two well-defined lineages. The eleven C. closterium isolates formed a lineage and all clades were supported strongly. Statistical comparisons of SSU rDNA indicated that the average distance within lineage Ⅰ was significantly higher than that of other microalgae species (P < 0.01). These results suggested the existence of cryptic species within C. closterium.

  1. A Multiple Interaction Analysis Reveals ADRB3 as a Potential Candidate for Gallbladder Cancer Predisposition via a Complex Interaction with Other Candidate Gene Variations.

    Science.gov (United States)

    Rai, Rajani; Kim, Jong Joo; Misra, Sanjeev; Kumar, Ashok; Mittal, Balraj

    2015-01-01

    Gallbladder cancer is the most common and a highly aggressive biliary tract malignancy with a dismal outcome. The pathogenesis of the disease is multifactorial, comprising the combined effect of multiple genetic variations of mild consequence along with numerous dietary and environmental risk factors. Previously, we demonstrated the association of several candidate gene variations with GBC risk. In this study, we aimed to identify the combination of gene variants and their possible interactions contributing towards genetic susceptibility of GBC. Here, we performed Multifactor-Dimensionality Reduction (MDR) and Classification and Regression Tree Analysis (CRT) to investigate the gene-gene interactions and the combined effect of 14 SNPs in nine genes (DR4 (rs20576, rs6557634); FAS (rs2234767); FASL (rs763110); DCC (rs2229080, rs4078288, rs7504990, rs714); PSCA (rs2294008, rs2978974); ADRA2A (rs1801253); ADRB1 (rs1800544); ADRB3 (rs4994); CYP17 (rs2486758)) involved in various signaling pathways. Genotyping was accomplished by PCR-RFLP or Taqman allelic discrimination assays. SPSS software version 16.0 and MDR software version 2.0 were used for all the statistical analysis. Single locus investigation demonstrated significant association of DR4 (rs20576, rs6557634), DCC (rs714, rs2229080, rs4078288) and ADRB3 (rs4994) polymorphisms with GBC risk. MDR analysis revealed ADRB3 (rs4994) to be crucial candidate in GBC susceptibility that may act either alone (p ADRB3 rs4994 as candidate influencing GBC susceptibility. PMID:26602921

  2. Sequence Variations in the Bovine Growth Hormone Gene Characterized by Single-Strand Conformation Polymorphism (Sscp) Analysis and Their Association with Milk Production Traits in Holsteins

    OpenAIRE

    Yao, J; Aggrey, S E; Zadworny, D.; Hayes, J. F.; Kuhnlein, U

    1996-01-01

    Sequence variations in the bovine growth hormone (GH) gene were investigated by single strand conformation polymorphism (SSCP) analysis of seven amplified fragments covering almost the entire gene (2.7 kb). SSCPs were detected in four of these fragments and a total of six polymorphisms were found in a sample of 128 Holstein bulls. Two polymorphisms, a T->C transition in the third intron (designated GH4.1) and an A->C transversion in the fifth exon (designated GH6.2), were shown to be associat...

  3. Geographical variation in the presence of genes encoding superantigenic exotoxins and beta-hemolysin among Staphylococcus aureus isolated from bovine mastitis in Europe and USA

    DEFF Research Database (Denmark)

    Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.

    2002-01-01

    The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the presence of genes encoding staphylococcal enterotoxins A-E, and H, toxic shock toxin-1 (TSST-1), and beta-hemolysin, and 128 of these were examined for exfoliative toxins A and B. The detection was done by PCR. Phenotypic methods were used to confirm the PCR-results. None of the 128 isolates carried...... the genes for exfoliative toxin A or B. The total proportion of isolates in which superantigenic exotoxins were detected varied from 2% (one isolate) of the Danish isolates to 65% (32 isolates) of the Norwegian isolates. This marked and highly significant geographical variation was also present...

  4. Exon Dosage Variations in Brazilian Patients with Parkinson’s Disease: Analysis of SNCA, PARKIN, PINK1 and DJ-1 Genes

    OpenAIRE

    Karla Cristina Vasconcelos Moura; Mário Campos Junior; Ana Lúcia Zuma de Rosso; Denise Hack Nicaretta; João Santos Pereira; Delson José Silva; Cíntia Barros Santos-Rebouças; Márcia Mattos Gonçalves Pimentel

    2012-01-01

    Parkinson’s disease is one of the most common neurodegenerative disorders associated with aging, reaching ∼ 2% of individuals over 65 years. Knowledge achieved in the last decade about the genetic basis of Parkinson’s disease clearly shows that genetic factors play an important role in the etiology of this disorder. Exon dosage variations account for a high proportion of Parkinson’s disease mutations, mainly for PARKIN gene. In the present study, we screened genomic rearrangements in SNCA, PA...

  5. Color Vision Variation as Evidenced by Hybrid L/M Opsin Genes in Wild Populations of Trichromatic Alouatta New World Monkeys.

    Science.gov (United States)

    Matsushita, Yuka; Oota, Hiroki; Welker, Barbara J; Pavelka, Mary S; Kawamura, Shoji

    2014-01-01

    Platyrrhine (New World) monkeys possess highly polymorphic color vision owing to allelic variation of the single-locus L/M opsin gene on the X chromosome. Most species consist of female trichromats and female and male dichromats. Howlers (genus Alouatta) are an exception; they are considered to be routinely trichromatic with L and M opsin genes juxtaposed on the X chromosome, as seen in catarrhine primates (Old World monkeys, apes, and humans). Yet it is not known whether trichromacy is invariable in howlers. We examined L/M opsin variation in wild howler populations in Costa Rica and Nicaragua (Alouatta palliata) and Belize (A. pigra), using fecal DNA. We surveyed exon 5 sequences (containing the diagnostic 277th and 285th residues for λmax) for 8 and 18 X chromosomes from Alouatta palliata and A. pigra, respectively. The wavelengths of maximal absorption (λmax) of the reconstituted L and M opsin photopigments were 564 nm and 532 nm, respectively, in both species. We found one M-L hybrid sequence with a recombinant 277/285 haplotype in Alouatta palliata and two L-M hybrid sequences in A. pigra. The λmax values of the reconstituted hybrid photopigments were in the range of 546~554 nm, which should result in trichromat phenotypes comparable to those found in other New World monkey species. Our finding of color vision variation due to high frequencies of L/M hybrid opsin genes in howlers challenges the current view that howlers are routine and uniform trichromats. These results deepen our understanding of the evolutionary significance of color vision polymorphisms and routine trichromacy and emphasize the need for further assessment of opsin gene variation as well as behavioral differences among subtypes of trichromacy. PMID:24523565

  6. El profesor universitario como protagonista de la reforma académica

    Directory of Open Access Journals (Sweden)

    Delgado Zarnbrano Alba Judith

    1991-06-01

    Full Text Available

    La reforma académica es un proyecto en marcha en la Universidad Nacional de Colombia, que se viene gestando desde hace aproximadamente cuatro años y se oficializa en mayo de 1989, cuando la vice-rectoría académica presenta el documento "lineamientos sobre programas curriculares" para orientar el debate y reflexión sobre el futuro académico de la institución. Cometido que se logra mediante la organizaci6n de seminarios con las directivas de programas curriculares y de un ciclo de conferencias y paneles abiertos al conjunto de la comunidad universitaria, buscando en todo momento que sus líneas fundamentales sean enriquecidas, compartidas y asumidas por todos.

  7. Sequence variation in DDAH1 and DDAH2 genes is strongly and additively associated with serum ADMA concentrations in individuals with type 2 diabetes.

    Directory of Open Access Journals (Sweden)

    Sotoodeh Abhary

    Full Text Available BACKGROUND: Asymmetric dimethylarginine (ADMA, present in human serum, is an endogenous inhibitor of nitric oxide synthase and contributes to vascular disease. Dimethylarginine dimethylaminohydrolase (DDAH is an ADMA degrading enzyme that has two isoforms: DDAHI and DDAHII. We sought to determine whether serum ADMA levels in type 2 diabetes are influenced by common polymorphisms in the DDAH1 and DDAH2 genes. METHODOLOGY/PRINCIPAL FINDINGS: Relevant clinical parameters were measured and peripheral whole blood obtained for serum and genetic analysis on 343 participants with type 2 diabetes. Serum ADMA concentrations were determined by mass spectroscopy. Twenty six tag SNPs in the DDAH1 and 10 in the DDAH2 gene were genotyped in all subjects and tested for association with serum ADMA levels. Several SNPs and haplotypes in the DDAH genes were strongly associated with ADMA levels. Most significantly in the DDAH1 gene, rs669173 (p = 2.96x10(-7, rs7521189 (p = 6.40x10(-7, rs2474123 (p = 0.00082 and rs13373844 (p = 0.00027, and in the DDAH2 gene, rs3131383 (p = 0.0029 and the TGCCCAGGAG haplotype (p = 0.0012 were significantly associated with ADMA levels. Sub-analysis by diabetic retinopathy (DR status revealed these variants were associated with ADMA levels predominantly in participants without DR. Combined analysis of the most strongly associated SNPs in DDAH1 (rs669173 and DDAH2 (rs3131383 revealed an additive effect (p = 1.37x10(-8 on ADMA levels. CONCLUSIONS/SIGNIFICANCE: Genetic variation in the DDAH1 and 2 genes is significantly associated with serum ADMA levels. Further studies are required to determine the pathophysiological significance of elevated serum ADMA in type 2 diabetes and to better understand how DDAH gene variation influences ADMA levels.

  8. Dynamic DNA cytosine methylation in the Populus trichocarpa genome: tissue-level variation and relationship to gene expression

    Directory of Open Access Journals (Sweden)

    Vining Kelly J

    2012-01-01

    Full Text Available Abstract Background DNA cytosine methylation is an epigenetic modification that has been implicated in many biological processes. However, large-scale epigenomic studies have been applied to very few plant species, and variability in methylation among specialized tissues and its relationship to gene expression is poorly understood. Results We surveyed DNA methylation from seven distinct tissue types (vegetative bud, male inflorescence [catkin], female catkin, leaf, root, xylem, phloem in the reference tree species black cottonwood (Populus trichocarpa. Using 5-methyl-cytosine DNA immunoprecipitation followed by Illumina sequencing (MeDIP-seq, we mapped a total of 129,360,151 36- or 32-mer reads to the P. trichocarpa reference genome. We validated MeDIP-seq results by bisulfite sequencing, and compared methylation and gene expression using published microarray data. Qualitative DNA methylation differences among tissues were obvious on a chromosome scale. Methylated genes had lower expression than unmethylated genes, but genes with methylation in transcribed regions ("gene body methylation" had even lower expression than genes with promoter methylation. Promoter methylation was more frequent than gene body methylation in all tissues except male catkins. Male catkins differed in demethylation of particular transposable element categories, in level of gene body methylation, and in expression range of genes with methylated transcribed regions. Tissue-specific gene expression patterns were correlated with both gene body and promoter methylation. Conclusions We found striking differences among tissues in methylation, which were apparent at the chromosomal scale and when genes and transposable elements were examined. In contrast to other studies in plants, gene body methylation had a more repressive effect on transcription than promoter methylation.

  9. Gibberellin-Regulation and Genetic Variations in Leaf Elongation for Tall Fescue in Association with Differential Gene Expression Controlling Cell Expansion.

    Science.gov (United States)

    Xu, Qian; Krishnan, Sanalkumar; Merewitz, Emily; Xu, Jichen; Huang, Bingru

    2016-01-01

    Leaf elongation rate (LER) is an important factor controlling plant growth and productivity. The objective of this study was to determine whether genetic variation in LER for a fast-growing ('K-31'), and a dwarf cultivar ('Bonsai') of tall fescue (Festuca arundinacea) and gibberellic acid (GA) regulation of LER were associated with differential expression of cell-expansion genes. Plants were treated with GA3, trinexapac-ethyl (TE) (GA inhibitor), or water (untreated control) in a hydroponic system. LER of 'K-31' was 63% greater than that of 'Bonsai', which corresponded with 32% higher endogenous GA4 content in leaf and greater cell elongation and production rates under the untreated control condition. Exogenous application of GA3 significantly enhanced LER while TE treatment inhibited leaf elongation due to GA3-stimulation or TE-inhibition of cell elongation and production rate in leaves for both cultivars. Real-time quantitative polymerase chain reaction analysis revealed that three α-expansins, one β-expansin, and three xyloglucan endotransglycosylase (XET) genes were associated with GA-stimulation of leaf elongation, of which, the differential expression of EXPA4 and EXPA7 was related to the genotypic variation in LER of two cultivars. Those differentially-expressed expansin and XET genes could play major roles in genetic variation and GA-regulated leaf elongation in tall fescue. PMID:27457585

  10. Usos de Internet y éxito académico en estudiantes universitarios

    Directory of Open Access Journals (Sweden)

    2016-07-01

    Full Text Available El uso de la tecnología provoca cambios sociales. Esto incluye el trabajo en el ámbito universitario en donde está cambiando tanto la forma de ejercer la docencia como la forma de aprender y se requiere conocer el efecto del uso de la tecnología sobre el rendimiento del alumnado. En este trabajo se investigó la incidencia del uso de Internet sobre el éxito académico del alumnado de cinco universidades de Ecuador. Se levantó una muestra aleatoria de 4.697 personas y se las categorizó en perfiles de uso de Internet para actividades académicas y para entretenimiento, utilizando análisis factorial y análisis clúster. Las categorías resultantes se utilizaron como variables independientes en modelos de regresión logística multinomial que buscaban determinar si el uso de Internet tenía incidencia sobre el éxito académico. Los resultados muestran que quienes realizan actividades interactivas con pares y profesores o quienes utilizan de forma balanceada las distintas herramientas de Internet tienden a un mayor éxito académico que aquellos que solo buscan información. En lo referente al entretenimiento, se encontró una incidencia positiva del uso de Internet sobre el éxito académico. Los estudiantes que realizan descargas de contenido de audio, video y software, y quienes utilizan todas las posibilidades de entretenimiento, presentan menor tendencia a suspender que los estudiantes que utilizan mínimamente Internet. En cuanto al género se presentan diferencias en los usos académicos y de entretenimiento.

  11. Indicadores de desempeño clave para unidades académicas universitarias

    Directory of Open Access Journals (Sweden)

    Guillermo Yáber

    2002-01-01

    Full Text Available El propósito de este trabajo es aplicar el modelo de Gerencia de Sistemas Conductuales (G.S.C. y el enfoque sistémico de organización y gestión en una unidad académica universitaria. Se emplearon en el diseño, desarrollo, aplicación y evaluación de indicadores de desempeño clave en una unidad académica universitaria venezolana. Se utilizaron indicadores para las siguientes categorías de gestión:efecto, impacto, eficacia, eficiencia, calidad y economía. Los resultados obtenidos sugieren que la unidad académica mejora sus indicadores de efecto, impacto, y eficiencia a través del tiempo y tiene oportunidad de mejoras en las categorías de calidad y economía. Los datos para analizar la eficacia no estuvieron disponibles para el momento del estudio. Los resultados proporcionan pautas tanto para la formulación de políticas académicas como para la toma de decisiones y ejecución de acciones destinadas a corregir y mejorar el desempeño de esa dependencia universitaria. Estos indicadores y los enfoques de donde se derivan, pueden aplicarse a otras unidades académicas en la misma universidad o a otras instituciones de educación superior que ofrezcan títulos o grados académicos. Se concluye que medir y evaluar indicadores de gestión constituyen prácticas para instrumentar la autorregulación y el control de la gestión en las instituciones de educación superior.

  12. Variations in the coding and regulatory sequences of the angiogenin (ANG) gene are not associated to ALS (amyotrophic lateral sclerosis) in the Italian population.

    Science.gov (United States)

    Corrado, Lucia; Battistini, Stefania; Penco, Silvana; Bergamaschi, Laura; Testa, Lucia; Ricci, Claudia; Giannini, Fabio; Greco, Giuseppe; Patrosso, Maria Cristina; Pileggi, Simona; Causarano, Renzo; Mazzini, Letizia; Momigliano-Richiardi, Patricia; D'Alfonso, Sandra

    2007-07-15

    Potentially causative missense variations in the ANG gene and a positive association with the synonymous rs11701-G substitution was detected mainly in Irish and Scottish ALS patients. We screened 262 Italian SOD1 negative ALS patients (250 sporadic) and 415 matched controls for sequence variations in the coding, 3'/5' UTR and 5' flanking (642 bp) regions of the ANG gene. We identified 53 sequence variations of which 46 new, 20 with a minor allele frequency (MAF) >or=0.01 and only three localised in the coding sequence, namely the missense I46V, identified in one patient and two controls, and the synonymous G86G and T97T corresponding to rs11701 and rs2228653. None of the detected SNPs or of their haplotypic combinations was significantly associated with ALS susceptibility or clinical features. In conclusion, we did not detect the association with rs11701-G or with any other newly detected variation in the ANG regulatory region. Furthermore we did not identify potentially causal mutations in the coding region. PMID:17462671

  13. Variation in the ovine hormone-sensitive lipase gene (HSL) and its association with growth and carcass traits in New Zealand Suffolk sheep.

    Science.gov (United States)

    Yang, Guo; Forrest, Rachel; Zhou, Huitong; Hickford, Jonathan

    2014-01-01

    The hormone-sensitive lipase (HSL) plays an important role in the regulation of lipolysis in adipose tissues, by catalysing a rate-limiting step in triglyceride hydrolysis. Variation within the human HSL gene (HSL) has been associated with an increased risk of obesity. In this study, variation within three regions (exon 3-4, exon 5-6 and exon 9) of ovine HSL was investigated in 538 Suffolk lambs bred from 13 independent sires using PCR-SSCP. Four sequence variants of intron 5 (designated A-D) and two variants of exon 9 (designated a and b) of ovine HSL were detected. No variation was found in exon 3-4 of the gene. The associations of the variation within ovine HSL with post-weaning growth and carcass traits including eye muscle depth (EMD), eye muscle width (EMW) and fat depth above the eye muscle (FDM) were assessed in 262 of the above 538 lambs using general linear mixed-effects models. In the single variant models, the presence of intron 5 A in a lamb's genotype was associated with reduced EMD (P = 0.036) and EMW (P = 0.018), whereas the presence of intron 5 C was associated with increased EMD (P HSL intron 5 variants and post-weaning growth, or between HSL exon 9 variants, post-weaning growth or carcass traits, were found.

  14. Association between allelic variation due to short tandem repeats in tRNA gene of Entamoeba histolytica and clinical phenotypes of amoebiasis.

    Science.gov (United States)

    Jaiswal, Virendra; Ghoshal, Ujjala; Mittal, Balraj; Dhole, Tapan N; Ghoshal, Uday C

    2014-05-01

    Genotypes of Entamoeba histolytica (E. histolytica) may contribute clinical phenotypes of amoebiasis such as amoebic liver abscess (ALA), dysentery and asymptomatic cyst passers state. Hence, we evaluated allelic variation due to short tandem repeats (STRs) in tRNA gene of E. histolytica and clinical phenotypes of amoebiasis. Asymptomatic cyst passers (n=24), patients with dysentery (n=56) and ALA (n=107) were included. Extracted DNA from stool (dysentery, asymptomatic cyst passers) and liver aspirate was amplified using 6 E. histolytica specific tRNA-linked STRs (D-A, A-L, N-K2, R-R, S-Q, and S(TGA)-D) primers. PCR products were subjected to sequencing. Association between allelic variation and clinical phenotypes was analyzed. A total of 9 allelic variations were found in D-A, 8 in A-L, 4 in N-K2, 5 in R-R, 10 in S(TAG)-D and 7 in S-Q loci. A significant association was found between allelic variants and clinical phenotypes of amoebiasis. This study reveals that allelic variation due to short tandem repeats (STRs) in tRNA gene of E. histolytica is associated different clinical outcome of amoebiasis.

  15. Design of a Comprehensive Biochemistry and Molecular Biology Experiment: Phase Variation Caused by Recombinational Regulation of Bacterial Gene Expression

    Science.gov (United States)

    Sheng, Xiumei; Xu, Shungao; Lu, Renyun; Isaac, Dadzie; Zhang, Xueyi; Zhang, Haifang; Wang, Huifang; Qiao, Zheng; Huang, Xinxiang

    2014-01-01

    Scientific experiments are indispensable parts of Biochemistry and Molecular Biology. In this study, a comprehensive Biochemistry and Molecular Biology experiment about "Salmonella enterica" serovar Typhi Flagellar phase variation has been designed. It consisted of three parts, namely, inducement of bacterial Flagellar phase variation,…

  16. La reforma curricular universitaria: evaluación y mejoramiento académico

    OpenAIRE

    Josefina Quintero Corzo; Juan Carlos Yepes Ocampo; Raúl Ancízar Munévar Molina

    2006-01-01

    Este artículo somete a discusión algunas ideas sobre reforma curricular universitaria surgidas de la crítica al discurso teórico y empírico que caracteriza los esquemas tradicionales. Se demuestra que la manera como se ha venido implementando, no satisface las políticas institucionales de cambio y mejoramiento académico. Se analiza el vínculo entre currículo e investigaci ón y su importancia para el proceso de reforma y mejoramiento académico.

  17. Deserción universitaria y alfabetización académica

    OpenAIRE

    Giohanny Olave-Arias; llene Rojas-García; Mireya Cisneros-Estupiñán

    2013-01-01

    El artículo pone en relación la deserción universitaria con la alfabetización académica, entendida como el nivel de desarrollo de la lectura y la escritura. El desarrollo del artículo consta de tres momentos: contextualización del problema de la deserción universitaria en Colombia; prácticas de lectura y escritura que generan dificultades de aprendizaje; importancia de la alfabetización académica para mejorar las habilidades lectoras de los estudiantes.

  18. Seguir escribiendo... seguir aprendiendo: la escritura de textos académicos en el nivel universitario

    OpenAIRE

    Soledad Aguilera M.; Yanina Elizabet Boatto

    2013-01-01

    La producción de textos académicos implica competencias discursivas y comunicativas y procesos cognitivos específicos, ante los cuales los estudiantes universitarios suelen presentar dificultades. Asimismo, dichas dificultades se ven reforzadas desde la enseñanza, ya que generalmente no se orienta a los alumnos durante los procesos de escritura. En este artículo nos proponemos recuperar aportes teóricos sobre la producción de textos académicos y, a partir de la reflexión sobre nuestra experie...

  19. Académicos gestores en la universidad actual: desafíos y aprendizajes

    OpenAIRE

    Sánchez-Moreno, Marita; Altopiedi, Mariana

    2016-01-01

    Objeto: El artículo presenta y discute algunos resultados de un estudio acerca de la gestión de académicos universitarios y se centra en la identificación de las principales claves –tanto de contenido como de orden metodológico– para diseñar programas formativos en relación con esta tarea. Diseño/metodología: La investigación –de corte cualitativo– contempló la realización de entrevistas en profundidad a 71 gestores académicos universitarios positivamente valorados como tales, en tres univ...

  20. Deserción universitaria y alfabetización académica

    Directory of Open Access Journals (Sweden)

    Giohanny Olave-Arias

    2013-12-01

    Full Text Available El artículo pone en relación la deserción universitaria con la alfabetización académica, entendida como el nivel de desarrollo de la lectura y la escritura. El desarrollo del artículo consta de tres momentos: contextualización del problema de la deserción universitaria en Colombia; prácticas de lectura y escritura que generan dificultades de aprendizaje; importancia de la alfabetización académica para mejorar las habilidades lectoras de los estudiantes.

  1. Tutores académicos universitarios que contribuyen al desarrollo personal del estudiante

    OpenAIRE

    Ricardo Campos Campos; Martha Gabriela Campos Mondragón

    2015-01-01

    Introducción. La tutoría académica universitaria centra su actuación en el asesoramiento y apoyo técnico a los estudiantes, desde los inicios hasta la finalización completa de sus estudios. Debido a que interviene en áreas igualmente importantes, como la académica, profesional y personal, puede contribuir al desarrollo integral de las personas durante su paso por la Universidad. Objetivo. Se planteó como objetivo general describir la influencia que tiene el tutor sobre el desarrollo ...

  2. El plagio académico: formar en competencias y buenas prácticas universitarias

    OpenAIRE

    Alfaro Torres, Paloma; Juan Juárez, Teresa de

    2014-01-01

    El plagio académico es una práctica demasiado frecuente entre los estudiantes universitarios ya que las nuevas tecnologías, y en especial, Internet permiten realizarlo con facilidad. Se analiza el concepto de plagio desde diversos puntos de vista y se profundiza en las competencias informacionales del uso ético y legal de la información que debe ser acometido desde diversos frentes para inculcar la honestidad académica en la enseñanza superior

  3. Calidad del dormir, insomnio y rendimiento académico en estudiantes de medicina

    Directory of Open Access Journals (Sweden)

    Alvaro Monterrosa Castro

    2015-01-01

    Full Text Available Es alta la prevalencia de mala calidad del sueño en estudiantes universitarios, especialmente de medicina. Los disturbios del dormir repercuten de manera negativa en la salud mental, física y en la calidad de vida. El objetivo es evaluar la calidad del dormir e insomnio y su asociación con el rendimiento académico, en estudiantes de medicina de una universidad pública del Caribe Colombiano. Estudio transversal, realizado en estudiantes de primero a décimo semestre de medicina de la Universidad de Cartagena, Colombia. Se aplicó formulario de datos socio demográfico y académico, así como la Escala de Insomnio de Atenas y el índice de calidad de sueño de Pittsburgh. Puntuación de Atenas > 5 indica insomnio y Pittsburgh >5: malos dormidores. Participación voluntaria, estratificada por sexo y semestre. Los datos fueron analizados con Epi-Info 7. Valor de p<0.05 estadísticamente significativo. Participaron 210 estudiantes. Edad: 19.7±2.0. Varones: 49.0%, procedentes de Cartagena: 69%. Promedio académico: 3.8±0.2. Rendimiento académico alto: 31.4%. Se estimaron como malos dormidores el 88.1%. No se observaron diferencias significativas entre buenos dormidores y malos dormidores en cuanto a rendimiento académico. El 46.6% presentaban insomnio. Los estudiantes con rendimiento académico alto, tuvieron significativamente menor presencia de insomnio. Los estudiantes con insomnio y malos dormidores tuvieron presencia significativamente mayor de somnolencia diurna. Se concluye que en estudiantes de medicina de una universidad colombiana fue elevada la presencia de malos dormidores, pero ello no se asoció con el rendimiento académico. El insomnio también fue elevadamente prevalente y si tuvo asociación significativa con el rendimiento académico.

  4. Coneixements previs i rendiment acadèmic a la Universitat

    OpenAIRE

    García Gay, Lourdes

    1999-01-01

    CONEIXEMENTS PREVIS I RENDIMENT ACADÈMIC A LA UNIVERSITATAdoptant el model del constructivisme, la tesi es proposa com a objectiu esbrinar quina és la base acadèmica de l'alumnat en arribar als estudis universitaris de Fisioteràpia i comprovar si aquesta base influeix en el rendiment acadèmic durant el primer curs de la carrera.La tesi està estructurada en dues parts. En la fonamentació teòrica cal considerar el context en què se situa la tesi (canvi del sistema educatiu, renovació de les PAA...

  5. Proyecto de Investigación : factores asociados al rendimiento académico

    OpenAIRE

    López-Soria Salas, Malena

    2011-01-01

    El presente proyecto pretende investigar las relaciones que se puedan dar entre el desempeño académico, entendido como dimensión, y diversos factores asociados en alumnos/as que cursan titulaciones de grado universitario. Sabemos la importancia de encontrar regularidades identificables en torno a factores que influyen en el desempeño académico con la finalidad de mejorar los procesos, apoyos, materiales, etc. Se entiende, en este contexto, los factores como herramientas que permiten tene...

  6. Variation of chemosensory receptor content of Campylobacter jejuni strains and modulation of receptor gene expression under different in vivo and in vitro growth conditions

    Directory of Open Access Journals (Sweden)

    Day Christopher J

    2012-06-01

    Full Text Available Abstract Background Chemotaxis is crucial for the colonisation/infection of hosts with Campylobacter jejuni. Central to chemotaxis are the group A chemotaxis genes that are responsible for sensing the external environment. The distribution of group A chemoreceptor genes, as found in the C. jejuni sequenced strains, tlp1-4, 7, 10 and 11 were determined in 33 clinical human and avian isolates. Results Group A tlp gene content varied among the strains with genes encoding tlp1 (aspartate receptor, ccaA and tlp7 present in all strains tested, where as tlp11 was present in only one of our international collection clinical isolates, C. jejuni 520, but was more prevalent (9/13 in the freshly isolated clinical stains from patients who required hospitalisation due to C. jejuni infection (GCH1-17. Relative expression levels of the group A tlp genes were also determined in C. jejuni reference strains NCTC 11168-GS, 11168-O and 81116 using cells grown in vitro at 37°C, 42°C and maintained at room temperature and with cells isolated directly from murine and avian hosts by immune magnetic separation without subsequent culture. Gene expression of tlp genes was varied based on strain, growth conditions and in vivo isolation source. Tlp1, although the most conserved, showed the lowest and most varied mRNA expression and protein production under laboratory conditions. Tlp7 was highly expressed at most conditions tested, and gene expression was not influenced by the tlp7 gene encoding a full length protein or one expressed as separate periplasmic and cytoplasmic domains. Conclusion We have shown that chemosensory receptor set variation exists among C. jejuni strains, but is not dependent on the isolation source.

  7. Genetic variation in toll-like receptors and retinoic acid-inducible gene I and outcome of hepatitis C virus infection

    DEFF Research Database (Denmark)

    Clausen, L N; Ladelund, S; Weis, N;

    2014-01-01

    SNPs in the IkBε, rs2233437 and rs730775. Presence of one or two of the variant allele in rs2233437 had more than twofold higher odds of resolution in adjusted logistic regression (adjusted odds ratio (aOR), 2.6; (95% CI, 1.4, 4.8) P = 0.002). We identified polymorphisms in the IkBε gene associated......We evaluated the effects of genetic variation in toll-like receptors (TLR), retinoic acid-inducible gene I (RIG-I) and their signalling pathways on spontaneous hepatitis C virus (HCV) resolution. We screened 95 single-nucleotide polymorphisms (SNPs) in 22 genes. SNPs significantly associated...... with resolution in the discovery cohort were genotyped in a validation cohort. Multivariate logistic regression adjusted for sex, hepatitis B surface antigen, HIV infection and the interleukin-28B rs12979860 SNP was performed in the combined cohort. Haplotype reconstruction and linkage disequilibrium analysis...

  8. Expression conservation within the circadian clock of a monocot: natural variation at barley Ppd-H1 affects circadian expression of flowering time genes, but not clock orthologs

    Directory of Open Access Journals (Sweden)

    Campoli Chiara

    2012-06-01

    Full Text Available Abstract Background The circadian clock is an endogenous mechanism that coordinates biological processes with daily changes in the environment. In plants, circadian rhythms contribute to both agricultural productivity and evolutionary fitness. In barley, the photoperiod response regulator and flowering-time gene Ppd-H1 is orthologous to the Arabidopsis core-clock gene PRR7. However, relatively little is known about the role of Ppd-H1 and other components of the circadian clock in temperate crop species. In this study, we identified barley clock orthologs and tested the effects of natural genetic variation at Ppd-H1 on diurnal and circadian expression of clock and output genes from the photoperiod-response pathway. Results Barley clock orthologs HvCCA1, HvGI, HvPRR1, HvPRR37 (Ppd-H1, HvPRR73, HvPRR59 and HvPRR95 showed a high level of sequence similarity and conservation of diurnal and circadian expression patterns, when compared to Arabidopsis. The natural mutation at Ppd-H1 did not affect diurnal or circadian cycling of barley clock genes. However, the Ppd-H1 mutant was found to be arrhythmic under free-running conditions for the photoperiod-response genes HvCO1, HvCO2, and the MADS-box transcription factor and vernalization responsive gene Vrn-H1. Conclusion We suggest that the described eudicot clock is largely conserved in the monocot barley. However, genetic differentiation within gene families and differences in the function of Ppd-H1 suggest evolutionary modification in the angiosperm clock. Our data indicates that natural variation at Ppd-H1 does not affect the expression level of clock genes, but controls photoperiodic output genes. Circadian control of Vrn-H1 in barley suggests that this vernalization responsive gene is also controlled by the photoperiod-response pathway. Structural and functional characterization of the barley circadian clock will set the basis for future studies of the adaptive significance of the circadian clock in

  9. Sequence variation and recognition specificity of the avirulence gene AvrPiz-t in Magnaporthe oryzae field populations

    Science.gov (United States)

    Magnaporthe oryzae, the rice blast pathogen, causes significant annual yield loss of rice worldwide. Currently, the most effective disease control approach is deployment of host resistance through introduction of resistance (R) genes into elite cultivars. The function of each R gene relies on the sp...

  10. Extreme obesity is associated with variation in genes related to the circadian rhythm of food intake and hypothalamic signaling.

    Science.gov (United States)

    Mariman, Edwin C M; Bouwman, Freek G; Aller, Erik E J G; van Baak, Marleen A; Wang, Ping

    2015-06-01

    The hypothalamus is important for regulation of energy intake. Mutations in genes involved in the function of the hypothalamus can lead to early-onset severe obesity. To look further into this, we have followed a strategy that allowed us to identify rare and common gene variants as candidates for the background of extreme obesity from a relatively small cohort. For that we focused on subjects with a well-selected phenotype and on a defined gene set and used a rich source of genetic data with stringent cut-off values. A list of 166 genes functionally related to the hypothalamus was generated. In those genes complete exome sequence data from 30 extreme obese subjects (60 genomes) were screened for novel rare indel, nonsense, and missense variants with a predicted negative impact on protein function. In addition, (moderately) common variants in those genes were analyzed for allelic association using the general population as reference (false discovery rategenes for BAIAP3, NBEA, PRRC2A, RYR1, SIM1, and TRH, and a novel indel variant in LEPR. Common variants in the six genes for MBOAT4, NPC1, NPW, NUCB2, PER1, and PRRC2A showed significant allelic association with extreme obesity. Our findings underscore the complexity of the genetic background of extreme obesity involving rare and common variants of genes from defined metabolic and physiologic processes, in particular regulation of the circadian rhythm of food intake and hypothalamic signaling.

  11. Variation in bleomycin hydrolase gene is associated with reduced survival after chemotherapy for testicular germ cell cancer

    NARCIS (Netherlands)

    de Haas, Esther C; Zwart, Nynke; Meijer, Coby; Nuver, Janine; Suurmeijer, Albert J H; Hoekstra, Harald J; van der Steege, Gerrit; Sleijfer, Dirk Th; Gietema, Jourik A; Boezen, Hendrika

    2008-01-01

    PURPOSE: Response to chemotherapy may be determined by gene polymorphisms involved in metabolism of cytotoxic drugs. A plausible candidate is the gene for bleomycin hydrolase (BLMH), an enzyme that inactivates bleomycin, an essential component of chemotherapy regimens for disseminated testicular ger

  12. Natural variation in expression of genes associated with biosynthesis and accumulation in cassava (Manihot esculenta Crantz) storage root

    Science.gov (United States)

    Several groups have reported on massive accumulation of total carotenoids in cassava storage root (CSR). Naturally occurring color variation associated with carotenoid accumulation was observed in cassava (Manihot esculenta Crantz) storage root of landraces from Amazon. Here carotenoid profiles from...

  13. Bovine Host Genetic Variation Influences Rumen Microbial Methane Production with Best Selection Criterion for Low Methane Emitting and Efficiently Feed Converting Hosts Based on Metagenomic Gene Abundance.

    Directory of Open Access Journals (Sweden)

    Rainer Roehe

    2016-02-01

    Full Text Available Methane produced by methanogenic archaea in ruminants contributes significantly to anthropogenic greenhouse gas emissions. The host genetic link controlling microbial methane production is unknown and appropriate genetic selection strategies are not developed. We used sire progeny group differences to estimate the host genetic influence on rumen microbial methane production in a factorial experiment consisting of crossbred breed types and diets. Rumen metagenomic profiling was undertaken to investigate links between microbial genes and methane emissions or feed conversion efficiency. Sire progeny groups differed significantly in their methane emissions measured in respiration chambers. Ranking of the sire progeny groups based on methane emissions or relative archaeal abundance was consistent overall and within diet, suggesting that archaeal abundance in ruminal digesta is under host genetic control and can be used to genetically select animals without measuring methane directly. In the metagenomic analysis of rumen contents, we identified 3970 microbial genes of which 20 and 49 genes were significantly associated with methane emissions and feed conversion efficiency respectively. These explained 81% and 86% of the respective variation and were clustered in distinct functional gene networks. Methanogenesis genes (e.g. mcrA and fmdB were associated with methane emissions, whilst host-microbiome cross talk genes (e.g. TSTA3 and FucI were associated with feed conversion efficiency. These results strengthen the idea that the host animal controls its own microbiota to a significant extent and open up the implementation of effective breeding strategies using rumen microbial gene abundance as a predictor for difficult-to-measure traits on a large number of hosts. Generally, the results provide a proof of principle to use the relative abundance of microbial genes in the gastrointestinal tract of different species to predict their influence on traits e

  14. Bovine Host Genetic Variation Influences Rumen Microbial Methane Production with Best Selection Criterion for Low Methane Emitting and Efficiently Feed Converting Hosts Based on Metagenomic Gene Abundance.

    Science.gov (United States)

    Roehe, Rainer; Dewhurst, Richard J; Duthie, Carol-Anne; Rooke, John A; McKain, Nest; Ross, Dave W; Hyslop, Jimmy J; Waterhouse, Anthony; Freeman, Tom C; Watson, Mick; Wallace, R John

    2016-02-01

    Methane produced by methanogenic archaea in ruminants contributes significantly to anthropogenic greenhouse gas emissions. The host genetic link controlling microbial methane production is unknown and appropriate genetic selection strategies are not developed. We used sire progeny group differences to estimate the host genetic influence on rumen microbial methane production in a factorial experiment consisting of crossbred breed types and diets. Rumen metagenomic profiling was undertaken to investigate links between microbial genes and methane emissions or feed conversion efficiency. Sire progeny groups differed significantly in their methane emissions measured in respiration chambers. Ranking of the sire progeny groups based on methane emissions or relative archaeal abundance was consistent overall and within diet, suggesting that archaeal abundance in ruminal digesta is under host genetic control and can be used to genetically select animals without measuring methane directly. In the metagenomic analysis of rumen contents, we identified 3970 microbial genes of which 20 and 49 genes were significantly associated with methane emissions and feed conversion efficiency respectively. These explained 81% and 86% of the respective variation and were clustered in distinct functional gene networks. Methanogenesis genes (e.g. mcrA and fmdB) were associated with methane emissions, whilst host-microbiome cross talk genes (e.g. TSTA3 and FucI) were associated with feed conversion efficiency. These results strengthen the idea that the host animal controls its own microbiota to a significant extent and open up the implementation of effective breeding strategies using rumen microbial gene abundance as a predictor for difficult-to-measure traits on a large number of hosts. Generally, the results provide a proof of principle to use the relative abundance of microbial genes in the gastrointestinal tract of different species to predict their influence on traits e.g. human metabolism

  15. Clinical and molecular spectra in galactosemic patients from neonatal screening in northeastern Italy: structural and functional characterization of new variations in the galactose-1-phosphate uridyltransferase (GALT) gene.

    Science.gov (United States)

    Viggiano, E; Marabotti, A; Burlina, A P; Cazzorla, C; D'Apice, M R; Giordano, L; Fasan, I; Novelli, G; Facchiano, A; Burlina, A B

    2015-04-01

    Classical galactosemia is an autosomal recessive inborn error of metabolism due to mutations of the GALT gene leading to toxic accumulation of galactose and derived metabolites. With the benefit of early diagnosis by neonatal screening and early therapy, the acute presentation of classical galactosemia can be prevented. However, despite early diagnosis and treatment, the long term outcome for these patients is still unpredictable because they may go on to develop cognitive disability, speech problems, neurological and/or movement disorders and, in females, ovarian dysfunction. The objectives of the current study were to report our experience with a group of galactosemic patients identified through the neonatal screening programs in northeastern Italy during the last 30years. No neonatal deaths due to galactosemia complications occurred after the introduction of the neonatal screening program. However, despite the early diagnosis and dietary treatment, the patients with classical galactosemia showed one or more long-term complications. A total of 18 different variations in the GALT gene were found in the patient cohort: 12 missense, 2 frameshift, 1 nonsense, 1 deletion, 1 silent variation, and 1 intronic. Six (p.R33P, p.G83V, p.P244S, p.L267R, p.L267V, p.E271D) were new variations. The most common variation was p.Q188R (12 alleles, 31.5%), followed by p.K285N (6 alleles, 15.7%) and p.N314D (6 alleles, 15.7%). The other variations comprised 1 or 2 alleles. In the patients carrying a new mutation, the biochemical analysis of GALT activity in erythrocytes showed an activity of galactosemia and underlines the importance of molecular diagnostic testing prior to making any treatment. PMID:25592817

  16. Inteligencia emocional, bienestar personal y rendimiento académico en preadolescentes

    Directory of Open Access Journals (Sweden)

    Marta Ferragut

    2012-01-01

    Full Text Available El objetivo principal de este estudio es el análisis de la relación entre la inteligencia emocional y el bienestar personal y su posible predicción del rendimiento académico. Los participantes fueron 166 estudiantes de último ciclo de primaria de entre 9 y 12 años. Para evaluar la inteligencia emocional, se empleó el Trait Meta-Mood Scale (TMMS- 24 de Salovey y colaboradores (1995, para el bienestar personal se ha aplicado la Escala Eudemon y el Ítem General de Felicidad (Fierro, 2006 y para el rendimientoacadémico se registraron distintas variables, donde la principal fue la nota media. Los resultados mostraron la existencia de correlaciones significativas entre bienestar e inteligencia emocional, así como entre rendimiento académico y bienestar, no así entre inteligencia emocional y rendimiento académico. Además, el análisis de regresión múltiple muestra una recta de regresión donde el único predictor para nota media es el bienestar. Estos resultados indican relación entre bienestar e inteligencia emocional y la importancia de estos constructos psicológicos para el logro académico.

  17. Hacia una didáctica de la escritura académica en la universidad

    Directory of Open Access Journals (Sweden)

    Victoria Yolanda Villaseñor López

    2013-01-01

    Full Text Available La lectura y escritura académicas en la universidad escasamente han sido atendidas como materia y contenido de enseñanza por los profesores. Se asume tácitamente que los alumnos han adquirido, durante su formación en los niveles y grados escolares previos, las competencias suficientes para desempeñarse como lectores y escritores especializados en las temáticas del estudio disciplinario. Sin embargo, los escritos de los estudiantes muestran un panorama poco optimista respecto a las competencias que han adquirido y desarrollado. Ante esta necesidad, y a partir de algunas dificultades específicas de escritura identificadas en las versiones de un capítulo de tesis de estudiantes del 8o semestre de la Licenciatura en Educación de Adultos (UPN, se emprendió una intervención didáctica para orientar la escritura académica. Tales fueron los objetivos de investigación e intervención que se atendieron y de los cuales trataremos en el presente artículo. Al final, descubrimos que la escritura académica guiada puede dar lugar a versiones del desempeño académico y sus expresiones disciplinarias cada vez más logradas y exitosas.

  18. Rendimiento académico de estudiantes del Programa Nacional Beca 18 en la Universidad Continental

    Directory of Open Access Journals (Sweden)

    Oscar Navarro Ramos

    2015-06-01

    Full Text Available El objetivo fue identificar el rendimiento académico de los estudiantes becarios del Programa Nacional Beca 18 y comparar con los resultados de los estudiantes de la modalidad regular de la Universidad Continental en el periodo 2014 – II. La investigación tuvo un diseño descriptivo transversal. Los estudiantes objeto de estudio estuvieron conformados por un grupo de estudiantes becados y otro de estudiantes no becados que iniciaron sus estudios del primer ciclo en el semestre 2014-II. Los estudiantes becados han compartido con los estudiantes no becados o regulares las diversas actividades académicas, desarrollando siete asignaturas con los mismos docentes, infraestructura, recursos educacionales, y siendo tratados bajo las mismas condiciones. Entre los hallazgos de este estudio se tiene que los 5 mejores estudiantes del primer ciclo en once carreras profesionales, 3 fueron de la modalidad regular y 2 del programa Beca 18; entre los 10 mejores estudiantes, 4 fueron de la modalidad regular y 6 del programa Beca 18. Algunas conclusiones indican que se ha observado en el primer grupo de estudiantes del programa Beca 18 -aquellos que iniciaron sus estudios en Arquitectura y diez carreras de Ingeniería- que lograron un alto rendimiento académico y demostraron mayor esfuerzo por su aprendizaje, obteniendo buenas calificaciones en la Universidad Continental, un factor sería las actividades de los tutores de Beca 18 que contribuye positivamente en los resultados académicos.

  19. Nivel de pensamiento, rasgos de personalidad y promedios académicos en estudiantes universitarios

    Directory of Open Access Journals (Sweden)

    Elda Cerchiaro

    2013-10-01

    Full Text Available El presente artículo recoge los aspectos más destacados de la investigación desarrollada en el año 2004 en la Universidad del Magdalena, centrada en establecer la relación entre nivel de pensamiento, rasgos de personalidad y promedios académicos en estudiantes universitarios. Los resultados arrojados por este estudio nos permitieron aproximarnos a una caracterización de los estudiantes de la Universidad del Magdalena en relación con el nivel de pensamiento que poseen, asociado a unos rasgos o factores de personalidad que, de alguna forma, se relacionan con altos promedios académicos, llevándonos a establecer tendencias por programas académicos, fundamentales para construir estrategias de intervención cognitiva muy acordes con las necesidades detecta-das. Así mismo, estos hallazgos ofrecen una oportunidad para revisar el verdadero sentido del rendimiento académico como expresión de las competencias que el estudiante ha desarrollado a través de su proceso formativo. (Duazary; 2006: 80-88

  20. Implicación familiar, autoconcepto del adolescente y rendimiento académico

    Directory of Open Access Journals (Sweden)

    Ana Álvarez

    2015-12-01

    Full Text Available El objetivo de este trabajo fue analizar la relación específica entre las diferentes formas de implicación familiar, las dimensiones del autoconcepto del estudiante y su rendimiento académico. En el estudio han participado 503 estudiantes de la Enseñanza Secundaria Obligatoria (ESO y el primer curso de Bachillerato. Los datos fueron recogidos a través de dos inventarios (Cuestionario de Implicación Familiar –CIF-, Escala de Evaluación del Autoconcepto -ESEA-2 y las calificaciones académicas. Los datos fueron analizados mediante análisis multivariados de la varianza y a través de análisis de senderos. Los resultados mostraron relación significativa entre las dimensiones de la implicación familiar percibida y las dimensiones del autoconcepto, excepto el reforzamiento de logro. Por otra parte, la relación entre implicación familiar percibida y rendimiento académico es mediada parcialmente por el autoconcepto académico.

  1. Genetic variation in the Cytb gene of human cerebral Taenia solium cysticerci recovered from clinically and radiologically heterogeneous patients with neurocysticercosis

    Directory of Open Access Journals (Sweden)

    Hector Palafox-Fonseca

    2013-11-01

    Full Text Available Neurocysticercosis (NC is a clinically and radiologically heterogeneous parasitic disease caused by the establishment of larval Taenia solium in the human central nervous system. Host and/or parasite variations may be related to this observed heterogeneity. Genetic differences between pig and human-derived T. solium cysticerci have been reported previously. In this study, 28 cysticerci were surgically removed from 12 human NC patients, the mitochondrial gene that encodes cytochrome b was amplified from the cysticerci and genetic variations that may be related to NC heterogeneity were characterised. Nine different haplotypes (Ht, which were clustered in four haplogroups (Hg, were identified. Hg 3 and 4 exhibited a tendency to associate with age and gender, respectively. However, no significant associations were found between NC heterogeneity and the different T. solium cysticerci Ht or Hg. Parasite variants obtained from patients with similar NC clinical or radiological features were genetically closer than those found in groups of patients with a different NC profile when using the Mantel test. Overall, this study establishes the presence of genetic differences in the Cytb gene of T. solium isolated from human cysticerci and suggests that parasite variation could contribute to NC heterogeneity.

  2. Genetic variation in the Cytb gene of human cerebral Taenia solium cysticerci recovered from clinically and radiologically heterogeneous patients with neurocysticercosis

    Science.gov (United States)

    Palafox-Fonseca, Héctor; Zúñiga, Gerardo; Bobes, Raúl José; Govezensky, Tzipe; Piñero, Daniel; Texco-Martínez, Laura; Fleury, Agnès; Proaño, Jefferson; Cárdenas, Graciela; Hernández, Marisela; Sciutto, Edda; Fragoso, Gladis

    2013-01-01

    Neurocysticercosis (NC) is a clinically and radiologically heterogeneous parasitic disease caused by the establishment of larval Taenia solium in the human central nervous system. Host and/or parasite variations may be related to this observed heterogeneity. Genetic differences between pig and human-derived T. solium cysticerci have been reported previously. In this study, 28 cysticerci were surgically removed from 12 human NC patients, the mitochondrial gene that encodes cytochrome b was amplified from the cysticerci and genetic variations that may be related to NC heterogeneity were characterised. Nine different haplotypes (Ht), which were clustered in four haplogroups (Hg), were identified. Hg 3 and 4 exhibited a tendency to associate with age and gender, respectively. However, no significant associations were found between NC heterogeneity and the different T. solium cysticerci Ht or Hg. Parasite variants obtained from patients with similar NC clinical or radiological features were genetically closer than those found in groups of patients with a different NC profile when using the Mantel test. Overall, this study establishes the presence of genetic differences in the Cytb gene of T. solium isolated from human cysticerci and suggests that parasite variation could contribute to NC heterogeneity. PMID:24271046

  3. Sequence variation in the melanocortin-1 receptor (MC1R pigmentation gene and its role in the cryptic coloration of two South American sand lizards

    Directory of Open Access Journals (Sweden)

    Josmael Corso

    2012-01-01

    Full Text Available In reptiles, dorsal body darkness often varies with substrate color or temperature environment, and is generally presumed to be an adaptation for crypsis or thermoregulation. However, the genetic basis of pigmentation is poorly known in this group. In this study we analyzed the coding region of the melanocortin-1-receptor (MC1R gene, and therefore its role underlying the dorsal color variation in two sympatric species of sand lizards (Liolaemus that inhabit the southeastern coast of South America: L. occipitalis and L. arambarensis. The first is light-colored and occupies aeolic pale sand dunes, while the second is brownish and lives in a darker sandy habitat. We sequenced 630 base pairs of MC1R in both species. In total, 12 nucleotide polymorphisms were observed, and four amino acid replacement sites, but none of them could be associated with a color pattern. Comparative analysis indicated that these taxa are monomorphic for amino acid sites that were previously identified as functionally important in other reptiles. Thus, our results indicate that MC1R is not involved in the pigmentation pattern observed in Liolaemus lizards. Therefore, structural differences in other genes, such as ASIP, or variation in regulatory regions of MC1R may be responsible for this variation. Alternatively, the phenotypic differences observed might be a consequence of non-genetic factors, such as thermoregulatory mechanisms.

  4. Genetic variation in the Cytb gene of human cerebral Taenia solium cysticerci recovered from clinically and radiologically heterogeneous patients with neurocysticercosis.

    Science.gov (United States)

    Palafox-Fonseca, Héctor; Zúñiga, Gerardo; Bobes, Raúl José; Govezensky, Tzipe; Piñero, Daniel; Texco-Martínez, Laura; Fleury, Agnès; Proaño, Jefferson; Cárdenas, Graciela; Hernández, Marisela; Sciutto, Edda; Fragoso, Gladis

    2013-11-01

    Neurocysticercosis (NC) is a clinically and radiologically heterogeneous parasitic disease caused by the establishment of larval Taenia solium in the human central nervous system. Host and/or parasite variations may be related to this observed heterogeneity. Genetic differences between pig and human-derived T. solium cysticerci have been reported previously. In this study, 28 cysticerci were surgically removed from 12 human NC patients, the mitochondrial gene that encodes cytochrome b was amplified from the cysticerci and genetic variations that may be related to NC heterogeneity were characterised. Nine different haplotypes (Ht), which were clustered in four haplogroups (Hg), were identified. Hg 3 and 4 exhibited a tendency to associate with age and gender, respectively. However, no significant associations were found between NC heterogeneity and the different T. solium cysticerci Ht or Hg. Parasite variants obtained from patients with similar NC clinical or radiological features were genetically closer than those found in groups of patients with a different NC profile when using the Mantel test. Overall, this study establishes the presence of genetic differences in the Cytb gene of T. solium isolated from human cysticerci and suggests that parasite variation could contribute to NC heterogeneity.

  5. Multiplex Ligation-Dependent Probe Amplification Analysis of GATA4 Gene Copy Number Variations in Patients with Isolated Congenital Heart Disease

    Directory of Open Access Journals (Sweden)

    Valentina Guida

    2010-01-01

    Full Text Available GATA4 mutations are found in patients with different isolated congenital heart defects (CHDs, mostly cardiac septal defects and tetralogy of Fallot. In addition, GATA4 is supposed to be the responsible gene for the CHDs in the chromosomal 8p23 deletion syndrome, which is recognized as a malformation syndrome with clinical symptoms of facial anomalies, microcephaly, mental retardation, and congenital heart defects. Thus far, no study has been carried out to investigate the role of GATA4 copy number variations (CNVs in non-syndromic CHDs. To explore the possible occurrence of GATA4 gene CNVs in isolated CHDs, we analyzed by multiplex ligation-dependent probe amplification (MLPA a cohort of 161 non-syndromic patients with cardiac anomalies previously associated with GATA4 gene mutations. The patients were mutation-negative for GATA4, NKX2.5, and FOG2 genes after screening with denaturing high performance liquid chromatography. MLPA analysis revealed that normalized MLPA signals were all found within the normal range values for all exons in all patients, excluding a major contribution of GATA4 gene CNVs in CHD pathogenesis.

  6. Variation in genes related to obesity, weight and weight change and risk of contralateral breast cancer in the WECARE Study population

    Science.gov (United States)

    Brooks, Jennifer D.; Bernstein, Leslie; Teraoka, Sharon N.; Knight, Julia A.; Mellemkjær, Lene; John, Esther M.; Malone, Kathleen E.; Reiner, Anne S.; Lynch, Charles F.; Concannon, Patrick; Haile, Robert W.; Bernstein, Jonine L

    2012-01-01

    Background Body mass index (BMI), a known breast cancer risk factor, could influence breast risk through mechanistic pathways related to sex hormones, insulin resistance, chronic inflammation and altered levels of adipose derived hormones. Results from studies of the relationship between BMI and second primary breast cancer have been mixed. To explore the relationship between BMI and asynchronous contralateral breast cancer (CBC), we examined whether variants in genes related to obesity, weight and weight change are associated with CBC risk. Methods Variants in twenty genes (182 single nucleotide polymorphisms) involved in adipose tissue metabolism, energy balance, insulin resistance and inflammation, as well as those identified through genome-wide association studies of BMI and type II diabetes were evaluated. We examined the association between variants in these genes and the risk of CBC among Caucasian participants (643 cases with CBC and 1,271 controls with unilateral breast cancer) in the population-based Women’s Environmental Cancer and Radiation Epidemiology (WECARE) Study using conditional logistic regression. Results After adjustment for multiple comparisons, no statistically significant associations between any variant and CBC risk were seen. Stratification by menopausal or estrogen receptor status did not alter these findings. Conclusion Among women with early onset disease who survive a first breast cancer diagnosis there was no association between variation in obesity-related genes and risk of CBC. Impact Genetic variants in genes related to obesity are not likely to strongly influence subsequent risk of developing a second primary breast cancer. PMID:23033454

  7. [Genetic variation and association of prostaglandin F2alpha receptor (PTGFR) gene with sow maternal behaviors in a White Duroc x Erhualian resource population].

    Science.gov (United States)

    Yang, Zhu-Qing; Ren, Jun; Zhang, Zhi-Yan; Chen, Cong-Ying

    2010-11-01

    Maternal behaviors of sows around parturition are important for survival of newborn offspring. Failure to establish normal maternal bonds such as maternal infanticide and crushing often occurs in some individuals. It causes both significant economic losses to the pig industry and severe problems of piglet welfare. Prostaglandin F2-alpha not only can stimulate the nest-building behavior of sows before parturition but also plays an important role in reproductive process and maternal behavior through protein FP encoded by the prostaglandin F receptor gene (PTGFR) as its receptor. In this study, genetic variation and association study of PTGFR gene with nest-building behavior, maternal infanticide, and crushing behavior was carried out in a White Duroc x Erhualian resource population. As a result, five synonymous mutations were identified on exon 1 and exon 2. Exon 1 g .250 A>G, Exon 1 g.619 G>A and Exon 2 g.483 T>C were chosen for genotyping in individuals of F0, F1 and 289 F2 sows. Family-based transmission disequilibrium test (TDT) demonstrated that there were no significant associations of 3 SNPs and haplotypes of PTGFR gene with sow nest-building, maternal infanticide and crushing behavior (P > 0.05). Therefore, it can be concluded that PTGFR gene is not the causative candidate gene for sow maternal behaviors. PMID:21513166

  8. Association between variations in the fat mass and obesity-associated gene and pancreatic cancer risk: a case–control study in Japan

    International Nuclear Information System (INIS)

    It is clear that genetic variations in the fat mass and obesity-associated (FTO) gene affect body mass index and the risk of obesity. Given the mounting evidence showing a positive association between obesity and pancreatic cancer, this study aimed to investigate the relation between variants in the FTO gene, obesity and pancreatic cancer risk. We conducted a hospital-based case–control study in Japan to investigate whether genetic variations in the FTO gene were associated with pancreatic cancer risk. We genotyped rs9939609 in the FTO gene of 360 cases and 400 control subjects. An unconditional logistic model was used to estimate the odds ratio (OR) and 95% confidence interval (CI) for the association between rs9939609 and pancreatic cancer risk. The minor allele frequency of rs9939609 was 0.18 among control subjects. BMI was not associated with pancreatic cancer risk. Compared with individuals with the common homozygous TT genotype, those with the heterozygous TA genotype and the minor homozygous AA genotype had a 48% (OR=1.48; 95%CI: 1.07–2.04), and 66% increased risk (OR=1.66; 95%CI: 0.70–3.90), respectively, of pancreatic cancer after adjustment for sex, age, body mass index, cigarette smoking and history of diabetes. The per-allele OR was 1.41 (95%CI: 1.07–1.85). There were no significant interactions between TA/AA genotypes and body mass index. Our findings indicate that rs9939609 in the FTO gene is associated with pancreatic cancer risk in Japanese subjects, possibly through a mechanism that is independent of obesity. Further investigation and replication of our results is required in other independent samples

  9. Germline DNA copy number variation in individuals with Argyrophilic grain disease reveals CTNS as a plausible candidate gene.

    Science.gov (United States)

    Villela, Darine; Kimura, Lilian; Schlesinger, David; Gonçalves, Amanda; Pearson, Peter L; Suemoto, Claudia K; Pasqualucci, Carlos; Krepischi, Ana Cristina; Grinberg, Lea T; Rosenberg, Carla

    2013-12-01

    Argyrophilic grain disease (AGD) is a progressive neurodegenerative disease of the human brain that has never been associated to a particular gene locus. In the present study, we report the results of a CNV investigation in 29 individuals whose anatomopathologic investigation of the brain showed AGD. Rare CNVs were identified in six patients (21%), in particular a 40 kb deletion at 17p13.2 encompassing the CTNS gene. Homozygote mutations in CTNS are known to cause cystinosis, a disorder characterized by the intralysosomal accumulation of cystine in all tissues. We present the first CNV results in individuals presenting AGD and a possible candidate gene implicated in the disorder. PMID:24385851

  10. Germline DNA copy number variation in individuals with Argyrophilic grain disease reveals CTNS as a plausible candidate gene

    Directory of Open Access Journals (Sweden)

    Darine Villela

    2013-01-01

    Full Text Available Argyrophilic grain disease (AGD is a progressive neurodegenerative disease of the human brain that has never been associated to a particular gene locus. In the present study, we report the results of a CNV investigation in 29 individuals whose anatomopathologic investigation of the brain showed AGD. Rare CNVs were identified in six patients (21%, in particular a 40 kb deletion at 17p13.2 encompassing the CTNS gene. Homozygote mutations in CTNS are known to cause cystinosis, a disorder characterized by the intralysosomal accumulation of cystine in all tissues. We present the first CNV results in individuals presenting AGD and a possible candidate gene implicated in the disorder.

  11. A nine-nucleotide deletion and splice variation in the coding region of the interferon induced ISG12 gene

    DEFF Research Database (Denmark)

    Smidt, Kamille; Hansen, Lise Lotte; Søgaard, T Max M;

    2003-01-01

    Interferons (IFNs) are a family of cytokines with growth inhibitory, and antiviral functions. IFNs exert their biological actions through the expression of more than 1000 IFN stimulated genes, ISGs. ISG12 is an IFN type I induced gene encoding a protein of Mr 12,000. We have identified a novel, IFN...... distributed between ISG12 and ISG12-S in breast carcinoma cells, in cancer cell lines and in cervical cytobrush material with neoplastic lesions. In addition, we have found a nine-nucleotide deletion situated in exon 4 of the ISG12 gene. This deletion leads to a three-amino-acid deletion (AMA) in the putative...

  12. The Effect of Genetic Variation of the Retinoic Acid Receptor-Related Orphan Receptor C Gene on Fatness in Cattle

    OpenAIRE

    Barendse, W.; Bunch, R. J.; Kijas, J. W.; M. B. Thomas

    2007-01-01

    Genotypes at the retinoic acid receptor-related orphan receptor C (RORC) gene were associated with fatness in 1750 cattle. Ten SNPs were genotyped in RORC and the adjacent gene leucine-rich repeat neuronal 6D (LRRN6D) to map the QTL, 7 of which are in a 4.2-kb sequence around the ligand-binding domain of the RORC gene. Of the 29 inferred haplotypes for these SNPs, 2 have a combined frequency of 54.6% while the top 5 haplotypes have a combined frequency of 85.3%. The average D′ value of linkag...

  13. Selection for phase variation of LOS biosynthetic genes frequently occurs in progression of non-typeable Haemophilus influenzae infection from the nasopharynx to the middle ear of human patients.

    Directory of Open Access Journals (Sweden)

    Kate L Fox

    Full Text Available Surface structures in Haemophilus influenzae are subject to rapid ON/OFF switching of expression, a process termed phase variation. We analyse tetranucleotide repeats controlling phase variation in lipo-oligosaccharide (LOS genes of H. influenzae in paired isolates from both the nasopharynx and middle ears of paediatric patients with chronic or recurrent otitis media. A change in expression of at least one of the seven phase variable LOS biosynthesis genes was seen in 12 of the 21 strain pairs. Several strains showed switching of expression in multiple LOS genes, consistent with a key role for phase variable LOS biosynthetic genes in human infection.

  14. Variation suggestive of horizontal gene transfer at a lipopolysaccharide (lps biosynthetic locus in Xanthomonas oryzae pv. oryzae, the bacterial leaf blight pathogen of rice

    Directory of Open Access Journals (Sweden)

    Sonti Ramesh V

    2004-10-01

    Full Text Available Abstract Background In animal pathogenic bacteria, horizontal gene transfer events (HGT have been frequently observed in genomic regions that encode functions involved in biosynthesis of the outer membrane located lipopolysaccharide (LPS. As a result, different strains of the same pathogen can have substantially different lps biosynthetic gene clusters. Since LPS is highly antigenic, the variation at lps loci is attributed to be of advantage in evading the host immune system. Although LPS has been suggested as a potentiator of plant defense responses, interstrain variation at lps biosynthetic gene clusters has not been reported for any plant pathogenic bacterium. Results We report here the complete sequence of a 12.2 kb virulence locus of Xanthomonas oryzae pv. oryzae (Xoo encoding six genes whose products are homologous to functions involved in LPS biosynthesis and transport. All six open reading frames (ORFs have atypical G+C content and altered codon usage, which are the hallmarks of genomic islands that are acquired by horizontal gene transfer. The lps locus is flanked by highly conserved genes, metB and etfA, respectively encoding cystathionine gamma lyase and electron transport flavoprotein. Interestingly, two different sets of lps genes are present at this locus in the plant pathogens, Xanthomonas campestris pv. campestris (Xcc and Xanthomonas axonopodis pv. citri (Xac. The genomic island is present in a number of Xoo strains from India and other Asian countries but is not present in two strains, one from India (BXO8 and another from Nepal (Nepal624 as well as the closely related rice pathogen, Xanthomonas oryzae pv. oryzicola (Xoor. TAIL-PCR analysis indicates that sequences related to Xac are present at the lps locus in both BXO8 and Nepal624. The Xoor strain has a hybrid lps gene cluster, with sequences at the metB and etfA ends, being most closely related to sequences from Xac and the tomato pathogen, Pseudomonas syringae pv. tomato

  15. Factores que favorecen el desarrollo de una actitud positiva hacia las actividades académicas

    Directory of Open Access Journals (Sweden)

    María Luisa Naranjo Pereira

    2010-01-01

    Full Text Available Este artículo presenta una investigación de tipo descriptivo, cuyo objetivo es analizar los factores personales que favorecen el desarrollo de una actitud positiva hacia las actividades académicas, de acuerdo con la opinión de dos grupos de estudiantes de décimo año. Ella está constituida por un constructo principal: la actitud positiva hacia las actividades académicas, y un subconstructo: los factores personales que favorecen esas actitudes. Los aspectos que integran este subconstructo son la autoestima positiva, la motivación, la comunicación asertiva y el manejo del estrés. La introducción y el referente teórico evidencian la relación que existe entre estos factores, las actitudes hacia el aprendizaje y los logros académicos de la población estudiantil. De acuerdo con los resultados obtenidos, se concluye que la población estudiantil concede importancia tanto a factores internos como externos relacionados con la motivación, y los percibe como significativos para el desarrollo de actitudes positivas hacia las actividades académicas. De igual forma sucede con el hecho de poseer una autoestima positiva, saber comunicarse asertivamente y poder manejar el estrés de forma adecuada. Se recomienda, por lo tanto, que las instituciones educativas presten especial atención al desarrollo socio-emocional del estudiantado, mediante la realización de programas que favorezcan el logro de su motivación académica, un mejoramiento de su autoestima, la habilidad para comunicarse asertivamente y el afrontamiento apropiado del estrés.

  16. Riesgo familiar total en familias con escolares según rendimiento académico

    Directory of Open Access Journals (Sweden)

    CAROLINA LUCERO ENRÍQUEZ GUERRERO

    2009-12-01

    Full Text Available Este artículo presenta los resultados del estudio cuyo objetivo fue establecer las diferencias en el riesgo familiar entre dos grupos de familias: con niños escolares de alto rendimiento y niños de bajo rendimiento académico en un centro educativo distrital de Bogotá. Metodología: estudio descriptivo comparativo transversal con un componente analítico y abordaje cuantitativo; la muestra fue de 186 familias, durante abril a julio de 2007. Los resultados muestran predominio de familias nucleares en ambos grupos (65%, relación inversa entre el riesgo familiar total evaluado por el instrumento RFT 7-70 y el rendimiento académico del escolar de la familia, es decir que las familias que registraron riesgo alto (9% y medio (31% en mayor proporción son familias con escolares de bajo rendimiento académico, frente al predominio del riesgo familiar bajo (78% en las familias con niños de alto rendimiento. Se aplicó t de student para diferencia de medias y se encontró asociación (P = 0,02 entre el riesgo familiar total alto y el bajo rendimiento académico del escolar. En conclusión, estos resultados sugieren principalmente que se deben priorizar los factores de riesgo que determinan mayor riesgo familiar en familias con escolares de bajo rendimiento académico y dar atención de salud integral con enfoque familiar e intersectorial, y participación activa de la comunidad. Continuar investigando en posibles asociaciones entre salud individual, prácticas de salud, educación, ambiente socioeconómico y psicoafectivo de la familia y el logro educativo de escolares en familias con niños en edad escolar.

  17. Variations in Adipokine Genes AdipoQ, Lep, and LepR Are Associated with Risk for Obesity-Related Metabolic Disease: The Modulatory Role of Gene-Nutrient Interactions

    Directory of Open Access Journals (Sweden)

    Jennifer Emily Enns

    2011-01-01

    Full Text Available Obesity rates are rapidly increasing worldwide and facilitate the development of many related disease states, such as cardiovascular disease, the metabolic syndrome, type 2 diabetes mellitus, and various types of cancer. Variation in metabolically important genes can have a great impact on a population's susceptibility to becoming obese and/or developing related complications. The adipokines adiponectin and leptin, as well as the leptin receptor, are major players in the regulation of body energy homeostasis and fat storage. This paper summarizes the findings of single nucleotide polymorphisms in these three genes and their effect on obesity and metabolic disease risk. Additionally, studies of gene-nutrient interactions involving adiponectin, leptin, and the leptin receptor are highlighted to emphasize the critical role of diet in susceptible populations.

  18. Variations in Adipokine Genes AdipoQ, Lep, and LepR are Associated with Risk for Obesity-Related Metabolic Disease: The Modulatory Role of Gene-Nutrient Interactions

    Science.gov (United States)

    Enns, Jennifer Emily; Taylor, Carla G.; Zahradka, Peter

    2011-01-01

    Obesity rates are rapidly increasing worldwide and facilitate the development of many related disease states, such as cardiovascular disease, the metabolic syndrome, type 2 diabetes mellitus, and various types of cancer. Variation in metabolically important genes can have a great impact on a population's susceptibility to becoming obese and/or developing related complications. The adipokines adiponectin and leptin, as well as the leptin receptor, are major players in the regulation of body energy homeostasis and fat storage. This paper summarizes the findings of single nucleotide polymorphisms in these three genes and their effect on obesity and metabolic disease risk. Additionally, studies of gene-nutrient interactions involving adiponectin, leptin, and the leptin receptor are highlighted to emphasize the critical role of diet in susceptible populations. PMID:21773001

  19. Germline DNA copy number variation in individuals with Argyrophilic grain disease reveals CTNS as a plausible candidate gene

    OpenAIRE

    Darine Villela; Lilian Kimura; David Schlesinger; Amanda Gonçalves; Pearson, Peter L; Suemoto, Claudia K.; Carlos Pasqualucci; Ana Cristina Krepischi; Lea T. Grinbergand; Carla Rosenberg

    2013-01-01

    Argyrophilic grain disease (AGD) is a progressive neurodegenerative disease of the human brain that has never been associated to a particular gene locus. In the present study, we report the results of a CNV investigation in 29 individuals whose anatomopathologic investigation of the brain showed AGD. Rare CNVs were identified in six patients (21%), in particular a 40 kb deletion at 17p13.2 encompassing the CTNS gene. Homozygote mutations in CTNS are known to cause cystinosis, a disorder chara...

  20. A tandem segmental duplication (TSD) in the green revolution gene Rht-D1b region underlies plant height variation

    Science.gov (United States)

    Semi-dwarfing genes Rht-B1b (Rht1) and Rht-D1b (Rht2), known as the “Green revolution” genes, have made a significant contribution to wheat production worldwide. Rht-D1c (Rht10) carried by Chinese wheat line Aibian 1 is an allele at the Rht-D1 locus. It has the strongest effect among all dwarfing...

  1. Genetic variation in angiotensin-converting enzyme 2 gene is associated with extent of left ventricular hypertrophy in hypertrophic cardiomyopathy

    OpenAIRE

    van der Merwe, Lize; Cloete, Ruben; Revera, Miriam; Heradien, Marshall; Goosen, Althea; Corfield, Valerie A.; Paul A Brink; Moolman-Smook, Johanna C

    2008-01-01

    Hypertrophic cardiomyopathy, a common, inherited cardiac muscle disease, is primarily caused by mutations in sarcomeric protein-encoding genes and is characterized by overgrowth of ventricular muscle that is highly variable in extent and location. This variability has been partially attributed to locus and allelic heterogeneity of the disease-causing gene, but other factors, including unknown genetic factors, also modulate the extent of hypertrophy that develops in response to the defective s...

  2. Comparative genomics of bacteria from the genus Collimonas: linking (dis)similarities in gene content to phenotypic variation and conservation.

    Science.gov (United States)

    Mela, F; Fritsche, K; de Boer, W; van den Berg, M; van Veen, J A; Maharaj, N N; Leveau, J H J

    2012-08-01

    Collimonas is a genus of soil bacteria comprising three recognized species: C. fungivorans, C. pratensis and C. arenae. Collimonads share the ability to degrade chitin (chitinolysis), feed on living fungal hyphae (mycophagy), and dissolve minerals (weathering), but vary in their inhibition of fungi (fungistasis). To better understand this phenotypic variability, we analysed the genomic content of four strains representing three Collimonas species (Ter14, Ter6, Ter91 and Ter10) by hybridization to a microarray based on reference strain C. fungivorans Ter331. The analysis revealed genes unique to strain Ter331 (e.g. those on the extrachromosomal element pTer331) and genes present in some but not all of the tested strains. Among the latter were several candidates that may contribute to fungistasis, including genes for the production and secretion of antifungals. We hypothesize that differential possession of these genes underlies the specialization of Collimonas strains towards different fungal hosts. We identified a set of 136 genes that were common in all tested Collimonas strains, but absent from the genomes of three other members of the family Oxalobacteraceae. Predicted products of these 'Collimonas core' genes include lytic, secreted enzymes such as chitinases, peptidases, nucleases and phosphatases with a putative role in mycophagy and weathering. PMID:23760828

  3. Phylogeny and mitochondrial gene order variation in Lophotrochozoa in the light of new mitogenomic data from Nemertea

    Directory of Open Access Journals (Sweden)

    von Döhren Jörn

    2009-08-01

    Full Text Available Abstract Background The new animal phylogeny established several taxa which were not identified by morphological analyses, most prominently the Ecdysozoa (arthropods, roundworms, priapulids and others and Lophotrochozoa (molluscs, annelids, brachiopods and others. Lophotrochozoan interrelationships are under discussion, e.g. regarding the position of Nemertea (ribbon worms, which were discussed to be sister group to e.g. Mollusca, Brachiozoa or Platyhelminthes. Mitochondrial genomes contributed well with sequence data and gene order characters to the deep metazoan phylogeny debate. Results In this study we present the first complete mitochondrial genome record for a member of the Nemertea, Lineus viridis. Except two trnP and trnT, all genes are located on the same strand. While gene order is most similar to that of the brachiopod Terebratulina retusa, sequence based analyses of mitochondrial genes place nemerteans close to molluscs, phoronids and entoprocts without clear preference for one of these taxa as sister group. Conclusion Almost all recent analyses with large datasets show good support for a taxon comprising Annelida, Mollusca, Brachiopoda, Phoronida and Nemertea. But the relationships among these taxa vary between different studies. The analysis of gene order differences gives evidence for a multiple independent occurrence of a large inversion in the mitochondrial genome of Lophotrochozoa and a re-inversion of the same part in gastropods. We hypothesize that some regions of the genome have a higher chance for intramolecular recombination than others and gene order data have to be analysed carefully to detect convergent rearrangement events.

  4. Genetic variations in the CLU and PICALM genes are associated with cognitive function in the oldest old

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Christensen, Kaare; McGue, Matt;

    2011-01-01

    measures of Mini Mental State Examination (MMSE) and a cognitive composite score. We found a significant association between the highly frequent CLU rs11136000 T allele (38%) and better performance on the cognitive composite score (p = 0.016) explaining 0.5% of the mean variation in cognitive composite...... score, and for men a significant association between the highly frequent PICALM rs3851179 A allele (38%). Better performance was found (p = 0.024), explaining 1.4% of the mean variation in cognitive composite score in men. These alleles correspond to the minor alleles initially found more frequent...

  5. Allelic Variation in the Perennial Ryegrass FLOWERING LOCUS T Gene is Associated with Changes in Flowering Time across a Range of Populations

    DEFF Research Database (Denmark)

    Skøt, Leif; Sanderson, Ruth; Thomas, Ann;

    2011-01-01

    The Arabidopsis (Arabidopsis thaliana) FLOWERING LOCUS T (FT) gene and its orthologs in other plant species (e.g. rice [Oryza sativa] OsFTL2/Hd3a) have an established role in the photoperiodic induction of flowering response. The genomic and phenotypic variations associated with the perennial...... ryegrass (Lolium perenne) ortholog of FT, designated LpFT3, was assessed in a diverse collection of nine European germplasm populations, which together constituted an association panel of 864 plants. Sequencing and genotyping of a series of amplicons derived from the nine populations, containing the...... complete exon and intron sequences as well as 5' and 3' noncoding sequences of LpFT3, identified a total of seven haplotypes. Genotyping assays designed to detect the genomic variation showed that three haplotypes were present in approximately equal proportions and represented 84% of the total, with a...

  6. Variation in TREK1 gene linked to depression-resistant phenotype is associated with potentiated neural responses to rewards in humans

    Science.gov (United States)

    Dillon, Daniel G.; Bogdan, Ryan; Fagerness, Jesen; Holmes, Avram J.; Perlis, Roy H.; Pizzagalli, Diego A.

    2010-01-01

    The TREK1 gene has been linked to a depression-resistant phenotype in rodents and antidepressant response in humans, but the neural mechanisms underlying these links are unclear. Because TREK1 is expressed in reward-related basal ganglia regions, it has been hypothesized that TREK1 genetic variation may be associated with anhedonic symptoms of depression. To investigate whether TREK1 genetic variation influences reward processing, we genotyped healthy individuals (n = 31) who completed a monetary incentive delay task during functional magnetic resonance imaging (fMRI). Three genotypes previously linked to positive antidepressant response were associated with potentiated basal ganglia activity to gains, but did not influence responses to penalties or no change feedback. TREK1 genetic variations did not affect basal ganglia volume, and fMRI group differences were confirmed when accounting for self-report measures of anhedonia. In addition, the total number of “protective” TREK1 alleles was associated with stronger responses to gains in several other reward-related regions, including the dorsal anterior cingulate cortex, orbitofrontal cortex, and mesial prefrontal cortex. In control analyses, associations between basal ganglia responses to gains and functional polymorphisms in the dopamine transporter (DAT1) and catechol-O-methyltransferase (COMT) genes were also explored. Results revealed that TREK1 and DAT/COMT genotypes were independently related to basal ganglia responses to gains. These findings indicate that TREK1 genotypes are associated with individual differences in reward-related brain activity. Future studies in depressed samples should evaluate whether variation in neural responses to rewards may contribute to the association between TREK1 and antidepressant response in humans. PMID:19621370

  7. Allelic variations of a light harvesting chlorophyll a/b-binding protein gene (Lhcb1 associated with agronomic traits in barley.

    Directory of Open Access Journals (Sweden)

    Yanshi Xia

    Full Text Available Light-harvesting chlorophyll a/b-binding protein (LHCP is one of the most abundant chloroplast proteins in plants. Its main function is to collect and transfer light energy to photosynthetic reaction centers. However, the roles of different LHCPs in light-harvesting antenna systems remain obscure. Exploration of nucleotide variation in the genes encoding LHCP can facilitate a better understanding of the functions of LHCP. In this study, nucleotide variations in Lhcb1, a LHCP gene in barley, were investigated across 292 barley accessions collected from 35 different countries using EcoTILLING technology, a variation of the Targeting Induced Local Lesions In Genomes (TILLING. A total of 23 nucleotide variations were detected