WorldWideScience

Sample records for acads gene variation

  1. Variations in IBD (ACAD8) in children with elevated C-4-carnitine detected by tandem mass spectrometry newborn screening

    NARCIS (Netherlands)

    C.B. Pedersen; C. Bischoff; E. Christensen; H. Simonsen; A.M. Lund; S.P. Young; D.D. Koeberl; D.S. Millington; C.R. Roe; D.S. Roe; R.J.A. Wanders; J.P.N. Ruiter; L.D. Keppen; Q. Stein; I. Knudsen; N. Gregersen; B.S. Andresen

    2006-01-01

    The isobutyryl-CoA dehydrogenase (IBD) enzyme is involved in the degradation of valine. IBD deficiency was first reported in 1998 and subsequent genetic investigations identified acyl-CoA dehydrogenase (ACAD) 8, now IBD, as the gene responsible for IBD deficiency. Only three individuals homozygous o

  2. Variations in IBD (ACAD8) in children with elevated C4-carnitine detected by tandem mass spectrometry newborn screening

    DEFF Research Database (Denmark)

    Pedersen, Christina B; Bischoff, Claus; Christensen, Ernst;

    2006-01-01

    or compound heterozygous for variations in the IBD gene have been reported. We present IBD deficiency in an additional four newborns with elevated C(4)-carnitine identified by tandem mass spectrometry (MS/MS) screening in Denmark and the United States. Three showed urinary excretions of isobutyryl......-glycine, and in vitro probe analysis of fibroblasts from two newborns indicated enzymatic IBD defect. Molecular genetic analysis revealed seven new rare variations in the IBD gene (c.348C>A, c.400G>T, c.409G>A, c.455T>C, c.958G>A, c.1000C>T and c.1154G>A). Furthermore, sequence analysis of the short-chain acyl...

  3. Parkinson's disease and mitochondrial gene variations

    DEFF Research Database (Denmark)

    Andalib, Sasan; Vafaee, Manouchehr Seyedi; Gjedde, Albert

    2014-01-01

    Parkinson's disease (PD) is a common disorder of the central nervous system in the elderly. The pathogenesis of PD is a complex process, with genetics as an important contributing factor. This factor may stem from mitochondrial gene variations and mutations as well as from nuclear gene variations...... and mutations. More recently, a particular role of mitochondrial dysfunction has been suggested, arising from mitochondrial DNA variations or acquired mutations in PD pathogenesis. The present review summarizes and weighs the evidence in support of mitochondrial DNA (mtDNA) variations as important contributors...

  4. Genetic variation in genes affecting milk composition and quality

    DEFF Research Database (Denmark)

    Bertelsen, Henriette Pasgaard

    In the past decade major advances in next generation sequencing technologies have provided new opportuneties for the detection of genetic variation. Combining the knowlegde of genetic variation with phenotypic distributions provides considerable possibilites for detection of candidate genes....... In addition, exploring genetic variation related to the major milk proteins of bovine milk indntified genetic variations with possitive effects on milk coagulation...

  5. académico

    Directory of Open Access Journals (Sweden)

    Josefina Quintero Corzo

    2006-01-01

    Full Text Available Este artículo somete a discusión algunas ideas sobre reforma curricular universitaria surgidas de la crítica al discurso teórico y empírico que caracteriza los esquemas tradicionales. Se demuestra que la manera como se ha venido implementando, no satisface las políticas institucionales de cambio y mejoramiento académico. Se analiza el vínculo entre currículo e investigaci ón y su importancia para el proceso de reforma y mejoramiento académico.

  6. Genomic variation in Salmonella enterica core genes for epidemiological typing

    Directory of Open Access Journals (Sweden)

    Leekitcharoenphon Pimlapas

    2012-03-01

    Full Text Available Abstract Background Technological advances in high throughput genome sequencing are making whole genome sequencing (WGS available as a routine tool for bacterial typing. Standardized procedures for identification of relevant genes and of variation are needed to enable comparison between studies and over time. The core genes--the genes that are conserved in all (or most members of a genus or species--are potentially good candidates for investigating genomic variation in phylogeny and epidemiology. Results We identify a set of 2,882 core genes clusters based on 73 publicly available Salmonella enterica genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher confidence. The core genes can be divided into two categories: a few highly variable genes and a larger set of conserved core genes, with low variance. For the most variable core genes, the variance in amino acid sequences is higher than for the corresponding nucleotide sequences, suggesting that there is a positive selection towards mutations leading to amino acid changes. Conclusions Genomic variation within the core genome is useful for investigating molecular evolution and providing candidate genes for bacterial genome typing. Identification of genes with different degrees of variation is important especially in trend analysis.

  7. Population genetic variation in gene expression is associated withphenotypic variation in Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Fay, Justin C.; McCullough, Heather L.; Sniegowski, Paul D.; Eisen, Michael B.

    2004-02-25

    The relationship between genetic variation in gene expression and phenotypic variation observable in nature is not well understood. Identifying how many phenotypes are associated with differences in gene expression and how many gene-expression differences are associated with a phenotype is important to understanding the molecular basis and evolution of complex traits. Results: We compared levels of gene expression among nine natural isolates of Saccharomyces cerevisiae grown either in the presence or absence of copper sulfate. Of the nine strains, two show a reduced growth rate and two others are rust colored in the presence of copper sulfate. We identified 633 genes that show significant differences in expression among strains. Of these genes,20 were correlated with resistance to copper sulfate and 24 were correlated with rust coloration. The function of these genes in combination with their expression pattern suggests the presence of both correlative and causative expression differences. But the majority of differentially expressed genes were not correlated with either phenotype and showed the same expression pattern both in the presence and absence of copper sulfate. To determine whether these expression differences may contribute to phenotypic variation under other environmental conditions, we examined one phenotype, freeze tolerance, predicted by the differential expression of the aquaporin gene AQY2. We found freeze tolerance is associated with the expression of AQY2. Conclusions: Gene expression differences provide substantial insight into the molecular basis of naturally occurring traits and can be used to predict environment dependent phenotypic variation.

  8. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  9. Plagio Académico

    OpenAIRE

    Campos, Rosalynn

    2015-01-01

    Concepto y ejemplo de plagio académico. Normas APA. Tratamiento de la información. Recurso educativo digital, en forma de Objeto de Aprendizaje. Diseñado para la difusión del plagio académico, sus consecuencias y cómo evitarlo. La estructura del diseño instruccional está dirigido al estilo de aprendizaje activo; aun así se puede aplicar en cualquier espacio académico.

  10. Epigenetic variation in the Egfr gene generates quantitative variation in a complex trait in ants.

    Science.gov (United States)

    Alvarado, Sebastian; Rajakumar, Rajendhran; Abouheif, Ehab; Szyf, Moshe

    2015-03-11

    Complex quantitative traits, like size and behaviour, are a pervasive feature of natural populations. Quantitative trait variation is the product of both genetic and environmental factors, yet little is known about the mechanisms through which their interaction generates this variation. Epigenetic processes, such as DNA methylation, can mediate gene-by-environment interactions during development to generate discrete phenotypic variation. We therefore investigated the developmental role of DNA methylation in generating continuous size variation of workers in an ant colony, a key trait associated with division of labour. Here we show that, in the carpenter ant Camponotus floridanus, global (genome-wide) DNA methylation indirectly regulates quantitative methylation of the conserved cell-signalling gene Epidermal growth factor receptor to generate continuous size variation of workers. DNA methylation can therefore generate quantitative variation in a complex trait by quantitatively regulating the transcription of a gene. This mechanism, alongside genetic variation, may determine the phenotypic possibilities of loci for generating quantitative trait variation in natural populations.

  11. Propagation of genetic variation in gene regulatory networks.

    Science.gov (United States)

    Plahte, Erik; Gjuvsland, Arne B; Omholt, Stig W

    2013-08-01

    A future quantitative genetics theory should link genetic variation to phenotypic variation in a causally cohesive way based on how genes actually work and interact. We provide a theoretical framework for predicting and understanding the manifestation of genetic variation in haploid and diploid regulatory networks with arbitrary feedback structures and intra-locus and inter-locus functional dependencies. Using results from network and graph theory, we define propagation functions describing how genetic variation in a locus is propagated through the network, and show how their derivatives are related to the network's feedback structure. Similarly, feedback functions describe the effect of genotypic variation of a locus on itself, either directly or mediated by the network. A simple sign rule relates the sign of the derivative of the feedback function of any locus to the feedback loops involving that particular locus. We show that the sign of the phenotypically manifested interaction between alleles at a diploid locus is equal to the sign of the dominant feedback loop involving that particular locus, in accordance with recent results for a single locus system. Our results provide tools by which one can use observable equilibrium concentrations of gene products to disclose structural properties of the network architecture. Our work is a step towards a theory capable of explaining the pleiotropy and epistasis features of genetic variation in complex regulatory networks as functions of regulatory anatomy and functional location of the genetic variation.

  12. Exploiting natural variation to identify insect-resistance genes.

    Science.gov (United States)

    Broekgaarden, Colette; Snoeren, Tjeerd A L; Dicke, Marcel; Vosman, Ben

    2011-10-01

    Herbivorous insects are widespread and often serious constraints to crop production. The use of insect-resistant crops is a very effective way to control insect pests in agriculture, and the development of such crops can be greatly enhanced by knowledge on plant resistance mechanisms and the genes involved. Plants have evolved diverse ways to cope with insect attack that has resulted in natural variation for resistance towards herbivorous insects. Studying the molecular genetics and transcriptional background of this variation has facilitated the identification of resistance genes and processes that lead to resistance against insects. With the development of new technologies, molecular studies are not restricted to model plants anymore. This review addresses the need to exploit natural variation in resistance towards insects to increase our knowledge on resistance mechanisms and the genes involved. We will discuss how this knowledge can be exploited in breeding programmes to provide sustainable crop protection against insect pests. Additionally, we discuss the current status of genetic research on insect-resistance genes. We conclude that insect-resistance mechanisms are still unclear at the molecular level and that exploiting natural variation with novel technologies will contribute greatly to the development of insect-resistant crop varieties.

  13. Genomic variation in Salmonella enterica core genes for epidemiological typing

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Lukjancenko, Oksana; Rundsten, Carsten Friis

    2012-01-01

    genomes and evaluate their value as typing targets, comparing whole genome typing and traditional methods such as 16S and MLST. A consensus tree based on variation of core genes gives much better resolution than 16S and MLST; the pan-genome family tree is similar to the consensus tree, but with higher...

  14. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    Science.gov (United States)

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

  15. Variation in the RAD51 gene and familial breast cancer

    Science.gov (United States)

    Lose, Felicity; Lovelock, Paul; Chenevix-Trench, Georgia; Mann, Graham J; Pupo, Gulietta M; Spurdle, Amanda B

    2006-01-01

    Introduction Human RAD51 is a homologue of the Escherichia coli RecA protein and is known to function in recombinational repair of double-stranded DNA breaks. Mutations in the lower eukaryotic homologues of RAD51 result in a deficiency in the repair of double-stranded DNA breaks. Loss of RAD51 function would therefore be expected to result in an elevated mutation rate, leading to accumulation of DNA damage and, hence, to increased cancer risk. RAD51 interacts directly or indirectly with a number of proteins implicated in breast cancer, such as BRCA1 and BRCA2. Similar to BRCA1 mice, RAD51-/- mice are embryonic lethal. The RAD51 gene region has been shown to exhibit loss of heterozygosity in breast tumours, and deregulated RAD51 expression in breast cancer patients has also been reported. Few studies have investigated the role of coding region variation in the RAD51 gene in familial breast cancer, with only one coding region variant – exon 6 c.449G>A (p.R150Q) – reported to date. Methods All nine coding exons of the RAD51 gene were analysed for variation in 46 well-characterised, BRCA1/2-negative breast cancer families using denaturing high-performance liquid chromatography. Genotyping of the exon 6 p.R150Q variant was performed in an additional 66 families. Additionally, lymphoblastoid cell lines from breast cancer patients were subjected to single nucleotide primer extension analysis to assess RAD51 expression. Results No coding region variation was found, and all intronic variation detected was either found in unaffected controls or was unlikely to have functional consequences. Single nucleotide primer extension analysis did not reveal any allele-specific changes in RAD51 expression in all lymphoblastoid cell lines tested. Conclusion Our study indicates that RAD51 is not a major familial breast cancer predisposition gene. PMID:16762046

  16. Gene Tree Discordance Causes Apparent Substitution Rate Variation.

    Science.gov (United States)

    Mendes, Fábio K; Hahn, Matthew W

    2016-07-01

    Substitution rates are known to be variable among genes, chromosomes, species, and lineages due to multifarious biological processes. Here, we consider another source of substitution rate variation due to a technical bias associated with gene tree discordance. Discordance has been found to be rampant in genome-wide data sets, often due to incomplete lineage sorting (ILS). This apparent substitution rate variation is caused when substitutions that occur on discordant gene trees are analyzed in the context of a single, fixed species tree. Such substitutions have to be resolved by proposing multiple substitutions on the species tree, and we therefore refer to this phenomenon as Substitutions Produced by ILS (SPILS). We use simulations to demonstrate that SPILS has a larger effect with increasing levels of ILS, and on trees with larger numbers of taxa. Specific branches of the species trees are consistently, but erroneously, inferred to be longer or shorter, and we show that these branches can be predicted based on discordant tree topologies. Moreover, we observe that fixing a species tree topology when performing tests of positive selection increases the false positive rate, particularly for genes whose discordant topologies are most affected by SPILS. Finally, we use data from multiple Drosophila species to show that SPILS can be detected in nature. Although the effects of SPILS are modest per gene, it has the potential to affect substitution rate variation whenever high levels of ILS are present, particularly in rapid radiations. The problems outlined here have implications for character mapping of any type of trait, and for any biological process that causes discordance. We discuss possible solutions to these problems, and areas in which they are likely to have caused faulty inferences of convergence and accelerated evolution.

  17. rendimiento académico

    Directory of Open Access Journals (Sweden)

    Ernesto Barceló Martínez

    2006-01-01

    Full Text Available Esta investigación se propuso encontrar la posible relación entre el rendimiento académico y la ausencia de ciertas habilidades cognoscitivas denominadas desde la neuropsicología como funciones ejecutivas, en un grupo de estudiantes universitarios. Se exploró entonces el estado de las funciones ejecutivas en estudiantes universitarios que presentaban bajo y alto rendimiento académico. El diseño utilizado en esta investigación fue el transeccional descriptivo. El análisis de los resultados se hizo utilizando el paquete estadístico Statistical Package for Social Sciences (spss. Estos mostraron que, en general, no existen diferencias significativas entre los estudiantes de bajo y alto rendimiento académico. Es decir, mostraron que el rendimiento académico no está directamente relacionado con déficits a nivel de las habilidades ejecutivas, pero sí podría estarlo a nivel del lenguaje y de los antecedentes familiares, psicológicos y académicos en estos estudiantes.

  18. Genome-Wide Associations of Gene Expression Variation in Humans.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  19. Genome-wide associations of gene expression variation in humans.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    2005-12-01

    Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.

  20. PAX6 gene variations associated with aniridia in south India

    Directory of Open Access Journals (Sweden)

    Shashikant Shetty

    2004-04-01

    Full Text Available Abstract Background Mutations in the transcription factor gene PAX6 have been shown to be the cause of the aniridia phenotype. The purpose of this study was to analyze patients with aniridia to uncover PAX6 gene mutations in south Indian population. Methods Total genomic DNA was isolated from peripheral blood of twenty-eight members of six clinically diagnosed aniridia families and 60 normal healthy controls. The coding exons of the human PAX6 gene were amplified by PCR and allele specific variations were detected by single strand conformation polymorphism (SSCP followed by automated sequencing. Results The sequencing results revealed novel PAX6 mutations in three patients with sporadic aniridia: c.715ins5, [c.1201delA; c.1239A>G] and c.901delA. Two previously reported nonsense mutations were also found: c.482C>A, c.830G>A. A neutral polymorphism was detected (IVS9-12C>T at the boundary of intron 9 and exon 10. The two nonsense mutations found in the coding region of human PAX6 gene are reported for the first time in the south Indian population. Conclusion The genetic analysis confirms that haploinsuffiency of the PAX6 gene causes the classic aniridia phenotype. Most of the point mutations detected in our study results in stop codons. Here we add three novel PAX6 gene mutations in south Indian population to the existing spectrum of mutations, which is not a well-studied ethnic group. Our study supports the hypothesis that a mutation in the PAX6 gene correlates with expression of aniridia.

  1. Diurnal variation of hepatic antioxidant gene expression in mice.

    Directory of Open Access Journals (Sweden)

    Yi-Qiao Xu

    Full Text Available BACKGROUND: This study was aimed to examine circadian variations of hepatic antioxidant components, including the Nrf2- pathway, the glutathione (GSH system, antioxidant enzymes and metallothionein in mouse liver. METHODS AND RESULTS: Adult mice were housed in light- and temperature-controlled facilities for 2 weeks, and livers were collected every 4 h during the 24 h period. Total RNA was isolated, purified, and subjected to real-time RT-PCR analysis. Hepatic mRNA levels of Nrf2, Keap1, Nqo1 and Gclc were higher in the light-phase than the dark-phase, and were female-predominant. Hepatic GSH presented marked circadian fluctuations, along with glutathione S-transferases (GST-α1, GST-µ, GST-π and glutathione peroxidase (GPx1. The expressions of GPx1, GST-µ and GST-π mRNA were also higher in females. Antioxidant enzymes Cu/Zn superoxide dismutase (Sod1, catalase (CAT, cyclooxygenase-2 (Cox-2 and heme oxygenase-1 (Ho-1 showed circadian rhythms, with higher expressions of Cox-2 and CAT in females. Metallothionein, a small non-enzymatic antioxidant protein, showed dramatic circadian variation in males, but higher expression in females. The circadian variations of the clock gene Brain and Muscle Arnt-like Protein-1(Bmal1, albumin site D-binding protein (Dbp, nuclear receptor Rev-Erbα (Nr1d1, period protein (Per1 and Per2 and cryptochrome 1(Cry1 were in agreement with the literature. Furthermore, acetaminophen hepatotoxicity is more severe when administered in the afternoon when hepatic GSH was lowest. CONCLUSIONS: Circadian variations and gender differences in transcript levels of antioxidant genes exist in mouse liver, which could affect body responses to oxidative stress at different times of the day.

  2. Variation within the Huntington's disease gene influences normal brain structure.

    Directory of Open Access Journals (Sweden)

    Mark Mühlau

    Full Text Available Genetics of the variability of normal and diseased brain structure largely remains to be elucidated. Expansions of certain trinucleotide repeats cause neurodegenerative disorders of which Huntington's disease constitutes the most common example. Here, we test the hypothesis that variation within the IT15 gene on chromosome 4, whose expansion causes Huntington's disease, influences normal human brain structure. In 278 normal subjects, we determined CAG repeat length within the IT15 gene on chromosome 4 and analyzed high-resolution T1-weighted magnetic resonance images by the use of voxel-based morphometry. We found an increase of GM with increasing long CAG repeat and its interaction with age within the pallidum, which is involved in Huntington's disease. Our study demonstrates that a certain trinucleotide repeat influences normal brain structure in humans. This result may have important implications for the understanding of both the healthy and diseased brain.

  3. Sequence variations in the FAD2 gene in seeded pumpkins.

    Science.gov (United States)

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-12-21

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

  4. Variations in ORAI1 Gene Associated with Kawasaki Disease.

    Science.gov (United States)

    Onouchi, Yoshihiro; Fukazawa, Ryuji; Yamamura, Kenichiro; Suzuki, Hiroyuki; Kakimoto, Nobuyuki; Suenaga, Tomohiro; Takeuchi, Takashi; Hamada, Hiromichi; Honda, Takafumi; Yasukawa, Kumi; Terai, Masaru; Ebata, Ryota; Higashi, Kouji; Saji, Tsutomu; Kemmotsu, Yasushi; Takatsuki, Shinichi; Ouchi, Kazunobu; Kishi, Fumio; Yoshikawa, Tetsushi; Nagai, Toshiro; Hamamoto, Kunihiro; Sato, Yoshitake; Honda, Akihito; Kobayashi, Hironobu; Sato, Junichi; Shibuta, Shoichi; Miyawaki, Masakazu; Oishi, Ko; Yamaga, Hironobu; Aoyagi, Noriyuki; Yoshiyama, Megumi; Miyashita, Ritsuko; Murata, Yuji; Fujino, Akihiro; Ozaki, Kouichi; Kawasaki, Tomisaku; Abe, Jun; Seki, Mitsuru; Kobayashi, Tohru; Arakawa, Hirokazu; Ogawa, Shunichi; Hara, Toshiro; Hata, Akira; Tanaka, Toshihiro

    2016-01-01

    Kawasaki disease (KD; MIM#61175) is a systemic vasculitis syndrome with unknown etiology which predominantly affects infants and children. Recent findings of susceptibility genes for KD suggest possible involvement of the Ca(2+)/NFAT pathway in the pathogenesis of KD. ORAI1 is a Ca(2+) release activated Ca(2+) (CRAC) channel mediating store-operated Ca(2+) entry (SOCE) on the plasma membrane. The gene for ORAI1 is located in chromosome 12q24 where a positive linkage signal was observed in our previous affected sib-pair study of KD. A common non-synonymous single nucleotide polymorphism located within exon 2 of ORAI1 (rs3741596) was significantly associated with KD (P = 0.028 in the discovery sample set (729 KD cases and 1,315 controls), P = 0.0056 in the replication sample set (1,813 KD cases vs. 1,097 controls) and P = 0.00041 in a meta-analysis by the Mantel-Haenszel method). Interestingly, frequency of the risk allele of rs3741596 is more than 20 times higher in Japanese compared to Europeans. We also found a rare 6 base-pair in-frame insertion variant associated with KD (rs141919534; 2,544 KD cases vs. 2,414 controls, P = 0.012). These data indicate that ORAI1 gene variations are associated with KD and may suggest the potential importance of the Ca(2+)/NFAT pathway in the pathogenesis of this disorder.

  5. Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ

    Directory of Open Access Journals (Sweden)

    Qing-Ming An

    2015-11-01

    Full Text Available The adiponectin gene (ADIPOQ plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5 of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2 were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3 and three SNPs were observed. Two patterns (A4-B4, A5-B5 and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg. In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits.

  6. Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

    Directory of Open Access Journals (Sweden)

    Edberg Jeffrey C

    2010-03-01

    Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

  7. Genes controlling mimetic colour pattern variation in butterflies.

    Science.gov (United States)

    Nadeau, Nicola J

    2016-10-01

    Butterfly wing patterns are made up of arrays of coloured scales. There are two genera in which within-species variation in wing patterning is common and has been investigated at the molecular level, Heliconius and Papilio. Both of these species have mimetic relationships with other butterfly species that increase their protection from predators. Heliconius have a 'tool-kit' of five genetic loci that control colour pattern, three of which have been identified at the gene level, and which have been repeatedly used to modify colour pattern by different species in the genus. By contrast, the three Papilio species that have been investigated each have different genetic mechanisms controlling their polymorphic wing patterns.

  8. The impact of gene expression variation on the robustness and evolvability of a developmental gene regulatory network.

    Directory of Open Access Journals (Sweden)

    David A Garfield

    2013-10-01

    Full Text Available Regulatory interactions buffer development against genetic and environmental perturbations, but adaptation requires phenotypes to change. We investigated the relationship between robustness and evolvability within the gene regulatory network underlying development of the larval skeleton in the sea urchin Strongylocentrotus purpuratus. We find extensive variation in gene expression in this network throughout development in a natural population, some of which has a heritable genetic basis. Switch-like regulatory interactions predominate during early development, buffer expression variation, and may promote the accumulation of cryptic genetic variation affecting early stages. Regulatory interactions during later development are typically more sensitive (linear, allowing variation in expression to affect downstream target genes. Variation in skeletal morphology is associated primarily with expression variation of a few, primarily structural, genes at terminal positions within the network. These results indicate that the position and properties of gene interactions within a network can have important evolutionary consequences independent of their immediate regulatory role.

  9. Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici

    Directory of Open Access Journals (Sweden)

    Megan C. McDonald

    2016-04-01

    Full Text Available Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene.

  10. Quantitative gene-gene and gene-environment mapping for leaf shape variation using tree-based models

    Science.gov (United States)

    Leaf shape traits have long been a focus of many disciplines, but searching for complex genetic and environmental interactive mechanisms regulating leaf shape variation has not yet been well developed. The question of the respective roles of gene and environment and how they interplay to modulate l...

  11. Evolution of variation in presence and absence of genes in bacterial pathways

    Directory of Open Access Journals (Sweden)

    Francis Andrew R

    2012-04-01

    Full Text Available Abstract Background Bacterial genomes exhibit a remarkable degree of variation in the presence and absence of genes, which probably extends to the level of individual pathways. This variation may be a consequence of the significant evolutionary role played by horizontal gene transfer, but might also be explained by the loss of genes through mutation. A challenge is to understand why there would be variation in gene presence within pathways if they confer a benefit only when complete. Results Here, we develop a mathematical model to study how variation in pathway content is produced by horizontal transfer, gene loss and partial exposure of a population to a novel environment. Conclusions We discuss the possibility that variation in gene presence acts as cryptic genetic variation on which selection acts when the appropriate environment occurs. We find that a high level of variation in gene presence can be readily explained by decay of the pathway through mutation when there is no longer exposure to the selective environment, or when selection becomes too weak to maintain the genes. In the context of pathway variation the role of horizontal gene transfer is probably the initial introduction of a complete novel pathway rather than in building up the variation in a genome without the pathway.

  12. Copy number variations in alternative splicing gene networks impact lifespan.

    Directory of Open Access Journals (Sweden)

    Joseph T Glessner

    Full Text Available Longevity has a strong genetic component evidenced by family-based studies. Lipoprotein metabolism, FOXO proteins, and insulin/IGF-1 signaling pathways in model systems have shown polygenic variations predisposing to shorter lifespan. To test the hypothesis that rare variants could influence lifespan, we compared the rates of CNVs in healthy children (0-18 years of age with individuals 67 years or older. CNVs at a significantly higher frequency in the pediatric cohort were considered risk variants impacting lifespan, while those enriched in the geriatric cohort were considered longevity protective variants. We performed a whole-genome CNV analysis on 7,313 children and 2,701 adults of European ancestry genotyped with 302,108 SNP probes. Positive findings were evaluated in an independent cohort of 2,079 pediatric and 4,692 geriatric subjects. We detected 8 deletions and 10 duplications that were enriched in the pediatric group (P=3.33×10(-8-1.6×10(-2 unadjusted, while only one duplication was enriched in the geriatric cohort (P=6.3×10(-4. Population stratification correction resulted in 5 deletions and 3 duplications remaining significant (P=5.16×10(-5-4.26×10(-2 in the replication cohort. Three deletions and four duplications were significant combined (combined P=3.7×10(-4-3.9×10(-2. All associated loci were experimentally validated using qPCR. Evaluation of these genes for pathway enrichment demonstrated ~50% are involved in alternative splicing (P=0.0077 Benjamini and Hochberg corrected. We conclude that genetic variations disrupting RNA splicing could have long-term biological effects impacting lifespan.

  13. Serotonergic gene variation: implications for personality traits and psychopathology.

    Science.gov (United States)

    Lesch, K P

    1999-06-01

    Serotonin 5-hydroxytryptamine (5-HT) is an important regulator of morphogenetic activities during early central nervous system development, including cell proliferation, migration, and differentiation as well as synapto-genesis. Serotonergic raphe neurons diffusely project to a variety of brain regions (e.g. cortex, amygdala, hippocampus) and play known roles in integrating emotion, cognition, motor function as well as in food intake, sleep, pain, and sexual activity. The diversity of physiologic functions is due to the fact that 5-HT acts as a master control neurotransmitter within a highly complex system of neural communication mediated by multiple pre- and postsynaptic 5-HT receptors, thus orchestrating the activity and interaction of several other neurotransmitter systems. Since proteins involved in the regulation of central serotonergic activity (e.g. enzymes, receptors, transporter) play pivotal role in brain 5-HT homeostasis, polymorphisms in the regulatory regions of their genes resulting in variation of expression and function are likely to influence complex traits, such as temperament/personality and psychopathology.

  14. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2014-01-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is…

  15. Evidence of a wide spectrum of cardiac involvement due to ACAD9 mutations: Report on nine patients.

    Science.gov (United States)

    Dewulf, Joseph P; Barrea, Catherine; Vincent, Marie-Françoise; De Laet, Corinne; Van Coster, Rudy; Seneca, Sara; Marie, Sandrine; Nassogne, Marie-Cécile

    2016-07-01

    Acyl-CoA dehydrogenase 9 (ACAD9) is a mitochondrial protein involved in oxidative phosphorylation complex I biogenesis. This protein also exhibits acyl-CoA dehydrogenase (ACAD) activity. ACAD9-mutated patients have been reported to suffer from primarily heart, muscle, liver, and nervous system disorders. ACAD9 mutation is suspected in cases of elevated lactic acid levels combined with complex I deficiency, and confirmed by ACAD9 gene analysis. At least 18 ACAD9-mutated patients have previously been reported, usually displaying severe cardiac involvement. We retrospectively studied nine additional patients from three unrelated families with a wide spectrum of cardiac involvement between the families as well as the patients from the same families. All patients exhibited elevated lactate levels. Deleterious ACAD9 mutations were identified in all patients except one for whom it was not possible to recover DNA. To our knowledge, this is one of the first reports on isolated mild ventricular hypertrophy due to ACAD9 mutation in a family with moderate symptoms during adolescence. This report also confirms that dilated cardiomyopathy may occur in conjunction with ACAD9 mutation and that some patients may respond clinically to riboflavin treatment. Of note, several patients suffered from patent ductus arteriosus (PDA), with one exhibiting a complex congenital heart defect. It is yet unknown whether these cardiac manifestations were related to ACAD9 mutation. In conclusion, this disorder should be suspected in the presence of lactic acidosis, complex I deficiency, and any cardiac involvement, even mild.

  16. The Relationship between Gene Network Structure and Expression Variation among Individuals and Species.

    Directory of Open Access Journals (Sweden)

    Karen E Sears

    2015-08-01

    Full Text Available Variation among individuals is a prerequisite of evolution by natural selection. As such, identifying the origins of variation is a fundamental goal of biology. We investigated the link between gene interactions and variation in gene expression among individuals and species using the mammalian limb as a model system. We first built interaction networks for key genes regulating early (outgrowth; E9.5-11 and late (expansion and elongation; E11-13 limb development in mouse. This resulted in an Early (ESN and Late (LSN Stage Network. Computational perturbations of these networks suggest that the ESN is more robust. We then quantified levels of the same key genes among mouse individuals and found that they vary less at earlier limb stages and that variation in gene expression is heritable. Finally, we quantified variation in gene expression levels among four mammals with divergent limbs (bat, opossum, mouse and pig and found that levels vary less among species at earlier limb stages. We also found that variation in gene expression levels among individuals and species are correlated for earlier and later limb development. In conclusion, results are consistent with the robustness of the ESN buffering among-individual variation in gene expression levels early in mammalian limb development, and constraining the evolution of early limb development among mammalian species.

  17. Components of Genetic Variation Associated with Second and Third Chromosome Gene Arrangements in Drosophila melanogaster

    OpenAIRE

    Ferrari, James A.

    1987-01-01

    The effects of naturally occuring combinations of second and third chromosome gene arrangements of Drosophila melanogaster on two quantitative traits were partitioned into parameters of additive, dominance and interaction components of genetic variation. Development time and preadult survival of the gene arrangement genotypes were measured under four experimental conditions. Gene arrangement effects, when significant, were predominantly additive under all conditions. Experimental conditions, ...

  18. Mosaics of gene variations in the Interleukin-10 gene promoter affect interleukin-10 production depending on the stimulation used.

    NARCIS (Netherlands)

    Mormann, M.; Rieth, H.; Hua, T.D.; Assohou-Luty, C.A.; Roupelieva, M.; Hu, S.L.; Kremsner, P.G.; Luty, J.F.; Kube, D.

    2004-01-01

    Interleukin-10 (IL-10), a cytokine involved in many aspects of the immune response shows interindividual variations in their expression. However, genetic variations of the 5'-flanking region of the IL-10 gene (PIL-10) are poorly characterised with respect to different stimuli. New extended haplo- an

  19. Natural variation in abiotic stress responsive gene expression and local adaptation to climate in Arabidopsis thaliana.

    Science.gov (United States)

    Lasky, Jesse R; Des Marais, David L; Lowry, David B; Povolotskaya, Inna; McKay, John K; Richards, James H; Keitt, Timothy H; Juenger, Thomas E

    2014-09-01

    Gene expression varies widely in natural populations, yet the proximate and ultimate causes of this variation are poorly known. Understanding how variation in gene expression affects abiotic stress tolerance, fitness, and adaptation is central to the field of evolutionary genetics. We tested the hypothesis that genes with natural genetic variation in their expression responses to abiotic stress are likely to be involved in local adaptation to climate in Arabidopsis thaliana. Specifically, we compared genes with consistent expression responses to environmental stress (expression stress responsive, "eSR") to genes with genetically variable responses to abiotic stress (expression genotype-by-environment interaction, "eGEI"). We found that on average genes that exhibited eGEI in response to drought or cold had greater polymorphism in promoter regions and stronger associations with climate than those of eSR genes or genomic controls. We also found that transcription factor binding sites known to respond to environmental stressors, especially abscisic acid responsive elements, showed significantly higher polymorphism in drought eGEI genes in comparison to eSR genes. By contrast, eSR genes tended to exhibit relatively greater pairwise haplotype sharing, lower promoter diversity, and fewer nonsynonymous polymorphisms, suggesting purifying selection or selective sweeps. Our results indicate that cis-regulatory evolution and genetic variation in stress responsive gene expression may be important mechanisms of local adaptation to climatic selective gradients.

  20. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    Science.gov (United States)

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  1. NMDA receptor gene variations as modifiers in Huntington disease : a replication study

    NARCIS (Netherlands)

    Saft, Carsten; Epplen, Jörg T; Wieczorek, Stefan; Landwehrmeyer, G Bernhard; Roos, Raymund A C; de Yebenes, Justo Garcia; Dose, Matthias; Tabrizi, Sarah J; Craufurd, David; Arning, Larissa; Kremer, Berry

    2011-01-01

    Several candidate modifier genes which, in addition to the pathogenic CAG repeat expansion, influence the age at onset (AO) in Huntington disease (HD) have already been described. The aim of this study was to replicate association of variations in the N-methyl D-aspartate receptor subtype genes GRIN

  2. Variation in the nucleotide sequence of a prolamin gene family in wild rice.

    Science.gov (United States)

    Barbier, P; Ishihama, A

    1990-07-01

    Variation in the DNA sequence of the 10 kDa prolamin gene family within the wild rice species Oryza rufipogon was probed using the direct sequencing of PCR-amplified genes. A comparison of the nucleotide and deduced amino-acid sequences of eight Asian strains of O. rufipogon and one strain of the related African species O. longistaminata is presented.

  3. Drd4 gene polymorphisms are associated with personality variation in a passerine bird

    NARCIS (Netherlands)

    Fidler, A.E.; Van Oers, K.; Drent, P.J.; Kuhn, S.; Mueller, J.C.; Kempenaers, B.

    2007-01-01

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, gen

  4. Common Genetic Variation in Circadian Rhythm Genes and Risk of Epithelial Ovarian Cancer (EOC)

    DEFF Research Database (Denmark)

    Jim, Heather S L; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    Disruption in circadian gene expression, whether due to genetic variation or environmental factors (e.g., light at night, shiftwork), is associated with increased incidence of breast, prostate, gastrointestinal and hematologic cancers and gliomas. Circadian genes are highly expressed in the ovari...

  5. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    DEFF Research Database (Denmark)

    Purrington, Kristen S; Slettedahl, Seth; Bolla, Manjeet K

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymor...

  6. Common variation in fatty acid metabolic genes and risk of incident sudden cardiac arrest

    NARCIS (Netherlands)

    R.N. Lemaitre (Rozenn ); C.O. Johnson (Catherine); S. Hesselson (Stephanie); N. Sotoodhenia (Nona); B. McKnight (Barbara); C.M. Sitlani (Colleen); D. Rea (Dan); I.B. King (Irena); P.-Y. Kwok (Pui-Yan); A. Mak (Angel); G. Li (Guo); J. Brody (Jennifer); E.B. Larson (Eric); D. Mozaffarian (Dariush); B.M. Psaty (Bruce); A. Huertas-Vazquez (Adriana); J.-C. Tardif (Jean-Claude); C.M. Albert (Christine); L.-P. Lyytikäinen (Leo-Pekka); D.E. Arking (Dan); S. Kääb (Stefan); H.V. Huikuri (Heikki); B.P. Krijthe (Bouwe); M. Eijgelsheim (Mark); Y.A. Wang (Ying); K. Reinier (Kyndaron); T. Lehtimäki (Terho); S.L. Pulit (Sara); R. Brugada (Ramon); M. Müller-Nurasyid (Martina); C. Newton-Cheh (Christopher); P.J. Karhunen (Pekka); B.H.Ch. Stricker (Bruno); P. Goyette (Philippe); J.I. Rotter (Jerome); S.S. Chugh (Sumeet); A. Chakravarti (Aravinda); X. Jouven (Xavier); D.S. Siscovick (David)

    2014-01-01

    textabstractBackground There is limited information on genetic factors associated with sudden cardiac arrest (SCA). Objective To assess the association of common variation in genes in fatty acid pathways with SCA risk. Methods We selected 85 candidate genes and 1155 single nucleotide polymorphisms (

  7. Unraveling the regulatory mechanisms underlying tissue-dependent genetic variation of gene expression

    NARCIS (Netherlands)

    Fu, Jingyuan; Wolfs, Marcel G M; Deelen, Patrick; Westra, Harm Jan; Fehrmann, Rudolf S N; te Meerman, Gerhardus; Buurman, Wim A; Rensen, Sander S M; Groen, Hendricus; Weersma, Rinse K; van den Berg, Leonard H; Veldink, Jan; Ophoff, Roel A; Snieder, Harold; van Heel, David; Jansen, Ritsert C; Hofker, Marten H; Wijmenga, Cisca; Franke, Lude

    2012-01-01

    It is known that genetic variants can affect gene expression, but it is not yet completely clear through what mechanisms genetic variation mediate this expression. We therefore compared the cis-effect of single nucleotide polymorphisms (SNPs) on gene expression between blood samples from 1,240 human

  8. Population transcriptomics uncovers the regulation of gene expression variation in adaptation to changing environment

    Science.gov (United States)

    Xu, Qin; Zhu, Caiyun; Fan, Yangyang; Song, Zhihong; Xing, Shilai; Liu, Wei; Yan, Juan; Sang, Tao

    2016-01-01

    Expression variation plays an important role in plant adaptation, but little is known about the factors impacting the expression variation when population adapts to changing environment. We used RNA-seq data from 80 individuals in 14 Miscanthus lutarioriparius populations, which were transplanted into a harsh environment from native habitat, to investigate the expression level, expression diversity and genetic diversity for genes expressed in both environments. The expression level of genes with lower expression level or without SNP tended to be more changeable in new environment, which suggested highly expressed genes experienced stronger purifying selection than those at lower level. Low proportion of genes with population effect confirmed the weak population structure and frequent gene flow in these populations. Meanwhile, the number of genes with environment effect was the most frequent compared with that with population effect. Our results showed that environment and genetic diversity were the main factors determining gene expression variation in population. This study could facilitate understanding the mechanisms of global gene expression variation when plant population adapts to changing environment. PMID:27150248

  9. Associations between Variation in X Chromosome Male Reproductive Genes and Sperm Competitive Ability in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Leah Greenspan

    2011-01-01

    Full Text Available Variation in reproductive success has long been thought to be mediated in part by genes encoding seminal proteins. Here we explore the effect on male reproductive phenotypes of X-linked polymorphisms, a chromosome that is depauperate in genes encoding seminal proteins. Using 57 X chromosome substitution lines, sperm competition was tested both when the males from the wild-extracted line were the first to mate (“defense” crosses, followed by a tester male, and when extracted-line males were the second to mate, after a tester male (“offfense” crosses. We scored the proportion of progeny sired by each male, the fecundity, the remating rate and refractoriness to remating, and tested the significance of variation among lines. Eleven candidate genes were chosen based on previous studies, and portions of these genes were sequenced in all 57 lines. A total of 131 polymorphisms were tested for associations with the reproductive phenotypes using linear models. Nine polymorphisms in 4 genes were found to show significant associations (at a 5% FDR. Overall, it appears that the X chromosomes harbor abundant variation in sperm competition, especially considering the paucity of seminal protein genes. This suggests that much of the male reproductive variation lies outside of genes that encode seminal proteins.

  10. Divergent selection for opsin gene variation in guppy (Poecilia reticulata) populations of Trinidad and Tobago.

    Science.gov (United States)

    Tezuka, A; Kasagi, S; van Oosterhout, C; McMullan, M; Iwasaki, W M; Kasai, D; Yamamichi, M; Innan, H; Kawamura, S; Kawata, M

    2014-11-01

    The guppy is known to exhibit remarkable interindividual variations in spectral sensitivity of middle to long wavelength-sensitive (M/LWS) cone photoreceptor cells. The guppy has four M/LWS-type opsin genes (LWS-1, LWS-2, LWS-3 and LWS-4) that are considered to be responsible for this sensory variation. However, the allelic variation of the opsin genes, particularly in terms of their absorption spectrum, has not been explored in wild populations. Thus, we examined nucleotide variations in the four M/LWS opsin genes as well as blue-sensitive SWS2-B and ultraviolet-sensitive SWS1 opsin genes for comparison and seven non-opsin nuclear loci as reference genes in 10 guppy populations from various light environments in Trinidad and Tobago. For the first time, we discovered a potential spectral variation (180 Ser/Ala) in LWS-1 that differed at an amino acid site known to affect the absorption spectra of opsins. Based on a coalescent simulation of the nucleotide variation of the reference genes, we showed that the interpopulation genetic differentiation of two opsin genes was significantly larger than the neutral expectation. Furthermore, this genetic differentiation was significantly related to differences in dissolved oxygen (DO) level, and it was not explained by the spatial distance between populations. The DO levels are correlated with eutrophication that possibly affects the color of aquatic environments. These results suggest that the population diversity of opsin genes is significantly driven by natural selection and that the guppy could adapt to various light environments through color vision changes.

  11. A new approach to quantify the adaptive potential of gene expression variation in gymnosperms.

    Science.gov (United States)

    Renaut, Sébastien

    2013-05-01

    Variation in patterns of gene expression contributes to phenotypic diversity and can ultimately predict adaptive responses. However, in many cases, the consequences of regulatory mutations on patterns of gene expression and ultimately phenotypic differences remain elusive. A standard way to study the genetic architecture of expression variation in model systems has been to map gene expression variation to genetic loci (Fig. 1a). At the same time, in many nonmodel species, especially for long-lived organisms, controlled crosses are not feasible. If we are to expand our understanding of the role of regulatory mutations on phenotypes, we need to develop new methodologies to study species under ecologically relevant conditions. In this issue of Molecular Ecology, Verta et al. (2013) present a new approach to analyse gene expression variation and regulatory networks in gymnosperms (Fig. 1b). They capitalized on the fact that gymnosperm seeds contain an energy storage tissue (the megagametophyte) that is directly derived from a single haploid cell (the megaspore). The authors identified over 800 genes for which expression segregated in this maternally inherited haploid tissue. Based on the observed segregation patterns, these genes (Mendelian Expression Traits) are most probably controlled by biallelic variants at a single locus. Most of these genes also belonged to different regulatory networks, except for one large group of 180 genes under the control of a putative trans-acting factor. In addition, the approach developed here may also help to uncover the effect of rare recessive mutations, which usually remain hidden in a heterozygous state in diploid individuals. The appeal of the work by Verta et al. (2013) to study gene expression variation is in its simplicity, which circumvents several of the hurdles behind traditional expression quantitative trait locus (eQTL) studies, and could potentially be applied to a large number of species.

  12. Chimpanzee sociability is associated with vasopressin (Avpr1a) but not oxytocin receptor gene (OXTR) variation.

    Science.gov (United States)

    Staes, Nicky; Koski, Sonja E; Helsen, Philippe; Fransen, Erik; Eens, Marcel; Stevens, Jeroen M G

    2015-09-01

    The importance of genes in regulating phenotypic variation of personality traits in humans and animals is becoming increasingly apparent in recent studies. Here we focus on variation in the vasopressin receptor gene 1a (Avpr1a) and oxytocin receptor gene (OXTR) and their effects on social personality traits in chimpanzees. We combine newly available genetic data on Avpr1a and OXTR allelic variation of 62 captive chimpanzees with individual variation in personality, based on behavioral assessments. Our study provides support for the positive association of the Avpr1a promoter region, in particular the presence of DupB, and sociability in chimpanzees. This complements findings of previous studies on adolescent chimpanzees and studies that assessed personality using questionnaire data. In contrast, no significant associations were found for the single nucleotide polymorphism (SNP) ss1388116472 of the OXTR and any of the personality components. Most importantly, our study provides additional evidence for the regulatory function of the 5' promoter region of Avpr1a on social behavior and its evolutionary stable effect across species, including rodents, chimpanzees and humans. Although it is generally accepted that complex social behavior is regulated by a combination of genes, the environment and their interaction, our findings highlight the importance of candidate genes with large effects on behavioral variation.

  13. Conceptual Variation or Incoherence? Textbook Discourse on Genes in Six Countries

    Science.gov (United States)

    Gericke, Niklas M.; Hagberg, Mariana; dos Santos, Vanessa Carvalho; Joaquim, Leyla Mariane; El-Hani, Charbel N.

    2012-06-01

    The aim of this paper is to investigate in a systematic and comparative way previous results of independent studies on the treatment of genes and gene function in high school textbooks from six different countries. We analyze how the conceptual variation within the scientific domain of Genetics regarding gene function models and gene concepts is transformed via the didactic transposition into school science textbooks. The results indicate that a common textbook discourse on genes and their function exist in textbooks from the different countries. The structure of science as represented by conceptual variation and the use of multiple models was present in all the textbooks. However, the existence of conceptual variation and multiple models is implicit in these textbooks, i.e., the phenomenon of conceptual variation and multiple models are not addressed explicitly, nor its consequences and, thus, it ends up introducing conceptual incoherence about the gene concept and its function within the textbooks. We conclude that within the found textbook-discourse ontological aspects of the academic disciplines of genetics and molecular biology were retained, but without their epistemological underpinnings; these are lost in the didactic transposition. These results are of interest since students might have problems reconstructing the correct scientific understanding from the transformed school science knowledge as depicted within the high school textbooks. Implications for textbook writing as well as teaching are discussed in the paper.

  14. Degranulation of rat cerebellum induces selective variations in gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Eliyahu, D.; Soreq, H.

    1982-02-01

    Selective variations in the composition of poly(A)-containing mRNA were found to be induced in the rat cerebellum by X-irradiation. mRNA populations prepared from normal and X-irradiated rat cerebella at different stages of their development displayed equal efficiencies when translated in vitro in reticulocyte lysates. Specific differences were revealed, however, when the labeled translation products of both mRNA preparations were subjected to two-dimensional gel electrophoresis followed by fluorography of the dried gels. Of more than 100 polypeptide products, several showed marked intensity differences, indicating changes in the abundance of their directing mRNA species. These differences appear both in developing and in mature cerebellar mRNA, and the extent of modification in mRNA is much higher than the consequent changes in the composition of proteins in the irradiated cerebellum. The degranulation-induced modifications in levels of specific cerebellar mRNA species can be used to identify proteins whose biosynthesis depends on the presence of interneurons.

  15. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.

    Science.gov (United States)

    Ruifu, Y; Minli, Z; Guo, Z; Wang, X

    1997-01-01

    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum.

  16. Genetic variation in V gene of class II Newcastle disease virus.

    Science.gov (United States)

    Hao, Huafang; Chen, Shengli; Liu, Peng; Ren, Shanhui; Gao, Xiaolong; Wang, Yanping; Wang, Xinglong; Zhang, Shuxia; Yang, Zengqi

    2016-01-01

    The genetic variation and molecular evolution of the V gene of the class II Newcastle disease virus (NDV) isolates with genotypes I-XVIII were determined using bioinformatics. Results indicated that low homology existed in different genotype viruses, whereas high homology often for the same genotypes, exception may be existed within genotypes I, V, VI, and XII. Sequence analysis showed that the genetic variation of V protein was consistent with virus genotype, and specific signatures on the V protein for nine genotypes were identified. Phylogenetic analysis demonstrated that the phylogenetic trees were highly consistent between the V and F genes, with slight discrepancies in the sub-genotypes. Evolutionary rate analyses based on V and F genes revealed the evolution rates varied in genotypes. These data indicate that the genetic variation of V protein is genotype-related and will help in elucidating the molecular evolution of NDV.

  17. Gene diversity and genetic variation in lung flukes (genus Paragonimus).

    Science.gov (United States)

    Blair, David; Nawa, Yukifumi; Mitreva, Makedonka; Doanh, Pham Ngoc

    2016-01-01

    Paragonimiasis caused by lung flukes (genus Paragonimus) is a neglected disease occurring in Asia, Africa and the Americas. The genus is species-rich, ancient and widespread. Genetic diversity is likely to be considerable, but investigation of this remains confined to a few populations of a few species. In recent years, studies of genetic diversity have moved from isoenzyme analysis to molecular phylogenetic analysis based on selected DNA sequences. The former offered better resolution of questions relating to allelic diversity and gene flow, whereas the latter is more suitable for questions relating to molecular taxonomy and phylogeny. A picture is emerging of a highly diverse taxon of parasites, with the greatest diversity found in eastern and southern Asia where ongoing speciation might be indicated by the presence of several species complexes. Diversity of lung flukes in Africa and the Americas is very poorly sampled. Functional molecules that might be of value for immunodiagnosis, or as targets for medical intervention, are of great interest. Characterisation of these from Paragonimus species has been ongoing for a number of years. However, the imminent release of genomic and transcriptomic data for several species of Paragonimus will dramatically increase the rate of discovery of such molecules, and illuminate their diversity within and between species.

  18. [Association of schizophrenia with variations in genes encoding transcription factors].

    Science.gov (United States)

    Boyajyan, A S; Atshemyan, S A; Zakharyan, R V

    2015-01-01

    Alterations in neuronal plasticity and immune system play a key role in pathogenesis of schizophrenia. Identification of genetic factors contributing to these alterations will significantly encourage elucidation of molecular etiopathomechanisms of this disorder. Transcription factors c-Fos, c-Jun, and Ier5 are the important regulators of neuronal plasticity and immune response. In the present work we investigated a potential association of schizophrenia with a number of single nucleotide polymorphisms of c-Fos-,c-Jun and Ier5 encoding genes (FOS, JUN, and IER5 respectively). Genotyping of DNA samples of patients with schizophrenia and healthy individuals was performed using polymerase chain reaction with allele specific primers. The results obtained demonstrated association between schizophrenia and FOS rs1063169, FOS rs7101, JUN rs11688, and IER5 rs6425663 polymorphisms. Namely, it was found that the inheritance of FOS rs1063169*T, JUN rs11688*A, and IER5 rs6425663*T minor variants decreases risk for development of schizophrenia whereas the inheritance of FOS rs7101*T minor variant, especially its homozygous form, increases risk for development of this disorder.

  19. Investigation of variation in gene expression profiling of human blood by extended principle component analysis.

    Directory of Open Access Journals (Sweden)

    Qinghua Xu

    Full Text Available BACKGROUND: Human peripheral blood is a promising material for biomedical research. However, various kinds of biological and technological factors result in a large degree of variation in blood gene expression profiles. METHODOLOGY/PRINCIPAL FINDINGS: Human peripheral blood samples were drawn from healthy volunteers and analysed using the Human Genome U133Plus2 Microarray. We applied a novel approach using the Principle Component Analysis and Eigen-R(2 methods to dissect the overall variation of blood gene expression profiles with respect to the interested biological and technological factors. The results indicated that the predominating sources of the variation could be traced to the individual heterogeneity of the relative proportions of different blood cell types (leukocyte subsets and erythrocytes. The physiological factors like age, gender and BMI were demonstrated to be associated with 5.3% to 9.2% of the total variation in the blood gene expression profiles. We investigated the gene expression profiles of samples from the same donors but with different levels of RNA quality. Although the proportion of variation associated to the RNA Integrity Number was mild (2.1%, the significant impact of RNA quality on the expression of individual genes was observed. CONCLUSIONS: By characterizing the major sources of variation in blood gene expression profiles, such variability can be minimized by modifications to study designs. Increasing sample size, balancing confounding factors between study groups, using rigorous selection criteria for sample quality, and well controlled experimental processes will significantly improve the accuracy and reproducibility of blood transcriptome study.

  20. Individual variation of adipose gene expression and identification of covariated genes by cDNA microarrays

    NARCIS (Netherlands)

    Boeuf, S.; Keijer, J.; Franssen-Hal, van N.L.W.; Klaus, S.

    2002-01-01

    Gene expression profiling through the application of microarrays provides comprehensive assessment of gene expression levels in a given tissue or cell population, as well as information on changes of gene expression in altered physiological or pathological situations. Microarrays are particularly su

  1. NMDA receptor gene variations as modifiers in Huntington disease: a replication study

    OpenAIRE

    2011-01-01

    Several candidate modifier genes which, in addition to the pathogenic CAG repeat expansion, influence the age at onset (AO) in Huntington disease (HD) have already been described. The aim of this study was to replicate association of variations in the N-methyl D-aspartate receptor subtype genes GRIN2A and GRIN2B in the “REGISTRY” cohort from the European Huntington Disease Network (EHDN). The analyses did replicate the association reported between the GRIN2A rs2650427 variation and AO in the ...

  2. Genetic variation in telomere maintenance genes in relation to ovarian cancer survival.

    Science.gov (United States)

    Harris, Holly R; Vivo, Immaculata De; Titus, Linda J; Vitonis, Allison F; Wong, Jason Y Y; Cramer, Daniel W; Terry, Kathryn L

    2012-01-01

    Telomeres are repetitive non-coding DNA sequences at the ends of chromosomes that provide protection against chromosomal instability. Telomere length and stability are influenced by proteins, including telomerase which is partially encoded by the TERT gene. Genetic variation in the TERT gene is associated with ovarian cancer risk, and predicts survival in lung cancer and glioma. We investigated whether genetic variation in five telomere maintenance genes was associated with survival among 1480 cases of invasive epithelial ovarian cancer in the population-based New England Case-Control Study. Cox proportional hazard models were used to calculate hazard ratios and 95% confidence intervals. Overall we observed no significant associations between SNPs in telomere maintenance genes and mortality using a significance threshold of p=0.001. However, we observed some suggestive associations in subgroup analyses. Future studies with larger populations may further our understanding of what role telomeres play in ovarian cancer survival.

  3. Sex Differences in Drosophila Somatic Gene Expression: Variation and Regulation by doublesex

    Directory of Open Access Journals (Sweden)

    Michelle N. Arbeitman

    2016-07-01

    Full Text Available Sex differences in gene expression have been widely studied in Drosophila melanogaster. Sex differences vary across strains, but many molecular studies focus on only a single strain, or on genes that show sexually dimorphic expression in many strains. How extensive variability is and whether this variability occurs among genes regulated by sex determination hierarchy terminal transcription factors is unknown. To address these questions, we examine differences in sexually dimorphic gene expression between two strains in Drosophila adult head tissues. We also examine gene expression in doublesex (dsx mutant strains to determine which sex-differentially expressed genes are regulated by DSX, and the mode by which DSX regulates expression. We find substantial variation in sex-differential expression. The sets of genes with sexually dimorphic expression in each strain show little overlap. The prevalence of different DSX regulatory modes also varies between the two strains. Neither the patterns of DSX DNA occupancy, nor mode of DSX regulation explain why some genes show consistent sex-differential expression across strains. We find that the genes identified as regulated by DSX in this study are enriched with known sites of DSX DNA occupancy. Finally, we find that sex-differentially expressed genes and genes regulated by DSX are highly enriched on the fourth chromosome. These results provide insights into a more complete pool of potential DSX targets, as well as revealing the molecular flexibility of DSX regulation.

  4. Detection, Validation, and Downstream Analysis of Allelic Variation in Gene Expression

    Science.gov (United States)

    Ciobanu, Daniel C.; Lu, Lu; Mozhui, Khyobeni; Wang, Xusheng; Jagalur, Manjunatha; Morris, John A.; Taylor, William L.; Dietz, Klaus; Simon, Perikles; Williams, Robert W.

    2010-01-01

    Common sequence variants within a gene often generate important differences in expression of corresponding mRNAs. This high level of local (allelic) control—or cis modulation—rivals that produced by gene targeting, but expression is titrated finely over a range of levels. We are interested in exploiting this allelic variation to study gene function and downstream consequences of differences in expression dosage. We have used several bioinformatics and molecular approaches to estimate error rates in the discovery of cis modulation and to analyze some of the biological and technical confounds that contribute to the variation in gene expression profiling. Our analysis of SNPs and alternative transcripts, combined with eQTL maps and selective gene resequencing, revealed that between 17 and 25% of apparent cis modulation is caused by SNPs that overlap probes rather than by genuine quantitative differences in mRNA levels. This estimate climbs to 40–50% when qualitative differences between isoform variants are included. We have developed an analytical approach to filter differences in expression and improve the yield of genuine cis-modulated transcripts to ∼80%. This improvement is important because the resulting variation can be successfully used to study downstream consequences of altered expression on higher-order phenotypes. Using a systems genetics approach we show that two validated cis-modulated genes, Stk25 and Rasd2, are likely to control expression of downstream targets and affect disease susceptibility. PMID:19884314

  5. cuidador e de acadêmicos

    Directory of Open Access Journals (Sweden)

    Márcia Gabriela Gomes Nascimento

    2015-01-01

    Full Text Available Objetivo: comprender las experiencias del cuidador y académicas multidisciplinarios de la salud para el desarrollo de autocuidado a ancianos después del accidente cerebrovascular en hogar. Métodos: estudio cualitativo, se utilizaron entrevistas semiestructuradas con seis cuidadores y ocho académicos, cuyos datos fueron analizados a la luz de la Fenomenología. Resultados: tres categorías emergieron: viviendo con los rectos y las limitaciones impuestas al cuidador y al ser cuidado; el ser profesional y el conservadurismo tecnicista; el equipo multidisciplinar en el hogar: experiencias con el ser cuidado y su cuidador. Conclusión: aprehendió que los cuidadores de ancianos después del accidente cerebrovascular necesitan de más apoyo y orientación para la realización de cuidados en el hogar, un plan de atención para facilitar y estimular el autocuidado, minimizando la sobrecarga del cuidador. Los académicos multiprofesionales señalaron visión tecnicista, evidenciándose necesidad de cambios Necesidad en la formación académica, basada en la atención humanista e integral.

  6. Structural variation of the ribosomal gene cluster within the class Insecta

    Energy Technology Data Exchange (ETDEWEB)

    Mukha, D.V.; Sidorenko, A.P.; Lazebnaya, I.V. [Vavilov Institute of General Genetics, Moscow (Russian Federation)] [and others

    1995-09-01

    General estimation of ribosomal DNA variation within the class Insecta is presented. It is shown that, using blot-hybridization, one can detect differences in the structure of the ribosomal gene cluster not only between genera within an order, but also between species within a genera, including sibling species. Structure of the ribosomal gene cluster of the Coccinellidae family (ladybirds) is analyzed. It is shown that cloned highly conservative regions of ribosomal DNA of Tetrahymena pyriformis can be used as probes for analyzing ribosomal genes in insects. 24 refs., 4 figs.

  7. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    Directory of Open Access Journals (Sweden)

    Kaas Rolf S

    2012-10-01

    Full Text Available Abstract Background Escherichia coli exists in commensal and pathogenic forms. By measuring the variation of individual genes across more than a hundred sequenced genomes, gene variation can be studied in detail, including the number of mutations found for any given gene. This knowledge will be useful for creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps more biologically relevant, especially considering that many of these genome sequences are draft quality. The E. coli pan-genome for this set of isolates contains 16,373 gene clusters. A core-gene tree, based on alignment and a pan-genome tree based on gene presence/absence, maps the relatedness of the 186 sequenced E. coli genomes. The core-gene tree displays high confidence and divides the E. coli strains into the observed MLST type clades and also separates defined phylotypes. Conclusion The results of comparing a large and diverse E. coli dataset support the theory that reliable and good resolution phylogenies can be inferred from the core-genome. The results further suggest that the resolution at the isolate level may, subsequently be improved by targeting more variable genes. The use of whole genome sequencing will make it possible to eliminate, or at least reduce, the need for several typing steps used in traditional epidemiology.

  8. Heritable genome-wide variation of gene expression and promoter methylation between wild and domesticated chickens

    Directory of Open Access Journals (Sweden)

    Nätt Daniel

    2012-02-01

    Full Text Available Abstract Background Variations in gene expression, mediated by epigenetic mechanisms, may cause broad phenotypic effects in animals. However, it has been debated to what extent expression variation and epigenetic modifications, such as patterns of DNA methylation, are transferred across generations, and therefore it is uncertain what role epigenetic variation may play in adaptation. Results In Red Junglefowl, ancestor of domestic chickens, gene expression and methylation profiles in thalamus/hypothalamus differed substantially from that of a domesticated egg laying breed. Expression as well as methylation differences were largely maintained in the offspring, demonstrating reliable inheritance of epigenetic variation. Some of the inherited methylation differences were tissue-specific, and the differential methylation at specific loci were little changed after eight generations of intercrossing between Red Junglefowl and domesticated laying hens. There was an over-representation of differentially expressed and methylated genes in selective sweep regions associated with chicken domestication. Conclusions Our results show that epigenetic variation is inherited in chickens, and we suggest that selection of favourable epigenomes, either by selection of genotypes affecting epigenetic states, or by selection of methylation states which are inherited independently of sequence differences, may have been an important aspect of chicken domestication.

  9. Natural variation in CBF gene sequence, gene expression and freezing tolerance in the Versailles core collection of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Brunel Dominique

    2008-10-01

    Full Text Available Abstract Background Plants from temperate regions are able to withstand freezing temperatures due to a process known as cold acclimation, which is a prior exposure to low, but non-freezing temperatures. During acclimation, a large number of genes are induced, bringing about biochemical changes in the plant, thought to be responsible for the subsequent increase in freezing tolerance. Key regulatory proteins in this process are the CBF1, 2 and 3 transcription factors which control the expression of a set of target genes referred to as the "CBF regulon". Results To assess the role of the CBF genes in cold acclimation and freezing tolerance of Arabidopsis thaliana, the CBF genes and their promoters were sequenced in the Versailles core collection, a set of 48 accessions that maximizes the naturally-occurring genetic diversity, as well as in the commonly used accessions Col-0 and WS. Extensive polymorphism was found in all three genes. Freezing tolerance was measured in all accessions to assess the variability in acclimated freezing tolerance. The effect of sequence polymorphism was investigated by evaluating the kinetics of CBF gene expression, as well as that of a subset of the target COR genes, in a set of eight accessions with contrasting freezing tolerance. Our data indicate that CBF genes as well as the selected COR genes are cold induced in all accessions, irrespective of their freezing tolerance. Although we observed different levels of expression in different accessions, CBF or COR gene expression was not closely correlated with freezing tolerance. Conclusion Our results indicate that the Versailles core collection contains significant natural variation with respect to freezing tolerance, polymorphism in the CBF genes and CBF and COR gene expression. Although there tends to be more CBF and COR gene expression in tolerant accessions, there are exceptions, reinforcing the idea that a complex network of genes is involved in freezing tolerance

  10. Geographic variation in advertisement calls in a tree frog species: gene flow and selection hypotheses.

    Directory of Open Access Journals (Sweden)

    Yikweon Jang

    Full Text Available BACKGROUND: In a species with a large distribution relative to its dispersal capacity, geographic variation in traits may be explained by gene flow, selection, or the combined effects of both. Studies of genetic diversity using neutral molecular markers show that patterns of isolation by distance (IBD or barrier effect may be evident for geographic variation at the molecular level in amphibian species. However, selective factors such as habitat, predator, or interspecific interactions may be critical for geographic variation in sexual traits. We studied geographic variation in advertisement calls in the tree frog Hyla japonica to understand patterns of variation in these traits across Korea and provide clues about the underlying forces for variation. METHODOLOGY: We recorded calls of H. japonica in three breeding seasons from 17 localities including localities in remote Jeju Island. Call characters analyzed were note repetition rate (NRR, note duration (ND, and dominant frequency (DF, along with snout-to-vent length. RESULTS: The findings of a barrier effect on DF and a longitudinal variation in NRR seemed to suggest that an open sea between the mainland and Jeju Island and mountain ranges dominated by the north-south Taebaek Mountains were related to geographic variation in call characters. Furthermore, there was a pattern of IBD in mitochondrial DNA sequences. However, no comparable pattern of IBD was found between geographic distance and call characters. We also failed to detect any effects of habitat or interspecific interaction on call characters. CONCLUSIONS: Geographic variations in call characters as well as mitochondrial DNA sequences were largely stratified by geographic factors such as distance and barriers in Korean populations of H. japonica. Although we did not detect effects of habitat or interspecific interaction, some other selective factors such as sexual selection might still be operating on call characters in conjunction with

  11. Copy number variation of microRNA genes in the human genome

    Directory of Open Access Journals (Sweden)

    Krzyzosiak Wlodzimierz J

    2011-04-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are important genetic elements that regulate the expression of thousands of human genes. Polymorphisms affecting miRNA biogenesis, dosage and target recognition may represent potentially functional variants. The functional consequences of single nucleotide polymorphisms (SNPs within critical miRNA sequences and outside of miRNA genes were previously demonstrated using both experimental and computational methods. However, little is known about how copy number variations (CNVs affect miRNA genes. Results In this study, we analyzed the co-localization of all miRNA loci with known CNV regions. Using bioinformatic tools we identified and validated 209 copy number variable miRNA genes (CNV-miRNAs in CNV regions deposited in Database of Genomic Variations (DGV and 11 CNV-miRNAs in two sets of CNVs defined as highly polymorphic. We propose potential mechanisms of CNV-mediated variation of functional copies of miRNAs (dosage for different types of CNVs overlapping miRNA genes. We also showed that, consistent with their essential biological functions, miRNA loci are underrepresented in highly polymorphic and well-validated CNV regions. Conclusion We postulate that CNV-miRNAs are potential functional variants and should be considered high priority candidate variants in genotype-phenotype association studies.

  12. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  13. Poly(T) variation within mitochondrial protein-coding genes in Globodera (Nematoda: Heteroderidae).

    Science.gov (United States)

    Riepsamen, Angelique H; Blok, Vivian C; Phillips, Mark; Gibson, Tracey; Dowton, Mark

    2008-03-01

    We sequenced a mitochondrial subgenome from the nematode Globodera rostochiensis, in two overlapping pieces. The subgenome was 9210 bp and contained four protein-coding genes (ND4, COIII, ND3, Cytb) and two tRNA genes (tRNA(Thr), tRNA(Gln)). Genome organization was similar to that of Globodera pallida, which is multipartite. Together with the small number of genes on this subgenome, this suggests that the mitochondrial genome of G. rostochiensis is also multipartite. In the initial clones sequenced, COIII and ND3 were full-length, while ND4 and Cytb were interrupted by premature stop codons and contained point indels that disrupted the reading frame. However, sequencing of multiple clones, from DNA extracted both from multiple individuals and from single cysts, revealed a predominant source of variation-in the length of polythymidine tracts. Comparison of our genomic sequences with ESTs similarly revealed variation in the length of polythymidine tracts. We subsequently sequenced both genomic DNA and mRNA from populations of G. pallida. In each case, variation in the length of polythymidine tracts was observed. The levels of expression of mitochondrial genes in G. pallida were representative of the subgenomes present: little evidence of differential expression was observed. These observations are consistent with the operation of posttranscriptional editing in Globodera mitochondria, although this is difficult to show conclusively in the presence of intraindividual gene sequence variation. Further, alternative explanations cannot be discounted; these include the operation of slippage during translation or that genomic copies of most genes are pseudogenes with a small proportion of full-length sequences able to maintain mitochondrial function.

  14. Systematic prioritization and integrative analysis of copy number variations in schizophrenia reveal key schizophrenia susceptibility genes.

    Science.gov (United States)

    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

    2014-11-01

    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  15. Patterns of variation among distinct alleles of the Flag silk gene from Nephila clavipes.

    Science.gov (United States)

    Higgins, Linden E; White, Sheryl; Nuñez-Farfán, Juan; Vargas, Jesus

    2007-02-20

    Spider silk proteins and their genes are very attractive to researchers in a wide range of disciplines because they permit linking many levels of organization. However, hypotheses of silk gene evolution have been built primarily upon single sequences of each gene each species, and little is known about allelic variation within a species. Silk genes are known for their repeat structure with high levels of homogenization of nucleotide and amino acid sequence among repeated units. One common explanation for this homogeneity is gene convergence. To test this model, we sequenced multiple alleles of one intron-exon segment from the Flag gene from four populations of the spider Nephila clavipes and compared the new sequences to a published sequence. Our analysis revealed very high levels of heterozygosity in this gene, with no pattern of population differentiation. There was no evidence of gene convergence within any of these alleles, with high levels of nucleotide and amino acid substitution among the repeating motifs. Our data suggest that minimally, there is relaxed selection on mutations in this gene and that there may actually be positive selection for heterozygosity.

  16. Gene expression and variation in social aggression by queens of the harvester ant Pogonomyrmex californicus.

    Science.gov (United States)

    Helmkampf, Martin; Mikheyev, Alexander S; Kang, Yun; Fewell, Jennifer; Gadau, Jürgen

    2016-08-01

    A key requirement for social cooperation is the mitigation and/or social regulation of aggression towards other group members. Populations of the harvester ant Pogonomyrmex californicus show the alternate social phenotypes of queens founding nests alone (haplometrosis) or in groups of unrelated yet cooperative individuals (pleometrosis). Pleometrotic queens display an associated reduction in aggression. To understand the proximate drivers behind this variation, we placed foundresses of the two populations into social environments with queens from the same or the alternate population, and measured their behaviour and head gene expression profiles. A proportion of queens from both populations behaved aggressively, but haplometrotic queens were significantly more likely to perform aggressive acts, and conflict escalated more frequently in pairs of haplometrotic queens. Whole-head RNA sequencing revealed variation in gene expression patterns, with the two populations showing moderate differentiation in overall transcriptional profile, suggesting that genetic differences underlie the two founding strategies. The largest detected difference, however, was associated with aggression, regardless of queen founding type. Several modules of coregulated genes, involved in metabolism, immune system and neuronal function, were found to be upregulated in highly aggressive queens. Conversely, nonaggressive queens exhibited a striking pattern of upregulation in chemosensory genes. Our results highlight that the social phenotypes of cooperative vs. solitary nest founding tap into a set of gene regulatory networks that seem to govern aggression level. We also present a number of highly connected hub genes associated with aggression, providing opportunity to further study the genetic underpinnings of social conflict and tolerance.

  17. Identifying the genetic variation of gene expression using gene sets: application of novel gene Set eQTL approach to PharmGKB and KEGG.

    Directory of Open Access Journals (Sweden)

    Ryan Abo

    Full Text Available Genetic variation underlying the regulation of mRNA gene expression in humans may provide key insights into the molecular mechanisms of human traits and complex diseases. Current statistical methods to map genetic variation associated with mRNA gene expression have typically applied standard linkage and/or association methods; however, when genome-wide SNP and mRNA expression data are available performing all pair wise comparisons is computationally burdensome and may not provide optimal power to detect associations. Consideration of different approaches to account for the high dimensionality and multiple testing issues may provide increased efficiency and statistical power. Here we present a novel approach to model and test the association between genetic variation and mRNA gene expression levels in the context of gene sets (GSs and pathways, referred to as gene set - expression quantitative trait loci analysis (GS-eQTL. The method uses GSs to initially group SNPs and mRNA expression, followed by the application of principal components analysis (PCA to collapse the variation and reduce the dimensionality within the GSs. We applied GS-eQTL to assess the association between SNP and mRNA expression level data collected from a cell-based model system using PharmGKB and KEGG defined GSs. We observed a large number of significant GS-eQTL associations, in which the most significant associations arose between genetic variation and mRNA expression from the same GS. However, a number of associations involving genetic variation and mRNA expression from different GSs were also identified. Our proposed GS-eQTL method effectively addresses the multiple testing limitations in eQTL studies and provides biological context for SNP-expression associations.

  18. Natural variation for gene expression responses to abiotic stress in maize.

    Science.gov (United States)

    Waters, Amanda J; Makarevitch, Irina; Noshay, Jaclyn; Burghardt, Liana T; Hirsch, Candice N; Hirsch, Cory D; Springer, Nathan M

    2017-02-01

    Plants respond to abiotic stress through a variety of physiological, biochemical, and transcriptional mechanisms. Many genes exhibit altered levels of expression in response to abiotic stress, which requires concerted action of both cis- and trans-regulatory features. In order to study the variability in transcriptome response to abiotic stress, RNA sequencing was performed using 14-day-old maize seedlings of inbreds B73, Mo17, Oh43, PH207 and B37 under control, cold and heat conditions. Large numbers of genes that responded differentially to stress between parental inbred lines were identified. RNA sequencing was also performed on similar tissues of the F1 hybrids produced by crossing B73 and each of the three other inbred lines. By evaluating allele-specific transcript abundance in the F1 hybrids, we were able to measure the abundance of cis- and trans-regulatory variation between genotypes for both steady-state and stress-responsive expression differences. Although examples of trans-regulatory variation were observed, cis-regulatory variation was more common for both steady-state and stress-responsive expression differences. The genes with cis-allelic variation for response to cold or heat stress provided an opportunity to study the basis for regulatory diversity.

  19. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Science.gov (United States)

    Mayer, Melanie G; Rödelsperger, Christian; Witte, Hanh; Riebesell, Metta; Sommer, Ralf J

    2015-06-01

    Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as major target for

  20. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Directory of Open Access Journals (Sweden)

    Melanie G Mayer

    2015-06-01

    Full Text Available Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as

  1. Conceptual Variation in the Depiction of Gene Function in Upper Secondary School Textbooks

    Science.gov (United States)

    Gericke, Niklas Markus; Hagberg, Mariana

    2010-10-01

    This paper explores conceptual variation in the depiction of gene function in upper secondary school textbooks. Historically, concepts in genetics have developed in various scientific frameworks, which has led to a level of incommensurability as concepts have changed over time within their respective frameworks. Since students may have difficulties in understanding concepts where there is implicit variation in descriptions of the same phenomena, we have developed a concept mapping instrument and applied it to study the gene function concepts in biology and chemistry textbooks that are widely used in Sweden, and others used in a selection of English speaking countries. The data were then further examined using content analysis. In the present paper we describe the conceptual variation of gene function as it is presented in the textbooks, and analyze the ways in which students’ understanding may be influenced. We conclude that it may be difficult for students to gain a modern, process-oriented understanding of gene function if textbooks are used as foundations for the planning and execution of lessons.

  2. Copy Number Variation of UGT 2B Genes in Indian Families Using Whole Genome Scans

    Directory of Open Access Journals (Sweden)

    Avinash M. Veerappa

    2016-01-01

    Full Text Available Background and Objectives. Uridine diphospho-glucuronosyltransferase 2B (UGT2B is a family of genes involved in metabolizing steroid hormones and several other xenobiotics. These UGT2B genes are highly polymorphic in nature and have distinct polymorphisms associated with specific regions around the globe. Copy number variations (CNVs status of UGT2B17 in Indian population is not known and their disease associations have been inconclusive. It was therefore of interest to investigate the CNV profile of UGT2B genes. Methods. We investigated the presence of CNVs in UGT2B genes in 31 members from eight Indian families using Affymetrix Genome-Wide Human SNP Array 6.0 chip. Results. Our data revealed >50% of the study members carried CNVs in UGT2B genes, of which 76% showed deletion polymorphism. CNVs were observed more in UGT2B17 (76.4% than in UGT2B15 (17.6%. Molecular network and pathway analysis found enrichment related to steroid metabolic process, carboxylesterase activity, and sequence specific DNA binding. Interpretation and Conclusion. We report the presence of UGT2B gene deletion and duplication polymorphisms in Indian families. Network analysis indicates the substitutive role of other possible genes in the UGT activity. The CNVs of UGT2B genes are very common in individuals indicating that the effect is neutral in causing any suspected diseases.

  3. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  4. Genetic variation in genes of the fatty acid synthesis pathway and breast cancer risk

    DEFF Research Database (Denmark)

    Campa, Daniele; McKay, James; Sinilnikova, Olga

    2009-01-01

    -binding protein), which is induced by glucose, and SREBP-1 (sterol response element-binding protein-1), which is stimulated by insulin through the PI3K/Akt signal transduction pathway. We investigated whether the genetic variability of the genes encoding for ChREBP, SREBP and FAS (respectively, MLXIPL, SREBF1...... and FASN) is related to breast cancer risk and body-mass index (BMI) by studying 1,294 breast cancer cases and 2,452 controls from the European Prospective Investigation on Cancer (EPIC). We resequenced the FAS gene and combined information of SNPs found by resequencing and SNPs from public databases....... Using a tagging approach and selecting 20 SNPs, we covered all the common genetic variation of these genes. In this study we were not able to find any statistically significant association between the SNPs in the FAS, ChREBP and SREPB-1 genes and an increased risk of breast cancer overall...

  5. Threshold-dominated regulation hides genetic variation in gene expression networks

    Directory of Open Access Journals (Sweden)

    Plahte Erik

    2007-12-01

    Full Text Available Abstract Background In dynamical models with feedback and sigmoidal response functions, some or all variables have thresholds around which they regulate themselves or other variables. A mathematical analysis has shown that when the dose-response functions approach binary or on/off responses, any variable with an equilibrium value close to one of its thresholds is very robust to parameter perturbations of a homeostatic state. We denote this threshold robustness. To check the empirical relevance of this phenomenon with response function steepnesses ranging from a near on/off response down to Michaelis-Menten conditions, we have performed a simulation study to investigate the degree of threshold robustness in models for a three-gene system with one downstream gene, using several logical input gates, but excluding models with positive feedback to avoid multistationarity. Varying parameter values representing functional genetic variation, we have analysed the coefficient of variation (CV of the gene product concentrations in the stable state for the regulating genes in absolute terms and compared to the CV for the unregulating downstream gene. The sigmoidal or binary dose-response functions in these models can be considered as phenomenological models of the aggregated effects on protein or mRNA expression rates of all cellular reactions involved in gene expression. Results For all the models, threshold robustness increases with increasing response steepness. The CVs of the regulating genes are significantly smaller than for the unregulating gene, in particular for steep responses. The effect becomes less prominent as steepnesses approach Michaelis-Menten conditions. If the parameter perturbation shifts the equilibrium value too far away from threshold, the gene product is no longer an effective regulator and robustness is lost. Threshold robustness arises when a variable is an active regulator around its threshold, and this function is maintained by

  6. Understanding gene sequence variation in the context of transcription regulation in yeast.

    Directory of Open Access Journals (Sweden)

    Irit Gat-Viks

    2010-01-01

    Full Text Available DNA sequence polymorphism in a regulatory protein can have a widespread transcriptional effect. Here we present a computational approach for analyzing modules of genes with a common regulation that are affected by specific DNA polymorphisms. We identify such regulatory-linkage modules by integrating genotypic and expression data for individuals in a segregating population with complementary expression data of strains mutated in a variety of regulatory proteins. Our procedure searches simultaneously for groups of co-expressed genes, for their common underlying linkage interval, and for their shared regulatory proteins. We applied the method to a cross between laboratory and wild strains of S. cerevisiae, demonstrating its ability to correctly suggest modules and to outperform extant approaches. Our results suggest that middle sporulation genes are under the control of polymorphism in the sporulation-specific tertiary complex Sum1p/Rfm1p/Hst1p. In another example, our analysis reveals novel inter-relations between Swi3 and two mitochondrial inner membrane proteins underlying variation in a module of aerobic cellular respiration genes. Overall, our findings demonstrate that this approach provides a useful framework for the systematic mapping of quantitative trait loci and their role in gene expression variation.

  7. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    OpenAIRE

    DWINITA WIKAN UTAMI; KALIA BARNITA; SITI YURIAH; IDA HANARIDA

    2011-01-01

    Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufip...

  8. Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in Aggressiveness of Prostate Cancer

    Science.gov (United States)

    2015-10-01

    and to determine the association of genetic variants with prostate cancer aggressiveness. Tasks were also proposed in the reporting period (Year 1) to...data and to determine the association of genetic variants with prostate cancer aggressiveness, and summarize data and develop a manuscript. We also...AWARD NUMBER: W81XWH-14-1-0453 TITLE: Genetic Variations in SLCO Transporter Genes Contributing to Racial Disparity in Aggressiveness of

  9. A relative variation-based method to unraveling gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Yali Wang

    Full Text Available Gene regulatory network (GRN reconstruction is essential in understanding the functioning and pathology of a biological system. Extensive models and algorithms have been developed to unravel a GRN. The DREAM project aims to clarify both advantages and disadvantages of these methods from an application viewpoint. An interesting yet surprising observation is that compared with complicated methods like those based on nonlinear differential equations, etc., methods based on a simple statistics, such as the so-called Z-score, usually perform better. A fundamental problem with the Z-score, however, is that direct and indirect regulations can not be easily distinguished. To overcome this drawback, a relative expression level variation (RELV based GRN inference algorithm is suggested in this paper, which consists of three major steps. Firstly, on the basis of wild type and single gene knockout/knockdown experimental data, the magnitude of RELV of a gene is estimated. Secondly, probability for the existence of a direct regulation from a perturbed gene to a measured gene is estimated, which is further utilized to estimate whether a gene can be regulated by other genes. Finally, the normalized RELVs are modified to make genes with an estimated zero in-degree have smaller RELVs in magnitude than the other genes, which is used afterwards in queuing possibilities of the existence of direct regulations among genes and therefore leads to an estimate on the GRN topology. This method can in principle avoid the so-called cascade errors under certain situations. Computational results with the Size 100 sub-challenges of DREAM3 and DREAM4 show that, compared with the Z-score based method, prediction performances can be substantially improved, especially the AUPR specification. Moreover, it can even outperform the best team of both DREAM3 and DREAM4. Furthermore, the high precision of the obtained most reliable predictions shows that the suggested algorithm may be

  10. Regulation of flowering in rice: two florigen genes, a complex gene network, and natural variation.

    Science.gov (United States)

    Tsuji, Hiroyuki; Taoka, Ken-ichiro; Shimamoto, Ko

    2011-02-01

    Photoperiodic control of flowering time consists of a complicated network that converges into the generation of a mobile flowering signal called florigen. Recent advances identifying the protein FT/Hd3a as the molecular nature responsible for florigen activity have focused current research on florigen genes as the important output of this complex signaling network. Rice is a model system for short-day plants and recent progress in elucidating the flowering network from rice and Arabidopsis, a long-day plant, provides an evolutionarily comparative view of the photoperiodic flowering pathway. This review summarizes photoperiodic flowering control in rice, including the interaction of complex layers of gene networks contributed from evolutionarily unique factors and the regulatory adaptation of conserved factors.

  11. Novel rare variations of the oxytocin receptor (OXTR) gene in autism spectrum disorder individuals.

    Science.gov (United States)

    Liu, Xiaoxi; Kawashima, Minae; Miyagawa, Taku; Otowa, Takeshi; Latt, Khun Zaw; Thiri, Myo; Nishida, Hisami; Sugiyama, Toshiro; Tsurusaki, Yoshinori; Matsumoto, Naomichi; Mabuchi, Akihiko; Tokunaga, Katsushi; Sasaki, Tsukasa

    2015-01-01

    The oxytocin receptor (OXTR) gene has been implicated as a risk gene for autism spectrum disorder (ASD)-a neurodevelopmental disorder with essential features of impairments in social communication and reciprocal interaction. The genetic associations between common variations in OXTR and ASD have been reported in multiple ethnic populations. However, little is known about the distribution of rare variations within OXTR in ASD patients. In this study, we resequenced the full length of OXTR in 105 ASD individuals using an approach that combined the power of next-generation sequencing technology, long-range PCR and DNA pooling. We demonstrated that rare variants with minor allele frequency as low as 0.05% could be reliably detected by our method. We identified 28 novel variants including potential functional variants in the intron region and one rare missense variant (R150S). We subsequently performed Sanger sequencing and validated five novel variants located in previously suggested candidate regions in ASD individuals. Further sequencing of 312 healthy subjects showed that the burden of rare variants is significantly higher in ASDs compared with healthy individuals. Our results support that the rare variation in OXTR gene might be involved in ASD.

  12. Effects of abhydrolase domain containing 5 gene (ABHD5) expression and variations on chicken fat metabolism.

    Science.gov (United States)

    Ouyang, Hongjia; Liu, Qing; Xu, Jiguo; Zeng, Fang; Pang, Xiaolin; Jebessa, Endashaw; Liang, Shaodong; Nie, Qinghua; Zhang, Xiquan

    2016-01-01

    Abhydrolase domain containing 5 gene (ABHD5), also known as comparative gene identification 58 (CGI-58), is a member of the α/β-hydrolase family as a protein cofactor of ATGL stimulating its triacylglycerol hydrolase activity. In this study, we aim to characterize the expression and variations of ABHD5 and to study their functions in chicken fat metabolism. We compared the ABHD5 expression level in various tissues and under different nutrition conditions, identified the variations of ABHD5, and associated them with production traits in an F2 resource population of chickens. Overexpression analysis with two different genotypes and siRNA interfering analysis of ABHD5 were performed in chicken preadipocytes. Chicken ABDH5 was expressed widely and most predominantly in adipose tissue. Five SNPs of the ABHD5 gene were identified and genotyped in the F2 resource population. The c.490C > T SNP was associated with subcutaneous fat thickness (P  C SNP was also associated with chicken body weight (P chicken preadipocytes, overexpression of wild type ABDH5 did not affect the mRNA level of ATGL (adipose triglyceride lipase) but markedly decreased (P chickens with a high fat diet. These results suggest that expression and variations of ABHD5 may affect fat metabolism through regulating the activity of ATGL in chickens.

  13. Contribution of haplotypes across the fibrinogen gene cluster to variation in risk of myocardial infarction.

    Science.gov (United States)

    Mannila, Maria Nastase; Eriksson, Per; Lundman, Pia; Samnegård, Ann; Boquist, Susanna; Ericsson, Carl-Göran; Tornvall, Per; Hamsten, Anders; Silveira, Angela

    2005-03-01

    Fibrinogen has consistently been recognized as an independent predictor of myocardial infarction (MI). Multiple mechanisms link fibrinogen to MI; therefore disentangling the factors underlying variation in plasma fibrinogen concentration is essential. Candidate regions in the fibrinogen gamma (FGG), alpha (FGA) and beta (FGB) genes were screened for single nucleotide polymorphisms (SNPs). Several novel SNPs were detected in the FGG and FGA genes in addition to the previously known SNPs in the fibrinogen genes. Tight linkage disequilibrium extending over various physical distances was observed between most SNPs. Consequently, eight SNPs were chosen and determined in 377 postinfarction patients and 387 healthy individuals. None of the SNPs were associated with plasma fibrinogen concentration or MI. Haplotype analyses revealed a consistent pattern of haplotypes associated with variation in risk of MI. Of the four haplotypes inferred using the FGA -58G>A and FGG 1299 +79T>C SNPs, the most frequent haplotype, FGG-FGA*1 (prevalence 46.6%), was associated with increased risk of MI (OR 1.51; 95%CI 1.18, 1.93), whereas the least frequent haplotype, FGG-FGA*4 (11.8%), was associated with lower risk of MI (OR 0.79 95%CI 0.64, 0.98). In conclusion, fibrinogen haplotypes, but not SNPs in isolation, are associated with variation in risk of MI.

  14. Genetic variations of glycinin subunit genes among cultivated and wild type soybean species

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Glycinin is a predominant storage protein in most soybean accessions. It is a hexamer constituted by five major subunits, which can be classified into two groups. Group Ⅰ contains Gl, G2 and G3, and Group Ⅱ contains G4 and G5. The genes encoding these subunits have been designated from Gyl to Gy5, respectively. In the present study, Gyl genomic fragments were cloned from wild accessions of subgenera Glycine glycine, Glycine soja and a cultivar of Glycine max. Their sequences and the deduced amino acid sequences were compared. The residues critical for assembling of G1 subunits from the wild perennial accession were conservative. The Gy4 fragments were cloned from two wild perennial accessions and compared with that from subgenus Soja. The intron 3 of Gy4 had abundant variations between the subgenera G. Soja and G. Glycine as well as within the subgenus G. Glycine. Abundant variations existed in the disordered regions 3 and 4 of G4 subunits from two wild perennial accessions. The genomic organization of glycinin genes was analyzed in 19 accessions from subgenera Soja and Glycine. The hybridization patterns were identical among the accessions of subgenus Soja. On the contrary, abundant polymorphisms existed between the accessions from subgenus Glycine. These results indicated that glycinin genes have high degree of conservation within subgenus Soja but more variations within subgenus Glycine.

  15. Associations between dopamine D4 receptor gene variation with both infidelity and sexual promiscuity.

    Directory of Open Access Journals (Sweden)

    Justin R Garcia

    Full Text Available BACKGROUND: Human sexual behavior is highly variable both within and between populations. While sex-related characteristics and sexual behavior are central to evolutionary theory (sexual selection, little is known about the genetic bases of individual variation in sexual behavior. The variable number tandem repeats (VNTR polymorphism in exon III of the human dopamine D4 receptor gene (DRD4 has been correlated with an array of behavioral phenotypes and may be predicatively responsible for variation in motivating some sexual behaviors, particularly promiscuity and infidelity. METHODOLOGY/PRINCIPAL FINDINGS: We administered an anonymous survey on personal history of sexual behavior and intimate relationships to 181 young adults. We also collected buccal wash samples and genotyped the DRD4 VNTR. Here we show that individuals with at least one 7-repeat allele (7R+ report a greater categorical rate of promiscuous sexual behavior (i.e., having ever had a "one-night stand" and report a more than 50% increase in instances of sexual infidelity. CONCLUSIONS/SIGNIFICANCE: DRD4 VNTR genotype varies considerably within and among populations and has been subject to relatively recent, local selective pressures. Individual differences in sexual behavior are likely partially mediated by individual genetic variation in genes coding for motivation and reward in the brain. Conceptualizing these findings in terms of r/K selection theory suggests a mechanism for selective pressure for and against the 7R+ genotype that may explain the considerable global allelic variation for this polymorphism.

  16. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Energy Technology Data Exchange (ETDEWEB)

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  17. Association of variation in Fc gamma receptor 3B gene copy number with rheumatoid arthritis in Caucasian samples

    NARCIS (Netherlands)

    McKinney, Cushla; Fanciulli, Manuela; Merriman, Marilyn E.; Phipps-Green, Amanda; Alizadeh, Behrooz Z.; Koeleman, Bobby P. C.; Dalbeth, Nicola; Gow, Peter J.; Harrison, Andrew A.; Highton, John; Jones, Peter B.; Stamp, Lisa K.; Steer, Sophia; Barrera, Pilar; Coenen, Marieke J. H.; Franke, Barbara; van Riel, Piet L. C. M.; Vyse, Tim J.; Aitman, Tim J.; Radstake, Timothy R. D. J.; Merriman, Tony R.

    2010-01-01

    Objective There is increasing evidence that variation in gene copy number (CN) influences clinical phenotype. The low-affinity Fc gamma receptor 3B (FCGR3B) located in the FCGR gene cluster is a CN polymorphic gene involved in the recruitment to sites of inflammation and activation of polymorphonucl

  18. Sweet taste receptor gene variation and aspartame taste in primates and other species.

    Science.gov (United States)

    Li, Xia; Bachmanov, Alexander A; Maehashi, Kenji; Li, Weihua; Lim, Raymond; Brand, Joseph G; Beauchamp, Gary K; Reed, Danielle R; Thai, Chloe; Floriano, Wely B

    2011-06-01

    Aspartame is a sweetener added to foods and beverages as a low-calorie sugar replacement. Unlike sugars, which are apparently perceived as sweet and desirable by a range of mammals, the ability to taste aspartame varies, with humans, apes, and Old World monkeys perceiving aspartame as sweet but not other primate species. To investigate whether the ability to perceive the sweetness of aspartame correlates with variations in the DNA sequence of the genes encoding sweet taste receptor proteins, T1R2 and T1R3, we sequenced these genes in 9 aspartame taster and nontaster primate species. We then compared these sequences with sequences of their orthologs in 4 other nontasters species. We identified 9 variant sites in the gene encoding T1R2 and 32 variant sites in the gene encoding T1R3 that distinguish aspartame tasters and nontasters. Molecular docking of aspartame to computer-generated models of the T1R2 + T1R3 receptor dimer suggests that species variation at a secondary, allosteric binding site in the T1R2 protein is the most likely origin of differences in perception of the sweetness of aspartame. These results identified a previously unknown site of aspartame interaction with the sweet receptor and suggest that the ability to taste aspartame might have developed during evolution to exploit a specialized food niche.

  19. Genetic variation in the immunosuppression pathway genes and breast cancer susceptibility

    DEFF Research Database (Denmark)

    Lei, Jieping; Rudolph, Anja; Moysich, Kirsten B

    2016-01-01

    Immunosuppression plays a pivotal role in assisting tumors to evade immune destruction and promoting tumor development. We hypothesized that genetic variation in the immunosuppression pathway genes may be implicated in breast cancer tumorigenesis. We included 42,510 female breast cancer cases.......5 × 10(-4) and 0.63, respectively). Our data provide evidence that the immunosuppression pathway genes STAT3, IL5, and GM-CSF may be novel susceptibility loci for breast cancer in women of European ancestry....... and 40,577 controls of European ancestry from 37 studies in the Breast Cancer Association Consortium (2015) with available genotype data for 3595 single nucleotide polymorphisms (SNPs) in 133 candidate genes. Associations between genotyped SNPs and overall breast cancer risk, and secondarily according...

  20. Clinal variation at phenology-related genes in spruce: parallel evolution in FTL2 and Gigantea?

    Science.gov (United States)

    Chen, Jun; Tsuda, Yoshiaki; Stocks, Michael; Källman, Thomas; Xu, Nannan; Kärkkäinen, Katri; Huotari, Tea; Semerikov, Vladimir L; Vendramin, Giovanni G; Lascoux, Martin

    2014-07-01

    Parallel clines in different species, or in different geographical regions of the same species, are an important source of information on the genetic basis of local adaptation. We recently detected latitudinal clines in SNPs frequencies and gene expression of candidate genes for growth cessation in Scandinavian populations of Norway spruce (Picea abies). Here we test whether the same clines are also present in Siberian spruce (P. obovata), a close relative of Norway spruce with a different Quaternary history. We sequenced nine candidate genes and 27 control loci and genotyped 14 SSR loci in six populations of P. obovata located along the Yenisei river from latitude 56°N to latitude 67°N. In contrast to Scandinavian Norway spruce that both departs from the standard neutral model (SNM) and shows a clear population structure, Siberian spruce populations along the Yenisei do not depart from the SNM and are genetically unstructured. Nonetheless, as in Norway spruce, growth cessation is significantly clinal. Polymorphisms in photoperiodic (FTL2) and circadian clock (Gigantea, GI, PRR3) genes also show significant clinal variation and/or evidence of local selection. In GI, one of the variants is the same as in Norway spruce. Finally, a strong cline in gene expression is observed for FTL2, but not for GI. These results, together with recent physiological studies, confirm the key role played by FTL2 and circadian clock genes in the control of growth cessation in spruce species and suggest the presence of parallel adaptation in these two species.

  1. Candidate Gene Approach for Parasite Resistance in Sheep – Variation in Immune Pathway Genes and Association with Fecal Egg Count

    Science.gov (United States)

    Periasamy, Kathiravan; Pichler, Rudolf; Poli, Mario; Cristel, Silvina; Cetrá, Bibiana; Medus, Daniel; Basar, Muladno; A. K., Thiruvenkadan; Ramasamy, Saravanan; Ellahi, Masroor Babbar; Mohammed, Faruque; Teneva, Atanaska; Shamsuddin, Mohammed; Podesta, Mario Garcia; Diallo, Adama

    2014-01-01

    Sheep chromosome 3 (Oar3) has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs) within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF) did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05) in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have potential for

  2. Candidate gene approach for parasite resistance in sheep--variation in immune pathway genes and association with fecal egg count.

    Directory of Open Access Journals (Sweden)

    Kathiravan Periasamy

    Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have

  3. Natural variation in DNA methylation in ribosomal RNA genes of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Richards Eric J

    2008-09-01

    Full Text Available Abstract Background DNA methylation is an important biochemical mark that silences repetitive sequences, such as transposons, and reinforces epigenetic gene expression states. An important class of repetitive genes under epigenetic control in eukaryotic genomes encodes ribosomal RNA (rRNA transcripts. The ribosomal genes coding for the 45S rRNA precursor of the three largest eukaryotic ribosomal RNAs (18S, 5.8S, and 25–28S are found in nucleolus organizer regions (NORs, comprised of hundreds to thousands of repeats, only some of which are expressed in any given cell. An epigenetic switch, mediated by DNA methylation and histone modification, turns rRNA genes on and off. However, little is known about the mechanisms that specify and maintain the patterns of NOR DNA methylation. Results Here, we explored the extent of naturally-occurring variation in NOR DNA methylation among accessions of the flowering plant Arabidopsis thaliana. DNA methylation in coding regions of rRNA genes was positively correlated with copy number of 45S rRNA gene and DNA methylation in the intergenic spacer regions. We investigated the inheritance of NOR DNA methylation patterns in natural accessions with hypomethylated NORs in inter-strain crosses and defined three different categories of inheritance in F1 hybrids. In addition, subsequent analysis of F2 segregation for NOR DNA methylation patterns uncovered different patterns of inheritance. We also revealed that NOR DNA methylation in the Arabidopsis accession Bor-4 is influenced by the vim1-1 (variant in methylation 1-1 mutation, but the primary effect is specified by the NORs themselves. Conclusion Our results indicate that the NORs themselves are the most significant determinants of natural variation in NOR DNA methylation. However, the inheritance of NOR DNA methylation suggests the operation of a diverse set of mechanisms, including inheritance of parental methylation patterns, reconfiguration of parental NOR DNA

  4. Variation in Telangiectasia Predisposing Genes Is Associated With Overall Radiation Toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Tanteles, George A. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Murray, Robert J.S. [Department of Genetics, University of Leicester, Leicester (United Kingdom); Mills, Jamie [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Barwell, Julian [Department of Genetics, University of Leicester, Leicester (United Kingdom); Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Chakraborti, Prabir [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Chan, Steve [Department of Clinical Oncology, Nottingham University Hospitals NHS Trust, Nottingham (United Kingdom); Cheung, Kwok-Leung [Division of Breast Surgery, University of Nottingham, Nottingham (United Kingdom); Ennis, Dawn [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Khurshid, Nazish [Department of Genetics, University of Leicester, Leicester (United Kingdom); Lambert, Kelly [Department of Breast Surgery, University Hospitals of Leicester, Glenfield Hospital, Leicester (United Kingdom); Machhar, Rohan; Meisuria, Mitul [Department of Genetics, University of Leicester, Leicester (United Kingdom); Osman, Ahmed; Peat, Irene [Department of Cancer Studies and Molecular Medicine, University Hospitals of Leicester, Leicester Royal Infirmary, Leicester (United Kingdom); Sahota, Harjinder [Department of Genetics, University of Leicester, Leicester (United Kingdom); Woodings, Pamela [Department of Clinical Oncology, Derby Hospitals NHS Foundation Trust, Derby (United Kingdom); Talbot, Christopher J., E-mail: cjt14@le.ac.uk [Department of Genetics, University of Leicester, Leicester (United Kingdom); and others

    2012-11-15

    Purpose: In patients receiving radiotherapy for breast cancer where the heart is within the radiation field, cutaneous telangiectasiae could be a marker of potential radiation-induced heart disease. We hypothesized that single nucleotide polymorphisms (SNPs) in genes known to cause heritable telangiectasia-associated disorders could predispose to such late, normal tissue vascular damage. Methods and Materials: The relationship between cutaneous telangiectasia as a late normal tissue radiation injury phenotype in 633 breast cancer patients treated with radiotherapy was examined. Patients were clinically assessed for the presence of cutaneous telangiectasia and genotyped at nine SNPs in three candidate genes. Candidate SNPs were within the endoglin (ENG) and activin A receptor, type II-like 1 (ACVRL1) genes, mutations in which cause hereditary hemorrhagic telangiectasia and the ataxia-telangiectasia mutated (ATM) gene associated with ataxia-telangiectasia. Results: A total of 121 (19.1%) patients exhibited a degree of cutaneous telangiectasiae on clinical examination. Regression was used to examine the associations between the presence of telangiectasiae in patients who underwent breast-conserving surgery, controlling for the effects of boost and known brassiere size (n=388), and individual geno- or haplotypes. Inheritance of ACVRL1 SNPs marginally contributed to the risk of cutaneous telangiectasiae. Haplotypic analysis revealed a stronger association between inheritance of a ATM haplotype and the presence of cutaneous telangiectasiae, fibrosis and overall toxicity. No significant association was observed between telangiectasiae and the coinheritance of the candidate ENG SNPs. Conclusions: Genetic variation in the ATM gene influences reaction to radiotherapy through both vascular damage and increased fibrosis. The predisposing variation in the ATM gene will need to be better defined to optimize it as a predictive marker for assessing radiotherapy late effects.

  5. Genetic variation in mitotic regulatory pathway genes is associated with breast tumor grade

    Science.gov (United States)

    Purrington, Kristen S.; Slettedahl, Seth; Bolla, Manjeet K.; Michailidou, Kyriaki; Czene, Kamila; Nevanlinna, Heli; Bojesen, Stig E.; Andrulis, Irene L.; Cox, Angela; Hall, Per; Carpenter, Jane; Yannoukakos, Drakoulis; Haiman, Christopher A.; Fasching, Peter A.; Mannermaa, Arto; Winqvist, Robert; Brenner, Hermann; Lindblom, Annika; Chenevix-Trench, Georgia; Benitez, Javier; Swerdlow, Anthony; Kristensen, Vessela; Guénel, Pascal; Meindl, Alfons; Darabi, Hatef; Eriksson, Mikael; Fagerholm, Rainer; Aittomäki, Kristiina; Blomqvist, Carl; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Wang, Xianshu; Olswold, Curtis; Olson, Janet E.; Mulligan, Anna Marie; Knight, Julia A.; Tchatchou, Sandrine; Reed, Malcolm W.R.; Cross, Simon S.; Liu, Jianjun; Li, Jingmei; Humphreys, Keith; Clarke, Christine; Scott, Rodney; Fostira, Florentia; Fountzilas, George; Konstantopoulou, Irene; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Ekici, Arif B.; Hartmann, Arndt; Beckmann, Matthias W.; Hartikainen, Jaana M.; Kosma, Veli-Matti; Kataja, Vesa; Jukkola-Vuorinen, Arja; Pylkäs, Katri; Kauppila, Saila; Dieffenbach, Aida Karina; Stegmaier, Christa; Arndt, Volker; Margolin, Sara; Balleine, Rosemary; Arias Perez, Jose Ignacio; Pilar Zamora, M.; Menéndez, Primitiva; Ashworth, Alan; Jones, Michael; Orr, Nick; Arveux, Patrick; Kerbrat, Pierre; Truong, Thérèse; Bugert, Peter; Toland, Amanda E.; Ambrosone, Christine B.; Labrèche, France; Goldberg, Mark S.; Dumont, Martine; Ziogas, Argyrios; Lee, Eunjung; Dite, Gillian S.; Apicella, Carmel; Southey, Melissa C.; Long, Jirong; Shrubsole, Martha; Deming-Halverson, Sandra; Ficarazzi, Filomena; Barile, Monica; Peterlongo, Paolo; Durda, Katarzyna; Jaworska-Bieniek, Katarzyna; Tollenaar, Robert A.E.M.; Seynaeve, Caroline; Brüning, Thomas; Ko, Yon-Dschun; Van Deurzen, Carolien H.M.; Martens, John W.M.; Kriege, Mieke; Figueroa, Jonine D.; Chanock, Stephen J.; Lissowska, Jolanta; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Schneeweiss, Andreas; Tapper, William J.; Gerty, Susan M.; Durcan, Lorraine; Mclean, Catriona; Milne, Roger L.; Baglietto, Laura; dos Santos Silva, Isabel; Fletcher, Olivia; Johnson, Nichola; Van'T Veer, Laura J.; Cornelissen, Sten; Försti, Asta; Torres, Diana; Rüdiger, Thomas; Rudolph, Anja; Flesch-Janys, Dieter; Nickels, Stefan; Weltens, Caroline; Floris, Giuseppe; Moisse, Matthieu; Dennis, Joe; Wang, Qin; Dunning, Alison M.; Shah, Mitul; Brown, Judith; Simard, Jacques; Anton-Culver, Hoda; Neuhausen, Susan L.; Hopper, John L.; Bogdanova, Natalia; Dörk, Thilo; Zheng, Wei; Radice, Paolo; Jakubowska, Anna; Lubinski, Jan; Devillee, Peter; Brauch, Hiltrud; Hooning, Maartje; García-Closas, Montserrat; Sawyer, Elinor; Burwinkel, Barbara; Marmee, Frederick; Eccles, Diana M.; Giles, Graham G.; Peto, Julian; Schmidt, Marjanka; Broeks, Annegien; Hamann, Ute; Chang-Claude, Jenny; Lambrechts, Diether; Pharoah, Paul D.P.; Easton, Douglas; Pankratz, V. Shane; Slager, Susan; Vachon, Celine M.; Couch, Fergus J.

    2014-01-01

    Mitotic index is an important component of histologic grade and has an etiologic role in breast tumorigenesis. Several small candidate gene studies have reported associations between variation in mitotic genes and breast cancer risk. We measured associations between 2156 single nucleotide polymorphisms (SNPs) from 194 mitotic genes and breast cancer risk, overall and by histologic grade, in the Breast Cancer Association Consortium (BCAC) iCOGS study (n = 39 067 cases; n = 42 106 controls). SNPs in TACC2 [rs17550038: odds ratio (OR) = 1.24, 95% confidence interval (CI) 1.16–1.33, P = 4.2 × 10−10) and EIF3H (rs799890: OR = 1.07, 95% CI 1.04–1.11, P = 8.7 × 10−6) were significantly associated with risk of low-grade breast cancer. The TACC2 signal was retained (rs17550038: OR = 1.15, 95% CI 1.07–1.23, P = 7.9 × 10−5) after adjustment for breast cancer risk SNPs in the nearby FGFR2 gene, suggesting that TACC2 is a novel, independent genome-wide significant genetic risk locus for low-grade breast cancer. While no SNPs were individually associated with high-grade disease, a pathway-level gene set analysis showed that variation across the 194 mitotic genes was associated with high-grade breast cancer risk (P = 2.1 × 10−3). These observations will provide insight into the contribution of mitotic defects to histological grade and the etiology of breast cancer. PMID:24927736

  6. Copy number variation of age-related macular degeneration relevant genes in the Korean population.

    Directory of Open Access Journals (Sweden)

    Jung Hyun Park

    Full Text Available PURPOSE: Studies that analyzed single nucleotide polymorphisms (SNP in various genes have shown that genetic factors are strongly associated with age-related macular degeneration (AMD susceptibility. Copy number variation (CNV may be an additional type of genetic variation that contributes to AMD pathogenesis. This study investigated CNV in 4 AMD-relevant genes in Korean AMD patients and control subjects. METHODS: Four CNV candidate regions located in AMD-relevant genes (VEGFA, ARMS2/HTRA1, CFH and VLDLR, were selected based on the outcomes of our previous study which elucidated common CNVs in the Asian populations. Real-time PCR based TaqMan Copy Number Assays were performed on CNV candidates in 273 AMD patients and 257 control subjects. RESULTS: The predicted copy number (PCN, 0, 1, 2 or 3+ of each region was called using the CopyCaller program. All candidate genes except ARMS2/HTRA1 showed CNV in at least one individual, in which losses of VEGFA and VLDLR represent novel findings in the Asian population. When the frequencies of PCN were compared, only the gain in VLDLR showed significant differences between AMD patients and control subjects (p = 0.025. Comparisons of the raw copy values (RCV revealed that 3 of 4 candidate genes showed significant differences (2.03 vs. 1.92 for VEGFA, p<0.01; 2.01 vs. 1.97 for CFH, p<0.01; 1.97 vs. 2.01, p<0.01 for ARMS2/HTRA1. CONCLUSION: CNVs located in AMD-relevant genes may be associated with AMD susceptibility. Further investigations encompassing larger patient cohorts are needed to elucidate the role of CNV in AMD pathogenesis.

  7. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Science.gov (United States)

    Anderson, Mark T; Seifert, H Steven

    2013-01-01

    Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae when investigating

  8. Phase variation leads to the misidentification of a Neisseria gonorrhoeae virulence gene.

    Directory of Open Access Journals (Sweden)

    Mark T Anderson

    Full Text Available Neisseria gonorrhoeae is the causative agent of gonorrhea and an obligate pathogen of humans. The Opa proteins of these bacteria are known to mediate attachment and internalization by host cells, including neutrophils. The Opa protein repertoire of a typical N. gonorrhoeae isolate is encoded on ~11 genes distributed throughout the chromosome and is subject to stochastic changes in expression through phase variation. Together, these characteristics make Opa proteins a critical yet unpredictable aspect of any experimental investigation into the interaction of N. gonorrhoeae with host cells. The goal of this study was to identify novel virulence factors of N. gonorrhoeae by assessing the contribution of a set of uncharacterized hydrogen peroxide-induced genes to bacterial survival against neutrophil-mediated killing. To this end, a strain harboring an engineered mutation in the NGO0322 gene was identified that exhibited increased sensitivity to neutrophil-mediated killing, enhanced internalization by neutrophils, and the ability to induce high levels of neutrophil-generated reactive oxygen species. Each of these phenotypes reverted to near wild-type levels following genetic complementation of the NGO0322 mutation. However, after immunoblot analysis of Opa proteins expressed by the isogenic parent, mutant, and genetically complemented strains, it was determined that phase variation had resulted in a disparity between the Opa profiles of these strains. To determine whether Opa phase variation, rather than NGO0322 mutation, was the cause of the observed neutrophil-related phenotypes, NGO0322 function was investigated in N. gonorrhoeae strains lacking all Opa proteins or constitutively expressing the OpaD variant. In both cases, mutation of NGO0322 did not alter survival of gonococci in the presence of neutrophils. These results demonstrate the importance of controlling for the frequent and random variation in Opa protein production by N. gonorrhoeae

  9. A general scenario of Hox gene inventory variation among major sarcopterygian lineages

    Directory of Open Access Journals (Sweden)

    Wang Chaolin

    2011-01-01

    Full Text Available Abstract Background Hox genes are known to play a key role in shaping the body plan of metazoans. Evolutionary dynamics of these genes is therefore essential in explaining patterns of evolutionary diversity. Among extant sarcopterygians comprising both lobe-finned fishes and tetrapods, our knowledge of the Hox genes and clusters has largely been restricted in several model organisms such as frogs, birds and mammals. Some evolutionary gaps still exist, especially for those groups with derived body morphology or occupying key positions on the tree of life, hindering our understanding of how Hox gene inventory varied along the sarcopterygian lineage. Results We determined the Hox gene inventory for six sarcopterygian groups: lungfishes, caecilians, salamanders, snakes, turtles and crocodiles by comprehensive PCR survey and genome walking. Variable Hox genes in each of the six sarcopterygian group representatives, compared to the human Hox gene inventory, were further validated for their presence/absence by PCR survey in a number of related species representing a broad evolutionary coverage of the group. Turtles, crocodiles, birds and placental mammals possess the same 39 Hox genes. HoxD12 is absent in snakes, amphibians and probably lungfishes. HoxB13 is lost in frogs and caecilians. Lobe-finned fishes, amphibians and squamate reptiles possess HoxC3. HoxC1 is only present in caecilians and lobe-finned fishes. Similar to coelacanths, lungfishes also possess HoxA14, which is only found in lobe-finned fishes to date. Our Hox gene variation data favor the lungfish-tetrapod, turtle-archosaur and frog-salamander relationships and imply that the loss of HoxD12 is not directly related to digit reduction. Conclusions Our newly determined Hox inventory data provide a more complete scenario for evolutionary dynamics of Hox genes along the sarcopterygian lineage. Limbless, worm-like caecilians and snakes possess similar Hox gene inventories to animals with

  10. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Directory of Open Access Journals (Sweden)

    Taylor Reiter

    Full Text Available Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR, phytanol-CoA 2-hydroxylase (PHYH, and pancreatic α-amylase 2B (AMY2B. These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  11. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Science.gov (United States)

    Reiter, Taylor; Jagoda, Evelyn; Capellini, Terence D

    2016-01-01

    Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR), phytanol-CoA 2-hydroxylase (PHYH), and pancreatic α-amylase 2B (AMY2B). These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  12. [Genetic variation analysis of canine parvovirus VP2 gene in China].

    Science.gov (United States)

    Yi, Li; Cheng, Shi-Peng; Yan, Xi-Jun; Wang, Jian-Ke; Luo, Bin

    2009-11-01

    To recognize the molecular biology character, phylogenetic relationship and the state quo prevalent of Canine parvovirus (CPV), Faecal samnples from pet dogs with acute enteritis in the cities of Beijing, Wuhan, and Nanjing were collected and tested for CPV by PCR and other assay between 2006 and 2008. There was no CPV to FPV (MEV) variation by PCR-RFLP analysis in all samples. The complete ORFs of VP2 genes were obtained by PCR from 15 clinical CPVs and 2 CPV vaccine strains. All amplicons were cloned and sequenced. Analysis of the VP2 sequences showed that clinical CPVs both belong to CPV-2a subtype, and could be classified into a new cluster by amino acids contrasting which contains Tyr-->Ile (324) mutation. Besides the 2 CPV vaccine strains belong to CPV-2 subtype, and both of them have scattered variation in amino acids residues of VP2 protein. Construction of the phylogenetic tree based on CPV VP2 sequence showed these 15 CPV clinical strains were in close relationship with Korea strain K001 than CPV-2a isolates in other countries at early time, It is indicated that the canine parvovirus genetic variation was associated with location and time in some degree. The survey of CPV capsid protein VP2 gene provided the useful information for the identification of CPV types and understanding of their genetic relationship.

  13. Selection of genes associated with variations in the Circle of Willis in gerbils using suppression subtractive hybridization.

    Science.gov (United States)

    Li, Zhenkun; Huo, Xueyun; Zhang, Shuangyue; Lu, Jing; Li, Changlong; Guo, Meng; Fu, Rui; He, Zhengming; Du, Xiaoyan; Chen, Zhenwen

    2015-01-01

    Deformities in the Circle of Willis (CoW) can significantly increase the risk of cerebrovascular disease in humans. However, the molecular mechanisms underlying these deformities have not been understood. Based on our previous studies, variations in the CoW of gerbils are hereditary. A normal CoW is observed in approximately 60% of gerbils, a percentage that also applies to humans. Thus, gerbil is an ideal experimental model for studying variations in the CoW. To study the mechanisms underlying these variations, we selected genes associated with different types of the CoW using suppression subtractive hybridization (SSH). After evaluating the efficiency of SSH using quantitative real-time polymerase chain reaction (qPCR) on subtracted and unsubtracted cDNA and Southern blotting on SSH PCR products, 12 SSH libraries were established. We identified 4 genes (CST3, GNAS, GPx4 and PFN2) associated with variations in the CoW. These genes were identified with qPCR and Western blotting using 70 expressed sequence tags from the SSH libraries. Cloning and sequencing allowed us to demonstrate that the 4 genes were closely related to mouse genes. We may assume that these 4 genes play an important role in the development of variations in the CoW. This study provides a foundation for further research of genes related to development of variations in the CoW and the mechanisms of dysmorphosis of cerebral vessels.

  14. Selection of genes associated with variations in the Circle of Willis in gerbils using suppression subtractive hybridization.

    Directory of Open Access Journals (Sweden)

    Zhenkun Li

    Full Text Available Deformities in the Circle of Willis (CoW can significantly increase the risk of cerebrovascular disease in humans. However, the molecular mechanisms underlying these deformities have not been understood. Based on our previous studies, variations in the CoW of gerbils are hereditary. A normal CoW is observed in approximately 60% of gerbils, a percentage that also applies to humans. Thus, gerbil is an ideal experimental model for studying variations in the CoW. To study the mechanisms underlying these variations, we selected genes associated with different types of the CoW using suppression subtractive hybridization (SSH. After evaluating the efficiency of SSH using quantitative real-time polymerase chain reaction (qPCR on subtracted and unsubtracted cDNA and Southern blotting on SSH PCR products, 12 SSH libraries were established. We identified 4 genes (CST3, GNAS, GPx4 and PFN2 associated with variations in the CoW. These genes were identified with qPCR and Western blotting using 70 expressed sequence tags from the SSH libraries. Cloning and sequencing allowed us to demonstrate that the 4 genes were closely related to mouse genes. We may assume that these 4 genes play an important role in the development of variations in the CoW. This study provides a foundation for further research of genes related to development of variations in the CoW and the mechanisms of dysmorphosis of cerebral vessels.

  15. Recombination in pe/ppe genes contributes to genetic variation in Mycobacterium tuberculosis lineages

    KAUST Repository

    Phelan, Jody E.

    2016-02-29

    Background Approximately 10 % of the Mycobacterium tuberculosis genome is made up of two families of genes that are poorly characterized due to their high GC content and highly repetitive nature. The PE and PPE families are typified by their highly conserved N-terminal domains that incorporate proline-glutamate (PE) and proline-proline-glutamate (PPE) signature motifs. They are hypothesised to be important virulence factors involved with host-pathogen interactions, but their high genetic variability and complexity of analysis means they are typically disregarded in genome studies. Results To elucidate the structure of these genes, 518 genomes from a diverse international collection of clinical isolates were de novo assembled. A further 21 reference M. tuberculosis complex genomes and long read sequence data were used to validate the approach. SNP analysis revealed that variation in the majority of the 168 pe/ppe genes studied was consistent with lineage. Several recombination hotspots were identified, notably pe_pgrs3 and pe_pgrs17. Evidence of positive selection was revealed in 65 pe/ppe genes, including epitopes potentially binding to major histocompatibility complex molecules. Conclusions This, the first comprehensive study of the pe and ppe genes, provides important insight into M. tuberculosis diversity and has significant implications for vaccine development.

  16. Systematic variation in gene expression patterns in human cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Ross, Douglas T.; Scherf, Uwe; Eisen, Michael B.; Perou, Charles M.; Rees, Christian; Spellman, Paul; Iyer, Vishwanath; Jeffrey, Stefanie S.; Van de Rijn, Matt; Waltham, Mark; Pergamenschikov, Alexander; Lee, Jeffrey C.F.; Lashkari, Deval; Shalon, Dari; Myers, Timothy G.; Weinstein, John N.; Botstein, David; Brown, Patrick O.

    2000-01-01

    We used cDNA micro arrays to explore the variation in expression of approximately 8,000 unique genes among the 60 cell lines used in the National Cancer Institute s screen for anti-cancer drugs. Classification of the cell lines based solely on the observed patterns of gene expression revealed a correspondence to the ostensible origins of the tumors from which the cell lines were derived. The consistent relationship between the gene expression patterns and the tissue of origin allowed us to recognize outliers whose previous classification appeared incorrect. Specific features of the gene expression patterns appeared to be related to physiological properties of the cell lines, such as their doubling time in culture, drug metabolism or the interferon response. Comparison of gene expression patterns in the cell lines to those observed in normal breast tissue or in breast tumor specimens revealed features of the expression patterns in the tumors that had recognizable counterparts in specific cell lines, reflecting the tumor, stromal and inflammatory components of the tumor tissue. These results provided a novel molecular characterization of this important group of human cell lines and their relationships to tumors in vivo.

  17. Evaluation of bovine chemerin (RARRES2 gene variation on beef cattle production traits

    Directory of Open Access Journals (Sweden)

    Amanda K Lindholm-Perry

    2012-03-01

    Full Text Available A previous study in cattle based on >48,000 markers identified markers on chromosome 4 near the chemerin gene associated with average daily feed intake (ADFI in steers (P<0.008. Chemerin is an adipokine associated with obesity and metabolic syndrome in humans, representing a strong candidate gene potentially underlying the observed association. To evaluate whether the bovine chemerin gene is involved in feed intake, 16 markers within and around the gene were tested for association in the same resource population. Eleven were nominally significant for ADFI (P<0.05 and two were significant after Bonferroni correction. Two and five SNP in this region were nominally significant for the related traits of average daily gain (ADG and residual feed intake (RFI, respectively. All markers were evaluated for effects on meat quality and carcass phenotypes. Many of the markers associated with ADFI were associated with hot carcass weight (HCW, adjusted fat thickness (AFT, and marbling (P<0.05. Marker alleles that were associated with lower ADFI were also associated with lower HCW, AFT, and marbling. Markers associated with ADFI were genotyped in a validation population of steers representing 14 breeds to determine predictive merit across populations. No consistent relationships for ADFI were detected. To determine whether cattle feed intake or growth phenotypes might be related to chemerin transcript abundance, the expression of chemerin was evaluated in adipose of 114 heifers that were siblings of the steers in the discovery population. Relative chemerin transcript abundance was not correlated with ADFI, ADG, or RFI, but associations with body condition score and yearling weight were observed. We conclude that variation in the chemerin gene may underlie observed association in the resource population, but that additional research is required to determine if this variation is widespread among breeds and to develop robust markers with predictive merit across

  18. Natural variation and gene regulatory basis for the responses of asparagus beans to soil drought

    Directory of Open Access Journals (Sweden)

    Pei eXu

    2015-10-01

    Full Text Available Asparagus bean (Vigna unguiculata ssp. sesquipedalis is the Asian subspecies of cowpea, a drought-resistant legume crop native to Africa. In order to explore the genetic variation of drought responses in asparagus bean, we conducted multi-year phenotyping of drought resistance traits across the Chinese asparagus bean mini-core. The phenotypic distribution indicated that the ssp. sesquipedalis subgene pool has maintained high natural variation in drought responses despite known domestic bottleneck. Thirty-nine SNP loci were found to show an association with drought resistance via a genome-wide association study (GWAS. Whole-plant water relations were compared among four genotypes by lysimetric assay. Apparent genotypic differences in transpiration patterns and the critical soil water threshold in relation to dehydration avoidance were observed, indicating a delicate adaptive mechanism for each genotype to its own climate. Microarray gene expression analyses revealed that known drought resistance pathways such as the ABA and phosphate lipid signaling pathways are conserved between genotypes, while differential regulation of certain aquaporin genes and hormonal genes may be important for the genotypic differences. Our results suggest that divergent sensitivity to soil water content is an important mechanism configuring the genotypic specific responses to water deficit. The SNP markers identified provide useful resources for marker-assisted breeding.

  19. Melanopsin Gene Variations Interact With Season to Predict Sleep Onset and Chronotype

    Science.gov (United States)

    Roecklein, Kathryn A.; Wong, Patricia M.; Franzen, Peter L.; Hasler, Brant P.; Wood-Vasey, W. Michael; Nimgaonkar, Vishwajit L.; Miller, Megan A.; Kepreos, Kyle M.; Ferrell, Robert E.; Manuck, Stephen B.

    2013-01-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are associated with differences in sleep-wake behavior among those not suffering from a mood disorder, the authors tested associations between melanopsin gene polymorphisms and self-reported sleep timing (sleep onset and wake time) in a community sample (N = 234) of non-Hispanic Caucasian participants (age 30–54 yrs) with no history of psychological, neurological, or sleep disorders. The authors also tested the effect of melanopsin variations on differences in preferred sleep and activity timing (i.e., chronotype), which may reflect differences in circadian phase, sleep homeostasis, or both. Daylength on the day of assessment was measured and included in analyses. DNA samples were genotyped for melanopsin gene polymorphisms using fluorescence polarization. P10L genotype interacted with daylength to predict self-reported sleep onset (interaction p seasonal patterns of recurrence or exacerbation. PMID:22881342

  20. Genetic variation in telomere maintenance genes, telomere length, and lung cancer susceptibility.

    Science.gov (United States)

    Hosgood, H Dean; Cawthon, Richard; He, Xingzhou; Chanock, Stephen; Lan, Qing

    2009-11-01

    Telomeres are responsible for the protection of the chromosome ends and shortened telomere length has been associated with risk of multiple cancers. Genetic variation in telomere-related genes may alter cancer risk associated with telomere length. Using lung cancer cases (n=120) and population-based controls (n=110) from Xuanwei, China, we analyzed telomere length separately and in conjunction with single nucleotide polymorphisms in the telomere maintenance genes POT1, TERT, and TERF2, which we have previously reported were associated with risk of lung cancer in this study. POT1 rs10244817, TERT rs2075786, and TERF2 rs251796 were significantly associated with lung cancer (p(trend)telomere length was not significantly associated with risk of lung cancer (OR=1.58; 95% CI=0.79-3.18) when compared to the longest tertile of telomere length. When stratified by genotype, there was a suggestion of a dose-response relationship between tertiles of telomere length and risk of lung cancer among the POT1 rs10244817 common variant carriers (OR (95% CI)=1.33 (0.47-3.75), 3.30 (1.14-9.56), respectively) but not among variant genotype carriers (p(interaction)=0.05). Our findings provide evidence that telomere length and genetic variation in telomere maintenance genes may be associated with risk of lung cancer susceptibility and warrant replication in larger studies.

  1. Genetic variation of Taenia pisiformis collected from Sichuan, China, based on the mitochondrial cytochrome B gene.

    Science.gov (United States)

    Yang, Deying; Ren, Yongjun; Fu, Yan; Xie, Yue; Nie, Huaming; Nong, Xiang; Gu, Xiaobin; Wang, Shuxian; Peng, Xuerong; Yang, Guangyou

    2013-08-01

    Taenia pisiformis is one of the most important parasites of canines and rabbits. T. pisiformis cysticercus (the larval stage) causes severe damage to rabbit breeding, which results in huge economic losses. In this study, the genetic variation of T. pisiformis was determined in Sichuan Province, China. Fragments of the mitochondrial cytochrome b (cytb) (922 bp) gene were amplified in 53 isolates from 8 regions of T. pisiformis. Overall, 12 haplotypes were found in these 53 cytb sequences. Molecular genetic variations showed 98.4% genetic variation derived from intra-region. FST and Nm values suggested that 53 isolates were not genetically differentiated and had low levels of genetic diversity. Neutrality indices of the cytb sequences showed the evolution of T. pisiformis followed a neutral mode. Phylogenetic analysis revealed no correlation between phylogeny and geographic distribution. These findings indicate that 53 isolates of T. pisiformis keep a low genetic variation, which provide useful knowledge for monitoring changes in parasite populations for future control strategies.

  2. Common genetic variations in the CYP2R1 and GC genes are determinants of vitamin D status in Danes

    DEFF Research Database (Denmark)

    Nissen, Ioanna

    by genetic variation in vitamin D modulating genes. Twin and family-based studies indicate that genetic variation may have an appreciable influence on vitamin D status. Moreover, several candidate gene studies including two genome-wide association studies (GWAS) have found single nucleotide polymorphisms...... (SNPs) in CYP2R1, CYP24A1, CYP27B1, C10orf88, DHCR7/NADSYN1, GC and VDR genes to be associated with vitamin D status. The main hypothesis of this work was that genetically determined variation in vitamin D metabolism would influence the effect of vitamin D sources (vitamin D......), after 6 months intake of vitamin D3-fortified bread and milk (paper II) and in 92 participants in the VitDgen study after artificial UVB irradiation during winter (paper III). Common genetic variations in the CYP2R1 and GC genes were found to be important determinants of vitamin D status in three out...

  3. FTO gene variation and measures of body mass in an African population

    Directory of Open Access Journals (Sweden)

    Hattersley Andrew T

    2009-03-01

    Full Text Available Abstract Background Variation in the fat mass and obesity associated (FTO gene has been reproducibly associated with body mass index (BMI and obesity in populations of White European origin. Data from Asians and African-Americans is less conclusive. Methods We assessed the effect of 16 FTO polymorphisms on body mass in a large population of predominantly lean Gambians (Nmax 2208 participating in a long-term surveillance program providing contemporary and early-life anthropometric measurements. Results Sixteen FTO tagSNPs screened here, including several associated with BMI in Europeans, were not associated with birth weight (BWT, early weight gain in 1–2 year olds, BMI in adults (≥ 18 y, or weight-for-height (WFH z-score across all ages. No association was seen between genotype and WFH z-score or other measures of body mass. The confidence limits indicate that the effect size for WFH z-score never exceeded 0.17 units per allele copy for any SNP (excluding the three SNPs with allele Conclusion To our knowledge this is the first study of FTO gene variation in a well-characterised African population. Our results suggest that FTO gene variation does not influence measures of body mass in Gambians living a traditional lifestyle, or has a smaller effect than that detected in Europeans. These findings are not directly comparable to results from previous studies in African-Americans due to differences in study design and analysis. It is also possible that any effect of FTO genotype on body mass is of limited relevance in a lean population where little excess food is available, compared to similar ethnic populations where food supply is plentiful.

  4. Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces

    Directory of Open Access Journals (Sweden)

    Chakrabarti Bhismadev

    2011-06-01

    Full Text Available Abstract Background From an early age, humans look longer at preferred stimuli and also typically look longer at facial expressions of emotion, particularly happy faces. Atypical gaze patterns towards social stimuli are common in autism spectrum conditions (ASC. However, it is unknown whether gaze fixation patterns have any genetic basis. In this study, we tested whether variations in the cannabinoid receptor 1 (CNR1 gene are associated with gaze duration towards happy faces. This gene was selected because CNR1 is a key component of the endocannabinoid system, which is involved in processing reward, and in our previous functional magnetic resonance imaging (fMRI study, we found that variations in CNR1 modulate the striatal response to happy (but not disgust faces. The striatum is involved in guiding gaze to rewarding aspects of a visual scene. We aimed to validate and extend this result in another sample using a different technique (gaze tracking. Methods A total of 30 volunteers (13 males and 17 females from the general population observed dynamic emotional expressions on a screen while their eye movements were recorded. They were genotyped for the identical four single-nucleotide polymorphisms (SNPs in the CNR1 gene tested in our earlier fMRI study. Results Two SNPs (rs806377 and rs806380 were associated with differential gaze duration for happy (but not disgust faces. Importantly, the allelic groups associated with a greater striatal response to happy faces in the fMRI study were associated with longer gaze duration at happy faces. Conclusions These results suggest that CNR1 variations modulate the striatal function that underlies the perception of signals of social reward, such as happy faces. This suggests that CNR1 is a key element in the molecular architecture of perception of certain basic emotions. This may have implications for understanding neurodevelopmental conditions marked by atypical eye contact and facial emotion processing

  5. Variation in the oxytocin receptor gene is associated with behavioral and neural correlates of empathic accuracy

    DEFF Research Database (Denmark)

    Laursen, Helle Ruff; Siebner, Hartwig Roman; Haren, Tina;

    2014-01-01

    The neuromodulators oxytocin and serotonin have been implicated in regulating affective processes underlying empathy. Understanding this dependency, however, has been limited by a lack of objective metrics for measuring empathic performance. Here we employ a novel psychophysical method for measur......The neuromodulators oxytocin and serotonin have been implicated in regulating affective processes underlying empathy. Understanding this dependency, however, has been limited by a lack of objective metrics for measuring empathic performance. Here we employ a novel psychophysical method...... performing an irrelevant attention-demanding task. We investigated the effect of variation in the oxytocin receptor gene (OXTR) and the serotonin transporter gene (SLC6A4) on the psychophysical and neurometric variability associated with empathic performance. The OXTR rs2268498 and rs53576 polymorphisms...

  6. Variation in the sequence and modification state of the human insulin gene flanking regions.

    Science.gov (United States)

    Ullrich, A; Dull, T J; Gray, A; Philips, J A; Peter, S

    1982-04-10

    The nucleotide sequence of a highly repetitive sequence region upstream from the human insulin gene is reported. The length of this region varies between alleles in the population, and appears to be stably transmitted to the next generation in a Mendelian fashion. There is no significant correlation between the length of this sequence and two types of diabetes mellitus. We observe variation in the cleavability of a BglI recognition site downstream from the human insulin gene, which is probably due to variable nucleotide modification. This presumed modification state appears not to be inherited, and varies between tissues within an individual and between individuals for a given tissue. Both alleles in a given tissue DNA sample are modified to the same extent.

  7. Drd4 gene polymorphisms are associated with personality variation in a passerine bird.

    Science.gov (United States)

    Fidler, Andrew E; van Oers, Kees; Drent, Piet J; Kuhn, Sylvia; Mueller, Jakob C; Kempenaers, Bart

    2007-07-22

    Polymorphisms in several neurotransmitter-associated genes have been associated with variation in human personality traits. Among the more promising of such associations is that between the human dopamine receptor D4 gene (Drd4) variants and novelty-seeking behaviour. However, genetic epistasis, genotype-environment interactions and confounding environmental factors all act to obscure genotype-personality relationships. Such problems can be addressed by measuring personality under standardized conditions and by selection experiments, with both approaches only feasible with non-human animals. Looking for similar Drd4 genotype-personality associations in a free-living bird, the great tit (Parus major), we detected 73 polymorphisms (66 SNPs, 7 indels) in the P. major Drd4 orthologue. Two of the P. major Drd4 gene polymorphisms were investigated for evidence of association with novelty-seeking behaviour: a coding region synonymous single nucleotide polymorphism (SNP830) and a 15bp indel (ID15) located 5' to the putative transcription initiation site. Frequencies of the three Drd4 SNP830 genotypes, but not the ID15 genotypes, differed significantly between two P. major lines selected over four generations for divergent levels of 'early exploratory behaviour' (EEB). Strong corroborating evidence for the significance of this finding comes from the analysis of free-living, unselected birds where we found a significant association between SNP830 genotypes and differing mean EEB levels. These findings suggest that an association between Drd4 gene polymorphisms and animal personality variation predates the divergence of the avian and mammalian lineages. Furthermore, this work heralds the possibility of following microevolutionary changes in frequencies of behaviourally relevant Drd4 polymorphisms within populations where natural selection acts differentially on different personality types.

  8. Genetic variation in the serotonin transporter gene influences ERP old/new effects during recognition memory.

    Science.gov (United States)

    Ross, Robert S; Medrano, Paolo; Boyle, Kaitlin; Smolen, Andrew; Curran, Tim; Nyhus, Erika

    2015-11-01

    Recognition memory is defined as the ability to recognize a previously encountered stimulus and has been associated with spatially and temporally distinct event-related potentials (ERPs). Allelic variations of the serotonin transporter gene (SLC6A4) have recently been shown to impact memory performance. Common variants of the serotonin transporter-linked polymorphic region (5HTTLPR) of the SLC6A4 gene result in long (l) and short (s) allelic variants with carriers of the s allele having lowered transcriptional efficiency. Thus, the current study examines the effects polymorphisms of the SLC6A4 gene have on performance and ERP amplitudes commonly associated with recognition memory. Electroencephalogram (EEG), genetic, and behavioral data were collected from sixty participants as they performed an item and source memory recognition task. In both tasks, participants studied and encoded 200 words, which were then mixed with 200 new words during retrieval. Participants were monitored with EEG during the retrieval portion of each memory task. EEG electrodes were grouped into four ROIs, left anterior superior, right anterior superior, left posterior superior, and right posterior superior. ERP mean amplitudes during hits in the item and source memory task were compared to correctly recognizing new items (correct rejections). Results show that s-carriers have decreased mean hit amplitudes in both the right anterior superior ROI 1000-1500ms post stimulus during the source memory task and the left anterior superior ROI 300-500ms post stimulus during the item memory task. These results suggest that individual differences due to genetic variation of the serotonin transporter gene influences recognition memory.

  9. Genetic Variation in Osteopontin Gene Is Associated with Susceptibility to Sarcoidosis in Slovenian Population

    Directory of Open Access Journals (Sweden)

    A. Maver

    2009-01-01

    Full Text Available Sarcoidosis is a systemic inflammatory disease characterised by appearance of granulomas. Precise etiology has not been elucidated. Osteopontin (Opn is a Th1 cytokine whose levels have been found increased in granulomas and serum samples from patients with sarcoidosis. We investigated whether genetic variation in Osteopontin gene (OPN gene contributes to susceptibility to sarcoidosis. Haplotype-block structure in the OPN gene region was investigated using data from HapMap project. Three representative SNPs have been selected from each block of SNPs in linkage disequilibrium (rs11730582-C/T, rs11728697-C/T and rs4754-C/T. Genotyping was performed using TaqMan SNP Genotyping Assays on a sample of 165 patients and 284 controls. Statistical analyses of association were performed using Chi-Square test and algorithms implemented in the haplo.stats and PHASE packages. Genotyping analysis revealed a significant difference in genotype frequencies at rs4754 polymorphism in groups of patients and controls under recessive genetic model (p=0.036, OR=1.99, 95%CI=1.04-3.82, CC homozygotes being significantly over-represented in the patients group. However these results failed to reach significance after correction for multiple testing (p=0.25. The frequencies of predicted haplotypes differed between patient and control groups, frequency of TTT haplotype was found to be significantly decreased in the group of patients with sarcoidosis (p=0.014, OR=0.40, 95%CI=0.20-0.79. Our results suggest that variation in the OPN gene might be significantly associated with sarcoidosis and that the TTT haplotype in OPN may act as a protective factor in sarcoidosis.

  10. Molecular cloning and daily variations of the Period gene in a reef fish Siganus guttatus.

    Science.gov (United States)

    Park, Ji-Gweon; Park, Yong-Ju; Sugama, Nozomi; Kim, Se-Jae; Takemura, Akihiro

    2007-04-01

    As the first step in understanding the molecular oscillation of the circa rhythms in the golden rabbitfish Siganus guttatus--a reef fish with a definite lunar-related rhythmicity--we cloned and sequenced a Period gene (rfPer). The rfPer gene contained an open reading frame that encodes a protein consisting of 1,452 amino acids; this protein is highly homologous to PER proteins of vertebrates including zebrafish. Phylogenetic analyses indicated that the rfPER protein is related to the zebrafish PER1 and PER4. The expression of rfPer mRNA in the whole brain, retina, and liver under light/dark (LD) conditions increased at 06:00 h and decreased at 18:00 h, suggesting that its robust circadian rhythm occurs in neural and peripheral tissues. When daily variation in the expression in rfPer mRNA in the whole brain and cultured pineal gland were examined under LD conditions, similar expression patterns of the gene were observed with an increase around dawn. Under constant light condition, the increased expression of rfPer mRNA in the whole brain disappeared around dawn. The present results demonstrate that rfPer is related to zPer4 and possibly zPer1. The present study is the first report on the Period gene from a marine fish.

  11. Genomic Copy Number Variations of the Complement Component C4B Gene Are Associated With Chronic Central Serous Chorioretinopathy

    NARCIS (Netherlands)

    Breukink, M.B.; Schellevis, R.L.; Boon, C.J.F.; Fauser, S.; Hoyng, C.B.; Hollander, A.I. den; Jong, E.K.

    2015-01-01

    PURPOSE: Chronic central serous chorioretinopathy (cCSC) has recently been associated to variants in the complement factor H gene. To further investigate the role of the complement system in cCSC, the genomic copy number variations in the complement component 4 gene (C4) were studied. METHODS: C4A a

  12. MHC class II genes in the European badger (Meles meles) : Characterization, patterns of variation, and transcription analysis

    NARCIS (Netherlands)

    Sin, Yung Wa; Dugdale, Hannah L.; Newman, Chris; Macdonald, David W.; Burke, Terry

    2012-01-01

    The major histocompatibility complex (MHC) comprises many genes, some of which are polymorphic with numerous alleles. Sequence variation among alleles is most pronounced in exon 2 of the class II genes, which encodes the alpha 1 and beta 1 domains that form the antigen-binding site (ABS) for the pre

  13. Genetic variation and population structure of interleukin genes among seven ethnic populations from Karnataka, India

    Indian Academy of Sciences (India)

    Srilakshmi M. Raj; Diddahally R. Govindaraju; Ranajit Chakraborty

    2007-12-01

    The extent of genetic variation and the degree of genetic differentiation among seven ethnic populations from Karnataka, India (Bunt, Havyak, Iyengar, Lingayath, Smartha, Vaishya, Vokkaliga), was investigated using four single nucleotide polymorphisms (SNPs: IL-1A 4845, IL-1B 3954, IL-1B 511 and IL-1RA 2018) of the interleukin gene cluster. Allele frequencies varied by threefold among these populations, which also differed for gene diversity and heterozygosity levels. The average degree of population subdivision among these castes was low ($F_{ST} = 0.02$). However, pair-wise interpopulation differentiation ranged from 0–7%, indicating no detectable differentiation to moderate differentiation between specific populations. The results of phylogenetic analysis based on genetic distances between populations agreed with known social and cultural data on these ethnic groups. Variation in the allele frequencies, as well as differentiation, may be attributed to differential selection and demographic factors including consanguinity among the ethnic groups. Information on the distribution of functionally relevant polymorphisms among ethnic populations may be important towards developing community medicine and public health policies.

  14. Variation in the oxytocin receptor gene is associated with behavioral and neural correlates of empathic accuracy

    Directory of Open Access Journals (Sweden)

    Helle Ruff Laursen

    2014-12-01

    Full Text Available The neuromodulators oxytocin and serotonin have been implicated in regulating affective processes underlying empathy. Understanding this dependency, however, has been limited by a lack of objective metrics for measuring empathic performance. Here we employ a novel psychophysical method for measuring empathic performance that quantitatively measures the ability of subjects to decode the experience of another person’s pain. In 50 female subjects, we acquired functional magnetic resonance imaging data as they were exposed to a target subject experiencing variable degrees of pain, whilst performing an irrelevant attention-demanding task. We investigated the effect of variation in the oxytocin receptor gene (OXTR and the serotonin transporter gene (SLC6A4 on the psychophysical and neurometric variability associated with empathic performance. The OXTR rs2268498 and rs53576 polymorphisms, but not the SLC6A4 5-HTTLPR, were associated with significant differences in empathic accuracy, with CC- and AA-carriers, respectively, displaying higher empathic accuracy. For OXTR rs2268498 there was also a genotype difference in the correlation between empathic accuracy and activity in the superior temporal sulcus (STS. In OXTR rs2268498 CC-carriers, high empathic accuracy was associated with stronger responsiveness of the right STS to the observed pain. Together, the results show that genetic variation in the OXTR has significant influence on empathic accuracy and that this may be linked to variable responsivity of the STS.

  15. Allelic variation of bile salt hydrolase genes in Lactobacillus salivarius does not determine bile resistance levels.

    LENUS (Irish Health Repository)

    Fang, Fang

    2009-09-01

    Commensal lactobacilli frequently produce bile salt hydrolase (Bsh) enzymes whose roles in intestinal survival are unclear. Twenty-six Lactobacillus salivarius strains from different sources all harbored a bsh1 allele on their respective megaplasmids. This allele was related to the plasmid-borne bsh1 gene of the probiotic strain UCC118. A second locus (bsh2) was found in the chromosomes of two strains that had higher bile resistance levels. Four Bsh1-encoding allele groups were identified, defined by truncations or deletions involving a conserved residue. In vitro analyses showed that this allelic variation was correlated with widely varying bile deconjugation phenotypes. Despite very low activity of the UCC118 Bsh1 enzyme, a mutant lacking this protein had significantly lower bile resistance, both in vitro and during intestinal transit in mice. However, the overall bile resistance phenotype of this and other strains was independent of the bsh1 allele type. Analysis of the L. salivarius transcriptome upon exposure to bile and cholate identified a multiplicity of stress response proteins and putative efflux proteins that appear to broadly compensate for, or mask, the effects of allelic variation of bsh genes. Bsh enzymes with different bile-degrading kinetics, though apparently not the primary determinants of bile resistance in L. salivarius, may have additional biological importance because of varying effects upon bile as a signaling molecule in the host.

  16. The impact of osteopontin gene variations on multiple sclerosis development and progression.

    Science.gov (United States)

    Comi, Cristoforo; Cappellano, Giuseppe; Chiocchetti, Annalisa; Orilieri, Elisabetta; Buttini, Sara; Ghezzi, Laura; Galimberti, Daniela; Guerini, Franca; Barizzone, Nadia; Perla, Franco; Leone, Maurizio; D'Alfonso, Sandra; Caputo, Domenico; Scarpini, Elio; Cantello, Roberto; Dianzani, Umberto

    2012-01-01

    Osteopontin is a proinflammatory molecule, modulating TH1 and TH17 responses. Several reports suggest its involvement in multiple sclerosis (MS) pathogenesis. We previously reported that OPN gene variations at the 3' end are a predisposing factor for MS development and evolution. In this paper, we extended our analysis to a gene variation at the 5' end on the -156G > GG single nucleotide polymorphism (SNP) and replicated our previous findings at the 3' end on the +1239A > C SNP. We found that only +1239A > C SNP displayed a statistically significant association with MS development, but both +1239A > C and -156G > GG had an influence on MS progression, since patients homozygous for both +1239A and -156GG alleles displayed slower progression of disability and slower switch to secondary progression than those carrying +1239C and/or -156G and those homozygous for +1239A only. Moreover, patients homozygous for +1239A also displayed a significantly lower relapse rate than those carrying +1239C, which is in line with the established role of OPN in MS relapses.

  17. Nucleotide variation at the dopa decarboxylase (Ddc) gene in natural populations of Drosophila melanogaster

    Indian Academy of Sciences (India)

    Andrey Tatarenkov; Francisco J. Ayala

    2007-08-01

    We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in strong positive association, whereas a large number of sites in the Raleigh population are associated nonrandomly but the association is not strong. Linkage disequilibrium analysis shows presence of two groups of haplotypes in the populations, each of which is fairly diverged, suggesting epistasis or inversion polymorphism. There is evidence of two forms of natural selection acting on Ddc. The McDonald–Kreitman test indicates a deficit of fixed amino acid differences between D. melanogaster and D. simulans, which may be due to negative selection. An excess of derived alleles at high frequency, significant according to the -test, is consistent with the effect of hitchhiking. The hitchhiking may have been caused by directional selection downstream of the locus studied, as suggested by a gradual decrease of the polymorphism-to-divergence ratio. Altogether, the Ddc locus exhibits a complicated pattern of variation apparently due to several evolutionary forces. Such a complex pattern may be a result of an unusually high density of functionally important genes.

  18. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC Risk.

    Directory of Open Access Journals (Sweden)

    Ganna Chornokur

    Full Text Available Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC, we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk.In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC. Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS. SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons.The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020; this SNP was also associated with the borderline/low malignant potential (LMP tumors (P = 0.021. Other genes significantly associated with EOC histological subtypes (p<0.05 included the UGT1A (endometrioid, SLC25A45 (mucinous, SLC39A11 (low malignant potential, and SERPINA7 (clear cell carcinoma. In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4.These results, generated on a large cohort of women, revealed associations between inherited cellular

  19. Genetic variations in the CLU and PICALM genes are associated with cognitive function in the oldest old

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Christensen, Kaare; McGue, Matt

    2011-01-01

    Recently, two large, and independent genome wide association studies of late-onset Alzheimer's disease (AD) established association with the same rs11136000 variation in the clusterin (CLU) gene. In addition, one variation, rs3851179, in the phosphatidylinositol binding clathrin assembly protein...... (PICALM) gene and one variation, rs6656401, in the complement component (3b/4b) receptor 1 (CR) gene were associated with AD. Here, we replicate these associations with cognitive functioning in 1380 individuals from the Danish (1905) birth cohort study of the oldest old (92-93 years at intake) using...... measures of Mini Mental State Examination (MMSE) and a cognitive composite score. We found a significant association between the highly frequent CLU rs11136000 T allele (38%) and better performance on the cognitive composite score (p = 0.016) explaining 0.5% of the mean variation in cognitive composite...

  20. Genetic variation in exon 5 of troponin - I gene in hypertrophic cardiomyopathy cases

    Directory of Open Access Journals (Sweden)

    Annapurna S

    2007-01-01

    Full Text Available Background: Cardiomyopathies are a heterogeneous group of heart muscle disorders and are classified as 1 Hypertrophic Cardiomyopathy (HCM 2 Dilated cardiomyopathy (DCM 3 Restrictive cardiomyopathy (RCM and 4 Arrhythmogenic right ventricular dysplasia (ARVD as per WHO classification, of which HCM and DCM are common. HCM is a complex but relatively common form of inherited heart muscle disease with prevalence of 1 in 500 individuals and is commonly associated with sarcomeric gene mutations. Cardiac muscle troponin I (TNNI-3 is one such sarcomeric protein and is a subunit of the thin filament-associated troponin-tropomyosin complex involved in calcium regulation of skeletal and cardiac muscle contraction. Mutations in this gene were found to be associated with a history of sudden cardiac death in HCM patients. Aim: Therefore the present study aims to identify for mutations associated with troponin I gene in a set of HCM patients from Indian population. Materials and Methods: Mutational analyses of 92 HCM cases were carried out following PCR based SSCP analysis. Results: The study revealed band pattern variation in 3 cases from a group of 92 HCM patients. This band pattern variation, on sequencing revealed base changes, one at nt 2560 with G>T transversion in exon-5 region with a wobble and others at nt 2479 and nt 2478 with G>C and C>G transversions in the intronic region upstream of the exon 5 on sequencing. Further analysis showed that one of the probands showed apical form of hypertrophy, two others showing asymmetric septal hypertrophy. Two of these probands showed family history of the condition. Conclusions: Hence, the study supports earlier reports of involvement of TNNI-3 in the causation of apical and asymmetrical forms of hypertrophy.

  1. A Molecular Epidemiology Analysis of HIV in Shenzhen and HIV Env Gene Variation Replication Analysis

    Institute of Scientific and Technical Information of China (English)

    CHEN Lin(陈琳); FENG Tiejian(冯铁建); LI Liangcheng(李良成); HE Jianfan(何建凡)

    2002-01-01

    Objective: To analyze molecular trends of the HIV epidemic in Shenzhen.Methods: Serum collected from Shenzhen AIDS patientsbetween 1992-1999 was analyzed using molecular techniques.DNA fragments of the HIV-1 Env gene were amplified bynested PCR from uncultured peripheral blood mononuclearcells (PBMCs) from these serum samples. The C2-C3 region ofthe Env gene was sequenced and analyzed. Specific high-riskbehaviors were also analyzed.Results: We found that the transmission of HIV in the citywas mainly through sexual behaviors (46.0%). There werefour HIV-1 subtypes: B', B, C and E with 6.31%, 7.95%,3.09% and 8.92% gene divergence inside each subtype inShenzhen. These results suggested that epidemic times were 6,8, 3 and 9 respectively. The main epidemic subtypes were Eand B strains. AIDS patient's antigenic variation was slightlyhigher than that of HIV infected individuals.Conclusion: Surveillance data reflect trends and theepidemic time of HIV, which will be useful for policy makersto formulate effective strategies of HIV/AIDS prevention andcontrol in Shenzhen.

  2. Genes and quantitative genetic variation involved with senescence in cells, organs and the whole plant

    Directory of Open Access Journals (Sweden)

    Benoit ePujol

    2015-02-01

    Full Text Available Senescence, the deterioration of morphological, physiological and reproductive functions with age that ends with the death of the organism, was widely studied in plants. Genes were identified that are linked to the deterioration of cells, organs and the whole plant. It is however unclear whether those genes are the source of age dependent deterioration or get activated to regulate such deterioration. Furthermore, it is also unclear whether such genes are active as a direct consequence of age or because they are specifically involved in some developmental stages. At the individual level, it is the relationship between quantitative genetic variation and age that can be used to detect the genetic signature of senescence. Surprisingly, the latter approach was only scarcely applied to plants. This may be the consequence of the demanding requirements for such approaches and/or the fact that most research interest was directed towards plants that avoid senescence. Here, I review those aspects in turn and call for an integrative genetic theory of senescence in plants. Such conceptual development would have implications for the management of plant genetic resources and generate progress on fundamental questions raised by ageing research.

  3. Molecular variation at a candidate gene implicated in the regulation of fire ant social behavior.

    Directory of Open Access Journals (Sweden)

    Dietrich Gotzek

    Full Text Available The fire ant Solenopsis invicta and its close relatives display an important social polymorphism involving differences in colony queen number. Colonies are headed by either a single reproductive queen (monogyne form or multiple queens (polygyne form. This variation in social organization is associated with variation at the gene Gp-9, with monogyne colonies harboring only B-like allelic variants and polygyne colonies always containing b-like variants as well. We describe naturally occurring variation at Gp-9 in fire ants based on 185 full-length sequences, 136 of which were obtained from S. invicta collected over much of its native range. While there is little overall differentiation between most of the numerous alleles observed, a surprising amount is found in the coding regions of the gene, with such substitutions usually causing amino acid replacements. This elevated coding-region variation may result from a lack of negative selection acting to constrain amino acid replacements over much of the protein, different mutation rates or biases in coding and non-coding sequences, negative selection acting with greater strength on non-coding than coding regions, and/or positive selection acting on the protein. Formal selection analyses provide evidence that the latter force played an important role in the basal b-like lineages coincident with the emergence of polygyny. While our data set reveals considerable paraphyly and polyphyly of S. invicta sequences with respect to those of other fire ant species, the b-like alleles of the socially polymorphic species are monophyletic. An expanded analysis of colonies containing alleles of this clade confirmed the invariant link between their presence and expression of polygyny. Finally, our discovery of several unique alleles bearing various combinations of b-like and B-like codons allows us to conclude that no single b-like residue is completely predictive of polygyne behavior and, thus, potentially causally

  4. Variation in fibrinogen FGG and FGA genes and risk of stroke: the Rotterdam Study.

    Science.gov (United States)

    Cheung, Elim Y L; Bos, Michiel J; Leebeek, Frank W G; Koudstaal, Peter J; Hofman, Albert; de Maat, Moniek P M; Breteler, Monique M B

    2008-08-01

    Haplotypes of the fibrinogen gamma and alpha (FGG and FGA) genes are associated with the structure of the fibrin network and may therefore influence the risk of stroke. We investigated the relationship between common variation in these genes with ischemic and haemorrhagic stroke. The study was based on 6,275 participants of the prospective population-based Rotterdam Study who at baseline (1990-1993) were aged 55 years or over, free from stroke, and had successful assessment of at least one FGG or FGA single nucleotide polymorphisms (SNP). Common haplotypes were estimated using seven tagging SNPs across a 30 kb region containing the FGG and FGA genes. Follow-up for incident stroke was complete until January 1, 2005. Associations between constructed haplotypes and risk of stroke were estimated with an age- and sex-adjusted logistic regression model. We observed 668 strokes, of which 393 were ischemic and 62 haemorrhagic, during a median follow-up time of 10.1 years. FGG + FGA haplotype 3 (H3) was associated with an increased risk of ischemic stroke (odds ratio [OR] 1.36, 95% confidence interval [CI] 1.09-1.69) and the risk estimate for hemorrhagic stroke was 0.71 (95% CI 0.46-1.09) compared to the most frequent H1. The FGG and FGA genes were not associated with stroke or its subtypes when analyzed separately. In conclusion, risk of ischemic stroke was higher in FGG + FGA H3 than in H1. The results suggested that an opposite association may exist for haemorrhagic stroke.

  5. Genomic variation in the vomeronasal receptor gene repertoires of inbred mice

    Directory of Open Access Journals (Sweden)

    Wynn Elizabeth H

    2012-08-01

    Full Text Available Abstract Background Vomeronasal receptors (VRs, expressed in sensory neurons of the vomeronasal organ, are thought to bind pheromones and mediate innate behaviours. The mouse reference genome has over 360 functional VRs arranged in highly homologous clusters, but the vast majority are of unknown function. Differences in these receptors within and between closely related species of mice are likely to underpin a range of behavioural responses. To investigate these differences, we interrogated the VR gene repertoire from 17 inbred strains of mice using massively parallel sequencing. Results Approximately half of the 6222 VR genes that we investigated could be successfully resolved, and those that were unambiguously mapped resulted in an extremely accurate dataset. Collectively VRs have over twice the coding sequence variation of the genome average; but we identify striking non-random distribution of these variants within and between genes, clusters, clades and functional classes of VRs. We show that functional VR gene repertoires differ considerably between different Mus subspecies and species, suggesting these receptors may play a role in mediating behavioural adaptations. Finally, we provide evidence that widely-used, highly inbred laboratory-derived strains have a greatly reduced, but not entirely redundant capacity for differential pheromone-mediated behaviours. Conclusions Together our results suggest that the unusually variable VR repertoires of mice have a significant role in encoding differences in olfactory-mediated responses and behaviours. Our dataset has expanded over nine fold the known number of mouse VR alleles, and will enable mechanistic analyses into the genetics of innate behavioural differences in mice.

  6. Genetic variation at hair length candidate genes in elephants and the extinct woolly mammoth

    Directory of Open Access Journals (Sweden)

    Tisdale Michele

    2009-09-01

    Full Text Available Abstract Background Like humans, the living elephants are unusual among mammals in being sparsely covered with hair. Relative to extant elephants, the extinct woolly mammoth, Mammuthus primigenius, had a dense hair cover and extremely long hair, which likely were adaptations to its subarctic habitat. The fibroblast growth factor 5 (FGF5 gene affects hair length in a diverse set of mammalian species. Mutations in FGF5 lead to recessive long hair phenotypes in mice, dogs, and cats; and the gene has been implicated in hair length variation in rabbits. Thus, FGF5 represents a leading candidate gene for the phenotypic differences in hair length notable between extant elephants and the woolly mammoth. We therefore sequenced the three exons (except for the 3' UTR and a portion of the promoter of FGF5 from the living elephantid species (Asian, African savanna and African forest elephants and, using protocols for ancient DNA, from a woolly mammoth. Results Between the extant elephants and the mammoth, two single base substitutions were observed in FGF5, neither of which alters the amino acid sequence. Modeling of the protein structure suggests that the elephantid proteins fold similarly to the human FGF5 protein. Bioinformatics analyses and DNA sequencing of another locus that has been implicated in hair cover in humans, type I hair keratin pseudogene (KRTHAP1, also yielded negative results. Interestingly, KRTHAP1 is a pseudogene in elephantids as in humans (although fully functional in non-human primates. Conclusion The data suggest that the coding sequence of the FGF5 gene is not the critical determinant of hair length differences among elephantids. The results are discussed in the context of hairlessness among mammals and in terms of the potential impact of large body size, subarctic conditions, and an aquatic ancestor on hair cover in the Proboscidea.

  7. Telomere length and variation in telomere biology genes in individuals with osteosarcoma.

    Science.gov (United States)

    Mirabello, Lisa; Richards, Elliott G; Duong, Linh M; Yu, Kai; Wang, Zhaoming; Cawthon, Richard; Berndt, Sonja I; Burdett, Laurie; Chowdhury, Salma; Teshome, Kedest; Douglass, Chester; Savage, Sharon A

    2011-01-01

    Osteosarcoma, the most common primary bone tumor, occurs most frequently in adolescents. Chromosomal aneuploidy is common in osteosarcoma cells, suggesting underlying chromosomal instability. Telomeres, located at chromosome ends, are essential for genomic stability; several studies have suggested that germline telomere length (TL) is associated with cancer risk. We hypothesized that TL and/or common genetic variation in telomere biology genes may be associated with risk of osteosarcoma. We investigated TL in peripheral blood DNA and 713 single nucleotide polymorphisms (SNPs) from 39 telomere biology genes in 98 osteosarcoma cases and 69 orthopedic controls. For the genotyping component, we added 1363 controls from the Prostate, Lung, Colorectal, and Ovarian Cancer ScreeningTrial. Short TL was not associated with osteosarcoma risk overall (OR 1.39, P=0.67), although there was a statistically significant association in females (OR 4.35, 95% Cl 1.20-15.74, P=0.03). Genotype analyses identified seven SNPs in TERF1 significantly associated with osteosarcoma risk after Bonferroni correction by gene. These SNPs were highly linked and associated with a reduced risk of osteosarcoma (OR 0.48-0.53, P=0.0001-0.0006). We also investigated associations between TL and telomere gene SNPs in osteosarcoma cases and orthopedic controls. Several SNPs were associated with TL prior to Bonferroni correction; one SNP in NOLA2 and one in MEN1 were marginally non-significant after correction (P(adj)=0.057 and 0.066, respectively). This pilot-study suggests that females with short telomeres may be at increased risk of osteosarcoma, and that SNPs in TERF1 are inversely associated with osteosarcoma risk.

  8. Novel sequence variations in LAMA2 and SGCG genes modulating cis-acting regulatory elements and RNA secondary structure

    Directory of Open Access Journals (Sweden)

    Olfa Siala

    2010-01-01

    Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.

  9. Circadian variations of clock gene Per2 and cell cycle genes in different stages of carcinogenesis in golden hamster buccal mucosa.

    Science.gov (United States)

    Tan, Xue-Mei; Ye, Hua; Yang, Kai; Chen, Dan; Wang, Qing-Qing; Tang, Hong; Zhao, Ning-Bo

    2015-05-07

    Previous studies have suggested that the expression of clock genes have circadian rhythms, and many cell cycle genes are regulated by clock genes. The disruption of circadian rhythms appears to be associated with the acceleration of cancer development. To investigate the circadian patterns of the clock gene Per2 and of cell cycle genes p53, Cyclin D1, CDK1 and Cyclin B1 in different stages of carcinogenesis, the daily mRNA profiles of these genes were detected by real-time RT-PCR in dimethylbenzanthracene-induced cancer, in precancerous lesions and in normal tissues. Per2, p53, Cyclin D1 and CDK1 showed circadian rhythms in the 3 different stages of carcinogenesis, whereas the circadian rhythm of Cyclin B1 was absent in the precancerous lesions. The mesors and amplitudes of Per2 and p53 were decreased (P circadian pattern variations of these genes in different stages of carcinogenesis.

  10. Variation in genes related to hepatic lipid metabolism and changes in waist circumference and body weight

    DEFF Research Database (Denmark)

    Meidtner, Karina; Fisher, Eva; Angquist, Lars

    2014-01-01

    ) and changes in weight and waist circumference. We also investigated effect modification by sex and dietary intake. Data of 6,287 individuals participating in the European prospective investigation into cancer and nutrition were included in the analyses. Data on weight and waist circumference were followed up...... for 6.9 ± 2.5 years. Association of 69 tagSNPs with baseline BMI and annual changes in weight as well as waist circumference were investigated using linear regression analysis. Interactions with sex, GI and intake of carbohydrates, fat as well as saturated, monounsaturated and polyunsaturated fatty...... acids were examined by including multiplicative SNP-covariate terms into the regression model. Neither baseline BMI nor annual weight or waist circumference changes were significantly associated with variation in the selected genes in the entire study population after correction for multiple testing...

  11. The architecture of gene regulatory variation across multiple human tissues: the MuTHER study.

    Directory of Open Access Journals (Sweden)

    Alexandra C Nica

    Full Text Available While there have been studies exploring regulatory variation in one or more tissues, the complexity of tissue-specificity in multiple primary tissues is not yet well understood. We explore in depth the role of cis-regulatory variation in three human tissues: lymphoblastoid cell lines (LCL, skin, and fat. The samples (156 LCL, 160 skin, 166 fat were derived simultaneously from a subset of well-phenotyped healthy female twins of the MuTHER resource. We discover an abundance of cis-eQTLs in each tissue similar to previous estimates (858 or 4.7% of genes. In addition, we apply factor analysis (FA to remove effects of latent variables, thus more than doubling the number of our discoveries (1,822 eQTL genes. The unique study design (Matched Co-Twin Analysis--MCTA permits immediate replication of eQTLs using co-twins (93%-98% and validation of the considerable gain in eQTL discovery after FA correction. We highlight the challenges of comparing eQTLs between tissues. After verifying previous significance threshold-based estimates of tissue-specificity, we show their limitations given their dependency on statistical power. We propose that continuous estimates of the proportion of tissue-shared signals and direct comparison of the magnitude of effect on the fold change in expression are essential properties that jointly provide a biologically realistic view of tissue-specificity. Under this framework we demonstrate that 30% of eQTLs are shared among the three tissues studied, while another 29% appear exclusively tissue-specific. However, even among the shared eQTLs, a substantial proportion (10%-20% have significant differences in the magnitude of fold change between genotypic classes across tissues. Our results underline the need to account for the complexity of eQTL tissue-specificity in an effort to assess consequences of such variants for complex traits.

  12. The Architecture of Gene Regulatory Variation across Multiple Human Tissues: The MuTHER Study

    Science.gov (United States)

    Nica, Alexandra C.; Parts, Leopold; Glass, Daniel; Nisbet, James; Barrett, Amy; Sekowska, Magdalena; Travers, Mary; Potter, Simon; Grundberg, Elin; Small, Kerrin; Hedman, Åsa K.; Bataille, Veronique; Tzenova Bell, Jordana; Surdulescu, Gabriela; Dimas, Antigone S.; Ingle, Catherine; Nestle, Frank O.; di Meglio, Paola; Min, Josine L.; Wilk, Alicja; Hammond, Christopher J.; Hassanali, Neelam; Yang, Tsun-Po; Montgomery, Stephen B.; O'Rahilly, Steve; Lindgren, Cecilia M.; Zondervan, Krina T.; Soranzo, Nicole; Barroso, Inês; Durbin, Richard; Ahmadi, Kourosh; Deloukas, Panos; McCarthy, Mark I.; Dermitzakis, Emmanouil T.; Spector, Timothy D.

    2011-01-01

    While there have been studies exploring regulatory variation in one or more tissues, the complexity of tissue-specificity in multiple primary tissues is not yet well understood. We explore in depth the role of cis-regulatory variation in three human tissues: lymphoblastoid cell lines (LCL), skin, and fat. The samples (156 LCL, 160 skin, 166 fat) were derived simultaneously from a subset of well-phenotyped healthy female twins of the MuTHER resource. We discover an abundance of cis-eQTLs in each tissue similar to previous estimates (858 or 4.7% of genes). In addition, we apply factor analysis (FA) to remove effects of latent variables, thus more than doubling the number of our discoveries (1,822 eQTL genes). The unique study design (Matched Co-Twin Analysis—MCTA) permits immediate replication of eQTLs using co-twins (93%–98%) and validation of the considerable gain in eQTL discovery after FA correction. We highlight the challenges of comparing eQTLs between tissues. After verifying previous significance threshold-based estimates of tissue-specificity, we show their limitations given their dependency on statistical power. We propose that continuous estimates of the proportion of tissue-shared signals and direct comparison of the magnitude of effect on the fold change in expression are essential properties that jointly provide a biologically realistic view of tissue-specificity. Under this framework we demonstrate that 30% of eQTLs are shared among the three tissues studied, while another 29% appear exclusively tissue-specific. However, even among the shared eQTLs, a substantial proportion (10%–20%) have significant differences in the magnitude of fold change between genotypic classes across tissues. Our results underline the need to account for the complexity of eQTL tissue-specificity in an effort to assess consequences of such variants for complex traits. PMID:21304890

  13. Variation at genes influencing facial morphology are not associated with developmental imprecision in human faces.

    Directory of Open Access Journals (Sweden)

    Sonja Windhager

    Full Text Available Facial asymmetries are commonly used as a proxy for human developmental imprecision resulting from inbreeding, and thus reduced genetic heterozygosity. Several environmental factors influence human facial asymmetry (e.g., health care, parasites, but the generalizability of findings on genetic stressors has been limited in humans by sample characteristics (island populations, endogamy and indirect genetic assessment (inference from pedigrees. In a sample of 3215 adult humans from the Rotterdam Study, we therefore studied the relationship of facial asymmetry, estimated from nine mid-facial landmarks, with genetic variation at 102 single nucleotide polymorphism (SNP loci recently associated with facial shape variation. We further tested whether the degree of individual heterozygosity is negatively correlated with facial asymmetry. An ANOVA tree regression did not identify any SNP relating to either fluctuating asymmetry or total asymmetry. In a general linear model, only age and sex--but neither heterozygosity nor any SNP previously reported to covary with facial shape--was significantly related to total or fluctuating asymmetry of the midface. Our study does not corroborate the common assumption in evolutionary and behavioral biology that morphological asymmetries reflect heterozygosity. Our results, however, may be affected by a relatively small degree of inbreeding, a relatively stable environment, and an advanced age in the Rotterdam sample. Further large-scale genetic studies, including gene expression studies, are necessary to validate the genetic and developmental origin of morphological asymmetries.

  14. Variation in oxytocin receptor gene (OXTR) polymorphisms is associated with emotional and behavioral reactions to betrayal.

    Science.gov (United States)

    Tabak, Benjamin A; McCullough, Michael E; Carver, Charles S; Pedersen, Eric J; Cuccaro, Michael L

    2014-06-01

    Variations in the gene that encodes the oxytocin receptor (OXTR) have been associated with many aspects of social cognition as well as several prosocial behaviors. However, potential associations of OXTR variants with reactions to betrayals of trust while cooperating for mutual benefit have not yet been explored. We examined how variations in 10 single-nucleotide polymorphisms on OXTR were associated with behavior and emotional reactions after a betrayal of trust in an iterated Prisoner's Dilemma Game. After correction for multiple testing, one haplotype (C-rs9840864, T-rs2268494) was significantly associated with faster retaliation post-betrayal-an association that appeared to be due to this haplotype's intermediate effect of exacerbating people's anger after they had been betrayed. Furthermore, a second haplotype (A-rs237887, C-rs2268490) was associated with higher levels of post-betrayal satisfaction, and a third haplotype (G-rs237887, C-rs2268490) was associated with lower levels of post-betrayal satisfaction.

  15. Post-polyploidisation morphotype diversification associates with gene copy number variation

    Science.gov (United States)

    Schiessl, Sarah; Huettel, Bruno; Kuehn, Diana; Reinhardt, Richard; Snowdon, Rod

    2017-01-01

    Genetic models for polyploid crop adaptation provide important information relevant for future breeding prospects. A well-suited model is Brassica napus, a recent allopolyploid closely related to Arabidopsis thaliana. Flowering time is a major adaptation trait determining life cycle synchronization with the environment. Here we unravel natural genetic variation in B. napus flowering time regulators and investigate associations with evolutionary diversification into different life cycle morphotypes. Deep sequencing of 35 flowering regulators was performed in 280 diverse B. napus genotypes. High sequencing depth enabled high-quality calling of single-nucleotide polymorphisms (SNPs), insertion-deletions (InDels) and copy number variants (CNVs). By combining these data with genotyping data from the Brassica 60 K Illumina® Infinium SNP array, we performed a genome-wide marker distribution analysis across the 4 ecogeographical morphotypes. Twelve haplotypes, including Bna.FLC.A10, Bna.VIN3.A02 and the Bna.FT promoter on C02_random, were diagnostic for the diversification of winter and spring types. The subspecies split between oilseed/kale (B. napus ssp. napus) and swedes/rutabagas (B. napus ssp. napobrassica) was defined by 13 haplotypes, including genomic rearrangements encompassing copies of Bna.FLC, Bna.PHYA and Bna.GA3ox1. De novo variation in copies of important flowering-time genes in B. napus arose during allopolyploidisation, enabling sub-functionalisation that allowed different morphotypes to appropriately fine-tune their lifecycle. PMID:28165502

  16. Intra-retinal variation of opsin gene expression in the guppy (Poecilia reticulata).

    Science.gov (United States)

    Rennison, Diana J; Owens, Gregory L; Allison, W Ted; Taylor, John S

    2011-10-01

    Although behavioural experiments demonstrate that colouration influences mate choice in many species, a complete understanding of this form of signalling requires information about colour vision in the species under investigation. The guppy (Poecilia reticulata) has become a model species for the study of colour-based sexual selection. To investigate the role of opsin gene duplication and divergence in the evolution of colour-based mate choice, we used in situ hybridization to determine where the guppy's nine cone opsins are expressed in the retina. Long wavelength-sensitive (LWS) opsins were more abundant in the dorsal retina than in the ventral retina. One of the middle wavelength-sensitive opsins (RH2-1) exhibited the opposite pattern, while the other middle wavelength-sensitive opsin (RH2-2) and the short wavelength-sensitive opsins (SWS1, SWS2A and SWS2B) were expressed throughout the retina. We also found variation in LWS opsin expression among individuals. These observations suggest that regions of the guppy retina are specialized with respect to wavelength discrimination and/or sensitivity. Intra-retinal variability in opsin expression, which has been observed in several fish species, might be an adaptation to variation in the strength and spectral composition of light entering the eye from above and below. The discovery that opsin expression varies in the guppy retina may motivate new behavioural experiments designed to study its role in mate choice.

  17. La desigualdad familiar y el logro académico

    OpenAIRE

    Tortajada, Ferrán

    2012-01-01

    En el presente trabajo “La desigualdad familiar y el logro académico” se pretende poner de relieve la importancia de las desigualdades familiares a la hora de obtener un mejor o peor rendimiento académico en nuestro sistema educativo. Nos podemos preguntar: ¿El reto que encuentra cada uno de los alumnos en el momento de ingresar en el sistema educativo es el mismo? ¿Las posibilidades de obtener un logro académico para unos y otros son las mismas? ¿Qué factores influyen y en qué medid...

  18. Variation in the Oxytocin Receptor Gene Is Associated with Face Recognition and its Neural Correlates

    Science.gov (United States)

    Westberg, Lars; Henningsson, Susanne; Zettergren, Anna; Svärd, Joakim; Hovey, Daniel; Lin, Tian; Ebner, Natalie C.; Fischer, Håkan

    2016-01-01

    The ability to recognize faces is crucial for daily social interactions. Recent studies suggest that intranasal oxytocin administration improves social recognition in humans. Oxytocin signaling in the amygdala plays an essential role for social recognition in mice, and oxytocin administration has been shown to influence amygdala activity in humans. It is therefore possible that the effects of oxytocin on human social recognition depend on mechanisms that take place in the amygdala—a central region for memory processing also in humans. Variation in the gene encoding the oxytocin receptor (OXTR) has been associated with several aspects of social behavior. The present study examined the potential associations between nine OXTR polymorphisms, distributed across the gene, and the ability to recognize faces, as well as face-elicited amygdala activity measured by functional magnetic resonance imaging (fMRI) during incidental encoding of faces. The OXTR 3′ polymorphism rs7632287, previously related to social bonding behavior and autism risk, was associated with participants’ ability to recognize faces. Carriers of the GA genotype, associated with enhanced memory, displayed higher amygdala activity during face encoding compared to carriers of the GG genotype. In line with work in rodents, these findings suggest that, in humans, naturally occurring endogenous modulation of OXTR function affects social recognition through an amygdala-dependent mechanism. These findings contribute to the understanding of how oxytocin regulates human social behaviors. PMID:27713694

  19. Variation in the Oxytocin Receptor Gene is associated with Face Recognition and its neural correlates

    Directory of Open Access Journals (Sweden)

    Lars Westberg

    2016-09-01

    Full Text Available The ability to recognize faces is crucial for daily social interactions. Recent studies suggest that intranasal oxytocin administration improves social recognition in humans. Oxytocin signaling in the amygdala plays an essential role for social recognition in mice, and oxytocin administration has been shown to influence amygdala activity in humans. It is therefore possible that the effects of oxytocin on human social recognition depend on mechanisms that take place in the amygdala – a central region for memory processing also in humans. Variation in the gene encoding the oxytocin receptor (OXTR has been associated with several aspects of social behavior. The present study examined the potential associations between nine OXTR polymorphisms, distributed across the gene, and the ability to recognize faces, as well as face-elicited amygdala activity measured by functional magnetic resonance imaging during incidental encoding of faces. The OXTR 3’ polymorphism rs7632287, previously related to social bonding behavior and autism risk, was associated with participants’ ability to recognize faces. Carriers of the GA genotype, associated with enhanced memory, displayed higher amygdala activity during face encoding compared to carriers of the GG genotype. In line with work in rodents, these findings suggest that, in humans, naturally occurring endogenous modulation of OXTR function affects social recognition through an amygdala-dependent mechanism. These findings contribute to the understanding of how oxytocin regulates human social behaviors.

  20. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    Directory of Open Access Journals (Sweden)

    DWINITA WIKAN UTAMI

    2011-09-01

    Full Text Available Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufipogon and CT13432 crossing. DNA of five rice lines were amplified using the spesific primer for Pi33, G1010. Amplification results purified through Exonuclease 1 and Shrimp Alkaline Phosphatase protocols. Labelling using fluorescent dyes done before sequencing nucleotide base using CEQ8000 instrument. The results showed that lines number 28 showed introgesion of the three control parent genome (subspecies of Indica, subspecies of Japonica, and O. rufipogon while the Lines number 79, 136, and 143 were identical to Indica genome. Strain number 195 was identical to Japonica genome. These broad genetic background lines promise as durable performance to attack the expansion of the dynamic nature of the pathogen to blast. The result of ortholog sequence analysis found conserved nucleotide base sequence (CAGCAGCC which involved in heterotrimeric G-protein group. This protein has role as plant receptor for recognizing pathogen elicitor in interaction of rice and blast pathogen.

  1. Evolutionary variation in neural gene expression in the developing sense organs of the crustacean Daphnia magna.

    Science.gov (United States)

    Klann, Marleen; Stollewerk, Angelika

    2017-02-24

    Arthropods have numerous sense organs, which are adapted to their habitat. While some sense organs are similar in structure and function in all arthropod groups, structural differences in functionally related sense organs have been described, as well as the absence of particular sense organ subtypes in individual arthropod groups. Here we address the question of how the diverse structures of arthropod sense organs have evolved by analysing the underlying molecular developmental processes in a crustacean, an arthropod group that has been neglected so far. We have investigated the development of four types of chemo- and mechanosensory sense organs in the branchiopod Daphnia magna (Cladocera) that either cannot be found in arthropods other than crustaceans or represent adaptations to an aquatic environment. The formation of the sensory organ precursors shows greater similarity to the arthropod taxa Chelicerata and Myriapoda than to the more closely related insects. All analysed sense organ types co-express the proneural genes ASH and atonal regardless of their structure and function. In contrast, in Drosophila melanogaster, ASH and atonal expression does not overlap and the genes confer different sense organ subtype identities. We performed experimental co-expression studies in D. melanogaster and found that the combinatorial expression of ato and ASH can change the external structure of sense organs. Our results indicate a central role for ASH and Atonal family members in the emergence of structural variations in arthropod sense organs.

  2. Chromosomal localisation and genetic variation of the SLC11A1 gene in goats (Capra hircus).

    Science.gov (United States)

    Vacca, G M; Pazzola, M; Pisano, C; Carcangiu, V; Diaz, M L; Nieddu, M; Robledo, R; Mezzanotte, R; Dettori, M L

    2011-10-01

    The solute carrier family 11 member A1 (SLC11A1) gene is associated with resistance to infectious diseases. Chromosomal localisation, genomic regions corresponding to functional domains and the genetic variability of microsatellites in the 3' untranslated region (3'-UTR) of this gene were investigated in 427 goats (Capra hircus) of six breeds. Using dual colour fluorescence in situ hybridisation, SLC11A1 was localised to goat chromosome 2. Single strand conformation polymorphism was used to screen for polymorphisms in SLC11A1 exons 2, 10 and 15. There was no variation among goat breeds in the sarcoma homology 3 (SH3) binding motif, the protein kinase C phosphorylation site or the two N-linked glycosylation sites. Exon 15 exhibited variability due to the presence of two polymorphic microsatellites. Genotyping of the upstream guanine-thymine repeat (GTn) at 3'-UTR revealed eight alleles (GT11, GT12, GT14-GT19) in goats, whereas GT13 (present in cattle) was absent. Most goats carried the GT16 allele and no allele was found to be exclusive to only one breed. The coefficient of genetic differentiation value (G(ST)) was 0.084. This microsatellite appears to be an informative DNA marker for genetic linkage analysis in goats.

  3. The association between ace gene variation and aerobic capacity in winter endurance disciplines.

    Science.gov (United States)

    Orysiak, J; Zmijewski, P; Klusiewicz, A; Kaliszewski, P; Malczewska-Lenczowska, J; Gajewski, J; Pokrywka, A

    2013-12-01

    The aim of the study was to examine the possible relationship between I/D polymorphism of ACE gene and selected indices of aerobic capacity among male and female athletes practising winter endurance sports. Sixty-six well-trained athletes (female n = 26, male n = 40), aged 18.4 ± 2.8 years, representing winter endurance sports (cross-country skiing, n = 48; biathlon, n = 8; Nordic combined, n = 10) participated in the study. Genotyping for ACE I/D polymorphism was performed using polymerase chain reaction. Maximal oxygen consumption (VO2max), maximal running velocity (Vmax) and running velocity at anaerobic threshold (VAT4) were determined in an incremental test to volitional exhaustion on a motorized treadmill. The ACE genotype had no significant effect on absolute VO2max, relative VO2max (divided by body mass or fat free body mass), VAT4 or Vmax. No interaction effect of gender x ACE genotype was found for each of the examined aerobic capacity indices. ACE gene variation was not found to be a determinant of aerobic capacity in either female or male Polish, well-trained endurance athletes participating in winter sports.

  4. Effects of common germ-line genetic variation in cell cycle genes on ovarian cancer survival

    DEFF Research Database (Denmark)

    Song, H.; Hogdall, E.; Ramus, S.J.;

    2008-01-01

    plausibly influence clinical characteristics of multiple tumors types. EXPERIMENTAL DESIGN: We examined associations between common germ-line genetic variation in 14 genes involved in cell cycle pathway (CCND1, CCND2, CCND3, CCNE1, CDKN1A, CDKN1B, CDKN2A, CDKN2B, CDKN2C, CDKN2D, CDK2, CDK4, CDK6, and RB1.......05) in these genes. The genotypes of each polymorphism were tested for association with survival by Cox regression analysis. RESULTS: A nominally statistically significant association between genotype and ovarian cancer survival was observed for polymorphisms in CCND2 and CCNE1. The per-allele hazard ratios (95......% confidence intervals) were 1.16 (1.03-1.31; P = 0.02) for rs3217933, 1.14 (1.02-1.27; P = 0.024) for rs3217901, and 0.85 (0.73-1.00; P = 0.043) for rs3217862 in CCND2 and 1.39 (1.04-1.85; P = 0.033) for rs3218038 in CCNE1. However, these were not significant after adjusting for multiple hypothesis tests...

  5. Clinical associations of host genetic variations in the genes of cytokines in critically ill patients.

    Science.gov (United States)

    Belopolskaya, O B; Smelaya, T V; Moroz, V V; Golubev, A M; Salnikova, L E

    2015-06-01

    Host genetic variations may influence a changing profile of biochemical markers and outcome in patients with trauma/injury. The objective of this study was to assess clinical associations of single nucleotide polymorphisms (SNPs) in the genes of cytokines in critically ill patients. A total of 430 patients were genotyped for SNPs in the genes of pro- (IL1B, IL6, IL8) and anti-inflammatory (IL4, IL10, IL13) cytokines. The main end-points were sepsis, mortality and adult respiratory distress syndrome (ARDS). We evaluated the dynamic levels of bilirubin, blood urea nitrogen, creatine kinase, creatinine and lactate dehydrogenase in five points of measurements (between 1 and 14 days after admission) and correlated them with SNPs. High-producing alleles of proinflammatory cytokines protected patients against sepsis (IL1B -511A and IL8 -251A) and mortality (IL1B -511A). High-producing alleles of anti-inflammatory cytokines IL4 -589T and IL13 431A (144Gln) were less frequent in ARDS patients. The carriers of IL6 -174C/C genotypes were prone to the increased levels of biochemical markers and acute kidney and liver insufficiency. Genotype-dependent differences in the levels of biochemical indicators gradually increased to a maximal value on the 14th day after admission. These findings suggest that genetic variability in pro- and anti-inflammatory cytokines may contribute to different clinical phenotypes in patients at high risk of critical illness.

  6. Evidence that Natural Selection is the Primary Cause of the Guanine-cytosine Content Variation in Rice Genes

    Institute of Scientific and Technical Information of China (English)

    Xiaoli Shi; Xiyin Wang; Zhe Li; Qihui Zhu; Ji Yang; Song Ge; Jingchu Luo

    2007-01-01

    Cereal genes are classified into two distinct classes according to the guanine-cytosine (GC) content at the third codon sites (GC3). Natural selection and mutation bias have been proposed to affect the GC content. However, there has been controversy about the cause of GC variation. Here, we characterized the GC content of 1 092 paralogs and other single-copy genes in the duplicated chromosomal regions of the rice genome (ssp. indica) and classified the paralogs into GC3-rich and GC3-poor groups. By referring to out-group sequences from Arabidopsis and maize, we confirmed that the average synonymous substitution rate of the GC3-rich genes is significantly lower than that of the GC3-poor genes. Furthermore,we explored the other possible factors corresponding to the GC variation including the length of coding sequences, the number of exons in each gene, the number of genes in each family, the location of genes on chromosomes and the protein functions. Consequently, we propose that natural selection rather than mutation bias was the primary cause of the GC variation.

  7. Genetic variations in the KIR gene family may contribute to susceptibility to ankylosing spondylitis: a meta-analysis.

    Science.gov (United States)

    Zuo, Hai-Ning; Wang, Zhi-Long; Cui, Dao-Ran; Xin, Da-Jiang

    2014-08-01

    The present meta-analysis of relevant case-control studies was conducted to investigate the possible relationships between genetic variations in the killer cell immunoglobulin-like receptor (KIR) gene clusters of the human KIR gene family and susceptibility to ankylosing spondylitis (AS). The following electronic databases were searched for relevant articles without language restrictions: the Web of Science, the Cochrane Library Database, PubMed, EMBASE, CINAHL, the Chinese Biomedical Database (CBM) and Chinese National Knowledge Infrastructure (CNKI) databases, covering all papers published until 2013. STATA statistical software was adopted in this meta-analysis as well. We also calculated the crude odds ratios (OR) and its 95% confidence intervals (95 % CI). Seven case-control studies with 1,004 patients diagnosed with AS and 2,138 healthy cases were implicated in our meta-analysis, and 15 genes in the KIR gene family were also evaluated. The results of our meta-analysis show statistical significance between the genetic variations in the KIR2DL1, KIR2DS4, KIR2DS5 and KIR3DS1 genes and an increased susceptibility to AS (KIR2DL1: OR 7.82, 95% CI 3.87-15.81, P0.05). The current meta-analysis provides reliable evidence that genetic variations in the KIR gene family may contribute to susceptibility to AS, especially for the KIR2DL1, KIR2DS4, KIR2DS5 and KIR3DS1 genes.

  8. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  9. Capturing sequence variation among flowering-time regulatory gene homologues in the allopolyploid crop species Brassica napus

    Directory of Open Access Journals (Sweden)

    Sarah eSchiessl

    2014-08-01

    Full Text Available Flowering, the transition from the vegetative to the generative phase, is a decisive time point in the lifecycle of a plant. Flowering is controlled by a complex network of transcription factors, photoreceptors, enzymes and miRNAs. In recent years, several studies gave rise to the hypothesis that this network is also strongly involved in the regulation of other important lifecycle processes ranging from germination and seed development through to fundamental developmental and yield-related traits. In the allopolyploid crop species Brassica napus, (genome AACC, homoeologous copies of flowering time regulatory genes are implicated in major phenological variation within the species, however the extent and control of intraspecific and intergenomic variation among flowering-time regulators is still unclear. To investigate differences among B. napus morphotypes in relation to flowering-time gene variation, we performed targeted deep sequencing of 29 regulatory flowering-time genes in four genetically and phenologically diverse B. napus accessions. The genotype panel included a winter-type oilseed rape, a winter fodder rape, a spring-type oilseed rape (all B. napus ssp. napus and a swede (B. napus ssp. napobrassica, which show extreme differences in winter-hardiness, vernalization requirement and flowering behaviour. A broad range of genetic variation was detected in the targeted genes for the different morphotypes, including non-synonymous SNPs, copy number variation and presence-absence variation. The results suggest that this broad variation in vernalisation, clock and signaling genes could be a key driver of morphological differentiation for flowering-related traits in this recent allopolyploid crop species.

  10. Genome-wide association implicates numerous genes underlying ecological trait variation in natural populations of Populus trichocarpa.

    Science.gov (United States)

    McKown, Athena D; Klápště, Jaroslav; Guy, Robert D; Geraldes, Armando; Porth, Ilga; Hannemann, Jan; Friedmann, Michael; Muchero, Wellington; Tuskan, Gerald A; Ehlting, Jürgen; Cronk, Quentin C B; El-Kassaby, Yousry A; Mansfield, Shawn D; Douglas, Carl J

    2014-07-01

    In order to uncover the genetic basis of phenotypic trait variation, we used 448 unrelated wild accessions of black cottonwood (Populus trichocarpa) from much of its range in western North America. Extensive data from large-scale trait phenotyping (with spatial and temporal replications within a common garden) and genotyping (with a 34 K Populus single nucleotide polymorphism (SNP) array) of all accessions were used for gene discovery in a genome-wide association study (GWAS). We performed GWAS with 40 biomass, ecophysiology and phenology traits and 29,355 filtered SNPs representing 3518 genes. The association analyses were carried out using a Unified Mixed Model accounting for population structure effects among accessions. We uncovered 410 significant SNPs using a Bonferroni-corrected threshold (P<1.7×10(-6)). Markers were found across 19 chromosomes, explained 1-13% of trait variation, and implicated 275 unique genes in trait associations. Phenology had the largest number of associated genes (240 genes), followed by biomass (53 genes) and ecophysiology traits (25 genes). The GWAS results propose numerous loci for further investigation. Many traits had significant associations with multiple genes, underscoring their genetic complexity. Genes were also identified with multiple trait associations within and/or across trait categories. In some cases, traits were genetically correlated while in others they were not.

  11. Genetic and epigenetic variation in the DNMT3B and MTHFR genes and colorectal adenoma risk.

    Science.gov (United States)

    Ho, Vikki; Ashbury, Janet E; Taylor, Sherryl; Vanner, Stephen; King, Will D

    2016-05-01

    Polymorphisms in DNMT3B and MTHFR have been implicated in cancer etiology; however, it is increasingly clear that gene-specific DNA methylation also affects gene expression. A cross-sectional study (N = 272) investigated the main and joint effects of polymorphisms and DNA methylation in DNMT3B and MTHFR on colorectal adenoma risk. Polymorphisms examined included DNMT3B c.-6-1045G > T, and MTHFR c.665C > T and c.1286A > C. DNA methylation of 66 and 28 CpG sites in DNMT3B and MTHFR, respectively, was quantified in blood leukocytes using Sequenom EpiTYPER®. DNA methylation was conceptualized using two approaches: (1) average methylation and (2) unsupervised principal component analysis to identify variables that represented methylation around the transcription start site and the gene coding area of both genes. Logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (CIs) associated with the main and joint effects of polymorphisms and DNA methylation. DNA methyltransferase 3B (DNMT3B) TT versus GG/GT genotypes was associated with increased colorectal adenoma risk (OR = 2.12; 95% CI: 1.03-4.34). In addition, increasing DNA methylation in the gene-coding area of DNMT3B was associated with higher risk of colorectal adenomas (OR = 1.34; 95% CI: 1.01-1.79 per SD). In joint effect analyses, synergistic effects were observed among those with both the DNMT3B TT genotype and higher DNMT3B methylation levels compared to those with GT/GG genotypes and lower methylation levels (OR = 4.19; 95% CI: 1.45-12.13 for average methylation; OR = 4.26; 95%CI: 1.31-13.87 for methylation in the transcription start site). This research provides novel evidence that genetic and epigenetic variations contribute to colorectal adenoma risk, precursor to the majority of colorectal cancer (CRC).

  12. Genetic variations of the porcine PRKAG3 gene in Chinese indigenous pig breeds

    Directory of Open Access Journals (Sweden)

    Zhou Li-Hua

    2004-07-01

    Full Text Available Abstract Four missense substitutions (T30N, G52S, V199I and R200Q in the porcine PRKAG3 gene were considered as the likely candidate loci affecting meat quality. In this study, the R200Q substitution was investigated in a sample of 62 individuals from Hampshire, Chinese Min and Erhualian pigs, and the genetic variations of T30N, G52S and V199I substitutions were detected in 1505 individuals from 21 Chinese indigenous breeds, 5 Western commercial pig breeds, and the wild pig. Allele 200R was fixed in Chinese Min and Erhualian pigs. Haplotypes II-QQ and IV-QQ were not observed in the Hampshire population, supporting the hypothesis that allele 200Q is tightly linked with allele 199V. Significant differences in allele frequencies of the three substitutions (T30N, G52S and V199I between Chinese indigenous pigs and Western commercial pigs were observed. Obvious high frequencies of the "favorable" alleles 30T and 52G in terms of meat quality were detected in Chinese indigenous pigs, which are well known for high meat quality. However, the frequency of the "favorable" allele 199I, which was reported to have a greater effect on meat quality in comparison with 30T and 52G, was very low in all of the Chinese indigenous pigs except for the Min pig. The reasons accounting for this discrepancy remain to be addressed. The presence of the three substitutions in purebred Chinese Tibetan pigs indicates that the three substitutions were ancestral mutations. A novel A/G substitution at position 51 in exon 1 was identified. The results suggest that further studies are required to investigate the associations of these substitutions in the PRKAG3 gene with meat quality of Chinese indigenous pigs, and to uncover other polymorphisms in the PRKAG3 gene with potential effects on meat quality in Chinese indigenous pigs.

  13. Melanopsin gene variations interact with season to predict sleep onset and chronotype.

    Science.gov (United States)

    Roecklein, Kathryn A; Wong, Patricia M; Franzen, Peter L; Hasler, Brant P; Wood-Vasey, W Michael; Nimgaonkar, Vishwajit L; Miller, Megan A; Kepreos, Kyle M; Ferrell, Robert E; Manuck, Stephen B

    2012-10-01

    The human melanopsin gene has been reported to mediate risk for seasonal affective disorder (SAD), which is hypothesized to be caused by decreased photic input during winter when light levels fall below threshold, resulting in differences in circadian phase and/or sleep. However, it is unclear if melanopsin increases risk of SAD by causing differences in sleep or circadian phase, or if those differences are symptoms of the mood disorder. To determine if melanopsin sequence variations are associated with differences in sleep-wake behavior among those not suffering from a mood disorder, the authors tested associations between melanopsin gene polymorphisms and self-reported sleep timing (sleep onset and wake time) in a community sample (N = 234) of non-Hispanic Caucasian participants (age 30-54 yrs) with no history of psychological, neurological, or sleep disorders. The authors also tested the effect of melanopsin variations on differences in preferred sleep and activity timing (i.e., chronotype), which may reflect differences in circadian phase, sleep homeostasis, or both. Daylength on the day of assessment was measured and included in analyses. DNA samples were genotyped for melanopsin gene polymorphisms using fluorescence polarization. P10L genotype interacted with daylength to predict self-reported sleep onset (interaction p sleep onset among those with the TT genotype was later in the day when individuals were assessed on longer days and earlier in the day on shorter days, whereas individuals in the other genotype groups (i.e., CC and CT) did not show this interaction effect. P10L genotype also interacted in an analogous way with daylength to predict self-reported morningness (interaction p sleep onset and chronotype as a function of daylength, whereas other genotypes at P10L do not seem to have effects that vary by daylength. A better understanding of how melanopsin confers heightened responsivity to daylength may improve our understanding of a broad range of

  14. Polymorphisms in the WNK1 gene are associated with blood pressure variation and urinary potassium excretion.

    Directory of Open Access Journals (Sweden)

    Stephen Newhouse

    Full Text Available WNK1--a serine/threonine kinase involved in electrolyte homeostasis and blood pressure (BP control--is an excellent candidate gene for essential hypertension (EH. We and others have previously reported association between WNK1 and BP variation. Using tag SNPs (tSNPs that capture 100% of common WNK1 variation in HapMap, we aimed to replicate our findings with BP and to test for association with phenotypes relating to WNK1 function in the British Genetics of Hypertension (BRIGHT study case-control resource (1700 hypertensive cases and 1700 normotensive controls. We found multiple variants to be associated with systolic blood pressure, SBP (7/28 tSNPs min-p = 0.0005, diastolic blood pressure, DBP (7/28 tSNPs min-p = 0.002 and 24 hour urinary potassium excretion (10/28 tSNPs min-p = 0.0004. Associations with SBP and urine potassium remained significant after correction for multiple testing (p = 0.02 and p = 0.01 respectively. The major allele (A of rs765250, located in intron 1, demonstrated the strongest evidence for association with SBP, effect size 3.14 mmHg (95%CI:1.23-4.9, DBP 1.9 mmHg (95%CI:0.7-3.2 and hypertension, odds ratio (OR: 1.3 [95%CI: 1.0-1.7].We genotyped this variant in six independent populations (n = 14,451 and replicated the association between rs765250 and SBP in a meta-analysis (p = 7 x 10(-3, combined with BRIGHT data-set p = 2 x 10(-4, n = 17,851. The associations of WNK1 with DBP and EH were not confirmed. Haplotype analysis revealed striking associations with hypertension and BP variation (global permutation p10 mmHg reduction and risk for hypertension (OR<0.60. Our data indicates that multiple rare and common WNK1 variants contribute to BP variation and hypertension, and provide compelling evidence to initiate further genetic and functional studies to explore the role of WNK1 in BP regulation and EH.

  15. Natural variation in the Pto pathogen resistance gene within species of wild tomato (Lycopersicon). I. Functional analysis of Pto alleles.

    Science.gov (United States)

    Rose, Laura E; Langley, Charles H; Bernal, Adriana J; Michelmore, Richard W

    2005-09-01

    Disease resistance to the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) in the cultivated tomato, Lycopersicon esculentum, and the closely related L. pimpinellifolium is triggered by the physical interaction between plant disease resistance protein, Pto, and the pathogen avirulence protein, AvrPto. To investigate the extent to which variation in the Pto gene is responsible for naturally occurring variation in resistance to Pst, we determined the resistance phenotype of 51 accessions from seven species of Lycopersicon to isogenic strains of Pst differing in the presence of avrPto. One-third of the plants displayed resistance specifically when the pathogen expressed AvrPto, consistent with a gene-for-gene interaction. To test whether this resistance in these species was conferred specifically by the Pto gene, alleles of Pto were amplified and sequenced from 49 individuals and a subset (16) of these alleles was tested in planta using Agrobacterium-mediated transient assays. Eleven alleles conferred a hypersensitive resistance response (HR) in the presence of AvrPto, while 5 did not. Ten amino acid substitutions associated with the absence of AvrPto recognition and HR were identified, none of which had been identified in previous structure-function studies. Additionally, 3 alleles encoding putative pseudogenes of Pto were isolated from two species of Lycopersicon. Therefore, a large proportion, but not all, of the natural variation in the reaction to strains of Pst expressing AvrPto can be attributed to sequence variation in the Pto gene.

  16. La voz en el discurso académico

    Directory of Open Access Journals (Sweden)

    Nicolás Polo Figueroa

    2012-01-01

    Full Text Available En aras del positivismo imperante en las aulas académicas, el término voz estaba proscrito del discurso académico. El escritor solo podía hablar en la forma impersonal se; la voz del colectivo científico al que le prestaba la voz. Gracias a renovados vientos en las ciencias humanas, la intersubjetividad en el discurso académico ha salido del clóset; los académicos están dejando oír su propia voz, aunque son muy conscientes de que tras esta hay una sinfonía de voces: la colectiva, la intersubjetiva, la social y la discursiva. Una mirada a estas es el objeto de esta comunicación.

  17. Patterns of human genetic variation inferred from comparative analysis of allelic mutations in blood group antigen genes.

    Science.gov (United States)

    Patnaik, Santosh Kumar; Blumenfeld, Olga O

    2011-03-01

    Comparative analysis of allelic variation of a gene sheds light on the pattern and process of its diversification at the population level. Gene families for which a large number of allelic forms have been verified by sequencing provide a useful resource for such studies. In this regard, human blood group-encoding genes are unique in that differences of cell surface traits among individuals and populations can be readily detected by serological screening, and correlation between the variant cell surface phenotype and the genotype is, in most cases, unequivocal. Here, we perform a comprehensive analysis of allelic forms, compiled in the Blood Group Antigen Gene Mutation database, of ABO, RHD/CE, GYPA/B/E and FUT1/2 gene families that encode the ABO, RH, MNS, and H/h blood group system antigens, respectively. These genes are excellent illustrative examples showing distinct mutational patterns among the alleles, and leading to speculation on how their origin may have been driven by recurrent but different molecular mechanisms. We illustrate how alignment of alleles of a gene may provide an additional insight into the DNA variation process and its pathways, and how this approach may serve to catalog alleles of a gene, simplifying the task and content of mutation databases.

  18. Identification of genes related to the phenotypic variations of a synthesized Paulownia (Paulownia tomentosa×Paulownia fortunei) autotetraploid.

    Science.gov (United States)

    Li, Yongsheng; Fan, Guoqiang; Dong, Yanpeng; Zhao, Zhenli; Deng, Minjie; Cao, Xibing; Xu, Enkai; Niu, Suyan

    2014-12-15

    Paulownia is a fast-growing deciduous tree native to China. It has great economic importance for the pulp and paper industries, as well as ecological prominence in forest ecosystems. Paulownia is of much interest to plant breeder keen to explore new plant varieties by selecting on the basis of phenotype. A newly synthesized autotetraploid Paulownia exhibited advanced characteristics, such as greater yield, and higher resistance than the diploid tree. However, tissue-specific transcriptome and genomic data in public databases are not sufficient to understand the molecular mechanisms associated with genome duplication. To evaluate the effects of genome duplication on the phenotypic variations in Paulownia tomentosa×Paulownia fortunei, the transcriptomes of the autotetraploid and diploid Paulownia were compared. Using Illumina sequencing technology, a total of 82,934 All-unigenes with a mean length of 1109 bp were assembled. The data revealed numerous differences in gene expression between the two transcriptomes, including 718 up-regulated and 667 down-regulated differentially expressed genes between the two Paulownia trees. An analysis of the pathway and gene annotations revealed that genes involved in nucleotide sugar metabolism in plant cell walls were down-regulated, and genes involved in the light signal pathway and the biosynthesis of structural polymers were up-regulated in autotetraploid Paulownia. The differentially expressed genes may contribute to the observed phenotypic variations between diploid and autotetraploid Paulownia. These results provide a significant resource for understanding the variations in Paulownia polyploidization and will benefit future breeding work.

  19. Association between a variation in the phosphodiesterase 4D gene and bone mineral density

    Directory of Open Access Journals (Sweden)

    Sambrook Philip N

    2005-03-01

    Full Text Available Abstract Background Fragility fractures caused by osteoporosis are a major cause of morbidity and mortality in aging populations. Bone mineral density (BMD is a useful surrogate marker for risk of fracture and is a highly heritable trait. The genetic variants underlying this genetic contribution are largely unknown. Methods We performed a large-scale association study investigating more than 25,000 single nucleotide polymorphisms (SNPs located within 16,000 genes. Allele frequencies were estimated in contrasting DNA pools from white females selected for low (2, n = 319 and high (> 1.11 g/cm2, n = 321 BMD at the lumbar spine. Significant findings were verified in two additional sample collections. Results Based on allele frequency differences between DNA pools and subsequent individual genotyping, one of the candidate loci indicated was the phosphodiesterase 4D (PDE4D gene region on chromosome 5q12. We subsequently tested the marker SNP, rs1498608, in a second sample of 138 white females with low (2 and 138 females with high (>1.04 g/cm2 lumbar spine BMD. Odds ratios were 1.5 (P = 0.035 in the original sample and 2.1 (P = 0.018 in the replication sample. Association fine mapping with 80 SNPs located within 50 kilobases of the marker SNP identified a 20 kilobase region of association containing exon 6 of PDE4D. In a second, family-based replication sample with a preponderance of females with low BMD, rs1498608 showed an opposite relationship with BMD at different sites (p = 0.00044-0.09. We also replicated the previously reported association of the Ser37Ala polymorphism in BMP2, known to interact biologically with PDE4D, with BMD. Conclusion This study indicates that variants in the gene encoding PDE4D account for some of the genetic contribution to bone mineral density variation in humans. The contrasting results from different samples indicate that the effect may be context-dependent. PDE4 inhibitors have been shown to increase bone mass in

  20. Académico Jorge Segura Vargas

    Directory of Open Access Journals (Sweden)

    Alfredo Jácome Roca

    2011-07-01

    Full Text Available

    El doctor Jorge Segura Vargas nació en Duitama, Boyacá, el 14 de agosto de 1924. Ingresó como estudiante fundador en 1942 a la naciente escuela de medicina de la Javeriana, la segunda facultad en Bogotá, que contó con no pocos enemigos que casi acaban con ella. El apoyo de algunos distinguidos profesores de la época –que además firmaron el acta de fundación- el tesón del Padre Félix Restrepo, a la sazón Rector Magnífico, y la perseverancia de alumnos como Segura, permitió que este finalizara sus estudios en 1947 en la primera promoción y se graduara en 1950 con la tesis “Vesícula no visible, intubación duodenal”. Con el título no terminaron los avatares, por la resistencia que generaban los egresados de la nueva escuela médica. Sin embargo, Jorge y algunos compañeros lograron ingresar al Hospital San José de Bogotá, donde llegaron a ser muy apreciados. El entrenamiento lo logró realizar en este tradicional centro hospitalario de la capital, con el profesor Hernando Anzola Cubides. Era Anzola un distinguido académico, miembro de la Sociedad de Cirugía de Bogotá, quien creó una importante escuela quirúrgica en la capital.

    Fue Alumno Fundador y Profesor Distinguido de la Facultad de Medicina de la Universidad Javeriana, Jefe del Departamento Quirúrgico del Hospital San Ignacio, donde dejó un legado de habilidades y conocimientos quirúrgicos, bonhomía y lealtad con la Facultad, que acompañó de principio a fin, en las buenas y en las malas.

  1. Association of genetic variations of the prostasin gene with essential hypertension in the Xinjiang Kazakh population

    Institute of Scientific and Technical Information of China (English)

    LI Nan-fang; ZHANG Ju-hong; CHANG Jian-hang; YANG Jin; WANG Hong-mei; ZHOU Ling; LUO Wen-li

    2011-01-01

    Background Transgenic overexpression of human prostasin in rats disturbs salt balance and causes hypertension. We investigated whether genetic variations in prostasin were implicated in hypertension or related phenotypes in the Xinjiang Kazakh population.Methods We sequenced all exons and the promoter regions of the prostasin gene in 94 hypertensive individuals, and the genotype identification was performed by the TaqMan polymerase chain reaction method. Case-control studies were conducted in 938 Kazakh subjects.Results E342K and 2827G>A, which are novel variants, were successfully genotyped in the general Xinjiang Kazakh population with a sample size of 938 individuals (406 men and 532 women). Only one hypertensive patient was identified with the E342K mutation. No significant association was observed between 2827G>A and hypertension. However,quantitative traits of hypertensive intermediate phenotypes were significantly associated with the A allele; P=-0.041 and 0.034 for body mass index (BMI) in the additive and recessive models, P=0.042 and 0.018 for OGTT-2h glucose in the additive and recessive models, P=0.031 for IRT-3h insulin in the recessive model, and P=0.038 for serum potassium in the dominant model.Conclusions This study does not provide evidence of a major role of prostasin variation in blood pressure modulation.However, association of prostasin polymorphisms with hypertension and metabolic effects can be observed in our population. Further investigation is warranted to clarify the relevance of prostasin polymorphisms to blood pressure regulation.

  2. Natural variation in rosette size under salt stress conditions corresponds to developmental differences between Arabidopsis accessions and allelic variation in the LRR-KISS gene

    KAUST Repository

    Julkowska, Magdalena M.

    2016-02-11

    Natural variation among Arabidopsis accessions is an important genetic resource to identify mechanisms underlying plant development and stress tolerance. To evaluate the natural variation in salinity stress tolerance, two large-scale experiments were performed on two populations consisting of 160 Arabidopsis accessions each. Multiple traits, including projected rosette area, and fresh and dry weight were collected as an estimate for salinity tolerance. Our results reveal a correlation between rosette size under salt stress conditions and developmental differences between the accessions grown in control conditions, suggesting that in general larger plants were more salt tolerant. This correlation was less pronounced when plants were grown under severe salt stress conditions. Subsequent genome wide association study (GWAS) revealed associations with novel candidate genes for salinity tolerance such as LRR-KISS (At4g08850), flowering locus KH-domain containing protein and a DUF1639-containing protein. Accessions with high LRR-KISS expression developed larger rosettes under salt stress conditions. Further characterization of allelic variation in candidate genes identified in this study will provide more insight into mechanisms of salt stress tolerance due to enhanced shoot growth.

  3. The association between common genetic variation in the FTO gene and metabolic syndrome in Han Chinese

    Institute of Scientific and Technical Information of China (English)

    WANG Tong; ZHANG Li-li; ZHANG Yun; SUN Xiao-fang; ZHANG Qian; HUANG Yi; XIAO Xin-hua; WANG Duen-mei; DIAO Cheng-ming; ZHANG Feng; XU Ling-ling; ZHANG Yong-biao; LI Wen-hui

    2010-01-01

    Background Genome-wide association studies for type 2 diabetes mellitus (T2DM) identified FTO gene as a locus conferring increased risk for common obesity in many populations with European ancestry. However, the involvement of FTO gene in obesity or T2DM related metabolic traits has not been consistently established in Chinese populations. The objective of this study was to investigate the association of FTO genetic polymorphisms with metabolic syndrome (MetS) in Han Chinese.Methods We tested 41 FTO single nucleotide polymorphisms (SNPs) for association between FTO and MetS-related traits. There were a total of 236 unrelated subjects (108 cases and 128 controls), grouped according to the International Diabetes Federation (IDF) criteria.Results Of the 41 SNPs examined, only SNP rs8047395 exhibited statistical significance (P=0.026) under a recessive model, after Bonferroni adjustment for multiple testing (OR 1.64, 95% CI 1.11-2.42; P=0.014). The common distributions of this polymorphism among Chinese-with a minor allele frequency (MAF) of 36% in the control group versus 48% in the MetS group-greatly improved our test power in a relatively small sample size for an association study. Previously identified obesity-(or T2DM-) associated FTO SNPs were less common in Han Chinese and were not associated with MetS in this study. No significant associations were found between our FTO SNPs and any endophenotypes of MetS.Conclusions A more common risk-conferring variant of FTO for MetS was identified in Han Chinese. Our study substantiated that genetic variations in FTO locus are involved in the pathogenesis of MetS.

  4. Case Study of Somaclonal Variation in Resistance Genes Mlo and Pme3 in Flaxseed (Linum usitatissimum L.) Induced by Nanoparticles

    Science.gov (United States)

    Kokina, Inese; Jermaļonoka, Marija; Bankovska, Linda; Gerbreders, Vjačeslavs; Ogurcovs, Andrejs; Jahundoviča, Inese

    2017-01-01

    Nanoparticles influence on genome is investigated worldwide. The appearance of somaclonal variation is a cause of great concern for any micropropagation system. Somaclonal variation describes the tissue-culture-induced phenotypic and genotypic variations. This paper shows the results of somaclonal variation in two resistance genes pectin methylesterase and Mlo-like protein in all tissue culture development stages, as donor plant, calluses, and regenerants of Linum usitatissimum induced by gold and silver nanoparticles. In this paper, it was essential to obtain DNA material from all tissue culture development stages from one donor plant to record changes in each nucleotide sequence. Gene region specific primers were developed for resistance genes such as Mlo and Pme3 to define the genetic variability in tissue culture of L. usitatissimum. In recent years, utilization of gold and silver nanoparticles in tissue culture is increased and the mechanisms of changes in genome induced by nanoparticles still remain unclear. Obtained data show the somaclonal variation increase in calluses obtained from one donor plant and grown on medium supplemented by gold nanoparticles (Mlo 14.68 ± 0.98; Pme3 2.07 ± 0.87) or silver nanoparticles (Mlo 12.01 ± 0.43; Pme3 10.04 ± 0.46) and decrease in regenerants. Morphological parameters of calluses showed a number of differences between each investigated culture group. PMID:28326314

  5. Common genetic variation in the Estrogen Receptor Beta (ESR2) gene and osteoarthritis: Results of a meta-analysis

    NARCIS (Netherlands)

    J.M. Kerkhof (Hanneke); I. Meulenbelt (Ingrid); A. Gonzalez (Antonio); D.J. Hart (Deborah); A. Hofman (Albert); M. Kloppenburg (Margreet); N.E. Lane; J. Loughlin (John); M.C. Nevitt (Michael); H.A.P. Pols (Huib); F. Rivadeneira Ramirez (Fernando); E. Slagboom (Eline); T.D. Spector (Tim); L. Stolk (Lisette); A. Tsezou (Aspasia); A.G. Uitterlinden (André); A.M. Valdes (Ana Maria); J.B.J. van Meurs (Joyce); A.J. Carr (Andrew Jonathan)

    2010-01-01

    textabstractBackground: The objective of this study was to examine the relationship between common genetic variation of the ESR2 gene and osteoarthritis.Methods: In the discovery study, the Rotterdam Study-I, 7 single nucleotide polymorphisms (SNPs) were genotyped and tested for association with hip

  6. Ovine leukocyte profiles do not associate with variation in the prion gene, but are breed-dependent

    Science.gov (United States)

    Prion genotype in sheep confer resistance to scrapie. In cattle, lymphocyte profile has been found to be associated with prion genotype. Therefore, the aim of this study was to determine if variations in the sheep prion gene were associated with leukocyte populations as measured by complete blood ce...

  7. Variations in potassium channel genes are associated with breast pain in women prior to breast cancer surgery.

    Science.gov (United States)

    Langford, Dale J; West, Claudia; Elboim, Charles; Cooper, Bruce A; Abrams, Gary; Paul, Steven M; Schmidt, Brian L; Levine, Jon D; Merriman, John D; Dhruva, Anand; Neuhaus, John; Leutwyler, Heather; Baggott, Christina; Sullivan, Carmen Ward; Aouizerat, Bradley E; Miaskowski, Christine

    2014-01-01

    Preoperative breast pain in women with breast cancer may result from a number of causes. Previous work from our team found that breast pain occurred in 28.2% of women (n = 398) who were about to undergo breast cancer surgery. The occurrence of preoperative breast pain was associated with a number of demographic and clinical characteristics, as well as variation in two cytokine genes. Given that ion channels regulate excitability of sensory neurons, we hypothesized that variations in potassium channel genes would be associated with preoperative breast pain in these patients. Therefore, in this study, we evaluated for associations between single-nucleotide polymorphisms and inferred haplotypes among 10 potassium channel genes and the occurrence of preoperative breast pain in patients scheduled to undergo breast cancer surgery. Multivariable logistic regression analyses were used to identify those genetic variations that were associated with the occurrence of preoperative breast pain while controlling for age and genomic estimates of and self-reported race/ethnicity. Variations in four potassium channel genes: (1) potassium voltage-gated channel, delayed rectifier, subfamily S, member 1 (KCNS1); (2) potassium inwardly rectifying channel, subfamily J, member 3 (KCNJ3); (3) KCNJ6; and (4) potassium channel, subfamily K, member 9 (KCNK9) were associated with the occurrence of breast pain. Findings from this study warrant replication in an independent sample of women who report breast pain following one or more breast biopsies.

  8. D-amino acid oxidase activator gene (DAOA) variation affects cerebrospinal fluid homovanillic acid concentrations in healthy Caucasians

    DEFF Research Database (Denmark)

    Andreou, Dimitrios; Saetre, Peter; Werge, Thomas;

    2012-01-01

    3918342 and rs1421292, were significantly associated with CSF HVA concentrations. Rs3918342 was found to be nominally associated with CSF 5-HIAA concentrations. None of the polymorphisms were significantly associated with MHPG concentrations. Our results indicate that DAOA gene variation affects dopamine...

  9. Common Variation in the NOS1AP Gene Is Associated With Drug-Induced QT Prolongation and Ventricular Arrhythmia

    NARCIS (Netherlands)

    Jamshidi, Yalda; Nolte, Ilja M.; Dalageorgou, Chrysoula; Zheng, Dongling; Johnson, Toby; Bastiaenen, Rachel; Ruddy, Suzanne; Talbott, Daniel; Norris, Kris J.; Snieder, Harold; George, Alfred L.; Marshall, Vanessa; Shakir, Saad; Kannankeril, Prince J.; Munroe, Patricia B.; Camm, A. John; Jeffery, Steve; Roden, Dan M.; Behr, Elijah R.

    2012-01-01

    Objectives This study sought to determine whether variations in NOS1AP affect drug-induced long QT syndrome (LQTS). Background Use of antiarrhythmic drugs is limited by the high incidence of serious adverse events including QT prolongation and torsades de pointes. NOS1AP gene variants play a role in

  10. Common variation in oxidative phosphorylation genes is not a major cause of insulin resistance or type 2 diabetes

    DEFF Research Database (Denmark)

    Snogdal, L S; Wod, M; Grarup, Niels;

    2012-01-01

    There is substantial evidence that mitochondrial dysfunction is linked to insulin resistance and is present in several tissues relevant to the pathogenesis of type 2 diabetes. Here, we examined whether common variation in genes involved in oxidative phosphorylation (OxPhos) contributes to type 2...... diabetes susceptibility or influences diabetes-related metabolic traits....

  11. Genetic Variation and the Risk of Haloperidol-Related Parkinsonism in Elderly Patients A Candidate Gene Approach

    NARCIS (Netherlands)

    Knol, Wilma; van Marum, Rob J.; Jansen, Paul A. F.; Strengman, Eric; Al Hadithy, Asmar F. Y.; Wilffert, Bob; Schobben, Alfred F. A. M.; Ophoff, Roel A.; Egberts, Toine C. G.

    2013-01-01

    Factors that influence the variation in occurrence of antipsychotic-related parkinsonism in elderly have not been well elucidated. The aim of this study was to investigate whether previous identified and studied genetic polymorphisms at DRD2, ANKK1, DRD3, HTR2A, HTR2C, RGS2, COMT, and BDNF genes are

  12. The impact of heat shock protein 70 gene variations on clinical presentation and outcome in schizophrenic inpatients.

    Science.gov (United States)

    Pae, Chi-Un; Drago, Antonio; Kim, Jung-Jin; Mandelli, Laura; De Ronchi, Diana; Serretti, Alessandro

    2009-01-01

    We previously investigated a group of single-nucleotide polymorphisms of a set of genes coding for heat shock proteins (HSPA1A, HSPA1B and HSPA1L) and found a significant association between one HSPA1B variation and schizophrenia (SZ). We now report an association between a set of variations (rs2227956, rs2075799, rs1043618, rs562047 and rs539689) within the same genes and a larger sample of schizophrenic inpatients. A single variation, rs539689 (HSPA1B), was found to be marginally associated with Positive and Negative Syndrome Scale (PANSS) positive scores at discharge, and haplotype analysis revealed a significant association between improvement in PANSS scores with both A-C-G-G and A-C-G-G haplotypes. These findings further support a role of heat shock proteins in the pathophysiology of SZ.

  13. Genetic variation in selenoprotein genes, lifestyle, and risk of colon and rectal cancer.

    Directory of Open Access Journals (Sweden)

    Martha L Slattery

    Full Text Available BACKGROUND: Associations between selenium and cancer have directed attention to role of selenoproteins in the carcinogenic process. METHODS: We used data from two population-based case-control studies of colon (n = 1555 cases, 1956 controls and rectal (n = 754 cases, 959 controls cancer. We evaluated the association between genetic variation in TXNRD1, TXNRD2, TXNRD3, C11orf31 (SelH, SelW, SelN1, SelS, SepX, and SeP15 with colorectal cancer risk. RESULTS: After adjustment for multiple comparisons, several associations were observed. Two SNPs in TXNRD3 were associated with rectal cancer (rs11718498 dominant OR 1.42 95% CI 1.16,1.74 pACT 0.0036 and rs9637365 recessive 0.70 95% CI 0.55,0.90 pACT 0.0208. Four SNPs in SepN1 were associated with rectal cancer (rs11247735 recessive OR 1.30 95% CI 1.04,1.63 pACT 0.0410; rs2072749 GGvsAA OR 0.53 95% CI 0.36,0.80 pACT 0.0159; rs4659382 recessive OR 0.58 95% CI 0.39,0.86 pACT 0.0247; rs718391 dominant OR 0.76 95% CI 0.62,0.94 pACT 0.0300. Interaction between these genes and exposures that could influence these genes showed numerous significant associations after adjustment for multiple comparisons. Two SNPs in TXNRD1 and four SNPs in TXNRD2 interacted with aspirin/NSAID to influence colon cancer; one SNP in TXNRD1, two SNPs in TXNRD2, and one SNP in TXNRD3 interacted with aspirin/NSAIDs to influence rectal cancer. Five SNPs in TXNRD2 and one in SelS, SeP15, and SelW1 interacted with estrogen to modify colon cancer risk; one SNP in SelW1 interacted with estrogen to alter rectal cancer risk. Several SNPs in this candidate pathway influenced survival after diagnosis with colon cancer (SeP15 and SepX1 increased HRR and rectal cancer (SepX1 increased HRR. CONCLUSIONS: Findings support an association between selenoprotein genes and colon and rectal cancer development and survival after diagnosis. Given the interactions observed, it is likely that the impact of cancer susceptibility from genotype is

  14. Variations in host genes encoding adhesion molecules and susceptibility to falciparum malaria in India

    Directory of Open Access Journals (Sweden)

    Tyagi Prajesh K

    2008-12-01

    Full Text Available Abstract Background Host adhesion molecules play a significant role in the pathogenesis of Plasmodium falciparum malaria and changes in their structure or levels in individuals can influence the outcome of infection. The aim of this study was to investigate the association of SNPs of three adhesion molecule genes, ICAM1, PECAM1 and CD36, with severity of falciparum malaria in a malaria-endemic and a non-endemic region of India. Methods The frequency distribution of seven selected SNPs of ICAM1, PECAM1 and CD36 was determined in 552 individuals drawn from 24 populations across India. SNP-disease association was analysed in a case-control study format. Genotyping of the population panel was performed by Sequenom mass spectroscopy and patient/control samples were genotyped by SNaPshot method. Haplotypes and linkage disequilibrium (LD plots were generated using PHASE and Haploview, respectively. Odds-ratio (OR for risk assessment was estimated using EpiInfo™ version 3.4. Results Association of the ICAM1 rs5498 (exon 6 G allele and the CD36 exon 1a A allele with increased risk of severe malaria was observed (severe versus control, OR = 1.91 and 2.66, P = 0.02 and 0.0012, respectively. The CD36 rs1334512 (-53 T allele as well as the TT genotype associated with protection from severe disease (severe versus control, TT versus GG, OR = 0.37, P = 0.004. Interestingly, a SNP of the PECAM1 gene (rs668, exon 3, C/G with low minor allele frequency in populations of the endemic region compared to the non-endemic region exhibited differential association with disease in these regions; the G allele was a risk factor for malaria in the endemic region, but exhibited significant association with protection from disease in the non-endemic region. Conclusion The data highlights the significance of variations in the ICAM1, PECAM1 and CD36 genes in the manifestation of falciparum malaria in India. The PECAM1 exon 3 SNP exhibits altered association with disease in the

  15. Common Variation in the LRRK2 Gene is a Risk Factor for Parkinson’s Disease

    Science.gov (United States)

    Mata, Ignacio F.; Checkoway, Harvey; Hutter, Carolyn M.; Samii, Ali; Roberts, John W.; Kim, Hojoong M.; Agarwal, Pinky; Alvarez, Victoria; Ribacoba, Renee; Pastor, Pau; Lorenzo-Betancor, Oswaldo; Infante, Jon; Sierra, María; Gómez-Garre, Pilar; Mir, Pablo; Ritz, Beate; Rhodes, Shannon L; Colcher, Amy; Van Deerlin, Vivianna; Chung, Kathryn A.; Quinn, Joseph F.; Yearout, Dora; Martinez, Erica; Farin, Federico M.; Wan, Jia Y.; Edwards, Karen L.; Zabetian, Cyrus P.

    2012-01-01

    Background Common variants in the LRRK2 gene influence risk of Parkinson’s disease (PD) in Asians, but whether the same is true in European-derived populations is less clear. Methods We genotyped 66 LRRK2 tagging single nucleotide polymorphisms (SNPs) in 575 PD patients and 689 controls from the Northwestern U.S. (Tier 1). PD-associated SNPs (p<0.05) were then genotyped in an independent sample of 3617 cases and 2512 controls from the U.S. and Spain (Tier 2). Logistic regression was used to model additive SNP genotype effects adjusted for age and sex among white individuals. Results Two regions showed independent association with PD in Tier 1, and SNPs in both regions were successfully replicated in Tier 2 (rs10878226, combined odds ratio [OR], 1.20; 95% confidence interval [CI], 1.08-1.33; p=6.3×10−4; rs11176013, OR, 0.89; CI, 0.83-0.95; p=4.6×10−4). Conclusions Our data suggest that common variation within LRRK2 conveys susceptibility for PD in individuals of European ancestry. PMID:23115130

  16. Haplotype variation of Green Revolution gene Rht-D1 during wheat domestication and improvement

    Institute of Scientific and Technical Information of China (English)

    Chihong Zhang; Lifeng Gao; Jiaqiang Sun; Jizeng Jia; Zhenglong Ren

    2014-01-01

    Green Revolution made a substantial contribution to wheat yields worldwide in the 1960s and 1970s. It is of great importance to analyze the haplotype variation of Rht-D1, the Green Revolution gene, during wheat (Triticum aestivum L.) domestication and breeding to understand its evolution and function in wheat breeding history. In this study, the Rht-D1 and its flanking regions were sequenced and single nucleotide polymorphisms were detected based on a panel of 45 accessions of Aegilops tauschi , 51 accessions of landraces and 80 accessions of commercial varieties. Genetic diversity in the wild accessions was much higher than that in the varieties and higher than that reported previously. Seven haplotypes (Hapl I to Hapl VII) of Rht-D1 were identified and their evolutionary relationships were proposed. In addition to the wel-known Green Revolution al ele Rht-D1b, Hapl VII (an al ele Rht-D1k) was identified in early breeding varieties, which reduced plant height by 16%. The results suggested that Rht-D1k had been used in breeding before the Green Revolution and made a great contribution to wheat production worldwide. Based on the breeding history and molecular evidence, we proposed that the wheat Green Revolution in China and International Maize and Wheat Improvement Center (CIMMYT) occurred independently.

  17. Heritable variation in heat shock gene expression: a potential mechanism for adaptation to thermal stress in embryos of sea turtles.

    Science.gov (United States)

    Tedeschi, J N; Kennington, W J; Tomkins, J L; Berry, O; Whiting, S; Meekan, M G; Mitchell, N J

    2016-01-13

    The capacity of species to respond adaptively to warming temperatures will be key to their survival in the Anthropocene. The embryos of egg-laying species such as sea turtles have limited behavioural means for avoiding high nest temperatures, and responses at the physiological level may be critical to coping with predicted global temperature increases. Using the loggerhead sea turtle (Caretta caretta) as a model, we used quantitative PCR to characterise variation in the expression response of heat-shock genes (hsp60, hsp70 and hsp90; molecular chaperones involved in cellular stress response) to an acute non-lethal heat shock. We show significant variation in gene expression at the clutch and population levels for some, but not all hsp genes. Using pedigree information, we estimated heritabilities of the expression response of hsp genes to heat shock and demonstrated both maternal and additive genetic effects. This is the first evidence that the heat-shock response is heritable in sea turtles and operates at the embryonic stage in any reptile. The presence of heritable variation in the expression of key thermotolerance genes is necessary for sea turtles to adapt at a molecular level to warming incubation environments.

  18. Rendimiento académico y ambiente social Rendimiento académico y ambiente social

    Directory of Open Access Journals (Sweden)

    Jesús Ruíz Herrero

    2011-03-01

    Full Text Available El presente artículo evalúa, mediante procedimientos estadísticos, la influencia que el nivel educativo y la profesión de los progenitores, la renta per cápita del distrito o el tipo de centro pudieran tener sobre el rendimiento académico. La tesis de la que se parte considera que tales factores condicionan los esquemas perceptivos y cognitivos (habitus con los que los alumnos hacen frente a su etapa académica, y que explican su éxito o fracaso. Para demostrarlo, hemos analizado los resultados en la prueba CDI del año 2008 para 6º de Primaria, que la Consejería de Educación de la Comunidad de Madrid organiza desde hace unos años a fin de evaluar el rendimiento académico del alumnado y si su nivel de conocimientos se ajusta a lo esperado para su curso. La perspectiva presentada aquí contrasta con la que sostienen otros discursos, como es el caso del discurso dominante en el sistema educativo, que sólo tienden a enfatizar los factores puramente individuales o psicológicos, o a desligarlos de las condiciones sociales que los han producido.The present article analyzes the influence that variables such as parent´s educational level of attainment or occupation, level of income associated to the family´s area of residence, or kind of school (private vs. factors could account for the differenciated cognitive and perceptive schemata (habitus that children develop to meet “the educational challenge”. To demonstrate such relations, statistical procedures are used. The data tested here has been collected from the average results that different schools taking part in CDI exam obtained in 2008 in the region of Madrid. This exam is held every academic year and organized by Consejería de Educación de Madrid (Madrid Office of Education to evaluate if pupils under test match the official academic level required for the grade they are in. Our perspective is further different than that which only tends to stress psicological factors as the

  19. Produtivismo acadêmico baseado em uma perspectiva habermasiana

    Directory of Open Access Journals (Sweden)

    Fábio Vizeu

    Full Text Available Resumo Este artigo argumenta que a questão da ética na prática acadêmica deve ser tratada com o mesmo cuidado adotado em outras práticas profissionais. Na verdade, uma dificuldade no debate sobre ética na prática acadêmica é desconsiderar que esta também consiste em uma prática social condicionada pelos mesmos problemas que a sociedade contemporânea enfrenta, especialmente em sua dimensão econômica. Nesse sentido, discute-se o utilitarismo na prática acadêmica com base no referencial da ética discursiva de Jürgen Habermas, explorando algumas inquietações sobre o produtivismo acadêmico brasileiro. Metodologicamente, usa-se o ensaio teórico como procedimento argumentativo, visando à construção de um texto menos formal e mais provocativo, instigando a reflexão e o debate, no meio, das questões pontuadas. Especificamente, observamos o problema da valorização quantitativa da produção sem a consideração da qualidade do trabalho acadêmico associado à tentativa de mensuração da atividade acadêmica, além da falta da devida reflexão sobre os valores ético-morais que circunscrevem a atividade científico-educacional no Brasil. Por último, para ilustrar a perspectiva apresentada, recorremos a situações hipotéticas da prática acadêmica e fazemos inferências sobre quatro correlações entre a orientação pragmática e questões éticas, considerando o constructo habermasiano da ação estratégica.

  20. Tissue Specificity and Sex-Specific Regulatory Variation Permit the Evolution of Sex-Biased Gene Expression.

    Science.gov (United States)

    Dean, Rebecca; Mank, Judith E

    2016-09-01

    Genetic correlations between males and females are often thought to constrain the evolution of sexual dimorphism. However, sexually dimorphic traits and the underlying sexually dimorphic gene expression patterns are often rapidly evolving. We explore this apparent paradox by measuring the genetic correlation in gene expression between males and females (Cmf) across broad evolutionary timescales, using two RNA-sequencing data sets spanning multiple populations and multiple species. We find that unbiased genes have higher Cmf than sex-biased genes, consistent with intersexual genetic correlations constraining the evolution of sexual dimorphism. However, we found that highly sex-biased genes (both male and female biased) also had higher tissue specificity, and unbiased genes had greater expression breadth, suggesting that pleiotropy may constrain the breakdown of intersexual genetic correlations. Finally, we show that genes with high Cmf showed some degree of sex-specific changes in gene expression in males and females. Together, our results suggest that genetic correlations between males and females may be less important in constraining the evolution of sex-biased gene expression than pleiotropy. Sex-specific regulatory variation and tissue specificity may resolve the paradox of widespread sex bias within a largely shared genome.

  1. Variation in the MC4R gene is associated with bone phenotypes in elderly Swedish women.

    Directory of Open Access Journals (Sweden)

    Gaurav Garg

    Full Text Available Osteoporosis is characterized by reduced bone mineral density (BMD and increased fracture risk. Fat mass is a determinant of bone strength and both phenotypes have a strong genetic component. In this study, we examined the association between obesity associated polymorphisms (SNPs with body composition, BMD, Ultrasound (QUS, fracture and biomarkers (Homocysteine (Hcy, folate, Vitamin D and Vitamin B12 for obesity and osteoporosis. Five common variants: rs17782313 and rs1770633 (melanocortin 4 receptor (MC4R; rs7566605 (insulin induced gene 2 (INSIG2; rs9939609 and rs1121980 (fat mass and obesity associated (FTO were genotyped in 2 cohorts of Swedish women: PEAK-25 (age 25, n = 1061 and OPRA (age 75, n = 1044. Body mass index (BMI, total body fat and lean mass were strongly positively correlated with QUS and BMD in both cohorts (r(2 = 0.2-0.6. MC4R rs17782313 was associated with QUS in the OPRA cohort and individuals with the minor C-allele had higher values compared to T-allele homozygotes (TT vs. CT vs.100 vs. 103 vs. 103; p = 0.002; (SOS: 1521 vs. 1526 vs. 1524; p = 0.008; (Stiffness index: 69 vs. 73 vs. 74; p = 0.0006 after adjustment for confounders. They also had low folate (18 vs. 17 vs. 16; p = 0.03 and vitamin D (93 vs. 91 vs. 90; p = 0.03 and high Hcy levels (13.7 vs 14.4 vs. 14.5; p = 0.06. Fracture incidence was lower among women with the C-allele, (52% vs. 58%; p = 0.067. Variation in MC4R was not associated with BMD or body composition in either OPRA or PEAK-25. SNPs close to FTO and INSIG2 were not associated with any bone phenotypes in either cohort and FTO SNPs were only associated with body composition in PEAK-25 (p≤0.001. Our results suggest that genetic variation close to MC4R is associated with quantitative ultrasound and risk of fracture.

  2. Genetic Variation in the HSD17B1 Gene and Risk of Prostate Cancer

    Science.gov (United States)

    Kraft, Peter; Pharoah, Paul; Chanock, Stephen J; Albanes, Demetrius; Kolonel, Laurence N; Hayes, Richard B; Altshuler, David; Andriole, Gerald; Berg, Christine; Boeing, Heiner; Burtt, Noel P; Bueno-de-Mesquita, Bas; Calle, Eugenia E; Cann, Howard; Canzian, Federico; Chen, Yen-Ching; Crawford, David E; Dunning, Alison M; Feigelson, Heather S; Freedman, Matthew L; Gaziano, John M; Giovannucci, Ed; Gonzalez, Carlos Alberto; Haiman, Christopher A; Hallmans, Goran; Henderson, Brian E; Hirschhorn, Joel N; Hunter, David J; Kaaks, Rudolf; Key, Timothy; Marchand, Loic Le; Ma, Jing; Overvad, Kim; Palli, Domenico; Pike, Malcolm C; Riboli, Elio; Rodriguez, Carmen; Setiawan, Wendy V; Stampfer, Meir J; Stram, Daniel O; Thomas, Gilles; Thun, Michael J; Travis, Ruth; Trichopoulou, Antonia; Virtamo, Jarmo; Wacholder, Sholom

    2005-01-01

    Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17β-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Δ5-androsterone-3β,17β-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs) that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G) or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002) inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes these subgroup analyses

  3. Genetic variation in the HSD17B1 gene and risk of prostate cancer.

    Directory of Open Access Journals (Sweden)

    Peter Kraft

    2005-11-01

    Full Text Available Steroid hormones are believed to play an important role in prostate carcinogenesis, but epidemiological evidence linking prostate cancer and steroid hormone genes has been inconclusive, in part due to small sample sizes or incomplete characterization of genetic variation at the locus of interest. Here we report on the results of a comprehensive study of the association between HSD17B1 and prostate cancer by the Breast and Prostate Cancer Cohort Consortium, a large collaborative study. HSD17B1 encodes 17beta-hydroxysteroid dehydrogenase 1, an enzyme that converts dihydroepiandrosterone to the testosterone precursor Delta5-androsterone-3beta,17beta-diol and converts estrone to estradiol. The Breast and Prostate Cancer Cohort Consortium researchers systematically characterized variation in HSD17B1 by targeted resequencing and dense genotyping; selected haplotype-tagging single nucleotide polymorphisms (htSNPs that efficiently predict common variants in U.S. and European whites, Latinos, Japanese Americans, and Native Hawaiians; and genotyped these htSNPs in 8,290 prostate cancer cases and 9,367 study-, age-, and ethnicity-matched controls. We found no evidence that HSD17B1 htSNPs (including the nonsynonymous coding SNP S312G or htSNP haplotypes were associated with risk of prostate cancer or tumor stage in the pooled multiethnic sample or in U.S. and European whites. Analyses stratified by age, body mass index, and family history of disease found no subgroup-specific associations between these HSD17B1 htSNPs and prostate cancer. We found significant evidence of heterogeneity in associations between HSD17B1 haplotypes and prostate cancer across ethnicity: one haplotype had a significant (p < 0.002 inverse association with risk of prostate cancer in Latinos and Japanese Americans but showed no evidence of association in African Americans, Native Hawaiians, or whites. However, the smaller numbers of Latinos and Japanese Americans in this study makes

  4. A molecular footprint of limb loss: sequence variation of the autopodial identity gene Hoxa-13.

    Science.gov (United States)

    Kohlsdorf, Tiana; Cummings, Michael P; Lynch, Vincent J; Stopper, Geffrey F; Takahashi, Kazuhiko; Wagner, Günter P

    2008-12-01

    The homeobox gene Hoxa-13 codes for a transcription factor involved in multiple functions, including body axis and hand/foot development in tetrapods. In this study we investigate whether the loss of one function (e.g., limb loss in snakes) left a molecular footprint in exon 1 of Hoxa-13 that could be associated with the release of functional constraints caused by limb loss. Fragments of the Hoxa-13 exon 1 were sequenced from 13 species and analyzed, with additional published sequences of the same region, using relative rates and likelihood-ratio tests. Five amino acid sites in exon 1 of Hoxa-13 were detected as evolving under positive selection in the stem lineage of snakes. To further investigate whether there is an association between limb loss and sequence variation in Hoxa-13, we used the random forest method on an alignment that included shark, basal fish lineages, and "eu-tetrapods" such as mammals, turtle, alligator, and birds. The random forest method approaches the problem as one of classification, where we seek to predict the presence or absence of autopodium based on amino acid variation in Hoxa-13 sequences. Different alignments tested were associated with similar error rates (18.42%). The random forest method suggested that phenotypic states (autopodium present and absent) can often be correctly predicted based on Hoxa-13 sequences. Basal, nontetrapod gnat-hostomes that never had an autopodium were consistently classified as limbless together with the snakes, while eu-tetrapods without any history of limb loss in their phylogeny were also consistently classified as having a limb. Misclassifications affected mostly lizards, which, as a group, have a history of limb loss and limb re-evolution, and the urodele and caecilian in our sample. We conclude that a molecular footprint can be detected in Hoxa-13 that is associated with the lack of an autopodium; groups with classification ambiguity (lizards) are characterized by a history of repeated limb loss

  5. Immune gene expression in Bombus terrestris: signatures of infection despite strong variation among populations, colonies, and sister workers.

    Directory of Open Access Journals (Sweden)

    Franziska S Brunner

    Full Text Available Ecological immunology relies on variation in resistance to parasites. Colonies of the bumblebee Bombus terrestris vary in their susceptibility to the trypanosome gut parasite Crithidia bombi, which reduces colony fitness. To understand the possible origin of this variation in resistance we assayed the expression of 28 immunologically important genes in foraging workers. We deliberately included natural variation of the host "environment" by using bees from colonies collected in two locations and sampling active foraging workers that were not age controlled. Immune gene expression patterns in response to C. bombi showed remarkable variability even among genetically similar sisters. Nevertheless, expression varied with parasite exposure, among colonies and, perhaps surprisingly, strongly among populations (collection sites. While only the antimicrobial peptide abaecin is universally up regulated upon exposure, linear discriminant analysis suggests that the overall exposure effect is driven by a combination of several immune pathways and further immune functions such as ROS regulation. Also, the differences among colonies in their immune gene expression profiles provide clues to the mechanistic basis of well-known inter-colony variation in susceptibility to this parasite. Our results show that transcriptional responses to parasite exposure can be detected in ecologically heterogeneous groups despite strong background noise.

  6. Variations and classification of toxic epitopes related to celiac disease among α-gliadin genes from four Aegilops genomes.

    Science.gov (United States)

    Li, Jie; Wang, Shunli; Li, Shanshan; Ge, Pei; Li, Xiaohui; Ma, Wujun; Zeller, F J; Hsam, Sai L K; Yan, Yueming

    2012-07-01

    The α-gliadins are associated with human celiac disease. A total of 23 noninterrupted full open reading frame α-gliadin genes and 19 pseudogenes were cloned and sequenced from C, M, N, and U genomes of four diploid Aegilops species. Sequence comparison of α-gliadin genes from Aegilops and Triticum species demonstrated an existence of extensive allelic variations in Gli-2 loci of the four Aegilops genomes. Specific structural features were found including the compositions and variations of two polyglutamine domains (QI and QII) and four T cell stimulatory toxic epitopes. The mean numbers of glutamine residues in the QI domain in C and N genomes and the QII domain in C, N, and U genomes were much higher than those in Triticum genomes, and the QI domain in C and N genomes and the QII domain in C, M, N, and U genomes displayed greater length variations. Interestingly, the types and numbers of four T cell stimulatory toxic epitopes in α-gliadins from the four Aegilops genomes were significantly less than those from Triticum A, B, D, and their progenitor genomes. Relationships between the structural variations of the two polyglutamine domains and the distributions of four T cell stimulatory toxic epitopes were found, resulting in the α-gliadin genes from the Aegilops and Triticum genomes to be classified into three groups.

  7. Accurately assessing the risk of schizophrenia conferred by rare copy-number variation affecting genes with brain function.

    Science.gov (United States)

    Raychaudhuri, Soumya; Korn, Joshua M; McCarroll, Steven A; Altshuler, David; Sklar, Pamela; Purcell, Shaun; Daly, Mark J

    2010-09-09

    Investigators have linked rare copy number variation (CNVs) to neuropsychiatric diseases, such as schizophrenia. One hypothesis is that CNV events cause disease by affecting genes with specific brain functions. Under these circumstances, we expect that CNV events in cases should impact brain-function genes more frequently than those events in controls. Previous publications have applied "pathway" analyses to genes within neuropsychiatric case CNVs to show enrichment for brain-functions. While such analyses have been suggestive, they often have not rigorously compared the rates of CNVs impacting genes with brain function in cases to controls, and therefore do not address important confounders such as the large size of brain genes and overall differences in rates and sizes of CNVs. To demonstrate the potential impact of confounders, we genotyped rare CNV events in 2,415 unaffected controls with Affymetrix 6.0; we then applied standard pathway analyses using four sets of brain-function genes and observed an apparently highly significant enrichment for each set. The enrichment is simply driven by the large size of brain-function genes. Instead, we propose a case-control statistical test, cnv-enrichment-test, to compare the rate of CNVs impacting specific gene sets in cases versus controls. With simulations, we demonstrate that cnv-enrichment-test is robust to case-control differences in CNV size, CNV rate, and systematic differences in gene size. Finally, we apply cnv-enrichment-test to rare CNV events published by the International Schizophrenia Consortium (ISC). This approach reveals nominal evidence of case-association in neuronal-activity and the learning gene sets, but not the other two examined gene sets. The neuronal-activity genes have been associated in a separate set of schizophrenia cases and controls; however, testing in independent samples is necessary to definitively confirm this association. Our method is implemented in the PLINK software package.

  8. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    DEFF Research Database (Denmark)

    Bross, Peter; Li, Zhijie; Hansen, Jakob;

    2007-01-01

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups fo...

  9. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    NARCIS (Netherlands)

    Bross, Peter; Li, Zhijie; Hansen, Jakob; Hansen, Jens Jacob; Nielsen, Marit Nyholm; Corydon, Thomas Juhl; Georgopoulos, Costa; Ang, Debbie; Lundemose, Jytte Banner; Niezen-Koning, Klary; Eiberg, Hans; Yang, Huanming; Kolvraa, Steen; Bolund, Lars; Gregersen, Niels

    2007-01-01

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups for v

  10. Natural variations in expression of regulatory and detoxification related genes under limiting phosphate and arsenate stress in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Tapsi eShukla

    2015-10-01

    Full Text Available Abiotic stress including nutrient deficiency and heavy metal toxicity severely affects plant growth, development, and productivity. Genetic variations within and in between species are one of the important factors in establishing interactions and responses of plants with the environment. In the recent past, natural variations in Arabidopsis thaliana have been used to understand plant development and response towards different stresses at genetic level. Phosphorus (Pi deficiency negatively affects plant growth and metabolism and modulates expression of the genes involved in Pi homeostasis. Arsenate, As(V, a chemical analogue of Pi, is taken up by the plants via phosphate transport system. Studies suggest that during Pi deficiency, enhanced As(V uptake leads to increased toxicity in plants. Here, the natural variations in Arabidopsis have been utilized to study the As(V stress response under limiting Pi condition. The primary root length was compared to identify differential response of three Arabidopsis accessions (Col-0, Sij-1 and Slavi-1 under limiting Pi and As(V stress. To study the molecular mechanisms responsible for the differential response, comprehensive expression profiling of the genes involved in uptake, detoxification and regulatory mechanisms was carried out. Analysis suggests genetic variation-dependent regulatory mechanisms may affect differential response of Arabidopsis natural variants towards As(V stress under limiting Pi condition. Therefore, it is hypothesized that detailed analysis of the natural variations under multiple stress conditions might help in the better understanding of the biological processes involved in stress tolerance and adaptation.

  11. Quantitative variation in obesity-related traits and insulin precursors linked to the OB gene region on human chromosome 7

    Energy Technology Data Exchange (ETDEWEB)

    Duggirala, R.; Stern, M.P.; Reinhart, L.J. [Univ. of Texas Health Science Center, San Antonio, TX (United States)] [and others

    1996-09-01

    Despite the evidence that human obesity has strong genetic determinants, efforts at identifying specific genes that influence human obesity have largely been unsuccessful. Using the sibship data obtained from 32 low-income Mexican American pedigrees ascertained on a type II diabetic proband and a multipoint variance-components method, we tested for linkage between various obesity-related traits plus associated metabolic traits and 15 markers on human chromosome 7. We found evidence for linkage between markers in the OB gene region and various traits, as follows: D7S514 and extremity skinfolds (LOD = 3.1), human carboxypeptidase A1 (HCPA1) and 32,33-split proinsulin level (LOD = 4.2), and HCPA1 and proinsulin level (LOD = 3.2). A putative susceptibility locus linked to the marker D7S514 explained 56% of the total phenotypic variation in extremity skinfolds. Variation at the HCPA1 locus explained 64% of phenotypic variation in proinsulin level and {approximately}73% of phenotypic variation in split proinsulin concentration, respectively. Weaker evidence for linkage to several other obesity-related traits (e.g., waist circumference, body-mass index, fat mass by bioimpedance, etc.) was observed for a genetic location, which is {approximately}15 cM telomeric to OB. In conclusion, our study reveals that the OB region plays a significant role in determining the phenotypic variation of both insulin precursors and obesity-related traits, at least in Mexican Americans. 66 refs., 3 figs., 4 tabs.

  12. BGMUT: NCBI dbRBC database of allelic variations of genes encoding antigens of blood group systems.

    Science.gov (United States)

    Patnaik, Santosh Kumar; Helmberg, Wolfgang; Blumenfeld, Olga O

    2012-01-01

    Analogous to human leukocyte antigens, blood group antigens are surface markers on the erythrocyte cell membrane whose structures differ among individuals and which can be serologically identified. The Blood Group Antigen Gene Mutation Database (BGMUT) is an online repository of allelic variations in genes that determine the antigens of various human blood group systems. The database is manually curated with allelic information collated from scientific literature and from direct submissions from research laboratories. Currently, the database documents sequence variations of a total of 1251 alleles of all 40 gene loci that together are known to affect antigens of 30 human blood group systems. When available, information on the geographic or ethnic prevalence of an allele is also provided. The BGMUT website also has general information on the human blood group systems and the genes responsible for them. BGMUT is a part of the dbRBC resource of the National Center for Biotechnology Information, USA, and is available online at http://www.ncbi.nlm.nih.gov/projects/gv/rbc/xslcgi.fcgi?cmd=bgmut. The database should be of use to members of the transfusion medicine community, those interested in studies of genetic variation and related topics such as human migrations, and students as well as members of the general public.

  13. Variation in the X-linked EFHC2 gene is associated with social cognitive abilities in males.

    Science.gov (United States)

    Startin, Carla M; Fiorentini, Chiara; de Haan, Michelle; Skuse, David H

    2015-01-01

    Females outperform males on many social cognitive tasks. X-linked genes may contribute to this sex difference. Males possess one X chromosome, while females possess two X chromosomes. Functional variations in X-linked genes are therefore likely to impact more on males than females. Previous studies of X-monosomic women with Turner syndrome suggest a genetic association with facial fear recognition abilities at Xp11.3, specifically at a single nucleotide polymorphism (SNP rs7055196) within the EFHC2 gene. Based on a strong hypothesis, we investigated an association between variation at SNP rs7055196 and facial fear recognition and theory of mind abilities in males. As predicted, males possessing the G allele had significantly poorer facial fear detection accuracy and theory of mind abilities than males possessing the A allele (with SNP variant accounting for up to 4.6% of variance). Variation in the X-linked EFHC2 gene at SNP rs7055196 is therefore associated with social cognitive abilities in males.

  14. Molecular variation and evolution of the tyrosine kinase domains of insulin receptor IRa and IRb genes in Cyprinidae.

    Science.gov (United States)

    Kong, XiangHui; Wang, XuZhen; He, ShunPing

    2011-07-01

    The insulin receptor (IR) gene plays an important role in regulating cell growth, differentiation and development. In the present study, DNA sequences of insulin receptor genes, IRa and IRb, were amplified and sequenced from 37 representative species of the Cyprinidae and from five outgroup species from non-cyprinid Cypriniformes. Based on coding sequences (CDS) of tyrosine kinase regions of IRa and IRb, molecular evolution and phylogenetic relationships were analyzed to better understand the characteristics of IR gene divergence in the family Cyprinidae. IRa and IRb were clustered into one lineage in the gene tree of the IR gene family, reconstructed using the unweighted pair group method with arithmetic mean (UPGMA). IRa and IRb have evolved into distinct genes after IR gene duplication in Cyprinidae. For each gene, molecular evolution analyses showed that there was no significant difference among different groups in the reconstructed maximum parsimony (MP) tree of Cyprinidae; IRa and IRb have been subjected to similar evolutionary pressure among different lineages. Although the amino acid sequences of IRa and IRb tyrosine kinase regions were highly conserved, our analyses showed that there were clear sequence variations between the tyrosine kinase regions of IRa and IRb proteins. This indicates that IRa and IRb proteins might play different roles in the insulin signaling pathway.

  15. Differential stress responses among newly received calves: variations in reductant capacity and Hsp gene expression.

    Science.gov (United States)

    Eitam, Harel; Vaya, Jacob; Brosh, Arieh; Orlov, Ala; Khatib, Soliman; Izhaki, Ido; Shabtay, Ariel

    2010-11-01

    Bovine respiratory disease complex (BRD), a major economic concern to the beef cattle industry all over the world, is triggered by physical, biological and psychological stresses. It is becoming noticeable that the key to reducing BRD appears to be centered at reducing the response to stress. The aims of the present study were to detect individual variations in the stress response of newly received young calves through their leukocyte heat shock protein (Hsp) response, selected neutrophil-related gene expression and oxidative stress, and relate them to pulmonary adhesions at slaughter, an indicative sign of clinical and subclinical episodes of BRD at an early age. Differential expression patterns of Hsp60 and Hsp70A1A were revealed in newly received calves 1 h, 5 h and 1 day after arrival, distinguishing between stress-responsive and non-stress-responsive individuals. Plasma cortisol was also indicative of stress-responsive and non-stress-responsive individuals, 1 h and 5 h after arrival. At the longer term, β-glycan levels were highest 7 days after arrival and significantly correlated with an adhesion-free phenotype at slaughter. Oxidative stress responses, measured through the oxidation products of the exogenous linoleoyl tyrosine (LT) marker, revealed that hydroperoxidation and epoxidation of membranes may readily occur. Based on the LT oxidation products and levels of β-glycan, we present a discriminant analysis model, according to which vulnerable individuals may be predicted at near 100% probability 7 days after arrival. Since clinical signs of BRD may often go undetected in feedlot calves, such a model, after its examination in large-scale experiments, may be a reliable tool for an early prediction of subclinical signs of BRD.

  16. Mutations in MAPT gene cause chromosome instability and introduce copy number variations widely in the genome.

    Science.gov (United States)

    Rossi, Giacomina; Conconi, Donatella; Panzeri, Elena; Redaelli, Serena; Piccoli, Elena; Paoletta, Laura; Dalprà, Leda; Tagliavini, Fabrizio

    2013-01-01

    In addition to the main function of promoting polymerization and stabilization of microtubules, other roles are being attributed to tau, now considered a multifunctional protein. In particular, previous studies suggest that tau is involved in chromosome stability and genome protection. We performed cytogenetic analysis, including molecular karyotyping, on lymphocytes and fibroblasts from patients affected by frontotemporal lobar degeneration carrying different mutations in the microtubule-associated protein tau gene, to investigate the effects of these mutations on genome stability. Furthermore, we analyzed the response of mutated lymphoblastoid cell lines to genotoxic agents to evaluate the participation of tau to DNA repair systems. We found a significantly higher level of chromosome aberrations in mutated than in control cells. Mutated lymphocytes showed higher percentages of stable lesions, clonal and total aneuploidy (medians: 2 versus 0, p $\\ll$ 0.01; 1.5 versus 0, p $\\ll$ 0.01; 16.5 versus 0, p $\\ll$ 0.01, respectively). Fibroblasts of patients showed higher percentages of stable lesions, structural aberrations and total aneuploidy (medians: 0 versus 0, p = 0.03; 5.8 versus 0, p = 0.02; 26.5 versus 12.6, p $\\ll$ 0.01, respectively). In addition, the in depth analysis of DNA copy number variations showed a higher tendency to non-allelic homologous recombination in mutated cells. Finally, while our analysis did not support an involvement of tau in DNA repair systems, it revealed its role in stabilization of chromatin. In summary, our findings indicate a role of tau in genome and chromosome stability that can be ascribed to its function as a microtubule-associated protein as well as a protein protecting chromatin integrity through interaction with DNA.

  17. Genetic variation of maturity groups and four E genes in the Chinese soybean mini core collection

    Science.gov (United States)

    Huang, Xinyang; Zhou, Jing; Zeng, Haiyan; Sun, Shi; Jia, Hongchang; Li, Wenbin; Zhou, Xinan; Li, Suzhen; Chen, Pengyin; Wu, Cunxiang; Guo, Yong; Han, Tianfu; Qiu, Lijuan

    2017-01-01

    The mini core collection (MCC) has been established by streamlining core collection (CC) chosen from China National Genebank including 23,587 soybean (Glycine max) accessions by morphological traits and simple sequence repeat (SSR) markers. Few studies have been focused on the maturity that has been considered as one of the most critical traits for the determination of the adaptation-growing region of the soybean. In the current study, two hundred and ninty-nine accessions of MCC planted for two years at four locations namely in Heihe, Harbin, Jining and Wuhan cities in China were used to assess the variation of maturity in MCC and identify the integrated effect of 4 E loci on flowering and maturity time in soybean. Forty-two North American varieties served as references of maturity groups (MG). Each accession in MCC was classified by comparing with the MG references in the days from VE (emergence) and physiological maturity (R7). The results showed that MCC covered a large range of MGs from MG000 to MGIX/X. Original locations and sowing types were revealed as the major affecting factors for maturity groups of the MCC accessions. The ratio of the reproductive period to the vegetative period (R/V) varied among MCC accessions. Genotyping of 4 maturity genes (i.e. E1, E2, E3 and E4) in 228 accessions indicated that recessive alleles e1, e2, e3 and e4 promoted earlier flowering and shortened the maturity time with different effects, while the dominate alleles were always detected in accessions with longer maturity. The allelic combinations determined the diversification of soybean maturity groups and adaptation to different regions. Our results indicated that the maturity of Chinese soybean MCC showed genetic diversities in phenotype and genotype, which provided information for further MG classification, geographic adaptation analysis of Chinese soybean cultivars, as well as developing new soybean varieties with adaptation to specific regions. PMID:28207889

  18. Mos1-mediated transgenesis to probe consequences of single gene mutations in variation-rich isolates of Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Maja Tarailo-Graovac

    Full Text Available Caenorhabditis elegans, especially the N2 isolate, is an invaluable biological model system. Numerous additional natural C. elegans isolates have been shown to have unexpected genotypic and phenotypic variations which has encouraged researchers to use next generation sequencing methodology to develop a more complete picture of genotypic variations among the isolates. To understand the phenotypic effects of a genomic variation (GV on a single gene, in a variation-rich genetic background, one should analyze that particular GV in a well understood genetic background. In C. elegans, the analysis is usually done in N2, which requires extensive crossing to bring in the GV. This can be a very time consuming procedure thus it is important to establish a fast and efficient approach to test the effect of GVs from different isolates in N2. Here we use a Mos1-mediated single-copy insertion (MosSCI method for phenotypic assessments of GVs from the variation-rich Hawaiian strain CB4856 in N2. Specifically, we investigate effects of variations identified in the CB4856 strain on tac-1 which is an essential gene that is necessary for mitotic spindle elongation and pronuclear migration. We show the usefulness of the MosSCI method by using EU1004 tac-1(or402 as a control. or402 is a temperature sensitive lethal allele within a well-conserved TACC domain (transforming acidic coiled-coil that results in a leucine to phenylalanine change at amino acid 229. CB4856 contains a variation that affects the second exon of tac-1 causing a cysteine to tryptophan change at amino acid 94 also within the TACC domain. Using the MosSCI method, we analyze tac-1 from CB4856 in the N2 background and demonstrate that the C94W change, albeit significant, does not cause any obvious decrease in viability. This MosSCI method has proven to be a rapid and efficient way to analyze GVs.

  19. Vascular endothelial growth factor (VEGFA gene variation in polycystic ovary syndrome in a Tunisian women population

    Directory of Open Access Journals (Sweden)

    Assila Ben Salem

    2016-10-01

    Full Text Available Abstract Background Polycystic ovary syndrome (PCOS is characterized by the growth of a number of small cysts on the ovaries which leads to sex hormonal imbalance. Women who are affected by this syndrome suffer from irregular menstrual cycles, decline in their fertility, excessive hair growth, obesity, acne and most importantly cardiac function problems. The vascular endothelial growth factor (VEGF plays a pivotal role in tissue vascularization in general and in the pathogenesis of many diseases. The PCOS was found to be associated with high expression levels of VEGF. In women who undergo assisted reproductive procedures (ART, VEGF was found to be a key mediator of other factors to control ovary angiogenesis. Here, we set out to examine the association of VEGFA gene polymorphism with PCOS and its components in a population of Tunisia women to enhance our understanding of the genetic background leading angiogenesis and vascularization abnormalities in PCOS. Methods The association of VEGFA gene with PCOS and its components was examined in a cohort of 268 women from Tunisia involving 118 PCOS patients and 150 controls. VEGFA gene variations were assessed through the analysis of the following SNPs rs699947 (A/C, rs833061 (C/T, rs1570360 (G/A, rs833068 (G/A, rs3025020 (C/T, and rs3025039 (C/T. The linkage disequilibrium between SNPs was assessed using HAPLOVIEW software while combination of SNPs into haplotypes in the population and the reconstruction of the cladogram were carried-out by PHASE and ARLEQUIN programs, respectively. Genetic association and genotype-phenotype correlations were calculated by logistic regression and non-parametric tests (Kruskall-Wallis and Mann–Whitney tests, respectively, using StatView program. Results We observed 10 haplotypes in our studied cohort whereH1 (ACGG, H2 (ACAG, H7 (CTGG and H8 (CTGA were the most frequent. We observed the association of the genotype CT of the SNP rs30225039 with PCOS phenotype (P = 0

  20. Natural variation in the Pto disease resistance gene within species of wild tomato (Lycopersicon). II. Population genetics of Pto.

    Science.gov (United States)

    Rose, Laura E; Michelmore, Richard W; Langley, Charles H

    2007-03-01

    Disease resistance to the bacterial pathogen Pseudomonas syringae pv. tomato (Pst) in the host species Lycopersicon esculentum, the cultivated tomato, and the closely related L. pimpinellifolium is triggered by the physical interaction between the protein products of the host resistance (R) gene Pto and the pathogen avirulence genes AvrPto and AvrPtoB. Sequence variation at the Pto locus was surveyed in natural populations of seven species of Lycopersicon to test hypotheses of host-parasite coevolution and functional adaptation of the Pto gene. Pto shows significantly higher nonsynonymous polymorphism than 14 other non-R-gene loci in the same samples of Lycopersicon species, while showing no difference in synonymous polymorphism, suggesting that the maintenance of amino acid polymorphism at this locus is mediated by pathogen selection. Also, a larger proportion of ancestral variation is maintained at Pto as compared to these non-R-gene loci. The frequency spectrum of amino acid polymorphisms known to negatively affect Pto function is skewed toward low frequency compared to amino acid polymorphisms that do not affect function or silent polymorphisms. Therefore, the evolution of Pto appears to be influenced by a mixture of both purifying and balancing selection.

  1. académicos consolidados del área educativa

    Directory of Open Access Journals (Sweden)

    Juan Carlos Mijangos Noh

    2012-01-01

    Full Text Available A partir de una revisión del concepto de gestión del conocimiento, mediante la cual se establece una concepción acerca del término, examinamos las acciones emprendidas y productos logrados por tres cuerpos académicos consolidados en el área de educación, todos ellos ubicados en universidades públicas mexicanas de provincia y reconocidos por el Programa de Mejoramiento del Profesorado, instituido por la Subsecretaría de Educación Superior de la Secretaría de Educación Pública de México. El análisis de los procesos de los tres cuerpos académicos consolidados se hace examinando las características de la gestión de conocimiento emprendida por los profesores involucrados, en los siguientes aspectos: el marco institucional y normativo en el que se efectuó la gestión, los objetivos, acciones y resultados de dicha gestión, y la trayectoria de cada uno de los cuerpos académicos, en materia de organización, que permitió la catálisis de sus procesos hacia el logro de productos que han sido evaluados y reconocidos como de buena calidad por los pares académicos. Las conclusiones permiten ubicar los patrones seguidos por los tres cuerpos académicos estudiados que, finalmente, podrán emplearse en el reconocimiento de pautas que sirvan a otros cuerpos académicos para catalizar sus procesos hacia la consolidación, mediante la gestión apropiada del conocimiento.

  2. Plan de negocios “portal académico

    OpenAIRE

    Lucio Morales, Jose Alexander; Munizaga Soria, Maria Luisa; Sanchez Corrales, David Xavier; Olaya Tapia, Jorge Enrique

    2009-01-01

    El avance tecnológico y el incremento constante de usuarios de Internet en el Ecuador, ha producido que la Internet llegue a formar parte de la educación actual, lo cual se traduce en el incremento de usuarios (estudiantes) con mayor conocimiento tecnológico. Actualmente existe una necesidad insatisfecha, que nosotros queremos cubrir con la creación del portal académico llamado “educacionenlinea.com”, el cual le permitirá consultar información académica, participar en foros y publicar docume...

  3. Autoconcepto y rendimiento académico en adolecentes

    OpenAIRE

    Iniesta Martínez, Almudena; Mañas-Viejo, Carmen

    2014-01-01

    El objetivo de este estudio es medir la relación existente entre las diferentes dimensiones del autoconcepto –académico, social, familiar, físico y social- y el rendimiento académico. El cuestionario de Autoconcepto forma 5 (AF5) se administró a 180 adolescentes de ambos sexos con edades comprendidas entre los 13 y 18 años (M = 15.25; DT = 1.09. Para analizar los datos se realiza una correlación de Pearson y un análisis discriminante. Los resultados obtenidos indicaron que hay una relación di...

  4. Lateralidad, procesos perceptivos y rendimiento académico.

    OpenAIRE

    Mera-Tapia, Guadalupe

    2013-01-01

    Es frecuente que factores neuropsicológicos alterados sean responsables en casos de alumnos con bajo rendimiento académico que fracasan en nuestro sistema educativo. En este trabajo se estudia si existen diferencias, entre alumnos con alto y bajo rendimiento académico en relación con los procesos perceptivos y la lateralidad. Se evalúan los procesos perceptivos (visión, y audición) y la lateralidad en dos muestras de 30 alumnos cada una, de alto y bajo rendimento respectivamente. Los alumnos ...

  5. Plagio académico en estudiantes de bachillerato

    OpenAIRE

    Díaz Arce, Dariel

    2016-01-01

    Los objetivos de este trabajo fueron: identificar las principales formas de plagio académico entre estudiantes de bachillerato y determinar la utilidad de Turnitin para detectarlos. Se analizaron 137 ensayos académicos de 52 estudiantes. Para evaluar el desempeño del IGS de Turnitin como predictor de plagio se empleó la metodología de las curvas ROC. Las principales formas de plagio fueron la ausencia de citas, el Copy-Paste, así como la paráfrasis y citación incorrectas con 86,9%; 62,8%; 47,...

  6. Natural variation of rice blast resistant gene Pi-ta in Oryza species

    Science.gov (United States)

    The Pi-ta gene in rice is a putative NBS type cytoplasmic receptor conferring resistance to races of Magnaporthe oryzae in a gene-for-gene manner. A Functional Nucleotide Polymorphism (FNP) change resulting in an amino acid substitution of Alanine to Serine at position 918 (nucleotide G to T at posi...

  7. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    DEFF Research Database (Denmark)

    Kaas, Rolf Sommer; Rundsten, Carsten Friis; Ussery, David

    2012-01-01

    more biologically relevant, especially considering that many of these genome sequences are draft quality. The E. coli pan-genome for this set of isolates contains 16,373 gene clusters. A core-gene tree, based on alignment and a pan-genome tree based on gene presence/absence, maps the relatedness...

  8. DNA sequence and haplotype variation in two candidate genes for dilated cardiomyopathy in the turkey Meleagris gallopavo.

    Science.gov (United States)

    Lin, Kuan-chin; Xu, Jun; Kamara, Davida; Geng, Tuoyu; Gyenai, Kwaku; Reed, Kent M; Smith, Edward J

    2007-05-01

    Determining variation in genes is fundamental to understanding their function in the disease state. Cardiac troponin T (cTnT) and phospholamban (PLN) genes have been implicated in dilated cardiomyopathy (DCM) in human and model species. To investigate the role of these 2 candidate genes in DCM in the turkey Meleagris gallopavo, understanding sequence variants and map position distribution is necessary. To this end, a total of 1854 and 1771 bp of cTnT and PLN gene sequences, respectively, were scanned for single nucleotide polymorphisms (SNPs) in a randomly bred population. A total of 15 SNPs was identified in the cTnT and PLN genomic sequences. Nine haplotypes, 5 in cTnT and 4 in PLN, were identified. Observed heterozygosities (0.02-0.39) in the turkey population were low for both genes. Within each gene, 1 SNP corresponding to a restriction enzyme site was identified and used to develop a PCR-restriction fragment length polymorphism (RFLP) genotyping assay. The PLN gene was genetically mapped to turkey chromosome 2, equivalent to Gallus gallus chromosome 3, and cTnT mapped to a turkey microchromosome. Although limited because of the relatively small sample size of 55 birds, the data from this SNP analysis of PLN and cTnT provide a foundation from which to evaluate the function of cTnT and PLN in the turkey. Information about the distribution of the SNPs and haplotypes will facilitate future association and linkage studies.

  9. Y-linked variation for autosomal immune gene regulation has the potential to shape sexually dimorphic immunity.

    Science.gov (United States)

    Kutch, Ian C; Fedorka, Kenneth M

    2015-12-01

    Sexually dimorphic phenotypes arise from the differential expression of male and female shared genes throughout the genome. Unfortunately, the underlying molecular mechanisms by which dimorphic regulation manifests and evolves are unclear. Recent work suggests that Y-chromosomes may play an important role, given that Drosophila melanogaster Ys were shown to influence the regulation of hundreds of X and autosomal genes. For Y-linked regulatory variation (YRV) to facilitate sexually dimorphic evolution, however, it must exist within populations (where selection operates) and influence male fitness. These criteria have seldom been investigated, leaving the potential for dimorphic evolution via YRV unclear. Interestingly, male and female D. melanogaster differ in immune gene regulation. Furthermore, immune gene regulation appears to be influenced by the Y-chromosome, suggesting it may contribute to dimorphic immune evolution. We address this possibility by introgressing Y-chromosomes from a single wild population into an isogenic background (to create Y-lines) and assessing immune gene regulation and bacterial defence. We found that Y-line males differed in their immune gene regulation and their ability to defend against Serratia marcescens. Moreover, gene expression and bacterial defence were positively genetically correlated. These data indicate that the Y-chromosome has the potential to shape the evolution of sexually dimorphic immunity in this system.

  10. Genetic Variation and Divergence of Genes Involved in Leaf Adaxial-abaxial Polarity Establishment in Brassica rapa

    Directory of Open Access Journals (Sweden)

    Jianli eLiang

    2016-02-01

    Full Text Available Alterations in leaf adaxial–abaxial (ad-ab polarity are one of the main factors that are responsible for leaf curvature. In Chinese cabbage, to form a leafy head, leaf incurvature is an essential prerequisite. Identifying ad-ab patterning genes and investigating its genetic variations will facilitate in elucidating the mechanism underlying leaf incurvature during head formation. In the present study we conducted comparative genomic analysis of the identification of 45 leaf ad-ab patterning genes in Brassica rapa based on 26 homologs in Arabidopsis thaliana, indicating that these genes underwent expansion and were retained after whole genome triplication (WGT. We also assessed the nucleotide diversity and selection footprints of these 45 genes in a collection of 94 Brassica rapa accessions that were composed of heading and non-heading morphotypes. Six of the 45 genes showed significant negative Tajima’s D indices and nucleotide diversity reduction in heading accessions compared to that in non-heading accessions, indicating that these underwent purifying selection. Further testing of the BrARF3.1 gene, which was one of the selection signals from a larger collection, confirmed that purifying selection did occur. Our results provide genetic evidence that ad-ab patterning genes are involved in leaf incurvature that is associated in the formation of a leafy head, as well as promote an understanding of the genetic mechanism underlying leafy head formation in Chinese cabbage.

  11. Robust assignment of cancer subtypes from expression data using a uni-variate gene expression average as classifier

    Directory of Open Access Journals (Sweden)

    Ryden Tobias

    2010-10-01

    Full Text Available Abstract Background Genome wide gene expression data is a rich source for the identification of gene signatures suitable for clinical purposes and a number of statistical algorithms have been described for both identification and evaluation of such signatures. Some employed algorithms are fairly complex and hence sensitive to over-fitting whereas others are more simple and straight forward. Here we present a new type of simple algorithm based on ROC analysis and the use of metagenes that we believe will be a good complement to existing algorithms. Results The basis for the proposed approach is the use of metagenes, instead of collections of individual genes, and a feature selection using AUC values obtained by ROC analysis. Each gene in a data set is assigned an AUC value relative to the tumor class under investigation and the genes are ranked according to these values. Metagenes are then formed by calculating the mean expression level for an increasing number of ranked genes, and the metagene expression value that optimally discriminates tumor classes in the training set is used for classification of new samples. The performance of the metagene is then evaluated using LOOCV and balanced accuracies. Conclusions We show that the simple uni-variate gene expression average algorithm performs as well as several alternative algorithms such as discriminant analysis and the more complex approaches such as SVM and neural networks. The R package rocc is freely available at http://cran.r-project.org/web/packages/rocc/index.html.

  12. Oxytocin and vasopressin receptor gene variation as a proximate base for inter- and intraspecific behavioral differences in bonobos and chimpanzees.

    Directory of Open Access Journals (Sweden)

    Nicky Staes

    Full Text Available Recent literature has revealed the importance of variation in neuropeptide receptor gene sequences in the regulation of behavioral phenotypic variation. Here we focus on polymorphisms in the oxytocin receptor gene (OXTR and vasopressin receptor gene 1a (Avpr1a in chimpanzees and bonobos. In humans, a single nucleotide polymorphism (SNP in the third intron of OXTR (rs53576 SNP (A/G is linked with social behavior, with the risk allele (A carriers showing reduced levels of empathy and prosociality. Bonobos and chimpanzees differ in these same traits, therefore we hypothesized that these differences might be reflected in variation at the rs53576 position. We sequenced a 320 bp region surrounding rs53576 but found no indications of this SNP in the genus Pan. However, we identified previously unreported SNP variation in the chimpanzee OXTR sequence that differs from both humans and bonobos. Humans and bonobos have previously been shown to have a more similar 5' promoter region of Avpr1a when compared to chimpanzees, who are polymorphic for the deletion of ∼ 360 bp in this region (+/- DupB which includes a microsatellite (RS3. RS3 has been linked with variation in levels of social bonding, potentially explaining part of the interspecies behavioral differences found in bonobos, chimpanzees and humans. To date, results for bonobos have been based on small sample sizes. Our results confirmed that there is no DupB deletion in bonobos with a sample size comprising approximately 90% of the captive founder population, whereas in chimpanzees the deletion of DupB had the highest frequency. Because of the higher frequency of DupB alleles in our bonobo population, we suggest that the presence of this microsatellite may partly reflect documented differences in levels of sociability found in bonobos and chimpanzees.

  13. Genome-wide association implicates numerous genes and pleiotropy underlying ecological trait variation in natural populations of Populus trichocarpa

    Energy Technology Data Exchange (ETDEWEB)

    McKown, Athena [University of British Columbia, Vancouver; Klapste, Jaroslav [University of British Columbia, Vancouver; Guy, Robert [University of British Columbia, Vancouver; Geraldes, Armando [University of British Columbia, Vancouver; Porth, Ilga [University of British Columbia, Vancouver; Hannemann, Jan [University of Victoria, Canada; Friedmann, Michael [University of British Columbia, Vancouver; Muchero, Wellington [ORNL; Tuskan, Gerald A [ORNL; Ehlting, Juergen [University of Victoria, Canada; Cronk, Quentin [University of British Columbia, Vancouver; El-Kassaby, Yousry [University of British Columbia, Vancouver; Mansfield, Shawn [University of British Columbia, Vancouver; Douglas, Carl [University of British Columbia, Vancouver

    2014-01-01

    To uncover the genetic basis of phenotypic trait variation, we used 448 unrelated wild accessions of black cottonwood (Populus trichocarpa Torr. & Gray) from natural populations throughout western North America. Extensive information from large-scale trait phenotyping (with spatial and temporal replications within a common garden) and genotyping (with a 34K Populus SNP array) of all accessions were used for gene discovery in a genome-wide association study (GWAS).

  14. Candidate genes revealed by a genome scan for mosquito resistance to a bacterial insecticide: sequence and gene expression variations

    Directory of Open Access Journals (Sweden)

    David Jean-Philippe

    2009-11-01

    Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full

  15. Gene expression variation resolves species and individual strains among coral-associated dinoflagellates within the genus Symbiodinium

    KAUST Repository

    Parkinson, John Everett

    2016-02-11

    Reef-building corals depend on symbiotic mutualisms with photosynthetic dinoflagellates in the genus Symbiodinium. This large microalgal group comprises many highly divergent lineages (“Clades A-I”) and hundreds of undescribed species. Given their ecological importance, efforts have turned to genomic approaches to characterize the functional ecology of Symbiodinium. To date, investigators have only compared gene expression between representatives from separate clades—the equivalent of contrasting genera or families in other dinoflagellate groups—making it impossible to distinguish between clade-level and species-level functional differences. Here, we examined the transcriptomes of four species within one Symbiodinium clade (Clade B) at ~20,000 orthologous genes, as well as multiple isoclonal cell lines within species (i.e. cultured strains). These species span two major adaptive radiations within Clade B, each encompassing both host-specialized and ecologically cryptic taxa. Species-specific expression differences were consistently enriched for photosynthesis-related genes, likely reflecting selection pressures driving niche diversification. Transcriptional variation among strains involved fatty acid metabolism and biosynthesis pathways. Such differences among individuals are potentially a major source of physiological variation, contributing to the functional diversity of coral holobionts composed of unique host-symbiont genotype pairings. Our findings expand the genomic resources available for this important symbiont group and emphasize the power of comparative transcriptomics as a method for studying speciation processes and inter-individual variation in non-model organisms.

  16. Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

    Science.gov (United States)

    Lean, Choo Bee; Lee, Edmund Jon Deoon

    2009-01-01

    MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

  17. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  18. Adaptive evolution of interleukin-3 (IL3), a gene associated with brain volume variation in general human populations.

    Science.gov (United States)

    Li, Ming; Huang, Liang; Li, Kaiqin; Huo, Yongxia; Chen, Chunhui; Wang, Jinkai; Liu, Jiewei; Luo, Zhenwu; Chen, Chuansheng; Dong, Qi; Yao, Yong-gang; Su, Bing; Luo, Xiong-jian

    2016-04-01

    Greatly expanded brain volume is one of the most characteristic traits that distinguish humans from other primates. Recent studies have revealed genes responsible for the dramatically enlarged human brain size (i.e., the microcephaly genes), and it has been well documented that many microcephaly genes have undergone accelerated evolution along the human lineage. In addition to being far larger than other primates, human brain volume is also highly variable in general populations. However, the genetic basis underlying human brain volume variation remains elusive and it is not known whether genes regulating human brain volume variation also have experienced positive selection. We have previously shown that genetic variants (near the IL3 gene) on 5q33 were significantly associated with brain volume in Chinese population. Here, we provide further evidence that support the significant association of genetic variants on 5q33 with brain volume. Bioinformatic analyses suggested that rs31480 is likely to be the causal variant among the studied SNPs. Molecular evolutionary analyses suggested that IL3 might have undergone positive selection in primates and humans. Neutrality tests further revealed signatures of positive selection of IL3 in Han Chinese and Europeans. Finally, extended haplotype homozygosity (EHH) and relative EHH analyses showed that the C allele of SNP rs31480 might have experienced recent positive selection in Han Chinese. Our results suggest that IL3 is an important genetic regulator for human brain volume variation and implied that IL3 might have experienced weak or modest positive selection in the evolutionary history of humans, which may be due to its contribution to human brain volume.

  19. SDF1 gene variation is associated with circulating SDF1alpha level and endothelial progenitor cell number: the Bruneck Study.

    Directory of Open Access Journals (Sweden)

    Qingzhong Xiao

    Full Text Available BACKGROUND: Stromal cell-derived factor-1 (SDF1 and its receptor CXC chemokine receptor 4 (CXCR4 play a critical role in progenitor cell homing, mobilization and differentiation. It would be interesting to assess the predictive value of SDF-1alpha level for EPC number, and to ascertain whether there is a relationship between SDF1 gene variation, plasma SDF-1alpha level, and the number and function of circulating EPCs. We also tested whether EPC number and function was related to CXCR4 gene variation. METHODOLOGY AND PRINCIPAL FINDINGS: We genotyped a cohort of individuals who participated in the Bruneck Study for single nucleotide polymorphisms (SNPs in the SDF1 and CXCR4 genes, and measured blood SDF1alpha level as well as EPC number and function. SDF1alpha levels were correlated with age, gender, alcohol consumption, circulating reticulocyte numbers, and concentrations of matrix metalloproteinase-9, C-reactive protein, cystatin C, fibrinogen and homocytein. In blood samples taken in 2005, EPC number was inversely associated with SDF1alpha level (p<0.001. EPC number in 2005 was also inversely associated with SDF1alpha level in 2000 (p = 0.009, suggesting a predictive value of plasma SDF1alpha level for EPC number. There was an association between the SDF1 gene rs2297630 SNP A/A genotype, increased SDF1alpha level (p = 0.002 and lower EPC number (p = 0.006. CONCLUSIONS: Our data indicate that a SDF1 gene variation (rs2297630 has an influence on SDF1alpha level and circulating EPC number, and that plasma SDF1alpha level is a predictor of EPC number.

  20. Differentially expressed genes linked to natural variation in long-term memory formation in Cotesia parasitic wasps

    Directory of Open Access Journals (Sweden)

    Joke J. F. A. Van Vugt

    2015-09-01

    Full Text Available Even though learning and memory are universal traits in the Animal Kingdom, closely related species reveal substantial variation in learning rate and memory dynamics. To determine the genetic background of this natural variation, we studied two congeneric parasitic wasp species, Cotesia glomerata and C. rubecula, which lay their eggs in caterpillars of the large and small cabbage white butterfly. A successful egg laying event serves as an unconditioned stimulus in a classical conditioning paradigm, where plant odors become associated to the encounter of a suitable host caterpillar. Depending on the host species, the number of conditioning trials and the parasitic wasp species, three different types of transcription-dependent long-term memory (LTM and one type of transcription-independent, anesthesia-resistant memory (ARM can be distinguished. To identify transcripts underlying these differences in memory formation, we isolated mRNA from parasitic wasp heads at three different time points between induction and consolidation of each of the four memory types, and for each sample three biological replicates, where after strand-specific paired-end 100 bp deep sequencing. Transcriptomes were assembled de novo and differential expression was determined for each memory type and time point after conditioning, compared to unconditioned wasps. Most differentially expressed (DE genes and antisense transcripts were only DE in one of the LTM types. Among the DE genes that were DE in two or more LTM types, were many protein kinases and phosphatases, small GTPases, receptors and ion channels. Some genes were DE in opposing directions between any of the LTM memory types and ARM, suggesting that ARM in Cotesia requires the transcription of genes inhibiting LTM or vice versa. We discuss our findings in the context of neuronal functioning, including RNA splicing and transport, epigenetic regulation, neurotransmitter/peptide synthesis and antisense transcription. In

  1. Social context-induced song variation affects female behavior and gene expression.

    Directory of Open Access Journals (Sweden)

    Sarah C Woolley

    2008-03-01

    Full Text Available Social cues modulate the performance of communicative behaviors in a range of species, including humans, and such changes can make the communication signal more salient. In songbirds, males use song to attract females, and song organization can differ depending on the audience to which a male sings. For example, male zebra finches (Taeniopygia guttata change their songs in subtle ways when singing to a female (directed song compared with when they sing in isolation (undirected song, and some of these changes depend on altered neural activity from a specialized forebrain-basal ganglia circuit, the anterior forebrain pathway (AFP. In particular, variable activity in the AFP during undirected song is thought to actively enable syllable variability, whereas the lower and less-variable AFP firing during directed singing is associated with more stereotyped song. Consequently, directed song has been suggested to reflect a "performance" state, and undirected song a form of vocal motor "exploration." However, this hypothesis predicts that directed-undirected song differences, despite their subtlety, should matter to female zebra finches, which is a question that has not been investigated. We tested female preferences for this natural variation in song in a behavioral approach assay, and we found that both mated and socially naive females could discriminate between directed and undirected song-and strongly preferred directed song. These preferences, which appeared to reflect attention especially to aspects of song variability controlled by the AFP, were enhanced by experience, as they were strongest for mated females responding to their mate's directed songs. We then measured neural activity using expression of the immediate early gene product ZENK, and found that social context and song familiarity differentially modulated the number of ZENK-expressing cells in telencephalic auditory areas. Specifically, the number of ZENK-expressing cells in the

  2. Variation in key genes of serotonin and norepinephrine function predicts gamma-band activity during goal-directed attention.

    Science.gov (United States)

    Enge, Sören; Fleischhauer, Monika; Lesch, Klaus-Peter; Reif, Andreas; Strobel, Alexander

    2014-05-01

    Recent evidence shows that genetic variations in key regulators of serotonergic (5-HT) signaling explain variance in executive tasks, which suggests modulatory actions of 5-HT on goal-directed selective attention as one possible underlying mechanism. To investigate this link, 130 volunteers were genotyped for the 5-HT transporter gene-linked polymorphic region (5-HTTLPR) and for a variation (TPH2-703 G/T) of the TPH2 gene coding for the rate-limiting enzyme of 5-HT synthesis in the brain. Additionally, a functional polymorphism of the norepinephrine transporter gene (NET -3081 A/T) was considered, which was recently found to predict attention and working memory processes in interaction with serotonergic genes. The flanker-based Attention Network Test was used to assess goal-directed attention and the efficiency of attentional networks. Event-related gamma-band activity served to indicate selective attention at the intermediate phenotype level. The main findings were that 5-HTTLPR s allele and TPH2 G-allele homozygotes showed increased induced gamma-band activity during target processing when combined with the NET A/A genotype compared with other genotype combinations, and that gamma activity mediates the genotype-specific effects on task performance. The results further support a modulatory role of 5-HT and NE function in the top-down attentional selection of motivationally relevant over competing or irrelevant sensory input.

  3. No Association between Variation in Longevity Candidate Genes and Aging-related Phenotypes in Oldest-old Danes.

    Science.gov (United States)

    Soerensen, Mette; Nygaard, Marianne; Debrabant, Birgit; Mengel-From, Jonas; Dato, Serena; Thinggaard, Mikael; Christensen, Kaare; Christiansen, Lene

    2016-06-01

    In this study we explored the association between aging-related phenotypes previously reported to predict survival in old age and variation in 77 genes from the DNA repair pathway, 32 genes from the growth hormone 1/ insulin-like growth factor 1/insulin (GH/IGF-1/INS) signalling pathway and 16 additional genes repeatedly considered as candidates for human longevity: APOE, APOA4, APOC3, ACE, CETP, HFE, IL6, IL6R, MTHFR, TGFB1, SIRTs 1, 3, 6; and HSPAs 1A, 1L, 14. Altogether, 1,049 single nucleotide polymorphisms (SNPs) were genotyped in 1,088 oldest-old (age 92-93 years) Danes and analysed with phenotype data on physical functioning (hand grip strength), cognitive functioning (mini mental state examination and a cognitive composite score), activity of daily living and self-rated health. Five SNPs showed association to one of the phenotypes; however, none of these SNPs were associated with a change in the relevant phenotype over time (7 years of follow-up) and none of the SNPs could be confirmed in a replication sample of 1,281 oldest-old Danes (age 94-100). Hence, our study does not support association between common variation in the investigated longevity candidate genes and aging-related phenotypes consistently shown to predict survival. It is possible that larger sample sizes are needed to robustly reveal associations with small effect sizes.

  4. Role of monochromatic light on daily variation of clock gene expression in the pineal gland of chick.

    Science.gov (United States)

    Jiang, Nan; Wang, Zixu; Cao, Jing; Dong, Yulan; Chen, Yaoxing

    2016-11-01

    The avian pineal gland is a master clock that can receive external photic cues and translate them into output rhythms. To clarify whether a shift in light wavelength can influence the circadian expression in chick pineal gland, a total of 240 Arbor Acre male broilers were exposed to white light (WL), red light (RL), green light (GL) or blue light (BL). After 2weeks light illumination, circadian expressions of seven core clock genes in pineal gland and the level of melatonin in plasma were examined. The results showed after illumination with monochromatic light, 24h profiles of all clock gene mRNAs retained circadian oscillation, except that RL tended to disrupt the rhythm of cCry2. Compared to WL, BL advanced the acrophases of the negative elements (cCry1, cCry2, cPer2 and cPer3) by 0.1-1.5h and delayed those of positive elements (cClock, cBmal1 and cBmal2) by 0.2-0.8h. And, RL advanced all clock genes except cClock and cPer2 by 0.3-2.1h, while GL delayed all clock genes by 0.5-1.5h except cBmal2. Meanwhile, GL increased the amplitude and mesor of positive and reduced both parameters of negative clock genes, but RL showed the opposite pattern. Although the acrophase of plasma melatonin was advanced by both GL and RL, the melatonin level was significantly increased in GL and decreased in RL. This tendency was consistent with the variations in the positive clock gene mRNA levels under monochromatic light and contrasted with those of negative clock genes. Therefore, we speculate that GL may enhance positive clock genes expression, leading to melatonin synthesis, whereas RL may enhance negative genes expression, suppressing melatonin synthesis.

  5. Variations of the perforin gene in patients with chronic inflammatory demyelinating polyradiculoneuropathy.

    Science.gov (United States)

    Buttini, S; Cappellano, G; Ripellino, P; Briani, C; Cocito, D; Osio, M; Cantello, R; Dianzani, U; Comi, C

    2015-01-01

    Perforin (PRF) has a key role in the function of cytotoxic T and natural killer cells. Rare variations of PRF1 predispose to autoimmunity. Chronic inflammatory demyelinating polyradiculoneuropathy (CIDP) is an autoimmune disease of the peripheral nervous system, involving defective lymphocyte apoptosis. The aim of this study was to investigate the role of PRF1 in CIDP. The entire coding region of PRF1 was sequenced in 94 patients and 158 controls. We found three missense variations leading to amino acid substitutions and one nonsense variation resulting in a premature stop codon. All variations would decrease PRF activity. Their overall frequency was significantly higher in patients than in controls (odds ratio (OR)=4.47). The most frequent variation was p.Ala91Val (OR=3.92) previously associated with other autoimmune diseases. Clinical analysis showed that PRF1 variations were more frequent in relapsing patients and in patients displaying axonal damage. These data suggest that PRF1 variations may influence CIDP development and course.

  6. [Diversity and genetic stability of yeast flocculation caused by variation of tandem repeats in yeast flocculin genes].

    Science.gov (United States)

    Yue, Feng; Guo, Xuena; He, Xiuping; Zhang, Borun

    2013-07-01

    Yeast flocculation is described as a reversible, asexual and calcium dependent process, in which cells adhere to form flocs by interaction of specific cell surface proteins named flocculins on yeast cells with mannose residues present on the cell wall of adjacent yeast cells. Yeast flocculation provides a very economical and convenient pathway for separation of yeast cells from the fermentation broth or removal of heavy metal ions from effluent. A large number of tandem repeats have been found in genes encoding flocculins, which not only have great regulatory effect on the structure and function of flocculins, generating the diversity of flocculation characteristics, but lead to genetic instability in flocculation as well for driving slippage and recombination reactions within and between FLO genes. Here, the research progress in effect of variation of tandem repeats in FLO genes on flocculation characteristics and genetic stability were reviewed to direct and promote the controllable application of flocculation in industrial fermentation process and environmental remediation.

  7. Analysis of the sequence variations in the Mhc DRB1-like gene of the endangered Humboldt penguin (Spheniscus humboldti).

    Science.gov (United States)

    Kikkawa, Eri F; Tsuda, Tomi T; Naruse, Taeko K; Sumiyama, Daisuke; Fukuda, Michio; Kurita, Masanori; Murata, Koichi; Wilson, Rory P; LeMaho, Yvon; Tsuda, Michio; Kulski, Jerzy K; Inoko, Hidetoshi

    2005-04-01

    The Major Histocompatibility Complex (Mhc) genomic region of many vertebrates is known to contain at least one highly polymorphic class II gene that is homologous in sequence to one or other of the human Mhc DRB1 class II genes. The diversity of the avian Mhc class II gene sequences have been extensively studied in chickens, quails, and some songbirds, but have been largely ignored in the oceanic birds, including the flightless penguins. We have previously reported that several penguin species have a high degree of polymorphism on exon 2 of the Mhc class II DRB1-like gene. In this study, we present for the first time the complete nucleotide sequences of exon 2, intron 2, and exon 3 of the DRB1-like gene of 20 Humboldt penguins, a species that is presently vulnerable to the dangers of extinction. The Humboldt DRB1-like nucleotide and amino acid sequences reveal at least eight unique alleles. Phylogenetic analysis of all the available avian DRB-like sequences showed that, of five penguin species and nine other bird species, the sequences of the Humboldt penguins grouped most closely to the Little penguin and the mallard, respectively. The present analysis confirms that the sequence variations of the Mhc class II gene, DRB1, are useful for discriminating among individuals within the same penguin population as well those within different penguin population groups and species.

  8. Vida académica de la facultad

    OpenAIRE

    Revista, Facultad de Medicina

    2010-01-01

    Distinciones académicas / Novedades docentes / Libro' 'Manual de Rehabilitación Médica" / Texto de Obstetricia y Perinatología / xv Curso Anual Medicina Interna / Libros Publicados en la Facultad de Medicina Universidad Nacional De Colombia, 1999.

  9. Formation of chimeric genes by copy-number variation as a mutational mechanism in schizophrenia.

    Science.gov (United States)

    Rippey, Caitlin; Walsh, Tom; Gulsuner, Suleyman; Brodsky, Matt; Nord, Alex S; Gasperini, Molly; Pierce, Sarah; Spurrell, Cailyn; Coe, Bradley P; Krumm, Niklas; Lee, Ming K; Sebat, Jonathan; McClellan, Jon M; King, Mary-Claire

    2013-10-03

    Chimeric genes can be caused by structural genomic rearrangements that fuse together portions of two different genes to create a novel gene. We hypothesize that brain-expressed chimeras may contribute to schizophrenia. Individuals with schizophrenia and control individuals were screened genome wide for copy-number variants (CNVs) that disrupted two genes on the same DNA strand. Candidate events were filtered for predicted brain expression and for frequency genes in localization, regulation, or function. Subcellular localizations of DNAJA2-NETO2 and MAP3K3-DDX42 differed from their parent genes. On the basis of the expression profile of the MATK promoter, MATK-ZFR2 is likely to be far more highly expressed in the brain during development than the ZFR2 parent gene. MATK-ZFR2 includes a ZFR2-derived isoform that we demonstrate localizes preferentially to neuronal dendritic branch sites. These results suggest that the formation of chimeric genes is a mechanism by which CNVs contribute to schizophrenia and that, by interfering with parent gene function, chimeras may disrupt critical brain processes, including neurogenesis, neuronal differentiation, and dendritic arborization.

  10. Balancing selection at the tomato RCR3 Guardee gene family maintains variation in strength of pathogen defense.

    Directory of Open Access Journals (Sweden)

    Anja C Hörger

    Full Text Available Coevolution between hosts and pathogens is thought to occur between interacting molecules of both species. This results in the maintenance of genetic diversity at pathogen antigens (or so-called effectors and host resistance genes such as the major histocompatibility complex (MHC in mammals or resistance (R genes in plants. In plant-pathogen interactions, the current paradigm posits that a specific defense response is activated upon recognition of pathogen effectors via interaction with their corresponding R proteins. According to the "Guard-Hypothesis," R proteins (the "guards" can sense modification of target molecules in the host (the "guardees" by pathogen effectors and subsequently trigger the defense response. Multiple studies have reported high genetic diversity at R genes maintained by balancing selection. In contrast, little is known about the evolutionary mechanisms shaping the guardee, which may be subject to contrasting evolutionary forces. Here we show that the evolution of the guardee RCR3 is characterized by gene duplication, frequent gene conversion, and balancing selection in the wild tomato species Solanum peruvianum. Investigating the functional characteristics of 54 natural variants through in vitro and in planta assays, we detected differences in recognition of the pathogen effector through interaction with the guardee, as well as substantial variation in the strength of the defense response. This variation is maintained by balancing selection at each copy of the RCR3 gene. Our analyses pinpoint three amino acid polymorphisms with key functional consequences for the coevolution between the guardee (RCR3 and its guard (Cf-2. We conclude that, in addition to coevolution at the "guardee-effector" interface for pathogen recognition, natural selection acts on the "guard-guardee" interface. Guardee evolution may be governed by a counterbalance between improved activation in the presence and prevention of auto-immune responses in

  11. High frequency genetic variation of purine biosynthesis genes is a mechanism of success in Campylobacter jejuni

    Science.gov (United States)

    Phenotypic variation is prevalent among progeny of the zoonotic pathogen Campylobacter jejuni, the leading agent of enterocolitis in the developed world. Heterogeneity bestows increased survival to bacterial populations because variable phenotypes ensure some cells will be protected against future s...

  12. Effects of Genetic Drift and Gene Flow on the Selective Maintenance of Genetic Variation

    OpenAIRE

    Star, Bastiaan; Spencer, Hamish G.

    2013-01-01

    Explanations for the genetic variation ubiquitous in natural populations are often classified by the population–genetic processes they emphasize: natural selection or mutation and genetic drift. Here we investigate models that incorporate all three processes in a spatially structured population, using what we call a construction approach, simulating finite populations under selection that are bombarded with a steady stream of novel mutations. As expected, the amount of genetic variation compa...

  13. Association between low density lipoprotein receptor-related protein 2 gene polymorphisms and bone mineral density variation in Chinese population.

    Directory of Open Access Journals (Sweden)

    Chun Wang

    Full Text Available Low density lipoprotein receptor-related protein 2 gene (LRP2 is located next to the genomic region showing suggestive linkage with both hip and wrist bone mineral density (BMD phenotypes. LRP2 knockout mice showed severe vitamin D deficiency and bone disease, indicating the involvement of LRP2 in the preservation of vitamin D metabolites and delivery of the precursor to the kidney for the generation of 1α,25(OH(2D(3. In order to investigate the contribution of LRP2 gene polymorphisms to the variation of BMD in Chinese population, a total of 330 Chinese female-offspring nuclear families with 1088 individuals and 400 Chinese male-offspring nuclear families with 1215 individuals were genotyped at six tagSNPs of the LRP2 gene (rs2389557, rs2544381, rs7600336, rs10210408, rs2075252 and rs4667591. BMD values at the lumbar spine 1-4 (L1-4 and hip sites were measured by DXA. The association between LRP2 polymorphisms and BMD phenotypes was assessed by quantitative transmission disequilibrium tests (QTDTs in female- and male-offspring nuclear families separately. In the female-offspring nuclear families, rs2075252 and haplotype GA of rs4667591 and rs2075252 were identified in the nominally significant total association with peak BMD at L1-4; however, no significant within-family association was found between peak BMD at the L1-4 and hip sites and six tagSNPs or haplotypes. In male-offspring nuclear families, neither the six tagSNPs nor the haplotypes was in total association or within-family association with the peak BMD variation at the L1-4 and hip sites by QTDT analysis. Our findings suggested that the polymorphisms of LRP2 gene is not a major factor that contributes to the peak BMD variation in Chinese population.

  14. Looking at the origin of phenotypic variation from pattern formation gene networks

    Indian Academy of Sciences (India)

    Isaac Salazar-Ciudad

    2009-10-01

    This article critically reviews some widespread views about the overall functioning of development. Special attention is devoted to views in developmental genetics about the superstructure of developmental gene networks. According to these views gene networks are hierarchic and multilayered. The highest layers partition the embryo in large coarse areas and control downstream genes that subsequently subdivide the embryo into smaller and smaller areas. These views are criticized on the bases of developmental and evolutionary arguments. First, these views, although detailed at the level of gene identities, do not incorporate morphogenetic mechanisms nor do they try to explain how morphology changes during development. Often, they assume that morphogenetic mechanisms are subordinate to cell signaling events. This is in contradiction to the evidence reviewed herein. Experimental evidence on pattern formation also contradicts the view that developmental gene networks are hierarchically multilayered and that their functioning is decodable from promoter analysis. Simple evolutionary arguments suggest that, indeed, developmental gene networks tend to be non-hierarchic. Re-use leads to extensive modularity in gene networks while developmental drift blurs this modularity. Evolutionary opportunism makes developmental gene networks very dependent on epigenetic factors.

  15. Removal of unwanted variation reveals novel patterns of gene expression linked to sleep homeostasis in murine cortex

    Directory of Open Access Journals (Sweden)

    Jason R. Gerstner

    2016-10-01

    Full Text Available Abstract Background Why we sleep is still one of the most perplexing mysteries in biology. Strong evidence indicates that sleep is necessary for normal brain function and that sleep need is a tightly regulated process. Surprisingly, molecular mechanisms that determine sleep need are incompletely described. Moreover, very little is known about transcriptional changes that specifically accompany the accumulation and discharge of sleep need. Several studies have characterized differential gene expression changes following sleep deprivation. Much less is known, however, about changes in gene expression during the compensatory response to sleep deprivation (i.e. recovery sleep. Results In this study we present a comprehensive analysis of the effects of sleep deprivation and subsequent recovery sleep on gene expression in the mouse cortex. We used a non-traditional analytical method for normalization of genome-wide gene expression data, Removal of Unwanted Variation (RUV. RUV improves detection of differential gene expression following sleep deprivation. We also show that RUV normalization is crucial to the discovery of differentially expressed genes associated with recovery sleep. Our analysis indicates that the majority of transcripts upregulated by sleep deprivation require 6 h of recovery sleep to return to baseline levels, while the majority of downregulated transcripts return to baseline levels within 1–3 h. We also find that transcripts that change rapidly during recovery (i.e. within 3 h do so on average with a time constant that is similar to the time constant for the discharge of sleep need. Conclusions We demonstrate that proper data normalization is essential to identify changes in gene expression that are specifically linked to sleep deprivation and recovery sleep. Our results provide the first evidence that recovery sleep is comprised of two waves of transcriptional regulation that occur at different times and affect functionally

  16. eIF4E Resistance: Natural Variation Should Guide Gene Editing.

    Science.gov (United States)

    Bastet, Anna; Robaglia, Christophe; Gallois, Jean-Luc

    2017-02-28

    eIF4E translation initiation factors have emerged as major susceptibility factors for RNA viruses. Natural eIF4E-based resistance alleles are found in many species and are mostly variants that maintain the translation function of the protein. eIF4E genes represent major targets for engineering viral resistance, and gene-editing technologies can be used to make up for the lack of natural resistance alleles in some crops, often by knocking out eIF4E susceptibility factors. However, we report here how redundancy among eIF4E genes can restrict the efficient use of knockout alleles in breeding. We therefore discuss how gene-editing technologies can be used to design de novo functional alleles, using knowledge about the natural evolution of eIF4E genes in different species, to drive resistance to viruses without affecting plant physiology.

  17. Seasonal variation in expression pattern of genes under HSP70 : Seasonal variation in expression pattern of genes under HSP70 family in heat- and cold-adapted goats (Capra hircus).

    Science.gov (United States)

    Banerjee, Dipak; Upadhyay, Ramesh C; Chaudhary, Umesh B; Kumar, Ravindra; Singh, Sohanvir; Ashutosh; G, Jagan Mohanarao; Polley, Shamik; Mukherjee, Ayan; Das, Tapan K; De, Sachinandan

    2014-05-01

    Heat shock protein 70 (HSP70) is one of the most abundant and best characterized heat shock protein family that consists of highly conserved stress proteins, expressed in response to stress, and plays crucial roles in environmental stress tolerance and adaptation. The present study was conducted to identify major types of genes under the HSP70 family and to quantify their expression pattern in heat- and cold-adapted Indian goats (Capra hircus) with respect to different seasons. Five HSP70 gene homologues to HSPA8, HSPA6, HSPA1A, HSPA1L, and HSPA2 were identified by gene-specific primers. The cDNA sequences showed high similarity to other mammals, and proteins have an estimated molecular weight of around 70 kDa. The expression of HSP70 genes was observed during summer and winter. During summer, the higher expression of HSPA8, HSPA6, and HSPA1A was observed, whereas the expression levels of HSPA1L and HSPA2 were found to be lower. It was also observed that the expression of HSPA1A and HSPA8 was higher during winter in both heat- and cold-adapted goats but downregulates in case of other HSPs. Therefore, both heat and cold stress induced the overexpression of HSP70 genes. An interesting finding that emerged from the study is the higher expression of HSP70 genes in cold-adapted goats during summer and in heat-adapted goats during winter. Altogether, the results indicate that the expression pattern of HSP70 genes is species- and breed-specific, most likely due to variations in thermal tolerance and adaptation to different climatic conditions.

  18. Association between genetic variation in the oxytocin receptor gene and emotional withdrawal, but not between oxytocin pathway genes and diagnosis in psychotic disorders.

    Directory of Open Access Journals (Sweden)

    Marit eHaram

    2015-01-01

    Full Text Available Social dysfunction is common in patients with psychotic disorders. Oxytocin is a neuropeptide with a central role in social behaviour. This study aims to explore the relationship between oxytocin pathway genes and symptoms related to social dysfunction in patients with psychotic disorders. We performed association analyses between four oxytocin pathway genes (OXT, OXTR, AVP, CD38 and four areas of social behaviour-related psychopathology as measured by Positive and Negative Syndrome Scale (PANSS. For this purpose, we used both a polygenic risk score (PGRS and single OXTR candidate SNPs previously reported in the literature (rs53576, rs237902, rs2254298. A total of 734 subjects with DSM-IV psychotic spectrum disorders and 420 healthy controls were included. Oxytocin pathway PGRSs were calculated based on the independent Psychiatric Genomics Consortium study sample. There was a significant association between symptom of Emotional Withdrawal and the previously reported OXTR risk allele A in rs53576. No significant associations between oxytocin pathway gene variants and a diagnosis of psychotic disorder were found. Our findings indicate that while oxytocin pathway genes do not appear to contribute to the susceptibility to psychotic disorders, variations in the OXTR gene might play a role in the development of impaired social behaviour.

  19. Spatial and temporal variation in selection of genes associated with pearl millet varietal quantitative traits in situ

    Directory of Open Access Journals (Sweden)

    Cedric Mariac

    2016-07-01

    Full Text Available Ongoing global climate changes imply new challenges for agriculture. Whether plants and crops can adapt to such rapid changes is still a widely debated question. We previously showed adaptation in the form of earlier flowering in pearl millet at the scale of a whole country over three decades. However, this analysis did not deal with variability of year to year selection. To understand and possibly manage plant and crop adaptation, we need more knowledge of how selection acts in situ. Is selection gradual, abrupt, and does it vary in space and over time? In the present study, we tracked the evolution of allele frequency in two genes associated with pearl millet phenotypic variation in situ. We sampled 17 populations of cultivated pearl millet over a period of two years. We tracked changes in allele frequencies in these populations by genotyping more than seven thousand individuals. We demonstrate that several allele frequencies changes are compatible with selection, by correcting allele frequency changes associated with genetic drift. We found marked variation in allele frequencies from year to year, suggesting a variable selection effect in space and over time. We estimated the strength of selection associated with variations in allele frequency. Our results suggest that the polymorphism maintained at the genes we studied is partially explained by the spatial and temporal variability of selection. In response to environmental changes, traditional pearl millet varieties could rapidly adapt thanks to this available functional variability.

  20. The effect of genetic variation of the serotonin 1B receptor gene on impulsive aggressive behavior and suicide.

    Science.gov (United States)

    Zouk, Hana; McGirr, Alexander; Lebel, Véronique; Benkelfat, Chawky; Rouleau, Guy; Turecki, Gustavo

    2007-12-05

    Impulsive-aggressive behaviors (IABs) are regarded as possible suicide intermediate phenotypes, mediating the relationship between genes and suicide outcome. In this study, we aimed to investigate the putative relationship between genetic variation at the 5-HT1B receptor gene, which in animal models is involved in impulse-aggression control, IABs, and suicide risk. We investigated the relationship of variation at five 5-HT1B loci and IAB measures in a sample of 696 subjects, including 338 individuals who died by suicide and 358 normal epidemiological controls. We found that variation at the 5-HT1B promoter A-161T locus had a significant effect on levels of IABs, as measured by the Buss-Durkee Hostility Inventory (BDHI). Suicides also differed from controls in distribution of variants at this locus. The A-161T locus, which seems to impact 5-HT1B transcription, could play a role in suicide predisposition by means of mediating impulsive-aggressive behaviors.

  1. No association between type 1 diabetes and genetic variation in vitamin D metabolism genes

    DEFF Research Database (Denmark)

    Thorsen, Steffen U; Mortensen, Henrik B; Carstensen, Bendix;

    2014-01-01

    BACKGROUND: Vitamin D, certain single nucleotide polymorphisms (SNPs) in the vitamin D-receptor (VDR) gene and vitamin D metabolism genes have been associated with type 1 diabetes (T1D). OBJECTIVE: We wanted to examine if the most widely studied SNPs in genes important for production, transport......, and action of vitamin D were associated with T1D or to circulating levels of vitamin D 25-hydroxyvitamin D [25(OH)D] in a juvenile Danish population. METHODS: We genotyped eight SNPs in five vitamin D metabolism genes in 1467 trios. 25(OH)D status were analyzed in 1803 children (907 patients and 896 siblings......). RESULTS: We did not demonstrate association with T1D for SNPs in the following genes: CYP27B1, VDR, GC, CYP2R1, DHCR7, and CYP24A1. Though, variants in the GC gene were significantly associated with 25(OH)D levels in the joint model. CONCLUSION: Some of the most examined SNPs in vitamin D metabolism genes...

  2. Multiple Cis-Acting Sequences Contribute to Evolved Regulatory Variation for Drosophila Adh Genes

    Science.gov (United States)

    Fang, X. M.; Brennan, M. D.

    1992-01-01

    Drosophila affinidisjuncta and Drosophila hawaiiensis are closely related species that display distinct tissue-specific expression patterns for their homologous alcohol dehydrogenase genes (Adh genes). In Drosophila melanogaster transformants, both genes are expressed at high levels in the larval and adult fat bodies, but the D. affinidisjuncta gene is expressed 10-50-fold more strongly in the larval and adult midguts and Malpighian tubules. The present study reports the mapping of cis-acting sequences contributing to the regulatory differences between these two genes in transformants. Chimeric genes were constructed and introduced into the germ line of D. melanogaster. Stage- and tissue-specific expression patterns were determined by measuring steady-state RNA levels in larvae and adults. Three portions of the promoter region make distinct contributions to the tissue-specific regulatory differences between the native genes. Sequences immediately upstream of the distal promoter have a strong effect in the adult Malpighian tubules, while sequences between the two promoters are relatively important in the larval Malpighian tubules. A third gene segment, immediately upstream of the proximal promoter, influences levels of the proximal Adh transcript in all tissues and developmental stages examined, and largely accounts for the regulatory difference in the larval and adult midguts. However, these as well as other sequences make smaller contributions to various aspects of the tissue-specific regulatory differences. In addition, some chimeric genes display aberrant RNA levels for the whole organism, suggesting close physical association between sequences involved in tissue-specific regulatory differences and those important for Adh expression in the larval and adult fat bodies. PMID:1644276

  3. Gene expression profiling of genetically determined growth variation in bivalve larvae (Crassostrea gigas).

    Science.gov (United States)

    Meyer, E; Manahan, D T

    2010-03-01

    Growth rates in animals are governed by a wide range of biological factors, many of which remain poorly understood. To identify the genes that establish growth differences in bivalve larvae, we compared expression patterns in contrasting phenotypes (slow- and fast-growth) that were experimentally produced by genetic crosses of the Pacific oyster Crassostrea gigas. Based on transcriptomic profiling of 4.5 million cDNA sequence tags, we sequenced and annotated 181 cDNA clones identified by statistical analysis as candidates for differential growth. Significant matches were found in GenBank for 43% of clones (N=78), including 34 known genes. These sequences included genes involved in protein metabolism, energy metabolism and regulation of feeding activity. Ribosomal protein genes were predominant, comprising half of the 34 genes identified. Expression of ribosomal protein genes showed non-additive inheritance - i.e. expression in fast-growing hybrid larvae was different from average levels in inbred larvae from these parental families. The expression profiles of four ribosomal protein genes (RPL18, RPL31, RPL352 and RPS3) were validated by RNA blots using additional, independent crosses from the same families. Expression of RPL35 was monitored throughout early larval development, revealing that these expression patterns were established early in development (in 2-day-old larvae). Our findings (i) provide new insights into the mechanistic bases of growth and highlight genes not previously considered in growth regulation, (ii) support the general conclusion that genes involved in protein metabolism and feeding regulation are key regulators of growth, and (iii) provide a set of candidate biomarkers for predicting differential growth rates during animal development.

  4. Genetic variation in the oxytocin receptor gene is associated with a social phenotype in autism spectrum disorders.

    Science.gov (United States)

    Harrison, Ashley J; Gamsiz, Ece D; Berkowitz, Isaac C; Nagpal, Shailender; Jerskey, Beth A

    2015-12-01

    Oxytocin regulates social behavior in animal models. Research supports an association between genetic variation in the oxytocin receptor gene (OXTR) and autism spectrum disorders (ASD). In this study, we examine the association between the OXTR gene and a specific social phenotype within ASD. This genotype-phenotype investigation may provide insight into how OXTR conveys risk for social impairment. The current study investigated 10 SNPS in the OXTR gene that have been previously shown to be associated with ASD. We examine the association of these SNPs with both a social phenotype and a repetitive behavior phenotype comprised of behaviors commonly impaired in ASD in the Simons simplex collection (SSC). Using a large sample to examine the association between OXTR and ASD (n = range: 485-1002), we find evidence to support a relation between two OXTR SNPs and the examined social phenotype among children diagnosed with ASD. Greater impairment on the social responsiveness scale standardized total score and on several subdomains was observed among individuals with one or more copies of the minor frequency allele in both rs7632287 and rs237884. Linkage disequilibrium (LD) mapping suggests that these two SNPs are in LD within and overlapping the 3' untranslated region (3'-UTR) of the OXTR gene. These two SNPs were also associated with greater impairment on the repetitive behavior scale. Results of this study indicate that social impairment and repetitive behaviors in ASD are associated with genomic variation in the 3'UTR of the OXTR gene. These variants may be linked to an allele that alters stability of the mRNA message although further work is necessary to test this hypothesis.

  5. Variations in potassium channel genes are associated with distinct trajectories of persistent breast pain after breast cancer surgery.

    Science.gov (United States)

    Langford, Dale J; Paul, Steven M; West, Claudia M; Dunn, Laura B; Levine, Jon D; Kober, Kord M; Dodd, Marylin J; Miaskowski, Christine; Aouizerat, Bradley E

    2015-03-01

    Persistent pain after breast cancer surgery is a common clinical problem. Given the role of potassium channels in modulating neuronal excitability, coupled with recently published genetic associations with preoperative breast pain, we hypothesized that variations in potassium channel genes will be associated with persistent postsurgical breast pain. In this study, associations between 10 potassium channel genes and persistent breast pain were evaluated. Using growth mixture modeling (GMM), 4 distinct latent classes of patients, who were assessed before and monthly for 6 months after breast cancer surgery, were identified previously (ie, No Pain, Mild Pain, Moderate Pain, Severe Pain). Genotyping was done using a custom array. Using logistic regression analyses, significant differences in a number of genotype or haplotype frequencies were found between: Mild Pain vs No Pain and Severe Pain vs No Pain classes. Seven single-nucleotide polymorphisms (SNPs) across 5 genes (ie, potassium voltage-gated channel, subfamily A, member 1 [KCNA1], potassium voltage-gated channel, subfamily D, member 2 [KCND2], potassium inwardly rectifying channel, subfamily J, members 3 and 6 (KCNJ3 and KCNJ6), potassium channel, subfamily K, member 9 [KCNK9]) were associated with membership in the Mild Pain class. In addition, 3 SNPs and 1 haplotype across 4 genes (ie, KCND2, KCNJ3, KCNJ6, KCNK9) were associated with membership in the Severe Pain class. These findings suggest that variations in potassium channel genes are associated with both mild and severe persistent breast pain after breast cancer surgery. Although findings from this study warrant replication, they provide intriguing preliminary information on potential therapeutic targets.

  6. Copy number of pilus gene clusters in Haemophilus influenzae and variation in the hifE pilin gene.

    Science.gov (United States)

    Read, T D; Satola, S W; Opdyke, J A; Farley, M M

    1998-04-01

    Brazilian purpuric fever (BPF)-associated Haemophilus influenzae biogroup aegyptius strain F3031 contains two identical copies of a five gene cluster (hifA to hifE) encoding pili similar to well-characterized Hif fimbriae of H. influenzae type b. HifE, the putative pilus tip adhesin of F3031, shares only 40% amino acid sequence similarity with the same molecule from type b strains, whereas the other four proteins have 75 to 95% identity. To determine whether pilus cluster duplication and the hifE(F3031) allele were special features of BPF-associated bacteria, we analyzed a collection of H. influenzae strains by PCR with hifA- and hifE-specific oligonucleotides, by Southern hybridization with a hifC gene probe, and by nucleotide sequencing. The presence of two pilus clusters was limited to some H. influenzae biogroup aegyptius strains. The hifE(F3031) allele was limited to H. influenzae biogroup aegyptius. Two strains contained one copy of hifE(F3031) and one copy of a variant hifE allele. We determined the nucleotide sequences of four hifE genes from H. influenzae biogroup aegyptius and H. influenzae capsule serotypes a and c. The predicted proteins produced by these genes demonstrated only 35 to 70% identity to the three published HifE proteins from nontypeable H. influenzae, serotype b, and BPF strains. The C-terminal third of the molecules implicated in chaperone binding was the most highly conserved region. Three conserved domains in the otherwise highly variable N-terminal putative receptor-binding region of HifE were similar to conserved portions in the N terminus of Neisseria pilus adhesin PilC. We concluded that two pilus clusters and hifE(F3031) were not specific for BPF-causing H. influenzae, and we also identified portions of HifE possibly involved in binding mammalian cell receptors.

  7. Variation of vlhA gene in Mycoplasma synoviae clones isolated from chickens

    OpenAIRE

    2011-01-01

    Abstract Mycoplasma synoviae synthesizes haemagglutinin VlhA which cleaves into the N-terminal part, a lipoprotein MSPB, and a C-terminal part MSPA. Previous studies have shown that the 3?-end of the expressed vlhA gene can recombine with vlhA pseudogenes in a process called gene conversion, but there has been no data about diversification of the expressed vlhA gene in M. synoviae populations replicating in chickens. Following intratracheal inoculation with the M. synoviae strain U...

  8. Unraveling the effects of selection and demography on immune gene variation in free-ranging plains zebra (Equus quagga populations.

    Directory of Open Access Journals (Sweden)

    Pauline L Kamath

    Full Text Available Demography, migration and natural selection are predominant processes affecting the distribution of genetic variation among natural populations. Many studies use neutral genetic markers to make inferences about population history. However, the investigation of functional coding loci, which directly reflect fitness, is critical to our understanding of species' ecology and evolution. Immune genes, such as those of the Major Histocompatibility Complex (MHC, play an important role in pathogen recognition and provide a potent model system for studying selection. We contrasted diversity patterns of neutral data with MHC loci, ELA-DRA and -DQA, in two southern African plains zebra (Equus quagga populations: Etosha National Park, Namibia, and Kruger National Park, South Africa. Results from neutrality tests, along with observations of elevated diversity and low differentiation across populations, supported previous genus-level evidence for balancing selection at these loci. Despite being low, MHC divergence across populations was significant and may be attributed to drift effects typical of geographically separated populations experiencing little to no gene flow, or alternatively to shifting allele frequency distributions driven by spatially variable and fluctuating pathogen communities. At the DRA, zebra exhibited geographic differentiation concordant with microsatellites and reduced levels of diversity in Etosha due to highly skewed allele frequencies that could not be explained by demography, suggestive of spatially heterogeneous selection and local adaptation. This study highlights the complexity in which selection affects immune gene diversity and warrants the need for further research on the ecological mechanisms shaping patterns of adaptive variation among natural populations.

  9. Gene flow between sexual and facultatively asexual lineages of an aphid species and the maintenance of reproductive mode variation.

    Science.gov (United States)

    Halkett, F; Plantegenest, M; Bonhomme, J; Simon, J-C

    2008-06-01

    Many organisms considered as strictly clonal may in fact experience some rare events of sexual reproduction with their sexual relatives. However, the rate of sexual-asexual gene flow has rarely been assessed mainly because its evaluation is difficult to achieve in the field. In the cyclically parthenogenetic aphid Rhopalosiphum padi, two main sets of lineages, differing in their investment in sexual reproduction and in their genetic attributes, co-exist even at a very fine scale: the 'sexual' lineages which have a full commitment to the sexual reproduction, and the 'facultatively asexual' lineages, which allocate investment in the sexual and parthenogenetic reproduction. This system offers a unique opportunity to tackle the genetic interactions between two contrasting reproductive modes. Here, we provide evidence that gene flow occurred between sexual and facultatively asexual lineages of R. padi. We carefully examined the shuffling in phenotypic and genotypic variation following a sexual reproduction event that took place in the field. Combining genotypic data and phenotypic measurements showed that this gene mixing led to the production of a wide array of reproductive modes, including strictly asexual lineages. Finally, we discuss the central role played by facultatively asexual lineages on the maintenance of reproductive mode variation.

  10. Variation in extracellular matrix genes is associated with weight regain after weight loss in a sex-specific manner

    DEFF Research Database (Denmark)

    Roumans, Nadia J T; Vink, Roel G; Gielen, Marij;

    2015-01-01

    The extracellular matrix (ECM) of adipocytes is important for body weight regulation. Here, we investigated whether genetic variation in ECM-related genes is associated with weight regain among participants of the European DiOGenes study. Overweight and obese subjects (n = 469, 310 females, 159 m.......40-5.63). Concluding, variants of ECM genes are associated with weight regain after weight loss in a sex-specific manner.......The extracellular matrix (ECM) of adipocytes is important for body weight regulation. Here, we investigated whether genetic variation in ECM-related genes is associated with weight regain among participants of the European DiOGenes study. Overweight and obese subjects (n = 469, 310 females, 159...... males) were on an 8-week low-calorie diet with a 6-month follow-up. Body weight was measured before and after the diet, and after follow-up. Weight maintenance scores (WMS, regained weight as percentage of lost weight) were calculated based on the weight data. Genotype data were retrieved for 2903 SNPs...

  11. SLC26A4 gene copy number variations in Chinese patients with non-syndromic enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Zhao Jiandong

    2012-05-01

    Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.

  12. Association studies of genetic variation in the WFS1 gene and type 2 diabetes in U.K. populations.

    Science.gov (United States)

    Minton, Jayne A L; Hattersley, Andrew T; Owen, Katharine; McCarthy, Mark I; Walker, Mark; Latif, Farida; Barrett, Timothy; Frayling, Timothy M

    2002-04-01

    Mutations in the WFS1 gene cause beta-cell death, resulting in a monogenic form of diabetes known as Wolfram syndrome. The role of variation in WFS1 in type 2 diabetes susceptibility is not known. We sequenced the WFS1 gene in 29 type 2 diabetic probands and identified 12 coding variants. We used 152 parent-offspring trios to look for familial association; the R allele at residue 456 (P = 0.04) and the H allele at residue 611 (P = 0.05) as well as the R456-H611 haplotype (P = 0.032) were overtransmitted to affected offspring from heterozygous parents. In a further cohort of 327 type 2 diabetic subjects and 357 normoglycemic control subjects, the H611 allele and the R456-H611 haplotype were present in more type 2 diabetic subjects than control subjects (one-tailed P = 0.06 and P = 0.023, respectively). In a combined analysis, the H611 allele was present in 60% of all diabetes chromosomes and 55% of all control chromosomes (odds ratio [OR] 1.24 [95% CI 1.03-1.48], P = 0.02), and the R456-H611 haplotype was significantly more frequent in type 2 diabetic subjects than in control subjects (60 vs. 54%, OR 1.29 [95% CI 1.08-1.54], P = 0.0053). Our results provide the first evidence that variation in the WFS1 gene may influence susceptibility to type 2 diabetes.

  13. A case study: neuroleptic malignant syndrome with risperidone and CYP2D6 gene variation.

    Science.gov (United States)

    Ochi, Shinichiro; Kawasoe, Koichiro; Abe, Masao; Fukuhara, Ryuji; Sonobe, Kantaro; Kawabe, Kentaro; Ueno, Shu-ichi

    2011-01-01

    We present a schizophrenic patient who experienced neuroleptic malignant syndrome with risperidone treatment due to variants of the CYP2D6 gene with reduced function. Clinicians need to be aware of this potential complication.

  14. Themes and Variations: Regulation of RpoN-Dependent Flagellar Genes across Diverse Bacterial Species

    Directory of Open Access Journals (Sweden)

    Jennifer Tsang

    2014-01-01

    Full Text Available Flagellar biogenesis in bacteria is a complex process in which the transcription of dozens of structural and regulatory genes is coordinated with the assembly of the flagellum. Although the overall process of flagellar biogenesis is conserved among bacteria, the mechanisms used to regulate flagellar gene expression vary greatly among different bacterial species. Many bacteria use the alternative sigma factor σ54 (also known as RpoN to transcribe specific sets of flagellar genes. These bacteria include members of the Epsilonproteobacteria (e.g., Helicobacter pylori and Campylobacter jejuni, Gammaproteobacteria (e.g., Vibrio and Pseudomonas species, and Alphaproteobacteria (e.g., Caulobacter crescentus. This review characterizes the flagellar transcriptional hierarchies in these bacteria and examines what is known about how flagellar gene regulation is linked with other processes including growth phase, quorum sensing, and host colonization.

  15. Polymorphic variation of genes in the fibrinolytic system and the risk of ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Yaakov Bentov

    Full Text Available INTRODUCTION: The etiology of ovarian cancer is largely unknown. One hypothesis is that the inefficient removal of the blood clots and fibrin products which are deposited in the vicinity of the ovary by retrograde menstruation might be associated with an increased risk of ovarian cancer. Several single nucleotide polymorphisms within genes which comprise the fibrinolytic system have been shown to have functional effects on the rate of blood clot degradation. These were considered to be candidate genes in the present study. AIM: We studied the genotype distributions of 12 functional SNPs of four genes (tPA, uPA PAI1 and TAFI among 775 ovarian cancer cases and 889 controls. RESULTS: No significant associations were seen between any of the ten SNPs and the risk of ovarian cancer as a whole, or in any histologic subgroup. DISCUSSION: Germline known functional variants of genes in the fibrinolytic system are not associated with risk of ovarian cancer.

  16. Expression profiles of sugarcane under drought conditions: Variation in gene regulation

    Directory of Open Access Journals (Sweden)

    Júlio César Farias de Andrade

    2015-01-01

    Full Text Available AbstractDrought is a major factor in decreased sugarcane productivity because of the resulting morphophysiological effects that it causes. Gene expression studies that have examined the influence of water stress in sugarcane have yielded divergent results, indicating the absence of a fixed pattern of changes in gene expression. In this work, we investigated the expression profiles of 12 genes in the leaves of a drought-tolerant genotype (RB72910 of sugarcane and compared the results with those of other studies. The genotype was subjected to 80–100% water availability (control condition and 0–20% water availability (simulated drought. To analyze the physiological status, the SPAD index, Fv/Fm ratio, net photosynthesis (A, stomatal conductance (gs and stomatal transpiration (E were measured. Total RNA was extracted from leaves and the expression of SAMDC, ZmPIP2-1 protein, ZmTIP4-2 protein, WIP protein, LTP protein, histone H3, DNAj, ferredoxin I, β-tubulin, photosystem I, gene 1 and gene 2 was analyzed by quantitative real-time PCR (RT-PCR. Important differences in the expression profiles of these genes were observed when compared with other genotypes, suggesting that complex defense mechanisms are activated in response to water stress. However, there was no recognizable pattern for the changes in expression of the different proteins associated with tolerance to drought stress.

  17. The association of telomere length and genetic variation in telomere biology genes.

    Science.gov (United States)

    Mirabello, Lisa; Yu, Kai; Kraft, Peter; De Vivo, Immaculata; Hunter, David J; Prescott, Jennifer; Wong, Jason Y Y; Chatterjee, Nilanjan; Hayes, Richard B; Savage, Sharon A

    2010-09-01

    Telomeres cap chromosome ends and are critical for genomic stability. Many telomere-associated proteins are important for telomere length maintenance. Recent genome-wide association studies (GWAS) have identified single nucleotide polymorphisms (SNPs) in genes encoding telomere-associated proteins (RTEL1 and TERT-CLPTM1) as markers of cancer risk. We conducted an association study of telomere length and 743 SNPs in 43 telomere biology genes. Telomere length in peripheral blood DNA was determined by Q-PCR in 3,646 participants from the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial and Nurses' Health Study. We investigated associations by SNP, gene, and pathway (functional group). We found no associations between telomere length and SNPs in TERT-CLPTM1L or RTEL1. Telomere length was not significantly associated with specific functional groups. Thirteen SNPs from four genes (MEN1, MRE11A, RECQL5, and TNKS) were significantly associated with telomere length. The strongest findings were in MEN1 (gene-based P=0.006), menin, which associates with the telomerase promoter and may negatively regulate telomerase. This large association study did not find strong associations with telomere length. The combination of limited diversity and evolutionary conservation suggest that these genes may be under selective pressure. More work is needed to explore the role of genetic variants in telomere length regulation.

  18. Genetic variation in toll-like receptors and retinoic acid-inducible gene I and outcome of hepatitis C virus infection: a candidate gene association study

    DEFF Research Database (Denmark)

    Clausen Nygaard, Louise; Ladelund, S; Weis, N;

    2014-01-01

    with resolution in the discovery cohort were genotyped in a validation cohort. Multivariate logistic regression adjusted for sex, hepatitis B surface antigen, HIV infection and the interleukin-28B rs12979860 SNP was performed in the combined cohort. Haplotype reconstruction and linkage disequilibrium analysis......We evaluated the effects of genetic variation in toll-like receptors (TLR), retinoic acid-inducible gene I (RIG-I) and their signalling pathways on spontaneous hepatitis C virus (HCV) resolution. We screened 95 single-nucleotide polymorphisms (SNPs) in 22 genes. SNPs significantly associated...... were performed. srs2233437, rs730775 and rs28362857 in Inhibitor of NF-kB ε (IkBε) and rs352140 in TLR9 were associated with spontaneous HCV resolution (P ≤ 0.05) in the discovery cohort (n = 308). In the validation cohort (n = 216), we replicated a significant association with HCV resolution for two...

  19. Natural variation in maternal care and cross-tissue patterns of oxytocin receptor gene methylation in rats.

    Science.gov (United States)

    Beery, Annaliese K; McEwen, Lisa M; MacIsaac, Julia L; Francis, Darlene D; Kobor, Michael S

    2016-01-01

    This article is part of a Special Issue "Parental Care". Since the first report of maternal care effects on DNA methylation in rats, epigenetic modifications of the genome in response to life experience have become the subject of intense focus across many disciplines. Oxytocin receptor expression varies in response to early experience, and both oxytocin signaling and methylation status of the oxytocin receptor gene (Oxtr) in blood have been related to disordered social behavior. It is unknown whether Oxtr DNA methylation varies in response to early life experience, and whether currently employed peripheral measures of Oxtr methylation reflect variation in the brain. We examined the effects of early life rearing experience via natural variation in maternal licking and grooming during the first week of life on behavior, physiology, gene expression, and epigenetic regulation of Oxtr across blood and brain tissues (mononucleocytes, hippocampus, striatum, and hypothalamus). Rats reared by "high" licking-grooming (HL) and "low" licking-grooming (LL) rat dams exhibited differences across study outcomes: LL offspring were more active in behavioral arenas, exhibited lower body mass in adulthood, and showed reduced corticosterone responsivity to a stressor. Oxtr DNA methylation was significantly lower at multiple CpGs in the blood of LL versus HL males, but no differences were found in the brain. Across groups, Oxtr transcript levels in the hypothalamus were associated with reduced corticosterone secretion in response to stress, congruent with the role of oxytocin signaling in this region. Methylation of specific CpGs at a high or low level was consistent across tissues, especially within the brain. However, individual variation in DNA methylation relative to these global patterns was not consistent across tissues. These results suggest that blood Oxtr DNA methylation may reflect early experience of maternal care, and that Oxtr methylation across tissues is highly concordant

  20. Contribution of Myostatin gene polymorphisms to normal variation in lean mass, fat mass and peak BMD in Chinese male offspring

    Institute of Scientific and Technical Information of China (English)

    Hua YUE; Miao LI; Yu-juan LIU; Song-hua WU; Zhen-lin ZHANG; Jin-wei HE; Hao ZHANG; Chun WANG; Wei-wei HU; Jie-mei GU; Yao-hua KE; Wen-zhen FU; Yun-qiu HU

    2012-01-01

    Myostatin gene is a member of the transforming growth factor-β (TGF-β) family that negatively regulates skeletal muscle growth.Genetic polymorphisms in Myostatin were found to be associated with the peak bone mineral density (BMD) in Chinese women.The purpose of this study was to investigate whether Myostatin played a role in the normal variation in peak BMD,lean mass (LM),and fat mass (FM) of Chinese men.Methods:Four hundred male-offspring nuclear families of Chinese Han ethnic group were recruited.Anthropometric measurements,includingthe peak BMD,body LM and FM were measured using dual-energy X-ray absorptiometry (DXA).The single nucleotide polymorphisms (SNPs) studied were tag-SNPs selected by sequencing.Both rs2293284 and +2278G>A were genotyped using TaqMan assay,and rs3791783 was genotyped with PCR-restriction fragment length polymorphism (RFLP) analysis.The associations of the SNPs with anthropometfic variations were analyzed using the quantitative transmission disequilibrium test (QTDT).Results:Using QTDT to detect within-family associations,neither single SNP nor haplotype was found to be associated with peak BMD at any bone site.However,rs3791783 was found to be significantly associated with fat mass of the trunk (P<0.001).Moreover,for within-family associations,haplotypes AGG,AAA,and TGG were found to be significantly associated with the trunk fat mass (all P<0.001).Conclusion:Our results suggest that genetic variation within Myostatin may play a role in regulating the variation in fat mass in Chinese males.Additionally,the Myostatin gene may be a candidate that determines body fat mass in Chinese men.

  1. Gene expression variation to predict 10-year survival in lymph-node-negative breast cancer

    Directory of Open Access Journals (Sweden)

    Karlsson Per

    2008-09-01

    Full Text Available Abstract Background It is of great significance to find better markers to correctly distinguish between high-risk and low-risk breast cancer patients since the majority of breast cancer cases are at present being overtreated. Methods 46 tumours from node-negative breast cancer patients were studied with gene expression microarrays. A t-test was carried out in order to find a set of genes where the expression might predict clinical outcome. Two classifiers were used for evaluation of the gene lists, a correlation-based classifier and a Voting Features Interval (VFI classifier. We then evaluated the predictive accuracy of this expression signature on tumour sets from two similar studies on lymph-node negative patients. They had both developed gene expression signatures superior to current methods in classifying node-negative breast tumours. These two signatures were also tested on our material. Results A list of 51 genes whose expression profiles could predict clinical outcome with high accuracy in our material (96% or 89% accuracy in cross-validation, depending on type of classifier was developed. When tested on two independent data sets, the expression signature based on the 51 identified genes had good predictive qualities in one of the data sets (74% accuracy, whereas their predictive value on the other data set were poor, presumably due to the fact that only 23 of the 51 genes were found in that material. We also found that previously developed expression signatures could predict clinical outcome well to moderately well in our material (72% and 61%, respectively. Conclusion The list of 51 genes derived in this study might have potential for clinical utility as a prognostic gene set, and may include candidate genes of potential relevance for clinical outcome in breast cancer. According to the predictions by this expression signature, 30 of the 46 patients may have benefited from different adjuvant treatment than they recieved. Trial

  2. Schooling and Variation in the "COMT" Gene: The Devil Is in the Details

    Science.gov (United States)

    Campbell, Daniel; Bick, Johanna; Yrigollen, Carolyn M.; Lee, Maria; Joseph, Antony; Chang, Joseph T.; Grigorenko, Elena L.

    2013-01-01

    Background: Schooling is considered one of the major contributors to the development of intelligence within societies and individuals. Genetic variation might modulate the impact of schooling and explain, at least partially, the presence of individual differences in classrooms. Method: We studied a sample of 1,502 children (mean age = 11.7 years)…

  3. Intra- and interindividual variation in gene expression in human adipose tissue

    NARCIS (Netherlands)

    van Beek, Esther A.; Bakker, Arjen H.; Kruyt, Philip M.; Hofker, Marten H.; Saris, Wim H.; Keijer, Jaap

    2007-01-01

    Adipose tissue is a highly plastic tissue with an important endocrine and metabolic function. To understand its role in human health and disease, it is necessary to understand the extent of variation and the specific differences within and between different depots and subjects. We employed cDNA micr

  4. Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population

    DEFF Research Database (Denmark)

    Frikke-Schmidt, Ruth

    2010-01-01

    Epidemiological studies consistently demonstrate a strong inverse association between low levels of high-density lipoprotein (HDL) cholesterol and increased risk of ischemic heart disease (IHD). This review focuses on whether both rare and common genetic variation in ABCA1 contributes to plasma...... levels of HDL cholesterol and to risk of IHD in the general population, and further seeks to understand whether low levels of HDL cholesterol per se are causally related to IHD. Studies of the ABCA1 gene demonstrate a general strategy for detecting functional genetic variants, and show that both common...

  5. Plasticity of the Leishmania genome leading to gene copy number variations and drug resistance [version 1; referees: 5 approved

    Directory of Open Access Journals (Sweden)

    Marie-Claude N. Laffitte

    2016-09-01

    Full Text Available Leishmania has a plastic genome, and drug pressure can select for gene copy number variation (CNV. CNVs can apply either to whole chromosomes, leading to aneuploidy, or to specific genomic regions. For the latter, the amplification of chromosomal regions occurs at the level of homologous direct or inverted repeated sequences leading to extrachromosomal circular or linear amplified DNAs. This ability of Leishmania to respond to drug pressure by CNVs has led to the development of genomic screens such as Cos-Seq, which has the potential of expediting the discovery of drug targets for novel promising drug candidates.

  6. Copy number variations of 11 macronuclear chromosomes and their gene expression in Oxytricha trifallax.

    Science.gov (United States)

    Xu, Ke; Doak, Thomas G; Lipps, Hans J; Wang, Jingmei; Swart, Estienne C; Chang, Wei-Jen

    2012-08-15

    Ciliated protozoa are peculiar for their nuclear dimorphism, wherein two types of nuclei divide nuclear functions: a germline micronucleus (MIC) is transcriptionally inert during vegetative growth, but serves as the genetic blueprint for the somatic macronucleus (MAC), which is responsible for all transcripts supporting cell growth and reproduction. While all the advantages/disadvantages associated with nuclear dimorphism are not clear, an essential advantage seems to be the ability to produce a highly polyploid MAC, which then allows for the maintenance of extremely large single cells - many ciliate cells are larger than small metazoa. In some ciliate classes, chromosomes in the MAC are extensively fragmented to create extremely short chromosomes that often carry single genes, and these chromosomes may be present in different copy numbers, resulting in different ploidies. While using gene copy number to regulate gene expression is limited in most eukaryotic systems, the extensive fragmentation in some ciliate classes provides this opportunity to every MAC gene. However, it is still unclear if this mechanism is in fact used extensively in these ciliates. To address this, we have quantified copy numbers of 11 MAC chromosomes and their gene expression in Oxytricha trifallax (CI: Spirotrichea). We compared copy numbers between two subpopulations of O. trifallax, and copy numbers of 7 orthologous genes between O. trifallax and the closely related Stylonychia lemnae. We show that copy numbers of MAC chromosomes are variable, dynamic, and positively correlated to gene expression. These features might be conserved in all spirotrichs, and might exist in other classes of ciliates with heavily fragmented MAC chromosomes.

  7. Genetic variation in cell death genes and risk of non-Hodgkin lymphoma.

    Directory of Open Access Journals (Sweden)

    Johanna M Schuetz

    Full Text Available BACKGROUND: Non-Hodgkin lymphomas are a heterogeneous group of solid tumours that constitute the 5(th highest cause of cancer mortality in the United States and Canada. Poor control of cell death in lymphocytes can lead to autoimmune disease or cancer, making genes involved in programmed cell death of lymphocytes logical candidate genes for lymphoma susceptibility. MATERIALS AND METHODS: We tested for genetic association with NHL and NHL subtypes, of SNPs in lymphocyte cell death genes using an established population-based study. 17 candidate genes were chosen based on biological function, with 123 SNPs tested. These included tagSNPs from HapMap and novel SNPs discovered by re-sequencing 47 cases in genes for which SNP representation was judged to be low. The main analysis, which estimated odds ratios by fitting data to an additive logistic regression model, used European ancestry samples that passed quality control measures (569 cases and 547 controls. A two-tiered approach for multiple testing correction was used: correction for number of tests within each gene by permutation-based methodology, followed by correction for the number of genes tested using the false discovery rate. RESULTS: Variant rs928883, near miR-155, showed an association (OR per A-allele: 2.80 [95% CI: 1.63-4.82]; p(F = 0.027 with marginal zone lymphoma that is significant after correction for multiple testing. CONCLUSIONS: This is the first reported association between a germline polymorphism at a miRNA locus and lymphoma.

  8. Relación entre burnout y engagement académicos con variables sociodemográficas y académicas

    OpenAIRE

    2015-01-01

    Este estudio buscó esclarecer la interdependencia entre burnout académico ( BA ) y engagement académico ( EA ) en estudiantes universitarios del área de la salud, y profundizar en la carac - terización de esta relación a partir de sus asociaciones con variables sociodemográficas y académicas (desempeño académico, DA ). Se utilizó un diseño observacional y correlacional de tipo multivariado con una muestra, constituida aleatoria y estratificadamente por 802 estudiantes de los programas ...

  9. Genomic analysis of QTLs and genes altering natural variation in stochastic noise.

    Science.gov (United States)

    Jimenez-Gomez, Jose M; Corwin, Jason A; Joseph, Bindu; Maloof, Julin N; Kliebenstein, Daniel J

    2011-09-01

    Quantitative genetic analysis has long been used to study how natural variation of genotype can influence an organism's phenotype. While most studies have focused on genetic determinants of phenotypic average, it is rapidly becoming understood that stochastic noise is genetically determined. However, it is not known how many traits display genetic control of stochastic noise nor how broadly these stochastic loci are distributed within the genome. Understanding these questions is critical to our understanding of quantitative traits and how they relate to the underlying causal loci, especially since stochastic noise may be directly influenced by underlying changes in the wiring of regulatory networks. We identified QTLs controlling natural variation in stochastic noise of glucosinolates, plant defense metabolites, as well as QTLs for stochastic noise of related transcripts. These loci included stochastic noise QTLs unique for either transcript or metabolite variation. Validation of these loci showed that genetic polymorphism within the regulatory network alters stochastic noise independent of effects on corresponding average levels. We examined this phenomenon more globally, using transcriptomic datasets, and found that the Arabidopsis transcriptome exhibits significant, heritable differences in stochastic noise. Further analysis allowed us to identify QTLs that control genomic stochastic noise. Some genomic QTL were in common with those altering average transcript abundance, while others were unique to stochastic noise. Using a single isogenic population, we confirmed that natural variation at ELF3 alters stochastic noise in the circadian clock and metabolism. Since polymorphisms controlling stochastic noise in genomic phenotypes exist within wild germplasm for naturally selected phenotypes, this suggests that analysis of Arabidopsis evolution should account for genetic control of stochastic variance and average phenotypes. It remains to be determined if natural

  10. Variation in extracellular matrix genes is associated with weight regain after weight loss in a sex-specific manner

    DEFF Research Database (Denmark)

    Roumans, Nadia J T; Vink, Roel G; Gielen, Marij

    2015-01-01

    males) were on an 8-week low-calorie diet with a 6-month follow-up. Body weight was measured before and after the diet, and after follow-up. Weight maintenance scores (WMS, regained weight as percentage of lost weight) were calculated based on the weight data. Genotype data were retrieved for 2903 SNPs.......40-5.63). Concluding, variants of ECM genes are associated with weight regain after weight loss in a sex-specific manner.......The extracellular matrix (ECM) of adipocytes is important for body weight regulation. Here, we investigated whether genetic variation in ECM-related genes is associated with weight regain among participants of the European DiOGenes study. Overweight and obese subjects (n = 469, 310 females, 159...

  11. The GM2 gangliosidoses databases: allelic variation at the HEXA, HEXB, and GM2A gene loci.

    Science.gov (United States)

    Cordeiro, P; Hechtman, P; Kaplan, F

    2000-01-01

    The GM2 gangliosidoses are a group of recessive disorders characterized by accumulation of GM2 ganglioside in neuronal cells. The genes responsible for these disorders are HEXA (Tay-Sachs disease and variants), HEXB (Sandhoff disease and variants), and GM2A (AB variant of GM2 gangliosidosis). We report the establishment of three relational locus-specific databases recording allelic variation at the HEXA, HEXB, and GM2A genes and accessed at the GM2 gangliosidoses home page (http://data.mch.mcgill.ca/gm2-gangliosidoses). Submission forms are available for the addition of new mutations to the databases. The databases are available online for users to search and retrieve information about specific alleles by a number of fields describing mutations, phenotypes, or author(s).

  12. Determination of cis/trans phase of variations in the MC1R gene with allele-specific PCR and single base extension

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Børsting, Claus; Sanchez, Juan J;

    2008-01-01

    The MC1R gene encodes a protein with key regulatory functions in the melanin synthesis. A multiplex PCR and a multiplex single base extension protocol were established for genotyping six exonic MC1R variations highly penetrant for red hair (R), four exonic MC1R variations weakly penetrant for red...

  13. Serotonin and Early Cognitive Development: Variation in the Tryptophan Hydroxylase 2 Gene Is Associated with Visual Attention in 7-Month-Old Infants

    Science.gov (United States)

    Leppanen, Jukka M.; Peltola, Mikko J.; Puura, Kaija; Mantymaa, Mirjami; Mononen, Nina; Lehtimaki, Terho

    2011-01-01

    Background: Allelic variation in the promoter region of a gene that encodes tryptophan hydroxylase isoform 2 (TPH2), a rate-limiting enzyme of serotonin synthesis in the central nervous system, has been associated with variations in cognitive function and vulnerability to affective spectrum disorders. Little is known about the effects of this gene…

  14. Epigenetic modifications at DMRs of placental genes are subjected to variations in normal gestation, pathological conditions and folate supplementation

    Science.gov (United States)

    Rahat, Beenish; Mahajan, Aatish; Bagga, Rashmi; Hamid, Abid; Kaur, Jyotdeep

    2017-01-01

    Invasive placentation and cancer development shares many similar molecular and epigenetic pathways. Paternally expressed, growth promoting genes (SNRPN, PEG10 and MEST) which are known to play crucial role in tumorogenesis, are not well studied during placentation. This study reports for the first time of the impact of gestational-age, pathological conditions and folic acid supplementation on dynamic nature of DNA and histone methylation present at their differentially methylated regions (DMRs). Here, we reported the association between low DNA methylation/H3K27me3 and higher expression of SNRPN, PEG10 and MEST in highly proliferating normal early gestational placenta. Molar and preeclamptic placental villi, exhibited aberrant changes in methylation levels at DMRs of these genes, leading to higher and lower expression of these genes, respectively, in reference to their respective control groups. Moreover, folate supplementation could induce gene specific changes in mRNA expression in placental cell lines. Further, MEST and SNRPN DMRs were observed to show the potential to act as novel fetal DNA markers in maternal plasma. Thus, variation in methylation levels at these DMRs regulate normal placentation and placental disorders. Additionally, the methylation at these DMRs might also be susceptible to folic acid supplementation and has the potential to be utilized in clinical diagnosis. PMID:28098215

  15. The thermostable direct hemolysin-related hemolysin (trh) gene of Vibrio parahaemolyticus: Sequence variation and implications for detection and function.

    Science.gov (United States)

    Nilsson, William B; Turner, Jeffrey W

    2016-07-01

    Vibrio parahaemolyticus is a leading cause of bacterial food-related illness associated with the consumption of undercooked seafood. Only a small subset of strains is pathogenic. Most clinical strains encode for the thermostable direct hemolysin (TDH) and/or the TDH-related hemolysin (TRH). In this work, we amplify and sequence the trh gene from over 80 trh+strains of this bacterium and identify thirteen genetically distinct alleles, most of which have not been deposited in GenBank previously. Sequence data was used to design new primers for more reliable detection of trh by endpoint PCR. We also designed a new quantitative PCR assay to target a more conserved gene that is genetically-linked to trh. This gene, ureR, encodes the transcriptional regulator for the urease gene cluster immediately upstream of trh. We propose that this ureR assay can be a useful screening tool as a surrogate for direct detection of trh that circumvents challenges associated with trh sequence variation.

  16. Genetic variation of the major histocompatibility complex (MHC class II B gene in the threatened Hume's pheasant, Syrmaticus humiae.

    Directory of Open Access Journals (Sweden)

    Weicai Chen

    Full Text Available Major histocompatibility complex (MHC genes are the most polymorphic genes in vertebrates and encode molecules that play a crucial role in pathogen resistance. As a result of their diversity, they have received much attention in the fields of evolutionary and conservation biology. Here, we described the genetic variation of MHC class II B (MHCIIB exon 2 in a wild population of Hume's pheasant (Syrmaticus humiae, which has suffered a dramatic decline in population over the last three decades across its ranges in the face of heavy exploitation and habitat loss. Twenty-four distinct alleles were found in 73 S. humiae specimens. We found seven shared alleles among four geographical groups as well as six rare MHCIIB alleles. Most individuals displayed between one to five alleles, suggesting that there are at least three MHCIIB loci of the Hume's pheasant. The dN ⁄ dS ratio at putative antigen-binding sites (ABS was significantly greater than one, indicating balancing selection is acting on MHCIIB exon 2. Additionally, recombination and gene conversion contributed to generating MHCIIB diversity in the Hume's pheasant. One to three recombination events and seventy-five significant gene conversion events were observed within the Hume's pheasant MHCIIB loci. The phylogenetic tree and network analysis revealed that the Hume's pheasant alleles do not cluster together, but are scattered through the tree or network indicating a trans-species evolutionary mode. These findings revealed the evolution of the Hume's pheasant MHC after suffering extreme habitat fragmentation.

  17. Allele variations in the OCA2 gene (pink-eyed-dilution locus) are associated with genetic susceptibility to melanoma.

    Science.gov (United States)

    Jannot, Anne-Sophie; Meziani, Roubila; Bertrand, Guylene; Gérard, Benedicte; Descamps, Vincent; Archimbaud, Alain; Picard, Catherine; Ollivaud, Laurence; Basset-Seguin, Nicole; Kerob, Delphine; Lanternier, Guy; Lebbe, Celeste; Saiag, P; Crickx, Beatrice; Clerget-Darpoux, Françoise; Grandchamp, Bernard; Soufir, Nadem; Melan-Cohort

    2005-08-01

    The occuloalbinism 2 (OCA2) gene, localized at 15q11, encodes a melanosomal transmembrane protein that is involved in the most common form of human occulo-cutaneous albinism, a human genetic disorder characterized by fair pigmentation and susceptibility to skin cancer. We wondered whether allele variations at this locus could influence susceptibility to malignant melanoma (MM). In all, 10 intragenic single-nucleotide polymorphisms (SNPs) were genotyped in 113 patients with melanomas and in 105 Caucasian control subjects with no personal or family history of skin cancer. By comparing allelic distribution between cases and controls, we show that MM and OCA2 are associated (p value=0.030 after correction for multiple testing). Then, a recently developed strategy, the 'combination test' enabled us to show that a combination formed by two SNPs was most strongly associated to MM, suggesting a possible interaction between intragenic SNPs. In addition, the role of OCA2 on MM risk was also detected using a logistic model taking into account the presence of variants of the melanocortin 1 receptor gene (MC1R, a key pigmentation gene) and all pigmentation characteristics as melanoma risk factors. Our data demonstrate that a second pigmentation gene, in addition to MC1R, is involved in genetic susceptibility to melanoma.

  18. Molecular phylogenetic and sequence variation analysis of dimeric α-amylase inhibitor genes in wheat and its wild relative species

    Directory of Open Access Journals (Sweden)

    Bharati Pandey

    2016-06-01

    Full Text Available Dimeric alpha-amylase inhibitors serve protection against insects that are highly dependent on starch for their energy. In order to study the molecular evolution and sequence variation, we have sequenced dimeric α-amylase inhibitors gene from different genomes in Triticeae including Indian bread and durum wheat genotypes. Using BLAST, obtained sequences show very high homology with other inhibitors available at GenBank database and had common conserved 10 cysteine residues. Investigated frequency of significant SNPs in the α-amylase inhibitor gene was 1 out of 60 bases. The phylogenetic analysis based on deduced amino acid sequences revealed that the genes encoding dimeric α-amylase inhibitors formed three groups and genes isolated from Indian bread wheat clustered with 0.19 inhibitors. In addition, we predicted that dimeric α-amylase inhibitors co-localized into chloroplast and mitochondria expect for the sequences isolated from Aegilops tauschii. Fingerprinting analysis done with ScanProsite confirmed biologically meaningful signatures. Multiple sequence alignment of dimeric α-amylase proteins from different plant species revealed a conserved secondary structure region, indicating homology at the sequence and structural levels. Analysis of the protein sequences obtained from wheat and its wild related species are very similar, indicates a highest conservation of these proteins.

  19. Variation at the Calpain 3 gene is associated with meat tenderness in zebu and composite breeds of cattle

    Directory of Open Access Journals (Sweden)

    Bunch Rowan J

    2008-07-01

    Full Text Available Abstract Background Quantitative Trait Loci (QTL affecting meat tenderness have been reported on Bovine chromosome 10. Here we examine variation at the Calpain 3 (CAPN3 gene in cattle, a gene located within the confidence interval of the QTL, and which is a positional candidate gene based on the biochemical activity of the protein. Results We identified single nucleotide polymorphisms (SNP in the genomic sequence of the CAPN3 gene and tested three of these in a sample of 2189 cattle. Of the three SNP genotyped, the CAPN3:c.1538+225G>T had the largest significant additive effect, with an allele substitution effect in the Brahman of α = -0.144 kg, SE = 0.060, P = 0.016, and the polymorphism explained 1.7% of the residual phenotypic variance in that sample of the breed. Significant haplotype substitution effects were found for all three breeds, the Brahman, the Belmont Red, and the Santa Gertrudis. For the common haplotype, the haplotype substitution effect in the Brahman was α = 0.169 kg, SE = 0.056, P = 0.003. The effect of this gene was compared to Calpastatin in the same sample. The SNP show negligible frequencies in taurine breeds and low to moderate minor allele frequencies in zebu or composite animals. Conclusion These associations confirm the location of a QTL for meat tenderness in this region of bovine chromosome 10. SNP in or near this gene may be responsible for part of the overall difference between taurine and zebu breeds in meat tenderness, and the greater variability in meat tenderness found in zebu and composite breeds. The evidence provided so far suggests that none of these tested SNP are causative mutations.

  20. Aggressive behavior, related conduct problems, and variation in genes affecting dopamine turnover.

    Science.gov (United States)

    Grigorenko, Elena L; De Young, Colin G; Eastman, Maria; Getchell, Marya; Haeffel, Gerald J; Klinteberg, Britt af; Koposov, Roman A; Oreland, Lars; Pakstis, Andrew J; Ponomarev, Oleg A; Ruchkin, Vladislav V; Singh, Jay P; Yrigollen, Carolyn M

    2010-01-01

    A number of dopamine-related genes have been implicated in the etiology of violent behavior and conduct problems. Of these genes, the ones that code for the enzymes that influence the turnover of dopamine (DA) have received the most attention. In this study, we investigated 12 genetic polymorphisms in four genes involved with DA functioning (COMT, MAOA and MAOB, and DbetaH) in 179 incarcerated male Russian adolescents and two groups of matched controls: boys without criminal records referred to by their teachers as (a) "troubled-behavior-free" boys, n=182; and (b) "troubled-behavior" boys, n=60. The participants were classified as (1) being incarcerated or not, (2) having the DSM-IV diagnosis of conduct disorder (CD) or not, and (3) having committed violent or nonviolent crimes (for the incarcerated individuals only). The findings indicate that, although no single genetic variant in any of the four genes differentiated individuals in the investigated groups, various linear combinations (i.e., haplotypes) and nonlinear combinations (i.e., interactions between variants within and across genes) of genetic variants resulted in informative and robust classifications for two of the three groupings. These combinations of genetic variants differentiated individuals in incarceration vs. nonincarcerated and CD vs. no-CD groups; no informative combinations were established consistently for the grouping by crime within the incarcerated individuals. This study underscores the importance of considering multiple rather than single markers within candidate genes and their additive and interactive combinations, both with themselves and with nongenetic indicators, while attempting to understand the genetic background of such complex behaviors as serious conduct problems.

  1. Genetic variation of Aflatoxin B(1) aldehyde reductase genes (AFAR) in human tumour cells

    DEFF Research Database (Denmark)

    Praml, Christian; Schulz, Wolfgang; Claas, Andreas

    2008-01-01

    AFAR genes play a key role in the detoxification of the carcinogen Aflatoxin B(1) (AFB(1)). In the rat, Afar1 induction can prevent AFB(1)-induced liver cancer. It has been proposed that AFAR enzymes can metabolise endogenous diketones and dialdehydes that may be cytotoxic and/or genotoxic....... Furthermore, human AFAR1 catalyses the rate limiting step in the synthesis of the neuromodulator gamma-hydroxybutyrate (GHB) and was found elevated in neurodegenerative diseases such as Alzheimer's and dementia with Lewy bodies (DLB). The human AFAR gene family maps to a genomic region in 1p36 of frequent...

  2. Plagio e integridad académica en Alemania

    Directory of Open Access Journals (Sweden)

    2016-07-01

    Full Text Available Alemania es quizá uno de los países europeos que, ya desde el siglo XVIII, ha mantenido un debate público más intenso sobre prácticas científicas y académicas deshonestas, relacionadas especialmente con tesis doctorales. Este debate fue especialmente productivo a finales del siglo XIX, dando lugar desde entonces, para evitar estas prácticas inaceptables, a la obligatoriedad de publicar todas las tesis doctorales, como requisito previo a la expedición del título de doctor por cualquier universidad alemana. Este trabajo analiza los avances más importantes en plagio e integridad académica en Alemania, especialmente después del escándalo surgido en 2011 a raíz del plagio de la tesis doctoral del Ministro de Defensa Guttenberg, como son la creación de una eficaz metodología colaborativa de investigación del plagio en trabajos científicos o académicos utilizando Internet y las redes sociales, materializada en la Wiki «VroniPlag». También se describe someramente en este trabajo la consolidación definitiva de la figura del «Defensor de la Ciencia», como instrumento de ámbito nacional para prevenir, gestionar y combatir la deshonestidad científica, aparte de la publicación en 2013 de una nueva versión del manual de referencia al respecto «Sicherung guter wissenschaftlicher Praxis». Por último se analizan las conclusiones de la experiencia alemana relacionada con la ética académica, también desde una perspectiva histórica, pues sus recientes logros y avances pueden servir de referencia a otros países europeos.

  3. Gene expression profiling of Spodoptera frugiperda hemocytes and fat body using cDNA microarray reveals polydnavirus-associated variations in lepidopteran host genes transcript levels

    Directory of Open Access Journals (Sweden)

    Feyereisen R

    2006-06-01

    Full Text Available Abstract Background Genomic approaches provide unique opportunities to study interactions of insects with their pathogens. We developed a cDNA microarray to analyze the gene transcription profile of the lepidopteran pest Spodoptera frugiperda in response to injection of the polydnavirus HdIV associated with the ichneumonid wasp Hyposoter didymator. Polydnaviruses are associated with parasitic ichneumonoid wasps and are required for their development within the lepidopteran host, in which they act as potent immunosuppressive pathogens. In this study, we analyzed transcriptional variations in the two main effectors of the insect immune response, the hemocytes and the fat body, after injection of filter-purified HdIV. Results Results show that 24 hours post-injection, about 4% of the 1750 arrayed host genes display changes in their transcript levels with a large proportion (76% showing a decrease. As a comparison, in S. frugiperda fat body, after injection of the pathogenic JcDNV densovirus, 8 genes display significant changes in their transcript level. They differ from the 7 affected by HdIV and, as opposed to HdIV injection, are all up-regulated. Interestingly, several of the genes that are modulated by HdIV injection have been shown to be involved in lepidopteran innate immunity. Levels of transcripts related to calreticulin, prophenoloxidase-activating enzyme, immulectin-2 and a novel lepidopteran scavenger receptor are decreased in hemocytes of HdIV-injected caterpillars. This was confirmed by quantitative RT-PCR analysis but not observed after injection of heat-inactivated HdIV. Conversely, an increased level of transcripts was found for a galactose-binding lectin and, surprisingly, for the prophenoloxidase subunits. The results obtained suggest that HdIV injection affects transcript levels of genes encoding different components of the host immune response (non-self recognition, humoral and cellular responses. Conclusion This analysis of the

  4. rendimiento académico en estudiantes de secundaria

    Directory of Open Access Journals (Sweden)

    Francisco Javier Tejedor-Tejedor

    2008-01-01

    Full Text Available Este trabajo tenía como objetivos comprobar la relación entre variables atencionales y rendimiento académico en la Educación Secundaria Obligatoria y averiguar si el uso de estrategias atencionales varía en función de la edad, grado académico o género de los alumnos. Se aplicó la Escala de Estrategias de Aprendizaje (ACRA a una muestra de 602 sujetos, y se recogieron sus notas finales en junio. Los resultados confirman que las variables atencionales exploración, subrayado lineal, fragmentación y atención, son las que parecen influir más en el rendimiento académico. El análisis correlacional señala un ligero decremento en el uso de las estrategias atencionales a lo largo de esta etapa educativa; y las comparaciones por género, indican que las chicas las utilizan más frecuentemente.

  5. Calidad de los programas académicos.

    Directory of Open Access Journals (Sweden)

    Ángela María Duque

    2009-11-01

    Full Text Available Se presenta una mirada global al proceso de autoevaluación y autorregulación con fines a la acreditación del Programa Académico de Odontología de la Facultad de Salud de la Universidad del Valle, según el modelo propuesto por el Consejo Nacional de Acreditación (CNA. Este modelo se fundamenta en el análisis de los siguientes factores: proyecto institucional, procesos académicos, estudiantes y profesores, bienestar institucional, organización, administración y gestión, egresados e impacto sobre el medio y recursos físicos y financieros. Con base en los análisis documentales de la institución y del programa académico y de los diferentes estamentos comprometidos (estudiantes, profesores, directivos, personal no docente, egresados y empleadores, se precisan los aspectos más relevantes que dieron como resultado la expedición del acto de acreditación, mediante Resolución 1650 del 26 de julio de 2001 del Ministerio de Educación Nacional.

  6. Differential stress responses among newly received calves: variations in reductant capacity and Hsp gene expression

    OpenAIRE

    Eitam, Harel; Vaya, Jacob; Brosh, Arieh; Orlov, Ala; Khatib, Soliman; Izhaki, Ido; Shabtay, Ariel

    2010-01-01

    Bovine respiratory disease complex (BRD), a major economic concern to the beef cattle industry all over the world, is triggered by physical, biological and psychological stresses. It is becoming noticeable that the key to reducing BRD appears to be centered at reducing the response to stress. The aims of the present study were to detect individual variations in the stress response of newly received young calves through their leukocyte heat shock protein (Hsp) response, selected neutrophil-rel...

  7. Association of ABO and Colton Blood Group Gene Polymorphisms With Hematological Traits Variation

    OpenAIRE

    Shahbazi, Shirin; Mashayekhi, Amir; Fatahi, Neda; Mahdavi, Mohammad-Reza

    2015-01-01

    Abstract Hematological parameters are appraised routinely to determine overall human health and to diagnose and monitor certain diseases. In GWASs, more than 30 loci carrying common deoxyribonucleic acid (DNA) polymorphisms have been identified related to hematological traits. In this study, we investigated the contribution of ABO rs2073823 along with AQP1 rs1049305 and rs10244884 polymorphisms in hematological traits variation in a cohort of Iranian healthy individuals. Genomic DNA was extra...

  8. Human MAMLD1 Gene Variations Seem Not Sufficient to Explain a 46,XY DSD Phenotype.

    Directory of Open Access Journals (Sweden)

    Núria Camats

    Full Text Available MAMLD1 is thought to cause disordered sex development in 46,XY patients. But its role is controversial because some MAMLD1 variants are also detected in normal individuals, several MAMLD1 mutations have wild-type activity in functional tests, and the male Mamld1-knockout mouse has normal genitalia and reproduction. Our aim was to search for MAMLD1 variations in 108 46,XY patients with disordered sex development, and to test them functionally. We detected MAMDL1 variations and compared SNP frequencies in controls and patients. We tested MAMLD1 transcriptional activity on promoters involved in sex development and assessed the effect of MAMLD1 on androgen production. MAMLD1 expression in normal steroid-producing tissues and mutant MAMLD1 protein expression were also assessed. Nine MAMLD1 mutations (7 novel were characterized. In vitro, most MAMLD1 variants acted similarly to wild type. Only the L210X mutation showed loss of function in all tests. We detected no effect of wild-type or MAMLD1 variants on CYP17A1 enzyme activity in our cell experiments, and Western blots revealed no significant differences for MAMLD1 protein expression. MAMLD1 was expressed in human adult testes and adrenals. In conclusion, our data support the notion that MAMLD1 sequence variations may not suffice to explain the phenotype in carriers and that MAMLD1 may also have a role in adult life.

  9. AHSG gene variation is not associated with regional body fat distribution--a magnetic resonance study.

    Science.gov (United States)

    Müssig, K; Staiger, H; Machicao, F; Machann, J; Hennige, A M; Schick, F; Claussen, C D; Fritsche, A; Häring, H-U; Stefan, N

    2009-09-01

    Obesity-resistance in AHSG-knockout mice indicate an important role of alpha2-Heremans-Schmid glycoprotein/fetuin-A (AHSG) in the development of obesity. We studied whether genetic variation within AHSG affects whole-body adiposity and regional fat distribution in humans. We genotyped 321 subjects at increased risk for type 2 diabetes for five single nucleotide polymorphisms (SNP) rs2248690, rs4831, rs2070635, rs4917, and rs1071592. Body fat distribution and ectopic hepatic and intramyocellular lipids were assessed by magnetic resonance techniques. AHSG levels were determined by immunoturbidimetry. The five chosen SNPs covered 100% of common genetic variation (minor allele frequency >/=0.05) within AHSG (r (2)>/=0.8). All SNPs were significantly associated with AHSG levels (pbody mass index (BMI). AHSG levels were associated with liver fat content (p=0.0160) and BMI (p=0.0247) after adjustment for gender and age. While rs2248690 was nominally associated with BMI in the dominant model (p=0.0432), none of the SNPs was associated with regional fat distribution. Common genetic variation within AHSG does not appear to influence regional body fat distribution, but may affect whole-body adiposity in humans.

  10. Human MAMLD1 Gene Variations Seem Not Sufficient to Explain a 46,XY DSD Phenotype

    Science.gov (United States)

    Audí, Laura; Mullis, Primus E.; Moreno, Francisca; González Casado, Isabel; López-Siguero, Juan Pedro; Corripio, Raquel; Bermúdez de la Vega, José Antonio; Blanco, José Antonio; Flück, Christa E.

    2015-01-01

    MAMLD1 is thought to cause disordered sex development in 46,XY patients. But its role is controversial because some MAMLD1 variants are also detected in normal individuals, several MAMLD1 mutations have wild-type activity in functional tests, and the male Mamld1-knockout mouse has normal genitalia and reproduction. Our aim was to search for MAMLD1 variations in 108 46,XY patients with disordered sex development, and to test them functionally. We detected MAMDL1 variations and compared SNP frequencies in controls and patients. We tested MAMLD1 transcriptional activity on promoters involved in sex development and assessed the effect of MAMLD1 on androgen production. MAMLD1 expression in normal steroid-producing tissues and mutant MAMLD1 protein expression were also assessed. Nine MAMLD1 mutations (7 novel) were characterized. In vitro, most MAMLD1 variants acted similarly to wild type. Only the L210X mutation showed loss of function in all tests. We detected no effect of wild-type or MAMLD1 variants on CYP17A1 enzyme activity in our cell experiments, and Western blots revealed no significant differences for MAMLD1 protein expression. MAMLD1 was expressed in human adult testes and adrenals. In conclusion, our data support the notion that MAMLD1 sequence variations may not suffice to explain the phenotype in carriers and that MAMLD1 may also have a role in adult life. PMID:26580071

  11. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    NARCIS (Netherlands)

    Chornokur, G.; Lin, H.Y.; Tyrer, J.P.; Lawrenson, K.; Dennis, J.; Amankwah, E.K.; Qu, X.; Tsai, Y.Y.; Jim, H.S.; Chen, Z.; Chen, A.Y.; Permuth-Wey, J.; Aben, K.; Anton-Culver, H.; Antonenkova, N.; Bruinsma, F.; Bandera, E.V.; Bean, Y.T.; Beckmann, M.W.; Bisogna, M.; Bjorge, L.; Bogdanova, N.; Brinton, L.A.; Brooks-Wilson, A.; Bunker, C.H.; Butzow, R.; Campbell, I.G.; Carty, K.; Chang-Claude, J.; Cook, L.S.; Cramer, D.W; Cunningham, J.M.; Cybulski, C.; Dansonka-Mieszkowska, A.; Bois, A. du; Despierre, E.; Dicks, E.; Doherty, J.A.; Dork, T.; Durst, M.; Easton, D.F.; Eccles, D.M.; Edwards, R.P.; Ekici, A.B.; Fasching, P.A.; Fridley, B.L.; Gao, Y.T.; Gentry-Maharaj, A.; Giles, G.G.; Glasspool, R.; Goodman, M.T.; Gronwald, J.; Harrington, P.; Harter, P.; Hein, A.; Heitz, F.; Hildebrandt, M.A.T.; Hillemanns, P.; Hogdall, C.K.; Hogdall, E.; Hosono, S.; Jakubowska, A.; Jensen, A.; Ji, B.T.; Karlan, B.Y.; Kelemen, L.E.; Kellar, M.; Kiemeney, L.A.L.M.; Krakstad, C.; Kjaer, S.K.; Kupryjanczyk, J.; Lambrechts, D.; Lambrechts, S.; Le, N.D.; Lee, A.W.; Lele, S.; Leminen, A.; Lester, J.; Levine, D.A.; Liang, D.; Lim, B.K.; Lissowska, J.; Lu, K.; Lubinski, J.; Lundvall, L.; Massuger, L.F.A.G.; Matsuo, K.; McGuire, V.; McLaughlin, J.R.; McNeish, I.; Menon, U.; Milne, R.L.; Modugno, F.; Moysich, K.B.; Ness, R.B.; Nevanlinna, H.; Eilber, U.; Odunsi, K.; Olson, S.H.; Orlow, I., et al.

    2015-01-01

    BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As

  12. Genetic variation of the prion protein gene (PRNP) in alpaca (Vicugna pacos)

    Science.gov (United States)

    Transmissible spongiform encephalopathies (TSE) are caused by accumulation of a misfolded form of the prion protein (PrP). The normal cellular isoform of PrP is produced by the prion gene (PRNP) and is highly expressed in the central nervous system. Currently, there is an absence of information rega...

  13. Dopamine Receptor D4 Gene Variation Predicts Preschoolers' Developing Theory of Mind

    Science.gov (United States)

    Lackner, Christine; Sabbagh, Mark A.; Hallinan, Elizabeth; Liu, Xudong; Holden, Jeanette J. A.

    2012-01-01

    Individual differences in preschoolers' understanding that human action is caused by internal mental states, or representational theory of mind (RTM), are heritable, as are developmental disorders such as autism in which RTM is particularly impaired. We investigated whether polymorphisms of genes affecting dopamine (DA) utilization and metabolism…

  14. Genetic variation in genes of the fatty acid synthesis pathway and breast cancer risk

    NARCIS (Netherlands)

    Campa, Daniele; McKay, James; Sinilnikova, Olga; Huesing, Anika; Vogel, Ulla; Hansen, Rikke Dalgaard; Overvad, Kim; Witt, Petra Mariann; Clavel-Chapelon, Francoise; Boutron-Ruault, Marie-Christine; Chajes, Veronique; Rohrmann, Sabine; Chang-Claude, Jenny; Boeing, Heiner; Fisher, Eva; Trichopoulou, Antonia; Trichopoulos, Dimitrios; Palli, Domenico; Villarini, Anna; Sacerdote, Carlotta; Mattiello, Amalia; Tumino, Rosario; Peeters, Petra H. M.; van Gils, Carla H.; Bueno-de-Mesquita, H. Bas; Lund, Eiliv; Dolores Chirlaque, Maria; Sala, Nuria; Rodriguez Suarez, Laudina; Barricarte, Aurelio; Dorronsoro, Miren; Sanchez, Maria-Jose; Lenner, Per; Hallmans, Goeran; Tsilidis, Kostas; Bingham, Sheila; Khaw, Kay-Tee; Gallo, Valentina; Norat, Teresa; Riboli, Elio; Rinaldi, Sabina; Lenoir, Gilbert; Tavtigian, Sean V.; Canzian, Federico; Kaaks, Rudolf

    2009-01-01

    Fatty acid synthase (FAS) is the major enzyme of lipogenesis. It catalyzes the NADPH-dependent condensation of acetyl-CoA and malonyl-CoA to produce palmitic acid. Transcription of the FAS gene is controlled synergistically by the transcription factors ChREBP (carbohydrate response element-binding p

  15. Variation in the purinergic P2RX(7) receptor gene and schizophrenia

    DEFF Research Database (Denmark)

    Hansen, Thomas; Jakobsen, Klaus D; Fenger, Mogens;

    2008-01-01

    The purinergic receptor gene P2RX(7) is located in a major linkage hotspot for schizophrenia and bipolar disorders, 12q21-33. It has previously been associated with bipolar disorder but has never been analysed in relation to schizophrenia, although it is involved in several neuronal processes...

  16. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    DEFF Research Database (Denmark)

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P

    2015-01-01

    BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. ...

  17. Genetic Variation in the Leptin Receptor Gene, Leptin, and Weight Gain in Young Dutch Adults

    NARCIS (Netherlands)

    Rossum, van C.T.M.; Hoebee, B.; Baak, van M.A.; Mars, M.; Saris, W.H.M.; Seidell, J.C.

    2003-01-01

    Objective: To investigate the association between leptin levels, polymorphisms in the leptin receptor (LEPR) gene, and weight gain. Research Methods and Procedures: From two large prospective cohorts in The Netherlands (n = 17, 500), we compared the baseline leptin of 259 subjects who had gained an

  18. Proteomic changes resulting from gene copy number variations in cancer cells.

    Directory of Open Access Journals (Sweden)

    Tamar Geiger

    2010-09-01

    Full Text Available Along the transformation process, cells accumulate DNA aberrations, including mutations, translocations, amplifications, and deletions. Despite numerous studies, the overall effects of amplifications and deletions on the end point of gene expression--the level of proteins--is generally unknown. Here we use large-scale and high-resolution proteomics combined with gene copy number analysis to investigate in a global manner to what extent these genomic changes have a proteomic output and therefore the ability to affect cellular transformation. We accurately measure expression levels of 6,735 proteins and directly compare them to the gene copy number. We find that the average effect of these alterations on the protein expression is only a few percent. Nevertheless, by using a novel algorithm, we find the combined impact that many of these regional chromosomal aberrations have at the protein level. We show that proteins encoded by amplified oncogenes are often overexpressed, while adjacent amplified genes, which presumably do not promote growth and survival, are attenuated. Furthermore, regulation of biological processes and molecular complexes is independent of general copy number changes. By connecting the primary genome alteration to their proteomic consequences, this approach helps to interpret the data from large-scale cancer genomics efforts.

  19. Variations in estrogen receptor ? gene and risk of dementia, and brain volumes on MRI.

    NARCIS (Netherlands)

    S.C.E. Schuit (Stephanie); A. Hofman (Albert); P.J. Koudstaal (Peter Jan); C.M. van Duijn (Cock); A.G. Uitterlinden (André); H.A.P. Pols (Huib); M.M.B. Breteler (Monique); J.B.J. van Meurs (Joyce); T. den Heijer (Tom)

    2004-01-01

    textabstractThe role of estrogens in Alzheimer's disease (AD) is controversial. We investigated the association between well-recognized, and potentially functional, polymorphisms in the estrogen receptor (ER) gene and the risk of AD in a prospective study of 6056 Caucasian older men and women aged

  20. CNTNAP2 gene dosage variation is associated with schizophrenia and epilepsy

    NARCIS (Netherlands)

    Friedman, J. I.; Vrijenhoek, T.; Markx, S.; Janssen, I. M.; Van der Vliet, W. A.; Faas, B. H. W.; Knoers, N. V.; Cahn, W.; Kahn, R. S.; Edelmann, L.; Davis, K. L.; Silverman, J. M.; Brunner, H. G.; Van Kessel, A. Geurts; Wijmenga, C.; Ophoff, R. A.; Veltman, J. A.

    2008-01-01

    A homozygous mutation of the CNTNAP2 gene has been associated with a syndrome of focal epilepsy, mental retardation, language regression and other neuropsychiatric problems in children of the Old Order Amish community. Here we report genomic rearrangements resulting in haploinsufficiency of the CNTN

  1. Regulatory gene mutation: a driving force behind group a Streptococcus strain- and serotype-specific variation.

    Science.gov (United States)

    Sarkar, Poulomee; Sumby, Paul

    2017-02-01

    Data from multiple bacterial pathogens are consistent with regulator-encoding genes having higher mutation frequencies than the genome average. Such mutations drive both strain- and type- (e.g., serotype, haplotype) specific phenotypic heterogeneity, and may challenge public health due to the potential of variants to circumvent established treatment and/or preventative regimes. Here, using the human bacterial pathogen the group A Streptococcus (GAS; S. pyogenes) as a model organism, we review the types and regulatory-, phenotypic-, and disease-specific consequences of naturally occurring regulatory gene mutations. Strain-specific regulator mutations that will be discussed include examples that transform isolates into hyper-invasive forms by enhancing expression of immunomodulatory virulence factors, and examples that promote asymptomatic carriage of the organism. The discussion of serotype-specific regulator mutations focuses on serotype M3 GAS isolates, and how the identified rewiring of regulatory networks in this serotype may be contributing to a decades old epidemiological association of M3 isolates with particularly severe invasive infections. We conclude that mutation plays an outsized role in GAS pathogenesis and has clinical relevance. Given the phenotypic variability associated with regulatory gene mutations, the rapid examination of these genes in infecting isolates may inform with respect to potential patient complications and treatment options.

  2. Interspecies variation reveals a conserved repressor of alpha-specific genes in Saccharomyces yeasts.

    Science.gov (United States)

    Zill, Oliver A; Rine, Jasper

    2008-06-15

    The mating-type determination circuit in Saccharomyces yeast serves as a classic paradigm for the genetic control of cell type in all eukaryotes. Using comparative genetics, we discovered a central and conserved, yet previously undetected, component of this genetic circuit: active repression of alpha-specific genes in a cells. Upon inactivation of the SUM1 gene in Saccharomyces bayanus, a close relative of Saccharomyces cerevisiae, a cells acquired mating characteristics of alpha cells and displayed autocrine activation of their mating response pathway. Sum1 protein bound to the promoters of alpha-specific genes, repressing their transcription. In contrast to the standard model, alpha1 was important but not required for alpha-specific gene activation and mating of alpha cells in the absence of Sum1. Neither Sum1 protein expression, nor its association with target promoters was mating-type-regulated. Thus, the alpha1/Mcm1 coactivators did not overcome repression by occluding Sum1 binding to DNA. Surprisingly, the mating-type regulatory function of Sum1 was conserved in S. cerevisiae. We suggest that a comprehensive understanding of some genetic pathways may be best attained through the expanded phenotypic space provided by study of those pathways in multiple related organisms.

  3. Investigating the potential role of genetic and epigenetic variation of DNA methyltransferase genes in hyperplastic polyposis syndrome.

    Directory of Open Access Journals (Sweden)

    Musa Drini

    Full Text Available BACKGROUND: Hyperplastic Polyposis Syndrome (HPS is a condition associated with multiple serrated polyps, and an increased risk of colorectal cancer (CRC. At least half of CRCs arising in HPS show a CpG island methylator phenotype (CIMP, potentially linked to aberrant DNA methyltransferase (DNMT activity. CIMP is associated with methylation of tumor suppressor genes including regulators of DNA mismatch repair (such as MLH1, MGMT, and negative regulators of Wnt signaling (such as WIF1. In this study, we investigated the potential for interaction of genetic and epigenetic variation in DNMT genes, in the aetiology of HPS. METHODS: We utilized high resolution melting (HRM analysis to screen 45 cases with HPS for novel sequence variants in DNMT1, DNMT3A, DNMT3B, and DNMT3L. 21 polyps from 13 patients were screened for BRAF and KRAS mutations, with assessment of promoter methylation in the DNMT1, DNMT3A, DNMT3B, DNMT3L MLH1, MGMT, and WIF1 gene promoters. RESULTS: No pathologic germline mutations were observed in any DNA-methyltransferase gene. However, the T allele of rs62106244 (intron 10 of DNMT1 gene was over-represented in cases with HPS (p<0.01 compared with population controls. The DNMT1, DNMT3A and DNMT3B promoters were unmethylated in all instances. Interestingly, the DNMT3L promoter showed low levels of methylation in polyps and normal colonic mucosa relative to matched disease free cells with methylation level negatively correlated to expression level in normal colonic tissue. DNMT3L promoter hypomethylation was more often found in polyps harbouring KRAS mutations (p = 0.0053. BRAF mutations were common (11 out of 21 polyps, whilst KRAS mutations were identified in 4 of 21 polyps. CONCLUSIONS: Genetic or epigenetic alterations in DNMT genes do not appear to be associated with HPS, but further investigation of genetic variation at rs62106244 is justified given the high frequency of the minor allele in this case series.

  4. Expression of flavonoid biosynthesis genes vis-à-vis rutin content variation in different growth stages of Fagopyrum species.

    Science.gov (United States)

    Gupta, Nidhi; Sharma, Sunil K; Rana, Jai C; Chauhan, Rajinder S

    2011-11-15

    Buckwheat is one of the field crops with the highest concentration of rutin, an important flavonoid of medicinal value. Two species of buckwheat, Fagopyrum esculentum and Fagopyrum tataricum, are the major sources of rutin. Seeds of latter contain 40-50× higher rutin compared to the former. The physiological and molecular bases of rutin content variation between Fagopyrum species are not known. The current study investigated the differences in rutin content in seeds and in other tissues and growth stages of two Fagopyrum species, and also correlated those differences with the expression of flavonoid pathway genes. The analysis of rutin content dynamics at different growth stages, S1-S9 (from seed germination to mature seed formation) of Fagopyrum species revealed that rutin content was higher during seedling stages of F. tataricum (3.5 to 4.6-fold) compared to F. esculentum and then increased exponentially from stages S3 to S6 (different leaf maturing stages and inflorescence) of F. esculentum, whereas it fluctuated in F. tataricum. The rutin content was highest in the inflorescence stage (S6) of both species, with a relatively higher biosynthesis and accumulation during post-flowering stages of F. tataricum compared to F. esculentum. The expression of flavonoid pathway genes, through qRT-PCR, in different growth stages vis-à-vis rutin content variation showed differential expression for four genes, PAL, CHS, CHI and FLS with the amounts of transcripts relatively higher in F. tataricum compared to F. esculentum, thereby, correlating these genes with the biosynthesis and accumulation of rutin. The expression of PAL was highest, 7.69 and 8.96-fold in Stages 2 (seedling stage) and 9 (fully developed seeds) of F. tataricum compared to F. esculentum, respectively. The expression of the CHS gene correlated with the rutin content because it was highest in the flowers (S6) and fully developed seeds (S9) of both Fagopyrum species, with relatively higher transcript amounts

  5. Mechanism and Effect of Temperature on Variations in Antibiotic Resistance Genes during Anaerobic Digestion of Dairy Manure

    Science.gov (United States)

    Sun, Wei; Qian, Xun; Gu, Jie; Wang, Xiao-Juan; Duan, Man-Li

    2016-07-01

    Animal manure comprises an important reservoir for antibiotic resistance genes (ARGs), but the variation in ARGs during anaerobic digestion at various temperatures and its underlying mechanism remain unclear. Thus, we performed anaerobic digestion using dairy manure at three temperature levels (moderate: 20 °C, mesophilic: 35 °C, and thermophilic: 55 °C), to analyze the dynamics of ARGs and bacterial communities by quantitative PCR and 16S rRNA gene sequencing. We found that 8/10 detected ARGs declined and 5/10 decreased more than 1.0 log during thermophilic digestion, whereas only four and five ARGs decreased during moderate and mesophilic digestion, respectively. The changes in ARGs and bacterial communities were similar under the moderate and mesophilic treatments, but distinct from those in the thermophilic system. Potential pathogens such as Bacteroidetes, Proteobacteria, and Corynebacterium were removed by thermophilic digestion but not by moderate and mesophilic digestion. The bacterial community succession was the dominant mechanism that influenced the variation in ARGs and integrons during anaerobic digestion. Thermophilic digestion decreased the amount of mesophilic bacteria (Bacteroidetes and Proteobacteria) carrying ARGs. Anaerobic digestion generally decreased the abundance of integrons by eliminating the aerobic hosts of integrons (Actinomycetales and Bacilli). Thermophilic anaerobic digestion is recommended for the treatment and reuse of animal manure.

  6. Variations among Japanese of the factor IX gene (F9) detected by PCR-denaturing gradient gel electrophoresis

    Energy Technology Data Exchange (ETDEWEB)

    Satoh, Chiyoko; Takahashi, Norio; Asakawa, Junichi; Hiyama, Keiko; Kodaira, Meiko (Radiation Effects Research Foundation, Hiroshima (Japan))

    1993-01-01

    In the course of feasibility studies to examine the efficiencies and practicalities of various techniques for screening for genetic variations, the human coagulation factor IX (F9) genes of 63 Japanese families were examined by PCR-denaturing gradient gel electrophoresis (PCR-DGGE). Four target sequences with lengths of 983-2,891 bp from the F9 genes of 126 unrelated individuals from Hiroshima and their 100 children were amplified by PCR, digested with restriction enzymes to approximately 500-bp fragments, and examined by DGGE - a total of 6,724 bp being examined per individual. GC-rich sequences (GC-clamps) of 40 bp were attached to both ends of the target sequences, as far as was feasible. Eleven types of new nucleotide substitutions were detected in the population, none of which produced RFLPs or caused hemophilia B. By examining two target sequences in a single lane, approximately 8,000 bp in a diploid individual could be examined. This approach is very effective for the detection of variations in DNA and is applicable to large-scale population studies. 46 refs., 3 figs., 1 tab.

  7. Mechanism and Effect of Temperature on Variations in Antibiotic Resistance Genes during Anaerobic Digestion of Dairy Manure.

    Science.gov (United States)

    Sun, Wei; Qian, Xun; Gu, Jie; Wang, Xiao-Juan; Duan, Man-Li

    2016-07-22

    Animal manure comprises an important reservoir for antibiotic resistance genes (ARGs), but the variation in ARGs during anaerobic digestion at various temperatures and its underlying mechanism remain unclear. Thus, we performed anaerobic digestion using dairy manure at three temperature levels (moderate: 20 °C, mesophilic: 35 °C, and thermophilic: 55 °C), to analyze the dynamics of ARGs and bacterial communities by quantitative PCR and 16S rRNA gene sequencing. We found that 8/10 detected ARGs declined and 5/10 decreased more than 1.0 log during thermophilic digestion, whereas only four and five ARGs decreased during moderate and mesophilic digestion, respectively. The changes in ARGs and bacterial communities were similar under the moderate and mesophilic treatments, but distinct from those in the thermophilic system. Potential pathogens such as Bacteroidetes, Proteobacteria, and Corynebacterium were removed by thermophilic digestion but not by moderate and mesophilic digestion. The bacterial community succession was the dominant mechanism that influenced the variation in ARGs and integrons during anaerobic digestion. Thermophilic digestion decreased the amount of mesophilic bacteria (Bacteroidetes and Proteobacteria) carrying ARGs. Anaerobic digestion generally decreased the abundance of integrons by eliminating the aerobic hosts of integrons (Actinomycetales and Bacilli). Thermophilic anaerobic digestion is recommended for the treatment and reuse of animal manure.

  8. Common polymorphic variation in the genetically diverse African insulin gene and its association with size at birth.

    Science.gov (United States)

    Petry, Clive J; Rayco-Solon, Pura; Fulford, Anthony J C; Stead, John D H; Wingate, Dianne L; Ong, Ken K; Sirugo, Giorgio; Prentice, Andrew M; Dunger, David B

    2009-09-01

    The insulin variable number of tandem repeats (INS VNTR) has been variably associated with size at birth in non-African populations. Small size at birth is a major determinant of neonatal mortality, so the INS VNTR may influence survival. We tested the hypothesis, therefore, that genetic variation around the INS VNTR in a rural Gambian population, who experience seasonal variation in nutrition and subsequently birth weight, may be associated with foetal and early growth. Six polymorphisms flanking the INS VNTR were genotyped in over 2,500 people. Significant associations were detected between the maternally inherited SNP 27 (rs689) allele and birth length [effect size 17.5 (5.2-29.8) mm; P = 0.004; n = 361]. Significant associations were also found between the maternally inherited African-specific SNP 28 (rs5506) allele and post-natal weight gain [effect size 0.19 (0.05-0.32) z score points/year; P = 0.005; n = 728). These results suggest that in the Gambian population studied there are associations between polymorphic variation in the genetically diverse INS gene and foetal and early growth characteristics, which contribute to overall polygenic associations with these traits.

  9. Gene expression variation between distinct areas of breast cancer measured from paraffin-embedded tissue cores

    Directory of Open Access Journals (Sweden)

    Gugger Mathias

    2008-11-01

    Full Text Available Abstract Background Diagnosis and prognosis in breast cancer are mainly based on histology and immunohistochemistry of formalin-fixed, paraffin-embedded (FFPE material. Recently, gene expression analysis was shown to elucidate the biological variance between tumors and molecular markers were identified that led to new classification systems that provided better prognostic and predictive parameters. Archived FFPE samples represent an ideal source of tissue for translational research, as millions of tissue blocks exist from routine diagnostics and from clinical studies. These should be exploited to provide clinicians with more accurate prognostic and predictive information. Unfortunately, RNA derived from FFPE material is partially degraded and chemically modified and reliable gene expression measurement has only become successful after implementing novel and optimized procedures for RNA isolation, demodification and detection. Methods In this study we used tissue cylinders as known from the construction of tissue microarrays. RNA was isolated with a robust protocol recently developed for RNA derived from FFPE material. Gene expression was measured by quantitative reverse transcription PCR. Results Sixteen tissue blocks from 7 patients diagnosed with multiple histological subtypes of breast cancer were available for this study. After verification of appropriate localization, sufficient RNA yield and quality, 30 tissue cores were available for gene expression measurement on TaqMan® Low Density Arrays (16 invasive ductal carcinoma (IDC, 8 ductal carcinoma in situ (DCIS and 6 normal tissue, and 14 tissue cores were lost. Gene expression values were used to calculate scores representing the proliferation status (PRO, the estrogen receptor status and the HER2 status. The PRO scores measured from entire sections were similar to PRO scores determined from IDC tissue cores. Scores determined from normal tissue cores consistently revealed lower PRO scores

  10. Genetic variation in the Catechol-O-Methyltransferase (COMT gene and morphine requirements in cancer patients with pain

    Directory of Open Access Journals (Sweden)

    Kaasa Stein

    2008-12-01

    Full Text Available Abstract Background Genetic variation contributes to differences in pain sensitivity and response to different analgesics. Catecholamines are involved in the modulation of pain and are partly metabolized by the catechol-O-methyltransferase (COMT enzyme. Genetic variability in the COMT gene may therefore contribute to differences in pain sensitivity and response to analgesics. It is shown that a polymorphism in the COMT gene, Rs4680 (Val158Met, influence pain sensitivity in human experimental pain and the efficacy for morphine in cancer pain treatment. In this study we wanted to investigate if variability in other regions in the COMT gene also contributes to interindividual variability in morphine efficacy. Results We genotyped 11 single nucleotide polymorphisms (SNPs throughout the COMT gene, and constructed haplotypes from these 11 SNPs, which were in Hardy-Weinberg equilibrium. We compared both genotypes and haplotypes against pharmacological, demographical and patient symptoms measurements in a Caucasian cancer patient cohort (n = 197 receiving oral morphine treatment for cancer pain. There were two frequent haplotypes (34.5% and 17.8% in our cohort. Multivariate analyses showed that patients carrying the most frequent haplotype (34.5% needed lower morphine doses than patients not carrying the haplotype, with a reduction factor of 0.71 (p = 0.005. On the allele level, carriers of alleles for six of the SNPs show weak associations in respect to morphine dose and the alleles associated with the lowest morphine doses constitute part of the most frequent haplotype. Conclusion This study suggests that genetic variability in the COMT gene influence the efficacy of morphine in cancer patients with pain, and that increased understanding of this variability is reached by expanding from analyses of single SNPs to haplotype construction and analyses.

  11. Variation in genes that regulate blood pressure are associated with glomerular filtration rate in Chinese.

    Directory of Open Access Journals (Sweden)

    May E Montasser

    Full Text Available Chronic kidney disease (CKD can be a consequence of diabetes, hypertension, immunologic disorders, and other exposures, as well as genetic factors that are still largely unknown. Glomerular filtration rate (GFR, which is widely used to measure kidney function, has a heritability ranging from 25% to 75%, but only 1.5% of this heritability is explained by genetic loci that have been identified to date. In this study we tested for associations between GFR and 234 SNPs in 26 genes from pathways of blood pressure regulation in 3,025 rural Chinese participants of the "Genetic Epidemiology Network of Salt Sensitivity" (GenSalt study. We estimated GFR (eGFR using baseline serum creatinine measurements obtained prior to dietary intervention. We identified significant associations between eGFR and 12 SNPs in 6 genes (ACE, ADD1, AGT, GRK4, HSD11B1, and SCNN1G. The cumulative effect of the protective alleles was an increase in mean eGFR of 4 mL/min per 1.73 m2, while the cumulative effect of the risk alleles was a decrease in mean eGFR of 3 mL/min per 1.73 m2. In addition, we identified a significant interaction between SNPs in CYP11B1 and ADRB2. We have identified common variants in genes from pathways that regulate blood pressure and influence kidney function as measured by eGFR, providing new insights into the genetic determinants of kidney function. Complex genetic effects on kidney function likely involve interactions among genes as we observed for CYP11B1 and ADRB2.

  12. Variation in the ICAM1 gene is not associated with severe malaria phenotypes

    OpenAIRE

    Fry, Andrew E.; Auburn, Sarah; Diakite, Mahamadou; Green, Angela; Richardson, Anna; Wilson, Jonathan; Jallow, Muminatou; Sisay-Joof, Fatou; Pinder, Margaret; Griffiths, Michael J.; Peshu, Norbert; Williams, Thomas N.; Marsh, Kevin; Malcolm E Molyneux; Taylor, Terrie E.

    2008-01-01

    Evidence from autopsy, mouse-model and in vitro binding studies suggests that adhesion of erythrocytes infected with Plasmodium falciparum to the human host intercellular adhesion molecule (ICAM)-1 receptor is important in the pathogenesis of severe malaria. Previous association studies between polymorphisms around the ICAM1 gene and susceptibility to severe malarial phenotypes have been inconclusive and often contradictory. We performed genetic association studies with 15 single-nucleotide-p...

  13. Seasonal Variations in Antibiotic Resistance Gene Transport in the Almendares River, Havana, Cuba

    OpenAIRE

    Knapp, Charles W.; Lazaro eLima; Susana eOlivares-Rieumont; Emma eBowen; David eWerner; David W eGraham

    2012-01-01

    Numerous studies have quantified antibiotic resistance genes (ARG) in rivers and streams around the world, and significant relationships have been shown that relate different pollutant outputs and increased local ARG levels. However, most studies have not considered ambient flow conditions, which can vary dramatically especially in tropical countries. Here, ARG were quantified in water column and sediment samples during the dry- and wet-seasons to assess how seasonal and other factors influen...

  14. Disease progression in Plasmodium knowlesi malaria is linked to variation in invasion gene family members.

    Directory of Open Access Journals (Sweden)

    Atique M Ahmed

    2014-08-01

    Full Text Available Emerging pathogens undermine initiatives to control the global health impact of infectious diseases. Zoonotic malaria is no exception. Plasmodium knowlesi, a malaria parasite of Southeast Asian macaques, has entered the human population. P. knowlesi, like Plasmodium falciparum, can reach high parasitaemia in human infections, and the World Health Organization guidelines for severe malaria list hyperparasitaemia among the measures of severe malaria in both infections. Not all patients with P. knowlesi infections develop hyperparasitaemia, and it is important to determine why. Between isolate variability in erythrocyte invasion, efficiency seems key. Here we investigate the idea that particular alleles of two P. knowlesi erythrocyte invasion genes, P. knowlesi normocyte binding protein Pknbpxa and Pknbpxb, influence parasitaemia and human disease progression. Pknbpxa and Pknbpxb reference DNA sequences were generated from five geographically and temporally distinct P. knowlesi patient isolates. Polymorphic regions of each gene (approximately 800 bp were identified by haplotyping 147 patient isolates at each locus. Parasitaemia in the study cohort was associated with markers of disease severity including liver and renal dysfunction, haemoglobin, platelets and lactate, (r = ≥ 0.34, p =  <0.0001 for all. Seventy-five and 51 Pknbpxa and Pknbpxb haplotypes were resolved in 138 (94% and 134 (92% patient isolates respectively. The haplotypes formed twelve Pknbpxa and two Pknbpxb allelic groups. Patients infected with parasites with particular Pknbpxa and Pknbpxb alleles within the groups had significantly higher parasitaemia and other markers of disease severity. Our study strongly suggests that P. knowlesi invasion gene variants contribute to parasite virulence. We focused on two invasion genes, and we anticipate that additional virulent loci will be identified in pathogen genome-wide studies. The multiple sustained entries of this diverse pathogen

  15. Disease progression in Plasmodium knowlesi malaria is linked to variation in invasion gene family members.

    Science.gov (United States)

    Ahmed, Atique M; Pinheiro, Miguel M; Divis, Paul C; Siner, Angela; Zainudin, Ramlah; Wong, Ing Tien; Lu, Chan Woon; Singh-Khaira, Sarina K; Millar, Scott B; Lynch, Sean; Willmann, Matthias; Singh, Balbir; Krishna, Sanjeev; Cox-Singh, Janet

    2014-08-01

    Emerging pathogens undermine initiatives to control the global health impact of infectious diseases. Zoonotic malaria is no exception. Plasmodium knowlesi, a malaria parasite of Southeast Asian macaques, has entered the human population. P. knowlesi, like Plasmodium falciparum, can reach high parasitaemia in human infections, and the World Health Organization guidelines for severe malaria list hyperparasitaemia among the measures of severe malaria in both infections. Not all patients with P. knowlesi infections develop hyperparasitaemia, and it is important to determine why. Between isolate variability in erythrocyte invasion, efficiency seems key. Here we investigate the idea that particular alleles of two P. knowlesi erythrocyte invasion genes, P. knowlesi normocyte binding protein Pknbpxa and Pknbpxb, influence parasitaemia and human disease progression. Pknbpxa and Pknbpxb reference DNA sequences were generated from five geographically and temporally distinct P. knowlesi patient isolates. Polymorphic regions of each gene (approximately 800 bp) were identified by haplotyping 147 patient isolates at each locus. Parasitaemia in the study cohort was associated with markers of disease severity including liver and renal dysfunction, haemoglobin, platelets and lactate, (r = ≥ 0.34, p =  <0.0001 for all). Seventy-five and 51 Pknbpxa and Pknbpxb haplotypes were resolved in 138 (94%) and 134 (92%) patient isolates respectively. The haplotypes formed twelve Pknbpxa and two Pknbpxb allelic groups. Patients infected with parasites with particular Pknbpxa and Pknbpxb alleles within the groups had significantly higher parasitaemia and other markers of disease severity. Our study strongly suggests that P. knowlesi invasion gene variants contribute to parasite virulence. We focused on two invasion genes, and we anticipate that additional virulent loci will be identified in pathogen genome-wide studies. The multiple sustained entries of this diverse pathogen into the human

  16. Metagenomic approach reveals variation of microbes with arsenic and antimony metabolism genes from highly contaminated soil.

    Science.gov (United States)

    Luo, Jinming; Bai, Yaohui; Liang, Jinsong; Qu, Jiuhui

    2014-01-01

    Microbes have great potential for arsenic (As) and antimony (Sb) bioremediation in heavily contaminated soil because they have the ability to biotransform As and Sb to species that have less toxicity or are more easily removed. In this study, we integrated a metagenomic method with physicochemical characterization to elucidate the composition of microbial community and functional genes (related to As and Sb) in a high As (range from 34.11 to 821.23 mg kg-1) and Sb (range from 226.67 to 3923.07 mg kg-1) contaminated mine field. Metagenomic analysis revealed that microbes from 18 phyla were present in the 5 samples of soil contaminated with high As and Sb. Moreover, redundancy analysis (RDA) of the relationship between the 18 phyla and the concentration of As and Sb demonstrated that 5 phyla of microbes, i.e. Actinobacteria, Firmicutes, Nitrospirae, Tenericutes and Gemmatimonadetes were positively correlated with As and Sb concentration. The distribution, diversity and abundance of functional genes (including arsC, arrA, aioA, arsB and ACR3) were much higher for the samples containing higher As and Sb concentrations. Based on correlation analysis, the results showed a positive relationship between arsC-like (R2 = 0.871) and aioA-like (R2 = 0.675) gene abundance and As concentration, and indicated that intracellular As(V) reduction and As(III) oxidation could be the dominant As detoxification mechanism enabling the microbes to survive in the environment. This study provides a direct and reliable reference on the diversity of microbial community and functional genes in an extremely high concentration As- and Sb-contaminated environment.

  17. Genetic variations and haplotype diversity of the UGT1 gene cluster in the Chinese population.

    Directory of Open Access Journals (Sweden)

    Jing Yang

    Full Text Available Vertebrates require tremendous molecular diversity to defend against numerous small hydrophobic chemicals. UDP-glucuronosyltransferases (UGTs are a large family of detoxification enzymes that glucuronidate xenobiotics and endobiotics, facilitating their excretion from the body. The UGT1 gene cluster contains a tandem array of variable first exons, each preceded by a specific promoter, and a common set of downstream constant exons, similar to the genomic organization of the protocadherin (Pcdh, immunoglobulin, and T-cell receptor gene clusters. To assist pharmacogenomics studies in Chinese, we sequenced nine first exons, promoter and intronic regions, and five common exons of the UGT1 gene cluster in a population sample of 253 unrelated Chinese individuals. We identified 101 polymorphisms and found 15 novel SNPs. We then computed allele frequencies for each polymorphism and reconstructed their linkage disequilibrium (LD map. The UGT1 cluster can be divided into five linkage blocks: Block 9 (UGT1A9, Block 9/7/6 (UGT1A9, UGT1A7, and UGT1A6, Block 5 (UGT1A5, Block 4/3 (UGT1A4 and UGT1A3, and Block 3' UTR. Furthermore, we inferred haplotypes and selected their tagSNPs. Finally, comparing our data with those of three other populations of the HapMap project revealed ethnic specificity of the UGT1 genetic diversity in Chinese. These findings have important implications for future molecular genetic studies of the UGT1 gene cluster as well as for personalized medical therapies in Chinese.

  18. Natural Variation Identifies ICARUS1, a Universal Gene Required for Cell Proliferation and Growth at High Temperatures in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Wangsheng Zhu

    2015-05-01

    Full Text Available Plants are highly sensitive to environmental changes and even small variations in ambient temperature have severe consequences on their growth and development. Temperature affects multiple aspects of plant development, but the processes and mechanisms underlying thermo-sensitive growth responses are mostly unknown. Here we exploit natural variation in Arabidopsis thaliana to identify and characterize novel components and processes mediating thermo-sensitive growth responses in plants. Phenotypic screening of wild accessions identified several strains displaying pleiotropic growth defects, at cellular and organism levels, specifically at high ambient temperatures. Positional cloning and characterization of the underlying gene revealed that ICARUS1 (ICA1, which encodes a protein of the tRNAHis guanylyl transferase (Thg1 superfamily, is required for plant growth at high temperatures. Transcriptome and gene marker analyses together with DNA content measurements show that ICA1 loss-of-function results in down regulation of cell cycle associated genes at high temperatures, which is linked with a block in G2/M transition and endoreduplication. In addition, plants with mutations in ICA1 show enhanced sensitivity to DNA damage. Characterization of additional strains that carry lesions in ICA1, but display normal growth, shows that alternative splicing is likely to alleviate the deleterious effects of some natural mutations. Furthermore, analyses of worldwide and regional collections of natural accessions indicate that ICA1 loss-of-function has arisen several times independently, and that these occur at high frequency in some local populations. Overall our results suggest that ICA1-mediated-modulation of fundamental processes such as tRNAHis maturation, modify plant growth responses to temperature changes in a quantitative and reversible manner, in natural populations.

  19. Genetic variation of the FMR1 gene among four Mexican populations: Mestizo, Huichol, Purepecha, and Tarahumara.

    Science.gov (United States)

    Barros-Núñez, Patricio; Rosales-Reynoso, Mónica Alejandra; Sandoval, Lucila; Romero-Espinoza, Pavel; Troyo-Sanromán, Rogelio; Ibarra, Bertha

    2008-01-01

    Fragile X syndrome is the most common cause of inherited mental retardation; it is caused by expansion of CGG repeats in the first exon of the FMR1 gene. The number of CGG repeats varies between 6 and 50 triplets in normal individuals; the most common alleles have 29 or 30 repeats. Allelic patterns in the global populations are similar; however; some reports show statistical differences among several populations. In Mexico, except by a single report on a western Mestizo population, the allelic frequencies of the FMR1 gene are unknown. In this study, we analyze 207, 140, 138, and 40 chromosomes from Mestizos, Tarahumaras, Huichols, and Purepechas respectively. After PCR amplification on DNA modified by sodium bisulfite treatment, molecular analysis of the FMR1 gene showed 30 different alleles among the 525 chromosomes evaluated. Trinucleotide repeat number in the different Mexican populations varied from 15 to 87, with modal numbers of 32 and 30 in Mestizos and Tarahumaras, 29 and 32 in Purepechas and 30 among Huichols. Together, these allelic patterns differ significantly from those reported for Caucasian, Chinese, African, Indonesian, Brazilian, and Chilean populations. The increased number of the unusual allele of 32 repeats observed in the Mexican mestizo population can be explained from its frequency in at least two Mexican native populations.

  20. Nicotinic Acetylcholine Receptor α4 Subunit Gene Variation Associated with Attention Deficit Hyperactivity Disorder

    Institute of Scientific and Technical Information of China (English)

    HUANG Xuezhu; XU Yong; LI Qianqian; LIU Pozi; YANG Yuan; ZHANG Fuquan; GUO Tianyou; YANG Chuang; GUO Lanting

    2009-01-01

    Previous pharmacological, human genetics, and animal models have implicated the nicotinic ace-tylcholine receptor a4 subunit (CHRNA4) gene in the pathogenesis of attention deficit/hyperactivity disorder (ADHD). The objective of this study is to examine the genetic association between single nucleotide poly-morphisms in the CHRNA4 gene (rs2273502, rs1044396, rs1044397, and rs3827020 loci) and ADHD. Both case-control and family-based designs are used. Children aged 6 to 16 years were interviewed and as-sessed with the children behavior checklist and the revised conner' parent rating scale to identify probands. No significant differences in the frequency distribution of genotypes or alleles were found between the case and control groups. However, further haplotype analyses showed the CCGG haplotype on dsk for ADHD in 164 case-control samples and the standard transmission disequilibrium test analyses suggest that the allele C of rs2273502 was over-transferred in 98 ADHD parent-offspring tdos. These findings suggest that the CHRNA4 gene may play a role in the pathogenesis of ADHD.

  1. Gene expression profiling in the Cynomolgus macaque Macaca fascicularis shows variation within the normal birth range

    Directory of Open Access Journals (Sweden)

    Vickers Mark H

    2011-10-01

    Full Text Available Abstract Background Although an adverse early-life environment has been linked to an increased risk of developing the metabolic syndrome, the molecular mechanisms underlying altered disease susceptibility as well as their relevance to humans are largely unknown. Importantly, emerging evidence suggests that these effects operate within the normal range of birth weights and involve mechanisms of developmental palsticity rather than pathology. Method To explore this further, we utilised a non-human primate model Macaca fascicularis (Cynomolgus macaque which shares with humans the same progressive history of the metabolic syndrome. Using microarray we compared tissues from neonates in the average birth weight (50-75th centile to those of lower birth weight (5-25th centile and studied the effect of different growth trajectories within the normal range on gene expression levels in the umbilical cord, neonatal liver and skeletal muscle. Results We identified 1973 genes which were differentially expressed in the three tissue types between average and low birth weight animals (P Conclusion These differences in gene expression levels between animals in the upper and lower percentiles of the normal birth weight range may point towards early life metabolic adaptations that in later life result in differences in disease risk.

  2. Mouse Models of Mutations and Variations in Autism Spectrum Disorder-Associated Genes: Mice Expressing Caps2/Cadps2 Copy Number and Alternative Splicing Variants

    Directory of Open Access Journals (Sweden)

    Tetsushi Sadakata

    2013-11-01

    Full Text Available Autism spectrum disorder (ASD is a neurodevelopmental disorder characterized by disturbances in interpersonal relationships and behavior. Although the prevalence of autism is high, effective treatments have not yet been identified. Recently, genome-wide association studies have identified many mutations or variations associated with ASD risk on many chromosome loci and genes. Identification of the biological roles of these mutations or variations is necessary to identify the mechanisms underlying ASD pathogenesis and to develop clinical treatments. At present, mice harboring genetic modifications of ASD-associated gene candidates are the best animal models to analyze hereditary factors involved in autism. In this report, the biological significance of ASD-associated genes is discussed by examining the phenotypes of mouse models with ASD-associated mutations or variations in mouse homologs, with a focus on mice harboring genetic modifications of the Caps2/Cadps2 (Ca2+-dependent activator protein for secretion 2 gene.

  3. Prediction model for sequence variation in the glycoprotein gene of infectious hematopoietic necrosis virus in California, U.S.A.

    Science.gov (United States)

    Kelley, Garry O; Garabed, Rebecca; Branscum, Adam; Perez, Andres; Thurmond, Mark

    2007-12-13

    The influence of spatio-temporal factors on genetic variation of infectious hematopoietic necrosis virus (IHNV) is an active area of research. Using host-isolate pairs collected from 1966 to 2004 for 237 IHNV isolates from California and southern Oregon, we examined genetic variation of the mid-G gene of IHNV that could be quantified across times and geographic locations. Information hypothesized to influence genetic variation was environmental and/or fish host demographic factors, viz. location (inland or coastal), year of isolation, habitat (river, lake, or hatchery), the agent factors of subgroup (LI or LII) and serotype (1, 2, or 3), and the host factors of fish age (juvenile or adult), sex (male or female), and season of spawning run (spring, fall, late fall, winter). Inverse distance weighting (IDW) was performed to create isopleth maps of the genetic distances of each subgroup. IDW maps showed that more genetic divergence was predicted for isolates found inland (for both subgroups: LI and LII) than for coastal watershed isolates. A mixed-effect beta regression with a logit link function was used to seek associations between genetic distances and hypothesized explanatory factors. The model that best described genetic distance contained the factors of location, year of isolation, and the interaction between location and year. Our model suggests that genetic distance was greater for isolates collected from 1966 to 2004 at inland locations than for isolates found in coastal watersheds during the same years. The agreement between the IDW and beta regression analyses quantitatively supports our conclusion that, during this time period, more genetic variation existed within subgroup LII in inland watersheds than within coastal LI isolates.

  4. The maintenance of genetic variation due to asymmetric gene flow in dendritic metapopulations.

    Science.gov (United States)

    Morrissey, Michael B; de Kerckhove, Derrick T

    2009-12-01

    Dendritic landscapes can have ecological properties that differ importantly from simpler spatial arrangements of habitats. Most dendritic landscapes are structured by elevation, and therefore, migration is likely to be directionally biased. While the population-genetic consequences of both dendritic landscape arrangements and asymmetric migration have begun to be studied, these processes have not been considered together. Simple conceptual models predict that if migration into branch (headwater) populations is limited, such populations can act as reservoirs for potentially unique alleles. As a consequence of the fact that dendritic landscapes have, by definition, more branches than internal habitat patches, this process may lead to the maintenance of higher overall genetic diversities in metapopulations inhabiting dendritic networks where migration is directionally biased. Here we begin to address the generality of these simple predictions using genetic models and a review of empirical literature. We show, for a range of demographic parameters, that dendritic systems with asymmetric migration can maintain levels of genetic variation that are very different, sometimes very elevated, compared with more classical models of geographical population structure. Furthermore, predicted patterns of genetic variation within metapopulations--that is, stepwise increases in genetic diversity at nodes--do occur in some empirical data.

  5. Genetic variation in the NBS1, MRE11, RAD50 and BLM genes and susceptibility to non-Hodgkin lymphoma

    Directory of Open Access Journals (Sweden)

    Gascoyne Randy D

    2009-11-01

    Full Text Available Abstract Background Translocations are hallmarks of non-Hodgkin lymphoma (NHL genomes. Because lymphoid cell development processes require the creation and repair of double stranded breaks, it is not surprising that disruption of this type of DNA repair can cause cancer. The members of the MRE11-RAD50-NBS1 (MRN complex and BLM have central roles in maintenance of DNA integrity. Severe mutations in any of these genes cause genetic disorders, some of which are characterized by increased risk of lymphoma. Methods We surveyed the genetic variation in these genes in constitutional DNA of NHL patients by means of gene re-sequencing, then conducted genetic association tests for susceptibility to NHL in a population-based collection of 797 NHL cases and 793 controls. Results 114 SNPs were discovered in our sequenced samples, 61% of which were novel and not previously reported in dbSNP. Although four variants, two in RAD50 and two in NBS1, showed association results suggestive of an effect on NHL, they were not significant after correction for multiple tests. Conclusion These results suggest an influence of RAD50 and NBS1 on susceptibility to diffuse large B-cell lymphoma and marginal zone lymphoma. Larger association and functional studies could confirm such a role.

  6. Genetic variation in genes encoding airway epithelial potassium channels is associated with chronic rhinosinusitis in a pediatric population.

    Directory of Open Access Journals (Sweden)

    Michael T Purkey

    Full Text Available BACKGROUND: Apical potassium channels regulate ion transport in airway epithelial cells and influence air surface liquid (ASL hydration and mucociliary clearance (MCC. We sought to identify whether genetic variation within genes encoding airway potassium channels is associated with chronic rhinosinusitis (CRS. METHODS: Single nucleotide polymorphism (SNP genotypes for selected potassium channels were derived from data generated on the Illumnia HumanHap550 BeadChip or Illumina Human610-Quad BeadChip for 828 unrelated individuals diagnosed with CRS and 5,083 unrelated healthy controls from the Children's Hospital of Philadelphia (CHOP. Statistical analysis was performed with set-based tests using PLINK, and corrected for multiple testing. RESULTS: Set-based case control analysis revealed the gene KCNMA1 was associated with CRS in our Caucasian subset of the cohort (598 CRS cases and 3,489 controls; p = 0.022, based on 10,000 permutations. In addition there was borderline evidence that the gene KCNQ5 (p = 0.0704 was associated with the trait in our African American subset of the cohort (230 CRS cases and 1,594 controls. In addition to the top significant SNPs rs2917454 and rs6907229, imputation analysis uncovered additional genetic variants in KCNMA1 and in KCNQ5 that were associated with CRS. CONCLUSIONS: We have implicated two airway epithelial potassium channels as novel susceptibility loci in contributing to the pathogenesis of CRS.

  7. Association between genetic variations in tumor necrosis factor receptor genes and survival of patients with T-cell lymphoma

    Institute of Scientific and Technical Information of China (English)

    Kan Zhai; Jiang Chang; Chen Wu; Ning Lu; Li-Ming Huang; Tong-Wen Zhang; Dian-Ke Yu; Wen Tan; Dong-Xin Lin

    2012-01-01

    The prognosis of T-cell lymphoma (TCL) has been shown to be associated with the clinical characteristics of patients.However,there is little knowledge of whether genetic variations also affect the prognosis of TCL.This study investigated the associations between single nucleotide polymorphisms (SNPs) in tumor necrosis factor receptor superfamily (TNFRSF) genes and the survival of patients with TCL.A total of 38tag SNPs in 18 TNFRSF genes were genotyped using Sequenom platform in 150 patients with TCL.Kaplan-Meier survival estimates were plotted and significance was assessed using log-rank tests.Cox proportional hazard models were used to analyze each of these 38 SNPs with adjustment for covariates that might influence patient survival,including sex and international prognostic Index score.Hazard ratios (HRs) and their 95% confidence intervals (Cls) were calculated.Among the 38 SNPs tested,3 were significantly associated with the survival of patients with TCL.These SNPs were located at LTβR (rs3759333C>T) and TNFRSF17 (rs2017662C >T and rs2071336C>T).The 5-year survival rates were significantly different among patients carrying different genotypes and the HRs for death between the different genotypes ranged from 0.45 to 2.46.These findings suggest that the SNPs in TNFRSF genes might be important determinants for the survival of TCL patients.

  8. Polymorphic variation of CYP1A1 and CYP1B1 genes in a Haryana population.

    Science.gov (United States)

    Giri, Shiv Kumar; Yadav, Anita; Kumar, Anil; Dev, Kapil; Gulati, Sachin; Gupta, Ranjan; Aggarwal, Neeraj; Gautam, Sanjeev Kumar

    2013-12-01

    Cytochrome P450 (CYP) 1A1 and CYP1B1 are important phase I xenobiotic metabolizing enzymes involved in the metabolism of numbers of toxins, endogenous hormones, and pharmaceutical drugs. Polymorphisms in these phase I genes can alter enzyme activity and are known to be associated with cancer susceptibility related to environmental toxins and hormone exposure. Their genotypes may also display ethnicity-dependent population frequencies. The present study was aimed to determine the frequencies of commonly known functional polymorphisms of CYP1A1 and CYP1B1 genes in a Haryana state population of North India. The allelic frequency of CYP1A1 polymorphism m1 (MspI) was 29.65% and m2 (Ile(462)Val) was 24.85%. The frequency of CYP1B1 polymorphism m1 (Val(432)Leu) was 45.85% and m2 (Asn(453)Ser) was 16.2%. We observed inter- and intra-ethnic variation in the frequency distribution of these polymorphisms. Analysis of polymorphisms in these genes might help in predicting the risk of cancer. Our results emphasize the need for more such studies in high-risk populations.

  9. Germline variation in NCF4, an innate immunity gene, is associated with an increased risk of colorectal cancer.

    Science.gov (United States)

    Ryan, Bríd M; Zanetti, Krista A; Robles, Ana I; Schetter, Aaron J; Goodman, Julie; Hayes, Richard B; Huang, Wen-Yi; Gunter, Mark J; Yeager, Meredith; Burdette, Laurie; Berndt, Sonja I; Harris, Curtis C

    2014-03-15

    Chronic inflammation has been implicated in the etiology of colorectal adenoma and cancer; however, few key inflammatory genes mediating this relationship have been identified. In this study, we investigated the association of germline variation in innate immunity genes in relation to the risk of colorectal neoplasia. Our study was based on the analysis of samples collected from the prostate, lung, colorectal and ovarian (PLCO) Cancer Screening Trial. We investigated the association between 196 tag single nucleotide polymorphisms (SNPs) in 20 key innate immunity genes with risk of advanced colorectal adenoma and cancer in 719 adenoma cases, 481 cancer cases and 719 controls. Logistic regression was used to estimate odds ratios (OR) and 95% confidence intervals (CIs). After Bonferroni correction, the AG/GG genotype of rs5995355, which is upstream of NCF4, was associated with an increased risk of colorectal cancer (OR = 2.43, 95% CI = 1.73-3.39; p immune response. While not definitive, our analyses suggest that the variant allele does not affect expression of NCF4, but rather modulates activity of the NADPH complex. Additional studies on the functional consequences of rs5995355 in NCF4 may help to clarify the mechanistic link between inflammation and colorectal cancer.

  10. Neonatal multiorgan failure due to ACAD9 mutation and complex I deficiency with mitochondrial hyperplasia in liver, cardiac myocytes, skeletal muscle, and renal tubules.

    Science.gov (United States)

    Leslie, Nancy; Wang, Xinjian; Peng, Yanyan; Valencia, C Alexander; Khuchua, Zaza; Hata, Jessica; Witte, David; Huang, Taosheng; Bove, Kevin E

    2016-03-01

    Complex I deficiency causes Leigh syndrome, fatal infant lactic acidosis, and neonatal cardiomyopathy. Mutations in more than 100 nuclear DNA and mitochondrial DNA genes miscode for complex I subunits or assembly factors. ACAD9 is an acyl-CoA dehydrogenase with a novel function in assembly of complex I; biallelic mutations cause progressive encephalomyopathy, recurrent Reye syndrome, and fatal cardiomyopathy. We describe the first autopsy in fatal neonatal lethal lactic acidosis due to mutations in ACAD9 that reduced complex I activity. We identified mitochondrial hyperplasia in cardiac myocytes, diaphragm muscle, and liver and renal tubules in formalin-fixed, paraffin-embedded tissue using immunohistochemistry for mitochondrial antigens. Whole-exome sequencing revealed compound heterozygous variants in the ACAD9 gene: c.187G>T (p.E63*) and c.941T>C (p.L314P). The nonsense mutation causes late infantile lethality; the missense variant is novel. Autopsy-derived fibroblasts had reduced complex I activity (53% of control) with normal activity in complexes II to IV, similar to reported cases of ACAD9 deficiency.

  11. Identification of PLCL1 gene for hip bone size variation in females in a genome-wide association study.

    Directory of Open Access Journals (Sweden)

    Yao-Zhong Liu

    bone cells. Our findings suggest that PLCL1 is a novel gene associated with variation in hip BS, and provide new insights into the pathogenesis of HF.

  12. Genetic variations in the human cannabinoid receptor gene are associated with happiness.

    Directory of Open Access Journals (Sweden)

    Masahiro Matsunaga

    Full Text Available Happiness has been viewed as a temporary emotional state (e.g., pleasure and a relatively stable state of being happy (subjective happiness level. As previous studies demonstrated that individuals with high subjective happiness level rated their current affective states more positively when they experience positive events, these two aspects of happiness are interrelated. According to a recent neuroimaging study, the cytosine to thymine single-nucleotide polymorphism of the human cannabinoid receptor 1 gene is associated with sensitivity to positive emotional stimuli. Thus, we hypothesized that our genetic traits, such as the human cannabinoid receptor 1 genotypes, are closely related to the two aspects of happiness. In Experiment 1, 198 healthy volunteers were used to compare the subjective happiness level between cytosine allele carriers and thymine-thymine carriers of the human cannabinoid receptor 1 gene. In Experiment 2, we used positron emission tomography with 20 healthy participants to compare the brain responses to positive emotional stimuli of cytosine allele carriers to that of thymine-thymine carriers. Compared to thymine-thymine carriers, cytosine allele carriers have a higher subjective happiness level. Regression analysis indicated that the cytosine allele is significantly associated with subjective happiness level. The positive mood after watching a positive film was significantly higher for the cytosine allele carriers compared to the thymine-thymine carriers. Positive emotion-related brain region such as the medial prefrontal cortex was significantly activated when the cytosine allele carriers watched the positive film compared to the thymine-thymine carriers. Thus, the human cannabinoid receptor 1 genotypes are closely related to two aspects of happiness. Compared to thymine-thymine carriers, the cytosine allele carriers of the human cannabinoid receptor 1 gene, who are sensitive to positive emotional stimuli, exhibited greater

  13. Genetic variations in the human cannabinoid receptor gene are associated with happiness.

    Science.gov (United States)

    Matsunaga, Masahiro; Isowa, Tokiko; Yamakawa, Kaori; Fukuyama, Seisuke; Shinoda, Jun; Yamada, Jitsuhiro; Ohira, Hideki

    2014-01-01

    Happiness has been viewed as a temporary emotional state (e.g., pleasure) and a relatively stable state of being happy (subjective happiness level). As previous studies demonstrated that individuals with high subjective happiness level rated their current affective states more positively when they experience positive events, these two aspects of happiness are interrelated. According to a recent neuroimaging study, the cytosine to thymine single-nucleotide polymorphism of the human cannabinoid receptor 1 gene is associated with sensitivity to positive emotional stimuli. Thus, we hypothesized that our genetic traits, such as the human cannabinoid receptor 1 genotypes, are closely related to the two aspects of happiness. In Experiment 1, 198 healthy volunteers were used to compare the subjective happiness level between cytosine allele carriers and thymine-thymine carriers of the human cannabinoid receptor 1 gene. In Experiment 2, we used positron emission tomography with 20 healthy participants to compare the brain responses to positive emotional stimuli of cytosine allele carriers to that of thymine-thymine carriers. Compared to thymine-thymine carriers, cytosine allele carriers have a higher subjective happiness level. Regression analysis indicated that the cytosine allele is significantly associated with subjective happiness level. The positive mood after watching a positive film was significantly higher for the cytosine allele carriers compared to the thymine-thymine carriers. Positive emotion-related brain region such as the medial prefrontal cortex was significantly activated when the cytosine allele carriers watched the positive film compared to the thymine-thymine carriers. Thus, the human cannabinoid receptor 1 genotypes are closely related to two aspects of happiness. Compared to thymine-thymine carriers, the cytosine allele carriers of the human cannabinoid receptor 1 gene, who are sensitive to positive emotional stimuli, exhibited greater magnitude

  14. Common variations within HACE1 gene and neuroblastoma susceptibility in a Southern Chinese population

    Science.gov (United States)

    Zhang, Zhuorong; Zhang, Ruizhong; Zhu, Jinhong; Wang, Fenghua; Yang, Tianyou; Zou, Yan; He, Jing; Xia, Huimin

    2017-01-01

    Neuroblastoma is a common fatal pediatric cancer of the developing sympathetic nervous system, which accounts for ~10% of all pediatric cancer deaths. To investigate genetic risk factors related to neuroblastoma, many genome-wide association studies have been performed, and single nucleotide polymorphisms (SNPs) within HACE1 gene have been identified to associate with neuroblastoma risk. However, the association of the HACE1 SNPs with neuroblastoma needs to be validated in Southern Chinese children. We genotyped five SNPs located in the HACE1 gene (rs4336470 C>T, rs9404576 T>G, rs4079063 A>G, rs2499663 T>C, and rs2499667 A>G) in 256 Southern Chinese patients in comparison with 531 ethnically matched healthy controls. Single locus analysis showed no significant association between any of HACE1 SNPs and neuroblastoma risk in Southern Chinese children. However, when all the risk genotypes were combined, we found a borderline significant trend toward an increased neuroblastoma risk with 4–5 risk genotypes (adjusted odds ratio =1.36, 95% confidence interval =0.98–1.89, P=0.065). Moreover, stratified analysis found that carriers of 4–5 risk genotypes tended to develop neuroblastoma in the retroperitoneal region and have more aggressive tumors, progressing to advanced clinical stages III/IV, when compared with those of 0–3 risk genotypes. In conclusion, HACE1 gene may have weak effect on neuroblastoma risk in Southern Chinese children. Large well-designed studies are needed to strengthen our findings.

  15. Genetic variation of the transthyretin gene in wild-type transthyretin amyloidosis (ATTRwt)

    Science.gov (United States)

    Sikora, Jacquelyn L.; Logue, Mark W.; Chan, Gloria G.; Spencer, Brian H.; Prokaeva, Tatiana B.; Baldwin, Clinton T.; Seldin, David C.; Connors, Lawreen H.

    2014-01-01

    Wild-type transthyretin amyloidosis (ATTRwt), typically diagnosed as congestive heart failure in elderly Caucasian men, features myocardial amyloid deposits of wild-type plasma protein transthyretin (TTR). ATTRwt is sporadic, its pathogenesis is poorly understood, and currently there are no biomarkers for diagnosis or prognosis. Genetic studies of variant-associated transthyretin amyloidosis (ATTRm) have suggested that non-coding TTR gene variants modulate disease. We hypothesized that cis-acting regulatory elements in the TTR gene non-coding regions may modify expression, affecting ATTRwt onset and progression. We studied an ATTRwt cohort consisting of 108 Caucasian males ranging in age from 59–87 years with cardiomyopathy due to wild-type TTR deposition; results were compared to 118 anonymous controls matched by age, sex, and race. Four predicted non-coding regulatory regions and all exons in the TTR gene were sequenced using the Sanger method. Eleven common variants were identified; 3 variants were significantly associated with ATTRwt (p < 0.05), though only one, rs72922940, remained near significance (pcorrected = 0.083) after multiple testing correction. Exon analyses demonstrated the occurrence of the p.G26S (G6S) polymorphism in 7% of ATTRwt subjects and 12% of controls; this variant was predicted to be a protective factor (p = 0.051). Four variants were significantly associated with age at onset and survival. In this first genetic study of a large, well-characterized cohort of ATTRwt, non-coding and coding variants associated with disease, age at onset, and survival were identified. Further investigation is warranted to determine the prevalence of these variants in ATTRwt, their regulatory function, and potential role in assessing disease risk. PMID:25367359

  16. Non-Steroidal Anti-Inflammatory Drugs, Variation in Inflammatory Genes, and Aggressive Prostate Cancer

    Directory of Open Access Journals (Sweden)

    John S. Witte

    2010-10-01

    Full Text Available Increasing evidence suggests that prostatic inflammation plays a key role in the development of prostate cancer. It remains controversial whether non-steroidal anti-inflammatory drugs (NSAIDs reduce the risk of prostate cancer. Here, we investigate how a previously reported inverse association between NSAID use and the risk of aggressive prostate cancer is modulated by variants in several inflammatory genes. We found that NSAIDs may have differential effects on prostate cancer development, depending on one’s genetic makeup. Further study of these inflammatory pathways may clarify the mechanisms through which NSAIDs impact prostate cancer risk.

  17. Strategies for Integrated Analysis of Genetic, Epigenetic, and Gene Expression Variation in Cancer: Addressing the Challenges

    DEFF Research Database (Denmark)

    Thingholm, Louise Bruun; Andersen, Lars; Makalic, Enes

    2016-01-01

    The development and progression of cancer, a collection of diseases with complex genetic architectures, is facilitated by the interplay of multiple etiological factors. This complexity challenges the traditional single-platform study design and calls for an integrated approach to data analysis....... However, integration of heterogeneous measurements of biological variation is a non-trivial exercise due to the diversity of the human genome and the variety of output data formats and genome coverage obtained from the commonly used molecular platforms. This review article will provide an introduction...... to integration strategies used for analyzing genetic risk factors for cancer. We critically examine the ability of these strategies to handle the complexity of the human genome and also accommodate information about the biological and functional interactions between the elements that have been measured...

  18. A common variation of the PTEN gene is associated with peripheral insulin resistance

    DEFF Research Database (Denmark)

    Grinder-Hansen, L; Ribel-Madsen, R; Wojtaszewski, Jørgen

    2016-01-01

    . RESULTS: The minor G allele of PTEN rs11202614 was associated with elevated fasting plasma insulin levels and a decreased peripheral glucose disposal rate, but not with the hepatic insulin resistance index or insulin secretion measured as the first-phase insulin response and disposition index. The single...... nucleotide polymorphism was not associated with either PI3K or Akt activities. CONCLUSION: A common PTEN variation is associated with peripheral insulin resistance and subsequent risk of developing T2D. However, the association with insulin resistance is not explained by decreased proximal insulin signalling......AIM: Phosphatase and tensin homologue (PTEN) reduces insulin sensitivity by inhibiting the phosphatidylinositol 3-kinase (PI3K)/v-akt murine thymoma viral oncogene homologue (Akt) pathway. This study investigated how a common single nucleotide polymorphism near PTEN, previously associated...

  19. Identification of genes involved in color variation of bamboo culms by suppression subtractive hybridization.

    Science.gov (United States)

    Xia, Xiangwan; Gui, Renyi; Yang, Haiyun; Fu, Ying; Wei, Fang; Zhou, Mingbing

    2015-12-01

    Phyllostachys vivax cv. aureocaulis is a widely planted ornamental bamboo with evergreen leaves. This plant's culm exhibits a golden-yellow background color marked randomly with narrow and broad green stripes but is occasionally light green with yellow stripes. In this study, we attempt to identify the molecular mechanism underlying the color variation in striped culms. We found that neither stroma nor grana lamellas were observed in plastids in yellow tissue cells, while complete chloroplasts were observed in green tissue. In addition, chlorophyll a and b were mainly distributed in ground tissue under the epiderm and in the cells surrounding the bundle sheath in the green portion of internodes. The amount of chlorophyll contained in cross-sections of the green portion of culms is significantly higher than in the yellow portion. However, carotenoid was nearly undetectable in both samples. In addition, we found that the expression levels of 7 ESTs, including PvESTs-F641 (JZ893845), PvESTs-F681 (JZ893885) and PvESTs-F798 (JZ894002), were significantly higher in green samples than that in yellow samples, while PvESTs-R200 (JZ894906), PvESTs-R541 (JZ895247), PvESTs-R333 (JZ895039) and PvESTs-R266 (JZ894972) were found at a higher level in yellow samples. These ESTs are thought to play a role in this color variation in plants. Our current results indicate that insufficient photosynthetic membrane proteins and lipids in yellow tissue could lead to chloroplast dysfunction and could result in the yellow appearance on certain P. vivax cv. aureocaulis culms.

  20. Evidence that genetic variation in the oxytocin receptor (OXTR) gene influences social cognition in ADHD.

    Science.gov (United States)

    Park, J; Willmott, M; Vetuz, G; Toye, C; Kirley, A; Hawi, Z; Brookes, K J; Gill, M; Kent, L

    2010-05-30

    Some children with ADHD also have social and communication difficulties similar to those seen in children with autistic spectrum disorders and this may be due to shared genetic liability. As the oxytocin receptor (OXTR) gene has been implicated in social cognition and autistic spectrum disorders, this study investigated whether OXTR polymorphisms previously implicated in autism were associated with ADHD and whether they influenced OXTR mRNA expression in 27 normal human amygdala brain samples. The family-based association sample consisted of 450 DSM-IV diagnosed ADHD probands and their parents. Although there was no association with the ADHD phenotype, an association with social cognitive impairments in a subset of the ADHD probands (N=112) was found for SNP rs53576 (F=5.24, p=0.007) with post-hoc tests demonstrating that the AA genotype was associated with better social ability compared to the AG genotype. Additionally, significant association was also found for rs13316193 (F=3.09, p=0.05) with post-hoc tests demonstrating that the CC genotype was significantly associated with poorer social ability than the TT genotype. No significant association between genotype and OXTR mRNA expression was found. This study supports previous evidence that the OXTR gene is implicated in social cognition.

  1. Genetic Variation of Myeloperoxidase Gene Contributes to Aggressive Periodontitis: A Preliminary Association Study in Turkish Population

    Directory of Open Access Journals (Sweden)

    Kamile Erciyas

    2010-01-01

    Full Text Available Myeloperoxidase (MPO is a lysosomal enzyme found in the azurophilic granules of polymorphonuclear leukocytes. It is involved in the defense against periodontal bacteria, and is also able to mediate inflammatory tissue destruction in aggressive and chronic periodontitis. The aim of this study was to explore the association between MPO-463G/A gene polymorphism and aggressive periodontitis (AgP and chronic periodontitis (CP. The study included 147 subjects. Probing depth (PD, clinical attachment loss (CAL, plaque index (PI, and gingival index (GI were recorded as the clinical parameters. Genomic DNA was obtained from the peripheral blood of 32 subjects with AgP, 25 with CP, and 90 reference controls. We genotyped the MPO-463G/A polymorphism using the PCR-RFLP method. All data were analyzed using SPSS version 13.0 for windows. There were no significant differences between the CP patients and controls regarding MPO-463A/G gene polymorphism either in terms of allele frequency or genotype frequency of MPO-463A/G. However, either in terms of allele frequency or genotype frequency of MPO-463A/G, there were significant differences between the AgP patients and the controls. In conclusion, our data suggest that MPO-463G/A may be associated with increased risk of aggressive periodontitis in Turkish patients.

  2. Variation in the Coat Protein Gene of Papaya ringspot Virus Isolates from Multiple Locations of China

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The potyvirus Papaya ringspot virus (PRSV) is an important pathogen of papaya that causes severe losses in economic crops for papaya production globally. The coat protein (CP) genes of five PRSV isolates originating from different locations in China were cloned and sequenced. The CP-coding region varied in size from 864-873 nucleotides, encoding proteins of 288-291 amino acids. The five Chinese isolates of PRSV have been characterized as papaya-infecting (PRSV-P). The CP sequences of the Chinese isolates were compared with those of previously published PRSV isolates originating from different countries at amino acid levels. A number of KE repeat boxes in the N terminus of the PRSV-CP were found in all Chinese isolates. The phylogenetic branching pattern revealed that there was certain extended grouping between geographic locations, and the Asian type probably represents the oldest population of PRSV. The information of CP genes will be useful in designing and developing durable virus resistant-PRSV transgenic papaya in China. Meanwhile broad-spectrum-virus resistant, strongly resistant-PRSV and good safe papaya lines are required.

  3. Seasonal variations in antibiotic resistance gene transport in the almendares river, havana, cuba.

    Science.gov (United States)

    Knapp, Charles W; Lima, Lazaro; Olivares-Rieumont, Susana; Bowen, Emma; Werner, David; Graham, David W

    2012-01-01

    Numerous studies have quantified antibiotic resistance genes (ARG) in rivers and streams around the world, and significant relationships have been shown that relate different pollutant outputs and increased local ARG levels. However, most studies have not considered ambient flow conditions, which can vary dramatically especially in tropical countries. Here, ARG were quantified in water column and sediment samples during the dry- and wet-seasons to assess how seasonal and other factors influence ARG transport down the Almendares River (Havana, Cuba). Eight locations were sampled and stream flow estimated during both seasons; qPCR was used to quantify four tetracycline, two erythromycin, and three beta-lactam resistance genes. ARG concentrations were higher in wet-season versus dry-season samples, which combined with higher flows, indicated much greater ARG transport downstream during the wet-season. However, water column ARG levels were more spatially variable in the dry-season than the wet-season, with the proximity of waste outfalls strongly influencing local ARG levels. Results confirm that dry-season sampling provides a useful picture of the impact of individual waste inputs on local stream ARG levels, whereas the majority of ARGs in this tropical river were transported downstream during the wet-season, possibly due to re-entrainment of ARG from sediments.

  4. Seasonal variations in antibiotic resistance gene transport in the Almendares River, Havana, Cuba

    Directory of Open Access Journals (Sweden)

    Charles W Knapp

    2012-11-01

    Full Text Available Numerous studies have quantified antibiotic resistance genes (ARG in rivers and streams around the world, and significant relationships have been shown that relate different pollutant outputs and increased local ARG levels. However, most studies have not considered ambient flow conditions, which can vary dramatically especially in tropical countries. Here, ARG were quantified in water-column and sediment samples during the dry-and wet-seasons to assess how seasonal and other factors influence ARG transport down the Almendares River (Havana, Cuba. Eight locations were sampled and stream flow estimated during both seasons; qPCR was used to quantify four tetracycline, two erythromycin, and three beta-lactam resistance genes. ARG concentrations were higher in wet-season versus dry-season samples, which combined with higher flows, indicated greater ARG transport downstream during the wet season. Water-column ARG levels were more spatially variable in the dry-season than the wet-season, with the proximity of waste outfalls strongly influencing local ARG levels. Results confirm that dry-season sampling provides a useful picture of the impact of individual waste inputs on local stream ARG levels, whereas, the majority of ARGs in this tropical river were transported downstream during the wet season, possibly due to re-entrainment of ARG from sediments.

  5. C-reactive protein levels are influenced by common IL-1 gene variations.

    Science.gov (United States)

    Berger, Peter; McConnell, Joseph P; Nunn, Martha; Kornman, Kenneth S; Sorrell, Julian; Stephenson, Katherine; Duff, Gordon W

    2002-02-21

    Elevated markers of systemic inflammation are associated with the development of acute coronary syndromes, but there is no current explanation for increased inflammation in overtly healthy individuals. The influence of genetic control of the inflammatory response on the observed variability is unknown. We studied the frequency of four polymorphisms in interleukin (IL) 1 genes, known to modulate inflammation, in 454 individuals undergoing coronary angiography and analysed their influence on plasma C-reactive protein (CRP) and fibrinogen levels. Females and smokers had higher levels of CRP than males (Pi = 0.001) and non-smokers (Pi = 0.001). Patients with genotype 2.2 for the IL-1B(+3954) polymorphism had twice the median CRP levels of patients who were genotype 1.1 (4.33 vs 2.01 mg/l; P = 0.001). Patients with genotype 1.2 or 2.2 at the IL-1A(+4845) polymorphism also had higher median CRP (2.92 vs 2.05 mg/l, Pi = 0.023). In multivariate analyses, CRP levels remained significantly associated with IL-1 polymorphisms after adjustment for smoking, gender and age. Fibrinogen levels had similar associations with the IL-1 genotypes. These data indicate that IL-1 gene polymorphisms known to affect the inflammatory response are highly related to plasma levels of CRP and fibrinogen in patients referred for coronary angiography.

  6. Pharmacogenetic Randomized Trial for Cocaine Abuse: Disulfiram and α1A-adrenoceptor gene variation

    Science.gov (United States)

    Shorter, D.; Nielsen, D.A.; Huang, W.; Harding, M. J.; Hamon, S.C.; Kosten, T.R.

    2013-01-01

    Disulfiram is a cocaine addiction pharmacotherapy that inhibits dopamine β-hydroxylase (DβH) and reduces norepinephrine production. We examined whether a functional variant of the ADRA1A gene (Cys to Arg at codon 347 in exon 2, Cys347Arg) may enhance treatment response through decreased stimulation of this α1A-adrenoceptor, since antagonists of this receptor show promise in reducing cocaine use. Sixty-nine cocaine and opioid co-dependent (DSM-IV) subjects were stabilized on methadone for two weeks and subsequently randomized into disulfiram (250 mg/day, N = 32) and placebo groups (N = 37) for 10 weeks. We genotyped the ADRA1A gene polymorphism (rs1048101) and evaluated its role for increasing cocaine free urines in those subjects treated with disulfiram using repeated measures analysis of variance, corrected for population structure. The 47 patients who carried at least one T allele of rs1048101 (TT or TC genotype) reduced their cocaine positive urines from 84% to 56% on disulfiram (p = .0001), while the 22 patients with the major allele CC genotype showed no disulfiram effect. This study indicates that a patient’s ADRA1A genotype could be used to identify a subset of individuals for which disulfiram and, perhaps, other α1-adrenoceptor blockers may be an effective pharmacotherapy for cocaine dependence. PMID:23849431

  7. Gene expression variations during Drosophila metamorphosis in real and simulated gravity

    Science.gov (United States)

    Marco, R.; Leandro-García, L. J.; Benguría, A.; Herranz, R.; Zeballos, A.; Gassert, G.; van Loon, J. J.; Medina, F. J.

    Establishing the extent and significance of the effects of the exposure to microgravity of complex living organisms is a critical piece of information if the long-term exploration of near-by planets involving human beings is going to take place in the Future As a first step in this direction we have started to look into the patterns of gene expression during Drosophila development in real and simulated microgravity using microarray analysis of mRNA isolated from samples exposed to different environmental conditions In these experiments we used Affymetrix chips version 1 0 containing probes for more than 14 000 genes almost the complete Drosophila genome 55 of which are tagged with some molecular or functional designation while 45 are still waiting to be identified in functional terms The real microgravity exposure was imposed on the samples during the crew exchanging Soyuz 8 Mission to the ISS in October 2003 when after 11 days in Microgravity the Spanish-born astronaut Pedro Duque returned in the Soyuz 7 capsule carrying the experiments prepared by our Team Due to the constraints in the current ISS experiments in these Missions we limited the stages explored in our experiment to the developmental processes occurring during Drosophila metamorphosis As the experimental conditions at the launch site Baikonour were fairly limited we prepared the experiment in Madrid Toulouse and transp o rted the samples at 15 C in a temperature controlled container to slow down the developmental process a

  8. Association of rare variation in the glutamate receptor gene SLC1A2 with susceptibility to bipolar disorder and schizophrenia.

    Science.gov (United States)

    Fiorentino, Alessia; Sharp, Sally I; McQuillin, Andrew

    2015-09-01

    The SLC1A2 gene encodes the excitatory amino acid transporter 2 (EAAT2). Glutamate is the major mediator of excitatory neurotransmission and EAAT2 is responsible for clearing the neurotransmitter from the synaptic cleft. Genetic variation in SLC1A2 has been implicated in a range of neurological and neuropsychiatric conditions including schizophrenia (SZ), autism and in core phenotypes of bipolar disorder (BD). The coding and putative regulatory regions of SLC1A2 gene were screened for variants using high resolution melting or sequenced in 1099 or in 32 BD subjects. Thirty-two variants were detected in the SLC1A2 gene. Fifteen potentially etiological variants were selected for genotyping in 1099 BD and 1095 control samples. Five amino acid changing variants were also genotyped in 630 participants suffering from SZ. None of the variants were found to be associated with BD or SZ or with the two diseases combined. However, two recurrent missense variants (rs145827578:G>A, p.(G6S); rs199599866:G>A, p.(R31Q)) and one recurrent 5'-untranslated region (UTR) variant (ss825678885:G>T) were detected in cases only. Combined analysis of the recurrent-case-only missense variants and of the case-only missense and 5'-UTR variants showed nominal evidence for association with the combined diseases (Fisher's P=0.019 and 0.0076). These findings are exploratory in nature and await replication in larger cohorts, however, they provide intriguing evidence that potentially functional rare variants in the SLC1A2 gene may confer susceptibility to psychotic disorders.

  9. Genetic variation in the toll-like receptor gene cluster (TLR10-TLR1-TLR6) and prostate cancer risk.

    Science.gov (United States)

    Stevens, Victoria L; Hsing, Ann W; Talbot, Jeffrey T; Zheng, Siqun Lilly; Sun, Jielin; Chen, Jinbo; Thun, Michael J; Xu, Jianfeng; Calle, Eugenia E; Rodriguez, Carmen

    2008-12-01

    Toll-like receptors (TLRs) are key players in the innate immune system and initiate the inflammatory response to foreign pathogens such as bacteria, fungi and viruses. The proposed role of chronic inflammation in prostate carcinogenesis has prompted investigation into the association of common genetic variation in TLRs with the risk of this cancer. We investigated the role of common SNPs in a gene cluster encoding the TLR10, TLR6 and TLR1 proteins in prostate cancer etiology among 1,414 cancer cases and 1,414 matched controls from the Cancer Prevention Study II Nutrition Cohort. Twenty-eight SNPs, which included the majority of the common nonsynonymous SNPs in the 54-kb gene region and haplotype-tagging SNPs that defined 5 specific haplotype blocks, were genotyped and their association with prostate cancer risk determined. Two SNPs in TLR10 [I369L (rs11096955) and N241H (rs11096957)] and 4 SNPs in TLR1 [N248S (rs4833095), S26L (rs5743596), rs5743595 and rs5743551] were associated with a statistically significant reduced risk of prostate cancer of 29-38% (for the homozygous variant genotype). The association of these SNPs was similar when the analysis was limited to cases with advanced prostate cancer. Haplotype analysis and linkage disequilibrium findings revealed that the 6 associated SNPs were not independent and represent a single association with reduced prostate cancer risk (OR = 0.55, 95% CI: 0.33, 0.90). Our study suggest that a common haplotype in the TLR10-TLR1-TLR6 gene cluster influences prostate cancer risk and clearly supports the need for further investigation of TLR genes in other populations.

  10. The Relationship Between Genetic Variations of the Cholesteryl Ester Transfer Protein Gene and Coronary Artery Disease in Turkish Subjects

    Science.gov (United States)

    Gundogdu, Fuat; Gurlertop, Yekta; Pirim, Ibrahim; Sevimli, Serdar; Dogan, Hasan; Arslan, Sakir; Aksoy, Hulya; Karakelloglu, Sule; Senocak, Huseyin

    2009-01-01

    Objective Although the relationship between cholesteryl ester transfer protein (CETP) and cholesterol metabolism has been characterized in recent years, the effect of CETP genetic variants associated with coronary artery disease (CAD) is still unclear. Therefore, we investigated the association between CETP gene polymorphism and levels of lipid in patients with CAD. Materials and Methods We conducted a case-control study that included 194 unrelated subjects who underwent coronary angiography for suspected ischemic heart disease. This group was divided into 96 patients with angiographically documented CAD and 98 subjects (individuals matched for age and gender) without angiographically documented CAD (CAD-free subjects), all of whom were studied to examine the genotypic distribution of the CETP gene polymorphism in CAD. Genotyping was performed via polymerase chain reaction. Results Of the 96 patients with CAD, 38 (40%) were B1B1, 42 (44%) B1B2 and 16 (16%) B2B2, compared with the control subjects, of which 35 (36%) were B1B1, 44 (45%) B1B2 and 19 (19%) B2B2. There were no significant differences between patients with CAD and control subjects in the distribution of the CETP gene polymorphism. Patients with the B1B1 genotype had lower high-density lipoprotein-cholesterol (HDL-C) and higher triglyceride (TG) levels than patients with the B2B2 genotype (p<0.05). In addition, among control subjects HDL-C levels were significantly higher in subjects with the B2B2 genotype than in subjects with the B1B1 genotype (p<0.01). Conclusion Our results suggest that genetic variations of the CTEP gene may be responsible for low HDL-C levels but may not be considered as a risk factor for CAD in the Turkish population. PMID:25610061

  11. Sequence Variation of the Pertussis Toxin S1 Subunit Encoding Gene in the Clinical Isolates of Bordetella pertussis in Iran

    Directory of Open Access Journals (Sweden)

    Hosseinpour

    2015-08-01

    Full Text Available Background Whooping cough (pertussis is an acute respiratory disease caused by Bordetella pertussis (B. pertussis. Pertussis toxin is an important virulence factor of B. pertussis and plays a major role in the immune and inflammatory responses. Likewise, allelic variations in the genes of virulence factors have led to the non-responsiveness of the new strains to both whole-cell and acellular vaccines. Given the importance of pertussis vaccine, we sought to address the lack of fundamental studies on the polymorphisms of the virulence genes of B. pertussis in Iran. Objectives The aim of this study was to identify the polymorphisms of the pertussis toxin S1 subunit (ptxS1 gene in the circulating strains and compare them to the vaccine strain. Patients and Methods In this study, 50 strains of B. pertussis isolated from patients with pertussis were investigated in the pertussis reference laboratory of Pasteur institute of Iran. Cultivation, biochemical tests, and the specific antisera were used to confirm B. pertussis. The sequencing of the polymerase chain reaction products was performed to determine the ptxS1 alleles, and B. pertussis 134 was studied as the vaccine strain. Results The results showed that all the strains had the dominant allele ptxS1A. There were differences between the alleles of the clinical strains and the vaccine strain. Conclusions In recent years, a significant increase in the incidence of pertussis has been reported worldwide. Our findings regarding the allelic shift of the ptxS1 gene are similar to those reported in many European and American countries showing the difference of the dominant allele of ptxS1 between the circulating isolates and the vaccine strains.

  12. Differential Shannon entropy and differential coefficient of variation: alternatives and augmentations to differential expression in the search for disease-related genes.

    Science.gov (United States)

    Wang, Kai; Phillips, Charles A; Rogers, Gary L; Barrenas, Fredrik; Benson, Mikael; Langston, Michael A

    2014-01-01

    Differential expression has been a standard tool for analysing case-control transcriptomic data since the advent of microarray technology. It has proved invaluable in characterising the molecular mechanisms of disease. Nevertheless, the expression profile of a gene across samples can be perturbed in ways that leave the expression level unaltered, while a biological effect is nonetheless present. This paper describes and analyses differential Shannon entropy and differential coefficient of variation, two alternate techniques for identifying genes of interest. Ontological analysis across 16 human disease datasets demonstrates that these alternatives are effective at identifying disease-related genes not found by mere differential expression alone. Because the two alternate techniques are based on somewhat different mathematical formulations, they tend to produce somewhat different gene lists. Moreover, each may pinpoint genes completely overlooked by the other. Thus, measures of entropy and variation can be used to replace or better yet augment standard differential expression computations.

  13. Variation and Characterization Analysis of Partial Fragment of Fibroin Gene From Silkworm, Antheraea pernyi

    Institute of Scientific and Technical Information of China (English)

    Li Wenli(李文利); Jin Liji; An Lijia

    2003-01-01

    A 1.4Kb DNA fragment containing 3' flanking sequence of fibroin gene of silkworm, Antheraea pernyi, was obtained from the silk gland's mRNA of 5th larva. Analysis of this sequence with another A.pernyi fibroin protein (accession No. D83241) revealed that it consists of a completely open reading frame (ORF), which includes 14 polyalanine-containing units (motifs) and 100bp 3'-UTR. The sequence of the predicted amino acid reveals the highest level of overall identity (90%) with D83241. It was found that it loses a repeat region at the upstream of TAA codon and some mutations. A putative polyadenylation signal AATAAA tail was found in position 1300, which follows the termination codon.

  14. Sequence variation at the phenylalanine hydroxylase gene in the British Isles

    Energy Technology Data Exchange (ETDEWEB)

    Tyfield, L.A. [Southmead Hospital, Bristol (United Kingdom)]|[Univ. of Bristol (United Kingdom); Stephenson, A. [Southmead Hospital, Bristol (United Kingdom); Cockburn, F. [Royal Hospital for Sick Children, Glasgow (United Kingdom)] [and others

    1997-02-01

    Using mutation and haplotype analysis, we have examined the phenylalanine hydroxylase gene in the phenylketonuria populations of four geographical areas of the British Isles: the west of Scotland, southern Wales, and southwestern and southeastern England. The enormous genetic diversity of this locus within the British Isles is demonstrated in the large number of different mutations characterized and in the variety of genetic backgrounds on which individual mutations are found. Allele frequencies of the more common mutations exhibited significant nonrandom distribution in a north/south differentiation. Differences between the west of Scotland and southwestern England may be related to different events in the recent and past histories of their respective populations. Similarities between southern Wales and southeastern England are likely to reflect the heterogeneity that is seen in and around two large capital cities. Finally, comparison with more recently colonized areas of the world corroborates the genealogical origin by range expansion of several mutations. 38 refs., 2 tabs.

  15. Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population

    DEFF Research Database (Denmark)

    Frikke-Schmidt, Ruth

    2010-01-01

    Epidemiological studies consistently demonstrate a strong inverse association between low levels of high-density lipoprotein (HDL) cholesterol and increased risk of ischemic heart disease (IHD). This review focuses on whether both rare and common genetic variation in ABCA1 contributes to plasma...... levels of HDL cholesterol and to risk of IHD in the general population, and further seeks to understand whether low levels of HDL cholesterol per se are causally related to IHD. Studies of the ABCA1 gene demonstrate a general strategy for detecting functional genetic variants, and show that both common...... and rare ABCA1 variants contribute to levels of HDL cholesterol and risk of IHD in the general population. The association between ABCA1 variants and risk of IHD appears, however, to be independent of plasma levels of HDL cholesterol. With the recent identification of the largest number of individuals...

  16. Variations of mitochondrial D-loop region plus downstream gene 12S rRNA-tRNAphe and gastric carcinomas

    Institute of Scientific and Technical Information of China (English)

    Cheng-Bo Han; Fan Li; Yu-Jie Zhao; Jia-Ming Ma; Dong-Ying Wu; Yu-Kui Zhang; Yan Xin

    2003-01-01

    AIM: To explore the instabilities, polymorphisms and other variations of mitochondrial D-loop region and downstream gene 12S rRNA-tRNAPhe in gastric cancers, and to study their relationship with gastric cancer.METHODS: Three adjacent regions (D-loop, tRNAphe and 12S rRNA) were detected for instabilities, polymorphisms and other variations via PCR amplification followed by direct DNA sequencing in 22 matched gastric cancerous tissues and para-cancerous normal tissues.RESULTS: PolyC or (CA)n instabilities were detected in 13/22(59.1%) gastric cancers and 9/22(40.9 %) in the control (P>0.05). There existed 2/12(16.7%) and 6/10(60%)alterations of 12S rR NA-tRNAphe in well differentiated gastric cancers and poorly differentiated ones, respectively(P0.05).Some new variations were found, among which np 318 and np 321 C-T transitions in D-loop region were two of the five bases for H-strand replication primer. Np 523 AC-deletion and np 527 C-T transition occurred at mtTF1 binding site (mtTFBS), which were associated with the transcription of downstream mitochondrial genome. Seven samples showed the np 16 182 polyC instabilities, five of which simultaneously showed np 16 189 T-C transitions.CONCLUSION: There is no statistic significance of instabilities and polymorphisms in mitochondrial D-loop region between gastric cancerous and para-cancerous normal tissues, which suggests that the instability might relate to heredity or be dependent on aging. There is asignificant correlation between differentiation degree of gastric cancer and variant frequencies of 12S rRNA-tRNAphe. The poorly differentiated gastric cancers are more prone to 12S rRNAtRNAphe variations, or gastric cancers with 12S rRNA-tRNAphe variations are more likely to be poorly differentiated, np 16189 T-C transition may be one of the important reasons for polyC instability in gastric cancer.

  17. Intelectuales reprobando al rendimiento académico

    OpenAIRE

    Vásquez Arango, Alejandro

    2012-01-01

    El “rendimiento académico” ha sido aceptado como el factor determinante de la calidad en los procesos de enseñanza aprendizaje propios de cualquier academia formal. Las políticas nacionales e internacionales que promueven el aumento de la calidad educativa, han apostado a elevar dicho rendimiento, el cual se materializa en resultados numéricos y busca medir las capacidades de los individuos según determinadas áreas del conocimiento. No es de extrañar entonces, la lucha frontal de los gobierno...

  18. Inequidad y diferencia: mujeres y desarrollo académico

    OpenAIRE

    Kiss, Diana; Barrios, Olga; Alvarez,Judith

    2007-01-01

    El trabajo presenta un análisis de la relación poder-saber en el contexto universitario. A partir de la exploración de la estructura organizacional de la Universidad de Los Lagos, en la docencia y en la gestión institucional, se identifican los espacios del poder material y simbólico que ocupan los hombres y las mujeres. Se exponen los resultados de un análisis intergenérico a nivel de posiciones en el escalafón académico, las remuneraciones y la inserción de las mujeres al equipo docente tan...

  19. Los procesos editoriales y la calidad académica

    OpenAIRE

    Pacheco-Gualdrón, Jorge Eliécer

    2016-01-01

    El proceso editorial de una revista está lleno de protagonistas invisibles. Desde la recepción de un artículo hasta la diagramación y publicación de la revista acontecen innumerables etapas. Incluso, cuando un autor envía su propuesta de artículo ya se han desarrollado múltiples procesos de investigación, reflexión y escritura académica que posibilitan la aceptación de su texto. 

  20. Variation in Uteroglobin-Related Protein 1 (UGRP1 gene is associated with Allergic Rhinitis in Singapore Chinese

    Directory of Open Access Journals (Sweden)

    Wang De Yun

    2011-03-01

    Full Text Available Abstract Background Uteroglobin-Related Protein 1 (UGRP1 is a secretoglobulin protein which has been suggested to play a role in lung inflammation and allergic diseases. UGRP1 has also been shown to be an important pneumoprotein, with diagnostic potential as a biomarker of lung damage. Previous genetic studies evaluating the association between variations on UGRP1 and allergic phenotypes have yielded mixed results. The aim of this present study was to identify genetic polymorphisms in UGRP1 and investigate if they were associated with asthma and allergic rhinitis in the Singapore Chinese population. Methods Resequencing of the UGRP1 gene was conducted on 40 randomly selected individuals from Singapore of ethnic Chinese origin. The polymorphisms identified were then tagged and genotyped in a population of 1893 Singapore Chinese individuals. Genetic associations were evaluated in this population comparing 795 individuals with allergic rhinitis, 718 with asthma (of which 337 had both asthma and allergic rhinitis and 717 healthy controls with no history of allergy or allergic diseases. Results By resequencing the UGRP1 gene within our population, we identified 11 novel and 16 known single nucleotide polymorphisms (SNPs. TagSNPs were then genotyped, revealing a significant association between rs7726552 and allergic rhinitis (Odds Ratio: 0.81, 95% Confidence Interval: 0.66-0.98, P = 0.039. This association remained statistically significant when it was analyzed genotypically or when stratified according to haplotypes. When variations on UGRP1 were evaluated against asthma, no association was observed. Conclusion This study documents the association between polymorphisms in UGRP1 and allergic rhinitis, suggesting a potential role in its pathogenesis.

  1. Evolutionary variations in the expression of dorso-ventral patterning genes and the conservation of pioneer neurons in Tribolium castaneum.

    Science.gov (United States)

    Biffar, Lucia; Stollewerk, Angelika

    2015-04-01

    Insects are ideally suited for gaining insight into the evolutionary developmental mechanisms that have led to adaptive changes of the nervous system since the specific structure of the nervous system can be directly linked to the neural stem cell (neuroblast) lineages, which in turn can be traced back to the last common ancestor of insects. The recent comparative analysis of the Drosophila melanogaster and Tribolium castaneum neuroblast maps revealed substantial differences in the expression profiles of neuroblasts. Here we show that despite the overall conservation of the dorso-ventral expression domains of muscle segment homeobox, intermediate neuroblasts defective and ventral nervous system defective, the expression of these genes relative to the neuroblasts in the respective domains has changed considerably during insect evolution. Furthermore, functional studies show evolutionary changes in the requirement of ventral nervous system defective in the formation of neuroblast 1-1 and the correct differentiation of its presumptive progeny, the pioneer neurons aCC and pCC. The inclusion of the expression data of the dorso-ventral genes into the recently established T. castaneum neuroblast map further increases the differences in the neuroblast expression profiles between D. melanogaster and T. castaneum. Despite these molecular variations, the Even-skipped positive pioneer neurons show an invariant arrangement, except for an additional Even-skipped positive cluster that we discovered in T. castaneum. Given the importance of these pioneer neurons in establishing the intersegmental nerves and the longitudinal tracts, which are part of the conserved axonal scaffold of arthropods, we discuss internal buffering mechanisms that might ensure that neuroblast lineages invariantly generate pioneer neurons over a wide range of molecular variations.

  2. Intrinsic karyotype stability and gene copy number variations may have laid the foundation for tetraploid wheat formation.

    Science.gov (United States)

    Zhang, Huakun; Bian, Yao; Gou, Xiaowan; Dong, Yuzhu; Rustgi, Sachin; Zhang, Bangjiao; Xu, Chunming; Li, Ning; Qi, Bao; Han, Fangpu; von Wettstein, Diter; Liu, Bao

    2013-11-26

    Polyploidy or whole-genome duplication is recurrent in plant evolution, yet only a small fraction of whole-genome duplications has led to successful speciation. A major challenge in the establishment of nascent polyploids is sustained karyotype instability, which compromises fitness. The three putative diploid progenitors of bread wheat, with AA, SS (S ∼ B), and DD genomes occurred sympatrically, and their cross-fertilization in different combinations may have resulted in fertile allotetraploids with various genomic constitutions. However, only SSAA or closely related genome combinations have led to the speciation of tetraploid wheats like Triticum turgidum and Triticum timopheevii. We analyzed early generations of four newly synthesized allotetraploid wheats with genome compositions S(sh)S(sh)A(m)A(m), S(l)S(l)AA, S(b)S(b)DD, and AADD by combined fluorescence and genomic in situ hybridization-based karyotyping. Results of karyotype analyses showed that although S(sh)S(sh)A(m)A(m) and S(l)S(l)AA are characterized by immediate and persistent karyotype stability, massive aneuploidy and extensive chromosome restructuring are associated with S(b)S(b)DD and AADD in which parental subgenomes showed markedly different propensities for chromosome gain/loss and rearrangements. Although compensating aneuploidy and reciprocal translocation between homeologs prevailed, reproductive fitness was substantially compromised due to chromosome instability. Strikingly, localized genomic changes in repetitive DNA and copy-number variations in gene homologs occurred in both chromosome stable lines, S(sh)S(sh)A(m)A(m) and S(l)S(l)AA. Our data demonstrated that immediate and persistent karyotype stability is intrinsic to newly formed allotetraploid wheat with genome combinations analogous to natural tetraploid wheats. This property, coupled with rapid gene copy-number variations, may have laid the foundation of tetraploid wheat establishment.

  3. Common genetic variation in the Estrogen Receptor Beta (ESR2 gene and osteoarthritis: results of a meta-analysis

    Directory of Open Access Journals (Sweden)

    Rivadeneira Fernando

    2010-11-01

    Full Text Available Abstract Background The objective of this study was to examine the relationship between common genetic variation of the ESR2 gene and osteoarthritis. Methods In the discovery study, the Rotterdam Study-I, 7 single nucleotide polymorphisms (SNPs were genotyped and tested for association with hip (284 cases, 2772 controls, knee (665 cases, 2075 controls, and hand OA (874 cases, 2184 controls using an additive model. In the replication stage one SNP (rs1256031 was tested in an additional 2080 hip, 1318 knee and 557 hand OA cases and 4001, 2631 and 1699 controls respectively. Fixed- and random-effects meta-analyses were performed over the complete dataset including 2364 hip, 1983 knee and 1431 hand OA cases and approximately 6000 controls. Results The C allele of rs1256031 was associated with a 36% increased odds of hip OA in women of the Rotterdam Study-I (OR 1.36, 95% CI 1.08-1.70, p = 0.009. Haplotype analysis and analysis of knee- and hand OA did not give additional information. With the replication studies, the meta-analysis did not show a significant effect of this SNP on hip OA in the total population (OR 1.06, 95% CI 0.99-1.15, p = 0.10. Stratification according to gender did not change the results. In this study, we had 80% power to detect an odds ratio of at least 1.14 for hip OA (α = 0.05. Conclusion This study showed that common genetic variation in the ESR2 gene is not likely to influence the risk of osteoarthritis with effects smaller than a 13% increase.

  4. Strategies for integrated analysis of genetic, epigenetic and gene expression variation in cancer: addressing the challenges

    Directory of Open Access Journals (Sweden)

    Louise Bruun Thingholm

    2016-02-01

    Full Text Available The development and progression of cancer, a collection of diseases with complex genetic architectures, is facilitated by the interplay of multiple etiological factors. This complexity challenges the traditional single-platform study design and calls for an integrated approach to data analysis. However, integration of heterogeneous measurements of biological variation is a non-trivial exercise due to the diversity of the human genome and the variety of output data formats and genome coverage obtained from the commonly used molecular platforms. This review article will provide an introduction to integration strategies used for analyzing genetic risk factors for cancer. We critically examine the ability of these strategies to handle the complexity of the human genome and also accommodate information about the biological and functional interactions between the elements that have been measured – making the assessment of disease risk against a composite genomic factor possible. The focus of this review is to provide an overview and introduction to the main strategies and to discuss where there is a need for further development.

  5. Association of ABO and Colton Blood Group Gene Polymorphisms With Hematological Traits Variation.

    Science.gov (United States)

    Shahbazi, Shirin; Mashayekhi, Amir; Fatahi, Neda; Mahdavi, Mohammad-Reza

    2015-12-01

    Hematological parameters are appraised routinely to determine overall human health and to diagnose and monitor certain diseases. In GWASs, more than 30 loci carrying common deoxyribonucleic acid (DNA) polymorphisms have been identified related to hematological traits. In this study, we investigated the contribution of ABO rs2073823 along with AQP1 rs1049305 and rs10244884 polymorphisms in hematological traits variation in a cohort of Iranian healthy individuals.Genomic DNA was extracted from peripheral blood of 168 healthy volunteer. Genotyping was performed by ARMS-PCR or PCR-RFLP and confirmed by DNA sequencing. Complete blood analyses were conducted for the participants. Significant association was observed between AQP1 rs1049305 and the hematological traits including hemoglobin, hematocrit, and platelet count (P = 0.012, 0.008, and 0.011, respectively). The AQP1 rs10244884 status was also significantly linked to hemoglobin and hematocrit levels in the study cohort (P = 0.015 and 0.041, respectively). Furthermore, ABO rs2073823 polymorphism was identified as a hemoglobin and hematocrit levels modifier (both with P = 0.004).AQP1 and ABO variants appear to predict hemoglobin and hematocrit levels but not other erythrocyte phenotype parameters including red blood cell counts and red blood cell indices.

  6. Oxytocin receptor gene sequences in owl monkeys and other primates show remarkable interspecific regulatory and protein coding variation.

    Science.gov (United States)

    Babb, Paul L; Fernandez-Duque, Eduardo; Schurr, Theodore G

    2015-10-01

    The oxytocin (OT) hormone pathway is involved in numerous physiological processes, and one of its receptor genes (OXTR) has been implicated in pair bonding behavior in mammalian lineages. This observation is important for understanding social monogamy in primates, which occurs in only a small subset of taxa, including Azara's owl monkey (Aotus azarae). To examine the potential relationship between social monogamy and OXTR variation, we sequenced its 5' regulatory (4936bp) and coding (1167bp) regions in 25 owl monkeys from the Argentinean Gran Chaco, and examined OXTR sequences from 1092 humans from the 1000 Genomes Project. We also assessed interspecific variation of OXTR in 25 primate and rodent species that represent a set of phylogenetically and behaviorally disparate taxa. Our analysis revealed substantial variation in the putative 5' regulatory region of OXTR, with marked structural differences across primate taxa, particularly for humans and chimpanzees, which exhibited unique patterns of large motifs of dinucleotide A+T repeats upstream of the OXTR 5' UTR. In addition, we observed a large number of amino acid substitutions in the OXTR CDS region among New World primate taxa that distinguish them from Old World primates. Furthermore, primate taxa traditionally defined as socially monogamous (e.g., gibbons, owl monkeys, titi monkeys, and saki monkeys) all exhibited different amino acid motifs for their respective OXTR protein coding sequences. These findings support the notion that monogamy has evolved independently in Old World and New World primates, and that it has done so through different molecular mechanisms, not exclusively through the oxytocin pathway.

  7. Y-chromosome variation among Sudanese: restricted gene flow, concordance with language, geography, and history.

    Science.gov (United States)

    Hassan, Hisham Y; Underhill, Peter A; Cavalli-Sforza, Luca L; Ibrahim, Muntaser E

    2008-11-01

    We study the major levels of Y-chromosome haplogroup variation in 15 Sudanese populations by typing major Y-haplogroups in 445 unrelated males representing the three linguistic families in Sudan. Our analysis shows Sudanese populations fall into haplogroups A, B, E, F, I, J, K, and R in frequencies of 16.9, 7.9, 34.4, 3.1, 1.3, 22.5, 0.9, and 13% respectively. Haplogroups A, B, and E occur mainly in Nilo-Saharan speaking groups including Nilotics, Fur, Borgu, and Masalit; whereas haplogroups F, I, J, K, and R are more frequent among Afro-Asiatic speaking groups including Arabs, Beja, Copts, and Hausa, and Niger-Congo speakers from the Fulani ethnic group. Mantel tests reveal a strong correlation between genetic and linguistic structures (r = 0.31, P = 0.007), and a similar correlation between genetic and geographic distances (r = 0.29, P = 0.025) that appears after removing nomadic pastoralists of no known geographic locality from the analysis. The bulk of genetic diversity appears to be a consequence of recent migrations and demographic events mainly from Asia and Europe, evident in a higher migration rate for speakers of Afro-Asiatic as compared with the Nilo-Saharan family of languages, and a generally higher effective population size for the former. The data provide insights not only into the history of the Nile Valley, but also in part to the history of Africa and the area of the Sahel.

  8. Increased Variation in Adh Enzyme Activity in Drosophila Mutation-Accumulation Experiment Is Not Due to Transposable Elements at the Adh Structural Gene

    Science.gov (United States)

    Aquadro, C. F.; Tachida, H.; Langley, C. H.; Harada, K.; Mukai, T.

    1990-01-01

    We present here a molecular analysis of the region surrounding the structural gene encoding alcohol dehydrogenase (Adh) in 47 lines of Drosophila melanogaster that have each accumulated mutations for 300 generations. While these lines show a significant increase in variation of alcohol dehydrogenase enzyme activity compared to control lines, we found no restriction map variation in a 13-kb region including the complete Adh structural gene and roughly 5 kb of both 5' and 3' sequences. Thus, the rapid accumulation of ADH activity variation after 28,200 allele generations does not appear to have been due to the mobilization of transposable elements into or out of the Adh structural gene region. PMID:1963870

  9. Variation in the ICAM1 gene is not associated with severe malaria phenotypes

    Science.gov (United States)

    Fry, Andrew E.; Auburn, Sarah; Diakite, Mahamadou; Green, Angela; Richardson, Anna; Wilson, Jonathan; Jallow, Muminatou; Sisay-Joof, Fatou; Pinder, Margaret; Griffiths, Michael J.; Peshu, Norbert; Williams, Thomas N.; Marsh, Kevin; Molyneux, Malcolm E.; Taylor, Terrie E.; Rockett, Kirk A.; Kwiatkowski, Dominic P.

    2009-01-01

    Evidence from autopsy, mouse-model and in vitro binding studies suggests that adhesion of erythrocytes infected with Plasmodium falciparum to the human host intercellular adhesion molecule (ICAM)-1 receptor is important in the pathogenesis of severe malaria. Previous association studies between polymorphisms around the ICAM1 gene and susceptibility to severe malarial phenotypes have been inconclusive and often contradictory. We performed genetic association studies with 15 single-nucleotide-polymorphisms (SNPs) around the ICAM1 locus. All SNPs were screened in a family study of 1071 trios from Gambia, Malawi and Kenya. Two key non-synonymous SNPs with previously reported associations, rs5491 (K56M or ‘ICAM-1Kilifi’) and rs5498 (K469E), were tested in an additional 708 Gambian trios and a case-control study of 4058 individuals. None of the polymorphisms were associated with severe malaria phenotypes. Pooled results across our studies for ICAM-1Kilifi were, in severe malaria, odds ratio (OR) 1.02, 95% confidence interval (CI) 0.96 – 1.09, P=0.54, and cerebral malaria OR 1.07, CI 0.97 – 1.17, P=0.17. We assess the available epidemiological, population genetic and functional evidence which links ICAM-1Kilifi to severe malaria susceptibility. PMID:18528404

  10. Structural variation around prolactin gene linked to quantitative traits in an elite Holstein sire family.

    Science.gov (United States)

    Cowan, C M; Dentine, M R; Ax, R L; Schuler, L A

    1990-05-01

    Digestion of genomic DNA with the restriction endonuclease Avail disclosed a probable insertion deletion of approximately 200 base pairs (bp) near the prolactin gene. Two alleles were apparent as three distinct hybridization patterns. These alleles were statistically associated with quantitative trait loci among sons of one elite Holstein sire family. The favorable genotype was correlated with the presence of a 1.15-kb hybridization band inherited from the sire when genomic DNA was probed with a full-length cDNA for prolactin. Pedigree estimates of genetic merit among genotypes were similar, differing by only 19.3 kg for milk in ancestor merit. Comparisons of genetic estimates for quantitative yield traits in offspring of this heterozygous sire showed significant (Pcheese yield dollars, and protein dollars. The estimated differences between homozygous genotypes for USDA Transmitting Abilities of PDM, PD$, Cheese Yield $ and Protein $ were 282.93 kg, $74.35, $48.58 and $53.67, respectively. However, the estimated breeding values from progeny ranged over 900 kg in transmitting ability for milk. Frequency of the favorable marker allele was estimated to be 0.231 in the elite cow population used as dams of sons. These results demonstrate the potential of molecular biological techniques to discriminate between individuals within a family and to predict breeding values for selection schemes.

  11. Varenicline for smoking cessation: nausea severity and variation in nicotinic receptor genes.

    Science.gov (United States)

    Swan, G E; Javitz, H S; Jack, L M; Wessel, J; Michel, M; Hinds, D A; Stokowksi, R P; McClure, J B; Catz, S L; Richards, J; Zbikowski, S M; Deprey, M; McAfee, T; Conti, D V; Bergen, A W

    2012-08-01

    This study evaluated association between common and rare sequence variants in 10 nicotinic acetylcholine receptor subunit genes and the severity of nausea 21 days after initiating the standard, Food and Drug Administration-approved varenicline regimen for smoking cessation. A total of 397 participants from a randomized clinical effectiveness trial with complete clinical and DNA resequencing data were included in the analysis (mean age=49.2 years; 68.0% female). Evidence for significant association between common sequence variants in CHRNB2 and nausea severity was obtained after adjusting for age, gender and correlated tests (all P(ACT)<0.05). Individuals with the minor allele of CHRNB2 variants experienced less nausea than did those without the minor allele, consistent with previously reported findings for CHRNB2 and the occurrence of nausea and dizziness as a consequence of first smoking attempt in adolescents, and with the known neurophysiology of nausea. As nausea is the most common reason for discontinuance of varenicline, further pharmacogenetic investigations are warranted.

  12. Investigation of modifier genes within copy number variations in Rett syndrome.

    Science.gov (United States)

    Artuso, Rosangela; Papa, Filomena T; Grillo, Elisa; Mucciolo, Mafalda; Yasui, Dag H; Dunaway, Keith W; Disciglio, Vittoria; Mencarelli, Maria A; Pollazzon, Marzia; Zappella, Michele; Hayek, Giuseppe; Mari, Francesca; Renieri, Alessandra; Lasalle, Janine M; Ariani, Francesca

    2011-07-01

    MECP2 mutations are responsible for two different phenotypes in females, classical Rett syndrome and the milder Zappella variant (Z-RTT). We investigated whether copy number variants (CNVs) may modulate the phenotype by comparison of array-CGH data from two discordant pairs of sisters and four additional discordant pairs of unrelated girls matched by mutation type. We also searched for potential MeCP2 targets within CNVs by chromatin immunopreceipitation microarray (ChIP-chip) analysis. We did not identify one major common gene/region, suggesting that modifiers may be complex and variable between cases. However, we detected CNVs correlating with disease severity that contain candidate modifiers. CROCC (1p36.13) is a potential MeCP2 target, in which a duplication in a Z-RTT and a deletion in a classic patient were observed. CROCC encodes a structural component of ciliary motility that is required for correct brain development. CFHR1 and CFHR3, on 1q31.3, may be involved in the regulation of complement during synapse elimination, and were found to be deleted in a Z-RTT but duplicated in two classic patients. The duplication of 10q11.22, present in two Z-RTT patients, includes GPRIN2, a regulator of neurite outgrowth and PPYR1, involved in energy homeostasis. Functional analyses are necessary to confirm candidates and to define targets for future therapies.

  13. Relación entre burnout y engagement académicos con variables sociodemográficas y académicas

    Directory of Open Access Journals (Sweden)

    Carmen Cecilia Caballero D.

    2015-01-01

    Full Text Available Este estudio buscó esclarecer la interdependencia entre burnout académico ( BA y engagement académico ( EA en estudiantes universitarios del área de la salud, y profundizar en la carac - terización de esta relación a partir de sus asociaciones con variables sociodemográficas y académicas (desempeño académico, DA . Se utilizó un diseño observacional y correlacional de tipo multivariado con una muestra, constituida aleatoria y estratificadamente por 802 estudiantes de los programas de medicina, enfermería, fisioterapia y psicología de universi - dades privadas de Barranquilla, Colombia. Los instrumentos utilizados fueron el MBI - SS , el UWES-S y un cuestionario sobre condiciones socioeconómicas y académicas. El análisis de las relaciones halladas entre BA y EA permitió considerarlos articulados como extremos de un mismo continuo fenoménico o factor, compuesto por las dimensiones de vigor, dedicación, ineficacia académica y cinismo, con valores opuestos en los extremos o polos del factor. Se identificaron variables sociodemográficas y académicas asociadas con los polos del BA y del EA del factor reconocido, donde el BA resultó un buen predictor de mal DA , y el EA un buen predictor de buen DA .

  14. Genetic Variation ofEPAS1Gene in Tibetan Pigs and ThreeLow-Altitude Pig Breeds in China

    Institute of Scientific and Technical Information of China (English)

    DONG Kun-zhe; KANG Ye; YAO Na; SHU Guo-tao; ZUO Qing-qing; ZHAO Qian-jun; MA Yue-hui

    2014-01-01

    Endothelial PAS domain protein 1 (EPAS1), also called hypoxia-inducible factor-2, is a key regulatory factor of hypoxic responses and plays an essential role in high-altitude adaptation in mammalian species. In this study, polymorphisms of EPAS1 were detected in 217 individuals from 2 Tibetan pig populations and 3 low-altitude pig breeds by DNA pooling, PCR-SSCP, PCR-RFLP and DNA sequencing methods. A total of 14 synonymous polymorphisms were identiifed in the coding region. The analysis suggested that SNP1 (G963A), SNP7 (C1632T), SNP10 (G1929A) and SNP11 (G1947A) showed potential association with high-altitude environment because of their particular variation patterns in Tibetan pigs. Linkage disequilibrium (LD) of these SNPs was analyzed. One common LD block including 5 SNPs clustering in exon 12 was identiifed in all studied pig populations. Haplotype H1 (AGGTC) in LD block was dominant in Tibetan pigs (76.6 and 74.2% in Linzhi (LZ) and Chayu (CY) pigs, respectively) and segregated at higher frequency than that in low-altitude pig breeds (52.3, 58.7 and 56.2% in Wuzhishan (WZS), Min (M) and Laiwu (LW) pigs, respectively), indicating that H1 may relate to adaptation to high altitude in Tibetan pigs. These ifndings raise hope thatEPAS1gene can be a candidate gene that involved in adaptation of high altitude in Tibetan pigs.

  15. Seasonal variations of gene expression biomarkers in Mytilus galloprovincialis cultured populations: temperature, oxidative stress and reproductive cycle as major modulators.

    Science.gov (United States)

    Jarque, Sergio; Prats, Eva; Olivares, Alba; Casado, Marta; Ramón, Montserrat; Piña, Benjamin

    2014-11-15

    The blue mussel Mytilus galloprovincialis has been used as monitoring organism in many biomonitoring programs because of its broad distribution in South European sea waters and its physiological characteristics. Different pollution-stress biomarkers, including gene expression biomarkers, have been developed to determine its physiological response to the presence of different pollutants. However, the existing information about basal expression profiles is very limited, as very few biomarker-based studies were designed to reflect the natural seasonal variations. In the present study, we analyzed the natural expression patterns of several genes commonly used in biomonitoring, namely ferritin, metallothionein, cytochrome P450, glutathione S-transferase, heat shock protein and the kinase responsive to stress KRS, during an annual life cycle. Analysis of mantle-gonad samples of cultured populations of M. galloprovincialis from the Delta del Ebro (North East Spain) showed natural seasonal variability of these biomarkers, pointing to temperature and oxidative stress as major abiotic modulators. In turn, the reproductive cycle, a process that can be tracked by VCLM7 expression, and known to be influenced by temperature, seems to be the major biotic factor involved in seasonality. Our results illustrate the influence of environmental factors in the physiology of mussels through their annual cycle, a crucial information for the correct interpretation of responses under stress conditions.

  16. Variation in the vitamin D receptor gene is not associated with risk of colorectal cancer in the Czech Republic.

    LENUS (Irish Health Repository)

    Hughes, David J

    2012-02-01

    PURPOSE: Increased levels of vitamin D may protect against colorectal cancer (CRC) development and recurrence. Accumulating epidemiologic evidence suggests these effects may be partly mediated by genetic variants of the vitamin D receptor (VDR) proposed to be associated with altered risk of CRC. We wished to determine if common VDR polymorphisms affected CRC risk in the Czech Republic, a homogenous European population with a high CRC incidence rate. METHODS: Frequencies of the common VDR gene polymorphisms rs2238136, rs1544410 (BsmI), rs7975232 (ApaI), and rs731236 (TaqI) were determined using allele-specific PCR in a case control analysis of a series of 754 CRC patients and 627 patients without malignant disease recruited from centers throughout the Czech Republic. Unconditional logistic regression was used to calculate odds ratios and 95% confidence intervals for the association between these variants and risk of CRC. RESULTS: None of the four polymorphisms tested had any significant effect on CRC risk. No significant differences were observed in susceptibility when the population was stratified by anatomical sub-site, sex, BMI, smoking, alcohol, or presence of polyps. CONCLUSIONS: We conclude that common variation in the VDR gene had little effect on its own on predisposition to sporadic CRC in the Czech population.

  17. Contribution of genotype and ethnicity to bone mineral density variation in Caucasians and Chinese:a test for five candidate genes for bone mass

    Institute of Scientific and Technical Information of China (English)

    Volodymyr Dvornyk; LIU Peng-yuan; LONG Ji-rong; ZHANG Yuan-yuan; LEI Shu-feng; Robert R Recker; DENG Hong-wen

    2005-01-01

    Background Ethnicity is shown to be one of important factors affacting bone mineral density (BMD).The present study was performed to compare the association of six markers for five candidate genes with BMD variation in two populations of different ethnicity, Caucasian and Chinese, and the contribution of genotype and ethnicity to this variation in the populations.Methods The studied restriction fragment length polymorphisms were BsaH Ⅰ of the calcium-sensing receptor gene, SacⅠ of the α2HS-glycoprotein (AHSG) gene, PvuⅡ and XbaⅠ of the oestrogen receptor α gene, ApaⅠ of the vitamin D receptor (VDR) gene and BstBⅠ of the parathyroid hormone gene.The association of these markers with BMD was analysed by one-way and two-way ANOVA with adjustment for covariates.Results Two polymorphisms, AHSG-SacⅠ and VDR-ApaⅠ, showed no association with BMD, while the others were associated with BMD variation at some skeletal sites in either males or females.The polymorphisms indicated clear distinctions between the associations depending on ethnicity, gender and skeletal site.Similar patterns were observed in their contribution to the total population BMD variation.Ethnicity appears to have a larger effect on the total population BMD variation in females than in males.It may account, on the average, for about 2% total population BMD variation at the spine of females and about 1% at the hip of males and females.Conclusion The results of the present study suggest that significant interethnic differentiation at some loci may contribute to the significant interethnic difference in BMD.However, this contribution apparently is not large.

  18. vsp Gene Expression by Giardia lamblia Clone GS/M-83-H7 during Antigenic Variation In Vivo and In Vitro

    OpenAIRE

    2001-01-01

    Giardia lamblia infections are associated with antigenic variation of the parasite, which is generated by a continuous change of the variant-specific surface proteins (VSPs). Many investigations on the process of antigenic variation were based on the use of G. lamblia clone GS/M-83-H7, which expresses VSP H7 as its major surface antigen. In the present study, mice were infected with the aforementioned clonal line to investigate vsp gene expression during the complex process of antigenic varia...

  19. Variation and evolution of the ABC transporter genes ABCB1, ABCC1, ABCG2, ABCG5 and ABCG8: implication for pharmacogenetics and disease.

    Science.gov (United States)

    Silverton, Latoya; Dean, Michael; Moitra, Karobi

    2011-01-01

    The ATP-binding cassette (ABC) transporter genes are ubiquitous in the genomes of all vertebrates. Some of these transporters play a key role in xenobiotic defense and are endowed with the capacity to efflux harmful toxic substances. A major role in the evolution of the vertebrate ABC genes is played by gene duplication. Multiple gene duplication and deletion events have been identified in ABC genes, resulting in either gene birth or gene death indicating that the process of gene evolution is still ongoing in this group of transporters. Additionally, polymorphisms in these genes are linked to variations in expression, function, drug disposition and drug response. Single nucleotide polymorphisms in the ABC genes may be considered as markers of individual risk for adverse drug reactions or susceptibility to complex diseases as they can uniquely influence the quality and quantity of gene product. As the ABC genes continue to evolve, globalization will yield additional migration and racial admixtures that will have far reaching implications for the pharmacogenetics of this unique family of transporters in the context of human health.

  20. Mestrado profissional como prática acadêmica Mestrado profissional como prática acadêmica

    OpenAIRE

    Fischer,Tânia

    2011-01-01

    Neste trabalho, discute-se o mestrado profissional como prática acadêmica, reconstituindo itinerários e identificando configurações, tensões e dilemas desse tipo de curso. Propõe-se que o mestrado profissional seja valorizado como experiência inovadora capaz de contribuir para a renovação da pós-graduação brasileira. The aim of this paper is to discuss the professional masters course as an academic activity. The itineraries, pathways, configurations, tensions and dilemmas of this type of c...

  1. The association of adiponectin gene promoter variations with non-small cell lung cancer in a Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Yingfu Li

    Full Text Available Recently, in vitro studies have demonstrated that adiponectin has antiangiogenic and tumor growth-limiting properties. Additionally, serum adiponectin levels have been associated with the risk of several cancers; specifically, serum adiponectin was significantly lower in lung cancer patients with advanced-stage disease. In this study, we examined the association of adiponectin gene promoter variations associated with adiponectin gene expression and plasma levels in non-small cell lung cancer (NSCLC in a Han Chinese population. A total of 319 patients with NSCLC and 489 healthy individuals were recruited to evaluate the association of four adiponectin gene promoter single-nucleotide polymorphisms (SNPs (SNP-12140G>A, SNP-11426A>G, SNP-11391G>A and SNP-11377C>G with NSCLS risk. Additionally, we constructed haplotypes of these four SNPs and evaluated the association of these haplotypes with NSCLS risk. Our results showed that among these four SNPs, only SNP-12140G>A was associated with NSCLC risk (P0.05. Additionally, an association analysis of the four SNPs stratified into pathologic stages I+II and III+IV showed that these SNPs did not exhibit significant differences between pathologic stages I+II and III+IV. Moreover, we did not observe any differences in allele and genotype frequency for these SNPs between adenocarcinoma and squamous cell carcinoma. Our results indicated that the G allele of SNP-12140 may be a risk factor for NSCLC (OR = 1.516; 95% CI: 1.098-2.094 in this Han Chinese population.

  2. Copy number variation and missense mutations of the agouti signaling protein (ASIP) gene in goat breeds with different coat colors.

    Science.gov (United States)

    Fontanesi, L; Beretti, F; Riggio, V; Gómez González, E; Dall'Olio, S; Davoli, R; Russo, V; Portolano, B

    2009-01-01

    In goats, classical genetic studies reported a large number of alleles at the Agouti locus with effects on coat color and pattern distribution. From these early studies, the dominant A(Wt) (white/tan) allele was suggested to cause the white color of the Saanen breed. Here, we sequenced the coding region of the goat ASIP gene in 6 goat breeds (Girgentana, Maltese, Derivata di Siria, Murciano-Granadina, Camosciata delle Alpi, and Saanen), with different coat colors and patterns. Five single nucleotide polymorphisms (SNPs) were identified, 3 of which caused missense mutations in conserved positions of the cysteine-rich carboxy-terminal domain of the protein (p.Ala96Gly, p.Cys126Gly, and p.Val128Gly). Allele and genotype frequencies suggested that these mutations are not associated or not completely associated with coat color in the investigated goat breeds. Moreover, genotyping and sequencing results, deviation from Hardy-Weinberg equilibrium, as well as allele copy number evaluation from semiquantitative fluorescent multiplex PCR, indicated the presence of copy number variation (CNV) in all investigated breeds. To confirm the presence of CNV and evaluate its extension, we applied a bovine-goat cross-species array comparative genome hybridization (aCGH) experiment using a custom tiling array based on bovine chromosome 13. aCGH results obtained for 8 goat DNA samples confirmed the presence of CNV affecting a region of less that 100 kb including the ASIP and AHCY genes. In Girgentana and Saanen breeds, this CNV might cause the A(Wt) allele, as already suggested for a similar structural mutation in sheep affecting the ASIP and AHCY genes, providing evidence for a recurrent interspecies CNV. However, other mechanisms may also be involved in determining coat color in these 2 breeds.

  3. Association between cholesteryl ester transfer protein gene polymorphisms and variations in lipid levels in patients with coronary heart disease

    Institute of Scientific and Technical Information of China (English)

    郑克勤; 张思仲; 贺勇; 张立; 张克兰; 黄德嘉; 孙岩

    2004-01-01

    Background The TaqⅠB, MspⅠ and I405V polymorphisms of cholesteryl ester transfer protein (CETP), an important regulatory factor of lipid metabolism, have been attracted much more attention by the researchers. In this study, we investigated the associations between these 3 polymorphisms of CETP gene and variations in plasma lipid and lipoprotein levels in patients with coronary heart disease (CHD).Methods Genomic DNA was extracted from leukocytes of 203 CHD patients and 100 control subjects using the salting out method. Genotyping of the CETP gene was performed using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) techniques. Statistical analysis was conducted using the SPSS 10.0 software package.Results The distribution of allele and genotype frequencies of the TaqⅠB, MspⅠ, and I405V polymorphisms was similar in the CHD patient group and the control group. The B1B1 genotype of the TaqⅠB polymorphism was associated with significantly higher TC (P=0.039) and LDL-C (P=0.044) levels than the B2B2 genotype in CHD patients, and with significantly higher LDL-C (P=0.034) levels than the B2B2 genotype in controls. Homozygotes of the I405V polymorphism exhibited significantly higher HDL-C levels than VV homozygotes among control subjects (P=0.023). In male CHD patients with unambiguously assigned haplotypes, B2-M2-V/B2-M2-I patients demonstrated significantly higher HDL-C concentrations than B1-M2-V/B1-M2-I (P=0.023) and B1-M2-V/B1-M2-V patients (P=0.047). Conclusions Genetic variations in the CETP gene may account for a significant proportion of the differences in plasma lipid and lipoprotein concentrations among the general population. The B1B1 genotype of the TaqⅠB polymorphism is probably a genetic risk factor for CHD in the study population.

  4. A common variation within the STEAP4 gene exons is associated with obesity in Uygur general population

    Institute of Scientific and Technical Information of China (English)

    GUO Yan-ying; LI Nan-fang; ZHOU Ling; YAO Xiao-guang; WANG Hong-mei; ZHANG Ju-hong; LUO Wen-li

    2011-01-01

    Background Coordinated regulation of nutrient and inflammatory responses by six transmembrane epithelial antigen of prostate 4 (STEAP4) was essential for metabolic homeostasis. STEAP4 expression in human white adipose tissuewas associated with obesity. This study aimed to evaluate association between STEAP4 genetic polymorphisms and obesity in Uygur Chinese general population.Methods The functional regions of STEAP4 gene were sequenced in 96 Uygur with obesity (body mass index (BMI)>30 kg/m2). Representative variations were selected according to the function and linkage disequilibrium and genotyped in 1507 obesity (BMI ≥25 kg/m2) and 825 non-obesity control (BMI <25 kg/m2), all of whom were selected from epidemiology study of obesity-related diseases during January to February 2007 among Uygur population in Hetian area of Xinjiang Uygur Autonomous Region.Results Fourteen novel and 6 known single nucleotide polymorphism (SNPs), including 2 nonsynonymous SNPs (nsSNPs), in the STEAP4 gene were identified. Of the 3 representative SNPs, the nsSNP rs1981529 (Gly75Asp, 224A/G)was significantly associated with obesity phenotype (additive P/Pc=0.001/0.006, dominant P/Pc=0.003/0.018, odds ratio (OR) and 95% confidence interval (CI) adjusted for age, gender and drinking 0.755 (0.641-0.890) and 0.750(0.621-0.907), respectively). By the multiple linear regression analysis, the quantitative phenotypes of BMI (P/Pc=0.002/0.004) and waist circumference (P/Pc=0.004/0.008) were found to be significantly associated with the genotypes of rs1981529 (Gly75Asp, 224A/G) in Uygur general population, and effect size (beta value) of one allele G of rs1981529 (Gly75Asp, 224A/G) was-0.553 kg/m2 for BMI and -1.311 cm for waist circumference after controlling age,gender and drinking factors.Conclusions The present study shows an association of the common variation rs1981529 (Gly75Asp, 224A/G) in the STEAP4 gene with obesity in Uygur general population. Further studies should replicate the

  5. Polymorphic variation in CHAT gene modulates general cognitive ability: An association study with random student cohort.

    Science.gov (United States)

    Liu, Xu; Shi, Yuanyu; Niu, Binbin; Shi, Zhangyan; Li, Junlin; Ma, Zhe; Wang, Jian; Gong, Pingyuan; Zheng, Anyun; Zhang, Fuchang; Gao, Xiaocai; Zhang, Kejin

    2016-03-23

    The choline O-acetyltransferase (CHAT) gene has been associated with various human disorders that involve cognitive impairment or deficiency. However, the influence of disease-associated variants of CHAT on normal individuals remains dubious. Here we demonstrated the impact of CHAT sequence variants (G-120A) on general human cognitive ability in a cohort of 750 Chinese undergraduate students. A multiple choice questionnaire was used to obtain basic demographic information, such as parents' occupations and education levels. We also administered and scored the Raven's Standard Progressive Matrices (RSPM). A one-way analysis of variance (ANOVA) and Kruskal-Wallis test (K-W) revealed a significant association between sequence polymorphisms of G-120A and individuals' Raven score (p=0.031 for ANOVA and p=0.026 for K-W tests). Moreover, further hierarchical analysis showed a similar trend in the association between G-120A variants and Raven scores only in the female subjects (p=0.008 for ANOVA and p=0.024 for K-W tests) but not in the male subjects. The results of a multiple linear regression confirmed that after we controlled gender, age, birthplace and other non-genetic factors, CHAT G-120A polymorphisms still significantly influenced individual Raven scores (B=-0.70, SE=0.28, t=-2.50, p=0.013). Our results demonstrated that sequence variants of CHAT were associated with human cognitive ability in not only patients with psychiatric disorders but also normal healthy individuals. However, some issues remained indeterminable, such as gender differences and the extent of the influence on individuals' general cognitive abilities; thus, the further research using an independent random sample was required.

  6. Variation in siderophore biosynthetic gene distribution and production across environmental and faecal populations of Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Laura J Searle

    Full Text Available Iron is essential for Escherichia coli growth and survival in the host and the external environment, but its availability is generally low due to the poor solubility of its ferric form in aqueous environments and the presence of iron-withholding proteins in the host. Most E. coli can increase access to iron by excreting siderophores such as enterobactin, which have a very strong affinity for Fe3+. A smaller proportion of isolates can generate up to 3 additional siderophores linked with pathogenesis; aerobactin, salmochelin, and yersiniabactin. However, non-pathogenic E. coli are also able to synthesise these virulence-associated siderophores. This raises questions about their role in the ecology of E. coli, beyond virulence, and whether specific siderophores might be linked with persistence in the external environment. Under the assumption that selection favours phenotypes that confer a fitness advantage, we compared siderophore production and gene distribution in E. coli isolated either from agricultural plants or the faeces of healthy mammals. This population-level comparison has revealed that under iron limiting growth conditions plant-associated isolates produced lower amounts of siderophores than faecal isolates. Additionally, multiplex PCR showed that environmental isolates were less likely to contain loci associated with aerobactin and yersiniabactin synthesis. Although aerobactin was linked with strong siderophore excretion, a significant difference in production was still observed between plant and faecal isolates when the analysis was restricted to strains only able to synthesise enterobactin. This finding suggests that the regulatory response to iron limitation may be an important trait associated with adaptation to the non-host environment. Our findings are consistent with the hypothesis that the ability to produce multiple siderophores facilitates E. coli gut colonisation and plays an important role in E. coli commensalism.

  7. Variation in the interleukin-6 receptor gene associates with type 2 diabetes in Danish whites.

    Science.gov (United States)

    Hamid, Yasmin H; Urhammer, Søren A; Jensen, Dorit P; Glümer, Charlotte; Borch-Johnsen, Knut; Jørgensen, Torben; Hansen, Torben; Pedersen, Oluf

    2004-12-01

    Interleukin-6 (IL-6) is a pleiotropic cytokine involved in the pathophysiology of various human diseases such as type 2 diabetes and obesity. IL-6 signals via a heterodimeric receptor complex consisting of a soluble IL-6 alpha-subunit (IL-6 receptor [IL6R]) and a signal transducing subunit (gp130). The IL6R gene maps to an important candidate locus for type 2 diabetes on chromosome 1q21. An Asp358Ala polymorphism of the IL6R has been reported to associate with obesity in Pima Indians. We investigated the Asp358Ala polymorphism in relation to type 2 diabetes, obesity, and other pre-diabetic quantitative traits among Danish whites. By applying a recessive genetic model in a case-control study of 1,349 type 2 diabetic patients and 4,596 glucose-tolerant control subjects, we found a significant difference in genotype distribution (P = 0.008) and in allele frequency (Ala-allele 38.3% [95% CI 36.5-40.1] in diabetic subjects vs. 41.2% [40.2-42.2] in control subjects; P = 0.007). The odds ratio for the Asp/Asp carriers versus Ala/Ala carriers was 1.38 (1.09-1.71). Among 4,251 middle-aged glucose-tolerant subjects, the Asp358Ala polymorphism was not associated with estimates of obesity, post-oral glucose tolerance test serum insulin release, or the homeostasis model assessment of insulin resistance index. In conclusion, the Asp358Ala polymorphism of the IL6R associates with type 2 diabetes in Danish whites.

  8. género y rendimiento académico

    Directory of Open Access Journals (Sweden)

    Elberto Antonio Plazas

    2006-01-01

    Full Text Available Se pretendió establecer si existía un efecto de interacción entre el estatus sociométrico y el género sobre el rendimiento académico en una muestra de 156 estudiantes (88 niñas y 68 varones de educación secundaria de un reconocido colegio público de Valledupar (Colombia. El estatus sociométrico se evaluó según las nominaciones de los pares para categorizar a los estudiantes en seis grupos: popular, rechazado, excluido, controvertido, promedio y no clasificado. El análisis de varianza no reveló un efecto significativo de la interacción del estatus sociométrico y el género sobre el rendimiento académico, aunque sí mostró un efecto significativo independiente de las dos variables principales. En la prueba post hoc, se presentó una relación directa entre el rendimiento y la Preferencia Social, así como entre el rendimiento y el Impacto Social, y una diferencia significativa entre niñas y varones controvertidos.

  9. La gestión de conocimiento en las relaciones académico-empresariales. Un nuevo enfoque para analizar el impacto del conocimiento académico

    OpenAIRE

    2011-01-01

    La necesidad de introducir las teorías basadas en el conocimiento para explicar las Relaciones Académico-Empresariales (RA-E) y el impacto que ha generado el conocimiento académico en su zona de influencia, llamese empresas, parte básicamente de los señalamientos que hacia Acs, et al., (1991: 363) con respecto a la incapacidad de los estudios económicos para reconocer qué modos y mecanismos de transmisión de conocimientos se dan lugar entre la investigación académica y las empresas debido a l...

  10. El rendimiento académico en el nivel de educación media como factor asociado al rendimiento académico en la universidad

    OpenAIRE

    Villalba, Angélica María; Salcedo Barragán, Mileidy

    2008-01-01

    Esta investigación pretende establecer la relación entre el rendimiento académico en Educación Media y el rendimiento académico en la universidad; enfatizando en el aprovechamiento en Ciencias Naturales y Matemáticas. El estudio es descriptivo correlacional y las variables fueron; el rendimiento académico en Educación Media; los Indicadores de Rendimiento y la Trayectoria escolar. Se determinó la correlación entre las variables a través del coeficiente de correlación de Spearman. Los resultad...

  11. Variations in genes regulating neuronal migration predict reduced prefrontal cognition in schizophrenia and bipolar subjects from mediterranean Spain: a preliminary study.

    Science.gov (United States)

    Tabarés-Seisdedos, R; Escámez, T; Martínez-Giménez, J A; Balanzá, V; Salazar, J; Selva, G; Rubio, C; Vieta, E; Geijó-Barrientos, E; Martínez-Arán, A; Reiner, O; Martínez, S

    2006-01-01

    Both neural development and prefrontal cortex function are known to be abnormal in schizophrenia and bipolar disorder. In order to test the hypothesis that these features may be related with genes that regulate neuronal migration, we analyzed two genomic regions: the lissencephaly critical region (chromosome 17p) encompassing the LIS1 gene and which is involved in human lissencephaly; and the genes related to the platelet-activating-factor, functionally related to LIS1, in 52 schizophrenic patients, 36 bipolar I patients and 65 normal control subjects. In addition, all patients and the 25 control subjects completed a neuropsychological battery. Thirteen (14.8%) patients showed genetic variations in either two markers related with lissencephaly or in the platelet-activating-factor receptor gene. These patients performed significantly worse in the Wisconsin Card Sorting Test-Perseverative Errors in comparison with patients with no lissencephaly critical region/platelet-activating-factor receptor variations. The presence of lissencephaly critical region/platelet-activating-factor receptor variations was parametrically related to perseverative errors, and this accounted for 17% of the variance (P = 0.0001). Finally, logistic regression showed that poor Wisconsin Card Sorting Test-Perseverative Errors performance was the only predictor of belonging to the positive lissencephaly critical region/platelet-activating-factor receptor group. These preliminary findings suggest that the variations in genes involved in neuronal migration predict the severity of the prefrontal cognitive deficits in both disorders.

  12. Low variation in the polymorphic Clock gene poly-Q region despite population genetic structure across barn swallow (Hirundo rustica populations.

    Directory of Open Access Journals (Sweden)

    Roi Dor

    Full Text Available Recent studies of several species have reported a latitudinal cline in the circadian clock gene, Clock, which influences rhythms in both physiology and behavior. Latitudinal variation in this gene may hence reflect local adaptation to seasonal variation. In some bird populations, there is also an among-individual association between Clock poly-Q genotype and clutch initiation date and incubation period. We examined Clock poly-Q allele variation in the Barn Swallow (Hirundo rustica, a species with a cosmopolitan geographic distribution and considerable variation in life-history traits that may be influenced by the circadian clock. We genotyped Barn Swallows from five populations (from three subspecies and compared variation at the Clock locus to that at microsatellite loci and mitochondrial DNA (mtDNA. We found very low variation in the Clock poly-Q region, as >96% of individuals were homozygous, and the two other alleles at this locus were globally rare. Genetic differentiation based on the Clock poly-Q locus was not correlated with genetic differentiation based on either microsatellite loci or mtDNA sequences. Our results show that high diversity in Clock poly-Q is not general across avian species. The low Clock variation in the background of heterogeneity in microsatellite and mtDNA loci in Barn Swallows may be an outcome of stabilizing selection on the Clock locus.

  13. Low Variation in the Polymorphic Clock Gene Poly-Q Region Despite Population Genetic Structure across Barn Swallow (Hirundo rustica) Populations

    Science.gov (United States)

    Dor, Roi; Lovette, Irby J.; Safran, Rebecca J.; Billerman, Shawn M.; Huber, Gernot H.; Vortman, Yoni; Lotem, Arnon; McGowan, Andrew; Evans, Matthew R.; Cooper, Caren B.; Winkler, David W.

    2011-01-01

    Recent studies of several species have reported a latitudinal cline in the circadian clock gene, Clock, which influences rhythms in both physiology and behavior. Latitudinal variation in this gene may hence reflect local adaptation to seasonal variation. In some bird populations, there is also an among-individual association between Clock poly-Q genotype and clutch initiation date and incubation period. We examined Clock poly-Q allele variation in the Barn Swallow (Hirundo rustica), a species with a cosmopolitan geographic distribution and considerable variation in life-history traits that may be influenced by the circadian clock. We genotyped Barn Swallows from five populations (from three subspecies) and compared variation at the Clock locus to that at microsatellite loci and mitochondrial DNA (mtDNA). We found very low variation in the Clock poly-Q region, as >96% of individuals were homozygous, and the two other alleles at this locus were globally rare. Genetic differentiation based on the Clock poly-Q locus was not correlated with genetic differentiation based on either microsatellite loci or mtDNA sequences. Our results show that high diversity in Clock poly-Q is not general across avian species. The low Clock variation in the background of heterogeneity in microsatellite and mtDNA loci in Barn Swallows may be an outcome of stabilizing selection on the Clock locus. PMID:22216124

  14. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-03-01

    Background: Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multi-gene family. Although the function of the members of the PE_PGRS multi-gene family is not yet known, it is hypothesized that the PE_PGRS genes may be associated with genetic variability. Material and methods: Whole genome sequencing analysis was performed on (n= 37) extensively drug resistant (XDR) MTB strains from Pakistan which included Central Asian (n= 23), East African Indian (n= 2), X3 (n= 1), T group (n= 3) and Orphan (n= 8) MTB strains. Results: By analyzing 42 PE_PGRS genes, 111 SNPs were identified, of which 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in the PE_PGRS genes were as follows: 6, 9, 10 and 55 present in each of the CAS, EAI, Orphan, T1 and X3 XDR MTB strains studied. Deletions in PE_PGRS genes: 19, 21 and 23 were observed in 7 (35.0%) CAS1 and 3 (37.5%) in Orphan XDR MTB strains, while deletions in the PE_PGRS genes: 49 and 50 were observed in 36 (95.0%) CAS1 and all CAS, CAS2 and Orphan XDR MTB strains. An insertion in PE_PGRS6 gene was observed in all CAS, EAI3 and Orphan, while insertions in the PE_PGRS genes 19 and 33 were observed in 19 (95%) CAS1 and all CAS, CAS2, EAI3 and Orphan XDR MTB strains. Conclusion: Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs, Insertions and Deletions in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  15. Contrasting evolutionary patterns of 28S and ITS rRNA genes reveal high intragenomic variation in Cephalenchus (Nematoda): Implications for species delimitation.

    Science.gov (United States)

    Pereira, Tiago José; Baldwin, James Gordon

    2016-05-01

    Concerted evolution is often assumed to be the evolutionary force driving multi-family genes, including those from ribosomal DNA (rDNA) repeat, to complete homogenization within a species, although cases of non-concerted evolution have been also documented. In this study, sequence variation of 28S and ITS ribosomal RNA (rRNA) genes in the genus Cephalenchus is assessed at three different levels, intragenomic, intraspecific, and interspecific. The findings suggest that not all Cephalenchus species undergo concerted evolution. High levels of intraspecific polymorphism, mostly due to intragenomic variation, are found in Cephalenchus sp1 (BRA-01). Secondary structure analyses of both rRNA genes and across different species show a similar substitution pattern, including mostly compensatory (CBC) and semi-compensatory (SBC) base changes, thus suggesting the functionality of these rRNA copies despite the variation found in some species. This view is also supported by low sequence variation in the 5.8S gene in relation to the flanking ITS-1 and ITS-2 as well as by the existence of conserved motifs in the former gene. It is suggested that potential cross-fertilization in some Cephalenchus species, based on inspection of female reproductive system, might contribute to both intragenomic and intraspecific polymorphism of their rRNA genes. These results reinforce the potential implications of intragenomic and intraspecific genetic diversity on species delimitation, especially in biodiversity studies based solely on metagenetic approaches. Knowledge of sequence variation will be crucial for accurate species diversity estimation using molecular methods.

  16. Variation in regulator of G-protein signaling 17 gene (RGS17 is associated with multiple substance dependence diagnoses

    Directory of Open Access Journals (Sweden)

    Zhang Huiping

    2012-05-01

    Full Text Available Abstract Background RGS17 and RGS20 encode two members of the regulator of G-protein signaling RGS-Rz subfamily. Variation in these genes may alter their transcription and thereby influence the function of G protein-coupled receptors, including opioid receptors, and modify risk for substance dependence. Methods The association of 13 RGS17 and eight RGS20 tag single nucleotide polymorphisms (SNPs was examined with four substance dependence diagnoses (alcohol (AD, cocaine (CD, opioid (OD or marijuana (MjD] in 1,905 African Americans (AAs: 1,562 cases and 343 controls and 1,332 European Americans (EAs: 981 cases and 351 controls. Analyses were performed using both χ2 tests and logistic regression analyses that covaried sex, age, and ancestry proportion. Correlation of genotypes and mRNA expression levels was assessed by linear regression analyses. Results Seven RGS17 SNPs showed a significant association with at least one of the four dependence traits after a permutation-based correction for multiple testing (0.003≤Pempirical≤0.037. The G allele of SNP rs596359, in the RGS17 promoter region, was associated with AD, CD, OD, or MjD in both populations (0.005≤Pempirical≤0.019. This allele was also associated with significantly lower mRNA expression levels of RGS17 in YRI subjects (P = 0.002 and non-significantly lower mRNA expression levels of RGS17 in CEU subjects (P = 0.185. No RGS20 SNPs were associated with any of the four dependence traits in either population. Conclusions This study demonstrated that variation in RGS17 was associated with risk for substance dependence diagnoses in both AA and EA populations.

  17. Child maltreatment, inflammation, and internalizing symptoms: Investigating the roles of C-reactive protein, gene variation, and neuroendocrine regulation.

    Science.gov (United States)

    Cicchetti, Dante; Handley, Elizabeth D; Rogosch, Fred A

    2015-05-01

    Prior research has found inconsistent evidence regarding the association among childhood adversity, inflammation, and internalizing symptoms, perhaps because previous studies have yet to adequately integrate important factors such as the timing of the adversity, genetic variation, and other relevant processes such as neuroendocrine regulation. The aims of the present study were threefold: (a) to determine whether the effect of the timing of child maltreatment on C-reactive protein (CRP), an inflammatory marker, varies by CRP gene variation; (b) to explore whether links between salivary CRP and childhood internalizing symptoms depend on the presence and timing of maltreatment experiences; and (c) to investigate the role of CRP in the relations between child neuroendocrine regulation and internalizing symptoms and examine whether these associations are moderated by the presence and timing of child maltreatment. Participants included a sample of 267 maltreated and 222 nonmaltreated children (M age = 9.72, SD = 0.99; 52.4% male; 66% African American) who attended a summer day camp research program designed for school-aged low-income children. Department of Human Services records were examined to determine the onset and recency of maltreatment for children in the maltreated group. The results indicated that among children with recent onset maltreatment, those with at least one A allele from CRP single nucleotide polymorphism rs1417938 evidenced significantly higher CRP levels compared to recently maltreated children carrying the TT genotype. Moreover, higher levels of CRP were associated with higher levels of internalizing symptoms only for recently maltreated children. Finally, we did not find support for salivary CRP as a mechanism in the relation between neuroendocrine regulation and childhood internalizing symptoms. Our findings highlight the importance of the timing of child maltreatment and have important implications for characterizing variability in inflammation

  18. Variations in MALT1 Gene Disruptions Detected by FISH in 109 MALT Lymphomas Occurring in Different Primary Sites.

    Science.gov (United States)

    Mulligan, Shannon; Hu, P; Murphy, A; Han, J; Tam, M; Lin, P; Konoplev, S; Lennon, P A

    2011-01-01

    Mucosa-associated lymphoid tissue (MALT) lymphoma is a type of B-cell non-Hodgkin lymphoma that can originate in the gastrointestinal (GI) tract, thyroid, breasts, lungs, and skin. The most common genetic abnormality occurring in MALT lymphomas involves t(11;18)(q21;q21) in the gene MALT1. This translocation results in a chimeric fusion product between the genes ATI2 and MALT1, which generates a survival advantage in the lymphoma cells. The MALT1 disruption is more common in some MALT lymphomas, distinguished by site, than others. If identified, this variation in frequency could affect treatment courses and outcomes for each type of MALT lymphoma. The study included 109 MALT lymphoma sample specimens. The sample paraffin-embedded slides were pretreated, hybridized for FISH using a MALT1 break-apart probe, post-washed, and viewed using a fluorescent microscope. On each slide, 100 individual cells were counted by two independent readers, totaling 200 cells per case, and the percentage of cells containing a translocation within each sample was recorded. A conservative threshold of 8% was used to make a positive call. There were a total of 18 positive results in the 109 samples tested. The tissue specimens tested that yielded positive results include the colon (62.5%), lung (57.14%), skin (25%), eyelid/lacrimal gland (16.67%), stomach (6.45%), kidney (50%), and thyroid (100%). The sites that yielded only negative results (0%) include the breast, salivary gland, salivary gland/parotid, soft tissue/skin, conjunctiva/orbital, small intestine, nasal, and epidural mass. As hypothesized, a variation in the MALT1 disruption was found. This is the first study to examine MALT1 disruption in the soft tissue, nasal, and epidural mass. The positive results of this study, specifically the results for the colon and lung, and the negative breast and salivary gland results are consistent with previous studies examining the genetic aberrations in MALT lymphomas. These results indicate

  19. An LTR Retrotransposon-Derived Gene Displays Lineage-Specific Structural and Putative Species-Specific Functional Variations in Eutherians

    Science.gov (United States)

    Irie, Masahito; Koga, Akihiko; Kaneko-Ishino, Tomoko; Ishino, Fumitoshi

    2016-01-01

    Amongst the 11 eutherian-specific genes acquired from a sushi-ichi retrotransposon is the CCHC type zinc-finger protein-encoding gene SIRH11/ZCCHC16. Its contribution to eutherian brain evolution is implied because of its involvement in cognitive function in mice, possibly via the noradrenergic system. Although, the possibility that Sirh11/Zcchc16 functions as a non-coding RNA still remains, dN/dS ratios in pairwise comparisons between its orthologs have provided supportive evidence that it acts as a protein. It became a pseudogene in armadillos (Cingulata) and sloths (Pilosa), the only two extant orders of xenarthra, which prompted us to examine the lineage-specific variations of SIRH11/ZCCHC16 in eutherians. We examined the predicted SIRH11/ZCCHC16 open reading frame (ORF) in 95 eutherian species based on the genomic DNA information in GenBank. A large variation in the SIRH11/ZCCHC16 ORF was detected in several lineages. These include a lack of a CCHC RNA-binding domain in its C-terminus, observed in gibbons (Hylobatidae: Primates) and megabats (Megachiroptera: Chiroptera). A lack of the N-terminal half, on the other hand, was observed in New World monkeys (Platyrrhini: Primates) and species belonging to New World and African Hystricognaths (Caviomorpha and Bathyergidae: Rodents) along with Cetacea and Ruminantia (Cetartiodactyla). Among the hominoids, interestingly, three out of four genera of gibbons have lost normal SIRH11/ZCCHC16 function by deletion or the lack of the CCHC RNA-binding domain. Our extensive dN/dS analysis suggests that such truncated SIRH11/ZCCHC16 ORFs are functionally diversified even within lineages. Combined, our results show that SIRH11/ZCCHC16 may contribute to the diversification of eutherians by lineage-specific structural changes after its domestication in the common eutherian ancestor, followed by putative species-specific functional changes that enhanced fitness and occurred as a consequence of complex natural selection events

  20. Clock gene variation is associated with breeding phenology and maybe under directional selection in the migratory barn swallow.

    Directory of Open Access Journals (Sweden)

    Manuela Caprioli

    Full Text Available BACKGROUND: In diverse taxa, photoperiodic responses that cause seasonal physiological and behavioural shifts are controlled by genes, including the vertebrate Clock orthologues, that encode for circadian oscillator mechanisms. While the genetic network behind circadian rhythms is well described, relatively few reports exist of the phenological consequences of and selection on Clock genes in the wild. Here, we investigated variation in breeding phenology in relation to Clock genetic diversity in a long-distance migratory bird, the barn swallow (Hirundo rustica. METHODOLOGY/PRINCIPAL FINDINGS: In a sample of 922 adult barn swallows from a single population breeding in Italy we found one very common (Q(7 and three rare (Q(5, Q(6, Q(8 length variants of a functionally significant polyglutamine repeat. Rare (2.9% Q(7/Q(8 heterozygous females, but not males, bred significantly later than common (91.5% Q(7/Q(7 females, consistent with the expectation that 'long' alleles cause late breeding, as observed in a resident population of another bird species. Because breeding date depends on arrival date from migration, present results suggest that the association between breeding date and Clock might be mediated by migration phenology. In addition, fecundity selection appears to be operating against Q(7/Q(8 because late migrating/breeding swallows have fewer clutches per season, and late breeding has additional negative selection effects via reduced offspring longevity. Genotype frequencies varied marginally non-significantly with age, as Q(7/Q(8 frequency showed a 4-fold reduction in old individuals. This result suggests negative viability selection against Q(7/Q(8, possibly mediated by costs of late breeding. CONCLUSIONS/SIGNIFICANCE: This is the first study of migratory birds showing an association between breeding phenology and Clock genotype and suggesting that negative selection occurs on a phenologically deviant genotype. Low polymorphism at Clock may

  1. Genetic variation at the SLCO1B1 gene locus and low density lipoprotein cholesterol lowering response to pravastatin in the elderly

    Science.gov (United States)

    Our goal was to determine whether genetic variation at genes affecting statin metabolism or targets of statin therapy would influence low density lipoprotein (LDL) cholesterol lowering with pravastatin, baseline heart disease, or cardiac endpoints on trial. We examined associations of single nucleot...

  2. Revistas académicas mexicanas. Panorama y prospectiva

    Directory of Open Access Journals (Sweden)

    José Octavio Alonso Gamboa

    2015-01-01

    Full Text Available Se analiza un conjunto de revistas académicas mexicanas registradas en Latindex con el objetivo de conocer sus características principales y plantear una prospectiva. Se revisan datos proporcionados por el Directorio de calidad editorial, identificados en el Catálogo, así como las formas de acceso y distribución para las revistas en línea. Los principales resultados destacan una proliferación de revistas, el papel de las instituciones de educación superior como editoras, la preeminencia de revistas de ciencias sociales y de divulgación científica, limitado uso del inglés, buena visibilidad en bases de datos regionales, adopción de criterios de calidad y una tendencia creciente de revistas en línea, gratuitas y de acceso abierto.

  3. Estudiantes mejor informados: mejores resultados académicos

    Directory of Open Access Journals (Sweden)

    María-del-Pilar Sánchez-Martín

    2017-01-01

    Full Text Available El presente trabajo de investigación tiene como objetivo analizar la influencia que tiene sobre el rendimiento académico la información recibida por los estudiantes respecto al proceso de evaluación acumulativo por actividades realizadas durante los seminarios activos. Para ello se ha realizado un experimento con 3 condiciones intrasujeto en las que se controla la información disponible para 377 estudiantes. Los resultados obtenidos indican que, cuando se facilita información a los estudiantes sobre el proceso de evaluación, estos realizan un mayor esfuerzo en las actividades de los seminarios activos. También se han encontrado resultados significativos en el impacto que tiene, en las calificaciones finales de los estudiantes, la elección por parte de estos del peso porcentual de los seminarios activos en la evaluación final.

  4. Novel insights into the composition, variation, organization, and expression of the low-molecular-weight glutenin subunit gene family in common wheat.

    Science.gov (United States)

    Zhang, Xiaofei; Liu, Dongcheng; Zhang, Jianghua; Jiang, Wei; Luo, Guangbin; Yang, Wenlong; Sun, Jiazhu; Tong, Yiping; Cui, Dangqun; Zhang, Aimin

    2013-04-01

    Low-molecular-weight glutenin subunits (LMW-GS), encoded by a complex multigene family, play an important role in the processing quality of wheat flour. Although members of this gene family have been identified in several wheat varieties, the allelic variation and composition of LMW-GS genes in common wheat are not well understood. In the present study, using the LMW-GS gene molecular marker system and the full-length gene cloning method, a comprehensive molecular analysis of LMW-GS genes was conducted in a representative population, the micro-core collections (MCC) of Chinese wheat germplasm. Generally, >15 LMW-GS genes were identified from individual MCC accessions, of which 4-6 were located at the Glu-A3 locus, 3-5 at the Glu-B3 locus, and eight at the Glu-D3 locus. LMW-GS genes at the Glu-A3 locus showed the highest allelic diversity, followed by the Glu-B3 genes, while the Glu-D3 genes were extremely conserved among MCC accessions. Expression and sequence analysis showed that 9-13 active LMW-GS genes were present in each accession. Sequence identity analysis showed that all i-type genes present at the Glu-A3 locus formed a single group, the s-type genes located at Glu-B3 and Glu-D3 loci comprised a unique group, while high-diversity m-type genes were classified into four groups and detected in all Glu-3 loci. These results contribute to the functional analysis of LMW-GS genes and facilitate improvement of bread-making quality by wheat molecular breeding programmes.

  5. C-B3-01: Variation in Seven Obesity-Related Genes and Risk of Postmenopausal Breast Cancer

    Science.gov (United States)

    Feigelson, Heather S; Teras, Lauren R; Diver, W Ryan; Tang, Weining; Patel, Alpa V; Calle, Eugenia E; Bouzyk, Mark

    2010-01-01

    Background/Aims: Obesity has been consistently associated with postmenopausal breast cancer risk. Proteins secreted by adipose tissue or involved in regulating obesity may play a role in breast tumor development. We conducted a nested case- control study among white, postmenopausal women from the American Cancer Society Cancer Prevention Study II (CPS -II) Nutrition Cohort to determine whether genes associated with obesity increase risk of breast cancer. Methods: Tagging single nucleotide polymorphisms (tagSNPs) were selected to capture common variation across seven candidate genes that encode adipose- related proteins: ADRB2, ADRB3, GHRL, HSD11B1, IRS1, IRS2, SHC1. Thirty-nine SNPs were genotyped in 648 cases and 659 controls. Logistic regression models and haplotype analysis were used to examine the association between each tagSNP and risk of breast cancer while adjusting for matching factors and potential confounders. We also examined whether these SNPs were associated with measures of adult adiposity. Results: Two of five tagSNPs in HSD11B1 were associated with breast cancer (rs11807619, P=0.006; rs932335, P=0.0002). The rs932335 C allele was associated with a nearly two-fold increased risk of breast cancer (OR=1.83; 95% CI: 1.01–3.33 for C/C versus G/G). The rs11807619 and rs932335 were highly correlated (r2=0.74), and when modeled as a haplotype, only haplotypes containing the rs932335 C allele were associated with breast cancer. Three of the eleven SNPs for IRS2 were associated with breast cancer (rs4773082, P=0.007; rs2289046, P=0.016; rs754204, P=0.03). When these 3 SNPs were examined as a haplotype, only the haplotype that included the G allele of rs2289046 was associated with breast cancer (OR=0.74, 95% CI: 0.62–0.90 for TGC compared to CAT). IRS2 rs2289046 and rs754204 were also associated with adult weight gain. None of the other SNPs in any gene investigated were associated with breast cancer or adiposity. Conclusions: Our results suggest that

  6. TAA repeat variation in the GRIK2 gene does not influence age at onset in Huntington's disease

    Science.gov (United States)

    Lee, Ji-Hyun; Lee, Jong-Min; Ramos, Eliana Marisa; Gillis, Tammy; Mysore, Jayalakshmi S.; Kishikawa, Shotaro; Hadzi, Tiffany; Hendricks, Audrey E.; Hayden, Michael R.; Morrison, Patrick J.; Nance, Martha; Ross, Christopher A.; Margolis, Russell L.; Squitieri, Ferdinando; Gellera, Cinzia; Gomez-Tortosa, Estrella; Ayuso, Carmen; Suchowersky, Oksana; Trent, Ronald J.; McCusker, Elizabeth; Novelletto, Andrea; Frontali, Marina; Jones, Randi; Ashizawa, Tetsuo; Frank, Samuel; Saint-Hilaire, Marie-Helene; Hersch, Steven M.; Rosas, Herminia D.; Lucente, Diane; Harrison, Madaline B.; Zanko, Andrea; Abramson, Ruth K.; Marder, Karen; Sequeiros, Jorge; Landwehrmeyer, G. Bernhard; Network, Ira Shoulson; Myers, Richard H.; MacDonald, Marcy E.; Gusella, James F.

    2013-01-01

    Huntington's disease is a neurodegenerative disorder caused by an expanded CAG trinucleotide repeat whose length is the major determinant of age at onset but remaining variation appears to be due in part to the effect of genetic modifiers. GRIK2, which encodes GluR6, a mediator of excitatory neurotransmission in the brain, has been suggested in several studies to be a modifier gene based upon a 3′ untranslated region TAA trinucleotide repeat polymorphism. Prior to investing in detailed studies of the functional impact of this polymorphism, we sought to confirm its effect on age at onset in a much larger dataset than in previous investigations. We genotyped the HD CAG repeat and the GRIK2 TAA repeat in DNA samples from 2,911 Huntington's disease subjects with known age at onset, and tested for a potential modifier effect of GRIK2 using a variety of statistical approaches. Unlike previous reports, we detected no evidence of an influence of the GRIK2 TAA repeat polymorphism on age at motor onset. Similarly, the GRIK2 polymorphism did not show significant modifier effect on psychiatric and cognitive age at onset in HD. Comprehensive analytical methods applied to a much larger sample than in previous studies do not support a role for GRIK2 as a genetic modifier of age at onset of clinical symptoms in Huntington's disease. PMID:22771793

  7. Variation of 184C→T of goat callipyge gene in different populations and its effect on body weight

    Institute of Scientific and Technical Information of China (English)

    Xianglong LI; Hailiang WANG; Rongyan ZHOU; Guiru ZHENG; Lanhui LI; Zunan SHEN

    2009-01-01

    In order to investigate its distribution in different goat populations, one SNP (184C→T, corresponding to AY850925) of goat callipyge (CLPG) gene recognized by Fork I was identified after sequencing 23 individuals from 10 breeds. PCR-RFLP was carried out according to the variation site in 584 goats of 14 populations from 11 provinces and autonomous regions in China. An interesting result was found that the Boer goat having the characteristics of double muscle had significantly higher T allele (0.2465) frequency and lower C allele (0.7535) frequency compared to other breeds. It could be inferred that the 184C→T mutation might be related to the double muscle characteristics of the Boer goat. The general linear model analysis showed that parental genotype had significant effect on the body weight of their offspring at different ages. It could be inferred that transition of 184C→T might be a paternal imprinting form, a polar over-dominance, in which only individuals that received the allele from their mother expressed the callipyge phenotype. The double muscle characteristics of the Boer goat might be related to its maternal genotype. More data with detailed information need to be investigated in order to confirm this assumption.

  8. Genetic diversity and its seasonal variation of Jiaozhou Bay phytoplankton determined by rbcL gene sequencing

    Institute of Scientific and Technical Information of China (English)

    LIU Yongjian; YANG Guanpin; GUAN Xiaojing; MEN Rongxin

    2006-01-01

    Ribulose-1, 5-bisphosphate carboxynase/oxygenase large subunit gene (rbcL) of Jiaozhou Bay phytoplankton was amplified from spring, summer and autumn surface seawater DNAs and cloned respectively. About 50 clones were randomly selected from each library and sequenced. If identical amino acid sequences are considered as the same operational taxonomy unit (OTU), 61 OTUs are identified according to inferred amino acid sequences, among them, 21 from spring seawater, 15 from summer seawater and 25 from autumn seawater. Shannon index calculated from OTU abundances reflects the genetic diversity of a community. The indexes of spring, summer and autumn surface seawater phytoplankton are 2.69, 2.44 and 2.76 respectively, indicating that phytoplankton genetic diversity of autumn seawater is the richest. Seasonal variation of phytoplankton community is significant; the community compositions of three seasons are almost completely different except for the two OTUs shared by summer and autumn. Surface seawater phytoplankton communities are possibly metacommunities different spatially and temporally.

  9. Large-Scale Evaluation of Common Variation in Regulatory T Cell–Related Genes and Ovarian Cancer Outcome

    DEFF Research Database (Denmark)

    Charbonneau, Bridget; Moysich, Kirsten B; Kalli, Kimberly R

    2014-01-01

    The presence of regulatory T cells (Treg) in solid tumors is known to play a role in patient survival in ovarian cancer and other malignancies. We assessed inherited genetic variations via 749 tag single-nucleotide polymorphisms (SNP) in 25 Treg-associated genes (CD28, CTLA4, FOXP3, IDO1, IL10, IL......10RA, IL15, 1L17RA, IL23A, IL23R, IL2RA, IL6, IL6R, IL8, LGALS1, LGALS9, MAP3K8, STAT5A, STAT5B, TGFB1, TGFB2, TGFB3, TGFBR1, TGRBR2, and TGFBR3) in relation to ovarian cancer survival. We analyzed genotype and overall survival in 10,084 women with invasive epithelial ovarian cancer, including 5......,248 high-grade serous, 1,452 endometrioid, 795 clear cell, and 661 mucinous carcinoma cases of European descent across 28 studies from the Ovarian Cancer Association Consortium (OCAC). The strongest associations were found for endometrioid carcinoma and IL2RA SNPs rs11256497 [HR, 1.42; 95% confidence...

  10. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-01-21

    Background Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multigene family. Although the function of PE_PGRS genes is unknown, it is hypothesized that the PE_PGRS genes may be associated with antigenic variability in MTB. Material and methods Whole genome sequencing analysis was performed on (n = 37) extensively drug-resistant (XDR) MTB strains from Pakistan, which included Lineage 1 (East African Indian, n = 2); Other lineage 1 (n = 3); Lineage 3 (Central Asian, n = 24); Other lineage 3 (n = 4); Lineage 4 (X3, n = 1) and T group (n = 3) MTB strains. Results There were 107 SNPs identified from the analysis of 42 PE_PGRS genes; of these, 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in PE_PGRS genes – 6, 9 and 10 – were common in all EAI, CAS, Other lineages (1 and 3), T1 and X3. Deletions (DELs) in PE_PGRS genes – 3 and 19 – were observed in 17 (80.9%) CAS1 and 6 (85.7%) in Other lineages (1 and 3) XDR MTB strains, while DELs in the PE_PGRS49 were observed in all CAS1, CAS, CAS2 and Other lineages (1 and 3) XDR MTB strains. All CAS, EAI and Other lineages (1 and 3) strains showed insertions (INS) in PE_PGRS6 gene, while INS in the PE_PGRS genes 19 and 33 were observed in 20 (95.2%) CAS1, all CAS, CAS2, EAI and Other lineages (1 and 3) XDR MTB strains. Conclusion Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs and INDELs in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  11. Identification and Characterization of Novel Variations in Platelet G-Protein Coupled Receptor (GPCR Genes in Patients Historically Diagnosed with Type 1 von Willebrand Disease.

    Directory of Open Access Journals (Sweden)

    Jacqueline Stockley

    Full Text Available The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12 could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =, both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =. Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.

  12. Comparative mitogenomic analyses of three scallops (Bivalvia: Pectinidae reveal high level variation of genomic organization and a diversity of transfer RNA gene sets

    Directory of Open Access Journals (Sweden)

    Kong Xiaoyu

    2009-05-01

    Full Text Available Abstract Background It can be seen from the available mollusk mitogenomes that the family Pectinidae exhibits the most variation in genome organization. In this study, comparative mitogenomic analyses were performed for three scallops from the subfamily Chlamydinae (Pectinidae, with the goal of characterizing the degree of variability of mitogenome organization and other characteristics among species from the same subfamily and exploring their possible evolution route. Findings The complete or nearly complete mtDNA sequences of scallop Mimachlamys nobilis (17 935 bp, Mizuhopecten yessoensis (20 964 bp and Chlamys farreri (17 035 bp were determined using long PCR amplification and primer walking sequencing strategy. Highly variable size difference of the three genomes resulted primarily from length and number variations of non-coding regions, and the major difference in gene content of the three scallop species are due to varying tRNA gene sets. Only 21, 16, and 17 tRNA genes were detected in the mitogenomes of M. nobilis, M. yessoensis and C. farreri, respectively. Remarkably, no trnS gene could be identified in any of the three scallops. A newly-detected trnA-like sequence within the mitogenome of M. yessoensis seems to exemplify the functional loss of a tRNA gene, and the duplication of trnD in M. yessoensis raises a fundamental question of whether the retention of the tRNA gene copy of 2-tRNAs is easier than that of 4-tRNAs. Analysis of putative evolutionary pathways of gene rearrangement indicates that transposition of neighboring gene blocks may play an important role in the evolution of mitogenomes in scallops. Parsimonious analysis of the genomic variations implies that the mitogenomes of M. yessoensis and C. farreri are likely to derive independently from a common ancestor that was closely related to M. nobilis. Conclusion Comparative mitogenomic analyses among three species from the subfamily Chlamydinae show that the three genomes

  13. Human brain harbors single nucleotide somatic variations in functionally relevant genes possibly mediated by oxidative stress [version 3; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Anchal Sharma

    2017-01-01

    Full Text Available Somatic variation in DNA can cause cells to deviate from the preordained genomic path in both disease and healthy conditions. Here, using exome sequencing of paired tissue samples, we show that the normal human brain harbors somatic single base variations measuring up to 0.48% of the total variations. Interestingly, about 64% of these somatic variations in the brain are expected to lead to non-synonymous changes, and as much as 87% of these represent G:C>T:A transversion events. Further, the transversion events in the brain were mostly found in the frontal cortex, whereas the corpus callosum from the same individuals harbors the reference genotype. We found a significantly higher amount of 8-OHdG (oxidative stress marker in the frontal cortex compared to the corpus callosum of the same subjects (pT:A transversions in the cortex. We found significant enrichment for axon guidance and related pathways for genes harbouring somatic variations. This could represent either a directed selection of genetic variations in these pathways or increased susceptibility of some loci towards oxidative stress. This study highlights that oxidative stress possibly influence single nucleotide somatic variations in normal human brain.

  14. Associations of ADH and ALDH2 gene variation with self report alcohol reactions, consumption and dependence: an integrated analysis

    Science.gov (United States)

    Macgregor, Stuart; Lind, Penelope A.; Bucholz, Kathleen K.; Hansell, Narelle K.; Madden, Pamela A.F.; Richter, Melinda M.; Montgomery, Grant W.; Martin, Nicholas G.; Heath, Andrew C.; Whitfield, John B.

    2009-01-01

    Alcohol dependence (AD) is a complex disorder with environmental and genetic origins. The role of two genetic variants in ALDH2 and ADH1B in AD risk has been extensively investigated. This study tested for associations between nine polymorphisms in ALDH2 and 41 in the seven ADH genes, and alcohol-related flushing, alcohol use and dependence symptom scores in 4597 Australian twins. The vast majority (4296) had consumed alcohol in the previous year, with 547 meeting DSM-IIIR criteria for AD. There were study-wide significant associations (P < 2.3 × 10−4) between ADH1B-Arg48His (rs1229984) and flushing and consumption, but only nominally significant associations (P < 0.01) with dependence. Individuals carrying the rs1229984 G-allele (48Arg) reported a lower prevalence of flushing after alcohol (P = 8.2 × 10−7), consumed alcohol on more occasions (P = 2.7 × 10−6), had a higher maximum number of alcoholic drinks in a single day (P = 2.7 × 10−6) and a higher overall alcohol consumption (P = 8.9 × 10−8) in the previous year than those with the less common A-allele (48His). After controlling for rs1229984, an independent association was observed between rs1042026 (ADH1B) and alcohol intake (P = 4.7 × 10−5) and suggestive associations (P < 0.001) between alcohol consumption phenotypes and rs1693482 (ADH1C), rs1230165 (ADH5) and rs3762894 (ADH4). ALDH2 variation was not associated with flushing or alcohol consumption, but was weakly associated with AD measures. These results bridge the gap between DNA sequence variation and alcohol-related behavior, confirming that the ADH1B-Arg48His polymorphism affects both alcohol-related flushing in Europeans and alcohol intake. The absence of study-wide significant effects on AD results from the low P-value required when testing multiple single nucleotide polymorphisms and phenotypes. PMID:18996923

  15. Association of 5' end neuregulin-1 (NRG1) gene variation with subcortical medial frontal microstructure in humans.

    Science.gov (United States)

    Winterer, Georg; Konrad, Andreas; Vucurevic, Goran; Musso, Francesco; Stoeter, Peter; Dahmen, Norbert

    2008-04-01

    ., Lemke, G., Sainz, J., Johannesson, G., Andresson, T., Gudbjartsson, D., Manolescu, A., Frigge, M.L., Gurney, M.E., Kong, A., Gulcher, J.R., Petursson, H., Stefansson, K. 2002. Neuregulin-1 and susceptibility to schizophrenia. Am. J. Hum. Genet. 71, 877-892). As predicted, we found medial frontal FA to be significantly associated with this NRG1 gene variation. Using voxel-based morphometry (VBM), we could largely exclude the possibility that this genotype effect is indirectly caused by genotype-dependent effects on brain volume. This is the first demonstration that SNP8NRG221533 of the NRG1 gene affects medial frontal white matter microstructure in humans. As the degree of neuronal myelination contributes to structural integrity, our finding further supports a potential role of NRG1 in neuronal myelination in the human brain. By extension, our findings suggest that SNP8NRG221533 may contribute to the risk for the complex polygenic illness schizophrenia via its impact on myelination in frontal lobe white matter.

  16. Patterns of nucleotide sequence variation in ICAM1 and TNF genes in twelve ethnic groups of India: roles of demographic history and natural selection

    Indian Academy of Sciences (India)

    Sanghamitra Sengupta; Shabana Farheen; Neelanjana Mukherjee; Partha P. Majumder

    2007-12-01

    We have studied DNA sequence variation in and around the genes ICAM1 and TNF, which play functional and correlated roles in inflammatory processes and immune cell responses, in 12 diverse ethnic groups of India, with a view to investigating the relative roles of demographic history and natural selection in shaping the observed patterns of variation. The total numbers of single nucleotide polymorphisms (SNPs) detected at the ICAM1 and TNF loci were 29 and 12, respectively. Haplotype and allele frequencies differed significantly across populations. The site frequency spectra at these loci were significantly different from those expected under neutrality, and showed an excess of intermediate-frequency variants consistent with balancing selection. However, as expected under balancing selection, there was no significant reduction of $F_{ST}$ values compared to neutral autosomal loci. Mismatch distributions were consistent with population expansion for both loci. On the other hand, the phylogenetic network among haplotypes for the TNF locus was similar to expectations under population expansion, while that for the ICAM1 was as expected under balancing selection. Nucleotide diversity at the ICAM1 locus was an order of magnitude lower in the promoter region, compared to the introns or exons, but no such difference was noted for the TNF gene. Thus, we conclude that the pattern of nucleotide variation in these genes has been modulated by both demographic history and selection. This is not surprising in view of the known allelic associations of several polymorphisms in these genes with various diseases, both infectious and noninfectious.

  17. A combination of PhP typing and β-d-glucuronidase gene sequence variation analysis for differentiation of Escherichia coli from humans and animals.

    Science.gov (United States)

    Masters, N; Christie, M; Katouli, M; Stratton, H

    2015-06-01

    We investigated the usefulness of the β-d-glucuronidase gene variance in Escherichia coli as a microbial source tracking tool using a novel algorithm for comparison of sequences from a prescreened set of host-specific isolates using a high-resolution PhP typing method. A total of 65 common biochemical phenotypes belonging to 318 E. coli strains isolated from humans and domestic and wild animals were analysed for nucleotide variations at 10 loci along a 518 bp fragment of the 1812 bp β-d-glucuronidase gene. Neighbour-joining analysis of loci variations revealed 86 (76.8%) human isolates and 91.2% of animal isolates were correctly identified. Pairwise hierarchical clustering improved assignment; where 92 (82.1%) human and 204 (99%) animal strains were assigned to their respective cluster. Our data show that initial typing of isolates and selection of common types from different hosts prior to analysis of the β-d-glucuronidase gene sequence improves source identification. We also concluded that numerical profiling of the nucleotide variations can be used as a valuable approach to differentiate human from animal E. coli. This study signifies the usefulness of the β-d-glucuronidase gene as a marker for differentiating human faecal pollution from animal sources.

  18. Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

    Science.gov (United States)

    Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2013-01-16

    The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples.

  19. Variation in Dehydration Tolerance, ABA Sensitivity and Related Gene Expression Patterns in D-Genome Progenitor and Synthetic Hexaploid Wheat Lines

    Directory of Open Access Journals (Sweden)

    Yumeto Kurahashi

    2009-06-01

    Full Text Available The wild wheat Aegilops tauschii Coss. has extensive natural variation available for breeding of common wheat. Drought stress tolerance is closely related to abscisic acid (ABA sensitivity. In this study, 17 synthetic hexaploid wheat lines, produced by crossing the tetraploid wheat cultivar Langdon with 17 accessions of Ae. tauschii, were used for comparative analysis of natural variation in drought tolerance and ABA sensitivity. Ae. tauschii showed wide natural variation, with weak association between the traits. Drought-sensitive accessions of Ae. tauschii exhibited significantly less ABA sensitivity. D-genome variations observed at the diploid genome level were not necessarily reflected in synthetic wheats. However, synthetic wheats derived from the parental Ae. tauschii accessions with high drought tolerance were significantly more tolerant to drought stress than those from drought-sensitive accessions. Moreover, synthetic wheats with high drought tolerance showed significantly higher ABA sensitivity than drought-sensitive synthetic lines. In the hexaploid genetic background, therefore, weak association of ABA sensitivity with drought tolerance wasobserved. To study differences in gene expression patterns between stress-tolerant and -sensitive lines, levels of two Cor/Lea and three transcription factor gene transcripts were compared. The more tolerant accession of Ae. tauschii tended to accumulate more abundant transcripts of the examined genes than the sensitive accession under stress conditions. The expression patterns in the synthetic wheats seemed to be additive for parental lines exposed to drought and ABA treatments. However, the transcript levels of transcription factor genes in the synthetic wheats did not necessarily correspond to the postulated levels based on expression in parental lines. Allopolyploidization altered the expression levels of the stress-responsive genes in synthetic wheats.

  20. S-SCAM, a rare copy number variation gene, induces schizophrenia-related endophenotypes in transgenic mouse model.

    Science.gov (United States)

    Zhang, Nanyan; Zhong, Peng; Shin, Seung Min; Metallo, Jacob; Danielson, Eric; Olsen, Christopher M; Liu, Qing-song; Lee, Sang H

    2015-02-01

    Accumulating genetic evidence suggests that schizophrenia (SZ) is associated with individually rare copy number variations (CNVs) of diverse genes, often specific to single cases. However, the causality of these rare mutations remains unknown. One of the rare CNVs found in SZ cohorts is the duplication of Synaptic Scaffolding Molecule (S-SCAM, also called MAGI-2), which encodes a postsynaptic scaffolding protein controlling synaptic AMPA receptor levels, and thus the strength of excitatory synaptic transmission. Here we report that, in a transgenic mouse model simulating the duplication conditions, elevation of S-SCAM levels in excitatory neurons of the forebrain was sufficient to induce multiple SZ-related endophenotypes. S-SCAM transgenic mice showed an increased number of lateral ventricles and a reduced number of parvalbumin-stained neurons. In addition, the mice exhibited SZ-like behavioral abnormalities, including hyperlocomotor activity, deficits in prepulse inhibition, increased anxiety, impaired social interaction, and working memory deficit. Notably, the S-SCAM transgenic mice showed a unique sex difference in showing these behavioral symptoms, which is reminiscent of human conditions. These behavioral abnormalities were accompanied by hyperglutamatergic function associated with increased synaptic AMPA receptor levels and impaired long-term potentiation. Importantly, reducing glutamate release by the group 2 metabotropic glutamate receptor agonist LY379268 ameliorated the working memory deficits in the transgenic mice, suggesting that hyperglutamatergic function underlies the cognitive functional deficits. Together, these results contribute to validate a causal relationship of the rare S-SCAM CNV and provide supporting evidence for the rare CNV hypothesis in SZ pathogenesis. Furthermore, the S-SCAM transgenic mice provide a valuable new animal model for studying SZ pathogenesis.

  1. Genetic variation in the CYP1A1 gene is related to circulating PCB118 levels in a population-based sample

    Energy Technology Data Exchange (ETDEWEB)

    Lind, Lars [Department of Medical Sciences, Cardiovascular Epidemiology, Uppsala University, Uppsala (Sweden); Penell, Johanna [Department of Medical Sciences, Occupational and Environmental Medicine, Uppsala University, Uppsala (Sweden); Syvänen, Anne-Christine; Axelsson, Tomas [Department of Medical Sciences, Molecular Medicine and Science for Life Laboratory, Uppsala University, Uppsala (Sweden); Ingelsson, Erik [Department of Medical Sciences, Molecular Epidemiology and Science for Life Laboratory, Uppsala University, Uppsala (Sweden); Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford (United Kingdom); Morris, Andrew P.; Lindgren, Cecilia [Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford (United Kingdom); Salihovic, Samira; Bavel, Bert van [MTM Research Centre, School of Science and Technology, Örebro University, Örebro (Sweden); Lind, P. Monica, E-mail: monica.lind@medsci.uu.se [Department of Medical Sciences, Occupational and Environmental Medicine, Uppsala University, Uppsala (Sweden)

    2014-08-15

    Several of the polychlorinated biphenyls (PCBs), i.e. the dioxin-like PCBs, are known to induce the P450 enzymes CYP1A1, CYP1A2 and CYP1B1 by activating the aryl hydrocarbon receptor (Ah)-receptor. We evaluated if circulating levels of PCBs in a population sample were related to genetic variation in the genes encoding these CYPs. In the population-based Prospective Investigation of the Vasculature in Uppsala Seniors (PIVUS) study (1016 subjects all aged 70), 21 SNPs in the CYP1A1, CYP1A2 and CYP1B1 genes were genotyped. Sixteen PCB congeners were analysed by high-resolution chromatography coupled to high-resolution mass spectrometry (HRGC/ HRMS). Of the investigated relationships between SNPs in the CYP1A1, CYP1A2 and CYP1B1 and six PCBs (congeners 118, 126, 156, 169, 170 and 206) that captures >80% of the variation of all PCBs measured, only the relationship between CYP1A1 rs2470893 was significantly related to PCB118 levels following strict adjustment for multiple testing (p=0.00011). However, there were several additional SNPs in the CYP1A2 and CYP1B1 that showed nominally significant associations with PCB118 levels (p-values in the 0.003–0.05 range). Further, several SNPs in the CYP1B1 gene were related to both PCB156 and PCB206 with p-values in the 0.005–0.05 range. Very few associations with p<0.05 were seen for PCB126, PCB169 or PCB170. Genetic variation in the CYP1A1 was related to circulating PCB118 levels in the general elderly population. Genetic variation in CYP1A2 and CYP1B1 might also be associated with other PCBs. - Highlights: • We studied the relationship between PCBs and the genetic variation in the CYP genes. • Cross sectional data from a cohort of elderly were analysed. • The PCB levels were evaluated versus 21 SNPs in three CYP genes. • PCB 118 was related to variation in the CYP1A1 gene.

  2. Copy Number Variation of TLR-7 Gene and its Association with the Development of Systemic Lupus Erythematosus in Female Patients from Yucatan Mexico.

    Science.gov (United States)

    Pacheco, Guillermo Valencia; Cruz, Darig Cámara; González Herrera, Lizbeth J; Pérez Mendoza, Gerardo J; Adrián Amaro, Guadalupe I; Nakazawa Ueji, Yumi E; Angulo Ramírez, Angélica V

    2014-01-01

    Systemic lupus erythematosus (SLE) is a systemic autoimmune disease characterized by the production of autoantibodies against self-antigens, which occurs most often in women between 15 and 40 years of age. The innate immunity is involved in the pathogenesis of SLE through TLR- 7. Genetic factors such as copy number variation (CNV) of target genes may contribute to disease development, but this possible risk has not yet been studied in SLE patients from Yucatan, Mexico. The CNV of TLR-7 gene was determined by quantitative polymerase chain reaction assay using TaqMan probes in 80 SLE women and 150 control subjects. The results showed that 10% of SLE patients exhibited more than two copies of TLR-7 gene, whereas no mRNA overexpression was detected. These data suggested that increased CNV of the TLR-7 gene in Yucatan SLE women can be a risk factor for this disease.

  3. Escala de Estresores Académicos para la evaluación de los estresores académicos en estudiantes universitarios

    Directory of Open Access Journals (Sweden)

    Ramón G. Cabanach

    2016-07-01

    Full Text Available Este estudio tiene por objeto la evaluación de los estresores en el entorno académico. Los instrumentos empleados con este objetivo no siempre están adecuadamente adaptados al contexto universitario o son lo suficientemente exhaustivos como para englobar el elevado número de fuentes generadoras de estrés académico. El presente estudio utiliza una muestra de 1.196 estudiantes universitarios de diferentes titulaciones para describir y analizar la fiabilidad y validez de la Escala de Estresores Académicos, que forma parte del Cuestionario de Estrés Académico. Los resultados mostraron una escala compuesta por 54 ítems y 8 factores, que explican un 66% de la varianza, y que se mostró fiable tanto para el total de la escala ( = 0,96 como para cada uno de los factores, oscilando entre 0,81 y 0,94. Los factores identificados fueron deficiencias metodológicas del profesorado, sobrecarga académica, creencias sobre el rendimiento, intervenciones en público, clima social negativo, exámenes, carencia de valor de los contenidos y dificultades de participación.

  4. Copy number variation in chemokine superfamily: the complex scene of CCL3L-CCL4L genes in health and disease.

    Science.gov (United States)

    Colobran, R; Pedrosa, E; Carretero-Iglesia, L; Juan, M

    2010-10-01

    Genome copy number changes (copy number variations: CNVs) include inherited, de novo and somatically acquired deviations from a diploid state within a particular chromosomal segment. CNVs are frequent in higher eukaryotes and associated with a substantial portion of inherited and acquired risk for various human diseases. CNVs are distributed widely in the genomes of apparently healthy individuals and thus constitute significant amounts of population-based genomic variation. Human CNV loci are enriched for immune genes and one of the most striking examples of CNV in humans involves a genomic region containing the chemokine genes CCL3L and CCL4L. The CCL3L-CCL4L copy number variable region (CNVR) shows extensive architectural complexity, with smaller CNVs within the larger ones and with interindividual variation in breakpoints. Furthermore, the individual genes embedded in this CNVR account for an additional level of genetic and mRNA complexity: CCL4L1 and CCL4L2 have identical exonic sequences but produce a different pattern of mRNAs. CCL3L2 was considered previously as a CCL3L1 pseudogene, but is actually transcribed. Since 2005, CCL3L-CCL4L CNV has been associated extensively with various human immunodeficiency virus-related outcomes, but some recent studies called these associations into question. This controversy may be due in part to the differences in alternative methods for quantifying gene copy number and differentiating the individual genes. This review summarizes and discusses the current knowledge about CCL3L-CCL4L CNV and points out that elucidating their complete phenotypic impact requires dissecting the combinatorial genomic complexity posed by various proportions of distinct CCL3L and CCL4L genes among individuals.

  5. Increased brain size in mammals is associated with size variations in gene families with cell signalling, chemotaxis and immune-related functions.

    Science.gov (United States)

    Castillo-Morales, Atahualpa; Monzón-Sandoval, Jimena; Urrutia, Araxi O; Gutiérrez, Humberto

    2014-01-22

    Genomic determinants underlying increased encephalization across mammalian lineages are unknown. Whole genome comparisons have revealed large and frequent changes in the size of gene families, and it has been proposed that these variations could play a major role in shaping morphological and physiological differences among species. Using a genome-wide comparative approach, we examined changes in gene family size (GFS) and degree of encephalization in 39 fully sequenced mammalian species and found a significant over-representation of GFS variations in line with increased encephalization in mammals. We found that this relationship is not accounted for by known correlates of brain size such as maximum lifespan or body size and is not explained by phylogenetic relatedness. Genes involved in chemotaxis, immune regulation and cell signalling-related functions are significantly over-represented among those gene families most highly correlated with encephalization. Genes within these families are prominently expressed in the human brain, particularly the cortex, and organized in co-expression modules that display distinct temporal patterns of expression in the developing cortex. Our results suggest that changes in GFS associated with encephalization represent an evolutionary response to the specific functional requirements underlying increased brain size in mammals.

  6. Cylindrotheca closterium Is a Species Complex as Was Evidenced by the Variations of rbcL Gene and SSU rDNA

    Institute of Scientific and Technical Information of China (English)

    LI Haitao; YANG Guanpin; SUN Ying; WU Suihan; ZHANG Xiufang

    2007-01-01

    The genus Cylindrotheca consists of a small group of marine diatoms with a few species described. Eleven isolates of diatoms identified as Cylindrotheca closterium morphologically were obtained from Jiaozhou Bay with their nuclear-encoded small-subunit ribosomal RNA (SSU rDNA) and chloroplast-encoded rbcL gene sequences determined in this study. Interestingly, very high sequence divergences of SSU rDNA and rbcL gene were found among these isolates, and numerous nucleotide variation of rbcL gene caused relatively few variation of deduced amino acid sequence. Phylogenetic analyses based on SSU rDNA and rbcL gene, respectively, grouped the isolates into 6 clades. Phylogenetic tree of SSU rDNA placed all the Cylindrotheca isolates together, separating them into two lineages clearly. LineageⅠ was composed of the eleven C. closterium isolates obtained in this study together with another C. closterium isolate, but some clades were not well supported. LineageⅡ contained two C. closterium isolates and one C. fusiformis isolate. Phylogenetic analysis of rbcL gene also separated the Cylindrotheca isolates into two well-defined lineages. The eleven C. closterium isolates formed a lineage and all clades were supported strongly. Statistical comparisons of SSU rDNA indicated that the average distance within lineage Ⅰ was significantly higher than that of other microalgae species (P < 0.01). These results suggested the existence of cryptic species within C. closterium.

  7. The influence of population structure on gene expression and flowering time variation in the ubiquitous weed Capsella bursa-pastoris (Brassicaceae).

    Science.gov (United States)

    Kryvokhyzha, Dmytro; Holm, Karl; Chen, Jun; Cornille, Amandine; Glémin, Sylvain; Wright, Stephen I; Lagercrantz, Ulf; Lascoux, Martin

    2016-03-01

    Population structure is a potential problem when testing for adaptive phenotypic differences among populations. The observed phenotypic differences among populations can simply be due to genetic drift, and if the genetic distance between them is not considered, the differentiation may be falsely interpreted as adaptive. Conversely, adaptive and demographic processes might have been tightly associated and correcting for the population structure may lead to false negatives. Here, we evaluated this problem in the cosmopolitan weed Capsella bursa-pastoris. We used RNA-Seq to analyse gene expression differences among 24 accessions, which belonged to a much larger group that had been previously characterized for flowering time and circadian rhythm and were genotyped using genotyping-by-sequencing (GBS) technique. We found that clustering of accessions for gene expression retrieved the same three clusters that were obtained with GBS data previously, namely Europe, the Middle East and Asia. Moreover, the three groups were also differentiated for both flowering time and circadian rhythm variation. Correction for population genetic structure when analysing differential gene expression analysis removed all differences among the three groups. This may suggest that most differences are neutral and simply reflect population history. However, geographical variation in flowering time and circadian rhythm indicated that the distribution of adaptive traits might be confounded by population structure. To bypass this confounding effect, we compared gene expression differentiation between flowering ecotypes within the genetic groups. Among the differentially expressed genes, FLOWERING LOCUS C was the strongest candidate for local adaptation in regulation of flowering time.

  8. Los académicos en los noventa:¿actores, sujetos, espectadores o rehenes?

    OpenAIRE

    Manuel Gil Antón

    2000-01-01

    Se cuestiona el papel que han jugado los académicos de las universidades mexicanas en las transformaciones de la educación superior en la década de los noventa. Esbozado el contexto general de cambio y su importancia, se propone eludir la falsa dicotomía entre restaurar el pasado o instaurar, sin mediación reflexiva, un futuro esquemático. Se propone considerar al actual cuerpo académico nacional conformado por varias generaciones de académicos. Se establecen tres fases en cuanto a la modulac...

  9. vsp gene expression by Giardia lamblia clone GS/M-83-H7 during antigenic variation in vivo and in vitro.

    Science.gov (United States)

    Bienz, M; Siles-Lucas, M; Wittwer, P; Müller, N

    2001-09-01

    Giardia lamblia infections are associated with antigenic variation of the parasite, which is generated by a continuous change of the variant-specific surface proteins (VSPs). Many investigations on the process of antigenic variation were based on the use of G. lamblia clone GS/M-83-H7, which expresses VSP H7 as its major surface antigen. In the present study, mice were infected with the aforementioned clonal line to investigate vsp gene expression during the complex process of antigenic variation of the parasite. Trophozoites collected from the intestines of individual animals at different time points postinfection (p.i.) were analyzed directly for their vsp gene expression patterns, i.e., without cultivating the recovered parasites in vitro. Because few trophozoites were recovered at late time points p.i., a combined 5' rapid amplification of cDNA ends-reverse transcription-PCR approach was utilized. This allowed detection and subsequent sequence analysis of vsp gene transcripts upon generation of amplified cDNA analogues. The same PCR approach was applied for analysis of vsp gene expression in variants obtained after negative selection of axenic GS/M-83-H7 trophozoites by treatment with a cytotoxic, VSP H7-specific monoclonal antibody. In an overall view of the entire panel of in vivo- and in vitro-derived parasite populations, expression of 29 different vsp gene sequences could be demonstrated. In vivo antigenic variation of G. lamblia clone GS/M-83-H7 was shown to be a continuous process involving the consecutive appearance of relatively distinct sets of vsp transcripts. During the 42-day infection period investigated, this process activated at least 22 different vsp genes. Comparative molecular analyses of the amino acid level demonstrated that all cDNA segments identified encode structural elements typical of the terminal segment of Giardia VSP. The similarity of most of the GS/M-83-H7 VSP sequences identified in the present study supports previous

  10. SDF1 Gene Variation Is Associated with Circulating SDF1 alpha Level and Endothelial Progenitor Cell Number-The Bruneck Study

    OpenAIRE

    Xiao, Q.; Ye, S.; Oberhollenzer, F; Mayr, A; Jahangiri, M; Willeit, J.; Kiechl, S; Xu, Q.

    2008-01-01

    BACKGROUND: Stromal cell-derived factor-1 (SDF1) and its receptor CXC chemokine receptor 4 (CXCR4) play a critical role in progenitor cell homing, mobilization and differentiation. It would be interesting to assess the predictive value of SDF-1alpha level for EPC number, and to ascertain whether there is a relationship between SDF1 gene variation, plasma SDF-1alpha level, and the number and function of circulating EPCs. We also tested whether EPC number and function was related to CXCR4 gene ...

  11. entorno virtual de red académica

    Directory of Open Access Journals (Sweden)

    CLAUDIA JIMÉNEZ

    2007-01-01

    Full Text Available Este trabajo presenta un modelo conceptual para el armado de cursos flexibles, donde al estudiante se le permite realizar diferentes actividades para cumplir con los objetivos educativos de los mismos. El caso de estudio es la plataforma virtual de la red académica FORHUM (acrónimo de FORmación HUMana. Dicha plataforma fue concebida para facilitar el intercambio de conocimiento y la colaboración entre los miembros de una red de instituciones de Perú, Ecuador, Bolivia y Colombia que trabajan en temáticas del Hábitat. El modelo propuesto surgió de la evaluación del diseño de la central de ensamblaje de cursos en la plataforma virtual, en su primera versión, y del estudio de este proceso en otros entornos virtuales para la educación. El modelo de ensamblaje de cursos, aquí propuesto, permite la personalización de los mismos según diferentes estilos de aprendizaje, transferir el control del aprendizaje al estudiante y facilita la reutilización de objetos de aprendizaje creados por otros miembros de la red.

  12. The minor C-allele of rs2014355 in ACADS is associated with reduced insulin release following an oral glucose load

    OpenAIRE

    Pisinger Charlotta; Lauritzen Torsten; Sandbæk Annelli; Andersson Åsa; Sandholt Camilla H; Krarup Nikolaj T; Justesen Johanne M; Banasik Karina; Hornbak Malene; Witte Daniel R; Sørensen Thorkild IA; Pedersen Oluf; Hansen Torben

    2011-01-01

    Abstract Background A genome-wide association study (GWAS) using metabolite concentrations as proxies for enzymatic activity, suggested that two variants: rs2014355 in the gene encoding short-chain acyl-coenzyme A dehydrogenase (ACADS) and rs11161510 in the gene encoding medium-chain acyl-coenzyme A dehydrogenase (ACADM) impair fatty acid β-oxidation. Chronic exposure to fatty acids due to an impaired β-oxidation may down-regulate the glucose-stimulated insulin release and result in an increa...

  13. Capacidad predictiva de la autoeficacia académica sobre las dimensiones del autoconcepto en una muestra de adolescentes chilenos

    OpenAIRE

    García-Fernández, J.M.; Díaz-Herrero, A. (Ángela); Inglés, C.J. (Cándido J.); Torregrosa, M.S. (María Soledad); Lagos-San-Martín, N. (Nelly); Gonzálvez, C. (Carolina)

    2016-01-01

    El objetivo de este estudio fue analizar la capacidad predictiva de la autoefi cacia académica sobre las dimensiones del autoconcepto en una muestra de 860 estudiantes chilenos. El análisis de regresión logística reveló que la autoefi cacia académica fue un predictor positivo y signifi cativo de las escalas académicas (Matemáticas, Verbal y Académica General), no académicas (Habilidades Físicas, Apariencia Física, Relaciones con el Sexo Opuesto, Relaciones con el Mi...

  14. Copy number variation analysis detects novel candidate genes involved in follicular growth and oocyte maturation in a cohort of premature ovarian failure cases

    OpenAIRE

    Tšuiko, O.; Nõukas, M.; Žilina, O.; Hensen, K; Tapanainen, J.S.; Mägi, R.; Kals, M.; Kivistik, P. A.; Haller-Kikkatalo, K.; Salumets, A.; Kurg, A.

    2016-01-01

    STUDY QUESTION Can spontaneous premature ovarian failure (POF) patients derived from population-based biobanks reveal the association between copy number variations (CNVs) and POF? SUMMARY ANSWER CNVs can hamper the functional capacity of ovaries by disrupting key genes and pathways essential for proper ovarian function. WHAT IS KNOWN ALREADY POF is defined as the cessation of ovarian function before the age of 40 years. POF is a major reason for female infertility, although its cause remains...

  15. Allelic Variation in the Perennial Ryegrass FLOWERING LOCUS T Gene is Associated with Changes in Flowering Time across a Range of Populations

    DEFF Research Database (Denmark)

    Skøt, Leif; Sanderson, Ruth; Thomas, Ann

    2011-01-01

    The Arabidopsis (Arabidopsis thaliana) FLOWERING LOCUS T (FT) gene and its orthologs in other plant species (e.g. rice [Oryza sativa] OsFTL2/Hd3a) have an established role in the photoperiodic induction of flowering response. The genomic and phenotypic variations associated with the perennial...... ryegrass (Lolium perenne) ortholog of FT, designated LpFT3, was assessed in a diverse collection of nine European germplasm populations, which together constituted an association panel of 864 plants. Sequencing and genotyping of a series of amplicons derived from the nine populations, containing...... or structured association with further correction using genomic control indicated significant associations between LpFT3 and variation in flowering time. These associations were corroborated in a validation population segregating for the same major alleles. The most "diagnostic" region of genomic variation...

  16. Variation in the ovine hormone-sensitive lipase gene (HSL) and its association with growth and carcass traits in New Zealand Suffolk sheep.

    Science.gov (United States)

    Yang, Guo; Forrest, Rachel; Zhou, Huitong; Hickford, Jonathan

    2014-01-01

    The hormone-sensitive lipase (HSL) plays an important role in the regulation of lipolysis in adipose tissues, by catalysing a rate-limiting step in triglyceride hydrolysis. Variation within the human HSL gene (HSL) has been associated with an increased risk of obesity. In this study, variation within three regions (exon 3-4, exon 5-6 and exon 9) of ovine HSL was investigated in 538 Suffolk lambs bred from 13 independent sires using PCR-SSCP. Four sequence variants of intron 5 (designated A-D) and two variants of exon 9 (designated a and b) of ovine HSL were detected. No variation was found in exon 3-4 of the gene. The associations of the variation within ovine HSL with post-weaning growth and carcass traits including eye muscle depth (EMD), eye muscle width (EMW) and fat depth above the eye muscle (FDM) were assessed in 262 of the above 538 lambs using general linear mixed-effects models. In the single variant models, the presence of intron 5 A in a lamb's genotype was associated with reduced EMD (P = 0.036) and EMW (P = 0.018), whereas the presence of intron 5 C was associated with increased EMD (P HSL intron 5 variants and post-weaning growth, or between HSL exon 9 variants, post-weaning growth or carcass traits, were found.

  17. Association between allelic variation due to short tandem repeats in tRNA gene of Entamoeba histolytica and clinical phenotypes of amoebiasis.

    Science.gov (United States)

    Jaiswal, Virendra; Ghoshal, Ujjala; Mittal, Balraj; Dhole, Tapan N; Ghoshal, Uday C

    2014-05-01

    Genotypes of Entamoeba histolytica (E. histolytica) may contribute clinical phenotypes of amoebiasis such as amoebic liver abscess (ALA), dysentery and asymptomatic cyst passers state. Hence, we evaluated allelic variation due to short tandem repeats (STRs) in tRNA gene of E. histolytica and clinical phenotypes of amoebiasis. Asymptomatic cyst passers (n=24), patients with dysentery (n=56) and ALA (n=107) were included. Extracted DNA from stool (dysentery, asymptomatic cyst passers) and liver aspirate was amplified using 6 E. histolytica specific tRNA-linked STRs (D-A, A-L, N-K2, R-R, S-Q, and S(TGA)-D) primers. PCR products were subjected to sequencing. Association between allelic variation and clinical phenotypes was analyzed. A total of 9 allelic variations were found in D-A, 8 in A-L, 4 in N-K2, 5 in R-R, 10 in S(TAG)-D and 7 in S-Q loci. A significant association was found between allelic variants and clinical phenotypes of amoebiasis. This study reveals that allelic variation due to short tandem repeats (STRs) in tRNA gene of E. histolytica is associated different clinical outcome of amoebiasis.

  18. Design of a Comprehensive Biochemistry and Molecular Biology Experiment: Phase Variation Caused by Recombinational Regulation of Bacterial Gene Expression

    Science.gov (United States)

    Sheng, Xiumei; Xu, Shungao; Lu, Renyun; Isaac, Dadzie; Zhang, Xueyi; Zhang, Haifang; Wang, Huifang; Qiao, Zheng; Huang, Xinxiang

    2014-01-01

    Scientific experiments are indispensable parts of Biochemistry and Molecular Biology. In this study, a comprehensive Biochemistry and Molecular Biology experiment about "Salmonella enterica" serovar Typhi Flagellar phase variation has been designed. It consisted of three parts, namely, inducement of bacterial Flagellar phase variation,…

  19. Dynamic DNA cytosine methylation in the Populus trichocarpa genome: tissue-level variation and relationship to gene expression

    Directory of Open Access Journals (Sweden)

    Vining Kelly J

    2012-01-01

    Full Text Available Abstract Background DNA cytosine methylation is an epigenetic modification that has been implicated in many biological processes. However, large-scale epigenomic studies have been applied to very few plant species, and variability in methylation among specialized tissues and its relationship to gene expression is poorly understood. Results We surveyed DNA methylation from seven distinct tissue types (vegetative bud, male inflorescence [catkin], female catkin, leaf, root, xylem, phloem in the reference tree species black cottonwood (Populus trichocarpa. Using 5-methyl-cytosine DNA immunoprecipitation followed by Illumina sequencing (MeDIP-seq, we mapped a total of 129,360,151 36- or 32-mer reads to the P. trichocarpa reference genome. We validated MeDIP-seq results by bisulfite sequencing, and compared methylation and gene expression using published microarray data. Qualitative DNA methylation differences among tissues were obvious on a chromosome scale. Methylated genes had lower expression than unmethylated genes, but genes with methylation in transcribed regions ("gene body methylation" had even lower expression than genes with promoter methylation. Promoter methylation was more frequent than gene body methylation in all tissues except male catkins. Male catkins differed in demethylation of particular transposable element categories, in level of gene body methylation, and in expression range of genes with methylated transcribed regions. Tissue-specific gene expression patterns were correlated with both gene body and promoter methylation. Conclusions We found striking differences among tissues in methylation, which were apparent at the chromosomal scale and when genes and transposable elements were examined. In contrast to other studies in plants, gene body methylation had a more repressive effect on transcription than promoter methylation.

  20. Factores que intervienen en el rendimiento académico universitario: Un estudio de caso

    Directory of Open Access Journals (Sweden)

    Raúl Tomás Mora García

    2015-01-01

    Full Text Available Conocer los factores intervinientes en el rendimiento académico de los estudiantes es de vital importancia para mejorar el proceso de ense- ñanza-aprendizaje y la calidad universitaria. Esta investigación busca identificar los posibles factores que intervienen en el rendimiento acadé- mico de los estudiantes universitarios del grado en Arquitectura Técnica de la Universidad de Alicante. El estudio pretende determinar el poder explicativo y predictivo de nueve variables para pronosticar el rendi- miento académico de los estudiantes mediante regresión lineal múltiple. Se ha identificado que seis de las variables estudiadas son estadística- mente significativas y que dos de ellas tienen una gran influencia sobre el rendimiento académico.

  1. Identification ofFECH gene multiple variations in two Chinese patients with erythropoietic protoporphyria and a review

    Institute of Scientific and Technical Information of China (English)

    Zhang-biao LONG; Yong-wei WANG; Chen YANG; Gang LIU; Ya-li DU; Guang-jun NIE; Yan-zhong CHANG; Bing HAN

    2016-01-01

    Erythropoietic protoporphyria (EPP), an autosomal dominant disease, is caused by partial deficiency of ferrochelatase (FECH), which catalyzes the terminal step of heme biosynthesis because of loss-of-function mutations in theFECHgene. To date, only a few cases have been described in Asia. In this study, we describe the clinical features of two Chinese patients with EPP, with diagnosis confirmed by the increase of free protoporphyrin in eryth-rocytes, detection of plasma fluorescence peak at 630–634 nm, and analysis ofFECH gene mutations. Using gene scanning, we identified a smal deletion in theFECH gene (c.973 delA) in one proband (patient A) and a pathogenic FECH mutation (c.1232 G>T) in the other (patient B) and also observed some nucleotide variations (c.798 C>G, c.921 A>G, IVS1−23 C>T, IVS3+23 A>G, IVS9+35 C>T, and IVS3−48 T>C) in these patients. The family pedigree of patient A was then established by characterization of the genotype of the patient’s relatives. We also analyzed the potential perniciousness of the missense mutation with bioinformatic software, Polyphen and Sift. In summary, Chi-nese EPP patients have similar manifestations to those of Caucasians, and identification of the ChineseFECH gene mutations expands theFECH genotypic spectrum and may contribute to genetic counseling.%中文概要题目:中国两例红细胞生成性原卟啉病患者亚铁螯合酶基因多处突变的鉴定目的:通过亚铁螯合酶(FECH)基因突变检测和核苷酸多态性分析确诊疾病,分析中国人群中红细胞生成性原卟啉病(EPP)的基因谱。创新点:通过 FECH 基因检测和多态性分析可精准诊断EPP这一罕见病,可减少漏诊误诊。另外,本研究扩充了中国EPP患者FECH基因突变谱。方法:选取北京协和医院就诊疑似EPP患者两例,采用聚合酶链反应(PCR)扩增FECH基因和5-氨基酮戊酸合成酶(ALAS2)基因并进行测序,同时在美国国立生物技术

  2. Variation in stability of endogenous reference genes in fallopian tubes and endometrium from healthy and ectopic pregnant women.

    Science.gov (United States)

    Gebeh, Alpha K; Marczylo, Emma L; Amoako, Akwasi A; Willets, Jonathon M; Konje, Justin C

    2012-01-01

    RT-qPCR is commonly employed in gene expression studies in ectopic pregnancy. Most use RN18S1, β-actin or GAPDH as internal controls without validation of their suitability as reference genes. A systematic study of the suitability of endogenous reference genes for gene expression studies in ectopic pregnancy is lacking. The aims of this study were therefore to evaluate the stability of 12 reference genes and suggest those that are stable for use as internal control genes in fallopian tubes and endometrium from ectopic pregnancy and healthy non-pregnant controls. Analysis of the results showed that the genes consistently ranked in the top six by geNorm and NormFinder algorithms, were UBC, GAPDH, CYC1 and EIF4A2 (fallopian tubes) and UBC and ATP5B (endometrium). mRNA expression of NAPE-PLD as a test gene of interest varied between the groups depending on which of the 12 reference genes was used as internal controls. This study demonstrates that arbitrary selection of reference genes for normalisation in RT-qPCR studies in ectopic pregnancy without validation, risk producing inaccurate data and should therefore be discouraged.

  3. Context-dependent associations between variation in risk of ischemic heart disease and variation in the 5' promoter region of the apolipoprotein E gene in Danish women

    DEFF Research Database (Denmark)

    Stengård, Jari H; Dyson, Greg; Frikke-Schmidt, Ruth;

    2010-01-01

    and triglycerides. We addressed whether these genotypes improve the prediction of ischemic heart disease (IHD) in subsamples of individuals defined by traditional risk factors and the genotypes defined by the epsilon(2), epsilon(3), and epsilon(4) alleles in exon 4 of the apolipoprotein E gene. METHODS AND RESULTS......: In a sample of 3686 female and 2772 male participants of the Copenhagen City Heart Study who were free of IHD events, 576 individuals (257 women, 7.0% and 319 men, 11.5%) were diagnosed as having developed IHD in 6.5 years of follow-up. Using a stepwise Patient Rule-Induction Method modeling strategy...... of traditional risk factors in Copenhagen City Heart Study female participants. We discuss the use of these genotypes in medical risk assessment of IHD in the population represented by the Copenhagen City Heart Study....

  4. Inteligencia emocional y creatividad : factores predictores del rendimiento académico.

    OpenAIRE

    Belmonte Lillo, Víctor Manuel

    2013-01-01

    El objetivo del trabajo, “Inteligencia emocional y creatividad: factores predictores del rendimiento académico”, es estudiar la validez predictiva de la inteligencia emocional desde sus diferentes modelos (habilidad, competencia socioemocional y autoeficacia emocional) y la creatividad respecto al rendimiento académico tanto en general como por ámbitos en alumnado de ESO. En las dos primeras partes se analizan los constructos en estudio. En la tercera, se aborda las implicaciones de la creati...

  5. Actitudes, aptitudes y rendimiento académico en matemáticas

    OpenAIRE

    Pérez, Luis Eduardo; Niño, Diana Liceth; Páez, Laura Carolina

    2010-01-01

    El grupo MUSA.IMA1, de la Escuela de Matemáticas de la Universidad Sergio Arboleda decidió trabajar sobre las actitudes, las aptitudes y el rendimiento académico en el marco de la línea de investigación en Meta-Matemáticas. La finalidad es conocer mejor a los estudiantes y su rendimiento académico.

  6. Genetic analysis of TOR complex gene variation with human longevity: a nested case-control study of American men of Japanese ancestry.

    Science.gov (United States)

    Morris, Brian J; Donlon, Timothy A; He, Qimei; Grove, John S; Masaki, Kamal H; Elliott, Ayako; Willcox, D Craig; Allsopp, Richard; Willcox, Bradley J

    2015-02-01

    The mechanistic target of rapamycin (mTOR) pathway is crucial for life span determination in model organisms. The aim of the present study was to test tagging single-nucleotide polymorphisms that captured most of the genetic variation across key TOR complex 1 (TORC1) and TOR complex 2 (TORC2) genes MTOR, RPTOR, and RICTOR and the important downstream effector gene RPS6KA1 for association with human longevity (defined as attainment of at least 95 years of age) as well as health span phenotypes. Subjects comprised a homogeneous population of American men of Japanese ancestry, well characterized for aging phenotypes and who have been followed for 48 years. The study used a nested case-control design involving 440 subjects aged 95 years and older and 374 controls. It found no association of 6 tagging single-nucleotide polymorphisms for MTOR, 61 for RPTOR, 7 for RICTOR, or 5 for RPS6KA1 with longevity. Of 40 aging-related phenotypes, no significant association with genotype was seen. Thus common genetic variation (minor allele frequency ≥10%) in MTOR, RPTOR, RICTOR, and RPS6KA1 is not associated with extreme old age or aging phenotypes in this population. Further research is needed to assess the potential genetic contribution of other mTOR pathway genes to human longevity, gene expression, upstream and downstream targets, and clinically relevant aging phenotypes.

  7. Assessment of variation in immunosuppressive pathway genes reveals TGFBR2 to be associated with risk of clear cell ovarian cancer

    DEFF Research Database (Denmark)

    Hampras, Shalaka S; Sucheston-Campbell, Lara E; Cannioto, Rikki

    2016-01-01

    and 23,236 controls, we measured genetic associations of 1,351 SNPs in Treg cell pathway genes with odds of ovarian cancer and tested pathway and gene-level associations, overall and by histotype, for the 25 genes, using the admixture likelihood (AML) method. The most significant single SNP associations...... were tested for correlation with expression levels in 44 ovarian cancer patients. RESULTS: The most significant global associations for all genes in the pathway were seen in endometrioid (p = 0.082) and clear cell (p = 0.083), with the most significant gene level association seen with TGFBR2 (p = 0......BACKGROUND: Regulatory T (Treg) cells, a subset of CD4+ T lymphocytes, are mediators of immunosuppression in cancer, and, thus, variants in genes encoding Treg cell immune molecules could be associated with ovarian cancer. METHODS: In a population of 15,596 epithelial ovarian cancer (EOC) cases...

  8. Genome-wide analysis of DNA methylation, copy number variation, and gene expression in monozygotic twins discordant for primary biliary cirrhosis

    Directory of Open Access Journals (Sweden)

    Carlo eSelmi

    2014-03-01

    Full Text Available Primary biliary cirrhosis (PBC is an uncommon autoimmune disease with a homogeneous clinical phenotype that reflects incomplete disease concordance in monozygotic (MZ twins. We have taken advantage of a unique collection consisting of genomic DNA and mRNA from peripheral blood cells of female MZ twins (n=3 sets and sisters of similar age (n=8 pairs discordant for disease. We performed a genome-wide study to investigate differences in (i DNA methylation (using a custom tiled 4-plex array containing tiled 50-mers 19,084 randomly chosen methylation sites, (ii copy number variation (CNV (with a chip including markers derived from the 1000 Genomes Project, all three HapMap phases, and recently published studies, and/or (iii gene expression (by whole-genome expression arrays. Based on the results obtained from these three approaches we utilized quantitative PCR to compare the expression of candidate genes. Importantly, our data support consistent differences in discordant twins and siblings for the (i methylation profiles of 60 gene regions, (ii CNV of 10 genes, and (iii the expression of 2 interferon-dependent genes. Quantitative PCR analysis showed that 17 of these genes are differentially expressed in discordant sibling pairs. In conclusion, we report that MZ twins and sisters discordant for PBC manifest particular epigenetic differences and highlight the value of the epigenetic study of twins.

  9. Editorial Académico Jorge Cavelier Gaviria

    Directory of Open Access Journals (Sweden)

    Jorge Cavelier Gaviria

    1989-09-01

    Full Text Available

    * Este editorial es la transcripción de la circular dirigida por el Presidente de la Academia a los señores Académicos. Por su actualidad, trascendencia conceptual y normativa, el Comité de Publicaciones lo acogió como tal.

    Conocidas son las circunstancias que aquejan al país por los recientes acontecimientos que pretenden, a la fuerza, minar las instituciones, cimiento de nuestra nacionalidad, mediante el acecho y la destrucción de la mente, la voluntad y los bienes del hombre colombiano.

    Ciertamente al contemplar tales hechos de violencia, desafortunadamente crónicos en nuestro tiempo, pero con graves síntomas de epidemia, la inquietud que nace en nuestra personalidad de hombres de ciencia no puede ‘ser otra que la de examinar detenidamente la existencia de un grupo minoritario con graves alteraciones psicopáticas, pero inmensamente poderoso y por ende peligroso, cuya presencia desafortunadamente está provocando un desorden mental de increíbles proporciones en todos los estratos sociales y sin distingos de clases en toda la nación.

    La Academia no puede ni debe permanecer alejada e ignorante de estos hechos que por definición tocan las más sensibles fibras de nuestro ser, de nuestra devoción de hombres de ciencia, de nuestro ancestro, de nuestras conciencias y de nuestra formación profesional dedicada exclusivamente a la búsqueda del bienestar físico y mental de nuestros compatriotas.

    La filantropía, compuesto esencial que caracteriza a la profesión médica, necesariamente tiene que abogar por la humanización de los conflictos y la erradicación de la violencia, con miras al más respetable derecho de todos: el Derecho a la Paz.

    Es necesario por ello que examinemos con la profundidad y seriedad que caracterizan las actuaciones de esta institución, el porqué del proceder desorbitado e incongruente con la naturaleza misma del ser humano y que han desatado la

  10. Polymorphic variation of inflammation-related genes and risk of non-Hodgkin lymphoma for Uygur and Han Chinese in Xinjiang.

    Science.gov (United States)

    Gu, Xia; Shen, Yan; Fu, Ling; Zuo, Hong-Yun; Yasen, Halida; He, Ping; Guo, Xin-Hong; Shi, Yu-wei; Yusufu, Muhabaiti

    2014-01-01

    Polymorphisms of inflammation-related genes have been found to be associated with non-Hodgkin lymphoma (NHL) or some of its subtypes, but only a few relevant data have been reported in China. In this study, the Snapshot method was used to assess genetic variation; a total of 14 single nucleotide polymorphisms (SNPs) for 6 inflammatory factors in 157 NHL cases (64 Uygur ethnic subjects, 93 Han Chinese) and 435 controls (231 Uygur and 204 Han Chinese) were studied from the Xinjiang province of China. Haplotype distribution was estimated using PHASE 2.3 software. Statistical differences in the genotype and haplotype frequencies between case and control groups were also considered and estimated. For the Han population, the geneotype distributions for TNF- αrs1800629, TNF-αrs1800630, IL-6 rs1800795, IL-6 rs1800797, NF-KB1 rs1585215 and TLR-4 rs4986790 showed significant differences between the case and control groups (p<0.05). The TNF-α gene frequencies of ACG and CCA haplotypes in the cases were higher than in the controls (OR=2.45, 95% CI: 1.55-3.89, p=0.0002, OR=2.53, 95% CI: 1.10-5.80, p=0.029, respectively), and the same findings were detected for TNF-β gene CA haplotype (OR=1.87, 95% CI: 1.21-2.90, p=0.0054). However, for the Uygur population, no such significant differences were detected within the gene-type distribution of the 14 SNPs. The TNF-α gene frequency of the CCA haplotype between the two groups (OR=1.98, 95% CI: 1.11-3.51, p=0.021) revealed a statistically significant difference. Our results showed that polymorphic variations of inflammation-related genes could be important to the NHL etiology of the Han population, and that these may only have limited influence on the Uygur population.

  11. Aperturas epistémicas y transformaciones intersubjetivas: Haciendo acompañamiento académico a tesis de maestría

    Directory of Open Access Journals (Sweden)

    Dora Inés Munévar M.

    2013-04-01

    Full Text Available Antecedentes. Se retoman los orígenes individuales e interesados de los recorridos registrados por quienes hacen tesis de maestría. Objetivo. Repensar los nexos entre las formas de hacer investigación y acompañamiento académico a tesis de posgrado. Materiales y métodos. Remiten a los procesos investigativos de cuatro tesistas en tres maestrías de la Universidad Nacional de Colombia: discapacidad e inclusión social (2, estudios de género (1 y educación con énfasis en comunicación (1, recurriendo a la auto-reflexividad. Resultados. Los resultados narrativos dan cuenta de las relaciones estudiantiles con el saber mientras hacen investigaciones académicas. Conclusión. Señala que las experiencias académicas contienen epistemologías de resistencia y cambios en los modos de hacer investigación. Se afianzan tanto las aperturas epistémicas como las transformaciones intersubjetivas.

  12. Genetic variation in the CYP1A1 gene is related to circulating PCB118 levels in a population-based sample.

    Science.gov (United States)

    Lind, Lars; Penell, Johanna; Syvänen, Anne-Christine; Axelsson, Tomas; Ingelsson, Erik; Morris, Andrew P; Lindgren, Cecilia; Salihovic, Samira; van Bavel, Bert; Lind, P Monica

    2014-08-01

    Several of the polychlorinated biphenyls (PCBs), i.e. the dioxin-like PCBs, are known to induce the P450 enzymes CYP1A1, CYP1A2 and CYP1B1 by activating the aryl hydrocarbon receptor (Ah)-receptor. We evaluated if circulating levels of PCBs in a population sample were related to genetic variation in the genes encoding these CYPs. In the population-based Prospective Investigation of the Vasculature in Uppsala Seniors (PIVUS) study (1016 subjects all aged 70), 21 SNPs in the CYP1A1, CYP1A2 and CYP1B1 genes were genotyped. Sixteen PCB congeners were analysed by high-resolution chromatography coupled to high-resolution mass spectrometry (HRGC/ HRMS). Of the investigated relationships between SNPs in the CYP1A1, CYP1A2 and CYP1B1 and six PCBs (congeners 118, 126, 156, 169, 170 and 206) that captures >80% of the variation of all PCBs measured, only the relationship between CYP1A1 rs2470893 was significantly related to PCB118 levels following strict adjustment for multiple testing (p=0.00011). However, there were several additional SNPs in the CYP1A2 and CYP1B1 that showed nominally significant associations with PCB118 levels (p-values in the 0.003-0.05 range). Further, several SNPs in the CYP1B1 gene were related to both PCB156 and PCB206 with p-values in the 0.005-0.05 range. Very few associations with pPCB126, PCB169 or PCB170. Genetic variation in the CYP1A1 was related to circulating PCB118 levels in the general elderly population. Genetic variation in CYP1A2 and CYP1B1 might also be associated with other PCBs.

  13. Natural variation in expression of genes associated with carotenoid biosynthesis and accumulation in cassava (Manihot esculenta Crantz) storage root

    Science.gov (United States)

    Several groups have reported on massive accumulation of total carotenoids in cassava storage root (CSR). Naturally occurring color variation associated with carotenoid accumulation was observed in cassava (Manihot esculenta Crantz) storage root of landraces from Amazon. Here carotenoid profiles from...

  14. Post-zygotic and inter-individual structural genetic variation in a presumptive enhancer element of the locus between the IL10Rβ and IFNAR1 genes.

    Directory of Open Access Journals (Sweden)

    Hamid Reza Razzaghian

    Full Text Available Although historically considered as junk-DNA, tandemly repeated sequence motifs can affect human phenotype. For example, variable number tandem repeats (VNTR with embedded enhancers have been shown to regulate gene transcription. The post-zygotic variation is the presence of genetically distinct populations of cells in an individual derived from a single zygote, and this is an understudied aspect of genome biology. We report somatically variable VNTR with sequence properties of an enhancer, located upstream of IFNAR1. Initially, SNP genotyping of 63 monozygotic twin pairs and multiple tissues from 21 breast cancer patients suggested a frequent post-zygotic mosaicism. The VNTR displayed a repeated 32 bp core motif in the center of the repeat, which was flanked by similar variable motifs. A total of 14 alleles were characterized based on combinations of segments, which showed post-zygotic and inter-individual variation, with up to 6 alleles in a single subject. Somatic variation occurred in ∼24% of cases. In this hypervariable region, we found a clustering of transcription factor binding sites with strongest sequence similarity to mouse Foxg1 transcription factor binding motif. This study describes a VNTR with sequence properties of an enhancer that displays post-zygotic and inter-individual genetic variation. This element is within a locus containing four related cytokine receptors: IFNAR2, IL10Rβ, IFNAR1 and IFNGR2, and we hypothesize that it might function in transcriptional regulation of several genes in this cluster. Our findings add another level of complexity to the variation among VNTR-based enhancers. Further work may unveil the normal function of this VNTR in transcriptional control and its possible involvement in diseases connected with these receptors, such as autoimmune conditions and cancer.

  15. Extreme obesity is associated with variation in genes related to the circadian rhythm of food intake and hypothalamic signaling.

    Science.gov (United States)

    Mariman, Edwin C M; Bouwman, Freek G; Aller, Erik E J G; van Baak, Marleen A; Wang, Ping

    2015-06-01

    The hypothalamus is important for regulation of energy intake. Mutations in genes involved in the function of the hypothalamus can lead to early-onset severe obesity. To look further into this, we have followed a strategy that allowed us to identify rare and common gene variants as candidates for the background of extreme obesity from a relatively small cohort. For that we focused on subjects with a well-selected phenotype and on a defined gene set and used a rich source of genetic data with stringent cut-off values. A list of 166 genes functionally related to the hypothalamus was generated. In those genes complete exome sequence data from 30 extreme obese subjects (60 genomes) were screened for novel rare indel, nonsense, and missense variants with a predicted negative impact on protein function. In addition, (moderately) common variants in those genes were analyzed for allelic association using the general population as reference (false discovery rategenes for BAIAP3, NBEA, PRRC2A, RYR1, SIM1, and TRH, and a novel indel variant in LEPR. Common variants in the six genes for MBOAT4, NPC1, NPW, NUCB2, PER1, and PRRC2A showed significant allelic association with extreme obesity. Our findings underscore the complexity of the genetic background of extreme obesity involving rare and common variants of genes from defined metabolic and physiologic processes, in particular regulation of the circadian rhythm of food intake and hypothalamic signaling.

  16. DNA sequence variation and selection of tag single-nucleotide polymorphisms at candidate genes for drought-stress response in Pinus taeda L.

    Science.gov (United States)

    González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B

    2006-03-01

    Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level o