WorldWideScience

Sample records for abnormal mmr gene

  1. Constitutional Mismatch Repair Deficiency in Israel: High Proportion of Founder Mutations in MMR Genes and Consanguinity.

    Science.gov (United States)

    Baris, Hagit N; Barnes-Kedar, Inbal; Toledano, Helen; Halpern, Marisa; Hershkovitz, Dov; Lossos, Alexander; Lerer, Israela; Peretz, Tamar; Kariv, Revital; Cohen, Shlomi; Half, Elizabeth E; Magal, Nurit; Drasinover, Valerie; Wimmer, Katharina; Goldberg, Yael; Bercovich, Dani; Levi, Zohar

    2016-03-01

    Heterozygous germline mutations in any of the mismatch repair (MMR) genes, MLH1, MSH2, MSH6, and PMS2, cause Lynch syndrome (LS), an autosomal dominant cancer predisposition syndrome conferring a high risk of colorectal, endometrial, and other cancers in adulthood. Offspring of couples where both spouses have LS have a 1:4 risk of inheriting biallelic MMR gene mutations. These cause constitutional MMR deficiency (CMMRD) syndrome, a severe recessively inherited cancer syndrome with a broad tumor spectrum including mainly hematological malignancies, brain tumors, and colon cancer in childhood and adolescence. Many CMMRD children also present with café au lait spots and axillary freckling mimicking neurofibromatosis type 1. We describe our experience in seven CMMRD families demonstrating the role and importance of founder mutations and consanguinity on its prevalence. Clinical presentations included brain tumors, colon cancer, lymphoma, and small bowel cancer. In children from two nonconsanguineous Ashkenazi Jewish (AJ) families, the common Ashkenazi founder mutations were detected; these were homozygous in one family and compound heterozygous in the other. In four consanguineous families of various ancestries, different homozygous mutations were identified. In a nonconsanguineous Caucasus/AJ family, lack of PMS2 was demonstrated in tumor and normal tissues; however, mutations were not identified. CMMRD is rare, but, especially in areas where founder mutations for LS and consanguinity are common, pediatricians should be aware of it since they are the first to encounter these children. Early diagnosis will enable tailored cancer surveillance in the entire family and a discussion regarding prenatal genetic diagnosis. © 2015 Wiley Periodicals, Inc.

  2. Cancer risk and survival in path_MMR carriers by gene and gender up to 75 years of age

    DEFF Research Database (Denmark)

    Møller, Pål; Seppälä, Toni; Bernstein, Inge

    2017-01-01

    BACKGROUND: Most patients with path_MMR gene variants (Lynch syndrome (LS)) now survive both their first and subsequent cancers, resulting in a growing number of older patients with LS for whom limited information exists with respect to cancer risk and survival. OBJECTIVE AND DESIGN: This observa...

  3. Higher occurrence of childhood cancer in families with germline mutations in BRCA2, MMR and CDKN2A genes

    DEFF Research Database (Denmark)

    Magnusson, S.; Borg, A.; Kristoffersson, U.

    2008-01-01

    The contribution of hereditary factors for development of childhood tumors is limited to some few known syndromes associated with predominance of tumors in childhood. Occurrence of childhood tumors in hereditary cancer syndromes such as BRCA1/2 associated breast and ovarian cancer, DNA-mismatch r......-mismatch repair (MMR) genes associated hereditary non polyposis colorectal cancer and CDKN2A associated familial malignant melanoma are very little studied. Herein we report the prevalence of childhood tumors (diagnosed...

  4. Measles, Mumps, Rubella (MMR)

    Science.gov (United States)

    ... Diseases & Infections Measles, Mumps, Rubella (MMR) Measles, Mumps, Rubella (MMR) Adolescent Vaccination Recommendation: Adolescents who were not ... should get the second dose. About measles, mumps, rubella Measles is a highly infectious respiratory disease that ...

  5. A multifactorial likelihood model for MMR gene variant classification incorporating probabilities based on sequence bioinformatics and tumor characteristics: a report from the Colon Cancer Family Registry.

    Science.gov (United States)

    Thompson, Bryony A; Goldgar, David E; Paterson, Carol; Clendenning, Mark; Walters, Rhiannon; Arnold, Sven; Parsons, Michael T; Michael D, Walsh; Gallinger, Steven; Haile, Robert W; Hopper, John L; Jenkins, Mark A; Lemarchand, Loic; Lindor, Noralane M; Newcomb, Polly A; Thibodeau, Stephen N; Young, Joanne P; Buchanan, Daniel D; Tavtigian, Sean V; Spurdle, Amanda B

    2013-01-01

    Mismatch repair (MMR) gene sequence variants of uncertain clinical significance are often identified in suspected Lynch syndrome families, and this constitutes a challenge for both researchers and clinicians. Multifactorial likelihood model approaches provide a quantitative measure of MMR variant pathogenicity, but first require input of likelihood ratios (LRs) for different MMR variation-associated characteristics from appropriate, well-characterized reference datasets. Microsatellite instability (MSI) and somatic BRAF tumor data for unselected colorectal cancer probands of known pathogenic variant status were used to derive LRs for tumor characteristics using the Colon Cancer Family Registry (CFR) resource. These tumor LRs were combined with variant segregation within families, and estimates of prior probability of pathogenicity based on sequence conservation and position, to analyze 44 unclassified variants identified initially in Australasian Colon CFR families. In addition, in vitro splicing analyses were conducted on the subset of variants based on bioinformatic splicing predictions. The LR in favor of pathogenicity was estimated to be ~12-fold for a colorectal tumor with a BRAF mutation-negative MSI-H phenotype. For 31 of the 44 variants, the posterior probabilities of pathogenicity were such that altered clinical management would be indicated. Our findings provide a working multifactorial likelihood model for classification that carefully considers mode of ascertainment for gene testing. © 2012 Wiley Periodicals, Inc.

  6. MMR Vaccination and Febrile Seizures

    DEFF Research Database (Denmark)

    Vestergaard, Mogens; Hviid, Anders; Madsen, Kreesten Meldgaard

    2004-01-01

    CONTEXT: The rate of febrile seizures increases following measles, mumps, and rubella (MMR) vaccination but it is unknown whether the rate varies according to personal or family history of seizures, perinatal factors, or socioeconomic status. Furthermore, little is known about the long-term outcome...... of febrile seizures following vaccination. OBJECTIVES: To estimate incidence rate ratios (RRs) and risk differences of febrile seizures following MMR vaccination within subgroups of children and to evaluate the clinical outcome of febrile seizures following vaccination. DESIGN, SETTING, AND PARTICIPANTS......: Incidence of first febrile seizure, recurrent febrile seizures, and subsequent epilepsy. RESULTS: A total of 439,251 children (82%) received MMR vaccination and 17,986 children developed febrile seizures at least once; 973 of these febrile seizures occurred within 2 weeks of MMR vaccination. The RR...

  7. Measles, Mumps, and Rubella (MMR) Vaccination: What Everyone Should Know

    Science.gov (United States)

    ... MMRV=measles, mumps, rubella, and varicella combination vaccine Measles, Mumps, and Rubella (MMR) Vaccination: What Everyone Should ... of Page Who Should Not Get MMR Vaccine? Measles, Mumps, and Rubella (MMR) vaccine Some people should ...

  8. Evaluation of possible occurrence of mutation in MMR repair system genes in resistant and sensitiveclinical strains of Mycobacterium tuberculosisby using sequencing method

    Directory of Open Access Journals (Sweden)

    AmirPoyan Afzali

    2016-07-01

    Full Text Available Background:during recent years, the incidence and spread of drug resistance in Mycobacterium tuberculosis, the bacterium causing tuberculosis, has set this disease in World Health Organizationpriorities alignment of diseases like AIDS and hepatitis. Study of close examination of resistant and susceptible clinical strains genotypes is necessary to overcome drug resistance. Among the numerous repair systems, only there are limited number of encoding genes of DNA repair enzymes in Mycobacterium tuberculosis. Commonly these genes have been conserved and any changes among them likely increasethe mutation occurance due to the impossibility of correctionof spontaneous mutations insensitive strains of this bacteria.mut genes encodeDNA repairable enzymes.This study investigated the mutations in these genes and the effect of these mutations on tuberculosis drug resistance. Materials&Methods: In this study,of 29 available specimens,we were selected 8 susceptible strains and 21 resistantstrains andafter ordering appropriate primers and performing the proliferation reaction two types of amplicons produced which includingfragments of genes mut T2 and mut T4 and they were sent inorder to sequencing. Results:The results of chain reactionprimer represents an appropriate choice of primerswhich were investigated. Sequencing results showed that overall 73% of resistant strains that had been selected for study of mutT4gene, have no mutations in codons 48of mutT4 gene, and 70% of resistant strains have no GGA >>> CGA mutation at codon 58 of mutT2 gene. Conclusion: One of the strategies to overcome tuberculosis drug resistance is a close examination of genotypes of resistant and susceptible clinical strains. Results of this study was performedby examining changes in mut T2 and mut T4 gene sequence. The mutation in mut T2 always associated with mutation in mut T4, in this way, the first mutation may occurs in mut T4and after that, the second mutationmay occurs in mut T

  9. Abnormalities in Alternative Splicing of Apoptotic Genes and Cardiovascular Diseases

    Directory of Open Access Journals (Sweden)

    Zodwa Dlamini

    2015-11-01

    Full Text Available Apoptosis is required for normal heart development in the embryo, but has also been shown to be an important factor in the occurrence of heart disease. Alternative splicing of apoptotic genes is currently emerging as a diagnostic and therapeutic target for heart disease. This review addresses the involvement of abnormalities in alternative splicing of apoptotic genes in cardiac disorders including cardiomyopathy, myocardial ischemia and heart failure. Many pro-apoptotic members of the Bcl-2 family have alternatively spliced isoforms that lack important active domains. These isoforms can play a negative regulatory role by binding to and inhibiting the pro-apoptotic forms. Alternative splicing is observed to be increased in various cardiovascular diseases with the level of alternate transcripts increasing elevated in diseased hearts compared to healthy subjects. In many cases these isoforms appear to be the underlying cause of the disease, while in others they may be induced in response to cardiovascular pathologies. Regardless of this, the detection of alternate splicing events in the heart can serve as useful diagnostic or prognostic tools, while those splicing events that seem to play a causative role in cardiovascular disease make attractive future drug targets.

  10. Pregnancy outcome following M.MR vaccination

    Directory of Open Access Journals (Sweden)

    nahid Lorzadeh

    2007-09-01

    Full Text Available Lorzadeh N1, Ghafarzadeh M1, Vahabi S2, Lashgar-ara GhR3 1. Assistant professor, Department of gynecology, Faculty of medicine, Lorestan University of medical sciences 2. Assistant profwssor, Department of anesthesiology, Faculty of medicine, Lorestan University of medical sciences 3. General practitioner, Information and drugs center of Lorestan health department Abstract Background: In this study we evaluate the outcome of pregnancy in the patient that received M. MR vaccine during M.MR vaccination program on Lorestan of fall 2003. Materials and methods: This is a descriptive epidemiologic study, we evaluated all of women that vaccinated with M.MR vaccine during pre and post conception. We collected and analyzed all of information like prognosis of pregnancy, congenital rubella syndrome, gestational age weigh of newborn. Results: In 92 pregnancy women infected with MMR vaccine, the prognosis of pregnancy clearly seen 88 pregnant women (96% 73 (83% had normal and healthy newborn infant and 5 (6% had spontaneot abortion and 10 pregnant women (11% had legal abortion. Mean gestational age at birth was 39.5 ± 2.1 and weigh of newborn was 3257 ± 535 grams. None of the live born infants had not congenital rubella syndrome. Conclusion: In this study we showed M.MR vaccination during pregnancy had not any complication pregnancy. But pregnancy yet is an contraindication for M.MR vaccibnation, vecause this patient theories have risk of congenital rubella syndrome.

  11. Mismatch repair genes expression defects & association with clinicopathological characteristics in colorectal carcinoma.

    Science.gov (United States)

    Kaur, Gurjeet; Masoud, Abdelhafid; Raihan, N; Radzi, M; Khamizar, W; Kam, Lee Suk

    2011-08-01

    DNA mismatch repair gene (MMR) abnormalities are seen in 95 per cent of hereditary nonpolyposis colorectal cancer (HNPCC) and 10-15 per cent of sporadic colorectal cancers. There are no data on MMR abnormalities in Malaysian colorectal cancer patients. This study was aimed to determine the frequency of abnormal MMR gene protein expression in colorectal carcinoma in Northern Peninsular Malaysia using immunohistochemistry. Clinicopathological information was obtained from 148 patients' records who underwent bowel resection for colorectal cancer (CRC) at the three hospitals in Malaysia. Immunohistochemistry for MLH1, MSH2, MSH6 and PMS2 proteins were performed on paraffin embedded tissue containing carcinoma. A total of 148 subjects and 150 colorectal carcinomas of sporadic and hereditary types were assessed. Three patients had synchronous tumours. Twenty eight cancers (18.6%) from 26 subjects (17.6%) had absent immunohistochemical expression of any one of the MMR gene proteins. This comprised absent MLH1 only - 3 cancers, absent MSH2 only - 3, absent MSH6 only - 2, absent PMS2 only - 3, absent MLH1 and PMS2 - 14, absent MSH2 and MSH6 - 2 and absent MLH1, MSH6 and PMS2 - 1. There was significant association between abnormal MMR gene protein expression and proximal colon cancers, mucinous, signet ring and poorly differentiated morphology. Cancers with abnormal MMR gene expression were associated with microsatellite instability-high (MSI-H) phenotype. About 15 per cent demonstrated absent MSH2, MSH6 and PMS2 protein expression in isolation or in combination with other MMR genes, which often predicts a germline mutation, synonymous with a diagnosis of HNPCC. This appears to be high frequency compared to reported data.

  12. Abnormal gene expression and gene fusion in lung adenocarcinoma with high-throughput RNA sequencing.

    Science.gov (United States)

    Yang, Z-H; Zheng, R; Gao, Y; Zhang, Q; Zhang, H

    2014-02-01

    To explore the universal law of the abnormal gene expression and the structural variation of genes related to lung adenocarcinoma, the gene expression profile of GSE37765 were downloaded from Gene Expression Omnibus database. The differentially expressed genes (DEGs) were analyzed with t-test and NOISeq tool, and the core DEGs were screened out by combining with another RNA-seq data containing totally 77 pairs of samples in 77 patients with lung adenocarcinoma. Moreover, the functional annotation of the core DEGs was performed by using the Database for Annotation Visualization and Integrated Discovery following selection of oncogene and tumor suppressor by combining with tumor suppressor genes and Cancer Genes database, and motif-finding of core DEGs was performed with motif-finding algorithm Seqpos. We also used Tophat-fusion tool to further explore the fusion genes. In total, 850 downregulated DEGs and 206 upregulated DEGs were screened out in lung adenocarcinoma tissues. Next, we selected 543 core DEGs, including 401 downregulated and 142 upregulated genes, and vasculature development (P=1.89E-06) was significantly enriched among downregulated core genes, as well as mitosis (P=6.26E-04) enriched among upregulated core genes. On the basis of the cellular localization analysis of core genes, wnt-1-induced secreted protein 1 (WISP1) and receptor (G protein-coupled) activity modifying protein 1 (RAMP1) identified mainly located in extracellular region and extracellular space. We also screened one oncogene, v-myb avian myeloblastosis viral oncogene homolog-like 2 (MYBL2). Moreover, transcription factor GATA2 was mined by motif-finding analysis. Finally, four fusion genes belonged to the human leukocyte antigen (HLA) family. WISP1, RAMP1, MYBL2 and GATA2 could be potential targets of treatment for lung adenocarcinoma and the fusion of HLA family genes might have important roles in lung adenocarcinoma.

  13. Znaczenie mechanizmu naprawy DNA błędnie sparowanych zasad azotowych (MMR w raku piersi

    Directory of Open Access Journals (Sweden)

    Hanna Romanowicz

    2010-04-01

    Full Text Available Background: Microsatellite instability (MSI is due to defective DNA mismatch repair. Defects in DNA mismatch-repair (MMR genes lead to replication errors revealed as instability in microsatellite markers. Studieshave shown that breast cancer may be associated with mutations in mismatch repair genes, such as MSH2,MSH3, MSH4, MSH6, MLH1, MLH3, PMS1 and MUTYH. Aim: Results from studies that assayed MMR in sporadic breast cancer are reviewed. Conclusion: Several data suggest that microsatellite instability seems to be a risk factor for breast cancerin subjects belonging to HNPCC (hereditary non-polyposis colorectal cancer families with high incidence of thiscancer and sporadic breast cancer.

  14. Advances in detection systems of gene and chromosome abnormalities

    International Nuclear Information System (INIS)

    Yatagai, Takeo

    2002-01-01

    This review is described from the aspect of radiation biology. For analysis at gene level, oxidative lesion of DNA like 7,8-dihydro-8-oxoguanine formation and its repair by DNA polymerase η etc in bacteria, yeast and mammalian cells are suggested to be a useful index of radiation mutation. Transgenic mice with E. coli and/or phage gene as a reporter can be a tool for gene analysis for specific organ mutation: data obtained by irradiation of X-ray, γ-ray and accelerated carbon beam to the mouse gpt delta are presented. For analysis from gene to chromosome levels, loss of heterozygosity of a specific gene is a key for analysis of chromosome aberration at the molecular level. Studies in yeast and mammalian cells are presented. The author also described data of gene mutation in TK6 cells irradiated by 2 Gy of X-ray and 10 cGy of carbon beam (135 MeV/u) generated by ring-cycrotron. Human-hamster hybrid cell is an alternative tool. Concerning significance at the individual level, the author quoted studies of irradiation of parent mice resulting in increased incidence of somatic cell mutation and of cancer in offspring. Future systems for gene mutation will be a use of transgenic mice or of markers like a specific cancer. (K.H.)

  15. Age- and Gene-Dosage–Dependent Cre-Induced Abnormalities in the Retinal Pigment Epithelium

    Science.gov (United States)

    He, Lizhi; Marioutina, Mariya; Dunaief, Joshua L.; Marneros, Alexander G.

    2015-01-01

    To conditionally inactivate genes in the retinal pigment epithelium (RPE) transgenic mouse strains have been developed, in which Cre recombinase (Cre) expression is driven by an RPE-specific gene promoter. The RPE is a quiescent epithelium, and continuous expression of Cre could affect its function. Here, we tested the hypothesis that continuous postnatal Cre expression in the RPE may lead to cellular abnormalities, which may depend on both age and Cre gene dosage. We therefore examined the eyes of homozygous and heterozygous VMD2-Cre mice at various ages. In VMD2-Cre heterozygous mice variable progressive age-dependent RPE abnormalities were noticed, including attenuation of phalloidin and cytoplasmic active β-catenin staining, reduced cell size, and loss of the typical honeycomb pattern of RPE morphology in those RPE cells that stained for Cre. These morphological RPE abnormalities were not noticed in Cre-negative RPE cells in VMD2-Cre or age-matched control mice. In addition, an abnormal number and morphology of cell nuclei were noticed in a subset of Cre-expressing RPE cells in aged heterozygous VMD2-Cre mice, whereas more severe nuclear abnormalities were observed already in young homozygous VMD2-Cre mice. Thus, continuous postnatal expression of Cre causes abnormalities in the RPE in an age- and Cre gene dosage-dependent manner, which needs to be considered in the interpretation of gene targeting studies in the RPE. PMID:24854863

  16. Chromosomal Abnormalities and Putative Susceptibility Genes in Autism Spectrum Disorders

    DEFF Research Database (Denmark)

    Nielsen, Mette Gilling

    Autism spectrum disorders (ASDs) is a heterogeneous group of neurodevelopmental disorders with a significant genetic component as shown by family and twin studies. However, only a few genes have repeatedly been shown to be involved in the development of ASDs. The aim of this study has been...

  17. MMR and autism: further evidence against a causal association.

    Science.gov (United States)

    Farrington, C P; Miller, E; Taylor, B

    2001-06-14

    The hypothesis that MMR vaccines cause autism was first raised by reports of cases in which developmental regression occurred soon after MMR vaccination. A previous study found no evidence to support this hypothesis. It has recently been suggested that MMR vaccine might cause autism, but that the induction interval need not be short. The data from the earlier study were reanalysed to test this second hypothesis. Our results do not support this hypothesis, and provide further evidence against a causal association between MMR vaccination and autism.

  18. Altered Clock and Lipid Metabolism-Related Genes in Atherosclerotic Mice Kept with Abnormal Lighting Condition

    Directory of Open Access Journals (Sweden)

    Zhu Zhu

    2016-01-01

    Full Text Available Background. The risk of atherosclerosis is elevated in abnormal lipid metabolism and circadian rhythm disorder. We investigated whether abnormal lighting condition would have influenced the circadian expression of clock genes and clock-controlled lipid metabolism-related genes in ApoE-KO mice. Methods. A mouse model of atherosclerosis with circadian clock genes expression disorder was established using ApoE-KO mice (ApoE-KO LD/DL mice by altering exposure to light. C57 BL/6J mice (C57 mice and ApoE-KO mice (ApoE-KO mice exposed to normal day and night and normal diet served as control mice. According to zeitgeber time samples were acquired, to test atheromatous plaque formation, serum lipids levels and rhythmicity, clock genes, and lipid metabolism-related genes along with Sirtuin 1 (Sirt1 levels and rhythmicity. Results. Atherosclerosis plaques were formed in the aortic arch of ApoE-KO LD/DL mice. The serum lipids levels and oscillations in ApoE-KO LD/DL mice were altered, along with the levels and diurnal oscillations of circadian genes, lipid metabolism-associated genes, and Sirt1 compared with the control mice. Conclusions. Abnormal exposure to light aggravated plaque formation and exacerbated disorders of serum lipids and clock genes, lipid metabolism genes and Sirt1 levels, and circadian oscillation.

  19. An elastin gene mutation producing abnormal tropoelastin and abnormal elastic fibres in a patient with autosomal dominant cutis laxa.

    Science.gov (United States)

    Tassabehji, M; Metcalfe, K; Hurst, J; Ashcroft, G S; Kielty, C; Wilmot, C; Donnai, D; Read, A P; Jones, C J

    1998-06-01

    Elastin is the protein responsible for the characteristic elastic properties of many tissues including the skin, lungs and large blood vessels. Loss-of-function mutations in the elastin gene are known to cause the heart defect supravalvular aortic stenosis (SVAS). We and others have identified deletions, nonsense mutations and splice site mutations in SVAS patients that abolish the function of one elastin gene. We have now identified an elastin mutation in a patient with a completely different phenotype, the rare autosomal dominant condition cutis laxa. A frameshift mutation in exon 32 of the elastin gene is predicted to replace 37 amino acids at the C-terminus of elastin by a novel sequence of 62 amino acids. mRNA and immunoprecipitation studies show that the mutant allele is expressed. Electron microscopy of skin sections shows abnormal branching and fragmentation in the amorphous elastin component, and immunocytochemistry shows reduced elastin deposition in the elastic fibres and fewer microfibrils in the dermis. These findings suggest that the mutant tropoelastin protein is synthesized, secreted and incorporated into the elastic matrix, where it alters the architecture of elastic fibres. Interference with cross-linking would reduce elastic recoil in affected tissues and explain the cutis laxa phenotype.

  20. [Effect of Pentavac and MMR vaccination on the intestine.].

    Science.gov (United States)

    Thornjóðleifsson, Bjarni; Davíðsdóttir, Katrín; Agnarsson, Ulfur; Theodórs, Arndís; Gunnarsdóttir, Aðalbjœrg; Mœller, Elva; Jónsdóttir, Auður; Sigþórsson, Guðmundur; Kjeld, Matthías; Bjarnason, Ingvar

    2002-06-01

    The safety of infant vaccination has been questioned in recent years. In particular it has been suggested that the measles, mumps and rubella (MMR) vaccination leads to brain damage manifesting as autism consequent to the development of an "enterocolitis" in the immediate post-vaccination period. To assess if MMR vaccination is associated with sub-clinical intestinal inflammation which is central to the autistic "enterocolitis" theory. The study was not designed to test directly the association of autism to MMR vaccination. We studied 109/20 infants, before and two and four weeks after immunization with Pentavac and MMR vaccines, for the presence of intestinal inflammation (faecal calprotectin). Neither vaccination was associated with any significant increase in faecal calprotectin concentrations. The failure of the MMR vaccination to cause an intestinal inflammatory response provides evidence against the proposed gut-brain interaction that is central to the autistic "enterocolitis" hypothesis.

  1. Brain gene expression differences are associated with abnormal tail biting behavior in pigs.

    Science.gov (United States)

    Brunberg, E; Jensen, P; Isaksson, A; Keeling, L J

    2013-03-01

    Knowledge about gene expression in animals involved in abnormal behaviors can contribute to the understanding of underlying biological mechanisms. This study aimed to explore the motivational background to tail biting, an abnormal injurious behavior and severe welfare problem in pig production. Affymetrix microarrays were used to investigate gene expression differences in the hypothalamus and prefrontal cortex of pigs performing tail biting, pigs receiving bites to the tail and neutral pigs who were not involved in the behavior. In the hypothalamus, 32 transcripts were differentially expressed (P biting behavior as performers or receivers. Among these 19 transcripts were genes associated with production traits in pigs (PDK4), sociality in humans and mice (GTF2I) and novelty seeking in humans (EGF). These are in line with hypotheses linking tail biting with reduced back fat thickness and explorative behavior. © 2012 The Authors. Genes, Brain and Behavior © 2012 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

  2. Sonic Hedgehog: A Good Gene Gone Bad? Detection and Treatment of Genetic Abnormalities.

    Science.gov (United States)

    Yaich, Lauren E.

    2001-01-01

    Presents a case of a baby born with the genetic condition holoprosencephaly in which students explore the "Sonic hedgehog" gene, signal transduction, and the ethics of body and tissue donation. Presents a two-part assignment that features students writing an informed consent document that explains the science behind this congenital abnormality,…

  3. MMR vaccination of children with egg allergy is safe

    DEFF Research Database (Denmark)

    Andersen, Dorthe Vestergård; Jørgensen, Inger Merete

    2013-01-01

    Measles, mumps and rubella (MMR) vaccination is part of the Danish Childhood Vaccination Programme. It is known that children may react with anaphylaxis to MMR vaccines containing traces of egg protein. In Denmark, national clinical guidelines recommend that children with egg allergy be referred...... to vaccination at a paediatric ward despite changed recommendations in other countries. The purpose of this study was to determine whether children with egg allergy presented with anaphylactic/allergic reactions to MMR vaccination and to discuss whether Danish recommendations should be upheld....

  4. Dispelling vaccine myths: MMR and considerations for practicing pharmacists.

    Science.gov (United States)

    Mormann, Megan; Gilbertson, Carolyn; Milavetz, Gary; Vos, Susan

    2012-01-01

    To discuss information surrounding the erroneous association between the measles-mumps-rubella (MMR) vaccine and autism spectrum disorders (ASDs) and to provide pharmacists with information to dispel vaccine myths. Pharmaceutical and medical literature and public media (e.g., newspapers). The diagnosis of ASDs is on the rise, and many speculations have been made as to the cause, including the MMR vaccine. A small case series article published in The Lancet in 1998 and later retracted has been the center of the controversy over whether the MMR vaccine causes ASDs. New definitive research demonstrates no link, and medical organizations state that evidence does not support a link between the MMR vaccine and ASDs. Pharmacists can play a role in providing up-do-date information to patients to dispel myths concerning vaccine safety. Accurate peer review remains an important step to ensure correct information is given to health care providers and the public.

  5. The web and public confidence in MMR vaccination in Italy.

    Science.gov (United States)

    Aquino, Francesco; Donzelli, Gabriele; De Franco, Emanuela; Privitera, Gaetano; Lopalco, Pier Luigi; Carducci, Annalaura

    2017-08-16

    Measles, mumps and rubella (MMR) vaccination coverage in Italy has been decreasing starting from 2012 and, at the present, none of the Italian regions has achieved the goal of 95% coverage target. A decision of the Court of Justice of Rimini in March 2012 that awarded vaccine-injury compensation for a case of autism has been indicated as a probable trigger event leading to a reduction of vaccine confidence in Italy. The aim of the study was to explore the relationship between MMR vaccination coverage to online search trends and social network activity on the topic "autism and MMR vaccine", during the period 2010-2015. A significant inverse correlation was found between MMR vaccination coverage and Internet search activity, tweets and Facebook posts. New media might have played a role in spreading misinformation. Media monitoring could be useful to assess the level of vaccine hesitancy and to plan and target effective information campaigns. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. 'MMR talk' and vaccination choices: an ethnographic study in Brighton.

    Science.gov (United States)

    Poltorak, Mike; Leach, Melissa; Fairhead, James; Cassell, Jackie

    2005-08-01

    In the context of the high-profile controversy that has unfolded in the UK around the measles, mumps and rubella (MMR) vaccine and its possible adverse effects, this paper explores how parents in Brighton, southern England, are thinking about MMR for their own children. Research focusing on parents' engagement with MMR has been dominated by analysis of the proximate influences on their choices, and in particular scientific and media information, which have led health policy to focus on information and education campaigns. This paper reports ethnographic work including narratives by mothers in Brighton. Our work questions such reasoning in showing how wider personal and social issues shape parents' immunisation actions. The narratives by mothers show how practices around MMR are shaped by personal histories, by birth experiences and related feelings of control, by family health histories, by their readings of their child's health and particular strengths and vulnerabilities, by particular engagements with health services, by processes building or undermining confidence, and by friendships and conversations with others, which are themselves shaped by wider social differences and transformations. Although many see vaccination as a personal decision which must respond to the particularities of a child's immune system, 'MMR talk', which affirms these conceptualisations, has become a social phenomenon in itself. These perspectives suggest ways in which people's engagements with MMR reflect wider changes in their relations with science and the state.

  7. Small Molecule Disrupts Abnormal Gene Fusion Associated with Leukemia | Center for Cancer Research

    Science.gov (United States)

    Rare chromosomal abnormalities, called chromosomal translocations, in which part of a chromosome breaks off and becomes attached to another chromosome, can result in the generation of chimeric proteins. These aberrant proteins have unpredictable, and sometimes harmful, functions, including uncontrolled cell growth that can lead to cancer. One type of translocation, in which a portion of the gene encoding nucleoporin 98 (NUP98)—one of about 50 proteins comprising the nuclear pore complex through which proteins are shuttled into and out of the nucleus—fuses with another gene, has been shown to result in improper histone modifications. These abnormalities alter the gene expression patterns of certain types of hematopoietic, or blood-forming, stem cells, resulting primarily in overexpression of the Hoxa7, Hoxa9,and Hoxa10 genes. NUP98 chromosomal translocations have been associated with many types of leukemia, including acute myeloid leukemia (AML), acute lymphoid leukemia (ALL), chronic myeloid leukemia in blast crisis (CML-bc), and myelodysplastic syndrome (MDS).

  8. Genetic Analysis of Mismatch Repair Genes Alterations in Extramammary Paget Disease.

    Science.gov (United States)

    Kang, Zhihua; Xu, Feng; Zhu, Yingfeng; Fu, Pan; Zhang, Qiao-An; Hu, Tingting; Li, Xiangyu; Zhang, Qunfeng; Wu, Zhiyuan; Zhang, Xinju; Wang, Hua; Xu, Jinhua; Fang, Zujun; Guan, Ming

    2016-11-01

    Extramammary Paget disease (EMPD) is a rare cutaneous malignant neoplasm. The familial occurrence of EMPD and the high risk of concomitant secondary tumors in EMPD patients have gained much attention. These findings highlight the importance of genetic alterations in the tumorigenesis of this skin cancer. Genetic tests and functional analysis of mismatch repair (MMR) genes were performed in EMPD. The results showed that 8 of 20 cases with germline MMR genes mutations and 5 of them exhibited microsatellite instability (MSI). Immunohistochemical staining showed that the tumor tissues from 20 patients had the normal expression of MLH1 but 5 cases had the reduced expression of MSH2. There is a nearly significant correlation between MSI and germline mutations. In 172 cases, rates of germline and somatic mutations were 34.3% and 13.4%, respectively. The mutations of MLH1 V384D (15.7%), R217C (4.1%), and I219V (5.2%) were common in this cancer. In addition, the yeast 2-hybrid and immunoprecipitation assays exhibited reduced interaction between MLH1 and PMS2 in MLH1 V384D and R217C but not I219V. Moreover, MLH1 V384D and R217C had impaired MMR activity compared with the wild-type and I219V mutation by an in vitro MMR assay. The germline mutations in MMR genes are involved in the pathogenesis of EMPD and partially explain the genetic abnormalities for this disease.

  9. Reporting of MMR evidence in professional publications: 1988-2007.

    Science.gov (United States)

    Hilton, S; Hunt, K; Langan, M; Hamilton, V; Petticrew, M

    2009-11-01

    To examine how journals and magazines disseminate research evidence and guidance on best practice to health professionals by aligning commentaries on measles, mumps, and rubella vaccine (MMR) evidence in journals with key events in the MMR controversy. Content analysis. Comment articles in six commonly read UK publications. Number of comment pieces by publication, year and article type; trends in the focus, tone and inclusion of recommendations on MMR. 860 articles met the inclusion criteria (BMJ n = 104, Community Practitioner n = 45, Health Visitor n = 24, Practice Nurse n = 61, Nursing Standard n = 61 and Pulse n = 565). Of these 860 comment pieces, 264 made some reference to evidence endorsing the safety of MMR. Around one in 10 were rated as negative (10.9%, n = 29) or neutral (11.3%, n = 30) in relation to MMR safety, and nearly a quarter (22.7%, n = 60) were rated as mixed. Following the publication of Wakefield et al's 1998 paper there was a period of neutrality. In 2000, despite growing public concerns and widespread media coverage, fewer than 20 comment pieces were published. Less than a quarter of comment pieces (n = 196, 22.7%) included recommendations. While a period of neutrality may reflect a professional response to uncertainty by holding back until consensus emerges, it may also represent a missed opportunity to promote evidence-based practice.

  10. No evidence of an association between MMR vaccine and gait disturbance.

    Science.gov (United States)

    Miller, E; Andrews, N; Grant, A; Stowe, J; Taylor, B

    2005-03-01

    MMR vaccine has been reported to cause gait disturbance, and this possible association has been claimed to support the MMR-causes-autism theory. To determine whether any association between gait disturbance and MMR vaccination exceeds the age related background rate of gait disturbance, using record linkage and self control case series analyses. MMR vaccination records were linked to hospital admission and general practitioner attendance data. An increased rate of gait problems with onset in various intervals in the 60 day period after MMR vaccination was looked for in children aged 12 to vaccination risk periods. This study provides no evidence for a causal association between MMR and gait disturbance.

  11. Rubella in Israel after the MMR vaccine: elimination or containment?

    Science.gov (United States)

    Anis, Emilia; Grotto, Itamar; Moerman, Larisa; Kaliner, Ehud; Warshavsky, Bruce; Slater, Paul E; Lev, Boaz

    2013-05-01

    Since 1996, after the full institution of the two-dose measles, mumps, and rubella vaccine (MMR) regimen in Israel, rubella incidence has declined dramatically and has remained extremely low. Cyclical outbreaks ended; the two brief outbreaks that did occur were quickly contained; and epidemiological data indicate that the disease is practically absent from the country. But similar steep declines in the incidence of measles and mumps, the two other MMR-preventable diseases, were followed by major outbreaks in 2007 and 2010. Epidemiological analyses show that undervaccination of subgroups within the Jewish ultra-orthodox population, both in Israel and abroad, and virus importation into Israel, continue to be risk factors for all three MMR-preventable diseases. Israel's public health system, therefore, should focus on a policy of containment: improve MMR coverage among undervaccinated subgroups and assure that virus importation is no longer a risk. Then the goal of rubella elimination will become feasible. We discuss how the Israeli experience may contribute to the World Health Organization Initiative to eliminate simultaneously measles and rubella.

  12. Measles, Mumps, Rubella and the MMR Vaccine during Pregnancy

    Science.gov (United States)

    ... very rare cases, a person who receives the measles vaccine will develop the illness. However, there is information on a large number of pregnancies where a woman received the MMR vaccine during pregnancy. They did not have pregnancy complications and there was no increased rate of birth ...

  13. MMR vaccination and autism: is there a link?

    Science.gov (United States)

    DeStefano, Frank; Thompson, William W

    2002-07-01

    In 1998, a report was published describing 12 patients with inflammatory bowel conditions and regressive developmental disorders consisting primarily of autism. The authors hypothesised that MMR vaccine may have been responsible for the bowel dysfunction which subsequently resulted in the neurodevelopmental disorders. The suggestion that measles vaccine may cause autism through a persistent bowel infection generated much interest since it provided a possible biological mechanism for a causal association. Epidemiological studies, however, have not found an association between MMR vaccination and autism. Autism has a strong genetic component and its associated neurological defects probably occur during embryonic development. It seems unlikely that a vaccination that is given after birth could cause autism. In a minority of cases, autism may have onset after 1 year of age (regressive autism) but the one epidemiological study that included such cases did not find an association with MMR vaccination. Currently, the weight of the available epidemiological and related evidence does not support a causal link between MMR vaccine and autism.

  14. Contribution of chromosomal abnormalities and genes of the major histocompatibility complex to early pregnancy losses

    Directory of Open Access Journals (Sweden)

    Tkach I. R.

    2015-02-01

    Full Text Available Aim. The determination of chromosomal abnormalities in samples from early pregnancy losses and allelic polymorphism of HLA–DRB1 and DQA1 genes in couples with recurrent miscarriage. Methods. Banding cytogenetic and interphase mFISH analysis, DNA extraction by salting method, PCR, agarose gel electrophoresis. Results. Cytogenetic and molecular-cytogenetic investigations of SA material identified karyotype anomalies in 32.4 % of cases with prevalence of autosomal trisomy – 42.65 %, triploidy – 30.38 % and monosomy X – 19.11 %. Complex analysis of frequency and distribution of allelic variants of genes HLA-DRB1 and HLA-DQA1 allowed establishing the alleles DRB1*0301, DRB1*1101-1104 and DQA1*0501 to be aggressor alleles in women with recurrent pregnancy loss (RPL. The cumulative homology of allelic polymorphism of more than 50 % of HLA-DRB1 and HLA-DQA1 loci between partners increases the risk of RPL by almost four times. Conclusion. The detected chromosome aneuploidies in the samples from products of conception and the changes in the major histocompatibility complex genes can cause the failure of a couples reproductive function and can lead to an early fetal loss.

  15. Chromosome 15 structural abnormalities: effect on IGF1R gene expression and function

    Directory of Open Access Journals (Sweden)

    Rossella Cannarella

    2017-09-01

    Full Text Available Insulin-like growth factor 1 receptor (IGF1R, mapping on the 15q26.3 chromosome, is required for normal embryonic and postnatal growth. The aim of the present study was to evaluate the IGF1R gene expression and function in three unrelated patients with chromosome 15 structural abnormalities. We report two male patients with the smallest 15q26.3 chromosome duplication described so far, and a female patient with ring chromosome 15 syndrome. Patient one, with a 568 kb pure duplication, had overgrowth, developmental delay, mental and psychomotor retardation, obesity, cryptorchidism, borderline low testis volume, severe oligoasthenoteratozoospermia and gynecomastia. We found a 1.8-fold increase in the IGF1R mRNA and a 1.3-fold increase in the IGF1R protein expression (P < 0.05. Patient two, with a 650 kb impure duplication, showed overgrowth, developmental delay, mild mental retardation, precocious puberty, low testicular volume and severe oligoasthenoteratozoospermia. The IGF1R mRNA and protein expression was similar to that of the control. Patient three, with a 46,XX r(15 (p10q26.2 karyotype, displayed intrauterine growth retardation, developmental delay, mental and psychomotor retardation. We found a <0.5-fold decrease in the IGF1R mRNA expression and an undetectable IGF1R activity. After reviewing the previously 96 published cases of chromosome 15q duplication, we found that neurological disorders, congenital cardiac defects, typical facial traits and gonadal abnormalities are the prominent features in patients with chromosome 15q duplication. Interestingly, patients with 15q deletion syndrome display similar features. We speculate that both the increased and decreased IGF1R gene expression may play a role in the etiology of neurological and gonadal disorders.

  16. MMR-Vaccine and Regression in Autism Spectrum Disorders: Negative Results Presented from Japan

    Science.gov (United States)

    Uchiyama, Tokio; Kurosawa, Michiko; Inaba, Yutaka

    2007-01-01

    It has been suggested that the measles, mumps, and rubella vaccine (MMR) is a cause of regressive autism. As MMR was used in Japan only between 1989 and 1993, this time period affords a natural experiment to examine this hypothesis. Data on 904 patients with autism spectrum disorders (ASD) were analyzed. During the period of MMR usage no…

  17. U.K. parents' decision-making about measles-mumps-rubella (MMR) vaccine 10 years after the MMR-autism controversy: a qualitative analysis.

    Science.gov (United States)

    Brown, Katrina F; Long, Susannah J; Ramsay, Mary; Hudson, Michael J; Green, John; Vincent, Charles A; Kroll, J Simon; Fraser, Graham; Sevdalis, Nick

    2012-02-27

    Public concern about an unsubstantiated link between MMR vaccine and autism stemmed from a 1998 paper by Dr Andrew Wakefield and colleagues, and the substantial media coverage which that work attracted. Though the Wakefield paper is now discredited and an MMR-autism link has never been demonstrated empirically, this concern has manifested in over a decade of suboptimal MMR uptake. Few qualitative studies have explored parents' MMR decision-making since uptake began to improve in 2004. This study updates and adds methodological rigour to the evidence base. 24 mothers planning to accept, postpone or decline the first MMR dose (MMR1) for their 11-36 month-old children, described their decision-making in semi-structured interviews. Mothers were recruited via General Practice, parents' groups/online forums, and chain referral. MMR1 status was obtained from General Practice records 6 months post-interview. Interview transcripts were coded and interpreted using a modified Grounded Theory approach. Five themes were identified: MMR vaccine and controversy; Social and personal consequences of MMR decision; Health professionals and policy; Severity and prevalence of measles, mumps and rubella infections; Information about MMR and alternatives. Results indicated that MMR1 acceptors were sympathetic toward Wakefield as a person, but universally rejected his study which sparked the controversy; parents opting for single vaccines expressed the sense that immune overload is not a consideration but that not all three components of MMR are warranted by disease severity; and MMR1 rejectors openly criticised other parents' MMR decisions and decision-making. This study corroborated some previous qualitative work but indicated that the shrinking group of parents now rejecting MMR comprises mainly those with more extreme and complex anti-immunisation views, whilst parents opting for single vaccines may use second-hand information about the controversy. In response, policymakers and

  18. Cross-calibration of the Siemens mMR

    DEFF Research Database (Denmark)

    Keller, Sune H; Jakoby, Björn; Svalling, Susanne

    2016-01-01

    BACKGROUND: We present a quick and easy method to perform quantitatively accurate PET scans of typical water-filled PET plastic shell phantoms on the Siemens Biograph mMR PET/MR system. We perform regular cross-calibrations (Xcal) of our PET systems, including the PET/MR, using a Siemens mCT water...... range [0.95-1.05], showing high accuracy. CONCLUSIONS: The mMR is the most stable PET system in this study, and the mean underestimation is no longer an issue with the easily accessible μ-map, which resulted in correct cross-calibration ratios in all seven tests. We will share the user-defined μ...

  19. White Matter Abnormalities and Dystonic Motor Disorder Associated with Mutations in the "SLC16A2" Gene

    Science.gov (United States)

    Gika, Artemis D.; Siddiqui, Ata; Hulse, Anthony J.; Edward, Selvakumari; Fallon, Penny; McEntagart, Meriel E.; Jan, Wajanat; Josifova, Dragana; Lerman-Sagie, Tally; Drummond, James; Thompson, Edward; Refetoff, Samuel; Bonnemann, Carsten G.; Jungbluth, Heinz

    2010-01-01

    Aim: Mutations in the "SLC16A2" gene have been implicated in Allan-Herndon-Dudley syndrome (AHDS), an X-linked learning disability syndrome associated with thyroid function test (TFT) abnormalities. Delayed myelination is a non-specific finding in individuals with learning disability whose genetic basis is often uncertain. The aim of this study…

  20. Improving MMR vaccination rates: herd immunity is a realistic goal.

    Science.gov (United States)

    Cockman, Philippa; Dawson, Luise; Mathur, Rohini; Hull, Sally

    2011-10-04

    As measles is a highly infectious disease, the United Kingdom recommendation is for at least 95% of children to receive a first vaccination with the measles, mumps, and rubella (MMR) vaccine before age 2 years and a booster before age 5 years to achieve herd immunity and prevent outbreaks. Reported vaccination rates for England have improved since a low level in 2003-4. Coverage for London is consistently lower than for England, however, and concerns have been expressed that there could be an epidemic of measles in the capital. Observational time series study. London Borough of Tower Hamlets. Key measurements for improvement Uptake rates for childhood vaccinations. The key target was to reach 95% coverage for the first MMR vaccine before age 2 years. Financial support for the development of geographically based networks of general practices. Commissioning of care packages, incentivising delivery of high quality integrated care with network level vaccination targets of 95%. Innovative use of information technology to enable robust call and recall processes, active follow-up of defaulters, and increased knowledge about the demography of the children most difficult to reach. The development of networks of practices facilitated collaborative working among primary care clinicians and other stakeholders; peer review of achievements; and an element of healthy competition. Uptake improved for all childhood vaccinations, and to herd immunity levels for most. Uptake of the first MMR vaccine before age 2 years rose from 80% in September 2009 to 94% in March 2011. Achieving herd immunity for childhood vaccinations is an achievable target in an ethnically mixed, socially deprived inner city borough. The ability to identify characteristics of the difficult to reach groups, including significant differences in uptake across different ethnicities, will allow targeted interventions that may further improve overall coverage.

  1. Disruption of the mouse Jhy gene causes abnormal ciliary microtubule patterning and juvenile hydrocephalus

    Science.gov (United States)

    Appelbe, Oliver K.; Bollman, Bryan; Attarwala, Ali; Triebes, Lindy A.; Muniz-Talavera, Hilmarie; Curry, Daniel J.; Schmidt, Jennifer V.

    2013-01-01

    SUMMARY Congenital hydrocephalus, the accumulation of excess cerebrospinal fluid (CSF) in the ventricles of the brain, affects one of every 1,000 children born today, making it one of the most common human developmental disorders. Genetic causes of hydrocephalus are poorly understood in humans, but animal models suggest a broad genetic program underlying the regulation of CSF balance. In this study, the random integration of a transgene into the mouse genome led to the development of an early onset and rapidly progressive hydrocephalus. Juvenile hydrocephalus transgenic mice (JhylacZ) inherit communicating hydrocephalus in an autosomal recessive fashion with dilation of the lateral ventricles observed as early as postnatal day 1.5. Ventricular dilation increases in severity over time, becoming fatal at 4-8 weeks of age. The ependymal cilia lining the lateral ventricles are morphologically abnormal and reduced in number in JhylacZ/lacZ brains, and ultrastructural analysis revealed disorganization of the expected 9+2 microtubule pattern. Rather, the majority of JhylacZ/lacZ cilia develop axonemes with 9+0 or 8+2 microtubule structures. Disruption of an unstudied gene, 4931429I11Rik (now named Jhy) appears to underlie the hydrocephalus of JhylacZ/lacZ mice, and the Jhy transcript and protein are decreased in JhylacZ/lacZ mice. Partial phenotypic rescue was achieved in JhylacZ/lacZ mice by the introduction of a bacterial artificial chromosome (BAC) carrying 60-70% of the JHY protein coding sequence. Jhy is evolutionarily conserved from humans to basal vertebrates, but the predicted JHY protein lacks identifiable functional domains. Ongoing studies are directed at uncovering the physiological function of JHY and its role in CSF homeostasis. PMID:23906841

  2. Risk, its perception and the media: the MMR controversy.

    Science.gov (United States)

    Hackett, Alison Jane

    2008-07-01

    This article aims to explore how the media contributes to and generates 'risk' and 'risk perception.' The example of parents refusing to have their children immunised with the measles, mumps and rubella (MMR) vaccine following negative media reporting will be discussed. The media appears to have an important influence on the perception of risk. We are living in a society that is increasingly aware of risk, and in which risk is socially constructed. It is important that healthcare professionals provide clear, consistent, evidence-based information to clients, ensuring that any areas of uncertainty are acknowledged. Otherwise, the public's trust in the healthcare professional will be undermined.

  3. Differential gene expression profile associated with the abnormality of bone marrow mesenchymal stem cells in aplastic anemia.

    Directory of Open Access Journals (Sweden)

    Jianping Li

    Full Text Available Aplastic anemia (AA is generally considered as an immune-mediated bone marrow failure syndrome with defective hematopoietic stem cells (HSCs and marrow microenvironment. Previous studies have demonstrated the defective HSCs and aberrant T cellular-immunity in AA using a microarray approach. However, little is known about the overall specialty of bone marrow mesenchymal stem cells (BM-MSCs. In the present study, we comprehensively compared the biological features and gene expression profile of BM-MSCs between AA patients and healthy volunteers. In comparison with healthy controls, BM-MSCs from AA patients showed aberrant morphology, decreased proliferation and clonogenic potential and increased apoptosis. BM-MSCs from AA patients were susceptible to be induced to differentiate into adipocytes but more difficult to differentiate into osteoblasts. Consistent with abnormal biological features, a large number of genes implicated in cell cycle, cell division, proliferation, chemotaxis and hematopoietic cell lineage showed markedly decreased expression in BM-MSCs from AA patients. Conversely, more related genes with apoptosis, adipogenesis and immune response showed increased expression in BM-MSCs from AA patients. The gene expression profile of BM-MSCs further confirmed the abnormal biological properties and provided significant evidence for the possible mechanism of the destruction of the bone marrow microenvironment in AA.

  4. MMR vaccine in 14 months old children, intramuscular versus subcutaneous administration

    NARCIS (Netherlands)

    Lafeber AF; Klis FRM van der; Marzec AHJO; Labadie J; Ommen R van; Strieder TG; Berbers GAM; Utrecht Stichting Thuiszorg; Amersfoort Stichting Thuiszorg Eemland (STE),; LVO

    2001-01-01

    In this study we compared the recommended subcutaneous administration of the RIVM MMR vaccine with the intramuscular administration for both safety and immunogenicity. Study subjects were 14 months old children, living in Amersfoort or Utrecht, who were eligible for their first MMR vaccination.

  5. MMR vaccination status of children exempted from school-entry immunization mandates.

    Science.gov (United States)

    Buttenheim, Alison M; Sethuraman, Karthik; Omer, Saad B; Hanlon, Alexandra L; Levy, Michael Z; Salmon, Daniel

    2015-11-17

    Child immunizations are one of the most successful public health interventions of the past century. Still, parental vaccine hesitancy is widespread and increasing. One manifestation of this are rising rates of nonmedical or "personal beliefs" exemptions (PBEs) from school-entry immunization mandates. Exemptions have been shown to be associated with increased risk of disease outbreak, but the strength of this association depends critically on the true vaccination status of exempted children, which has not been assessed. To estimate the true measles-mumps-rubella (MMR) vaccination status of children with PBEs. We use administrative data collected by the California Department of Public Health in 2009 and imputation to estimate the MMR vaccination status of children with PBEs under varying scenarios. Results from 2009 surveillance data indicate MMR1/MMR2 coverage of 18-47% among children with PBEs at typical schools and 11-34% among children with PBEs at schools with high PBE rates. Imputation scenarios point to much higher coverage (64-92% for MMR1 and 25-58% for MMR2 at typical schools; 49-90% for MMR1 and 16-63% for MMR2 at high PBE schools) but still below levels needed to maintain herd immunity against measles. These coverage estimates suggest that prior analyses of the relative risk of measles associated with vaccine refusal underestimate that risk by an order of magnitude of 2-10 times. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Characterization of oil palm MADS box genes in relation to the mantled flower abnormality

    NARCIS (Netherlands)

    Syed Alwee, S.; Linden, van der C.G.; Schoot, van der J.; Folter, de S.; Angenent, G.C.; Cheah, S.C.; Smulders, M.J.M.

    2006-01-01

    In vitro propagation of oil palm (Elaeis guineensis Jacq.) frequently induces a somaclonal variant called `mantled¿ abnormality, in which the stamens of both male and female flowers are transformed into carpels. This leads to a reduced yield or complete loss of the harvest of palm oil. The high

  7. Prenatal diagnostic testing of the Noonan syndrome genes in fetuses with abnormal ultrasound findings

    NARCIS (Netherlands)

    Croonen, Ellen A.; Nillesen, Willy M.; Stuurman, Kyra E.; Oudesluijs, Gretel; van de Laar, Ingrid M. B. M.; Martens, Liesbeth; Ockeloen, Charlotte; Mathijssen, Inge B.; Schepens, Marga; Ruiterkamp-Versteeg, Martina; Scheffer, Hans; Faas, Brigitte H. W.; van der Burgt, Ineke; Yntema, Helger G.

    2013-01-01

    In recent studies on prenatal testing for Noonan syndrome (NS) in fetuses with an increased nuchal translucency (NT) and a normal karyotype, mutations have been reported in 9-16% of cases. In this study, DNA of 75 fetuses with a normal karyotype and abnormal ultrasound findings was tested in a

  8. Cumulative Epigenetic Abnormalities in Host Genes with Viral and Microbial Infection during Initiation and Progression of Malignant Lymphoma/Leukemia

    Energy Technology Data Exchange (ETDEWEB)

    Oka, Takashi, E-mail: oka@md.okayama-u.ac.jp [Department of Pathology, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikata-cho, Okayama 700-8558 (Japan); Sato, Hiaki [Department of Medical Technology, Graduate School of Health Science, Okayama University Medical School, 2-5-1 Shikata-cho, Okayama 700-8558 (Japan); Ouchida, Mamoru [Department of Molecular Genetics, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikata-cho, Okayama 700-8558 (Japan); Utsunomiya, Atae [Department of Hematology, Imamura Bun-in Hospital, 11-23 Kamoike Shinnmachi, Kagoshima, 890-0064 (Japan); Yoshino, Tadashi [Department of Pathology, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikata-cho, Okayama 700-8558 (Japan)

    2011-02-04

    Although cancers have been thought to be predominantly driven by acquired genetic changes, it is becoming clear that microenvironment-mediated epigenetic alterations play important roles. Aberrant promoter hypermethylation is a prevalent phenomenon in human cancers as well as malignant lymphoma/leukemia. Tumor suppressor genes become frequent targets of aberrant hypermethylation in the course of gene-silencing due to the increased and deregulated DNA methyltransferases (DNMTs). The purpose of this article is to review the current status of knowledge about the contribution of cumulative epigenetic abnormalities of the host genes after microbial and virus infection to the crisis and progression of malignant lymphoma/leukemia. In addition, the relevance of this knowledge to malignant lymphoma/leukemia assessment, prevention and early detection will be discussed.

  9. Cumulative Epigenetic Abnormalities in Host Genes with Viral and Microbial Infection during Initiation and Progression of Malignant Lymphoma/Leukemia

    International Nuclear Information System (INIS)

    Oka, Takashi; Sato, Hiaki; Ouchida, Mamoru; Utsunomiya, Atae; Yoshino, Tadashi

    2011-01-01

    Although cancers have been thought to be predominantly driven by acquired genetic changes, it is becoming clear that microenvironment-mediated epigenetic alterations play important roles. Aberrant promoter hypermethylation is a prevalent phenomenon in human cancers as well as malignant lymphoma/leukemia. Tumor suppressor genes become frequent targets of aberrant hypermethylation in the course of gene-silencing due to the increased and deregulated DNA methyltransferases (DNMTs). The purpose of this article is to review the current status of knowledge about the contribution of cumulative epigenetic abnormalities of the host genes after microbial and virus infection to the crisis and progression of malignant lymphoma/leukemia. In addition, the relevance of this knowledge to malignant lymphoma/leukemia assessment, prevention and early detection will be discussed

  10. Repeated manganese administration produced abnormal expression of circadian clock genes in the hypothalamus and liver of rats.

    Science.gov (United States)

    Li, Huan; Fan, Ximin; Luo, Ying; Song, Sheng; Liu, Jie; Fan, Qiyuan

    2017-09-01

    Manganese (Mn) neurotoxicity displays non-motor dysfunction and motor impairment like Parkinson's disease (PD), and is called as Manganism. Circadian disruption is a non-motor symptom found in PD and Manganism. Clock genes are essential to drive and maintain circadian rhythm, but little is known about Mn exposure on circadian clock genes expression. Both the brain and liver are targets of Mn, we hypothesize that repeated Mn administration could affect clock gene expression in the hypothalamus and livers. Male Sprague-Dawley rats were intraperitoneally injected Mn 2+ 1mg and 5mg/kg as MnCl 2 ·4H 2 O, every other day for 30 days. Mn neurotoxicity was evaluated by behavioral changes and loss of dopaminergic neurons via immunohistochemistry. The expression of circadian clock genes was determined via RT-qPCR. Repeated Mn administration dose-dependently retarded the body weight gain, impaired the rotarod activity, decreased the number of dopaminergic neurons in the substantia nigra, and activated microglia in the brain. Expressions of circadian core genes brain and muscle Arnt-like protein-1 (Bmal1), locomotor output cycles kaput (Clock) and neuronal PAS domain protein2 (Npas2), and clock feedback gene cryptochrome1 (Cry1), period genes (Per1 and Per2) in the hypothalamus and liver were decreased after exposure to Mn in a dose-dependent manner, while expressions of clock-targeted genes nuclear receptor Rev-Erbα (Nr1d1) and D-box-binding protein (Dbp) were increased. Peripheral clock in the liver appears to be more susceptible to Mn-induced abnormal clock gene expression. In summary, repeated Mn administration produced dysregulation of circadian clock gene expressions in both the brain and liver. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Abnormal muscle and hematopoietic gene expression may be important for clinical morbidity in primary hyperparathyroidism

    DEFF Research Database (Denmark)

    Reppe, Sjur; Stilgren, Lis; Abrahamsen, Bo

    2007-01-01

    , kidney stones and metabolic bone disease. Our objective was to characterize changes in muscle and hematopoietic gene expression in patients with reversible mild PHPT after parathyroidectomy and possibly link molecular pathology to symptoms. Global mRNA profiling using Affymetrix gene chips was carried...

  12. Eye and brain abnormalities in congenital muscular dystrophies caused by fukutin-related protein gene (FKRP) mutations.

    Science.gov (United States)

    Kava, Maina; Chitayat, David; Blaser, Susan; Ray, Peter N; Vajsar, Jiri

    2013-11-01

    Mutations in the fukutin-related protein gene account for a broad spectrum of phenotypes ranging from severe congenital muscular dystrophies to a much milder limb-girdle muscular dystrophy 2I. The involvement of the eyes is variable, with most patients having normal eye examination. We describe eye and brain abnormalities in a 16 month-old-boy with Walker-Warburg syndrome phenotype resulting from a novel fukutin-related protein gene mutation in exon 4 and compare these with other reported patients with fukutin-related protein gene mutation. All patients with reported fukutin-related protein gene mutations who had eye involvement were included. Their clinical features, brain magnetic resonance imaging, and eye findings were compared with our patient. Patients with fukutin-related protein gene mutation tend to have no or mild eye involvement (generally strabismus), with very few cases reported of moderate to severe eye involvement. Our patient with a novel mutation c.558dupC(p.Ala187fs) represents one of the most severe phenotypes described in regard to eye involvement. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. MMR vaccination and pervasive developmental disorders: a case-control study.

    Science.gov (United States)

    Smeeth, Liam; Cook, Claire; Fombonne, Eric; Heavey, Lisa; Rodrigues, Laura C; Smith, Peter G; Hall, Andrew J

    Concern that measles-mumps-rubella (MMR) vaccination might cause autism has led to a fall in vaccine coverage. We investigated whether MMR vaccination is associated with an increased risk of autism or other pervasive developmental disorders. We did a matched case-control study using the UK General Practice Research Database. Cases were people born in 1973 or later who had first recorded diagnosis of pervasive developmental disorder while registered with a contributing general practice between 1987 and 2001. Controls were matched on age, sex, and general practice. 1294 cases and 4469 controls were included. 1010 cases (78.1%) had MMR vaccination recorded before diagnosis, compared with 3671 controls (82.1%) before the age at which their matched case was diagnosed. After adjustment for age at joining the database, the odds ratio for association between MMR and pervasive developmental disorder was 0.86 (95% CI 0.68-1.09). Findings were similar when restricted to children with a diagnosis of autism, to those vaccinated with MMR before the third birthday, or to the period before media coverage of the hypothesis linking MMR with autism. Our findings suggest that MMR vaccination is not associated with an increased risk of pervasive developmental disorders.

  14. Abnormalities in alternative splicing of angiogenesis-related genes and their role in HIV-related cancers

    Directory of Open Access Journals (Sweden)

    Mthembu NN

    2017-03-01

    Full Text Available Nonkululeko N Mthembu,1 Zukile Mbita,2 Rodney Hull,1 Zodwa Dlamini1 1Research, Innovation and Engagements, Mangosuthu University of Technology, Durban, 2Department of Biochemistry, Microbiology and Biotechnology, University of Limpopo, Sovenga, South Africa Abstract: Alternative splicing of mRNA leads to an increase in proteome biodiversity by allowing the generation of multiple mRNAs, coding for multiple protein isoforms of various structural and functional properties from a single primary pre-mRNA transcript. The protein isoforms produced are tightly regulated in normal development but are mostly deregulated in various cancers. In HIV-infected individuals with AIDS, there is an increase in aberrant alternative splicing, resulting in an increase in HIV/AIDS-related cancers, such as Kaposi’s sarcoma, non-Hodgkin’s lymphoma, and cervical cancer. This aberrant splicing leads to abnormal production of protein and is caused by mutations in cis-acting elements or trans-acting factors in angiogenesis-related genes. Restoring the normal regulation of alternative splicing of angiogenic genes would alter the expression of protein isoforms and may confer normal cell physiology in patients with these cancers. This review highlights the abnormalities in alternative splicing of angiogenesis-related genes and their implication in HIV/AIDS-related cancers. This allows us to gain an insight into the pathogenesis of HIV/AIDS-related cancer and in turn elucidate the therapeutic potential of alternatively spliced genes in HIV/AIDS-related malignancies. Keywords: vascular endothelial growth factor, oncogenic viruses, hypoxia induced factor 1, Kaposi’s sarcoma, non-Hodgkin’s lymphoma, therapies targeting alternative splicing

  15. Identification of abnormal gene expression in bovine transgenic somatic cell nuclear transfer embryos

    OpenAIRE

    Cho, Jongki; Kang, Sungkeun; Lee, Byeong Chun

    2014-01-01

    This study was conducted to investigate the expression of three genes related to early embryonic development in bovine transgenic cloned embryos. To accomplish this, development of bovine transgenic somatic cell nuclear transfer (SCNT) embryos was compared with non-transgenic embryos. Next, mRNA transcription of three specific genes (DNMT1, Hsp 70.1, and Mash2) related to early embryo development in transgenic SCNT embryos was compared between transgenic and non-transgenic SCNTs, parthenogene...

  16. Image reconstruction of mMR PET data using the open source software STIR

    Energy Technology Data Exchange (ETDEWEB)

    Markiewicz, Pawel [Centre for Medical Image Computing, University College London, London (United Kingdom); Thielemans, Kris [Institute of Nuclear Medicine, University College London, London (United Kingdom); Burgos, Ninon [Centre for Medical Image Computing, University College London, London (United Kingdom); Manber, Richard [Institute of Nuclear Medicine, University College London, London (United Kingdom); Jiao, Jieqing [Centre for Medical Image Computing, University College London, London (United Kingdom); Barnes, Anna [Institute of Nuclear Medicine, University College London, London (United Kingdom); Atkinson, David [Centre for Medical Imaging, University College London, London (United Kingdom); Arridge, Simon R [Centre for Medical Image Computing, University College London, London (United Kingdom); Hutton, Brian F [Institute of Nuclear Medicine, University College London, London (United Kingdom); Ourselin, Sébastien [Centre for Medical Image Computing, University College London, London (United Kingdom); Dementia Research Centre, University College London, London (United Kingdom)

    2014-07-29

    Simultaneous PET and MR acquisitions have now become possible with the new hybrid Biograph Molecular MR (mMR) scanner from Siemens. The purpose of this work is to create a platform for mMR 3D and 4D PET image reconstruction which would be freely accessible to the community as well as fully adjustable in order to obtain optimal images for a given research task in PET imaging. The proposed platform is envisaged to prove useful in developing novel and robust image bio-markers which could then be adapted for use on the mMR scanner.

  17. XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication.

    Science.gov (United States)

    Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David

    2012-07-01

    Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.

  18. Neurodevelopmental Disorders Associated with Abnormal Gene Dosage: Smith-Magenis and Potocki-Lupski Syndromes.

    Science.gov (United States)

    Neira-Fresneda, Juanita; Potocki, Lorraine

    2015-09-01

    Smith-Magenis syndrome (SMS) and Potocki-Lupski syndrome (PTLS) are reciprocal contiguous gene syndromes within the well-characterized 17p11.2 region. Approximately 3.6 Mb microduplication of 17p11.2, known as PTLS, represents the mechanistically predicted homologous recombination reciprocal of the SMS microdeletion, both resulting in multiple congenital anomalies. Mouse model studies have revealed that the retinoic acid-inducible 1 gene (RAI1) within the SMS and PTLS critical genomic interval is the dosage-sensitive gene responsible for the major phenotypic features in these disorders. Even though PTLS and SMS share the same genomic region, clinical manifestations and behavioral issues are distinct and in fact some mirror traits may be on opposite ends of a given phenotypic spectrum. We describe the neurobehavioral phenotypes of SMS and PTLS patients during different life phases as well as clinical guidelines for diagnosis and a multidisciplinary approach once diagnosis is confirmed by array comparative genomic hybridization or RAI1 gene sequencing. The main goal is to increase awareness of these rare disorders because an earlier diagnosis will lead to more timely developmental intervention and medical management which will improve clinical outcome.

  19. Microsatellite Instability Use in Mismatch Repair Gene Sequence Variant Classification

    Directory of Open Access Journals (Sweden)

    Bryony A. Thompson

    2015-03-01

    Full Text Available Inherited mutations in the DNA mismatch repair genes (MMR can cause MMR deficiency and increased susceptibility to colorectal and endometrial cancer. Microsatellite instability (MSI is the defining molecular signature of MMR deficiency. The clinical classification of identified MMR gene sequence variants has a direct impact on the management of patients and their families. For a significant proportion of cases sequence variants of uncertain clinical significance (also known as unclassified variants are identified, constituting a challenge for genetic counselling and clinical management of families. The effect on protein function of these variants is difficult to interpret. The presence or absence of MSI in tumours can aid in determining the pathogenicity of associated unclassified MMR gene variants. However, there are some considerations that need to be taken into account when using MSI for variant interpretation. The use of MSI and other tumour characteristics in MMR gene sequence variant classification will be explored in this review.

  20. MMR (Measles, Mumps and Rubella) Vaccine: What You Need to Know

    Science.gov (United States)

    VACCINE INFORMATION STATEMENT MMR (Measles, Mumps, and Rubella) Vaccine: What You Need to Know Many Vaccine Information Statements are available in Spanish and other languages. See www. immunize. org/ vis Hojas ...

  1. Effect of Pentavac and measles-mumps-rubella (MMR) vaccination on the intestine.

    Science.gov (United States)

    Thjodleifsson, B; Davídsdóttir, K; Agnarsson, U; Sigthórsson, G; Kjeld, M; Bjarnason, I

    2002-12-01

    The safety of infant vaccination has been questioned in recent years. In particular it has been suggested that the measles, mumps, and rubella (MMR) vaccination leads to brain damage manifesting as autism consequent to the development of an "enterocolitis" in the immediate post-vaccination period. To assess if MMR vaccination is associated with subclinical intestinal inflammation, which is central to the autistic "enterocolitis" theory. We studied 109/58 infants, before and two and four weeks after immunisation with Pentavac and MMR vaccines, for the presence of intestinal inflammation (faecal calprotectin). Neither vaccination was associated with any significant increase in faecal calprotectin concentrations. The failure of the MMR vaccination to cause an intestinal inflammatory response provides evidence against the proposed gut-brain interaction that is central to the autistic "enterocolitis" hypothesis.

  2. MMR (measles, mumps, and rubella) vaccine - what you need to know

    Science.gov (United States)

    ... taken in its entirety from the CDC MMR (Measles, Mumps, & Rubella) Vaccine Information Statement (VIS): www.cdc. ... Why get vaccinated? Measles, mumps, and rubella are viral diseases that can ... Before vaccines, these diseases were very common in ...

  3. Is hospital based MMR vaccination for children with egg allergy here to stay?

    LENUS (Irish Health Repository)

    Hawkes, C P

    2010-01-01

    Egg allergy is incorrectly considered to constitute a contraindication to MMR in the community, despite a long history of its safe administration to egg allergic children. The product insert perpetuates this misinformation but the Irish guidelines from the RCPI are unequivocal. We reviewed all paediatric cases vaccinated in our hospital in 2007-2008. Forty seven of 91 children receiving vaccinations in hospital, had been referred for MMR due to concerns regarding egg allergy. In 32% (n=15), GP referral for vaccination was made despite correspondence from the clinic advising routine vaccination in the community. Nineteen were second MMR immunisations, which should all have occurred in the community. Unnecessary hospital referral for MMR vaccination is an extra burden on hospital resources, and causes unwarranted anxiety amongst parents of children with egg allergy. A change in practice seems difficult to achieve, as many referrals happen despite individualised correspondence to GPs and other referring clinicians outlining the current guidelines.

  4. The Heterogeneity Between Lynch-Associated and Sporadic MMR Deficiency in Colorectal Cancers.

    Science.gov (United States)

    Liu, Guo-Chen; Liu, Ran-Yi; Yan, Jun-Ping; An, Xin; Jiang, Wu; Ling, Yi-Hong; Chen, Jie-Wei; Bei, Jin-Xin; Zuo, Xiao-Yu; Cai, Mu-Yan; Liu, Ze-Xian; Zuo, Zhi-Xiang; Liu, Ji-Hong; Pan, Zhi-Zhong; Ding, Pei-Rong

    2018-02-20

    Previous studies demonstrated that prognosis of germline deficiency in mismatch repair protein (dMMR) was different from that of sporadic dMMR. The underlying mechanism has not been studied. From a prospectively maintained database, we collected dMMR colorectal cancer (CRC) patients identified by postoperative immunohistochemistry screening. According to genetic test, patients were grouped as Lynch-associated or sporadic dMMR. We compared the clinical-pathological features, prognosis, and immunoreactive differences between the two groups. By whole-exome sequencing and neoantigen detection pipeline, mutational frequencies and neoantigen burdens were also compared. All statistical tests were two-sided. Sixty-seven sporadic dMMR and 85 Lynch-associated CRC patients were included in the study. Sporadic dMMR patients were older (P < .001) and their tumors were poorly differentiated (P = .03). The survival was better in the Lynch-associated group (P = .001). After adjustment, the difference still remained statistically significant (hazard ratio = 0.29, 95% confidence interval = 0.09 to 0.95, P = .04). The scores of Crohn's-like reaction (CRO; P < .001), immunoreactions in the invasive margin (IM; P = .01), tumor stroma (TS; P = .009), and cancer nest (CN; P = .02) of the Lynch-associated group were statistically significantly higher. The numbers of CD3+, CD8+, Foxp3+ tumor-infiltrating lymphocytes (TILs) in IM; CD3+, CD4+ TILs in TS; and CD3+, CD4+, CD8+ TILs in CN were statistically significantly higher in Lynch-associated dMMR patients. Based on the 16 patients who under went whole-exome sequencing, there were also more somatic mutations and neoantigen burdens in the Lynch-associated group compared with the sporadic dMMR group (439/pt vs 68/pt, P = .006; 628/pt vs 97/pt, P = .009). There are heterogeneities in dMMR CRCs. Lynch-associated dMMR patients present with more somatic mutations and neoantigens compared with sporadic dMMR, which probably results in stronger

  5. Abnormalities of sensory and memory functions in mice lacking Bsg gene.

    Science.gov (United States)

    Naruhashi, K; Kadomatsu, K; Igakura, T; Fan, Q W; Kuno, N; Muramatsu, H; Miyauchi, T; Hasegawa, T; Itoh, A; Muramatsu, T; Nabeshima, T

    1997-07-30

    Basigin is a highly glycosylated transmembrane protein belonging to the immunoglobulin superfamily. We used mutant mice lacking the basigin gene (Bsg) to investigate its involvement in learning and memory. Mutations were generated by the gene targeting method. Various kinds of learning and memory tasks were performed in mutant, hetero and wild type mice. The mutant mice showed worse performance than the wild and hetero mice in the Y-maze task, which assesses short-term memory, and in the water finding task, which examines latent learning, without any motor dysfunction. Moreover, the mutant mice showed less acclimation in the habituation task compared with the wild-type mice. The mutant mice were also more sensitive to electric foot-shock. These findings are consistent with the expression profile of basigin in the central nervous system. Thus, basigin may play an important role in learning and memory as well as in the sensory functions.

  6. Two novel variants of the ABCG5 gene cause xanthelasmas and macrothrombocytopenia: a brief review of hematologic abnormalities of sitosterolemia.

    Science.gov (United States)

    Bastida, J M; Benito, R; Janusz, K; Díez-Campelo, M; Hernández-Sánchez, J M; Marcellini, S; Girós, M; Rivera, J; Lozano, M L; Hortal, A; Hernández-Rivas, J M; González-Porras, J R

    2017-09-01

    Essentials Diagnosis of sitosterolemia, a rare recessive or syndromic disorder, is usually delayed. Peripheral blood smear is extremely useful for establishing the suspicion of sitosterolemia. High-throughput sequencing technology enables the molecular diagnosis of inherited thrombocytopenias. Accurate characterization of sitosterolemia helps us determine appropriate management. Background Sitosterolemia (STSL) is a recessive inherited disorder caused by pathogenic variants in the ABCG5 and ABCG8 genes. Increased levels of plasma plant sterols (PSs) usually result in xanthomas and premature coronary atherosclerosis, although hematologic abnormalities may occasionally be present. This clinical picture is unfamiliar to many physicians, and patients may be at high risk of misdiagnosis. Objectives To report two novel ABCG5 variants causing STSL in a Spanish patient, and review the clinical and mutational landscape of STSL. Patient/Methods A 46-year-old female was referred to us with lifelong macrothrombocytopenia. She showed familial hypercholesterolemia-related xanthomas. Molecular analysis was performed with high-throughput sequencing. Plasma PS levels were evaluated with gas-liquid chromatography. The STSL landscape was reviewed with respect to specific online databases and all reports published since 1974. Results A blood smear revealed giant platelets and stomatocytes. Novel compound heterozygous variants were detected in exons 7 (c.914C>G) and 13 (c.1890delT) of ABCG5. The patient showed an increased plasma level of sitosterol. These findings support the diagnosis of STSL. In our review, we identified only 25 unrelated STLS patients who presented with hematologic abnormalities including macrothrombocytopenia. It remains unknown why only some patients develop hematologic abnormalities. Conclusions This is the first Spanish STSL patient to be reported and molecularly characterized. The early diagnosis of STLS is strongly supported by the presence of stomatocytes

  7. Anatomy of a health scare: education, income and the MMR controversy in the UK

    OpenAIRE

    Dan Anderberg; Arnaud Chevalier; Jonathan Wadsworth

    2009-01-01

    One theory for why there is a strong education gradient in health outcomes is that more educated individuals more quickly absorb new information about health technology. The MMR controversy in the UK provides a case where, for a brief period of time, some highly publicized research suggested that a particular multi-component vaccine, freely provided to young children, could have potentially serious side-effects. As the controversy set in, uptake of the MMR vaccine by more educated parents dec...

  8. Specific gene expression profiles and chromosomal abnormalities are associated with infant disseminated neuroblastoma

    Directory of Open Access Journals (Sweden)

    Kushner Brian

    2009-02-01

    Full Text Available Abstract Background Neuroblastoma (NB tumours have the highest incidence of spontaneous remission, especially among the stage 4s NB subgroup affecting infants. Clinical distinction of stage 4s from lethal stage 4 can be difficult, but critical for therapeutic decisions. The aim of this study was to investigate chromosomal alterations and differential gene expression amongst infant disseminated NB subgroups. Methods Thirty-five NB tumours from patients diagnosed at Results All stage 4s patients underwent spontaneous remission, only 48% stage 4 patients survived despite combined modality therapy. Stage 4 tumours were 90% near-diploid/tetraploid, 44% MYCN amplified, 77% had 1p LOH (50% 1p36, 23% 11q and/or 14q LOH (27% and 47% had 17q gain. Stage 4s were 90% near-triploid, none MYCN amplified and LOH was restricted to 11q. Initial comparison analyses between stage 4s and 4 P P = 0.0054, 91% with higher expression in stage 4. Less definite expression profiles were observed between stage 4s and 4 P P = 0.005 was maintained. Distinct gene expression profiles but no significant association with specific chromosomal region localization was observed between stage 4s and stage 4 Conclusion Specific chromosomal aberrations are associated with distinct gene expression profiles which characterize spontaneously regressing or aggressive infant NB, providing the biological basis for the distinct clinical behaviour.

  9. Mutations in DDR2 gene cause SMED with short limbs and abnormal calcifications.

    Science.gov (United States)

    Bargal, Ruth; Cormier-Daire, Valerie; Ben-Neriah, Ziva; Le Merrer, Martine; Sosna, Jacob; Melki, Judith; Zangen, David H; Smithson, Sarah F; Borochowitz, Zvi; Belostotsky, Ruth; Raas-Rothschild, Annick

    2009-01-01

    The spondylo-meta-epiphyseal dysplasia [SMED] short limb-hand type [SMED-SL] is a rare autosomal-recessive disease, first reported by Borochowitz et al. in 1993.(1) Since then, 14 affected patients have been reported.(2-5) We diagnosed 6 patients from 5 different consanguineous Arab Muslim families from the Jerusalem area with SMED-SL. Additionally, we studied two patients from Algerian and Pakistani ancestry and the parents of the first Jewish patients reported.(1) Using a homozygosity mapping strategy, we located a candidate region on chromosome 1q23 spanning 2.4 Mb. The position of the Discoidin Domain Receptor 2 (DDR2) gene within the candidate region and the similarity of the ddr2 knockout mouse to the SMED patients' phenotype prompted us to study this gene(6). We identified three missense mutations c.2254 C > T [R752C], c. 2177 T > G [I726R], c.2138C > T [T713I] and one splice site mutation [IVS17+1g > a] in the conserved sequence encoding the tyrosine kinase domain of the DDR2 gene. The results of this study will permit an accurate early prenatal diagnosis and carrier screening for families at risk.

  10. Loss of Apc heterozygosity and abnormal tissue building in nascent intestinal polyps in mice carrying a truncated Apc gene.

    Science.gov (United States)

    Oshima, M; Oshima, H; Kitagawa, K; Kobayashi, M; Itakura, C; Taketo, M

    1995-05-09

    Mutations in the APC (adenomatous polyposis coli) gene appear to be responsible for not only familial adenomatous polyposis but also many sporadic cases of gastrointestinal cancers. Using homologous recombination in mouse embryonic stem cells, we constructed mice that contained a mutant gene encoding a product truncated at a 716 (Apc delta 716). Mendelian transmission of the gene caused most homozygous mice to die in utero before day 8 of gestation. The heterozygotes developed multiple polyps throughout the intestinal tract, mostly in the small intestine. The earliest polyps arose multifocally during the third week after birth, and new polyps continued to appear thereafter. Surprisingly, every nascent polyp consisted of a microadenoma covered with a layer of the normal villous epithelium. These microadenomas originated from single crypts by forming abnormal outpockets into the inner (lacteal) side of the neighboring villi. We carefully dissected such microadenomas from nascent polyps by peeling off the normal epithelium and determined their genotype by PCR: all microadenomas had already lost the wild-type Apc allele, whereas the mutant allele remained unchanged. These results indicate that loss of heterozygosity followed by formation of intravillous microadenomas is responsible for polyposis in Apc delta 716 intestinal mucosa. It is therefore unlikely that the truncated product interacts directly with the wild-type protein and causes the microadenomas by a dominant negative mechanism.

  11. Cardiac abnormalities in diabetic patients with mutation in the mitochondrial tRNA Leu(UUR)Gene

    International Nuclear Information System (INIS)

    Ueno, Hiroshi; Shiotani, Hideyuki

    1999-01-01

    An A-to-G transition at position 3243 of the mitochondrial DNA is known to be a pathogenic factor for mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS), diabetes and cardiomyopathy. This mutation causes dysfunction of the central nervous system in MELAS. Because the heart, as well as the brain and nervous system, is highly dependent on the energy produced by mitochondrial oxidation, these tissues are more vulnerable to mitochondrial defects. Cardiac abnormalities were assessed in 10 diabetic patients associated with this mutation using echocardiography and 123 I-metaiodobenzylguanidine (MIBG) scintigraphy, and compared with 19 diabetic patients without the mutation. Duration of diabetes, therapy, control of blood glucose and diabetic complications, such as diabetic retinopathy and nephropathy, were not different between the 2 groups. Diabetic patients with the mutation had a significantly thicker interventricular septum (16.8±3.7 vs 11.0±1.6 mm, p 0.05). In conclusion, left ventricular hypertrophy with or without abnormal wall motion and severely reduced MIBG uptake may be characteristic in diabetic patients with a mutation in the mitochondrial tRNA Leu(UUR) gene. (author)

  12. No effect of MMR withdrawal on the incidence of autism: a total population study.

    Science.gov (United States)

    Honda, Hideo; Shimizu, Yasuo; Rutter, Michael

    2005-06-01

    A causal relationship between the measles, mumps, and rubella (MMR) vaccine and occurrence of autism spectrum disorders (ASD) has been claimed, based on an increase in ASD in the USA and the UK after introduction of the MMR vaccine. However, the possibility that this increase is coincidental has not been eliminated. The unique circumstances of a Japanese MMR vaccination program provide an opportunity for comparison of ASD incidence before and after termination of the program. This study examined cumulative incidence of ASD up to age seven for children born from 1988 to 1996 in Kohoku Ward (population approximately 300,000), Yokohama, Japan. ASD cases included all cases of pervasive developmental disorders according to ICD-10 guidelines. The MMR vaccination rate in the city of Yokohama declined significantly in the birth cohorts of years 1988 through 1992, and not a single vaccination was administered in 1993 or thereafter. In contrast, cumulative incidence of ASD up to age seven increased significantly in the birth cohorts of years 1988 through 1996 and most notably rose dramatically beginning with the birth cohort of 1993. The significance of this finding is that MMR vaccination is most unlikely to be a main cause of ASD, that it cannot explain the rise over time in the incidence of ASD, and that withdrawal of MMR in countries where it is still being used cannot be expected to lead to a reduction in the incidence of ASD.

  13. Is the cultural context of MMR rejection a key to an effective public health discourse?

    Science.gov (United States)

    Cassell, J A; Leach, M; Poltorak, M S; Mercer, C H; Iversen, A; Fairhead, J R

    2006-09-01

    (1) To explore the social and cultural influences, and health beliefs associated with low uptake of MMR (measles, mumps and rubella vaccine). (2) To describe and explore the prevalence of health beliefs associated with non-compliance with MMR, with a view to improving the personal relevance and impact of information for parents, in the context of persisting low uptake following public controversy. We undertook a survey of mothers' experiences of and attitudes to the MMR, developed through ethnographic study, which was linked to maternal and child information on the Child Health Database in Brighton, England. Mothers interpret MMR risk through concepts of child health embedded in family health history, with a majority both of compliers and non-compliers holding that each child's immune system is unique. Cultural 'risk factors' for non-compliance relate strongly to the use of complementary healthcare, such as homeopathy, with evidence that rejection of vitamin K is associated with MMR non-compliance. Forty per cent, both of compliers and non-compliers, did not consider the possible benefits to other children of MMR. These findings have paradoxical and challenging consequences for the promotion of immunization in the policy context of increasing emphasis on healthy choices. They demonstrate the need for immunization information that acknowledges and addresses lay concepts of immunity.

  14. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    Science.gov (United States)

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  15. Minor abnormalities of testis development in mice lacking the gene encoding the MAPK signalling component, MAP3K1.

    Directory of Open Access Journals (Sweden)

    Nick Warr

    2011-05-01

    Full Text Available In mammals, the Y chromosome is a dominant male determinant, causing the bipotential gonad to develop as a testis. Recently, cases of familial and spontaneous 46,XY disorders of sex development (DSD have been attributed to mutations in the human gene encoding mitogen-activated protein kinase kinase kinase 1, MAP3K1, a component of the mitogen-activated protein kinase (MAPK signal transduction pathway. In individuals harbouring heterozygous mutations in MAP3K1, dysregulation of MAPK signalling was observed in lymphoblastoid cell lines, suggesting a causal role for these mutations in disrupting XY sexual development. Mice lacking the cognate gene, Map3k1, are viable and exhibit the eyes open at birth (EOB phenotype on a mixed genetic background, but on the C57BL/6J genetic background most mice die at around 14.5 dpc due to a failure of erythropoiesis in the fetal liver. However, no systematic examination of sexual development in Map3k1-deficient mice has been described, an omission that is especially relevant in the case of C57BL/6J, a genetic background that is sensitized to disruptions to testis determination. Here, we report that on a mixed genetic background mice lacking Map3k1 are fertile and exhibit no overt abnormalities of testis development. On C57BL/6J, significant non-viability is observed with very few animals surviving to adulthood. However, an examination of development in Map3k1-deficient XY embryos on this genetic background revealed no significant defects in testis determination, although minor abnormalities were observed, including an increase in gonadal length. Based on these observations, we conclude that MAP3K1 is not required for mouse testis determination. We discuss the significance of these data for the functional interpretation of sex-reversing MAP3K1 mutations in humans.

  16. Abnormal muscle and hematopoietic gene expression may be important for clinical morbidity in primary hyperparathyroidism

    DEFF Research Database (Denmark)

    Reppe, Sjur; Stilgren, Lis; Abrahamsen, Bo

    2007-01-01

    out in biopsies obtained before and 1 yr after parathyroidectomy in seven patients discovered by routine blood [Ca(2+)] screening. The tissue distribution of PTH receptor (PTHR1 and PTHR2) mRNAs were quantitated using real-time RT-PCR in unrelated persons to define PTH target tissues. Of about 10......, muscle, and hematopoietic cells have to be considered as one independent, important cause of molecular disease in PHPT leading to profound alterations in gene expression that may help explain symptoms like muscle fatigue, cardiovascular pathology, and precipitation of psychiatric illness....

  17. Normal and abnormal cerebrovascular development: gene-environment interactions during early life with later life consequences.

    Science.gov (United States)

    Scher, Mark S

    2013-01-01

    A greater understanding of cerebrovascular health and disease requires the consideration of recent neuroscience advances concerning neuroplasticity in the context of classical developmental neurology principles. Consideration of the ontogenetic interplay of nature and nurture influencing brain development during prenatal and early postnatal time periods should consider the concept of the developmental origins of neurological health and disease. Adaptive and maladaptive effects of neuroplasticity require a systems biology approach integrating molecular, receptor, cellular, neural network, and behavioral perspectives, culminating in the structural and functional cerebrovascular phenotypes that express health or disease across the lifespan. Cognizance of the interrelationships among maternal, placental, fetal, and neonatal factors requires an interdisciplinary appreciation of genetic/epigenetic forces of neuroplasticity during early life that incrementally influence cerebrovascular health or disease throughout childhood and adulthood. Knowledge of the systemic effects of multiorgan function on cerebrovascular development further broadens the systems biology approach to general plasticity of the individual as a whole organism. Short- and long-term consequences of the positive and negative effects of neuroplasticity must consider ongoing gene-environment interactions with maturation and aging, superimposed on earlier fetal/neonatal experiences that sustain neurological health or contribute to disease during childhood and adulthood. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Approaches to diagnose DNA mismatch repair gene defects in cancer.

    Science.gov (United States)

    Peña-Diaz, Javier; Rasmussen, Lene Juel

    2016-02-01

    The DNA repair pathway mismatch repair (MMR) is responsible for the recognition and correction of DNA biosynthetic errors caused by inaccurate nucleotide incorporation during replication. Faulty MMR leads to failure to address the mispairs or insertion deletion loops (IDLs) left behind by the replicative polymerases and results in increased mutation load at the genome. The realization that defective MMR leads to a hypermutation phenotype and increased risk of tumorigenesis highlights the relevance of this pathway for human disease. The association of MMR defects with increased risk of cancer development was first observed in colorectal cancer patients that carried inactivating germline mutations in MMR genes and the disease was named as hereditary non-polyposis colorectal cancer (HNPCC). Currently, a growing list of cancers is found to be MMR defective and HNPCC has been renamed Lynch syndrome (LS) partly to include the associated risk of developing extra-colonic cancers. In addition, a number of non-hereditary, mostly epigenetic, alterations of MMR genes have been described in sporadic tumors. Besides conferring a strong cancer predisposition, genetic or epigenetic inactivation of MMR genes also renders cells resistant to some chemotherapeutic agents. Therefore, diagnosis of MMR deficiency has important implications for the management of the patients, the surveillance of their relatives in the case of LS and for the choice of treatment. Some of the alterations found in MMR genes have already been well defined and their pathogenicity assessed. Despite this substantial wealth of knowledge, the effects of a large number of alterations remain uncharacterized (variants of uncertain significance, VUSs). The advent of personalized genomics is likely to increase the list of VUSs found in MMR genes and anticipates the need of diagnostic tools for rapid assessment of their pathogenicity. This review describes current tools and future strategies for addressing the relevance

  19. Beyond screening for chromosomal abnormalities: Advances in non-invasive diagnosis of single gene disorders and fetal exome sequencing.

    Science.gov (United States)

    Hayward, Jane; Chitty, Lyn S

    2018-04-01

    Emerging genomic technologies, largely based around next generation sequencing (NGS), are offering new promise for safer prenatal genetic diagnosis. These innovative approaches will improve screening for fetal aneuploidy, allow definitive non-invasive prenatal diagnosis (NIPD) of single gene disorders at an early gestational stage without the need for invasive testing, and improve our ability to detect monogenic disorders as the aetiology of fetal abnormalities. This presents clinicians and scientists with novel challenges as well as opportunities. In addition, the transformation of prenatal genetic testing arising from the introduction of whole genome, exome and targeted NGS produces unprecedented volumes of data requiring complex analysis and interpretation. Now translating these technologies to the clinic has become the goal of clinical genomics, transforming modern healthcare and personalized medicine. The achievement of this goal requires the most progressive technological tools for rapid high-throughput data generation at an affordable cost. Furthermore, as larger proportions of patients with genetic disease are identified we must be ready to offer appropriate genetic counselling to families and potential parents. In addition, the identification of novel treatment targets will continue to be explored, which is likely to introduce ethical considerations, particularly if genome editing techniques are included in these targeted treatments and transferred into mainstream personalized healthcare. Here we review the impact of NGS technology to analyse cell-free DNA (cfDNA) in maternal plasma to deliver NIPD for monogenic disorders and allow more comprehensive investigation of the abnormal fetus through the use of exome sequencing. Copyright © 2017. Published by Elsevier Ltd.

  20. Cardiac abnormalities in diabetic patients with mutation in the mitochondrial tRNA {sup Leu(UUR)}Gene

    Energy Technology Data Exchange (ETDEWEB)

    Ueno, Hiroshi [Hyogo Medical Center for Adults, Akashi (Japan); Shiotani, Hideyuki

    1999-11-01

    An A-to-G transition at position 3243 of the mitochondrial DNA is known to be a pathogenic factor for mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS), diabetes and cardiomyopathy. This mutation causes dysfunction of the central nervous system in MELAS. Because the heart, as well as the brain and nervous system, is highly dependent on the energy produced by mitochondrial oxidation, these tissues are more vulnerable to mitochondrial defects. Cardiac abnormalities were assessed in 10 diabetic patients associated with this mutation using echocardiography and {sup 123}I-metaiodobenzylguanidine (MIBG) scintigraphy, and compared with 19 diabetic patients without the mutation. Duration of diabetes, therapy, control of blood glucose and diabetic complications, such as diabetic retinopathy and nephropathy, were not different between the 2 groups. Diabetic patients with the mutation had a significantly thicker interventricular septum (16.8{+-}3.7 vs 11.0{+-}1.6 mm, p<0.001) than those without the mutation. Fractional shortening was lower in diabetic patients with the mutation than those without it (30.7{+-}7.0 vs 42.5{+-}6.6, p<0.001). MIBG uptake on the delayed MIBG image was significantly lower in diabetic patients with the mutation than in those without the mutation (mean value of the heart to mediastinum ratio: 1.6{+-}0.2 vs 2.0{+-}0.4, p>0.05). In conclusion, left ventricular hypertrophy with or without abnormal wall motion and severely reduced MIBG uptake may be characteristic in diabetic patients with a mutation in the mitochondrial tRNA {sup Leu(UUR)} gene. (author)

  1. Association between perfluoroalkyl substance exposure and asthma and allergic disease in children as modified by MMR vaccination

    DEFF Research Database (Denmark)

    Timmermann, Clara Amalie Gade; Budtz-Jørgensen, Esben; Jensen, Tina Kold

    2017-01-01

    , and rubella (MMR) vaccination in early life may have a protective effect against asthma and allergy, and MMR vaccination is therefore taken into account when evaluating these associations. In a cohort of Faroese children whose mothers were recruited during pregnancy, serum concentrations of five PFASs...... with immunoglobulin E (IgE) (cord blood and at age 7 years) and asthma/allergic diseases (questionnaires at ages 5 and 13 years and skin prick test at age 13 years) was determined. A total of 559 children were included in the analyses. Interactions with MMR vaccination were evaluated. Among 22 MMR......-unvaccinated children, higher levels of the five PFASs at age 5 years were associated with increased odds of asthma at ages 5 and 13. The associations were reversed among MMR-vaccinated children. Prenatal PFAS exposure was not associated with childhood asthma or allergic diseases regardless of MMR vaccination status...

  2. Prevention of Hepatocellular Adenoma and Correction of Metabolic Abnormalities in Murine Glycogen Storage Disease Type Ia by Gene Therapy

    Science.gov (United States)

    Lee, Young Mok; Jun, Hyun Sik; Pan, Chi-Jiunn; Lin, Su Ru; Wilson, Lane H.; Mansfield, Brian C.; Chou, Janice Y.

    2012-01-01

    Glycogen storage disease type Ia (GSD-Ia), characterized by impaired glucose homeostasis and chronic risk of hepatocellular adenoma (HCA), is caused by deficiencies in the endoplasmic reticulum (ER)-associated glucose-6-phosphatase-α (G6Pase-α or G6PC) that hydrolyzes glucose-6-phosphate (G6P) to glucose. G6Pase-α activity depends upon the G6P transporter (G6PT) that translocates G6P from the cytoplasm into the ER lumen. The functional coupling of G6Pase-α and G6PT maintains interprandial glucose homeostasis. We have previously shown that gene therapy mediated by AAV-GPE, an adeno-associated virus (AAV) vector expressing G6Pase-α directed by the human G6PC promoter/enhancer (GPE), completely normalizes hepatic G6Pase-α deficiency in GSD-Ia (G6pc−/−) mice for at least 24 weeks. However, a recent study showed that, within 78 weeks of gene deletion, all mice lacking G6Pase-α in the liver develop HCA. We now show that gene therapy mediated by AAV-GPE maintains efficacy for at least 70–90 weeks for mice expressing more than 3% of wild type hepatic G6Pase-α activity. The treated mice displayed normal hepatic fat storage, normal blood metabolite and glucose tolerance profiles, reduced fasting blood insulin levels, maintained normoglycemia over a 24-hour fast, and had no evidence of hepatic abnormalities. After a 24-hour fast, hepatic G6PT mRNA levels in G6pc−/− mice receiving gene therapy were markedly increased. Since G6PT transport is the rate-limiting step in microsomal G6P metabolism it may explain why the treated G6pc−/− mice could sustain prolonged fasts. The low fasting blood insulin levels and lack of hepatic steatosis may explain the absence of HCA. Conclusion These results confirm that AAV-GPE-mediated gene transfer corrects hepatic G6Pase-α deficiency in murine GSD-Ia and prevents chronic HCA formation. PMID:22422504

  3. Gene trap mutation of murine Outer dense fiber protein-2 gene can result in sperm tail abnormalities in mice with high percentage chimaerism

    Directory of Open Access Journals (Sweden)

    Oko Richard

    2010-06-01

    Full Text Available Abstract Background Outer dense fiber protein 2, Odf2, is a major component of the outer dense fibers, ODF, in the flagellum of spermatozoa. ODF are associated with microtubule doublets that form the axoneme. We recently demonstrated that tyrosine phosphorylation of Odf2 is important for sperm motility. In the course of a study of Odf2 using Odf2 mouse knockout lines we observed that males of a high percentage chimaerism, made using XL169 embryonic stem cells, were infertile, whereas mice of low-medium percentage chimaerism were fertile. Results XL169 ES cells have a β-geo gene trap cassette inserted in the Odf2 gene. To determine possible underlying mechanisms resulting in infertility we analyzed epididymal sperm and observed that >50% displayed bent tails. We next performed ultrastructural analyses on testis of high percentage XL169 chimaeric mice. This analysis showed that high percentage XL169 chimaeric mice produce elongating spermatids that miss one or more entire outer dense fibers in their midpiece and principal piece. In addition, we observed elongating spermatids that show thinning of outer dense fibers. No other obvious abnormalities or defects are present in elongating spermatids. Spermatozoa from the caput and cauda epididymis of XL169 mice of high percentage chimaerism show additional tail defects, including absence of one or more axonemal microtubule doublets and bent tails. Sperm with bent tails display abnormal motility. Conclusions Our results document the possible impact of loss of one Odf2 allele on sperm tail structure and function, resulting in a novel sperm tail phenotype.

  4. Significant frequency of MSH2/MSH6 abnormality in ovarian endometrioid carcinoma supports histotype-specific Lynch syndrome screening in ovarian carcinomas.

    Science.gov (United States)

    Rambau, Peter F; Duggan, Máire A; Ghatage, Prafull; Warfa, Khadija; Steed, Helen; Perrier, Renee; Kelemen, Linda E; Köbel, Martin

    2016-08-01

    Lynch syndrome screening in ovarian carcinoma is controversial. The aim of this study was to assess the frequency of deficient mismatch repair (dMMR) protein in a retrospective cohort enriched for non-high-grade serous carcinomas and its association with outcome within histological types. Tissue microarrays representing 612 ovarian carcinomas were tested for mismatch repair proteins (MLH1, PMS2, MSH2, and MSH6) by immunohistochemistry. dMMR was detected in 13.8% of endometrioid and 2.4% of clear cell carcinomas, but not in other histological types. Within endometrioid carcinomas, 11 of 25 dMMR cases showed abnormal MLH1/PMS2, 10 cases showed abnormal MSH2/MSH6, and four cases showed only abnormal MSH6, indicating that at least 7.7% of endometrioid carcinomas have dMMR probably related to Lynch syndrome. The four dMMR clear cell carcinomas showed abnormal MSH2/MSH6 in three cases and only abnormal MSH6 in one case, all probably related to Lynch syndrome. Within endometrioid carcinomas, dMMR was significantly associated with age carcinoma, a higher CA125 level at diagnosis, higher FIGO grade, absence of ARID1A, and at least 20 CD8-positive intraepithelial lymphocytes per high-power field, but was not associated with cancer-specific death. Age ovarian carcinoma confined to endometrioid and clear cell carcinomas. © 2016 John Wiley & Sons Ltd.

  5. Pathological assessment of mismatch repair gene variants in Lynch syndrome

    DEFF Research Database (Denmark)

    Rasmussen, Lene Juel; Heinen, Christopher D; Royer-Pokora, Brigitte

    2012-01-01

    Lynch syndrome (LS) is caused by germline mutations in DNA mismatch repair (MMR) genes and is the most prevalent hereditary colorectal cancer syndrome. A significant proportion of variants identified in MMR and other common cancer susceptibility genes are missense or noncoding changes whose...

  6. Rare F311L CFTR gene mutation in a child presented with recurrent electrolyte abnormalities and metabolic alkalosis: case report.

    Science.gov (United States)

    Lumpaopong, Adisorn; Thirakhupt, Prapaipim; Srisuwan, Konggrapun; Chulamokha, Yupapin

    2009-05-01

    Delta F508 mutation is recognized as the most common genotype of cystic fibrosis (CF) however, there are small numbers of CF patients having Delta F508/F311L. In the present study, the authors report a 2-year-old Thai boy, originating from North India, presenting with recurrent episodes of febrile illness, hyponatremia, hypokalemia, and metabolic alkalosis since 4 months of age. He was transferred to our hospital for further investigation. Blood chemistry revealed the following serum electrolytes, sodium 122, potassium 3.69, chloride 79.7, and bicarbonate 33.8 mEq/L, and the following urine electrolytes, sodium metabolic alkalosis improved DNA sequencing analysis of his blood demonstrates compound mutation for Delta F508 and F311L in CFTR gene. In conclusion, the authors report a rare case of CF with Delta F508/F311L genotype presented with recurrent hyponatremia and metabolic alkalosis. Awareness of electrolyte abnormalities during febrile illness, proper genetic counseling, and long-term follow up are necessary in this patient.

  7. Polymerase proofreading domain mutations: New opportunities for immunotherapy in hypermutated colorectal cancer beyond MMR deficiency.

    Science.gov (United States)

    Bourdais, Rémi; Rousseau, Benoît; Pujals, Anaïs; Boussion, Helene; Joly, Charlotte; Guillemin, Aude; Baumgaertner, Isabelle; Neuzillet, Cindy; Tournigand, Christophe

    2017-05-01

    Immune checkpoint inhibition is a new therapeutic strategy that has shown promising efficacy in many cancer types. Significant activity associated with mismatch repair (MMR) deficiency has been observed in hypermutated, microsatellite unstable (MSI) metastatic colorectal cancer (CRC). Beyond deficient-MMR tumors, somatic or germline DNA polymerase D1 (POLD1) or DNA polymerase E (POLE) alterations cause a hypermutated phenotype in CRC. This recently identified and rare subgroup of proficient-MMR tumors may also benefit from immunotherapy. In this review, we provide a comprehensive overview of recent data on CRC tumors harboring POLD1 or POLE mutations, with a focus on their molecular, histological, and clinical features. We also examine the evidence supporting the development of immune checkpoint inhibitors in this specific subgroup of CRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. What Every Behavior Analyst Should Know About the "MMR Causes Autism" Hypothesis.

    Science.gov (United States)

    Ahearn, William H

    2010-01-01

    In 1998, the English physician Andrew Wakefield suggested that the MMR vaccine insults the guts of children who then regress developmentally and become autistic. Although his research did not provide firm evidence for this hypothesis, many believe that (a) the MMR vaccine can cause autism; (b) children with autism typically have gastrointestinal problems; and, (c) a necessary component of treating autism is "treating the gut" through dietary restrictions. Research has subsequently shown that Wakefield's hypothesis is unquestionably false, children with autism are not more likely to have gastrointestinal problems, and there is no sound evidence that diets are a valid treatment for autism. This paper will critically review these topics.

  9. Assessing how reduced expression levels of the mismatch repair genes MLH1, MSH2, and MSH6 affect repair efficiency.

    Science.gov (United States)

    Kansikas, Minttu; Kasela, Mariann; Kantelinen, Jukka; Nyström, Minna

    2014-09-01

    Lynch syndrome (LS), the most common familial colon cancer, is associated with mismatch repair (MMR) malfunction. As mutation carriers inherit one normal and one defected MMR gene allele, cancer risk can be considered as limited amount of normal MMR gene product. How reductions in different MMR gene expressions affect MMR capability is, however, not known. The in vitro MMR assay is a method for the pathogenicity assessment of MMR gene variants causing functional or expressional defects and thus also suitable to evaluate the effects of reduced expression of normal mRNA. Here, the assay was applied to quantify repair efficiencies of human cells retaining varying expression levels (25%/50%/75%) of the main LS susceptibility genes MLH1, MSH2, or MSH6. Compared with the shRNA knockdown control, already a 50% reduction in mRNA levels could be detected as decreased MMR function although without statistical significance in MLH1. In MSH2 and MLH1, total loss of MMR was achieved with 25% expression, whereas in MSH6 and MSH2, the repair capability decreased significantly already with 75% expression. Our results provide a preliminary indication of relative expressions required for wild-type function and suggest that the in vitro MMR assay could be used to recognize expression levels indicative of LS. © 2014 WILEY PERIODICALS, INC.

  10. Genetic screens to identify pathogenic gene variants in the common cancer predisposition Lynch syndrome

    DEFF Research Database (Denmark)

    Drost, Mark; Lützen, Anne; van Hees, Sandrine

    2013-01-01

    In many individuals suspected of the common cancer predisposition Lynch syndrome, variants of unclear significance (VUS), rather than an obviously pathogenic mutations, are identified in one of the DNA mismatch repair (MMR) genes. The uncertainty of whether such VUS inactivate MMR, and therefore...... are pathogenic, precludes targeted healthcare for both carriers and their relatives. To facilitate the identification of pathogenic VUS, we have developed an in cellulo genetic screen-based procedure for the large-scale mutagenization, identification, and cataloging of residues of MMR genes critical for MMR gene...

  11. Association between perfluoroalkyl substance exposure and asthma and allergic disease in children as modified by MMR vaccination

    DEFF Research Database (Denmark)

    Timmermann, Clara Amalie Gade; Budtz-Jørgensen, Esben; Jensen, Tina Kold

    2017-01-01

    , and rubella (MMR) vaccination in early life may have a protective effect against asthma and allergy, and MMR vaccination is therefore taken into account when evaluating these associations. In a cohort of Faroese children whose mothers were recruited during pregnancy, serum concentrations of five PFASs...

  12. Regional brain metabolite abnormalities in inherited prion disease and asymptomatic gene carriers demonstrated in vivo by quantitative proton magnetic resonance spectroscopy

    International Nuclear Information System (INIS)

    Waldman, A.D.; Cordery, R.J.; Godbolt, A.; Rossor, M.N.; MacManus, D.G.; Collinge, J.

    2006-01-01

    Inherited prion diseases are caused by mutations in the gene which codes for prion protein (PrP), leading to proliferation of abnormal PrP isomers in the brain and neurodegeneration; they include Gerstmann-Straeussler-Scheinker disease (GSS), fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD). We studied two patients with symptomatic inherited prion disease (P102L) and two pre-symptomatic P102L gene carriers using quantitative magnetic resonance spectroscopy (MRS). Short echo time spectra were acquired from the thalamus, caudate region and frontal white matter, metabolite levels and ratios were measured and z-scores calculated for individual patients relative to age-matched normal controls. MRS data were compared with structural magnetic resonance imaging. One fCJD case had generalised atrophy and showed increased levels of myo-inositol (MI) in the thalamus (z=3.7). The other had decreased levels of N-acetylaspartate (z=4) and diffuse signal abnormality in the frontal white matter. Both asymptomatic gene carriers had normal imaging, but increased frontal white matter MI (z=4.3, 4.1), and one also had increased MI in the caudate (z=5.3). Isolated MI abnormalities in asymptomatic gene carriers are a novel finding and may reflect early glial proliferation, prior to significant neuronal damage. MRS provides potential non-invasive surrogate markers of early disease and progression in inherited prion disease. (orig.)

  13. Regional brain metabolite abnormalities in inherited prion disease and asymptomatic gene carriers demonstrated in vivo by quantitative proton magnetic resonance spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Waldman, A.D.; Cordery, R.J.; Godbolt, A.; Rossor, M.N. [University College London, Dementia Research Group, Department of Neurodegenerative Disease, Institute of Neurology, London (United Kingdom); Imperial College of Science, Technology and Medicine, Division of Neuroscience and Psychological Medicine, Faculty of Medicine, London (United Kingdom); MacManus, D.G. [University College London, NMR Research Unit, Department of Clinical Neurology, Institute of Neurology, London (United Kingdom); Collinge, J. [University College London, MRC Prion Unit, Department of Neurodegenerative Disease, Institute of Neurology, London (United Kingdom)

    2006-06-15

    Inherited prion diseases are caused by mutations in the gene which codes for prion protein (PrP), leading to proliferation of abnormal PrP isomers in the brain and neurodegeneration; they include Gerstmann-Straeussler-Scheinker disease (GSS), fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD). We studied two patients with symptomatic inherited prion disease (P102L) and two pre-symptomatic P102L gene carriers using quantitative magnetic resonance spectroscopy (MRS). Short echo time spectra were acquired from the thalamus, caudate region and frontal white matter, metabolite levels and ratios were measured and z-scores calculated for individual patients relative to age-matched normal controls. MRS data were compared with structural magnetic resonance imaging. One fCJD case had generalised atrophy and showed increased levels of myo-inositol (MI) in the thalamus (z=3.7). The other had decreased levels of N-acetylaspartate (z=4) and diffuse signal abnormality in the frontal white matter. Both asymptomatic gene carriers had normal imaging, but increased frontal white matter MI (z=4.3, 4.1), and one also had increased MI in the caudate (z=5.3). Isolated MI abnormalities in asymptomatic gene carriers are a novel finding and may reflect early glial proliferation, prior to significant neuronal damage. MRS provides potential non-invasive surrogate markers of early disease and progression in inherited prion disease. (orig.)

  14. Media coverage of the measles-mumps-rubella vaccine and autism controversy and its relationship to MMR immunization rates in the United States.

    Science.gov (United States)

    Smith, Michael J; Ellenberg, Susan S; Bell, Louis M; Rubin, David M

    2008-04-01

    The purpose of this work was to assess the association between media coverage of the MMR-autism controversy and MMR immunization in the United States. The public-use files of the National Immunization Survey were used to estimate annual MMR coverage from 1995 to 2004. The primary outcome was selective measles-mumps-rubella nonreceipt, that is, those children who received all childhood immunizations except MMR. Media coverage was measured by using LexisNexis, a comprehensive database of national and local news media. Factors associated with MMR nonreceipt were identified by using a logistic regression model. Selective MMR nonreceipt, occurring in as few as 0.77% of children in the 1995 cohort, rose to 2.1% in the 2000 National Immunization Survey. Children included in the 2000 National Immunization Survey were born when the putative link between MMR and autism surfaced in the medical literature but before any significant media attention occurred. Selective nonreceipt was more prevalent in private practices and unrelated to family characteristics. MMR nonreceipt returned to baseline before sustained media coverage of the MMR-autism story began. There was a significant increase in selective MMR nonreceipt that was temporally associated with the publication of the original scientific literature, suggesting a link between MMR and autism, which preceded media coverage of the MMR-autism controversy. This finding suggests a limited influence of mainstream media on MMR immunization in the United States.

  15. Simultaneous vaccination with MMR and DTaP-IPV-Hib and rate of hospital admissions with any infections

    DEFF Research Database (Denmark)

    Sørup, Signe; Benn, Christine S; Poulsen, Anja

    2016-01-01

    and inactivated vaccines may increase child mortality compared with the live vaccine alone. We examined the hypothesis that simultaneous administration of MMR and the inactivated DTaP-IPV-Hib vaccine compared with MMR alone is associated with higher incidence of infectious disease admissions. METHODS: Nationwide......BACKGROUND: In Denmark, live measles, mumps, and rubella vaccine (MMR) is associated with a reduced risk of infectious disease admissions, particularly for lower respiratory tract infections. In low-income countries, simultaneous vaccination (i.e. vaccination at the same visit) with live......, 4965 children had simultaneous MMR and DTaP-IPV-Hib as their most recent vaccination. Compared with MMR alone, simultaneous administration was associated with a higher rate of lower respiratory tract infections (adjusted incidence rate ratio (IRR), 1.27; 95% confidence interval (CI), 1...

  16. Alkylation damage causes MMR-dependent chromosomal instability in vertebrate embryos.

    NARCIS (Netherlands)

    Feitsma, H.; Akay, A.; Cuppen, E.

    2008-01-01

    S(N)1-type alkylating agents, like N-methyl-N-nitrosourea (MNU) and N-ethyl-N-nitrosourea (ENU), are potent mutagens. Exposure to alkylating agents gives rise to O(6)-alkylguanine, a modified base that is recognized by DNA mismatch repair (MMR) proteins but is not repairable, resulting in

  17. Parental decision-making in uptake of the MMR vaccination: a systematic review of qualitative literature.

    Science.gov (United States)

    Allan, N; Harden, J

    2015-12-01

    Controversy has surrounded MMR vaccination in the aftermath of Wakefield's 1998 paper suggesting links between MMR and the development of pervasive developmental disorder in children. The paper sparked off media debate and contributed to a lack of parental trust in health-care providers and reduction in MMR uptake. This review aims to identify and evaluate research on the subject, with a view to present the reasons behind, and influences on parental decision-making in relation to MMR. Systematic search strategy identified 14 relevant papers on which thematic analysis was performed. Themes identified were categorized as follows: perceptions of risk; roles and responsibility; experience and knowledge. There were limited changes in parental decision-making factors over the time period despite an increase in uptake. Many studies fail to differentiate between accepters and rejecters, making it difficult to draw out clear conclusions. Policymakers need to adapt information provided to address these concerns. Future research should focus more on distinguishing between accepters and rejecters to determine which factors can alter outcome. © The Author 2014. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Anatomy of a health scare: education, income and the MMR controversy in the UK.

    Science.gov (United States)

    Anderberg, Dan; Chevalier, Arnaud; Wadsworth, Jonathan

    2011-05-01

    The measles, mumps and rubella (MMR) controversy provides an interesting case where, for a short period of time, research publicized in the media, suggested a potential risk of serious side-effects associated with the vaccine, where there was also a sharp behavioral response from the public, and where the initial information was subsequently overturned. We consider the controversy from the perspective of health inequalities and the assimilation of information, focusing on whether and how vaccine uptake behavior in the wake of the controversy differed among groups of parents by education and income. Using panel data on the variation in the uptake of the MMR, and other childhood immunizations, across local Health Authority areas we find that the uptake rate of the MMR declined faster in areas where a larger fraction of parents had stayed in education past the age of 18 than in areas with less educated parents. We also find that the same areas reduced their relative uptake of other uncontroversial childhood immunizations, suggesting a "spillover" effect. Using a supplementary data source we find evidence of a corresponding positive income effect, indicating that wealthier parents avoided the MMR dilemma by purchasing single vaccines. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Dynamic and Control Analysis of Modular Multi-Parallel Rectifiers (MMR)

    DEFF Research Database (Denmark)

    Zare, Firuz; Ghosh, Arindam; Davari, Pooya

    2017-01-01

    This paper presents dynamic analysis of a Modular Multi-Parallel Rectifier (MMR) based on state-space modelling and analysis. The proposed topology is suitable for high power application which can reduce line current harmonics emissions significantly. However, a proper controller is required...

  20. Quantitative comparison of PET performance-Siemens Biograph mCT and mMR.

    Science.gov (United States)

    Karlberg, Anna M; Sæther, Oddbjørn; Eikenes, Live; Goa, Pål Erik

    2016-12-01

    Integrated clinical whole-body PET/MR systems were introduced in 2010. In order to bring this technology into clinical usage, it is of great importance to compare the performance with the well-established PET/CT. The aim of this study was to evaluate PET performance, with focus on image quality, on Siemens Biograph mMR (PET/MR) and Siemens Biograph mCT (PET/CT). A direct quantitative comparison of the performance characteristics between the mMR and mCT system was performed according to National Electrical Manufacturers Association (NEMA) NU 2-2007 protocol. Spatial resolution, sensitivity, count rate and image quality were evaluated. The evaluation was supplemented with additional standardized uptake value (SUV) measurements. The spatial resolution was similar for the two systems. Average sensitivity was higher for the mMR (13.3 kcps/MBq) compared to the mCT system (10.0 kcps/MBq). Peak noise equivalent count rate (NECR) was slightly higher for the mMR (196 kcps @ 24.4 kBq/mL) compared to the mCT (186 kcps @ 30.1 kBq/mL). Scatter fractions in the clinical activity concentration range yielded lower values for the mCT (34.9 %) compared to those for the mMR (37.0 %). Best image quality of the systems resulted in approximately the same mean hot sphere contrast and a difference of 19 percentage points (pp) in mean cold contrast, in favour of the mCT. In general, point spread function (PSF) increased hot contrast and time of flight (TOF) increased both hot and cold contrast. Highest hot contrast for the smallest sphere (10 mm) was achieved with the combination of TOF and PSF on the mCT. Lung residual error was higher for the mMR (22 %) than that for the mCT (17 %), with no effect of PSF. With TOF, lung residual error was reduced to 8 % (mCT). SUV was accurate for both systems, but PSF caused overestimations for the 13-, 17- and 22-mm spheres. Both systems proved good performance characteristics, and the PET image quality of the mMR was close to that of the m

  1. Congenital Abnormalities

    Science.gov (United States)

    ... Stages Ages and Stages Prenatal Baby (0-12 mos.) Toddler 1-3yrs. Preschool 3-5yrs Grade School ... Categories of Congenital Abnormalities Chromosome Abnormalities Chromosomes are structures that carry genetic material inherited from one generation ...

  2. Comparison of gene expression profiles and responses to zinc chloride among inter- and intraspecific hybrids with growth abnormalities in wheat and its relatives.

    Science.gov (United States)

    Takamatsu, Kiyofumi; Iehisa, Julio C M; Nishijima, Ryo; Takumi, Shigeo

    2015-07-01

    Hybrid necrosis is a well-known reproductive isolation mechanism in plant species, and an autoimmune response is generally considered to trigger hybrid necrosis through epistatic interaction between disease resistance-related genes in hybrids. In common wheat, the complementary Ne1 and Ne2 genes control hybrid necrosis, defined as type I necrosis. Two other types of hybrid necrosis (type II and type III) have been observed in interspecific hybrids between tetraploid wheat and Aegilops tauschii. Another type of hybrid necrosis, defined here as type IV necrosis, has been reported in F1 hybrids between Triticum urartu and some accessions of Triticum monococcum ssp. aegilopoides. In types I, III and IV, cell death occurs gradually starting in older tissues, whereas type II necrosis symptoms occur only under low temperature. To compare comprehensive gene expression patterns of hybrids showing growth abnormalities, transcriptome analysis of type I and type IV necrosis was performed using a wheat 38k oligo-DNA microarray. Defense-related genes including many WRKY transcription factor genes were dramatically up-regulated in plants showing type I and type IV necrosis, similarly to other known hybrid abnormalities, suggesting an association with an autoimmune response. Reactive oxygen species generation and necrotic cell death were effectively inhibited by ZnCl2 treatment in types I, III and IV necrosis, suggesting a significant association of Ca(2+) influx in upstream signaling of necrotic cell death in wheat hybrid necrosis.

  3. Evaluating a Web-Based MMR Decision Aid to Support Informed Decision-Making by UK Parents: A Before-and-After Feasibility Study

    Science.gov (United States)

    Jackson, Cath; Cheater, Francine M.; Peacock, Rose; Leask, Julie; Trevena, Lyndal

    2010-01-01

    Objective: The objective of this feasibility study was to evaluate the acceptability and potential effectiveness of a web-based MMR decision aid in supporting informed decision-making for the MMR vaccine. Design: This was a prospective before-and-after evaluation. Setting: Thirty parents of children eligible for MMR vaccination were recruited from…

  4. Mismatch repair gene expression in gastroesophageal cancers.

    Science.gov (United States)

    Dracea, Amelia; Angelescu, Cristina; Danciulescu, Mihaela; Ciurea, Marius; Ioana, Mihai; Burada, Florin

    2015-09-01

    Mismatch repair (MMR) genes play a critical role in maintaining genomic stability, and the impairment of MMR machinery is associated with different human cancers, mainly colorectal cancer. The purpose of our study was to analyze gene expression patterns of three MMR genes (MSH2, MHS6, and EXO1) in gastroesophageal cancers, a pathology in which the contribution of DNA repair genes remains essentially unclear. A total of 45 Romanian patients diagnosed with sporadic gastroesophageal cancers were included in this study. For each patient, MMR mRNA levels were measured in biopsied tumoral (T) and peritumoral (PT) tissues obtained by upper endoscopy. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) with specific TaqMan probes was used to measure gene expression levels for MSH2, MSH6, and EXO1 genes. A significant association was observed for the investigated MMR genes, all of which were detected to be upregulated in gastroesophageal tumor samples when compared with paired normal samples. In the stratified analysis, the association was limited to gastric adenocarcinoma samples. We found no statistically significant associations between MMR gene expression and tumor site or histological grade. In our study, MSH2, MSH6, and EXO1 genes were overexpressed in gastroesophageal cancers. Further investigations based on more samples are necessary to validate our findings.

  5. [Abnormal floral meristem development in transgenic tomato plants do not depend on the expression of genes encoding defense-related PR-proteins and antimicrobial peptides].

    Science.gov (United States)

    Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu

    2014-01-01

    In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial

  6. Association between perfluoroalkyl substance exposure and asthma and allergic disease in children as modified by MMR vaccination.

    Science.gov (United States)

    Timmermann, Clara Amalie Gade; Budtz-Jørgensen, Esben; Jensen, Tina Kold; Osuna, Christa Elyse; Petersen, Maria Skaalum; Steuerwald, Ulrike; Nielsen, Flemming; Poulsen, Lars K; Weihe, Pál; Grandjean, Philippe

    2017-12-01

    Perfluoroalkyl substances (PFASs) are highly persistent chemicals that might be associated with asthma and allergy, but the associations remain unclear. Therefore, this study examined whether pre- and postnatal PFAS exposure was associated with childhood asthma and allergy. Measles, mumps, and rubella (MMR) vaccination in early life may have a protective effect against asthma and allergy, and MMR vaccination is therefore taken into account when evaluating these associations. In a cohort of Faroese children whose mothers were recruited during pregnancy, serum concentrations of five PFASs - Perfluorohexane sulfonic acid (PFHxS), perfluorooctane sulfonic acid (PFOS), perfluorooctanoic acid (PFOA), perfluorononanoic acid (PFNA), and perfluorodecanoic acid (PFDA) - were measured at three timepoints (maternal serum in pregnancy week 34-36 and child serum at ages 5 and 13 years) and their association with immunoglobulin E (IgE) (cord blood and at age 7 years) and asthma/allergic diseases (questionnaires at ages 5 and 13 years and skin prick test at age 13 years) was determined. A total of 559 children were included in the analyses. Interactions with MMR vaccination were evaluated. Among 22 MMR-unvaccinated children, higher levels of the five PFASs at age 5 years were associated with increased odds of asthma at ages 5 and 13. The associations were reversed among MMR-vaccinated children. Prenatal PFAS exposure was not associated with childhood asthma or allergic diseases regardless of MMR vaccination status. In conclusion, PFAS exposure at age 5 was associated with increased risk of asthma among a small subgroup of MMR-unvaccinated children but not among MMR-vaccinated children. While PFAS exposure may impact immune system functions, this study suggests that MMR vaccination might be a potential effect-modifier.

  7. The blame frame: media attribution of culpability about the MMR-autism vaccination scare.

    Science.gov (United States)

    Holton, Avery; Weberling, Brooke; Clarke, Christopher E; Smith, Michael J

    2012-01-01

    Scholars have examined how news media frame events, including responsibility for causing and fixing problems, and how these frames inform public judgment. This study analyzed 281 newspaper articles about a controversial medical study linking the measles, mumps, and rubella (MMR) vaccination with autism. Given criticism of the study and its potential negative impact on vaccination rates across multiple countries, the current study examined actors to whom news media attributed blame for the MMR-vaccine association, sources used to support those attributions, and what solutions (e.g., mobilizing information), if any, were offered. This study provides unique insight by examining the evolution of these attributions over the lifetime of the controversy. Findings emphasize how news media may attribute blame in health risk communication and how that ascription plays a potentially vital role in shaping public behavior. Theoretical and practical implications are discussed.

  8. Measles, the media, and MMR: Impact of the 2014-15 measles outbreak.

    Science.gov (United States)

    Cataldi, Jessica R; Dempsey, Amanda F; O'Leary, Sean T

    2016-12-07

    In late 2014, a measles outbreak beginning in California received significant media attention. To better understand the impact of this outbreak, we conducted a survey to assess and compare among vaccine hesitant and non-hesitant new mothers how this outbreak affected vaccine knowledge, attitudes, vaccination plans, and media use. A cross-sectional email survey of English-speaking women with a child ⩽1year old using a convenience sample of women from nine obstetrics and gynecology (OB/GYN) practices in Colorado assessed vaccine hesitancy, knowledge and attitudes about MMR vaccines and the outbreak, MMR vaccination plans before and after the outbreak, and use of and trust for media sources related to the outbreak. The response rate was 50% (351/701). Knowledge about the outbreak was high and vaccination attitudes were mostly favorable. Forty-eight percent of respondents thought MMR vaccine was more important after the outbreak. Online news (76%), television news (75%), and social media (68%) were the most frequently used media sources, yet were highly trusted by only 18%, 22%, and 1% of respondents respectively. Government websites (34%) and information from a doctor's office (34%) were infrequently used, but were highly trusted by 62% and 60% of respondents. Knowledge of the outbreak was lower among vaccine-hesitant respondents. Few mothers changed MMR vaccination plans after the outbreak. New mothers had high levels of knowledge and favorable attitudes about vaccination after the 2014-15 measles outbreak. Media sources used the most are not the most trusted. Communication about outbreaks of vaccine-preventable diseases should include spread of accurate information to new media sources and strengthening of existing trust in traditional media. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Curcumin Chemosensitizes 5-Fluorouracil Resistant MMR-Deficient Human Colon Cancer Cells in High Density Cultures

    OpenAIRE

    Shakibaei, Mehdi; Buhrmann, Constanze; Kraehe, Patricia; Shayan, Parviz; Lueders, Cora; Goel, Ajay

    2014-01-01

    OBJECTIVE: Treatment of colorectal cancer (CRC) remains a clinical challenge, as more than 15% of patients are resistant to 5-Fluorouracil (5-FU)-based chemotherapeutic regimens, and tumor recurrence rates can be as high as 50-60%. Cancer stem cells (CSC) are capable of surviving conventional chemotherapies that permits regeneration of original tumors. Therefore, we investigated the effectiveness of 5-FU and plant polyphenol (curcumin) in context of DNA mismatch repair (MMR) status and CSC ac...

  10. Curcumin chemosensitizes 5-fluorouracil resistant MMR-deficient human colon cancer cells in high density cultures.

    Directory of Open Access Journals (Sweden)

    Mehdi Shakibaei

    Full Text Available OBJECTIVE: Treatment of colorectal cancer (CRC remains a clinical challenge, as more than 15% of patients are resistant to 5-Fluorouracil (5-FU-based chemotherapeutic regimens, and tumor recurrence rates can be as high as 50-60%. Cancer stem cells (CSC are capable of surviving conventional chemotherapies that permits regeneration of original tumors. Therefore, we investigated the effectiveness of 5-FU and plant polyphenol (curcumin in context of DNA mismatch repair (MMR status and CSC activity in 3D cultures of CRC cells. METHODS: High density 3D cultures of CRC cell lines HCT116, HCT116+ch3 (complemented with chromosome 3 and their corresponding isogenic 5-FU-chemo-resistant derivative clones (HCT116R, HCT116+ch3R were treated with 5-FU either without or with curcumin in time- and dose-dependent assays. RESULTS: Pre-treatment with curcumin significantly enhanced the effect of 5-FU on HCT116R and HCR116+ch3R cells, in contrast to 5-FU alone as evidenced by increased disintegration of colonospheres, enhanced apoptosis and by inhibiting their growth. Curcumin and/or 5-FU strongly affected MMR-deficient CRC cells in high density cultures, however MMR-proficient CRC cells were more sensitive. These effects of curcumin in enhancing chemosensitivity to 5-FU were further supported by its ability to effectively suppress CSC pools as evidenced by decreased number of CSC marker positive cells, highlighting the suitability of this 3D culture model for evaluating CSC marker expression in a close to vivo setting. CONCLUSION: Our results illustrate novel and previously unrecognized effects of curcumin in enhancing chemosensitization to 5-FU-based chemotherapy on DNA MMR-deficient and their chemo-resistant counterparts by targeting the CSC sub-population. (246 words in abstract.

  11. Curcumin chemosensitizes 5-fluorouracil resistant MMR-deficient human colon cancer cells in high density cultures.

    Science.gov (United States)

    Shakibaei, Mehdi; Buhrmann, Constanze; Kraehe, Patricia; Shayan, Parviz; Lueders, Cora; Goel, Ajay

    2014-01-01

    Treatment of colorectal cancer (CRC) remains a clinical challenge, as more than 15% of patients are resistant to 5-Fluorouracil (5-FU)-based chemotherapeutic regimens, and tumor recurrence rates can be as high as 50-60%. Cancer stem cells (CSC) are capable of surviving conventional chemotherapies that permits regeneration of original tumors. Therefore, we investigated the effectiveness of 5-FU and plant polyphenol (curcumin) in context of DNA mismatch repair (MMR) status and CSC activity in 3D cultures of CRC cells. High density 3D cultures of CRC cell lines HCT116, HCT116+ch3 (complemented with chromosome 3) and their corresponding isogenic 5-FU-chemo-resistant derivative clones (HCT116R, HCT116+ch3R) were treated with 5-FU either without or with curcumin in time- and dose-dependent assays. Pre-treatment with curcumin significantly enhanced the effect of 5-FU on HCT116R and HCR116+ch3R cells, in contrast to 5-FU alone as evidenced by increased disintegration of colonospheres, enhanced apoptosis and by inhibiting their growth. Curcumin and/or 5-FU strongly affected MMR-deficient CRC cells in high density cultures, however MMR-proficient CRC cells were more sensitive. These effects of curcumin in enhancing chemosensitivity to 5-FU were further supported by its ability to effectively suppress CSC pools as evidenced by decreased number of CSC marker positive cells, highlighting the suitability of this 3D culture model for evaluating CSC marker expression in a close to vivo setting. Our results illustrate novel and previously unrecognized effects of curcumin in enhancing chemosensitization to 5-FU-based chemotherapy on DNA MMR-deficient and their chemo-resistant counterparts by targeting the CSC sub-population. (246 words in abstract).

  12. Next-generation sequencing of 100 candidate genes in young victims of suspected sudden cardiac death with structural abnormalities of the heart

    DEFF Research Database (Denmark)

    Hertz, C L; Christiansen, S L; Ferrero-Miliani, Laura

    2016-01-01

    with non-diagnostic structural abnormalities of the heart. METHODS AND RESULTS: We screened 72 suspected SCD cases (HaloPlex Target Enrichment System (Agilent) and NGS (Illumina MiSeq) for 100 genes previously associated with inherited cardiomyopathies and channelopathies. Fifty......-two cases had non-diagnostic structural cardiac abnormalities and 20 cases, diagnosed with a cardiomyopathy post-mortem (ARVC = 14, HCM = 6), served as comparators. Fifteen (29 %) of the deceased individuals with non-diagnostic findings had variants with likely functional effects based on conservation......, computational prediction, allele-frequency and supportive literature. The corresponding frequency in deceased individuals with cardiomyopathies was 35 % (p = 0.8). CONCLUSION: The broad genetic screening revealed variants with likely functional effects at similar high rates, i.e. in 29 and 35 % of the suspected...

  13. The significance of mismatch repair genes in gastric cancer.

    Science.gov (United States)

    Lee, Hye-Jeong; Jang, You-Jin; Lee, Eun-Jung; Kim, Jong-Han; Park, Sung-Soo; Park, Seong-Heum; Kim, Chong-Suk; Mok, Young-Jae

    2013-01-01

    Microsatellite instability (MSI) is a form of genetic instability characterized by new alleles not present in the normal genotype. This mutation occurs by altered DNA mismatch repair (MMR) genes. Studies of limited numbers of patients have reported conflicting results regarding the association of the MSI phenotype with gastric cancer. This study aims to evaluate the clinical significance of mismatch repair genes in gastric cancer. We studied 156 gastric cancer patients who underwent gastrectomy from March 2010 to February 2011 in our hospital. Mismatch repair status was determined by the immunohistochemical analysis of human MutL Homolog 1 (hMLH1) and human MutS Homolog 2 (hMSH2) expression. Seventeen (10.9%) cases did not express hMLH1 but all cases expressed hMSH2. In univariate analyses, the expression of hMLH1 was associated with age, nodal status, and Lauren's classification. In multivariate analyses, there was no statistically significant association between the loss of hMLH1 expression and selected clinical parameters. The expression of hMLH1 was associated with age, nodal status, and Lauren's classification. Our results suggest that MMR gene abnormalities play an important role in the tumorigenesis of patients demonstrating gastric cancer.

  14. DEVELOPMENT AND DEPLOYMENT ASSESSMENT OF A MELT-DOWN PROOF MODULAR MICRO REACTOR (MDP-MMR)

    Energy Technology Data Exchange (ETDEWEB)

    Hawari, Ayman I.; Venneri, Francesco

    2018-04-02

    The objective of this project is to perform feasibility assessment and technology gap analysis and establish a development roadmap for an innovative and highly compact Micro Modular Reactor (MMR) concept that integrates power production, power conversion and electricity generation in a single unit. The MMR is envisioned to use fully ceramic micro-encapsulated (FCM) fuel, a particularly robust form of TRISO fuel, and to be gas-cooled (e.g., He or CO2) and capable of generating power in the range of 10 to 40 MW-thermal. It is designed to be absolutely melt-down proof (MDP) under all circumstances including complete loss of coolant scenarios with no possible release of radioactive material, to be factory produced, to have a cycle length of greater than 20 years, and to be highly proliferation resistant. In addition, it will be transportable, retrievable and suitable for use in remote areas. As such, the MDP-MMR will represent a versatile reactor concept that is suitable for use in various applications including electricity generation, process heat utilization and propulsion.

  15. NUP98/JARID1A is a novel recurrent abnormality in pediatric acute megakaryoblastic leukemia with a distinct HOX gene expression pattern.

    Science.gov (United States)

    de Rooij, J D E; Hollink, I H I M; Arentsen-Peters, S T C J M; van Galen, J F; Berna Beverloo, H; Baruchel, A; Trka, J; Reinhardt, D; Sonneveld, E; Zimmermann, M; Alonzo, T A; Pieters, R; Meshinchi, S; van den Heuvel-Eibrink, M M; Zwaan, C Michel

    2013-12-01

    Cytogenetic abnormalities and early response to treatment are the main prognostic factors in acute myeloid leukemia (AML). Recently, NUP98/NSD1 (t(5; 11)(q35; p15)), a cytogenetically cryptic fusion, was described as recurrent event in AML, characterized by dismal prognosis and HOXA/B gene overexpression. Using split-signal fluorescence in situ hybridization, other NUP98-rearranged pediatric AML cases were identified, including several acute megakaryoblastic leukemia (AMKL) cases with a cytogenetically cryptic fusion of NUP98 to JARID1A (t(11;15)(p15;q35)). In this study we screened 105 pediatric AMKL cases to analyze the frequency of NUP98/JARID1A and other recurrent genetic abnormalities. NUP98/JARID1A was identified in 11/105 patients (10.5%). Other abnormalities consisted of RBM15/MKL1 (n=16), CBFA2T3/GLIS2 (n=13) and MLL-rearrangements (n=13). Comparing NUP98/JARID1A-positive patients with other pediatric AMKL patients, no significant differences in sex, age and white blood cell count were found. NUP98/JARID1A was not an independent prognostic factor for 5-year overall (probability of overall survival (pOS)) or event-free survival (probability of event-free survival (pEFS)), although the 5-year pOS for the entire AMKL cohort was poor (42 ± 6%). Cases with RBM15/MLK1 fared significantly better in terms of pOS and pEFS, although this was not independent from other risk factors in multivariate analysis. NUP98/JARID1A cases were characterized by HOXA/B gene overexpression, which is a potential druggable pathway. In conclusion, NUP98/JARID1A is a novel recurrent genetic abnormality in pediatric AMKL.

  16. Meiotic abnormalities

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1993-12-31

    Chapter 19, describes meiotic abnormalities. These include nondisjunction of autosomes and sex chromosomes, genetic and environmental causes of nondisjunction, misdivision of the centromere, chromosomally abnormal human sperm, male infertility, parental age, and origin of diploid gametes. 57 refs., 2 figs., 1 tab.

  17. Somatic aberrations of mismatch repair genes as a cause of microsatellite-unstable cancers.

    Science.gov (United States)

    Geurts-Giele, Willemina R R; Leenen, Celine H M; Dubbink, Hendrikus J; Meijssen, Isabelle C; Post, Edward; Sleddens, Hein F B M; Kuipers, Ernst J; Goverde, Anne; van den Ouweland, Ans M W; van Lier, Margot G F; Steyerberg, Ewout W; van Leerdam, Monique E; Wagner, Anja; Dinjens, Winand N M

    2014-12-01

    Lynch syndrome (LS) is caused by germline mutations in mismatch repair (MMR) genes, resulting in microsatellite-unstable tumours. Approximately 35% of suspected LS (sLS) patients test negative for germline MMR gene mutations, hampering conclusive LS diagnosis. The aim of this study was to investigate somatic MMR gene aberrations in microsatellite-unstable colorectal and endometrial cancers of sLS patients negative for germline MMR gene mutations. Suspected LS cases were selected from a retrospective Clinical Genetics Department diagnostic cohort and from a prospective multicentre population-based study on LS in The Netherlands. In total, microsatellite-unstable tumours of 40 sLS patients (male/female 20/20, median age 57 years) were screened for somatic MMR gene mutations by next-generation sequencing. In addition, loss of heterozygosity (LOH) of the affected MMR genes in these tumours as well as in 68 LS-associated tumours and 27 microsatellite-unstable tumours with MLH1 promoter hypermethylation was studied. Of the sLS cases, 5/40 (13%) tumours had two pathogenic somatic mutations and 16/40 (40%) tumours had a (likely) pathogenic mutation and LOH. Overall, LOH of the affected MMR gene locus was observed in 24/39 (62%) tumours with informative LOH markers. Of the LS cases and the tumours with MLH1 promoter hypermethylation, 39/61 (64%) and 2/21 (10%) tumours, respectively, demonstrated LOH. Half of microsatellite-unstable tumours of sLS patients without germline MMR gene mutations had two (likely) deleterious somatic MMR gene aberrations, indicating their sporadic origin. Therefore, we advocate adding somatic mutation and LOH analysis of the MMR genes to the molecular diagnostic workflow of LS. Copyright © 2014 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  18. Knowledge, attitudes, beliefs and practices of general practitioners towards measles and MMR vaccination in southeastern France in 2012.

    Science.gov (United States)

    Pulcini, C; Massin, S; Launay, O; Verger, P

    2014-01-01

    As a result of sub-optimal immunization levels, measles has re-emerged in the EU since 2008 (30 ,567 cases in 2011), and nearly half of the cases reported are in France. Our objectives were to assess knowledge, attitudes, beliefs and practices of French general practitioners (GPs) towards measles and measles-mumps-rubella (MMR) vaccination. In 2012, we surveyed 329 GPs in southeastern France. Forty-five percent reported that they saw patients with measles in 2011. They considered the risk of complications low among 2-5-year-old children and young adults without co-morbidity. Twenty percent knew that two MMR doses are 99% effective in preventing measles. Nearly all (95%) GPs stated that they verified the MMR status for patients measles. Participation in continuing medical education courses and considering measles to be a serious disease were independently associated with such post-exposure vaccination. GPs considered the following were potential barriers to the second dose of MMR (MMR2): parents/patients' belief that measles is harmless (80%), parents/patients' fear of the vaccine's side effects (50%), difficulty in documenting vaccination (48%) and lack of reminders for MMR2 (16%). Finally, some GPs also had misconceptions about the severity of measles (13%) and the usefulness of MMR2 (12%), which also served as barriers. In conclusion, it is essential to raise GPs' awareness of this disease and fill any gaps in their knowledge, by providing them with evidence-based information on measles and MMR vaccination. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  19. Loss of Apc heterozygosity and abnormal tissue building in nascent intestinal polyps in mice carrying a truncated Apc gene.

    OpenAIRE

    Oshima, M; Oshima, H; Kitagawa, K; Kobayashi, M; Itakura, C; Taketo, M

    1995-01-01

    Mutations in the APC (adenomatous polyposis coli) gene appear to be responsible for not only familial adenomatous polyposis but also many sporadic cases of gastrointestinal cancers. Using homologous recombination in mouse embryonic stem cells, we constructed mice that contained a mutant gene encoding a product truncated at a 716 (Apc delta 716). Mendelian transmission of the gene caused most homozygous mice to die in utero before day 8 of gestation. The heterozygotes developed multiple polyps...

  20. Selecting patients with young-onset colorectal cancer for mismatch repair gene analysis

    DEFF Research Database (Denmark)

    Walker, M; O'Sullivan, B; Perakath, B

    2007-01-01

    BACKGROUND: Young patients with colorectal cancer are at increased risk of carrying a germline mutation in mismatch repair (MMR) genes. This study investigated the role of clinical criteria and immunohistochemistry for MMR proteins in selecting young patients for mutation testing. METHODS: A cohort...... of 56 consecutive patients with colorectal cancer aged less than 45 years were stratified into three groups based on clinical criteria: 'Amsterdam criteria', 'high risk' and 'young onset only'. Immunohistochemistry for four MMR proteins was carried out and the rate of compliance with clinical guidelines....... CONCLUSION: MMR immunohistochemistry should be considered routine in young-onset colorectal cancer....

  1. Walking abnormalities

    Science.gov (United States)

    ... include: Arthritis of the leg or foot joints Conversion disorder (a mental disorder) Foot problems (such as a ... injuries. For an abnormal gait that occurs with conversion disorder, counseling and support from family members are strongly ...

  2. Cross calibration of the Siemens mMR: easily acquired accurate PET phantom measurements, long term stability and reproducibility

    International Nuclear Information System (INIS)

    Keller, Sune H; Jakoby, Bjorn; Hansen, Adam Espe; Svalling, Susanne; Klausen, Thomas L

    2015-01-01

    We present a quick and easy method to perform quantitatively accurate PET scans of typical water-filled PET plastic shell phantoms on the Siemens mMR PET/MR scanner. We perform regular cross calibrations (Xcals) of our PET scanners, including the Siemens mMR PET/MR, with a Siemens mCT water phantom. We evaluate the mMR cross calibration stability over a 3-year period. Recently, the mMR software (VB20P) offered the option of using predefined μ-maps. We evaluated this option by using either the predefined μ-map of the long mMR water phantom or a system-integrated user defined CT-based μ-map of the mCT water phantom used for Xcal. On 54 cross calibrations that were acquired over 3 years, the mMR on average underestimated the concentration by 16% due to the use of MR-based μ-maps. The mMR produced the narrowest range and lowest standard deviation of the Xcal ratios, implying it and is the most stable of the 6 scanners included in this study over a 3 year period. With correctly segmented μ-maps, the mMR produced Xcal ratios of 1.00-1.02, well within the acceptance range [0.95-1.05]. Measuring the concentration in a centrally placed cylindrical VOI allows for some robustness against misregistration of the μ-maps but it should be no more than a few millimeters in the x-y plane, while the tolerance is larger on the z-axis (when, as always with PET, keeping clear of the axial edges of the FOV). The mMR is the most stable scanner in this study and the mean underestimation is no longer an issue with the easily accessible μ-map, which in all 7 tests resulted in correct Xcal ratios. We will share the user defined μ-map of the mCT phantom and the protocol with interested mMR users.

  3. Identification of 9 uterine genes that are regulated during mouse pregnancy and exhibit abnormal levels in the cyclooxygenase-1 knockout mouse

    Directory of Open Access Journals (Sweden)

    Soper Jessica

    2007-07-01

    Full Text Available Abstract Background Preterm birth is the leading cause of all infant mortality. In 2004, 12.5% of all births were preterm. In order to understand preterm labor, we must first understand normal labor. Since many of the myometrial changes that occur during pregnancy are similar in mice and humans and mouse gestation is short, we have studied the uterine genes that change in the mouse during pregnancy. Here, we used microarray analysis to identify uterine genes in the gravid mouse that are differentially regulated in the cyclooxygenase-1 knockout mouse model of delayed parturition. Methods Gestational d18.0 uteri (n = 4 were collected from pregnant wild-type and cyclooxygenase-1 knockout mice. Part of the uterus was used for frozen sections and RNA was isolated from the remainder. Microarray analysis was performed at the Indiana University School of Medicine Genomic Core and analyzed using the Microarray Data Portal. Northern analysis was performed to confirm microarray data and the genes localized in the gravid uterus by in situ hybridization. Results We identified 277 genes that are abnormally expressed in the gravid d18.0 cyclooxygenase-1 knockout mouse. Nine of these genes are also regulated in the normal murine uterus during the last half of gestation. Many of these genes are involved in the immune response, consistent with an important role of the immune system in parturition. Expression of 4 of these genes; arginase I, IgJ, Tnfrsf9 and troponin; was confirmed by Northern analysis to be mis-regulated during pregnancy in the knockout mouse. In situ hybridization of these genes demonstrated a similar location in the gravid wild-type and Cox-1 knockout mouse uteri. Conclusion To our knowledge, this is the first work to demonstrate the uterine location of these 4 genes in the mouse during late pregnancy. There are several putative transcription factor binding sites that are shared by many of the 9 genes identified here including; estrogen and

  4. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Directory of Open Access Journals (Sweden)

    Catherine Cukras

    Full Text Available Retinitis Pigmentosa (RP is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A in the gene encoding retinol binding protein 4 (RBP4. This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  5. Performance Estimation of Supercritical Co2 Micro Modular Reactor (MMR) for Varying Cooling Air Temperature

    International Nuclear Information System (INIS)

    Ahn, Yoonhan; Kim, Seong Gu; Cho, Seong Kuk; Lee, Jeong Ik

    2015-01-01

    A Small Modular Reactor (SMR) receives interests for the various application such as electricity co-generation, small-scale power generation, seawater desalination, district heating and propulsion. As a part of SMR development, supercritical CO2 Micro Modular Reactor (MMR) of 36.2MWth in power is under development by the KAIST research team. To enhance the mobility, the entire system including the power conversion system is designed for the full modularization. Based on the preliminary design, the thermal efficiency is 31.5% when CO2 is sufficiently cooled to the design temperature. A supercritical CO2 MMR is designed to supply electricity to the remote regions. The ambient temperature of the area can influence the compressor inlet temperature as the reactor is cooled with the atmospheric air. To estimate the S-CO2 cycle performance for various environmental conditions, A quasi-static analysis code is developed. For the off design performance of S-CO2 turbomachineries, the experimental result of Sandia National Lab (SNL) is utilized

  6. Managing controversy through consultation: a qualitative study of communication and trust around MMR vaccination decisions.

    Science.gov (United States)

    McMurray, Robert; Cheater, Francine M; Weighall, Anna; Nelson, Carolyn; Schweiger, Martin; Mukherjee, Suzanne

    2004-07-01

    Controversy over the measles, mumps, and rubella (MMR) vaccine has reduced uptake, raising concerns of a future disease epidemic. To explore parents' accounts of decision making relating to the MMR vaccine controversy, identifying uptake determinants and education needs. Qualitative interviews analysed using the 'framework' approach. Five general practices in the Leeds area, 2002-2003. Sixty-nine interviews conducted with parents of children aged between 4 and 5 years, and 12 interviews with primary care practitioners, managers and immunisation coordinators serving participating sites. Participants were interviewed one-to-one in a place of their choice. The vaccination decision is primarily a function of parental assessments of the relative acceptability and likelihood of possible outcomes. For most parents the evidence of science and medicine plays little role in the decision. Although local general practitioners and health visitors are trusted information sources, the influence of primary care providers on the vaccination decision is limited by concerns over consultation legitimacy, discussion opportunity, and perceptions of financial and political partiality. Parents and practitioners identify a need for new approaches to support decisions and learning when faced with this and similar healthcare controversies. These include new collaborative approaches to information exchange designed to transform rather than supplant existing parent knowledge as part of an ongoing learning process. The study identified new ways in which parents and practitioners need to be supported in order to increase understanding of medical science and secure more informed decisions in the face of health controversy.

  7. Identification of nickel response genes in abnormal early developments of sea urchin by differential display polymerase chain reaction.

    Science.gov (United States)

    Ryu, Tae Kwon; Lee, Gunsup; Rhee, Yong; Park, Heung-Sik; Chang, Man; Lee, Sukchan; Lee, Jaean; Lee, Taek-Kyun

    2012-10-01

    Bioassays and biomarkers have been previously developed to assess the effects of heavy metal contaminants on the early life stages of the sea urchin. In this study, malformation in the early developmental processes was observed in sea urchin (Strongylocentrotus intermedius) larvae exposed to 10 ppm Ni for over 30 h. The most critical stage at which the triggering of nickel effects takes place is thought to be the blastula stage, which occurs after fertilization in larval development. To investigate the molecular-level responses of sea urchin exposed to heavy metal stress and to explore the differentially expressed genes that are induced or repressed by nickel, differential display polymerase chain reaction (DD-PCR) was used with sea urchin mRNAs. The malformation-related genes expressed in the early life stages of the sea urchin were cloned from larvae exposed to 10 ppm of nickel for 15 h, and accessed via DD-PCR. Sequence analysis results revealed that each of the genes evidenced high homology with EGF2, PCSK9, serine/threonine protein kinase, apolipophorin precursor protein, and MGC80921 protein/transcript variant 2. This result may prove useful in the development of novel biomarkers for the assessment of heavy metal stresses on sea urchin embryos. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. A novel measles outbreak control strategy in the Netherlands in 2013-2014 using a national electronic immunization register: A study of early MMR uptake and its determinants.

    Science.gov (United States)

    Nic Lochlainn, Laura M; Woudenberg, Tom; van Lier, Alies; Zonnenberg, Irmgard; Philippi, Marvin; de Melker, Hester E; Hahné, Susan J M

    2017-10-13

    During a large measles outbreak in the Netherlands in 2013-2014, infants aged 6-14months living in municipalities with low (measles-mumps-rubella (MMR) coverage were individually invited for an early MMR using the national electronic immunization register, Præventis. We estimated uptake of early MMR prior to and during the 2013-2014 outbreak and assessed determinants for early MMR vaccination. We obtained vaccination records from Præventis, and defined early MMR as vaccination before 415days (13months) of age. A multi-level multivariable logistic regression model, restricted to infants with three diphtheria-pertussis-tetanus-polio (DPTP) vaccinations was used to examine the association between early MMR uptake and sex, parents' country of birth, socioeconomic status (SES; at postcode level) and voting proportions for the Reformed Political Party (SGP; at municipal level), used as a proxy for religious objections towards vaccination. In the 29 municipalities with low MMR coverage, uptake of early MMR was 0.5-2.2% prior to the outbreak. Between July 2013 and March 2014, 5,800 (57%) invited infants received an early MMR. Among infants with three DPTP, 70% received an early MMR. Only 1% of infants without prior DPTP received an early MMR. Lower early MMR uptake was associated with a higher SGP voter-ship (OR 0.89 per 5% increase, 95%CI 0.83-0.96), parents' with unknown country of birth (OR 0.66 95%CI 0.47-0.93) and compared with very high SES, high SES had significantly lower early MMR uptake (OR 0.66 95%CI 0.50-0.87). This is the first study describing use of Præventis during an outbreak and to assess determinants of early MMR uptake. More than half of invited infants obtained an early MMR. SES, parents' with unknown country of birth and religious objections towards vaccination were found to be associated with lower early MMR uptake. In future outbreaks, these determinants could be used to tailor intervention strategies. Copyright © 2017. Published by Elsevier Ltd.

  9. Disruption of the gene encoding the latent transforming growth factor-β binding protein 4 (LTBP-4) causes abnormal lung development, cardiomyopathy, and colorectal cancer

    Science.gov (United States)

    Sterner-Kock, Anja; Thorey, Irmgard S.; Koli, Katri; Wempe, Frank; Otte, Jürgen; Bangsow, Thorsten; Kuhlmeier, Katharina; Kirchner, Thomas; Jin, Shenchu; Keski-Oja, Jorma; von Melchner, Harald

    2002-01-01

    Transforming growth factor-βs (TGF-βs) are multifunctional growth factors that are secreted as inactive (latent) precursors in large protein complexes. These complexes include the latency-associated propeptide (LAP) and a latent transforming growth factor-β binding protein (LTBP). Four isoforms of LTBPs (LTBP-1–LTBP-4) have been cloned and are believed to be structural components of connective tissue microfibrils and local regulators of TGF-β tissue deposition and signaling. By using a gene trap strategy that selects for integrations into genes induced transiently during early mouse development, we have disrupted the mouse homolog of the human LTBP-4 gene. Mice homozygous for the disrupted allele develop severe pulmonary emphysema, cardiomyopathy, and colorectal cancer. These highly tissue-specific abnormalities are associated with profound defects in the elastic fiber structure and with a reduced deposition of TGF-β in the extracellular space. As a consequence, epithelial cells have reduced levels of phosphorylated Smad2 proteins, overexpress c-myc, and undergo uncontrolled proliferation. This phenotype supports the predicted dual role of LTBP-4 as a structural component of the extracellular matrix and as a local regulator of TGF-β tissue deposition and signaling. PMID:12208849

  10. Reversal of Phenotypic Abnormalities by CRISPR/Cas9-Mediated Gene Correction in Huntington Disease Patient-Derived Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Xu, Xiaohong; Tay, Yilin; Sim, Bernice; Yoon, Su-In; Huang, Yihui; Ooi, Jolene; Utami, Kagistia Hana; Ziaei, Amin; Ng, Bryan; Radulescu, Carola; Low, Donovan; Ng, Alvin Yu Jin; Loh, Marie; Venkatesh, Byrappa; Ginhoux, Florent; Augustine, George J; Pouladi, Mahmoud A

    2017-03-14

    Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in HTT. Here we report correction of HD human induced pluripotent stem cells (hiPSCs) using a CRISPR-Cas9 and piggyBac transposon-based approach. We show that both HD and corrected isogenic hiPSCs can be differentiated into excitable, synaptically active forebrain neurons. We further demonstrate that phenotypic abnormalities in HD hiPSC-derived neural cells, including impaired neural rosette formation, increased susceptibility to growth factor withdrawal, and deficits in mitochondrial respiration, are rescued in isogenic controls. Importantly, using genome-wide expression analysis, we show that a number of apparent gene expression differences detected between HD and non-related healthy control lines are absent between HD and corrected lines, suggesting that these differences are likely related to genetic background rather than HD-specific effects. Our study demonstrates correction of HD hiPSCs and associated phenotypic abnormalities, and the importance of isogenic controls for disease modeling using hiPSCs. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  11. Reversal of Phenotypic Abnormalities by CRISPR/Cas9-Mediated Gene Correction in Huntington Disease Patient-Derived Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Xiaohong Xu

    2017-03-01

    Full Text Available Huntington disease (HD is a dominant neurodegenerative disorder caused by a CAG repeat expansion in HTT. Here we report correction of HD human induced pluripotent stem cells (hiPSCs using a CRISPR-Cas9 and piggyBac transposon-based approach. We show that both HD and corrected isogenic hiPSCs can be differentiated into excitable, synaptically active forebrain neurons. We further demonstrate that phenotypic abnormalities in HD hiPSC-derived neural cells, including impaired neural rosette formation, increased susceptibility to growth factor withdrawal, and deficits in mitochondrial respiration, are rescued in isogenic controls. Importantly, using genome-wide expression analysis, we show that a number of apparent gene expression differences detected between HD and non-related healthy control lines are absent between HD and corrected lines, suggesting that these differences are likely related to genetic background rather than HD-specific effects. Our study demonstrates correction of HD hiPSCs and associated phenotypic abnormalities, and the importance of isogenic controls for disease modeling using hiPSCs.

  12. Targeted mutagenesis of the Hira gene results in gastrulation defects and patterning abnormalities of mesoendodermal derivatives prior to early embryonic lethality.

    Science.gov (United States)

    Roberts, Catherine; Sutherland, Helen F; Farmer, Hannah; Kimber, Wendy; Halford, Stephanie; Carey, Alisoun; Brickman, Joshua M; Wynshaw-Boris, Anthony; Scambler, Peter J

    2002-04-01

    The Hira gene encodes a nuclear WD40 domain protein homologous to the yeast transcriptional corepressors Hir1p and Hir2p. Using targeted mutagenesis we demonstrate that Hira is essential for murine embryogenesis. Analysis of inbred 129Sv embryos carrying the null mutation revealed an initial requirement during gastrulation, with many mutant embryos having a distorted primitive streak. Mutant embryos recovered at later stages have a range of malformations with axial and paraxial mesendoderm being particularly affected, a finding consistent with the disruption of gastrulation seen earlier in development. This phenotype could be partially rescued by a CD1 genetic background, although the homozygous mutation was always lethal by embryonic day 11, with death probably resulting from abnormal placentation and failure of cardiac morphogenesis.

  13. Two siblings with immunodeficiency, facial abnormalities and chromosomal instability without mutation in DNMT3B gene but liability towards malignancy; a new chromatin disorder delineation?

    Directory of Open Access Journals (Sweden)

    Neitzel Heidemarie

    2010-03-01

    Full Text Available Abstract Background ICF syndrome (standing for Immunodeficiency, Centromere instability and Facial anomalies syndrome is a very rare autosomal recessive immune disorder caused by mutations of the gene de novo DNA-methyltransferase 3B (DNMT3B. However, in the literature similar clinical cases without such mutations are reported, as well. Results We report on a family in which the unrelated spouses had two female siblings sharing similar phenotypic features resembling ICF-syndrome, i.e. congenital abnormalities, immunodeficiency, developmental delay and high level of chromosomal instability, including high frequency of centromeric/pericentromeric rearrangements and breaks, chromosomal fragments despiralization or pulverization. However, mutations in DNMT3B could not be detected. Conclusion The discovery of a new so-called 'chromatin disorder' is suggested. Clinical, molecular genetic and cytogenetic characteristics are reported and compared to other 'chromatin disorders'.

  14. Two siblings with immunodeficiency, facial abnormalities and chromosomal instability without mutation in DNMT3B gene but liability towards malignancy; a new chromatin disorder delineation?

    Science.gov (United States)

    Polityko, Anna; Khurs, Olga; Rumyantseva, Natalia; Naumchik, Irina; Kosyakova, Nadezda; Tönnies, Holger; Sperling, Karl; Neitzel, Heidemarie; Weise, Anja; Liehr, Thomas

    2010-03-08

    ICF syndrome (standing for Immunodeficiency, Centromere instability and Facial anomalies syndrome) is a very rare autosomal recessive immune disorder caused by mutations of the gene de novo DNA-methyltransferase 3B (DNMT3B). However, in the literature similar clinical cases without such mutations are reported, as well. We report on a family in which the unrelated spouses had two female siblings sharing similar phenotypic features resembling ICF-syndrome, i.e. congenital abnormalities, immunodeficiency, developmental delay and high level of chromosomal instability, including high frequency of centromeric/pericentromeric rearrangements and breaks, chromosomal fragments despiralization or pulverization. However, mutations in DNMT3B could not be detected. The discovery of a new so-called 'chromatin disorder' is suggested. Clinical, molecular genetic and cytogenetic characteristics are reported and compared to other 'chromatin disorders'.

  15. Healthcare workers and measles-mumps-rubella (MMR) status: how worried should we be about further outbreaks?

    Science.gov (United States)

    Basu, S; Giri, P; Adisesh, A; McNAUGHT, R

    2014-08-01

    Recently, a number of outbreaks of measles and mumps have occurred within the UK and Europe. Healthcare workers (HCWs) are at risk of contracting and transmitting disease to patients and staff. To examine this risk at the point of entry to healthcare, we assessed the serological results of new HCWs presenting for pre-placement clearance without evidence of measles-mumps-rubella (MMR) immunity between 1 April 2010 and 31 March 2012. Overall rates of serological positivity to MMR across all age groups were 88·2%, 68·8% and 93·9%, respectively. With regard to measles and mumps, there were statistically significant decreases in the percentage of HCWs born after 1980 that had positive serology (P vaccination. Despite our entry-level findings, the ongoing risk of a MMR outbreak within this cohort of HCWs appears low.

  16. INTRALESIONAL MEASLES, MUMPS AND RUBELLA (MMR VACCINE-AN EFFECTIVE THERAPEUTIC TOOL IN THE TREATMENT OF WART

    Directory of Open Access Journals (Sweden)

    Raju

    2015-11-01

    Full Text Available BACKGROUND: Warts are common cutaneous viral infection. Various therapeutic modalities have been using in treatment of wart, but none of them are standardised. Immunotherapy is new current approach in the treatment of wart. AIMS: To know the efficacy and safety profile of Measles Mumps Rubella (MMR Vaccine in the treatment of wart. METHODS: MMR vaccine was injected into a largest single wart intralesionally and subsequent injections given every 2 weeks apart for about 3 to 5 times. Every month followup of patients was done to know the clearance of wart. RESULTS: Complete remission of warts seen in 70.4% of patients, partial remission seen in 22.2% and no response was seen in 7.4% of patients. No serious adverse side effects were seen in the current study. CONCLUSION: MMR vaccine can be considered as a safe, effective, inexpensive intralesional immunotherapeutic modality in the treatment of wart.

  17. Peripuberty stress leads to abnormal aggression, altered amygdala and orbitofrontal reactivity and increased prefrontal MAOA gene expression

    DEFF Research Database (Denmark)

    Márquez, C; Poirier, G L; Cordero, M I

    2013-01-01

    Although adverse early life experiences have been found to increase lifetime risk to develop violent behaviors, the neurobiological mechanisms underlying these long-term effects remain unclear. We present a novel animal model for pathological aggression induced by peripubertal exposure to stress...... by increased activatory acetylation of histone H3, but not H4, at the promoter of the MAOA gene. Treatment with an MAOA inhibitor during adulthood reversed the peripuberty stress-induced antisocial behaviors. Beyond the characterization and validation of the model, we present novel data highlighting changes...... of violent behaviors....

  18. Abnormal iron metabolism and oxidative stress in mice expressing a mutant form of the ferritin light polypeptide gene

    Science.gov (United States)

    Barbeito, Ana G.; Garringer, Holly J.; Baraibar, Martin A.; Gao, Xiaoying; Arredondo, Miguel; Núñez, Marco T.; Smith, Mark A.; Ghetti, Bernardino; Vidal, Ruben

    2009-01-01

    Insertional mutations in exon 4 of the ferritin light chain (FTL) gene are associated with hereditary ferritinopathy (HF) or neuroferritinopathy, an autosomal dominant neurodegenerative disease characterized by progressive impairment of motor and cognitive functions. To determine the pathogenic mechanisms by which mutations in FTL lead to neurodegeneration, we investigated iron metabolism and markers of oxidative stress in the brain of transgenic (Tg) mice that express the mutant human FTL498-499InsTC cDNA. Compared with wild-type mice, brain extracts from Tg (FTL-Tg) mice showed an increase in the cytoplasmic levels of both FTL and ferritin heavy chain polypeptides, a decrease in the protein and mRNA levels of transferrin receptor-1, and a significant increase in iron levels. Transgenic mice also showed the presence of markers for lipid peroxidation, protein carbonyls, and nitrone–protein adducts in the brain. However, gene expression analysis of iron management proteins in the liver of Tg mice indicates that the FTL-Tg mouse liver is iron deficient. Our data suggest that disruption of iron metabolism in the brain has a primary role in the process of neurodegeneration in HF and that the pathogenesis of HF is likely to result from a combination of reduction in iron storage function and enhanced toxicity associated with iron-induced ferritin aggregates in the brain. PMID:19519778

  19. Measles, mumps, and rubella antibody patterns of persistence and rate of decline following the second dose of the MMR vaccine.

    Science.gov (United States)

    Seagle, Emma E; Bednarczyk, Robert A; Hill, Tenisha; Fiebelkorn, Amy Parker; Hickman, Carole J; Icenogle, Joseph P; Belongia, Edward A; McLean, Huong Q

    2018-02-01

    Antibodies to measles, mumps, and rubella decline 3% per year on average, and have a high degree of individual variation. Yet, individual variations and differences across antigens are not well understood. To better understand potential implications on individual and population susceptibility, we reanalyzed longitudinal data to identify patterns of seropositivity and persistence. Children vaccinated with the second dose of measles, mumps, rubella vaccine (MMR2) at 4-6 years of age were followed up to 12 years post-vaccination. The rates of antibody decline were assessed using regression models, accounting for differences between and within subjects. Most of the 302 participants were seropositive throughout follow-up (96% measles, 88% mumps, 79% rubella). The rate of antibody decline was associated with MMR2 response and baseline titer for measles and age at first dose of MMR (MMR1) for rubella. No demographic or clinical factors were associated with mumps rate of decline. One month post-MMR2, geometric mean titer (GMT) to measles was high (3892 mIU/mL), but declined on average 9.7% per year among those with the same baseline titer and 15 months, respectively. GMT to mumps one month post-MMR2 was 151, declining 9.2% per year. Only 14% of subjects had the same persistence trends for all antigens. The rate of antibody decay varied substantially among individuals and the 3 antigen groups. A fast rate of decline coupled with high variation was observed for mumps, yet no predictors were identified. Future research should focus on better understanding waning titers to mumps and its impacts on community protection and individual susceptibility, in light of recent outbreaks in vaccinated populations. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Systematic immunohistochemical screening for mismatch repair and ERCC1 gene expression from colorectal cancers in China: Clinicopathological characteristics and effects on survival.

    Science.gov (United States)

    Li, Pan; Xiao, Zhitao; Braciak, Todd A; Ou, Qingjian; Chen, Gong; Oduncu, Fuat S

    2017-01-01

    We performed a systematic screening of colorectal cancer (CRC) tissues to investigate whether mismatch repair (MMR) status and ERCC1 protein expression could be predictive of clinical outcomes for these patients following the recommendation of The Evaluation of Genomic Applications in Practice of Prevention (EGAPP). The expression of four MMR genes and ERCC1 were assessed by immunohistochemistry (IHC) from cancer tissue samples of 2233 consecutive CRC patients. We observed that most CRC patients with a proficient MMR (pMMR) status tended to have simultaneous ERCC1 protein expression (Pgenes and ERCC1 showed a significant relationship.

  1. Inactivation of DNA mismatch repair by variants of uncertain significance in the PMS2 gene.

    Science.gov (United States)

    Drost, Mark; Koppejan, Hester; de Wind, Niels

    2013-11-01

    Lynch syndrome (LS) is a common cancer predisposition caused by an inactivating mutation in one of four DNA mismatch repair (MMR) genes. Frequently a variant of uncertain significance (VUS), rather than an obviously pathogenic mutation, is identified in one of these genes. The inability to define pathogenicity of such variants precludes targeted healthcare. Here, we have modified a cell-free assay to test VUS in the MMR gene PMS2 for functional activity. We have analyzed nearly all VUS in PMS2 found thus far and describe loss of MMR activity for five, suggesting the applicability of the assay for diagnosis of LS. © 2013 WILEY PERIODICALS, INC.

  2. Widening inequalities in MMR vaccine uptake rates among ethnic groups in an urban area of the UK during a period of vaccine controversy (1994-2000).

    Science.gov (United States)

    Hawker, Jeremy I; Olowokure, Babatunde; Wood, Annette L; Wilson, Richard C; Johnson, Richard

    2007-10-23

    We examined MMR vaccine uptake among ethnic groups in Birmingham, UK between 1994 and 2000, a period incorporating adverse MMR vaccine publicity. From 1994 to 2000 overall uptake: (1) fell significantly from 91.1% in 1994 to 89.8% (chi(2) for trend pvaccine uptake and differential response to adverse vaccine publicity.

  3. Abnormal apoptosis of trophoblastic cells is related to the up-regulation of CYP11A gene in placenta of preeclampsia patients.

    Directory of Open Access Journals (Sweden)

    Guolin He

    Full Text Available Abnormal placenta trophoblast proliferation and apoptosis is related to the pathogenesis of preeclampsia. Emerging evidence has also indicated that key pregnancy-associated hormones, such as hCG, progesterone, are found in high concentration at the maternal-fetal interface. The purpose of this study was to investigate the expression of CYP11A, a key enzyme in steroid hormone synthesis and metabolism, in normal pregnancy and severe preeclampsia placenta and to explore the underlying mechanism of the relationship between the altered CYP11A expression and onset of preeclampsia. Immunohistochemistry method was used to study the localization of CYP11A-encoded protein P450scc in the placenta; reverse transcription polymerase chain reaction (RT-PCR and Western blotting were used to examine CYP11A expression at mRNA and protein levels in patients with severe preeclampsia and normal placental tissue. CYP11A overexpression in trophoblastic cells was used to evaluate the effect on viability. TUNEL staining was used to determine whether overexpression of CYP11A could affect trophoblastic cell apoptosis. The results showed that CYP11A was selectively expressed in the cytoplasm of the placental trophoblastic cells. CYP11A expression were significantly increased in severe preeclampsia compared with normal pregnancy in both mRNA and protein levels. Multiple regression analysis indicated that CYP11A gene expression was positively correlated to ALT level and Plt, while negatively correlated to INR. Overexpression of CYP11A reduced trophoblastic cell proliferation and induced HTR8/SVneo cells apoptosis through activation of activated caspase-3 expression. These results suggest that abnormally high expression of CYP11A inhibits trophoblastic proliferation and increases apoptosis and therefore could be involved in the pathogenesis of preeclampsia.

  4. Reasons for measles cases not being vaccinated with MMR: investigation into parents' and carers' views following a large measles outbreak.

    Science.gov (United States)

    McHale, P; Keenan, A; Ghebrehewet, S

    2016-03-01

    Uptake rates for the combined measles, mumps and rubella (MMR) vaccine have been below the required 95% in the UK since a retracted and discredited article linking the MMR vaccine with autism and inflammatory bowel disease was released in 1998. This study undertook semi-structured telephone interviews among parents or carers of 47 unvaccinated measles cases who were aged between 13 months and 9 years, during a large measles outbreak in Merseyside. Results showed that concerns over the specific links with autism remain an important cause of refusal to vaccinate, with over half of respondents stating this as a reason. A quarter stated child illness during scheduled vaccination time, while other reasons included general safety concerns and access issues. Over half of respondents felt that more information or a discussion with a health professional would help the decision-making process, while a third stated improved access. There was clear support for vaccination among respondents when asked about current opinions regarding MMR vaccine. The findings support the hypothesis that safety concerns remain a major barrier to MMR vaccination, and also support previous evidence that experience of measles is an important determinant in the decision to vaccinate.

  5. Cross-calibration of the Siemens mMR: easily acquired accurate PET phantom measurements, long-term stability and reproducibility.

    Science.gov (United States)

    Keller, Sune H; Jakoby, Björn; Svalling, Susanne; Kjaer, Andreas; Højgaard, Liselotte; Klausen, Thomas L

    2016-12-01

    We present a quick and easy method to perform quantitatively accurate PET scans of typical water-filled PET plastic shell phantoms on the Siemens Biograph mMR PET/MR system. We perform regular cross-calibrations (Xcal) of our PET systems, including the PET/MR, using a Siemens mCT water phantom. The mMR calibration stability was evaluated over a 3-year period where 54 cross-calibrations were acquired, showing that the mMR on average underestimated the concentration by 16 %, consistently due to the use of MR-based μ-maps. The mMR produced the narrowest calibration ratio range with the lowest standard deviation, implying it is the most stable of the six systems in the study over a 3-year period. MMR ACCURACY WITH PREDEFINED μ-MAPS: With the latest mMR software version, VB20P, it is possible to utilize predefined phantom μ-maps. We evaluated both the system-integrated, predefined μ-map of the long mMR water phantom and our own user-defined CT-based μ-map of the mCT water phantom, which is used for cross-calibration. For seven scans, which were reconstructed with correctly segmented μ-maps, the mMR produced cross-calibration ratios of 1.00-1.02, well within the acceptance range [0.95-1.05], showing high accuracy. The mMR is the most stable PET system in this study, and the mean underestimation is no longer an issue with the easily accessible μ-map, which resulted in correct cross-calibration ratios in all seven tests. We will share the user-defined μ-map of the mCT phantom and the protocol with interested mMR users.

  6. SNP g.1007A>G within the porcine DNAL4 gene affects sperm motility traits and percentage of midpiece abnormalities.

    Science.gov (United States)

    Wiedemann, I; Maehlmeyer, A; Jansen, S; Sharifi, A R; Knorr, C

    2018-04-01

    The flagellar beating of a spermatozoa's axoneme is caused by the varying activation and inactivation of dynein molecules. Dynein, axonemal, light chain 4 (DNAL4) is a functional candidate gene for sperm motility as it encodes a small subunit of the dyneins. We resequenced the porcine DNAL4 using three artificial insemination (AI) boars each with high (>68%) or low (r = -.43), motility of undiluted semen (MOTUD) (r = -.09), motility after 24 h (MOT1) (r = -.17) and after 48 hr (MOT2) (r = -.23) were estimated. Significantly positive correlations existed between CONC and MOT1 (r = .07) as well as MOT2 (r = .10), between MOTUD and MOT1 (r = .33), between MOTUD and MOT2 (r = .36), and finally between MOT1 and MOT2 (r = .70). Significantly negatively correlated were all motility traits with the parameters abnormal acrosome (AA) (MOTUD r = -.06; MOT1 r = -.08, and MOT2 r = -.1) and presence of cytoplasmic droplet (CD) (MOTUD r = -.07; MOT1 r = -.08; MOT2 r = -.07). Association analyses (single marker regression model; SMR) propose that SNP g.1007A>G, located in the second intron, reduces motility significantly (MOTUD -4.59%; MOT1 -10.33%; MOT2 -19.37%). According to the dominant-recessive model (DRM), genotype AA is always superior compared to genotypes AG and GG (i.e. MOTUD 67.67%, 64.16% and 53.91%; MOT1 54.17%, 43.75% and 28.44%; MOT2 44.12%, 24.91% and 4.97%). The average effect of gene substitution (g.1007A>G) on abnormal midpiece (AM) was 0.71%, the genotypic values-as expressed by LSmeans-were 0.1 (AA) and 0.81 (AG). © 2017 Blackwell Verlag GmbH.

  7. Somatic mutations in mismatch repair genes in sporadic gastric carcinomas are not a cause but a consequence of the mutator phenotype

    NARCIS (Netherlands)

    Pinto, Mafalda; Wub, Ying; Mensink, Rob G. J.; Cirnes, Luis; Seruca, Raquel; Hofstra, Robert M. W.

    2008-01-01

    In hereditary nonpolyposis colorectal cancer (HNPCC), patients' mismatch repair (MMR) gene mutations cause MMR deficiency, leading to microsatellite instability (MSI-H). MSI-H is also found in a substantial fraction of sporadic gastric carcinomas (SGC), mainly due to MLH1 promoter hypermethylation,

  8. Osteo-chondroprogenitor-specific deletion of the selenocysteine tRNA gene, Trsp, leads to chondronecrosis and abnormal skeletal development: a putative model for Kashin-Beck disease.

    Directory of Open Access Journals (Sweden)

    Charlene M Downey

    2009-08-01

    Full Text Available Kashin-Beck disease, a syndrome characterized by short stature, skeletal deformities, and arthropathy of multiple joints, is highly prevalent in specific regions of Asia. The disease has been postulated to result from a combination of different environmental factors, including contamination of barley by mold mycotoxins, iodine deficiency, presence of humic substances in drinking water, and, importantly, deficiency of selenium. This multifunctional trace element, in the form of selenocysteine, is essential for normal selenoprotein function, including attenuation of excessive oxidative stress, and for the control of redox-sensitive molecules involved in cell growth and differentiation. To investigate the effects of skeletal selenoprotein deficiency, a Cre recombinase transgenic mouse line was used to trigger Trsp gene deletions in osteo-chondroprogenitors. Trsp encodes selenocysteine tRNA([Ser]Sec, required for the incorporation of selenocysteine residues into selenoproteins. The mutant mice exhibited growth retardation, epiphyseal growth plate abnormalities, and delayed skeletal ossification, as well as marked chondronecrosis of articular, auricular, and tracheal cartilages. Phenotypically, the mice thus replicated a number of the pathological features of Kashin-Beck disease, supporting the notion that selenium deficiency is important to the development of this syndrome.

  9. Gene expression of the mismatch repair gene MSH2 in primary colorectal cancer

    DEFF Research Database (Denmark)

    Jensen, Lars Henrik; Kuramochi, Hidekazu; Crüger, Dorthe Gylling

    2011-01-01

    Microsatellite instability (MSI) is caused by defective mismatch repair (MMR) and is one of the very few molecular markers with proven clinical importance in colorectal cancer with respect to heredity, prognosis, and treatment effect. The gene expression of the MMR gene MSH2 may be a quantitative...... marker for the level of MMR and a potential molecular marker with clinical relevance. The aim was to investigate the gene expression of MSH2 in primary operable colorectal cancer in correlation with MSI, protein expression, and promoter hypermethylation. In a cohort of 210 patients, the primary tumor...... and lymphnode metastases were analyzed with immunohistochemistry, methylation and MSI analyses, and quantitative polymerase chain reaction (PCR). The median gene expression of MSH2 was 1.00 (range 0.16-11.2, quartiles 0.70-1.51) and there was good agreement between the gene expression in primary tumor and lymph...

  10. Prognostic values of DNA mismatch repair genes in ovarian cancer patients treated with platinum-based chemotherapy.

    Science.gov (United States)

    Zhao, Chuchu; Li, Saisai; Zhao, Menghuang; Zhu, Haiyan; Zhu, Xueqiong

    2018-01-01

    DNA mismatch repair (MMR) is a highly conserved biological pathway that plays a key role in maintaining genomic stability. MMR has been reported as a prognostic marker in certain cancers; however, the results are controversial. Therefore, identification of the prognostic value of MMR genes in ovarian cancer based on a large sample size is pivotal. In the current study, we systemically investigated the prognostic roles of seven MMR genes, MSH2, MSH3, MSH6, MLH1, MLH3, PMS1 and PMS2, in ovarian cancer patients treated with platinum-based chemotherapy through "The Kaplan-Meier plotter" (KM plotter) database, which contains gene expression data and survival information of ovarian cancer patients. Among seven MMR genes, high mRNA levels of MSH6, MLH1 and PMS2 were significantly associated with a better overall survival for all ovarian cancer patients treated with platinum-based chemotherapy, especially in late-stage and poor-differentiated ovarian cancer patients. Increased MSH6 and PMS2 mRNA expression was correlated with a favorable overall survival in serous ovarian cancer patients. Our results indicate that sufficient MMR system is associated with an improved survival in ovarian cancer treated with platinum-based chemotherapy. MMR gene may be a potential prognosis predictor in ovarian cancer.

  11. Hereditary Ovarian Cancer: Not Only BRCA 1 and 2 Genes

    Directory of Open Access Journals (Sweden)

    Angela Toss

    2015-01-01

    Full Text Available More than one-fifth of ovarian tumors have hereditary susceptibility and, in about 65–85% of these cases, the genetic abnormality is a germline mutation in BRCA genes. Nevertheless, several other suppressor genes and oncogenes have been associated with hereditary ovarian cancers, including the mismatch repair (MMR genes in Lynch syndrome, the tumor suppressor gene, TP53, in the Li-Fraumeni syndrome, and several other genes involved in the double-strand breaks repair system, such as CHEK2, RAD51, BRIP1, and PALB2. The study of genetic discriminators and deregulated pathways involved in hereditary ovarian syndromes is relevant for the future development of molecular diagnostic strategies and targeted therapeutic approaches. The recent development and implementation of next-generation sequencing technologies have provided the opportunity to simultaneously analyze multiple cancer susceptibility genes, reduce the delay and costs, and optimize the molecular diagnosis of hereditary tumors. Particularly, the identification of mutations in ovarian cancer susceptibility genes in healthy women may result in a more personalized cancer risk management with tailored clinical and radiological surveillance, chemopreventive approaches, and/or prophylactic surgeries. On the other hand, for ovarian cancer patients, the identification of mutations may provide potential targets for biologic agents and guide treatment decision-making.

  12. Using electronic mail to improve MMR uptake amongst third level students.

    LENUS (Irish Health Repository)

    Cooney, F

    2010-03-01

    This study assessed the usefulness of email in informing third level students about special MMR clinics being provided on campus during a mumps outbreak in the North West of Ireland. Email messages were sent directly to students, informing them of the clinics, inviting them to make a clinic appointment by email and providing details of walk-in clinics. At the clinics, all 177 attendees were asked to fill out a questionnaire and the response rate was 89% (n=158). Regarding the main sources of information about the vaccination clinics, email was selected by 117 (74%) students, word-of-mouth by 27 (17%), posters\\/leaflets by 8 (5%), and other sources by 6 (4%). Use of email as a source of information was rated as very good\\/excellent by 115 (73%), as good by 35 (22%) and poor\\/fair by 8 (5%). This study demonstrates that email is a useful and acceptable way of informing third level students about immunisation clinics in an outbreak situation.

  13. Dilemmas of a vitalizing vaccine market: lessons from the MMR vaccine/autism debate.

    Science.gov (United States)

    Bragesjö, Fredrik; Hallberg, Margareta

    2011-03-01

    A number of issues related to vaccines and vaccinations in society are discussed in this paper. Our purpose is to merge an analysis of some recent changes in the vaccine market with social science research on the relationship between citizens and authorities. The article has two empirical parts. The first shows how the vaccine market, which for many years has had immense financial problems, nowadays seems to becoming economically vitalized, mostly due to the production of new and profitable vaccines. However prosperous the future may appear, certain reactions from the public regarding vaccination initiatives offer insight into inherent problems of vaccine policies in many Western countries. In the second part of the article, these problems are exemplified with the recent controversy over the MMR (measles, mumps, and rubella) vaccine. We conclude that in spite of the improving profit-margins, the vaccine market remains vulnerable and insecure. Vaccines are permeated by society, even more so than pharmaceutics that are used to cure or alleviate illnesses. Radical changes in financial conditions with promises of a more profitable market will not, we argue, solve other even more fundamental problems.

  14. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  15. Aseptic meningitis in a large MMR vaccine campaign (590,609 people) in Curitiba, Paraná, Brazil, 1998

    OpenAIRE

    ARRUDA, Walter Oleschko; KONDAGESKI, Charles

    2001-01-01

    The aseptic meningitis after Measles-Mumps-Rubella vaccine (MMR) is a well recognized complication, and different incidences have been observed in several studies. We retrospectively analyzed forty cases of aseptic meningitis, during a large public immunization campaign (1998) in Curitiba, Southern Brazil (590,609 people), admitted in our Service. The vaccine utilized was Leningrad-3-Zagreb mumps strain, Edmonston-Zagreb measles strain, and RA 27#3 rubella strain. In all county, a total numbe...

  16. 'That's just what's expected of you … so you do it': mothers discussions around choice and the MMR vaccination.

    Science.gov (United States)

    Johnson, Sally; Capdevila, Rose

    2014-01-01

    One of the major shifts in the form and experience of contemporary family life has been the increasing insertion of the 'expert' voice into the relationship between parents and children. This paper focuses on an exploration of mothers' engagement with advice around the combined measles, mumps and rubella (MMR) vaccine. Much of the previous literature utilises a 'decision-making' framework, based on 'risk assessment' whereby mothers' decisions are conceptualised as rooted in complex belief systems, and supposes that that by gaining an understanding of these systems, beliefs and behaviour can be modified and uptake improved. However, less attention has been paid to the ways in which mothers negotiate such advice or the ways in which advice is mediated by positionings, practices and relationships. Analysis of data from a focus group with five mothers identified three themes: (i) Sourcing advice and information, (ii) Constructing 'Mother knows best' and (iii) Negotiating agency. Despite the trustworthiness of advice and information being questioned, an awareness of concerns about the MMR, and health professionals being constructed as remote, ultimate conformity to, and compliance with, the 'system' and 'society' were described as determining MMR 'decisions'.

  17. Molecular characteristics of mismatch repair genes in sporadic colorectal tumors in Czech patients.

    Science.gov (United States)

    Vymetalkova, Veronika Polakova; Slyskova, Jana; Korenkova, Vlasta; Bielik, Ludovit; Langerova, Lucie; Prochazka, Pavel; Rejhova, Alexandra; Schwarzova, Lucie; Pardini, Barbara; Naccarati, Alessio; Vodicka, Pavel

    2014-01-31

    Mismatch repair (MMR) genes are known to be frequently altered in colorectal cancer (CRC). Both genetics and epigenetics modifications seems to be relevant in this phenomenon, however it is still not clear how these two aspects are interconnected. The present study aimed at characterizing of epigenetic and gene expression profiles of MMR genes in sporadic CRC patients from the Czech Republic, a country with one of the highest incidences of this cancer all over Europe. Expression levels and CpG promoter methylation status of all MMR genes were evaluated in DNA from tumor and adjacent mucosal samples of 53 incident CRC patients. We have found significantly increased transcription levels in EXO1 gene in tumor tissues (P = 0.05) and significant over-expression of MSH3 gene in colon tumors when compared to adjacent mucosal tissues (P = 0.02). Interestingly, almost all MMR genes were differently expressed when localization of tumors was compared. In particular, colon tumors showed an up-regulation of EXO1, MSH2, MSH3, MSH6, and PMS2 genes in comparison to rectal tumors (P = 0.02). Expression levels of all MMR genes positively correlated between each other. The promoter methylation of MLH1 gene was observed in 9% of CRC tissues only. In our study, we have observed different pattern of MMR genes expression according to tumor localization. However, a lack of association between methylation in MMR genes and their corresponding expressions was noticed in this study, the relationship between these two aspects is worthy to be analyzed in larger population studies and in pre-malignant stages.

  18. Antibody persistence in children aged 6-7years one year following booster immunization with two MMR vaccines applied by aerosol or by injection.

    Science.gov (United States)

    Díaz Ortega, José Luis; Castaneda, Deyanira; Arellano Quintanilla, Doris Ma; Martínez, David; Trumbo, Silas P; Fernández de Castro, Jorge

    2017-05-25

    In a previous study on booster vaccination, we reported that two aerosolized MMR vaccines were as safe and immunogenic as injectable vaccines containing the same antigens. We now present results of antibody persistence one year after immunization. To assess the antibody persistence for measles, mumps, and rubella one year following booster immunization. We performed clinical and serological follow-up of participants in a previous study of Mexican children aged 6-7years, in which participants were randomized to four groups receiving, by aerosolized or by injection, the MMR SII vaccine (Serum Institute of India), or the MMR II (Merck Sharp & Dhome). We evaluated the antibody persistence by PRN test for measles and by ELISA for rubella and mumps. The occurrence of clinical events was evaluated via periodic visits of a nurse team to children's schools and homes. Of the 260 initial participants, 241 completed one-year follow-up. There were only statistically significant differences in baseline seropositivity for mumps. One year after immunization, seropositivity in all groups was 100% for measles and rubella. The seropositivity rank for mumps was from 90.3% for the injected vaccine MMR II to 96.6% for vaccine MMR SII applied by aerosol; these differences were not statistically significant. With exception of the aerosolized vaccine MMR SII for the geometric mean titer (GMT) for measles, all study groups presented declination of GMT for the three viruses. The difference between the aerosolized vaccines MMR SII and MMR RII was statistically significant for mumps antibodies. Only mild clinical events were identified. Under conditions of no endemic transmission for measles and rubella, and of low circulation of mumps virus, school-aged children remained seropositive to the three viruses one year following booster immunization. The study was registered under CMN 2010-005 number at COFEPRIS (National Regulatory Authority). Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Missed Opportunities for Measles, Mumps, and Rubella (MMR) Immunization in Mesoamerica: Potential Impact on Coverage and Days at Risk.

    Science.gov (United States)

    Mokdad, Ali H; Gagnier, Marielle C; Colson, K Ellicott; Dansereau, Emily; Zúñiga-Brenes, Paola; Ríos-Zertuche, Diego; Haakenstad, Annie; Johanns, Casey K; Palmisano, Erin B; Hernandez, Bernardo; Iriarte, Emma

    2015-01-01

    Recent outbreaks of measles in the Americas have received news and popular attention, noting the importance of vaccination to population health. To estimate the potential increase in immunization coverage and reduction in days at risk if every opportunity to vaccinate a child was used, we analyzed vaccination histories of children 11-59 months of age from large household surveys in Mesoamerica. Our study included 22,234 children aged less than 59 months in El Salvador, Guatemala, Honduras, Mexico, Nicaragua, and Panama. Child vaccination cards were used to calculate coverage of measles, mumps, and rubella (MMR) and to compute the number of days lived at risk. A child had a missed opportunity for vaccination if their card indicated a visit for vaccinations at which the child was not caught up to schedule for MMR. A Cox proportional hazards model was used to compute the hazard ratio associated with the reduction in days at risk, accounting for missed opportunities. El Salvador had the highest proportion of children with a vaccine card (91.2%) while Nicaragua had the lowest (76.5%). Card MMR coverage ranged from 44.6% in Mexico to 79.6% in Honduras while potential coverage accounting for missed opportunities ranged from 70.8% in Nicaragua to 96.4% in El Salvador. Younger children were less likely to have a missed opportunity. In Panama, children from households with higher expenditure were more likely to have a missed opportunity for MMR vaccination compared to the poorest (OR 1.62, 95% CI: 1.06-2.47). In Nicaragua, compared to children of mothers with no education, children of mothers with primary education and secondary education were less likely to have a missed opportunity (OR 0.46, 95% CI: 0.24-0.88 and OR 0.25, 95% CI: 0.096-0.65, respectively). Mean days at risk for MMR ranged from 158 in Panama to 483 in Mexico while potential days at risk ranged from 92 in Panama to 239 in El Salvador. Our study found high levels of missed opportunities for immunizing

  20. Missed Opportunities for Measles, Mumps, and Rubella (MMR Immunization in Mesoamerica: Potential Impact on Coverage and Days at Risk.

    Directory of Open Access Journals (Sweden)

    Ali H Mokdad

    Full Text Available Recent outbreaks of measles in the Americas have received news and popular attention, noting the importance of vaccination to population health. To estimate the potential increase in immunization coverage and reduction in days at risk if every opportunity to vaccinate a child was used, we analyzed vaccination histories of children 11-59 months of age from large household surveys in Mesoamerica.Our study included 22,234 children aged less than 59 months in El Salvador, Guatemala, Honduras, Mexico, Nicaragua, and Panama. Child vaccination cards were used to calculate coverage of measles, mumps, and rubella (MMR and to compute the number of days lived at risk. A child had a missed opportunity for vaccination if their card indicated a visit for vaccinations at which the child was not caught up to schedule for MMR. A Cox proportional hazards model was used to compute the hazard ratio associated with the reduction in days at risk, accounting for missed opportunities.El Salvador had the highest proportion of children with a vaccine card (91.2% while Nicaragua had the lowest (76.5%. Card MMR coverage ranged from 44.6% in Mexico to 79.6% in Honduras while potential coverage accounting for missed opportunities ranged from 70.8% in Nicaragua to 96.4% in El Salvador. Younger children were less likely to have a missed opportunity. In Panama, children from households with higher expenditure were more likely to have a missed opportunity for MMR vaccination compared to the poorest (OR 1.62, 95% CI: 1.06-2.47. In Nicaragua, compared to children of mothers with no education, children of mothers with primary education and secondary education were less likely to have a missed opportunity (OR 0.46, 95% CI: 0.24-0.88 and OR 0.25, 95% CI: 0.096-0.65, respectively. Mean days at risk for MMR ranged from 158 in Panama to 483 in Mexico while potential days at risk ranged from 92 in Panama to 239 in El Salvador.Our study found high levels of missed opportunities for

  1. Persistence of rubella and mumps antibodies, following changes in the recommended age for the second dose of MMR vaccine in Portugal.

    Science.gov (United States)

    Gonçalves, G; Frade, J; Nascimento, M S J; Mesquita, J R; Nunes, C

    2016-11-01

    In Portugal, the recommended age for the second dose of MMR (MMR2) was changed from 10-13 years to 5-6 years for those born in 1994 and afterwards. This study aimed to assess if MMR schedule and time elapsed from the last dose are associated with the concentration of rubella and mumps IgG antibodies. Three Portuguese birth cohorts (convenience samples) were selected for this study (66, 59 and 41 participants born respectively in 1990-1993, 1994-1995 and 2001-2003). Geometric mean concentrations (GMC) for mumps IgG were respectively 36, 30 and 38 RU/ml (P = 0·236) and for rubella IgG were 18, 20 and 17 IU/ml (P = 0·641). For both specific antibodies, no differences were observed with time since MMR2. Receiving MMR2 at 5-6 or 10-13 years was not associated with concentration of both antibodies. The GMC of rubella IgG was lower in males (P = 0·029). Taking into account previous evidence and the logistics needed to change vaccination schedules, it seems reasonable that sustaining very high coverage with two doses of MMR is currently the most pragmatic way to control mumps and rubella rather than any changes to the schedule.

  2. DNA mismatch repair preferentially protects genes from mutation.

    Science.gov (United States)

    Belfield, Eric J; Ding, Zhong Jie; Jamieson, Fiona J C; Visscher, Anne M; Zheng, Shao Jian; Mithani, Aziz; Harberd, Nicholas P

    2018-01-01

    Mutation is the source of genetic variation and fuels biological evolution. Many mutations first arise as DNA replication errors. These errors subsequently evade correction by cellular DNA repair, for example, by the well-known DNA mismatch repair (MMR) mechanism. Here, we determine the genome-wide effects of MMR on mutation. We first identify almost 9000 mutations accumulated over five generations in eight MMR-deficient mutation accumulation (MA) lines of the model plant species, Arabidopsis thaliana We then show that MMR deficiency greatly increases the frequency of both smaller-scale insertions and deletions (indels) and of single-nucleotide variant (SNV) mutations. Most indels involve A or T nucleotides and occur preferentially in homopolymeric (poly A or poly T) genomic stretches. In addition, we find that the likelihood of occurrence of indels in homopolymeric stretches is strongly related to stretch length, and that this relationship causes ultrahigh localized mutation rates in specific homopolymeric stretch regions. For SNVs, we show that MMR deficiency both increases their frequency and changes their molecular mutational spectrum, causing further enhancement of the GC to AT bias characteristic of organisms with normal MMR function. Our final genome-wide analyses show that MMR deficiency disproportionately increases the numbers of SNVs in genes, rather than in nongenic regions of the genome. This latter observation indicates that MMR preferentially protects genes from mutation and has important consequences for understanding the evolution of genomes during both natural selection and human tumor growth. © 2018 Belfield et al.; Published by Cold Spring Harbor Laboratory Press.

  3. Abnormal Head Position

    Science.gov (United States)

    ... Frequently Asked Questions Español Condiciones Chinese Conditions Abnormal Head Position En Español Read in Chinese What is an abnormal head posture? An abnormal or compensatory head posture occurs ...

  4. Systematic immunohistochemical screening for mismatch repair and ERCC1 gene expression from colorectal cancers in China: Clinicopathological characteristics and effects on survival.

    Directory of Open Access Journals (Sweden)

    Pan Li

    Full Text Available We performed a systematic screening of colorectal cancer (CRC tissues to investigate whether mismatch repair (MMR status and ERCC1 protein expression could be predictive of clinical outcomes for these patients following the recommendation of The Evaluation of Genomic Applications in Practice of Prevention (EGAPP.The expression of four MMR genes and ERCC1 were assessed by immunohistochemistry (IHC from cancer tissue samples of 2233 consecutive CRC patients.We observed that most CRC patients with a proficient MMR (pMMR status tended to have simultaneous ERCC1 protein expression (P< 0.001. Stage III CRC patients with deficient MMR (dMMR had higher prognoses than the same stage patients with pMMR (DFS: 74% vs 65%, P = 0.04; OS: 79% vs 69%, P = 0.04. Here, dMMR is also associated with poorer survival for stage II patients after chemotherapy (DFS: 66% vs 78%, P = 0.04. Stage II and III patients that were shown to express ERCC1 protein had higher DFS and OS than those that were deficient in expression (stage II, DFS: 83% vs 70%, P = 0.006; OS 85% vs 73%, P = 0.02. Stage III, DFS: 67% vs56%, P = 0.03; OS: 71% vs 57%, P = 0.04.Our results indicate that dMMR appeared to predictive of a survival benefit for stage III CRC patients. We also found the determination of ERCC1 expression to be useful for predicting DFS or OS for stage II and III CRC patients. In addition, the expression of MMR genes and ERCC1 showed a significant relationship.

  5. Radiometric calibration of the reflective bands of NS001-Thematic Mapper Simulator (TMS) and modular multispectral radiometers (MMR)

    Science.gov (United States)

    Markham, Brian L.; Wood, Frank M., Jr.; Ahmad, Suraiya P.

    1988-01-01

    The NS001 Thematic Mapper Simulator scanner (TMS) and several modular multispectral radiometers (MMRs) are among the primary instruments used in the First ISLSCP (International Satellite Land Surface Climatology Project) Field Experiment (FIFE). The NS001 has a continuously variable gain setting. Calibration of the NS001 data is influenced by drift in the dark current level of up to six counts during a mirror scan at typical gain settings. The MMR instruments are being used in their 1 deg FOV configuration on the helicopter and 15 deg FOV on the ground.

  6. Temozolomide Resistance in Glioblastoma Cell Lines: Implication of MGMT, MMR, P-Glycoprotein and CD133 Expression

    Science.gov (United States)

    Prados, Jose; Caba, Octavio; Cabeza, Laura; Berdasco, Maria; Gónzalez, Beatriz; Melguizo, Consolación

    2015-01-01

    Background The use of temozolomide (TMZ) has improved the prognosis for glioblastoma multiforme patients. However, TMZ resistance may be one of the main reasons why treatment fails. Although this resistance has frequently been linked to the expression of O6-methylguanine-DNA methyltransferase (MGMT) it seems that this enzyme is not the only molecular mechanism that may account for the appearance of drug resistance in glioblastoma multiforme patients as the mismatch repair (MMR) complex, P-glycoprotein, and/or the presence of cancer stem cells may also be implicated. Methods Four nervous system tumor cell lines were used to analyze the modulation of MGMT expression and MGMT promoter methylation by TMZ treatment. Furthermore, 5-aza-2’-deoxycytidine was used to demethylate the MGMT promoter and O(6)-benzylguanine to block GMT activity. In addition, MMR complex and P-glycoprotein expression were studied before and after TMZ exposure and correlated with MGMT expression. Finally, the effect of TMZ exposure on CD133 expression was analyzed. Results Our results showed two clearly differentiated groups of tumor cells characterized by low (A172 and LN229) and high (SF268 and SK-N-SH) basal MGMT expression. Interestingly, cell lines with no MGMT expression and low TMZ IC50 showed a high MMR complex expression, whereas cell lines with high MGMT expression and high TMZ IC50 did not express the MMR complex. In addition, modulation of MGMT expression in A172 and LN229 cell lines was accompanied by a significant increase in the TMZ IC50, whereas no differences were observed in SF268 and SK-N-SH cell lines. In contrast, P-glycoprotein and CD133 was found to be unrelated to TMZ resistance in these cell lines. Conclusions These results may be relevant in understanding the phenomenon of TMZ resistance, especially in glioblastoma multiforme patients laking MGMT expression, and may also aid in the design of new therapeutic strategies to improve the efficacy of TMZ in glioblastoma

  7. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

    Science.gov (United States)

    Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

    2015-01-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95 % CI 0.63–5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

  8. Liver-specific rescuing of CEACAM1 reverses endothelial and cardiovascular abnormalities in male mice with null deletion of Ceacam1 gene

    Directory of Open Access Journals (Sweden)

    Lucia Russo

    2018-03-01

    Full Text Available Objective: Mice with global null mutation of Ceacam1 (Cc1−/−, display impairment of insulin clearance that causes hyperinsulinemia followed by insulin resistance, elevated hepatic de novo lipogenesis, and visceral obesity. In addition, they manifest abnormal vascular permeability and elevated blood pressure. Liver-specific rescuing of Ceacam1 reversed all of the metabolic abnormalities in Cc1−/−liver+ mice. The current study examined whether Cc1−/− male mice develop endothelial and cardiac dysfunction and whether this relates to the metabolic abnormalities caused by defective insulin extraction. Methods and results: Myography studies showed reduction of agonist-stimulated nitric oxide production in resistance arterioles in Cc1−/−, but not Cc1−/−liver+ mice. Liver-based rescuing of CEACAM1 also attenuated the abnormal endothelial adhesiveness to circulating leukocytes in parallel to reducing plasma endothelin-1 and recovering plasma nitric oxide levels. Echocardiography studies revealed increased septal wall thickness, cardiac hypertrophy and reduced cardiac performance in Cc1−/−, but not Cc1−/−xliver+ mice. Insulin signaling experiments indicated compromised IRS1/Akt/eNOS pathway leading to lower nitric oxide level, and activated Shc/MAPK pathway leading to more endothelin-1 production in the aortae and hearts of Cc1−/−, but not Cc1−/−xliver+ mice. The increase in the ratio of endothelin-1 receptor A/B indicated an imbalance in the vasomotor activity of Cc1−/− mice, which was normalized in Cc1−/−xliver+ mice. Conclusions: The data underscore a critical role for impaired CEACAM1-dependent hepatic insulin clearance pathways and resulting hyperinsulinemia and lipid accumulation in aortae and heart in regulating the cardiovascular function. Keywords: Insulin clearance, Hyperinsulinemia, Insulin resistance, Endothelial function, Cardiomyopathy

  9. Abnormal Expressions of DNA Glycosylase Genes NEIL1, NEIL2, and NEIL3 Are Associated with Somatic Mutation Loads in Human Cancer.

    Science.gov (United States)

    Shinmura, Kazuya; Kato, Hisami; Kawanishi, Yuichi; Igarashi, Hisaki; Goto, Masanori; Tao, Hong; Inoue, Yusuke; Nakamura, Satoki; Misawa, Kiyoshi; Mineta, Hiroyuki; Sugimura, Haruhiko

    2016-01-01

    The effects of abnormalities in the DNA glycosylases NEIL1, NEIL2, and NEIL3 on human cancer have not been fully elucidated. In this paper, we found that the median somatic total mutation loads and the median somatic single nucleotide mutation loads exhibited significant inverse correlations with the median NEIL1 and NEIL2 expression levels and a significant positive correlation with the median NEIL3 expression level using data for 13 cancer types from the Cancer Genome Atlas (TCGA) database. A subset of the cancer types exhibited reduced NEIL1 and NEIL2 expressions and elevated NEIL3 expression, and such abnormal expressions of NEIL1, NEIL2, and NEIL3 were also significantly associated with the mutation loads in cancer. As a mechanism underlying the reduced expression of NEIL1 in cancer, the epigenetic silencing of NEIL1 through promoter hypermethylation was found. Finally, we investigated the reason why an elevated NEIL3 expression level was associated with an increased number of somatic mutations in cancer and found that NEIL3 expression was positively correlated with the expression of APOBEC3B, a potent inducer of mutations, in diverse cancers. These results suggested that the abnormal expressions of NEIL1, NEIL2, and NEIL3 are involved in cancer through their association with the somatic mutation load.

  10. The mate recognition protein gene mediates reproductive isolation and speciation in the Brachionus plicatilis cryptic species complex

    Directory of Open Access Journals (Sweden)

    Gribble Kristin E

    2012-08-01

    Full Text Available Abstract Background Chemically mediated prezygotic barriers to reproduction likely play an important role in speciation. In facultatively sexual monogonont rotifers from the Brachionus plicatilis cryptic species complex, mate recognition of females by males is mediated by the Mate Recognition Protein (MRP, a globular glycoprotein on the surface of females, encoded by the mmr-b gene family. In this study, we sequenced mmr-b copies from 27 isolates representing 11 phylotypes of the B. plicatilis species complex, examined the mode of evolution and selection of mmr-b, and determined the relationship between mmr-b genetic distance and mate recognition among isolates. Results Isolates of the B. plicatilis species complex have 1–4 copies of mmr-b, each composed of 2–9 nearly identical tandem repeats. The repeats within a gene copy are generally more similar than are gene copies among phylotypes, suggesting concerted evolution. Compared to housekeeping genes from the same isolates, mmr-b has accumulated only half as many synonymous differences but twice as many non-synonymous differences. Most of the amino acid differences between repeats appear to occur on the outer face of the protein, and these often result in changes in predicted patterns of phosphorylation. However, we found no evidence of positive selection driving these differences. Isolates with the most divergent copies were unable to mate with other isolates and rarely self-crossed. Overall the degree of mate recognition was significantly correlated with the genetic distance of mmr-b. Conclusions Discrimination of compatible mates in the B. plicatilis species complex is determined by proteins encoded by closely related copies of a single gene, mmr-b. While concerted evolution of the tandem repeats in mmr-b may function to maintain identity, it can also lead to the rapid spread of a mutation through all copies in the genome and thus to reproductive isolation. The mmr-b gene is evolving

  11. Association between expression of DNA mismatch repair genes and clinical features and prognosis of patients with radical resection of colon cancer.

    Science.gov (United States)

    Wang, J B; Ma, D L; Li, J Y; Sun, Q D; Liu, Y E

    2016-08-19

    The aim of this study was to investigate the clinical significance of the expression of DNA mismatch repair (MMR) genes in patients subjected to radical surgical removal of colon cancer, as well as their correlation with disease prognosis. Ninety stage II and III colon cancer patients who received laparoscopic radical resection of colon cancer at our hospital were recruited in this study. The expression of hMLH1, hMSH2, hMSH6, and hPMS2 in the resected tumor tissues was examined by SP immunohistochemistry, in order to analyze the relationship between defective DNA MMR (dMMR) and the clinico-pathological features and prognosis of colon cancer. Patients were followed up over a period of 5-35 months, and the Kaplan-Meier survival curve was plotted. dMMR was confirmed in 27 subjects (30.0%), among whom recurrence with metastasis and death was reported in 5 (18.5%) and 2 (7.4%) patients, respectively. The remaining 63 subjects displayed proficient DNA MMR (pMMR); among these, 19 (30.2%) and 7 (11.1%) recurrences with metastasis and death were reported, respectively. dMMR showed no significant correlation with gender, age, or therapeutic modality (P > 0.05), but was significantly correlated with the degree of differentiation, tumor location, number of resected lymph nodes, presence of ileus, and TNM stage (P < 0.05). The prognosis of patients with dMMR was better than that of patients with pMMR. dMMR serves as a biomarker for the prognosis of stage II/III colon cancers.

  12. The MMR vaccination and autism controversy in United Kingdom 1998-2005: inevitable community outrage or a failure of risk communication?

    Science.gov (United States)

    Burgess, David C; Burgess, Margaret A; Leask, Julie

    2006-05-01

    The report of an hypothesised link between measles-mumps-rubella (MMR) vaccination and autism in 1998 became a major public health issue in the United Kingdom (UK), leaving most experts surprised by the overwhelming influence it had on public opinion about MMR vaccination. Coverage rates fell dramatically, and did not start to recover until 2004. Could this public reaction have been predicted? We used Sandman's model of components predicting community outrage to assess the MMR controversy. The controversy fulfilled all of Sandman's 12 primary components and six of the eight additional components. The Sandman model provided a useful framework to analyse this controversy and explained a significant portion of the community reaction and subsequent fall in vaccination coverage rates.

  13. County-level assessment of United States kindergarten vaccination rates for measles mumps rubella (MMR) for the 2014-2015 school year.

    Science.gov (United States)

    Kluberg, Sheryl A; McGinnis, Denise P; Hswen, Yulin; Majumder, Maimuna S; Santillana, Mauricio; Brownstein, John S

    2017-11-07

    United States kindergarten measles-mumps-rubella (MMR) vaccination rates are typically reported at the state level by the Centers for Disease Control and Prevention (CDC). The lack of local MMR data prevents identification of areas with low vaccination rates that would be vulnerable to the spread of disease. We collected county-level vaccination rates for the 2014-2015 school year with the objective of identifying these regions. We requested county-level kindergarten vaccination data from state health departments, and mapped these data to visualize geographic patterns in achievement of the 95% MMR vaccination target. We aggregated the county-level data to the state level for comparison against CDC state estimates. We also analyzed the relationship of MMR vaccination level with county-level and state-level poverty (using U.S. census data), using both a national mixed model with state as a random effect, and individual linear regression models by state. We received county vaccination data from 43 states. The median kindergarten MMR vaccination rate was 96.0% (IQR 89-98) across all counties, however, we estimated that 48.4% of the represented counties had vaccination rates below 95%. Our state estimates closely reflected CDC values. Nationally, every 10% increase in under-18 county poverty was associated with a 0.24% increase in MMR vaccination rates (95% CI: -0.07%; 0.54%), but the direction of this relationship varied by state. We found that county data can reveal vaccination trends that are unobservable from state-level data, but we also discovered that the current availability of county-level data is inadequate. Our findings can be used by state health departments to identify target areas for vaccination programs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Expression of the mismatch repair gene hMLH1 is enhanced in non-small cell lung cancer with EGFR mutations.

    Directory of Open Access Journals (Sweden)

    Mei Li

    Full Text Available Mismatch repair (MMR plays a pivotal role in keeping the genome stable. MMR dysfunction can lead to carcinogenesis by gene mutation accumulation. HMSH2 and hMLH1 are two key components of MMR. High or low expression of them often mark the status of MMR function. Mutations (EGFR, KRAS, etc are common in non-small cell lung cancer (NSCLC. However, it is not clear what role MMR plays in NSCLC gene mutations. The expression of MMR proteins hMSH2 and hMLH1, and the proliferation markers PCNA and Ki67 were measured by immunohistochemistry in 181 NSCLCs. EGFR and KRAS mutations were identified by high resolution melting analysis. Stronger hMLH1 expression correlated to a higher frequency of EGFR mutations in exon 19 and 21 (p<0.0005. Overexpression of hMLH1 and the adenocarcinoma subtype were both independent factors that related to EGFR mutations in NSCLCs (p=0.013 and p<0.0005. The expression of hMLH1, hMSH2 and PCNA increased, while Ki67 expression significantly decreased (p=0.030 in NSCLCs with EGFR mutations. Overexpression of hMLH1 could be a new molecular marker to predict the response to EGFR-TKIs in NSCLCs. Furthermore, EGFR mutations might be an early event of NSCLC that occur before MMR dysfunction.

  15. Tooth - abnormal colors

    Science.gov (United States)

    ... medlineplus.gov/ency/article/003065.htm Tooth - abnormal colors To use the sharing features on this page, please enable JavaScript. Abnormal tooth color is any color other than white to yellowish- ...

  16. Urine - abnormal color

    Science.gov (United States)

    ... medlineplus.gov/ency/article/003139.htm Urine - abnormal color To use the sharing features on this page, please enable JavaScript. The usual color of urine is straw-yellow. Abnormally colored urine ...

  17. Abnormal uterine bleeding

    Science.gov (United States)

    Anovulatory bleeding; Abnormal uterine bleeding - hormonal; Polymenorrhea - dysfunctional uterine bleeding ... ACOG committee opinion no. 557: Management of acute abnormal uterine bleeding in nonpregnant reproductive-aged women. Reaffirmed 2015. ACOG. ...

  18. Double somatic mutations in mismatch repair genes are frequent in colorectal cancer after Hodgkin's lymphoma treatment.

    Science.gov (United States)

    Rigter, Lisanne S; Snaebjornsson, Petur; Rosenberg, Efraim H; Atmodimedjo, Peggy N; Aleman, Berthe M; Ten Hoeve, Jelle; Geurts-Giele, Willemina R; van Ravesteyn, Thomas W; Hoeksel, Johan; Meijer, Gerrit A; Te Riele, Hein; van Leeuwen, Flora E; Dinjens, Winand N; van Leerdam, Monique E

    2018-03-01

    Hodgkin's lymphoma survivors who were treated with infradiaphragmatic radiotherapy or procarbazine-containing chemotherapy have a fivefold increased risk of developing colorectal cancer (CRC). This study aims to provide insight into the development of therapy-related CRC (t-CRC) by evaluating histopathological and molecular characteristics. 54 t-CRCs diagnosed in a Hodgkin's lymphoma survivor cohort were analysed for mismatch repair (MMR) proteins by immunohistochemistry, microsatellite instability (MSI) and KRAS / BRAF mutations. MSI t-CRCs were evaluated for promoter methylation and mutations in MMR genes. Pathogenicity of MMR gene mutations was evaluated by in silico predictions and functional analyses. Frequencies were compared with a general population cohort of CRC (n=1111). KRAS and BRAF mutations were present in 41% and 15% t-CRCs, respectively. Compared with CRCs in the general population, t-CRCs had a higher MSI frequency (24% vs 11%, p=0.003) and more frequent loss of MSH2/MSH6 staining (13% vs 1%, p<0.001). Loss of MLH1/PMS2 staining and MLH1 promoter methylation were equally common in t-CRCs and the general population. In MSI CRCs without MLH1 promoter methylation, double somatic MMR gene mutations (or loss of heterozygosity as second hit) were detected in 7/10 (70%) t-CRCs and 8/36 (22%) CRCs in the general population (p=0.008). These MMR gene mutations in t-CRCs were classified as pathogenic. MSI t-CRC cases could not be ascribed to Lynch syndrome. We have demonstrated a higher frequency of MSI among t-CRCs, which results from somatic MMR gene mutations. This suggests a novel association of somatic MMR gene mutations with prior anticancer treatment. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  19. Global gene expression profiles in brain regions reflecting abnormal neuronal and glial functions targeting myelin sheaths after 28-day exposure to cuprizone in rats

    International Nuclear Information System (INIS)

    Abe, Hajime; Saito, Fumiyo; Tanaka, Takeshi; Mizukami, Sayaka; Watanabe, Yousuke; Imatanaka, Nobuya; Akahori, Yumi; Yoshida, Toshinori; Shibutani, Makoto

    2016-01-01

    Both developmental and postpubertal cuprizone (CPZ) exposure impairs hippocampal neurogenesis in rats. We previously found that developmental CPZ exposure alters the expression of genes related to neurogenesis, myelination, and synaptic transmission in specific brain regions of offspring. Here, we examined neuronal and glial toxicity profiles in response to postpubertal CPZ exposure by using expression microarray analysis in the hippocampal dentate gyrus, corpus callosum, cerebral cortex, and cerebellar vermis of 5-week-old male rats exposed to 0, 120, and 600 mg/kg CPZ for 28 days. Genes showing transcript upregulation were subjected to immunohistochemical analysis. We found transcript expression alterations at 600 mg/kg for genes related to synaptic transmission, Ache and Prima1, and cell cycle regulation, Tfap4 and Cdkn1a, in the dentate gyrus, which showed aberrant neurogenesis in the subgranular zone. This dose downregulated myelination-related genes in multiple brain regions, whereas KLOTHO + oligodendrocyte density was decreased only in the corpus callosum. The corpus callosum showed an increase in transcript levels for inflammatory response-related genes and in the number of CD68 + microglia, MT + astrocytes, and TUNEL + apoptotic cells. These results suggest that postpubertal CPZ exposure targets synaptic transmission and cell cycle regulation to affect neurogenesis in the dentate gyrus. CPZ suppressed myelination in multiple brain regions and KLOTHO-mediated oligodendrocyte maturation only in the corpus callosum. The increased number of CD68 + microglia, MT + astrocytes, and TUNEL + apoptotic cells in the corpus callosum may be involved in the induction of KLOTHO + oligodendrocyte death and be a protective mechanism against myelin damage following CPZ exposure. - Highlights: • Target gene expression profiles were examined in rats after 28-day CPZ exposure. • Multiple brain region-specific global gene expression profiling was performed. • CPZ

  20. Metabolic abnormalities in young Egyptian women with polycystic ovary syndrome and their relation to ADIPOQ gene variants and body fat phenotype

    Directory of Open Access Journals (Sweden)

    Moushira Zaki

    2015-10-01

    Conclusion: The prevalence of MS was significantly higher in PCOS women than controls, and central obesity and hypertension are risk factors for insulin resistance. Moreover, obesity plays a key role in the development of PCOS and ADIPOQ −11391G>A gene variants showed association with MS.

  1. Abnormalities in structure and expression of the retinoblastoma gene in small cell lung cancer cell lines and xenografts in nude mice

    DEFF Research Database (Denmark)

    Rygaard, K; Sorenson, G D; Pettengill, O S

    1990-01-01

    the Rb protein, we investigated the expression of the Mr 110,000-116,000 Rb protein in SCLC tumors grown as xenografts in nude mice and/or as cell lines. Rb messenger RNA expression was determined by Northern blotting, and gross structural gene alterations were investigated by Southern blotting. Tumors...

  2. A novel deletion mutation and structural abnormality in the Bruton's tyrosine kinase gene identified in a Chinese patient with X-linked agammaglobulinemia.

    Science.gov (United States)

    Wang, Shifu; Lu, Yanqin; Li, Hu; Wang, Zhaoxia; Mo, Xinkai; Chai, Zhengbin; Han, Jinxiang

    2014-01-01

    X-linked agammaglobulinemia (XLA) is a heritable primary immune deficiency disorder caused by mutation of Bruton's tyrosine kinase (BTK) gene. The main clinical characteristics of XLA are recurrent respiratory tract infections and profoundly low serum immunoglobulin levels and B cells. The clinical characteristics of a five-year-old Chinese boy with XLA were described. Mutations of BTK genes were identified by traditional DNA sequencing based on PCR. A three-dimensional model of the truncated BTK protein was constructed. Molecular analysis showed a point deletion of an adenine nucleotide at position 1427 (p.Tyr476Ser), which would cause a frameshift and premature termination at codon 484. Three-dimensional analysis showed that the truncated protein had lost the functional region for both ATP and substrate binding such that tyrosine kinase activity would be affected. The study identified a novel BTK mutation of one Chinese XLA patient. The truncated BTK model identified the loss of a functional domain.

  3. Chronic exposure of mutant DISC1 mice to lead produces sex-dependent abnormalities consistent with schizophrenia and related mental disorders: a gene-environment interaction study.

    Science.gov (United States)

    Abazyan, Bagrat; Dziedzic, Jenifer; Hua, Kegang; Abazyan, Sofya; Yang, Chunxia; Mori, Susumu; Pletnikov, Mikhail V; Guilarte, Tomas R

    2014-05-01

    The glutamatergic hypothesis of schizophrenia suggests that hypoactivity of the N-methyl-D-aspartate receptor (NMDAR) is an important factor in the pathophysiology of schizophrenia and related mental disorders. The environmental neurotoxicant, lead (Pb(2+)), is a potent and selective antagonist of the NMDAR. Recent human studies have suggested an association between prenatal Pb(2+) exposure and the increased likelihood of schizophrenia later in life, possibly via interacting with genetic risk factors. In order to test this hypothesis, we examined the neurobehavioral consequences of interaction between Pb(2+) exposure and mutant disrupted in schizophrenia 1 (mDISC1), a risk factor for major psychiatric disorders. Mutant DISC1 and control mice born by the same dams were raised and maintained on a regular diet or a diet containing moderate levels of Pb(2+). Chronic, lifelong exposure of mDISC1 mice to Pb(2+) was not associated with gross developmental abnormalities but produced sex-dependent hyperactivity, exaggerated responses to the NMDAR antagonist, MK-801, mildly impaired prepulse inhibition of the acoustic startle, and enlarged lateral ventricles. Together, these findings support the hypothesis that environmental toxins could contribute to the pathogenesis of mental disease in susceptible individuals.

  4. The Common C49620T Polymorphism in the Sulfonylurea Receptor Gene SUR1 (ABCC8) in Patients with Gestational Diabetes and Subsequent Glucose Metabolism Abnormalities

    Science.gov (United States)

    Molęda, Piotr; Bińczak-Kuleta, Agnieszka; Homa, Katarzyna; Safranow, Krzysztof; Celewicz, Zbigniew; Syrenicz, Anhelli; Stefański, Adam; Fronczyk, Aneta; Majkowska, Lilianna

    2012-01-01

    Aim. The aim of this study is to investigate the relationship between the common C49620T polymorphism in the sulfonylurea receptor (SUR1) gene and glucose metabolism, β-cell secretory function and insulin resistance in women with a history of gestational diabetes (GDM). Material and Methods. Study group included 199 women, diagnosed GDM within the last 5–12 years and control group of comparable 50 women in whom GDM was excluded during pregnancy. Blood glucose and insulin levels were measured during oral glucose tolerance test. Indices of insulin resistance (HOMA-IR) and β-cell function (HOMA %B) were calculated. In all patients, the C49620T polymorphism in intron 15 of the SUR1 gene was determined. Results. The distribution of the studied polymorphism in the two groups did not differ from each other (χ 2 = 0.34, P = 0.8425). No association between the distribution of polymorphisms and coexisting glucose metabolism disorders (χ 2 = 7,13, P = 0, 3043) was found. No association was also observed between the polymorphism and HOMA %B or HOMA-IR. Conclusions. The polymorphism C49620T in the SUR1 gene is not associated with insulin resistance and/or insulin secretion in women with a history of GDM and does not affect the development of GDM, or the development of glucose intolerance in the studied population. PMID:22927833

  5. Abnormalities in structure and expression of the retinoblastoma gene in small cell lung cancer cell lines and xenografts in nude mice

    DEFF Research Database (Denmark)

    Rygaard, K; Sorenson, G D; Pettengill, O S

    1990-01-01

    the Rb protein, we investigated the expression of the Mr 110,000-116,000 Rb protein in SCLC tumors grown as xenografts in nude mice and/or as cell lines. Rb messenger RNA expression was determined by Northern blotting, and gross structural gene alterations were investigated by Southern blotting. Tumors...... small cell lung cancer (SCLC). Absence of the 4.7 kilobase mRNA has been found to be frequent in SCLC, and it has been reported that the Rb Mr 110,000-116,000 protein product is always absent, even in tumors expressing Rb mRNA. Using Western blotting technique with a monoclonal antibody directed against...

  6. Defining Abnormally Low Tenders

    DEFF Research Database (Denmark)

    Ølykke, Grith Skovgaard; Nyström, Johan

    2017-01-01

    The concept of an abnormally low tender is not defined in EU public procurement law. This article takes an interdisciplinary law and economics approach to examine a dataset consisting of Swedish and Danish judgments and verdicts concerning the concept of an abnormally low tender. The purpose...

  7. CDX2 downregulation is associated with poor differentiation and MMR deficiency in colon cancer

    DEFF Research Database (Denmark)

    Olsen, J.; Eiholm, Susanne; Kirkeby, L T

    2016-01-01

    , and migration. In this study, we investigated CDX2 mRNA and protein expression in relation to the clinicopathological characteristics of colon cancer, including mismatch repair status and recurrence risk. METHODS: Tumor samples were obtained from colon cancer patients. Biopsies from tumor tissue and normal......BACKGROUND: Homeobox genes are often deregulated in cancer and can have both oncogenic and tumor-suppressing potential. The Caudal-related homeobox transcription factor 2 (CDX2) is an intestine-specific transcription factor. CDX2 has been implicated in differentiation, proliferation, cell adhesion...

  8. Calcific Aortic Valve Disease: Part 2—Morphomechanical Abnormalities, Gene Reexpression, and Gender Effects on Ventricular Hypertrophy and Its Reversibility

    Science.gov (United States)

    2016-01-01

    In part 1, we considered cytomolecular mechanisms underlying calcific aortic valve disease (CAVD), hemodynamics, and adaptive feedbacks controlling pathological left ventricular hypertrophy provoked by ensuing aortic valvular stenosis (AVS). In part 2, we survey diverse signal transduction pathways that precede cellular/molecular mechanisms controlling hypertrophic gene expression by activation of specific transcription factors that induce sarcomere replication in-parallel. Such signaling pathways represent potential targets for therapeutic intervention and prevention of decompensation/failure. Hypertrophy provoking signals, in the form of dynamic stresses and ligand/effector molecules that bind to specific receptors to initiate the hypertrophy, are transcribed across the sarcolemma by several second messengers. They comprise intricate feedback mechanisms involving gene network cascades, specific signaling molecules encompassing G protein-coupled receptors and mechanotransducers, and myocardial stresses. Future multidisciplinary studies will characterize the adaptive/maladaptive nature of the AVS-induced hypertrophy, its gender- and individual patient-dependent peculiarities, and its response to surgical/medical interventions. They will herald more effective, precision medicine treatments. PMID:27184804

  9. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene.

    Science.gov (United States)

    Win, Aung Ko; Reece, Jeanette C; Buchanan, Daniel D; Clendenning, Mark; Young, Joanne P; Cleary, Sean P; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G; MacInnis, Robert J; Tucker, Katherine M; Winship, Ingrid M; Macrae, Finlay A; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W; Newcomb, Polly A; Thibodeau, Stephen N; Lindor, Noralane M; Hopper, John L; Gallinger, Steven; Jenkins, Mark A

    2015-12-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understandin g the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95% confidence interval (CI) 9.19-50.1; p mutation alone (HR 1.94, 95% CI 0.63-5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative.

  10. Abnormal P-53 suppressor gene expression predicts for a poorer outcome in patients with locally advanced adenocarcinoma of the prostate treated by external beam radiation therapy with or without pre-radiation androgen ablation: results based on RTOG study 86-10

    International Nuclear Information System (INIS)

    Lawton, Colleen A.; Grignon, David; Caplan, Richard; Sarkar, Fazlul; Forman, Jeffrey; Mesic, John; Fu, Karen K.; Abrams, Ross

    1995-01-01

    Purpose/Objective: The purpose of this study is to establish the effect of the abnormal expression of the P-53 suppressor gene on the results of locally advanced adenocarcinoma of the prostate treated with radiation therapy with or without pre-radiation therapy androgen ablation. Materials and Methods: Patients evaluated were part of a RTOG phase III multi-institutional trial. This trial assessed the value of pre-radiation therapy androgen ablation on patients with locally advanced disease (bulky stage B and stage C). Of the 471 patients registered, pre-treatment pathological material was available for 129 patients. P-53 status was determined immunohistochemically utilizing a commercially available antibody (D07). Clinical endpoints evaluated were overall survival and development of metastases. Results: Twenty-three of the 129 patients had abnormal expression of the P-53 suppressor gene. Presence of this abnormal expression significantly correlated with lower overall survival (p=0.03) and the development of distant metastases (p=0.03). Abnormal expression of the P-53 gene was an independent prognostic indicator when evaluated against clinical stage and Gleason score. Conclusion: This data from patients entered on a phase III multi-institutional, randomized clinical trial shows that abnormal P-53 suppressor gene expression as determined immunohistochemically is an independent predictor of poorer survival and the development of distant metastases in patients with locally advanced adenocarcinoma of the prostate treated with radiation therapy with or without pre-radiation therapy androgen ablation

  11. Determining the functional significance of mismatch repair gene missense variants using biochemical and cellular assays

    DEFF Research Database (Denmark)

    Heinen, Christopher D; Juel Rasmussen, Lene

    2012-01-01

    ABSTRACT: With the discovery that the hereditary cancer susceptibility disease Lynch syndrome (LS) is caused by deleterious germline mutations in the DNA mismatch repair (MMR) genes nearly 20 years ago, genetic testing can now be used to diagnose this disorder in patients. A definitive diagnosis...... of LS can direct how clinicians manage the disease as well as prevent future cancers for the patient and their families. A challenge emerges, however, when a germline missense variant is identified in a MMR gene in a suspected LS patient. The significance of a single amino acid change in these large...... some of these assays along with the challenges of using such assays to determine the functional consequences of MMR VUS which, in turn, can provide valuable insight into their clinical significance. With increased gene sequencing in patients, the number of identified VUS has expanded dramatically...

  12. Plant abnormality diagnosis device

    International Nuclear Information System (INIS)

    Saeki, Akira.

    1992-01-01

    The device of the present invention diagnose an abnormal event occurred in a large-scaled plant, such as a nuclear power plant. The device comprises the following four functions. (1) Abnormality candidates are estimated based on an intelligence base storing characteristics established between the characteristics/functions and physical amounts of the plant components, and detected abnormality and measured values. Among the candidates, one which coincidents with the measured value such as an actual process amount is judged as a first cause. (2) In addition, a real time plant behavior is estimated based on parameters determining a plant operation mode. The candidate for the abnormality cause is estimated by the comparison between the result of the estimation and the measured value such as a process amount. (3) Characteristics established between the characteristics/functions and the physical amount of the plant components are structured stepwise thereby identifying the first abnormality cause. (4) Inactuated or failed portions of the components for restoring the abnormality to normal state are identified based on the intelligence base simultaneously with the estimation for the first abnormality cause. (I.S.)

  13. Calibration of Multiple In Silico Tools for Predicting Pathogenicity of Mismatch Repair Gene Missense Substitutions

    Science.gov (United States)

    Thompson, Bryony A.; Greenblatt, Marc S.; Vallee, Maxime P.; Herkert, Johanna C.; Tessereau, Chloe; Young, Erin L.; Adzhubey, Ivan A.; Li, Biao; Bell, Russell; Feng, Bingjian; Mooney, Sean D.; Radivojac, Predrag; Sunyaev, Shamil R.; Frebourg, Thierry; Hofstra, Robert M.W.; Sijmons, Rolf H.; Boucher, Ken; Thomas, Alun; Goldgar, David E.; Spurdle, Amanda B.; Tavtigian, Sean V.

    2015-01-01

    Classification of rare missense substitutions observed during genetic testing for patient management is a considerable problem in clinical genetics. The Bayesian integrated evaluation of unclassified variants is a solution originally developed for BRCA1/2. Here, we take a step toward an analogous system for the mismatch repair (MMR) genes (MLH1, MSH2, MSH6, and PMS2) that confer colon cancer susceptibility in Lynch syndrome by calibrating in silico tools to estimate prior probabilities of pathogenicity for MMR gene missense substitutions. A qualitative five-class classification system was developed and applied to 143 MMR missense variants. This identified 74 missense substitutions suitable for calibration. These substitutions were scored using six different in silico tools (Align-Grantham Variation Grantham Deviation, multivariate analysis of protein polymorphisms [MAPP], Mut-Pred, PolyPhen-2.1, Sorting Intolerant From Tolerant, and Xvar), using curated MMR multiple sequence alignments where possible. The output from each tool was calibrated by regression against the classifications of the 74 missense substitutions; these calibrated outputs are interpretable as prior probabilities of pathogenicity. MAPP was the most accurate tool and MAPP + PolyPhen-2.1 provided the best-combined model (R2 = 0.62 and area under receiver operating characteristic = 0.93). The MAPP + PolyPhen-2.1 output is sufficiently predictive to feed as a continuous variable into the quantitative Bayesian integrated evaluation for clinical classification of MMR gene missense substitutions. PMID:22949387

  14. Changes in the expression profile of the meiosis-involved mismatch repair genes in impaired human spermatogenesis.

    Science.gov (United States)

    Terribas, Ernest; Bonache, Sandra; García-Arévalo, Marta; Sánchez, Josvany; Franco, Eladio; Bassas, Lluís; Larriba, Sara

    2010-01-01

    DNA mismatch repair (MMR) genes have been described to participate in crossover events during meiotic recombination, which is, in turn, a key step of spermatogenesis. This evidence suggests that MMR family gene expression may be altered in infertile men with defective sperm production. In order to determine the expression profile of MMR genes in impaired human spermatogenesis, we performed transcript levels analysis of MMR genes (MLH1, MLH3, PMS2, MSH4, and MSH5), and other meiosis-involved genes (ATR, HSPA2, and SYCP3) as controls, by real-time reverse transcription-polymerase chain reaction in testis from 13 patients with spermatogenic failure, 5 patients with primary germ cell tumors, and 10 controls with conserved spermatogenesis. Correlation of the expression values with the histological findings was also performed. The MMR gene expression values, with the exception of PMS2, are significantly decreased in men with spermatogenic failure. The pattern of MMR reduction correlates with the severity of damage, being maximum in maturation arrest. Specifically, expression of the testicular MSH4 gene could be useful as a surrogate marker for the presence of intratesticular elongated spermatid in patients with nonobstructive azoospermia, contributing to predict the viability of assisted reproduction. Interestingly, a reduction in the MSH4 and MSH5 transcript concentration per spermatocyte was also observed. The decreased expression level of other meiosis-specific genes, such as HSPA2 and SYCP3, suggests that the spermatocyte capacity to express meiosis-related genes is markedly reduced in spermatogenic failure, contributing to meiosis impairment and spermatogenic blockade.

  15. Mucin phenotypic expression and p53 gene abnormality of gastric super-minute well-differentiated adenocarcinoma: re-evaluation with relationship between histogenesis of well-differentiated adenocarcinoma and intestinal metaplasia in distal stomach.

    Science.gov (United States)

    Wada, Ryo; Yamaguchi, Toshikazu; Tanizaki, Takayuki

    2005-09-01

    gastric and intestinal phenotypic mucin, are considered to develop from the tubular proliferative zone with the incomplete type of the intestinal metaplasia and p53 gene abnormality, while a part of them, which had only gastric phenotypic mucin, may derive from the gastric native tubules (non-metaplastic epithelium) with p53 gene abnormality.

  16. Mucin phenotypic expression and p53 gene abnormality of gastric super-minute well-differentiated adenocarcinoma: Re-evaluation with relationship between histogenesis of well-differentiated adenocarcinoma and intestinal metaplasia in distal stomach

    Directory of Open Access Journals (Sweden)

    Yamaguchi Toshikazu

    2005-01-01

    lesions in the distal stomach, which had both gastric and intestinal phenotypic mucin, are considered to develop from the tubular proliferative zone with the incomplete type of the intestinal metaplasia and p53 gene abnormality, while a part of them, which had only gastric phenotypic mucin, may derive from the gastric native tubules (non-metaplastic epithelium with p53 gene abnormality.

  17. Characterization of rubella-specific humoral immunity following two doses of MMR vaccine using proteome microarray technology

    Science.gov (United States)

    Haralambieva, Iana H.; Gibson, Michael J.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Warner, Nathaniel D.; Grill, Diane E.

    2017-01-01

    Introduction//Background The lack of standardization of the currently used commercial anti-rubella IgG antibody assays leads to frequent misinterpretation of results for samples with low/equivocal antibody concentration. The use of alternative approaches in rubella serology could add new information leading to a fuller understanding of rubella protective immunity and neutralizing antibody response after vaccination. Methods We applied microarray technology to measure antibodies to all rubella virus proteins in 75 high and 75 low rubella virus-specific antibody responders after two MMR vaccine doses. These data were used in multivariate penalized logistic regression modeling of rubella-specific neutralizing antibody response after vaccination. Results We measured antibodies to all rubella virus structural proteins (i.e., the glycoproteins E1 and E2 and the capsid C protein) and to the non-structural protein P150. Antibody levels to each of these proteins were: correlated with the neutralizing antibody titer (prubella virus-specific neutralizing antibody titers (misclassification error = 0.2). Conclusion Our study supports the use of this new technology, as well as the use of antibody profiles/patterns (rather than single antibody measures) as biomarkers of neutralizing antibody response and correlates of protective immunity in rubella virus serology. PMID:29145521

  18. Information is in the eye of the beholder: Seeking information on the MMR vaccine through an Internet search engine.

    Science.gov (United States)

    Yom-Tov, Elad; Fernandez-Luque, Luis

    2014-01-01

    Vaccination campaigns are one of the most important and successful public health programs ever undertaken. People who want to learn about vaccines in order to make an informed decision on whether to vaccinate are faced with a wealth of information on the Internet, both for and against vaccinations. In this paper we develop an automated way to score Internet search queries and web pages as to the likelihood that a person making these queries or reading those pages would decide to vaccinate. We apply this method to data from a major Internet search engine, while people seek information about the Measles, Mumps and Rubella (MMR) vaccine. We show that our method is accurate, and use it to learn about the information acquisition process of people. Our results show that people who are pro-vaccination as well as people who are anti-vaccination seek similar information, but browsing this information has differing effect on their future browsing. These findings demonstrate the need for health authorities to tailor their information according to the current stance of users.

  19. Functional analysis helps importance of unclassified mismatch repair genes

    NARCIS (Netherlands)

    Ou, Jianghua; Niessen, Renee C.; L tzen, Anne; Sijmons, Rolf H.; Kleibeuker, Jan. H.; De Wind, Niels; Rasmussen, Lene Juel; Hofstra, Robert M. W.

    2007-01-01

    Hereditary nonpolyposis colorectal cancer (HNPCC) or Lynch syndrome is caused by DNA variations in the DNA mismatch repair (MMR) genes MSH2, MLH1, MSH6, and PMS2. Many of the mutations identified result in premature termination of translation and thus in loss-of-function of the encoded mutated

  20. Up-regulation of mismatch repair genes MSH6, PMS2 and MLH1 parallels development of genetic instability and is linked to tumor aggressiveness and early PSA recurrence in prostate cancer.

    Science.gov (United States)

    Wilczak, Waldemar; Rashed, Semin; Hube-Magg, Claudia; Kluth, Martina; Simon, Ronald; Büscheck, Franziska; Clauditz, Till Sebastian; Grupp, Katharina; Minner, Sarah; Tsourlakis, Maria Christina; Möller-Koop, Christina; Graefen, Markus; Adam, Meike; Haese, Alexander; Wittmer, Corinna; Sauter, Guido; Izbicki, Jakob Robert; Huland, Hartwig; Schlomm, Thorsten; Steurer, Stefan; Krech, Till; Lebok, Patrick

    2017-01-01

    DNA mismatch repair (MMR) is integral to the maintenance of genetic stability. We aimed to evaluate the clinical impact of MMR gene expression in prostate cancer. The MMR genes MSH6, MLH1 and PMS2 were analyzed by immunohistochemistry on a tissue microarray containing 11152 prostate cancer specimens. Results were compared with ETS-related gene status and deletions of PTEN, 3p13, 5q21 and 6q15. MSH6, MLH1 and PMS2 expression was detectable in 89.5%, 85.4% and 85.0% of cancers and was particularly strong in cancers with advanced pathological tumor stage (P gene expression paralleled features of genetic instability, such as the number of genomic deletions per cancer; strong expression of all three MMR genes was found in 24%, 29%, 30%, 33% and 42% of cancers with no, one, two, three or four to five deletions (P genes was largely driven by the subset of cancers lacking ERG fusion (P gene overexpression was only marginal in ERG-positive cancers. Multivariate analyses suggested an independent prognostic relevance of MMR genes in ERG-negative prostate cancers when compared with prognostic parameters available at the time of initial biopsy. In conclusion, MMR overexpression is common in prostate cancer and is linked to poor outcome as well as features indicating genetic instability. ERG fusion should be analyzed along with MMR gene expression in potential clinical tests. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Chromosomal Abnormalities in ADHD

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2002-07-01

    Full Text Available The prevalence of fragile X syndrome, velocardiofacial syndrome (VCFS, and other cytogenetic abnormalities among 100 children (64 boys with combined type ADHD and normal intelligence was assessed at the NIMH and Georgetown University Medical Center.

  2. "Jeopardy" in Abnormal Psychology.

    Science.gov (United States)

    Keutzer, Carolin S.

    1993-01-01

    Describes the use of the board game, Jeopardy, in a college level abnormal psychology course. Finds increased student interaction and improved application of information. Reports generally favorable student evaluation of the technique. (CFR)

  3. Chromosomal abnormalities and autism

    Directory of Open Access Journals (Sweden)

    Farida El-Baz

    2016-01-01

    Conclusion: Chromosomal abnormalities were not detected in the studied autistic children, and so the relation between the genetics and autism still needs further work up with different study methods and techniques.

  4. Overcoming qEEG abnormalities and reward gene deficits during protracted abstinence in male psychostimulant and polydrug abusers utilizing putative dopamine D₂ agonist therapy: part 2.

    Science.gov (United States)

    Blum, Kenneth; Chen, Thomas J H; Morse, Siobhan; Giordano, John; Chen, Amanda Lih Chaun; Thompson, James; Allen, Cameron; Smolen, Andrew; Lubar, Joel; Stice, Eric; Downs, B William; Waite, Roger L; Madigan, Margaret A; Kerner, Mallory; Fornari, Frank; Braverman, Eric R

    2010-11-01

    It is well established that in both food- and drug-addicted individuals there is "dopamine resistance" associated with the DRD2 gene A1 allele. Based on earlier studies, evidence is emerging wherein the potential of utilizing a natural, nonaddicting, safe, putative D2 agonist may play a significant role in the recovery of individuals with reward deficiency syndrome, including those addicted to psychoactive chemicals. Positive outcomes demonstrated by quantitative electroencephalographic (qEEG) imaging in a randomized, triple-blind, placebo-controlled, crossover study involving oral Synaptose Complex KB220Z™ showed an increase of alpha waves and low beta wave activity in the parietal brain region. Using t statistics, significant differences observed between placebo and Synaptose Complex KB220Z™ consistently occurred in the frontal regions after week 1 and then again after week 2 of analyses (P = 0.03). This is the first report to demonstrate involvement of the prefrontal cortex in the qEEG response to a natural putative D2 agonist (Synaptose Complex KB220Z™), especially evident in dopamine D2 A1 allele subjects. Independently, we have further supported this finding with an additional study of 3 serious polydrug abusers undergoing protracted abstinence who carried the DRD2 A1 allele. Significant qEEG differences were found between those who received 1 dose of placebo compared with those who were administered Synaptose Complex KB220Z™. Synaptose Complex KB220Z™ induced positive regulation of the dysregulated electrical activity of the brain in these addicts. The results are indicative of a phase change from low amplitude or low power in the brain to a more regulated state by increasing an average of 6.169 mV(2) across the prefrontal cortical region. In the first experiment we found that while 50% of the subjects carried the DRD2 A1 allele, 100% carried ≥ 1 risk allele. Specifically, based on the proposed addiction risk score for these 14 subjects, 72% had

  5. Mismatch-mediated error prone repair at the immunoglobulin genes.

    Science.gov (United States)

    Chahwan, Richard; Edelmann, Winfried; Scharff, Matthew D; Roa, Sergio

    2011-12-01

    The generation of effective antibodies depends upon somatic hypermutation (SHM) and class-switch recombination (CSR) of antibody genes by activation induced cytidine deaminase (AID) and the subsequent recruitment of error prone base excision and mismatch repair. While AID initiates and is required for SHM, more than half of the base changes that accumulate in V regions are not due to the direct deamination of dC to dU by AID, but rather arise through the recruitment of the mismatch repair complex (MMR) to the U:G mismatch created by AID and the subsequent perversion of mismatch repair from a high fidelity process to one that is very error prone. In addition, the generation of double-strand breaks (DSBs) is essential during CSR, and the resolution of AID-generated mismatches by MMR to promote such DSBs is critical for the efficiency of the process. While a great deal has been learned about how AID and MMR cause hypermutations and DSBs, it is still unclear how the error prone aspect of these processes is largely restricted to antibody genes. The use of knockout models and mice expressing mismatch repair proteins with separation-of-function point mutations have been decisive in gaining a better understanding of the roles of each of the major MMR proteins and providing further insight into how mutation and repair are coordinated. Here, we review the cascade of MMR factors and repair signals that are diverted from their canonical error free role and hijacked by B cells to promote genetic diversification of the Ig locus. This error prone process involves AID as the inducer of enzymatically-mediated DNA mismatches, and a plethora of downstream MMR factors acting as sensors, adaptors and effectors of a complex and tightly regulated process from much of which is not yet well understood. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  6. Abnormal sound detection device

    International Nuclear Information System (INIS)

    Yamada, Izumi; Matsui, Yuji.

    1995-01-01

    Only components synchronized with rotation of pumps are sampled from detected acoustic sounds, to judge the presence or absence of abnormality based on the magnitude of the synchronized components. A synchronized component sampling means can remove resonance sounds and other acoustic sounds generated at a synchronously with the rotation based on the knowledge that generated acoustic components in a normal state are a sort of resonance sounds and are not precisely synchronized with the number of rotation. On the other hand, abnormal sounds of a rotating body are often caused by compulsory force accompanying the rotation as a generation source, and the abnormal sounds can be detected by extracting only the rotation-synchronized components. Since components of normal acoustic sounds generated at present are discriminated from the detected sounds, reduction of the abnormal sounds due to a signal processing can be avoided and, as a result, abnormal sound detection sensitivity can be improved. Further, since it is adapted to discriminate the occurrence of the abnormal sound from the actually detected sounds, the other frequency components which are forecast but not generated actually are not removed, so that it is further effective for the improvement of detection sensitivity. (N.H.)

  7. Addressing issues of vaccination literacy and psychological empowerment in the measles-mumps-rubella (MMR) vaccination decision-making: a qualitative study.

    Science.gov (United States)

    Fadda, Marta; Depping, Miriam K; Schulz, Peter J

    2015-09-02

    Whether or not to vaccinate one's child is one of the first health-related decisions parents have to make after their child's birth. For the past 20 years, the share of parents choosing not to immunize their children has increased in many countries, for various reasons. Among these, rumors affirming that vaccinations contain dangerous chemicals or might trigger severe chronic diseases have negatively affected parental attitudes towards pediatric immunizations, particularly the vaccination against measles, mumps and rubella (MMR), raising a number of public health concerns. The primary aim of this qualitative study is to understand what drives parents' decision, giving special attention to vaccination literacy and psychological empowerment in such a context. Twenty individual semi-structured interviews were conducted in the Canton of Ticino (Switzerland) between January and June 2014. Participants were either mothers or fathers of children less than 1 year old living in Switzerland. An inductive thematic analysis was performed to identify the main themes with regard to vaccination literacy and psychological empowerment in the MMR vaccination decision-making. Parents' reports yielded four main themes: (a) the paradox of the free choice, referring to the misinterpretation of current vaccination policies; (b) giving up the power, pointing at the outcomes of a low perceived competence; (c) a far-reaching decision, reflecting the importance attributed to the MMR choice and the different levels of impact the decision can have; (d) the demand for shared-decision making, referring to the parental needs in relation to the child's healthcare provider. Understanding what drives parents' management of their children's immunization schedule in terms of vaccination literacy and psychological empowerment can help health professionals to communicate more effectively with parents in order to facilitate an informed decision, and stakeholders to design tailored health education

  8. 'Avoiding harm to others' considerations in relation to parental measles, mumps and rubella (MMR) vaccination discussions - an analysis of an online chat forum.

    Science.gov (United States)

    Skea, Zoë C; Entwistle, Vikki A; Watt, Ian; Russell, Elizabeth

    2008-11-01

    Vaccination against contagious diseases is intended to benefit individuals and contribute to the eradication of such diseases from the population as a whole. The Measles, Mumps and Rubella (MMR) vaccine is widely recommended for all children with the aim of protecting against measles, mumps, and rubella. However, within the UK, there has been significant controversy surrounding its safety. This paper presents findings from a UK study of discussions about MMR in an online chat forum for parents. We observed archived discussions (without posting any messages) and conducted a thematic analysis to explore in more detail how participants discussed particular topics. Most participants were female, had young children, lived in the UK. They had reached a range of decisions regarding MMR vaccination. This analysis focuses on discussions about 'avoiding harm to others,' which were important considerations for many of the participating parents. In the context of concerns about MMR safety, participants expressed a desire to both (a) protect their own child and (b) help protect others by contributing to herd immunity. Parents made a distinction between healthy and vulnerable children which had important implications for their views about who should bear the burden of vaccination. Some parents were quite critical of those who did not vaccinate healthy children, and urged them to do so on grounds of social responsibility. Our findings suggest that social scientists with an interest in vaccination practice should attend carefully to lay understandings of herd immunity as a public good and views about obligations to others in society. Policy makers, too, might consider giving more emphasis to herd immunity in vaccination promotional material, although attention should be paid to the ways in which parents distinguish between healthy and vulnerable children.

  9. Immune response to the mumps component of the MMR vaccine in the routine of immunisation services in the Brazilian National Immunisation Program

    Directory of Open Access Journals (Sweden)

    Eliane Matos dos Santos

    2014-06-01

    Full Text Available A non-controlled longitudinal study was conducted to evaluate the combined vaccine against measles, mumps and rubella (MMR immunogenicity in 150 children vaccinated in the routine of three health units in the city of Rio de Janeiro, Brazil, 2008-2009, without other vaccines administered during the period from 30 days before to 30 days after vaccination. A previous study conducted in Brazil in 2007, in 1,769 children ranging from 12-15 months of age vaccinated against yellow fever and MMR simultaneously or at intervals of 30 days or more between doses, had shown low seroconversion for mumps regardless of the interval between administration of the two vaccines. The current study showed 89.5% (95% confidence interval: 83.3; 94.0 seroconversion rate for mumps. All children seroconverted for measles and rubella. After revaccination, high antibody titres and seroconversion rates were achieved against mumps. The results of this study and others suggest that two MMR doses confer optimal immunoresponses for all three antigens and the possible need for additional doses should be studied taking into account not only serological, but also epidemiological data, as there is no serological correlate of protection for mumps.

  10. The impact of the media on the decision of parents in South Wales to accept measles-mumps-rubella (MMR) immunization.

    Science.gov (United States)

    Walsh, S; Thomas, D Rh; Mason, B W; Evans, M R

    2015-02-01

    A large measles outbreak occurred in South Wales in 2012/2013. The outbreak has been attributed to low take-up of measles-mumps-rubella (MMR) immunization in the early 2000s. To understand better the factors that led to this outbreak we present the findings of a case-control study carried out in the outbreak area in 2001 to investigate parents' decision on whether to accept MMR. Parents who decided not to take-up MMR at the time were more likely to be older and better educated, more likely to report being influenced by newspapers [adjusted odds ratio (aOR) 3·07, 95% confidence interval (CI) 1·62-5·80], television (aOR 3·30, 95% CI 1·70-6·43), the internet (aOR 7·23, 3·26-16·06) and vaccine pressure groups (aOR 5·20, 95% CI 2·22-12·16), and less likely to be influenced by a health visitor (aOR 0·30, 95% CI 0·16-0·57). In this area of Wales, daily English-language regional newspapers, UK news programmes and the internet appeared to have a powerful negative influence. We consider the relevance of these findings to the epidemiology of the outbreak and the subsequent public health response.

  11. The effectiveness of measles-mumps-rubella (MMR) vaccination in the prevention of pediatric hospitalizations for targeted and untargeted infections: A retrospective cohort study.

    Science.gov (United States)

    La Torre, Giuseppe; Saulle, Rosella; Unim, Brigid; Meggiolaro, Angela; Barbato, Angelo; Mannocci, Alice; Spadea, Antonietta

    2017-08-03

    To evaluate the effectiveness of the measles-mumps-rubella (MMR) vaccine in reducing hospitalizations for infectious disease, targeted and not targeted, as well as from respiratory diseases in children in Rome. The cohort was recomposed through record linkage of 2 archives (vaccination register and hospital discharge records. The analysis included 11,004 children. 20.9% did not receive the MMR vaccination, 49% and 30.1% received one and 2 doses. There were no hospitalizations for rubella, 2 for mumps, and 12 for measles. The vaccine was highly protective against measles and mumps hospitalizations (HR = 0.10; 95% CI: 0.03.0.34). Regarding all infectious diseases there were 414 hospitalizations, and the vaccine was protective (HR = 0.29; 95% CI: 0.25 to 0.34). Concerning respiratory diseases, there were 809 admissions (7.4%), and the vaccine was highly protective (HR: 0.18; 95% CI: 0.07 to 0.48). MMR vaccination is effective for the primary prevention of target and not targeted infectious diseases and may also limit hospitalizations for respiratory diseases.

  12. Microsatellites in the Eukaryotic DNA Mismatch Repair Genes as Modulators of Evolutionary Mutation Rate

    Science.gov (United States)

    Chang, Dong Kyung; Metzgar, David; Wills, Christopher; Boland, C. Richard

    2003-01-01

    All "minor" components of the human DNA mismatch repair (MMR) system-MSH3, MSH6, PMS2, and the recently discovered MLH3-contain mononucleotide microsatellites in their coding sequences. This intriguing finding contrasts with the situation found in the major components of the DNA MMR system-MSH2 and MLH1-and, in fact, most human genes. Although eukaryotic genomes are rich in microsatellites, non-triplet microsatellites are rare in coding regions. The recurring presence of exonal mononucleotide repeat sequences within a single family of human genes would therefore be considered exceptional.

  13. Relationship among sera lipoprotein abnormalities in healthy ...

    African Journals Online (AJOL)

    Jane

    2011-08-29

    Aug 29, 2011 ... HOMA-IR (P = 0.03) in the case group as compared to the control group. We conclude that a family history of diabetic parents can lead to lipid parameters abnormalities and CVD risk factor via aggregation of inherited defected genes. Key words: Diabetes, oxidized-low density lipoprotein (LDL), Apo B100, ...

  14. Aseptic meningitis in a large MMR vaccine campaign (590,609 people in Curitiba, Paraná, Brazil, 1998

    Directory of Open Access Journals (Sweden)

    ARRUDA Walter Oleschko

    2001-01-01

    Full Text Available The aseptic meningitis after Measles-Mumps-Rubella vaccine (MMR is a well recognized complication, and different incidences have been observed in several studies. We retrospectively analyzed forty cases of aseptic meningitis, during a large public immunization campaign (1998 in Curitiba, Southern Brazil (590,609 people, admitted in our Service. The vaccine utilized was Leningrad-3-Zagreb mumps strain, Edmonston-Zagreb measles strain, and RA 27#3 rubella strain. In all county, a total number of 87 cases were reported, resulting in a incidence of 1.7 cases per 10,000 given doses . The mean age was 23.7 ± 12.8 years. The female:male ratio was 1.35:1. Severe headache with meningismus (92.5%, fever (87.5%, nausea/vomiting (82.5% were the most common clinical findings. Three cases (7.5% developed mild mumps. All patients underwent cerebrospinal fluid (CSF tap with the following findings: mononuclear pleocytosis from 100 to 500 cells/mm³ in 17 cases (42.5%; 257.5 ± 260.6 cells/mm³; increased protein 28 cases (67.5%; 92.1 ± 76.9 mg/dL; glucose was normal in all cases (56.8 ± 11.2 mg/dL except in 4 (10% cases, which presented less than 44 mg/dL. All serological tests (latex to bacterial meningitis, Cryptococcus, cysticercosis, VDRL and bacteriological cultures were negative. Virus identification were also negative in 8 samples. None of the patients had neurological deficits or related symptoms after one year of onset. We believe the benefit of vaccination clearly outweights the incidence of benign vaccine-associated meningitis.

  15. Aseptic meningitis in a large MMR vaccine campaign (590,609 people) in Curitiba, Paraná, Brazil, 1998.

    Science.gov (United States)

    Arruda, W O; Kondageski, C

    2001-01-01

    The aseptic meningitis after Measles-Mumps-Rubella vaccine (MMR) is a well recognized complication, and different incidences have been observed in several studies. We retrospectively analyzed forty cases of aseptic meningitis, during a large public immunization campaign (1998) in Curitiba, Southern Brazil (590,609 people), admitted in our Service. The vaccine utilized was Leningrad-3-Zagreb mumps strain, Edmonston-Zagreb measles strain, and RA 27#3 rubella strain. In all county, a total number of 87 cases were reported, resulting in a incidence of 1.7 cases per 10,000 given doses. The mean age was 23.7 +/- 12.8 years. The female:male ratio was 1.35:1. Severe headache with meningismus (92.5%), fever (87.5%), nausea/vomiting (82.5%) were the most common clinical findings. Three cases (7.5%) developed mild mumps. All patients underwent cerebrospinal fluid (CSF) tap with the following findings: mononuclear pleocytosis from 100 to 500 cells/mm(3) in 17 cases (42.5%; 257.5 +/- 260.6 cells/mm3); increased protein 28 cases (67.5%; 92.1 +/- 76.9 mg/dL); glucose was normal in all cases (56.8 +/- 11.2 mg/dL) except in 4 (10%) cases, which presented less than 44 mg/dL. All serological tests (latex to bacterial meningitis, Cryptococcus, cysticercosis, VDRL) and bacteriological cultures were negative. Virus identification were also negative in 8 samples. None of the patients had neurological deficits or related symptoms after one year of onset. We believe the benefit of vaccination clearly outweighs the incidence of benign vaccine-associated meningitis.

  16. Functional role of DNA mismatch repair gene PMS2 in prostate cancer cells

    Science.gov (United States)

    Mitsui, Yozo; Chiyomaru, Takeshi; Yamamura, Soichiro; Majid, Shahana; Saini, Sharanjot; Deng, Guoren; Gill, Ankurpreet; Wong, Darryn K.; Shiina, Hiroaki; Nonomura, Norio; Lau, Yun-Fai C.; Dahiya, Rajvir; Tanaka, Yuichiro

    2015-01-01

    DNA mismatch repair (MMR) enzymes act as proofreading complexes that maintains genomic integrity and MMR-deficient cells show an increased mutation rate. MMR has also been shown to influence cell signaling and the regulation of tumor development. MMR consists of various genes and includes post-meiotic segregation (PMS) 2 which is a vital component of mutL-alpha. In prostate, the functional role of this gene has never been reported and in this study, our aim was to investigate the effect of PMS2 on growth properties of prostate cancer (PCa) cells. Previous studies have shown PMS2 to be deficient in DU145 cells and this lack of expression was confirmed by Western blotting whereas normal prostatic PWR-1E and RWPE-1 cells expressed this gene. PMS2 effects on various growth properties of DU145 were then determined by creating stable gene transfectants. Interestingly, PMS2 caused decreased cell proliferation, migration, invasion, and in vivo growth; and increased apoptosis as compared to vector control. We further analyzed genes affected by PMS2 expression and observe the apoptosis-related TMS1 gene to be significantly upregulated whereas anti-apoptotic BCL2A1 was downregulated. These results demonstrate a functional role for PMS2 to protect against PCa progression by enhancing apoptosis of PCa cells. PMID:26036629

  17. Nitrofurantoin and congenital abnormalities

    DEFF Research Database (Denmark)

    Czeizel, A.E.; Rockenbauer, M.; Sørensen, Henrik Toft

    2001-01-01

    Objective: To study human teratogenic potential of oral nitrofurantoin treatment during pregnancy. Materials and Methods: Pair analysis of cases with congenital abnormalities and matched population controls in the population-based dataset of the Hungarian Case-Control Surveillance of Congenital...

  18. CT of pleural abnormalities

    International Nuclear Information System (INIS)

    Webb, W.R.

    1995-01-01

    Briefly discussed were CT diagnosis of pleural thickening, CT technique for examining the pleura or pleuro-pulmonary disease, diagnosis of pleural collections, diagnosis of pleural fluid abnormalities in patients with pneumonia, pleural neoplasms, malignant (diffuse) mesothelioma, metastases, local fibrous tumor of the pleura (benign mesothelioma) (21 refs.)

  19. Chromosomal abnormalities and autism

    African Journals Online (AJOL)

    Farida El-Baz

    2015-06-19

    Jun 19, 2015 ... ORIGINAL ARTICLE. Chromosomal abnormalities and autism. Farida El-Baz a. , Mohamed Saad Zaghloul a. , Ezzat El Sobky a. ,. Reham M Elhossiny a,. *, Heba Salah a. , Neveen Ezy Abdelaziz b a Pediatric Department, Faculty of Medicine, Ain Shams University, Cairo, Egypt b Children with Special ...

  20. Endometrial tumour BRAF mutations and MLH1 promoter methylation as predictors of germline mismatch repair gene mutation status: a literature review.

    Science.gov (United States)

    Metcalf, Alexander M; Spurdle, Amanda B

    2014-03-01

    Colorectal cancer (CRC) that displays high microsatellite instability (MSI-H) can be caused by either germline mutations in mismatch repair (MMR) genes, or non-inherited transcriptional silencing of the MLH1 promoter. A correlation between MLH1 promoter methylation, specifically the 'C' region, and BRAF V600E status has been reported in CRC studies. Germline MMR mutations also greatly increase risk of endometrial cancer (EC), but no systematic review has been undertaken to determine if these tumour markers may be useful predictors of MMR mutation status in EC patients. Endometrial cancer cohorts meeting review inclusion criteria encompassed 2675 tumours from 20 studies for BRAF V600E, and 447 tumours from 11 studies for MLH1 methylation testing. BRAF V600E mutations were reported in 4/2675 (0.1%) endometrial tumours of unknown MMR mutation status, and there were 7/823 (0.9%) total sequence variants in exon 11 and 27/1012 (2.7%) in exon 15. Promoter MLH1 methylation was not observed in tumours from 32 MLH1 mutation carriers, or for 13 MSH2 or MSH6 mutation carriers. MMR mutation-negative individuals with tumour MLH1 and PMS2 IHC loss displayed MLH1 methylation in 48/51 (94%) of tumours. We have also detailed specific examples that show the importance of MLH1 promoter region, assay design, and quantification of methylation. This review shows that BRAF mutations occurs so infrequently in endometrial tumours they can be discounted as a useful marker for predicting MMR-negative mutation status, and further studies of endometrial cohorts with known MMR mutation status are necessary to quantify the utility of tumour MLH1 promoter methylation as a marker of negative germline MMR mutation status in EC patients.

  1. DNA methylation abnormalities in congenital heart disease.

    Science.gov (United States)

    Serra-Juhé, Clara; Cuscó, Ivon; Homs, Aïda; Flores, Raquel; Torán, Núria; Pérez-Jurado, Luis A

    2015-01-01

    Congenital heart defects represent the most common malformation at birth, occurring also in ∼50% of individuals with Down syndrome. Congenital heart defects are thought to have multifactorial etiology, but the main causes are largely unknown. We have explored the global methylation profile of fetal heart DNA in comparison to blood DNA from control subjects: an absolute correlation with the type of tissue was detected. Pathway analysis revealed a significant enrichment of differential methylation at genes related to muscle contraction and cardiomyopathies in the developing heart DNA. We have also searched for abnormal methylation profiles on developing heart-tissue DNA of syndromic and non-syndromic congenital heart defects. On average, 3 regions with aberrant methylation were detected per sample and 18 regions were found differentially methylated between groups. Several epimutations were detected in candidate genes involved in growth regulation, apoptosis and folate pathway. A likely pathogenic hypermethylation of several intragenic sites at the MSX1 gene, involved in outflow tract morphogenesis, was found in a fetus with isolated heart malformation. In addition, hypermethylation of the GATA4 gene was present in fetuses with Down syndrome with or without congenital heart defects, as well as in fetuses with isolated heart malformations. Expression deregulation of the abnormally methylated genes was detected. Our data indicate that epigenetic alterations of relevant genes are present in developing heart DNA in fetuses with both isolated and syndromic heart malformations. These epimutations likely contribute to the pathogenesis of the malformation by cis-acting effects on gene expression.

  2. Neurological abnormalities predict disability

    DEFF Research Database (Denmark)

    Poggesi, Anna; Gouw, Alida; van der Flier, Wiesje

    2014-01-01

    To investigate the role of neurological abnormalities and magnetic resonance imaging (MRI) lesions in predicting global functional decline in a cohort of initially independent-living elderly subjects. The Leukoaraiosis And DISability (LADIS) Study, involving 11 European centres, was primarily aimed...... at evaluating age-related white matter changes (ARWMC) as an independent predictor of the transition to disability (according to Instrumental Activities of Daily Living scale) or death in independent elderly subjects that were followed up for 3 years. At baseline, a standardized neurological examination.......0 years, 45 % males), 327 (51.7 %) presented at the initial visit with ≥1 neurological abnormality and 242 (38 %) reached the main study outcome. Cox regression analyses, adjusting for MRI features and other determinants of functional decline, showed that the baseline presence of any neurological...

  3. Equipment abnormality monitoring device

    International Nuclear Information System (INIS)

    Ando, Yasumasa

    1991-01-01

    When an operator hears sounds in a plantsite, the operator compares normal sounds of equipment which he previously heard and remembered with sounds he actually hears, to judge if they are normal or abnormal. According to the method, there is a worry that abnormal conditions can not be appropriately judged in a case where the number of objective equipments is increased and in a case that the sounds are changed gradually slightly. Then, the device of the present invention comprises a plurality of monitors for monitoring the operation sound of equipments, a recording/reproducing device for recording and reproducing the signals, a selection device for selecting the reproducing signals among the recorded signals, an acoustic device for converting the signals to sounds, a switching device for switching the signals to be transmitted to the acoustic device between to signals of the monitor and the recording/reproducing signals. The abnormality of the equipments can be determined easily by comparing the sounds representing the operation conditions of equipments for controlling the plant operation and the sounds recorded in their normal conditions. (N.H.)

  4. Folate metabolism abnormalities in autism: potential biomarkers.

    Science.gov (United States)

    Frye, Richard E; Slattery, John C; Quadros, Edward V

    2017-08-03

    Autism spectrum disorder (ASD) has been linked to abnormalities in folate metabolism. Polymorphisms in folate genes may act in complex polygenic ways to increase the risk of developing ASD. Autoantibodies that block folate transport into the brain have been associated with ASD and children with ASD and these autoantibodies respond to high doses of a reduced form of folate known as folinic acid (leucovorin calcium). Some of the same abnormalities are also found in mothers of children with ASD and supplementing folate during preconception and gestational periods reduces the risk to the offspring from developing ASD. These data suggest that folate pathway abnormalities may be a major metabolic disturbance underlying ASD that can be leveraged as biomarkers to improve symptoms and prevent ASD.

  5. Randomized controlled study of the effectiveness of annual and 6-monthly screening with mass miniature radiography (MMR) for the active case-finding of cardiopulmonary TB patients

    CSIR Research Space (South Africa)

    Churchyard, JG

    2003-05-01

    Full Text Available Committee Project Summary : Gen 524 Project Title: A Randomized Controlled study of the effectiveness of annual and 6-monthly screening with mass miniature radiography (MMR) for the active case-finding of cardiopulmonary TB patients Author(s... tuberculosis (TB) control programme, TB case rates in the gold mining industry have risen progressively during the 1990s to levels of over 3,000 per 100,000 men per year. Deaths while on TB treatment now account for twice as many deaths among gold miners...

  6. Feeling Abnormal: Simulation of Deviancy in Abnormal and Exceptionality Courses.

    Science.gov (United States)

    Fernald, Charles D.

    1980-01-01

    Describes activity in which student in abnormal psychology and psychology of exceptional children classes personally experience being judged abnormal. The experience allows the students to remember relevant research, become sensitized to the feelings of individuals classified as deviant, and use caution in classifying individuals as abnormal.…

  7. Abnormal glucose tolerance and lipid abnormalities in Indian ...

    African Journals Online (AJOL)

    Discussion. Regardless of varying diagnostic classification, abnormal glucose tolerance is a well-documented risk factor. 16 Abnormalities in. Because ofthe small number offemale MI survivors, the effect of obesity and abnormal glucose tolerance on lipid levels was studied in the male patients only. There was no significant.

  8. Assessing pathogenicity of MLH1 variants by co-expression of human MLH1 and PMS2 genes in yeast

    Directory of Open Access Journals (Sweden)

    Hudler Petra

    2009-10-01

    Full Text Available Abstract Background Loss of DNA mismatch repair (MMR in humans, mainly due to mutations in the hMLH1 gene, is linked to hereditary nonpolyposis colorectal cancer (HNPCC. Because not all MLH1 alterations result in loss of MMR function, accurate characterization of variants and their classification in terms of their effect on MMR function is essential for reliable genetic testing and effective treatment. To date, in vivo assays for functional characterization of MLH1 mutations performed in various model systems have used episomal expression of the modified MMR genes. We describe here a novel approach to determine accurately the functional significance of hMLH1 mutations in vivo, based on co-expression of human MLH1 and PMS2 in yeast cells. Methods Yeast MLH1 and PMS1 genes, whose protein products form the MutLα complex, were replaced by human orthologs directly on yeast chromosomes by homologous recombination, and the resulting MMR activity was tested. Results The yeast strain co-expressing hMLH1 and hPMS2 exhibited the same mutation rate as the wild-type. Eight cancer-related MLH1 variants were introduced, using the same approach, into the prepared yeast model, and their effect on MMR function was determined. Five variants (A92P, S93G, I219V, K618R and K618T were classified as non-pathogenic, whereas variants T117M, Y646C and R659Q were characterized as pathogenic. Conclusion Results of our in vivo yeast-based approach correlate well with clinical data in five out of seven hMLH1 variants and the described model was thus shown to be useful for functional characterization of MLH1 variants in cancer patients found throughout the entire coding region of the gene.

  9. Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome.

    Science.gov (United States)

    Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael

    2017-07-01

    Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

  10. Two mismatch repair gene mutations found in a colon cancer patient - which one is pathogenic?

    NARCIS (Netherlands)

    Kariola, R; Otway, R; Lonnqvist, KE; Raevaara, TE; Macrae, F; Vos, YJ; Kohonen-Corish, M; Hofstra, RMW; Nystrom-Lahti, M

    Hereditary nonpolyposis colorectal cancer (HNPCC) is a dominantly inherited cancer syndrome. Germline mutations in five different mismatch repair (MMR) genes, MSH2, MSH6, MLHI, MLH3, and PMS2 are linked to HNPCC. Here, we describe two colon cancer families in which the index patients carry missense

  11. Understanding the Pathogenicity of Noncoding Mismatch Repair Gene Promoter Variants in Lynch Syndrome.

    Science.gov (United States)

    Liu, Qing; Thompson, Bryony A; Ward, Robyn L; Hesson, Luke B; Sloane, Mathew A

    2016-05-01

    Lynch syndrome is the most common familial cancer condition that mainly predisposes to tumors of the colon and endometrium. Cancer susceptibility is caused by the autosomal dominant inheritance of a loss-of-function mutation or epimutation in one of the DNA mismatch repair (MMR) genes. Cancer risk assessment is often possible with nonsynonymous coding region mutations, but in many cases patients present with DNA sequence changes within noncoding regions, including the promoters, of MMR genes. The pathogenic role of promoter variants, and hence clinical significance, is unclear and this hinders the clinical management of carriers. In this review, we provide an overview of the classification of MMR gene variants, outline the laboratory assays and online resources that can be used to assess the causality of promoter variants in Lynch syndrome, and highlight some of the practical challenges of demonstrating the pathogenicity of these variants. In conclusion, we propose a guide that could be integrated into the current InSiGHT classification scheme to help determine if a MMR gene promoter variant is pathogenic. © 2016 WILEY PERIODICALS, INC.

  12. A Database to Support the Interpretation of Human Mismatch Repair Gene Variants

    NARCIS (Netherlands)

    Ou, Jianghua; Niessen, Renee C.; Vonk, Jan; Westers, Helga; Hofstra, Robert M. W.; Sijmons, Rolf H.

    2008-01-01

    Germline mutations in the mismatch repair (MMR) genes MLH1, MSH2, MSH6, or PMS2 can cause Lynch syndrome. This syndrome, also known as hereditary nonpolyposis colorectal cancer (HNPCC), is an autosomal dominantly-inherited disorder predominantly characterized by colorectal and endometrial cancer.

  13. Mismatch repair gene mutation spectrum in the Swedish Lynch syndrome population

    DEFF Research Database (Denmark)

    Lagerstedt-Robinson, Kristina; Rohlin, Anna; Aravidis, Christos

    2016-01-01

    . Mutation data were collected on a national basis from all laboratories involved in genetic testing. Mutation analyses were performed using mainly Sanger sequencing and multiplex ligation-dependent probe amplification. A total of 201 unique disease-predisposing MMR gene mutations were identified in 369...

  14. Exercises to Improve Gait Abnormalities

    Science.gov (United States)

    ... Articles Directories Videos Resources Contact Exercises to Improve Gait Abnormalities Home » Article Categories » Exercise and Fitness Font Size: A A A A Exercises to Improve Gait Abnormalities Next Page The manner of how a ...

  15. 'Just that little bit of doubt': Scottish parents', teenage girls' and health professionals' views of the MMR, H1N1 and HPV vaccines.

    Science.gov (United States)

    Kennedy, Catriona; Gray Brunton, Carol; Hogg, Rhona

    2014-02-01

    Parental decision making about childhood vaccinations is complex and the vaccination schedule ever-changing. Vaccination may be controversial even in countries with historically high vaccination rates such as Scotland. Health behaviour models have aided understanding of individual vaccine intentions for specific vaccines. These are limited in explaining actual behaviours and are divorced from the impact of socio-cultural contexts on vaccination decision making. To explore vaccination views in Scotland amongst parents, teenage girls and health professionals across three controversial vaccines: the Measles, Mumps, Rubella (MMR), the Human Papilloma virus (HPV) and the Influenza A (H1N1) vaccine. We used qualitative interviews and focus group discussions in a purposive sample of health professionals (n = 51), parents (n = 15) and teenage girls aged 12-15 years (n = 8) about their views of these vaccines. Discussions were analysed using thematic analysis. Two main themes are highlighted: 'vaccine risks revisited' in which we explored how the MMR legacy resurfaced and how worries about vaccine safety permeated the data. 'Vaccine responsibilities' indicated tensions regarding roles and responsibilities for vaccines. An overarching notion of 'just that little bit of doubt' referred to lingering doubts and uncertainties interwoven across the vaccines. Public health authorities should remain alert towards pervasive vaccine concerns. It is important for authorities to clarify vaccine roles and responsibilities in the face of new and existing vaccines and to acknowledge public concerns regarding vaccine safety.

  16. [Penile congenital abnormalities].

    Science.gov (United States)

    Boillot, B; Teklali, Y; Moog, R; Droupy, S

    2013-07-01

    Congenital abnormalities of the penis are usually diagnosed at birth and pose aesthetic and functional problems sometimes requiring surgical management. A literature review was conducted on Medline considering the articles listed until January 2012. Hypospadias is the most common malformation (1 in 250 boys. Familial forms: 7%). The causes remain hypothetical but the doubling of the incidence in 30 years could be linked to fetal exposure to endocrine disruptors "estrogen-like" used in the food industry in particular. Surgical treatment is usually intended to improve the aesthetic appearance but sometimes, in case of significant curvature or posterior meatus, necessary for normal sexual life and fertility. Other malformations (epispades, buried penis, transpositions, twists and preputial abnormalities) as well as management for functional or aesthetic consequences of these malformations in adulthood require complex surgical care in a specialized environment. The improvement of surgical techniques and pediatric anesthesia allows an early and effective specialized surgical approach of penile malformations. Management of sequelae in adulthood must be discussed and requires experience of surgical techniques on pediatric and adult penis. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  17. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  18. Epigenetic alteration of mismatch repair genes in the population chronically exposed to arsenic in West Bengal, India.

    Science.gov (United States)

    Bhattacharjee, Pritha; Sanyal, Tamalika; Bhattacharjee, Sandip; Bhattacharjee, Pritha

    2018-02-27

    Arsenic exposure and its adverse health outcome, including the association with cancer risk are well established from several studies across the globe. The present study aims to analyze the epigenetic regulation of key mismatch repair (MMR) genes in the arsenic-exposed population. A case-control study was conducted involving two hundred twenty four (N=224) arsenic exposed [with skin lesion (WSL=110) and without skin lesion (WOSL=114)] and one hundred and two (N=102) unexposed individuals. The methylation status of key MMR genes i.e. MLH1, MSH2, and PMS2 were analyzed using methylation-specific PCR (MSP). The gene expression was studied by qRTPCR. The expression of H3K36me3, which was earlier reported to be an important regulator of MMR pathway, was assessed using ELISA. Arsenic-exposed individuals showed significant promoter hypermethylation (p gene expression [MLH1 (p=0.001) and MSH2 (prepair genes due to promoter hypermethylation of MLH1 and MSH2 and inefficient recruitment of MMR complex at the site of DNA damage owing to the reduced level of H3K36me3 impairs the mismatch repair pathway that might render the arsenic-exposed individuals more susceptible towards DNA damage and associated cancer risk. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. A Rare Stapes Abnormality

    Directory of Open Access Journals (Sweden)

    Hala Kanona

    2015-01-01

    Full Text Available The aim of this study is to increase awareness of rare presentations, diagnostic difficulties alongside management of conductive hearing loss and ossicular abnormalities. We report the case of a 13-year-old female reporting progressive left-sided hearing loss and high resolution computed tomography was initially reported as normal. Exploratory tympanotomy revealed an absent stapedius tendon and lack of connection between the stapes superstructure and footplate. The footplate was fixed. Stapedotomy and stapes prosthesis insertion resulted in closure of the air-bone gap by 50 dB. A review of world literature was performed using MedLine. Middle ear ossicular discontinuity can result in significant conductive hearing loss. This can be managed effectively with surgery to help restore hearing. However, some patients may not be suitable or decline surgical intervention and can be managed safely conservatively.

  20. Analysis of Lynch Syndrome Mismatch Repair Genes in Women with Endometrial Cancer.

    Science.gov (United States)

    Rubio, Izaskun; Ibáñez-Feijoo, Eduardo; Andrés, Leire; Aguirre, Elena; Balmaña, Judith; Blay, Pilar; Llort, Gemma; González-Santiago, Santiago; Maortua, Hiart; Tejada, Maria Isabel; Martinez-Bouzas, Cristina

    2016-01-01

    Endometrial cancer is the second most frequent neoplasm in women with Lynch syndrome (LS). We sought to assess whether analyzing women with endometrial cancer would identify families with LS not identified with current clinical criteria. We included women diagnosed with endometrial cancer younger than 50 years and also older if they had a family cancer history associated with LS. In blood samples obtained, we analyzed mutations in mismatch repair (MMR) genes, as well as protein expression by immunohistochemistry and microsatellite instability (MSI) in tumour tissue. A total of 103 patients were enrolled. We detected 14 pathogenic mutations and 4 genetic variants of unknown clinical significance in MMR genes. We found MSI in 41.66% of the women with a pathogenic mutation. In this group, 76.92% showed loss of at least one MMR protein. Women with mutations were younger at diagnosis, but all of them had a family history compatible with LS. Analysis of the MMR genes, in particular MSH6, seems to be appropriate in women with endometrial cancer and a family history of tumours associated with LS. © 2016 S. Karger AG, Basel.

  1. Microsatellite instability, promoter methylation and protein expression of the DNA mismatch repair genes in epithelial ovarian cancer.

    Science.gov (United States)

    V, Shilpa; Bhagat, Rahul; C S, Premalata; V R, Pallavi; Krishnamoorthy, Lakshmi

    2014-10-01

    The role of defective mismatch repair (MMR) system in ovarian carcinoma is not well defined. The purpose of the study was to determine the relationship between microsatellite instability (MSI), promoter methylation and protein expression of MMR genes in epithelial ovarian carcinoma (EOC). MSI and promoter methylation of MLH1, MSH2 and PMS2 genes were studied using PCR methods in the study cohort. A small subset of samples was used to analyze the protein expression by immunohistochemistry (IHC). MSI was observed in >60% of tumor samples and 47% of normal ovaries. MLH1 was methylated in 37.5% and 64.3% EOCs and LMP tumors. The loss of immunoexpression of MMR genes was not seen in ovarian tumors. There was no correlation between MSI, promoter methylation and protein expression of the MMR genes suggesting that each may function independently. MSI is a common event in ovarian carcinoma and may increase the clinical awareness of the subset of tumors. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Abnormal pressure in hydrocarbon environments

    Science.gov (United States)

    Law, B.E.; Spencer, C.W.

    1998-01-01

    Abnormal pressures, pressures above or below hydrostatic pressures, occur on all continents in a wide range of geological conditions. According to a survey of published literature on abnormal pressures, compaction disequilibrium and hydrocarbon generation are the two most commonly cited causes of abnormally high pressure in petroleum provinces. In young (Tertiary) deltaic sequences, compaction disequilibrium is the dominant cause of abnormal pressure. In older (pre-Tertiary) lithified rocks, hydrocarbon generation, aquathermal expansion, and tectonics are most often cited as the causes of abnormal pressure. The association of abnormal pressures with hydrocarbon accumulations is statistically significant. Within abnormally pressured reservoirs, empirical evidence indicates that the bulk of economically recoverable oil and gas occurs in reservoirs with pressure gradients less than 0.75 psi/ft (17.4 kPa/m) and there is very little production potential from reservoirs that exceed 0.85 psi/ft (19.6 kPa/m). Abnormally pressured rocks are also commonly associated with unconventional gas accumulations where the pressuring phase is gas of either a thermal or microbial origin. In underpressured, thermally mature rocks, the affected reservoirs have most often experienced a significant cooling history and probably evolved from an originally overpressured system.

  3. The CREB Coactivator CRTC2 Is a Lymphoma Tumor Suppressor that Preserves Genome Integrity through Transcription of DNA Mismatch Repair Genes.

    Science.gov (United States)

    Fang, Minggang; Pak, Magnolia L; Chamberlain, Lynn; Xing, Wei; Yu, Hongbo; Green, Michael R

    2015-06-09

    The CREB-regulated transcription coactivator CRTC2 stimulates CREB target gene expression and has a well-established role in modulating glucose and lipid metabolism. Here, we find, unexpectedly, that loss of CRTC2, as well as CREB1 and its coactivator CREB-binding protein (CBP), results in a deficiency in DNA mismatch repair (MMR) and a resultant increased mutation frequency. We show that CRTC2, CREB1, and CBP are transcriptional activators of well-established MMR genes, including EXO1, MSH6, PMS1, and POLD2. Mining of expression profiling databases and analysis of patient samples reveal that CRTC2 and its target MMR genes are downregulated in specific T cell lymphoma subtypes, which are microsatellite unstable. The levels of acetylated histone H3 on the CRTC2 promoter are significantly reduced in lymphoma in comparison to normal tissue, explaining the decreased CRTC2 expression. Our results establish a role for CRTC2 as a lymphoma tumor suppressor gene that preserves genome integrity by stimulating transcription of MMR genes. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Variations in mismatch repair genes and colorectal cancer risk and clinical outcome.

    Science.gov (United States)

    Vymetalkova, Veronika; Pardini, Barbara; Rosa, Fabio; Di Gaetano, Cornelia; Novotny, Jan; Levy, Miroslav; Buchler, Tomas; Slyskova, Jana; Vodickova, Ludmila; Naccarati, Alessio; Vodicka, Pavel

    2014-07-01

    DNA mismatch repair (MMR) deficiency is one of the best understood forms of genetic instability in colorectal cancer (CRC). CRC is routinely cured by 5-fluorouracil (5-FU)-based chemotherapy, with a prognostic effect and resistance to such therapy conferred by MMR status. In this study, we aimed to analyse the effect of genetic variants in classical coding regions or in less-explored predicted microRNA (miRNA)-binding sites in the 3' untranslated region (3'UTR) of MMR genes on the risk of CRC, prognosis and the efficacy of 5-FU therapy. Four single nucleotide polymorphisms (SNPs) in MMR genes were initially tested for susceptibility to CRC in a case-control study (1095 cases and 1469 healthy controls). Subsequently, the same SNPs were analysed for their role in survival on a subset of patients with complete follow-up. Two SNPs in MLH3 and MSH6 were associated with clinical outcome. Among cases with colon and sigmoideum cancer, carriers of the CC genotype of rs108621 in the 3'UTR of MLH3 showed a significantly increased survival compared to those with the CT + TT genotype (log-rank test, P = 0.05). Moreover, this polymorphism was also associated with an increased risk of relapse or metastasis in patients with heterozygous genotype (log-rank test, P = 0.03). Patients carrying the CC genotype for MSH6 rs1800935 (D180D) and not undergoing 5-FU-based chemotherapy showed a decreased number of recurrences (log-rank test, P = 0.03). No association with CRC risk was observed. We provide the first evidence that variations in potential miRNA target-binding sites in the 3'UTR of MMR genes may contribute to modulate CRC prognosis and predictivity of therapy. © The Author 2014. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Recurrent Cytogenetic Abnormalities in Acute Myeloid Leukemia.

    Science.gov (United States)

    Yang, John J; Park, Tae Sung; Wan, Thomas S K

    2017-01-01

    The spectrum of chromosomal abnormality associated with leukemogenesis of acute myeloid leukemia (AML) is broad and heterogeneous when compared to chronic myeloid leukemia and other myeloid neoplasms. Recurrent chromosomal translocations such as t(8;21), t(15;17), and inv(16) are frequently detected, but hundreds of other uncommon chromosomal aberrations from AML also exist. This chapter discusses 22 chromosomal abnormalities that are common structural, numerical aberrations, and other important but infrequent (less than 1 %) translocations emphasized in the WHO classification. Brief morphologic, cytogenetic, and clinical characteristics are summarized, so as to provide a concise reference to cancer cytogenetic laboratories. Morphology based on FAB classification is used together with the current WHO classification due to frequent mentioning in a vast number of reference literatures. Characteristic chromosomal aberrations of other myeloid neoplasms such as myelodysplastic syndrome and myeloproliferative neoplasm will be discussed in separate chapters-except for certain abnormalities such as t(9;22) in de novo AML. Gene mutations detected in normal karyotype AML by cutting edge next generation sequencing technology are also briefly mentioned.

  6. Evaluating the performance of clinical criteria for predicting mismatch repair gene mutations in Lynch syndrome: a comprehensive analysis of 3,671 families.

    Science.gov (United States)

    Steinke, Verena; Holzapfel, Stefanie; Loeffler, Markus; Holinski-Feder, Elke; Morak, Monika; Schackert, Hans K; Görgens, Heike; Pox, Christian; Royer-Pokora, Brigitte; von Knebel-Doeberitz, Magnus; Büttner, Reinhard; Propping, Peter; Engel, Christoph

    2014-07-01

    Carriers of mismatch repair (MMR) gene mutations have a high lifetime risk for colorectal and endometrial cancers, as well as other malignancies. As mutation analysis to detect these patients is expensive and time-consuming, clinical criteria and tumor-tissue analysis are widely used as pre-screening methods. The aim of our study was to evaluate the performance of commonly applied clinical criteria (the Amsterdam I and II Criteria, and the original and revised Bethesda Guidelines) and the results of tumor-tissue analysis in predicting MMR gene mutations. We analyzed 3,671 families from the German HNPCC Registry and divided them into nine mutually exclusive groups with different clinical criteria. A total of 680 families (18.5%) were found to have a pathogenic MMR gene mutation. Among all 1,284 families with microsatellite instability-high (MSI-H) colorectal cancer, the overall mutation detection rate was 53.0%. Mutation frequencies and their distribution between the four MMR genes differed significantly between clinical groups (p small-bowel cancer (p small-bowel cancer were clinically relevant predictors for Lynch syndrome. © 2013 UICC.

  7. Identification of mismatch repair gene mutations in young patients with colorectal cancer and in patients with multiple tumours associated with hereditary non-polyposis colorectal cancer

    NARCIS (Netherlands)

    Niessen, R C; Berends, M J W; Wu, Y; Sijmons, R H; Hollema, H; Ligtenberg, M J L; de Walle, H E K; de Vries, E G E; Karrenbeld, A; Buys, C H C M; van der Zee, A G J; Hofstra, R M W; Kleibeuker, J H

    2006-01-01

    Background: Patients with early-onset colorectal cancer (CRC) or those with multiple tumours associated with hereditary non-polyposis colorectal cancer (HNPCC) raise suspicion of the presence of germline DNA mismatch repair (MMR) gene mutations. Aim: To analyse the value of family history,

  8. Somatosensory abnormalities in knee OA.

    Science.gov (United States)

    Wylde, Vikki; Palmer, Shea; Learmonth, Ian D; Dieppe, Paul

    2012-03-01

    The aim of this study was to use quantitative sensory testing (QST) to explore the range and prevalence of somatosensory abnormalities demonstrated by patients with advanced knee OA. One hundred and seven knee OA patients and 50 age- and sex-matched healthy participants attended a 1-h QST session. Testing was performed on the medial side of the knee and the pain-free forearm. Light-touch thresholds were assessed using von Frey filaments, pressure pain thresholds using a digital pressure algometer, and thermal sensation and pain thresholds using a Thermotest MSA. Significant differences in median threshold values from knee OA patients and healthy participants were identified using Mann-Whitney U-tests. The z-score transformations were used to determine the prevalence of the different somatosensory abnormalities in knee OA patients. Testing identified 70% of knee OA patients as having at least one somatosensory abnormality. Comparison of median threshold values between knee OA patients and healthy participants revealed that patients had localized thermal and tactile hypoaesthesia and pressure hyperalgesia at the osteoarthritic knee. Tactile hypoaesthesia and pressure hyperalgesia were also present at the pain-free forearm. The most prevalent somatosensory abnormalities were tactile hypoaesthesia and pressure hyperalgesia, evident in between 20 and 34% of patients. This study found that OA patients demonstrate an array of somatosensory abnormalities, of which the most prevalent were tactile hypoaesthesia and pressure hyperalgesia. Further research is now needed to establish the clinical implications of these somatosensory abnormalities.

  9. Abnormal Fhit protein expression and high frequency of microsatellite instability in sporadic colorectal cancer.

    Science.gov (United States)

    Sarli, Leopoldo; Bottarelli, Lorena; Azzoni, Cinzia; Campanini, Nicoletta; Di Cola, Gabriella; Bader, Giovanni; Iusco, Domenico; Salvemini, Carlo; Caruso, Giuseppe; Donadei, Enrico; Pizzi, Silvia; D'Adda, Tiziana; Renato, Costi; Roncoroni, Luigi; Bordi, Cesare

    2004-07-01

    The role of Fhit protein in the oncogenesis of colorectal cancer is still in debate. Recent studies have revealed that reduced Fhit protein expression is associated with a deficiency of the mismatch repair protein. One hundred and twenty unselected patients who underwent curative resection for sporadic colorectal cancer in a three-year period were evaluated for microsatellite instability (MSI) using six microsatellite markers, and for the presence of Fhit and mismatch repair (MMR) proteins (Mlh1 and Msh2) by means of immunostaining. The relations between these markers were analysed. Reduced or absent Fhit expression was noted in 18 out of 118 patients. This altered expression was significantly higher in right-sided cancer (P = 0.005), mucinous tumours (P = 0.005) and in poorly differentiated histological types (P = 0.0001). MSI was found in 22 out of 109 patients, more so in right-sided cancer (P = 0.0001), poorly differentiated histology (P = 0.0001), and mucinous tumours (P = 0.0001). No association was found with TNM stage. MSI was present in 66.7% of tumours with altered Fhit expression and in only 10% of tumours with preserved or intermediate Fhit expression (P = 0.0001). Of the tumours with reduced or absent Fhit expression, 72.2% had loss of nuclear Mlh1 or Msh2 expression compared with only 14% of the preserved or intermediate Fhit expression tumours (P = 0.0001). These results support the hypothesis that deficiency in a MMR gene could be a cause of the high frequency of alterations in Fhit expression, and they permit the suggestion that FHIT gene alteration may be part of the genetic pathway involving MSI through which some colorectal cancers arise.

  10. [DNA methylation and development abnormalities in cloned animals].

    Science.gov (United States)

    Yang, Rong-Rong; Li, Xiang-Yun

    2007-09-01

    Most cloned animals by nuclear transfer were dead before their births, and only a few can develop to their late gestation or adulthood. Although some cloned offsprings can survive, they often have some development disfigurements and abnormal phenotypes in various degrees. DNA methylation is an important modifiable manner of epigenetic dominating the correct expression of gene. It is a main instrument of regulating genome function and plays a prominent part in the embryonic normal development. Through researching the pattern of DNA methylation, we found that there were many abnormal DNA methylation patterns in cloned animals, which might be the primary reasons for inducing premature death of cloned embryos and development abnormalities of cloned animals. This article discusses the function of DNA methylation, the aberrant DNA methylation patterns in cloned animals, and the reasons of inducing abnormal DNA methylation in cloned animals.

  11. Novel Mutations in MLH1 and MSH2 Genes in Mexican Patients with Lynch Syndrome

    Directory of Open Access Journals (Sweden)

    Jose Miguel Moreno-Ortiz

    2016-01-01

    Full Text Available Background. Lynch Syndrome (LS is characterized by germline mutations in the DNA mismatch repair (MMR genes MLH1, MSH2, MSH6, and PMS2. This syndrome is inherited in an autosomal dominant pattern and is characterized by early onset colorectal cancer (CRC and extracolonic tumors. The aim of this study was to identify mutations in MMR genes in three Mexican patients with LS. Methods. Immunohistochemical analysis was performed as a prescreening method to identify absent protein expression. PCR, Denaturing High Performance Liquid Chromatography (dHPLC, and Sanger sequencing complemented the analysis. Results. Two samples showed the absence of nuclear staining for MLH1 and one sample showed loss of nuclear staining for MSH2. The mutations found in MLH1 gene were c.2103+1G>C in intron 18 and compound heterozygous mutants c.1852_1854delAAG (p.K618del and c.1852_1853delinsGC (p.K618A in exon 16. In the MSH2 gene, we identified mutation c.638dupT (p.L213fs in exon 3. Conclusions. This is the first report of mutations in MMR genes in Mexican patients with LS and these appear to be novel.

  12. Oral abnormalities in the Ellis-van Creveld syndrome

    Directory of Open Access Journals (Sweden)

    Babaji Prashant

    2010-01-01

    Full Text Available Ellis-van Creveld (EvC syndrome is an autosomal recessive disorder, mainly affecting the ectodermal components such as, enamel, nail, and hair. The gene for EvC syndrome is located on chromosome 4p16. Patients with EvC syndrome characteristically presents with congenitally missing teeth, abnormal frenal attachment, microdontia, and hexadactyly.

  13. Neuroimaging abnormalities in Griscelli's disease

    International Nuclear Information System (INIS)

    Sarper, Nazan; Akansel, Guer; Aydogan, Metin; Gedikbasi, Demet; Babaoglu, Kadir; Goekalp, Ayse Sevim

    2002-01-01

    Griscelli's disease is a rare autosomal recessive immunodeficiency syndrome. We report a 7-1/2-month-old white girl who presented with this syndrome, but initially without neurological abnormalities. Initial CT of the brain was normal. Despite haematological remission with chemotherapy, she developed neurological symptoms, progressing to coma. At this time, CT showed areas of coarse calcification in the globi pallidi, left parietal white matter and left brachium pontis. Hypodense areas were present in the genu and posterior limb of the internal capsule on the right side, as well as posterior aspects of both thalami, together with minimal generalised atrophy. MRI revealed areas of increased T2 signal and a focal area of abnormal enhancement in the subcortical white matter. Griscelli's disease should be added to the list of acquired neuroimaging abnormalities in infants. (orig.)

  14. Incidence of legal abortions and congenital abnormalities in Hungary

    International Nuclear Information System (INIS)

    Czeizel, A.E.

    1991-01-01

    The annual and monthly distributions of congenital abnormalities and pregnancy outcomes as confounding factors were evaluated in Hungary in reflection of the accident at the Chernobyl reactor. The different congenital abnormality entities and the components of fetal radiation syndrome did not show a higher rate after the Chernobyl accident in the data-set of the Hungarian Congenital Abnormality Registry. Among confounding factors, the rate of induced abortions did not increase after the Chernobyl accident in Hungary. In the 9th month after the peak of public concern (May and June, 1986) the rate of livebirths decreased. Three indicator conditions: 15 sentinel anomalies as indicators of germinal dominant gene mutations, Down syndrome as an indicator of germinal numerical and structural chromosomal mutations, and unidentified multiple congenital abnormalities as indicators of germinal dominant gene and chromosomal mutations were selected from the material of the Hungarian Congenital Abnormality Registry. Diagnoses were checked, familial and sporadic cases were separated and only the sporadic cases were evaluated. The analysis of indicator conditions did not reveal any measurable germinal mutagenic effect of the Chernobyl accident in Hungary

  15. Prognostic impact of mismatch repair genes germline defects in colorectal cancer patients: are all mutations equal?

    Science.gov (United States)

    Maccaroni, Elena; Bracci, Raffaella; Giampieri, Riccardo; Bianchi, Francesca; Belvederesi, Laura; Brugiati, Cristiana; Pagliaretta, Silvia; Del Prete, Michela; Scartozzi, Mario; Cascinu, Stefano

    2015-01-01

    Background Lynch syndrome (LS) is the most common hereditary colorectal cancer (CRC) syndrome, caused by germline mutations in MisMatch Repair (MMR) genes, particularly in MLH1, MSH2 and MSH6. Patients with LS seem to have a more favourable prognosis than those with sporadic CRC, although the prognostic impact of different mutation types is unknown. Aim of our study is to compare survival outcomes of different types of MMR mutations in patients with LS-related CRC. Methods 302 CRC patients were prospectively selected on the basis of Amsterdam or Revised Bethesda criteria to undergo genetic testing: direct sequencing of DNA and MLPA were used to examine the entire MLH1, MSH2 and MSH6 coding sequence. Patients were classified as mutation-positive or negative according to the genetic testing result. Results A deleterious MMR mutation was found in 38/302 patients. Median overall survival (OS) was significantly higher in mutation-positive vs mutation-negative patients (102.6 vs 77.7 months, HR:0.63, 95%CI:0.46–0.89, p = 0.0083). Different types of mutation were significantly related with OS: missense or splicing-site mutations were associated with better OS compared with rearrangement, frameshift or non-sense mutations (132.5 vs 82.5 months, HR:0.46, 95%CI:0.16–0.82, p = 0.0153). Conclusions Our study confirms improved OS for LS-patients compared with mutation-negative CRC patients. In addition, not all mutations could be considered equal: the better prognosis in CRC patients with MMR pathogenic missense or splicing site mutation could be due to different functional activity of the encoded MMR protein. This matter should be investigated by use of functional assays in the future. PMID:26485756

  16. Triorchidism: A Rare Genitourinary Abnormality

    African Journals Online (AJOL)

    During early adulthood it will be carried out by palpation, ultrasonography, semen analysis, serum testosterone and follicle stimulating hormone levels and during late adulthood follow up will be done by ultrasonography for malignancy every 2 years. CONCLUSION. Polyorchidism is a rare genitourinary abnormality and its.

  17. Chromosomal abnormalities associated with omphalocele.

    Science.gov (United States)

    Chen, Chih-Ping

    2007-03-01

    Fetuses with omphalocele have an increased risk for chromosomal abnormalities. The risk varies with maternal age, gestational age at diagnosis, association with umbilical cord cysts, complexity of associated anomalies, and the contents of omphalocele. There is considerable evidence that genetics contributes to the etiology of omphalocele. This article provides an overview of chromosomal abnormalities associated with omphalocele and a comprehensive review of associated full aneuploidy such as trisomy 18, trisomy 13, triploidy, trisomy 21, 45,X, 47,XXY, and 47,XXX, partial aneuploidy such as dup (3q), dup (11p), inv (11), dup (1q), del (1q), dup (4q), dup (5p), dup (6q), del (9p), dup (15q), dup(17q), Pallister-Killian syndrome with mosaic tetrasomy 12p and Miller-Dieker lissencephaly syndrome with deletion of 17p13.3, and uniparental disomy (UPD) such as UPD 11 and UPD 14. Omphalocele is a prominent marker for chromosomal abnormalities. Perinatal identification of omphalocele should alert chromosomal abnormalities and familial unbalanced translocations, and prompt thorough cytogenetic investigations and genetic counseling.

  18. Chromosomal Abnormalities Associated With Omphalocele

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chen

    2007-03-01

    Full Text Available Fetuses with omphalocele have an increased risk for chromosomal abnormalities. The risk varies with maternal age, gestational age at diagnosis, association with umbilical cord cysts, complexity of associated anomalies, and the contents of omphalocele. There is considerable evidence that genetics contributes to the etiology of omphalocele. This article provides an overview of chromosomal abnormalities associated with omphalocele and a comprehensive review of associated full aneuploidy such as trisomy 18, trisomy 13, triploidy, trisomy 21, 45,X, 47,XXY, and 47,XXX, partial aneuploidy such as dup(3q, dup(11p, inv(11, dup(1q, del(1q, dup(4q, dup(5p, dup(6q, del(9p, dup(15q, dup(17q, Pallister-Killian syndrome with mosaic tetrasomy 12p and Miller-Dieker lissencephaly syndrome with deletion of 17p13.3, and uniparental disomy (UPD such as UPD 11 and UPD 14. Omphalocele is a prominent marker for chromosomal abnormalities. Perinatal identification of omphalocele should alert chromosomal abnormalities and familial unbalanced translocations, and prompt thorough cytogenetic investigations and genetic counseling.

  19. Admission haematological abnormalities and postoperative ...

    African Journals Online (AJOL)

    Admission haematological abnormalities and postoperative outcomes in neonates with acute surgical conditions in Alexandria, Egypt. HL Wella, SMM Farahat. Abstract. No Abstract. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · AJOL African Journals ...

  20. Role of APC and DNA mismatch repair genes in the development of colorectal cancers

    Directory of Open Access Journals (Sweden)

    Roy Deodutta

    2003-12-01

    Full Text Available Abstract Colorectal cancer is the third most common cause of cancer-related death in both men and women in the western hemisphere. According to the American Cancer Society, an estimated 105,500 new cases of colon cancer with 57,100 deaths will occur in the U.S. in 2003, accounting for about 10% of cancer deaths. Among the colon cancer patients, hereditary risk contributes approximately 20%. The main inherited colorectal cancers are the familial adenomatous polyposis (FAP and the hereditary nonpolyposis colorectal cancers (HNPCC. The FAP and HNPCC are caused due to mutations in the adenomatous polyposis coli (APC and DNA mismatch repair (MMR genes. The focus of this review is to summarize the functions of APC and MMR gene products in the development of colorectal cancers.

  1. Sensorineural Deafness, Distinctive Facial Features and Abnormal Cranial Bones

    Science.gov (United States)

    Gad, Alona; Laurino, Mercy; Maravilla, Kenneth R.; Matsushita, Mark; Raskind, Wendy H.

    2008-01-01

    The Waardenburg syndromes (WS) account for approximately 2% of congenital sensorineural deafness. This heterogeneous group of diseases currently can be categorized into four major subtypes (WS types 1-4) on the basis of characteristic clinical features. Multiple genes have been implicated in WS, and mutations in some genes can cause more than one WS subtype. In addition to eye, hair and skin pigmentary abnormalities, dystopia canthorum and broad nasal bridge are seen in WS type 1. Mutations in the PAX3 gene are responsible for the condition in the majority of these patients. In addition, mutations in PAX3 have been found in WS type 3 that is distinguished by musculoskeletal abnormalities, and in a family with a rare subtype of WS, craniofacial-deafness-hand syndrome (CDHS), characterized by dysmorphic facial features, hand abnormalities, and absent or hypoplastic nasal and wrist bones. Here we describe a woman who shares some, but not all features of WS type 3 and CDHS, and who also has abnormal cranial bones. All sinuses were hypoplastic, and the cochlea were small. No sequence alteration in PAX3 was found. These observations broaden the clinical range of WS and suggest there may be genetic heterogeneity even within the CDHS subtype. PMID:18553554

  2. Placental Abnormalities and Preeclampsia in Trisomy 13 Pregnancies

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chen

    2009-03-01

    Full Text Available Women who are carrying a trisomy 13 fetus are prone to have an abnormal placenta as well as to develop preeclampsia in the second and third trimesters. This article provides a comprehensive review of placental abnormalities, such as small placental volume, reduced placental vascularization, a partial molar appearance of the placenta and placental mesenchymal dysplasia, and preeclampsia associated with trisomy 13 pregnancies. The candidate preeclampsia-causing genes on chromosome 13, such as sFlt1, COL4A2 and periostin, are discussed.

  3. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    Science.gov (United States)

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  4. Mismatch repair gene mutation spectrum in the Swedish Lynch syndrome population.

    Science.gov (United States)

    Lagerstedt-Robinson, Kristina; Rohlin, Anna; Aravidis, Christos; Melin, Beatrice; Nordling, Margareta; Stenmark-Askmalm, Marie; Lindblom, Annika; Nilbert, Mef

    2016-11-01

    Lynch syndrome caused by constitutional mismatch‑repair defects is one of the most common hereditary cancer syndromes with a high risk for colorectal, endometrial, ovarian and urothelial cancer. Lynch syndrome is caused by mutations in the mismatch repair (MMR) genes i.e., MLH1, MSH2, MSH6 and PMS2. After 20 years of genetic counseling and genetic testing for Lynch syndrome, we have compiled the mutation spectrum in Sweden with the aim to provide a population-based perspective on the contribution from the different MMR genes, the various types of mutations and the influence from founder mutations. Mutation data were collected on a national basis from all laboratories involved in genetic testing. Mutation analyses were performed using mainly Sanger sequencing and multiplex ligation-dependent probe amplification. A total of 201 unique disease-predisposing MMR gene mutations were identified in 369 Lynch syndrome families. These mutations affected MLH1 in 40%, MSH2 in 36%, MSH6 in 18% and PMS2 in 6% of the families. A large variety of mutations were identified with splice site mutations being the most common mutation type in MLH1 and frameshift mutations predominating in MSH2 and MSH6. Large deletions of one or several exons accounted for 21% of the mutations in MLH1 and MSH2 and 22% in PMS2, but were rare (4%) in MSH6. In 66% of the Lynch syndrome families the variants identified were private and the effect from founder mutations was limited and predominantly related to a Finnish founder mutation that accounted for 15% of the families with mutations in MLH1. In conclusion, the Swedish Lynch syndrome mutation spectrum is diverse with private MMR gene mutations in two-thirds of the families, has a significant contribution from internationally recognized mutations and a limited effect from founder mutations.

  5. Risk of metachronous colon cancer following surgery for rectal cancer in mismatch repair gene mutation carriers.

    Science.gov (United States)

    Win, Aung Ko; Parry, Susan; Parry, Bryan; Kalady, Matthew F; Macrae, Finlay A; Ahnen, Dennis J; Young, Graeme P; Lipton, Lara; Winship, Ingrid; Boussioutas, Alex; Young, Joanne P; Buchanan, Daniel D; Arnold, Julie; Le Marchand, Loïc; Newcomb, Polly A; Haile, Robert W; Lindor, Noralane M; Gallinger, Steven; Hopper, John L; Jenkins, Mark A

    2013-06-01

    Despite regular surveillance colonoscopy, the metachronous colorectal cancer risk for mismatch repair (MMR) gene mutation carriers after segmental resection for colon cancer is high and total or subtotal colectomy is the preferred option. However, if the index cancer is in the rectum, management decisions are complicated by considerations of impaired bowel function. We aimed to estimate the risk of metachronous colon cancer for MMR gene mutation carriers who underwent a proctectomy for index rectal cancer. This retrospective cohort study comprised 79 carriers of germline mutation in a MMR gene (18 MLH1, 55 MSH2, 4 MSH6, and 2 PMS2) from the Colon Cancer Family Registry who had had a proctectomy for index rectal cancer. Cumulative risks of metachronous colon cancer were calculated using the Kaplan-Meier method. During median 9 years (range 1-32 years) of observation since the first diagnosis of rectal cancer, 21 carriers (27 %) were diagnosed with metachronous colon cancer (incidence 24.25, 95 % confidence interval [CI] 15.81-37.19 per 1,000 person-years). Cumulative risk of metachronous colon cancer was 19 % (95 % CI 9-31 %) at 10 years, 47 (95 % CI 31-68 %) at 20 years, and 69 % (95 % CI 45-89 %) at 30 years after surgical resection. The frequency of surveillance colonoscopy was 1 colonoscopy per 1.16 years (95 % CI 1.01-1.31 years). The AJCC stages of the metachronous cancers, where available, were 72 % stage I, 22 % stage II, and 6 % stage III. Given the high metachronous colon cancer risk for MMR gene mutation carriers diagnosed with an index rectal cancer, proctocolectomy may need to be considered.

  6. A study of molecular signals deregulating mismatch repair genes in prostate cancer compared to benign prostatic hyperplasia.

    Science.gov (United States)

    Basu, Sanmitra; Majumder, Subhadipa; Bhowal, Ankur; Ghosh, Alip; Naskar, Sukla; Nandy, Sumit; Mukherjee, Subhabrata; Sinha, Rajan Kumar; Basu, Keya; Karmakar, Dilip; Banerjee, Soma; Sengupta, Sanghamitra

    2015-01-01

    Prostate cancer is one of the leading causes of mortality among aging males. There is an unmet requirement of clinically useful biomarkers for early detection of prostate cancer to reduce the liabilities of overtreatment and accompanying morbidity. The present population-based study investigates the factors disrupting expression of multiple functionally related genes of DNA mismatch repair pathway in prostate cancer patients to identify molecular attributes distinguishing adenocarcinoma from benign hyperplasia of prostate. Gene expression was compared between tissue samples from prostate cancer and benign prostatic hyperplasia using real-time-PCR, western blot and immunohistochemistry. Assessment of genotypes of seven single-nucleotide-polymorphisms of three MMR genes was conducted using PCR-coupled RFLP and sequencing. Promoter methylation was interrogated by methylation-specific-PCR and bisulfite-sequencing. Interaction between microRNAs and MMR genes was verified by 3'UTR-based dual luciferase assays. Concurrent reduction of three MMR genes namely hMLH1, hMSH6 and hMSH2 (34-85%, Pgene expressions were significantly elevated (66-85%, Pgenes. hsa-miR-155 & hsa-miR-141 and hsa-miR-155 & hsa-miR-21 were demonstrated to bind to their putative seed sequences in hMLH1 and hMSH6 3'UTRs respectively. Relatively higher expression of DNA methyl-transferases (DNMT1 and DNMT3b) and HIF-1α genes (34-50%, P<0.05) were also detected in tumor tissues. This study provides statistical evidence that MMR deficiency is correlated with hypermethylation of hMLH1 promoter and upregulation of hsa-miR-155, hsa-miR-141 and hsa-miR-21 in prostate cancer. This comparative study reflects that microRNA expression level, particularly hsa-miR-155, exhibits predictive signature of prostate adenocarcinoma.

  7. Congenital abnormalities (a bibliography with abstracts). Report for 1964-Nov 77

    International Nuclear Information System (INIS)

    Harrison, E.A.

    1977-11-01

    Radiation hazards, food additives, gene mutations, musculoskeletal diseases, neoplasms, leukemia, rubella and chromosomes as related to congenital abnormalities are topics covered by the citations of research reports in the bibliography

  8. A novel point mutation in the translation initiation codon of the pre-pro-vasopressin-neurophysin II gene: Cosegregation with morphological abnormalities and clinical symptoms in autosomal dominant neurohypophyseal diabetes insipidus

    Energy Technology Data Exchange (ETDEWEB)

    Rutishauser, J.; Boeni-Schnetzler, M.; Froesch, E.R.; Wichmann, W.; Huisman, T. [Univ. of Zuerich (Switzerland)] [and others

    1996-01-01

    Autosomal dominant neurohypophyseal diabetes insipidus (ADNDI) is a rare variant of idiopathic central diabetes insipidus. Several different mutations in the human vasopressin-neurophysin II (AVP-NP II) gene have been described. We studied nine family members from three generations of an ADNDI pedigree at the clinical, morphological, and molecular levels. AVP concentrations were measured during diagnostic fluid restriction tests. Coronal and sagittal high resolution T1-weighted images of the pituitary were obtained from affected and healthy family members. PCR was used to amplify the AVP-NP II precursor gene, and PCR products were directly sequenced. Under maximal osmotic stimulation, AVP serum levels were close to or below the detection limit in affected individuals. Magnetic resonance imaging studies revealed the characteristic hyperintense ({open_quotes}bright spot{close_quotes}) appearance of the posterior pituitary in two healthy family members. This signal was absent in all four ADNDI patients examined. The coding sequences of AVP and its carrier protein, neurophysin II, were normal in all family members examined. Affected individuals showed a novel single base deletion (G 227) in the translation initiation codon of the AVP-NP II signal peptide on one allele. The mutation in the AVP-NP II leader sequence appears to be responsible for the disease in this kindred, possibly by interfering with protein translocation. The absence of the hyperintense posterior pituitary signal in affected individuals could reflect deficient posterior pituitary function. 56 refs., 4 figs., 3 tabs.

  9. A novel mutation of the adrenocorticotropin receptor (ACTH-R) gene in a family with the syndrome of isolated glucocorticoid deficiency, but no ACTH-R abnormalities in two families with the triple A syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Tsigos, C.; Arai, K.; Latronico, A.C. [National Inst. of Child Health and Human Development, Bethesda, MD (United States)]|[Temple Univ. School of Medicine, Philadelphia, PA (United States)]|[Children`s Hospital of New Jersey, Newark, NJ (United States)] [and others

    1995-07-01

    Isolated glucocorticoid deficiency (IGD) is an autosomal recessive disorder characterized by primary adrenocortical insufficiency, usually without mineralocorticoid deficiency. Occasionally, the disorder is associated with alacrima and achalasia of the esophagus (triple A syndrome), suggesting potential heterogeneity in its etiology. Mutations in the ACTH receptor gene have been reported in several families with IGD. We have amplified and directly sequenced the entire intronless ACTH receptor gene in 1 other family with IGD and 2 famlies with triple A syndrome. The proband with IGD was a homozygote for an A {r_arrow}G substitution, changing tyrosine 254 to cysteine in the third extracellular loop of the receptor protein, probably interfering with ligand binding. Both of her parents were heterozygotes for this mutation, which was not detected in 100 normal alleles. No mutations were identified in the entire coding area of the ACTH receptor in the 2 families with triple A syndrome, supporting the idea of a developmental or postreceptor defect in this syndrome. 19 refs., 1 fig.

  10. Echocardiographic abnormalities in hypertensive patients

    International Nuclear Information System (INIS)

    Rodulfo Garcia, Maikel; Tornes Perez, Victor Manuel; Castellanos Tardo, Juan Ramon

    2012-01-01

    A descriptive cross-sectional study was carried out in 120 hypertensive patients with a course of 5 or more years, who went to the emergency room of 'Saturnino Lora' Provincial Teaching Hospital from November 2010 to November 2011 in order to determine the presence or absence of echocardiographic abnormalities typical of hypertension. Of these, 78,3 % was affected, most of whom reported not to continue with regular previous medical treatment, and 21,7 % had not these abnormalities. Age group of 50-60 years, males and blacks prevailed in the case material. The most significant echocardiographic findings were left ventricular hypertrophy and heart failure with ejection fraction of left ventricle preserved

  11. Glial abnormalities in mood disorders.

    Science.gov (United States)

    Öngür, Dost; Bechtholt, Anita J; Carlezon, William A; Cohen, Bruce M

    2014-01-01

    Multiple lines of evidence indicate that mood disorders are associated with abnormalities in the brain's cellular composition, especially in glial cells. Considered inert support cells in the past, glial cells are now known to be important for brain function. Treatments for mood disorders enhance glial cell proliferation, and experimental stimulation of cell growth has antidepressant effects in animal models of mood disorders. These findings suggest that the proliferation and survival of glial cells may be important in the pathogenesis of mood disorders and may be possible targets for the development of new treatments. In this article we review the evidence for glial abnormalities in mood disorders, and we discuss glial cell biology and evidence from postmortem studies of mood disorders. The goal is not to carry out a comprehensive review but to selectively discuss existing evidence in support of an argument for the role of glial cells in mood disorders.

  12. Abnormal Metabolite in Alcoholic Subjects,

    Science.gov (United States)

    1982-01-01

    0.01 0.12 81 A.A. 51 M 0 ɘ.01 0.09 Schizophrenia 85a W.G. 67 M 0 ɘ.01 0.21 Proteins & Ketones in Urine b 0 ɘ.01 0.11 86a W.H. 67 M 0 ɘ.01 0.15 b 0...AD-AS 90 TOTTS GAP MEDICAL RESEARCH LABS INC BANGOR PA F/G 6/5 ABNORMAL METABOLITE IN ALCOHOLIC SUBJECTS, U) 1982 R L BEECH, M E FELVER, M R...LAKSCHMANAN NOOBIN 70 C 0233 UNJCLASSIFIED NL I ,I/ ABNORMAL METABOLITE IN ALCOHOLIC SUBJECTS Richard L . Veech, Michael E. Felver, M.R. Lakschmanan, Stewart

  13. Computed tomography abnormalities in hanging

    International Nuclear Information System (INIS)

    Bianco, F.; Floris, R.

    1987-01-01

    The CT pattern of bilateral and symmetrical round low density areas in the globi pallidi has been observed in a young man who attempted suicide by hanging. These CT abnormalities are similar to those described in other conditions such as carbon monoxide, hydrogen sulfide, cyanide and methanol poisoning, hypoglycaemia, drowning and acute global central nervous system hypoperfusion.The findings appear to be correlated with acute cerebral hypoxia. (orig.)

  14. GLIAL ABNORMALITIES IN MOOD DISORDERS

    OpenAIRE

    Öngür, Dost; Bechtholt, Anita J.; Carlezon, William A.; Cohen, Bruce M.

    2014-01-01

    Multiple lines of evidence indicate that mood disorders are associated with abnormalities in the brain's cellular composition, especially in glial cells. Considered inert support cells in the past, glial cells are now known to be important for brain function. Treatments for mood disorders enhance glial cell proliferation, and experimental stimulation of cell growth has antidepressant effects in animal models of mood disorders. These findings suggest that the proliferation and survival of glia...

  15. Mastoid abnormalities in Down syndrome

    International Nuclear Information System (INIS)

    Glass, R.B.J.; Yousefzadeh, D.K.; Roizen, N.J.

    1989-01-01

    Hearing loss and otitis media are commonly associated with Down syndrome. Hypoplasia of the mastoids is seen in many affected children and sclerosis of mastoid bones is not uncommon in Down syndrome. Awareness and early recognition of mastoid abnormality may lead to appropriate and timely therapy, thereby preserving the child's hearing or compensating for hearing loss; factors which are important for learning and maximum development. (orig.)

  16. Mastoid abnormalities in Down syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Glass, R.B.J.; Yousefzadeh, D.K.; Roizen, N.J.

    1989-06-01

    Hearing loss and otitis media are commonly associated with Down syndrome. Hypoplasia of the mastoids is seen in many affected children and sclerosis of mastoid bones is not uncommon in Down syndrome. Awareness and early recognition of mastoid abnormality may lead to appropriate and timely therapy, thereby preserving the child's hearing or compensating for hearing loss; factors which are important for learning and maximum development.

  17. Abnormal uterine bleeding in perimenopause.

    Science.gov (United States)

    Goldstein, S R; Lumsden, M A

    2017-10-01

    Abnormal uterine bleeding is one of the commonest presenting complaints encountered in a gynecologist's office or primary-care setting. The wider availability of diagnostic tools has allowed prompt diagnosis and treatment of an increasing number of menstrual disorders in an office setting. This White Paper reviews the advantages and disadvantages of transvaginal ultrasound, blind endometrial sampling and diagnostic hysteroscopy. Once a proper diagnosis has been established, appropriate therapy may be embarked upon. Fortunately, only a minority of such patients will have premalignant or malignant disease. When bleeding is sufficient to cause severe anemia or even hypovolemia, prompt intervention is called for. In most of the cases, however, the abnormal uterine bleeding will be disquieting to the patient and significantly affect her 'quality of life'. Sometimes, reassurance and expectant management will be sufficient in such patients. Overall, however, in cases of benign disease, some intervention will be required. The use of oral contraceptive pills especially those with a short hormone-free interval, the insertion of the levonorgestrel intrauterine system, the incorporation of newer medical therapies including antifibrinolytic drugs and selective progesterone receptor modulators and minimally invasive treatments have made outpatient therapy increasingly effective. For others, operative hysteroscopy and endometrial ablation are proven therapeutic tools to provide both long- and short-term relief of abnormal uterine bleeding, thus avoiding, or deferring, hysterectomy.

  18. Alcohol Consumption and the Risk of Colorectal Cancer for Mismatch Repair Gene Mutation Carriers

    Science.gov (United States)

    Dashti, S. Ghazaleh; Buchanan, Daniel D.; Jayasekara, Harindra; Ouakrim, Driss Ait; Clendenning, Mark; Rosty, Christophe; Winship, Ingrid M.; Macrae, Finlay A.; Giles, Graham G.; Parry, Susan; Casey, Graham; Haile, Robert W.; Gallinger, Steven; Le Marchand, Loïc; Thibodeau, Stephen N.; Lindor, Noralane M.; Newcomb, Polly A.; Potter, John D.; Baron, John A.; Hopper, John L.; Jenkins, Mark A.; Win, Aung Ko

    2016-01-01

    Background People with germline mutation in one of the DNA mismatch repair (MMR) genes have increased colorectal cancer risk. For these high-risk people, study findings of the relationship between alcohol consumption and colorectal cancer risk have been inconclusive. Methods 1,925 MMR gene mutations carriers recruited into the Colon Cancer Family Registry who had completed a questionnaire on lifestyle factors were included. Weighted Cox proportional hazard regression models were used to estimate hazard ratios (HRs) and 95% confidence intervals (CIs) for the association between alcohol consumption and colorectal cancer. Results Colorectal cancer was diagnosed in 769 carriers (40%) at a mean (standard deviation) age of 42.6 (10.3) years. Compared with abstention, ethanol consumption from any alcoholic beverage up to 14 grams/day and >28 grams/day were associated with increased colorectal cancer risk (HR, 1.50; 95%CI, 1.09–2.07 and 1.69; 95%CI, 1.07–2.65 respectively; P-trend=0.05), and colon cancer risk (HR, 1.78; 95%CI, 1.27–2.49 and 1.94; 95%CI, 1.19–3.18 respectively; P-trend=0.02). However, there was no clear evidence for an association with rectal cancer risk. Also, there was no evidence for associations between consumption of individual alcoholic beverage types (beer, wine, spirits) and colorectal, colon, or rectal cancer risk. Conclusion Our data suggests that alcohol consumption, particularly more than 28 grams/day of ethanol (~2 standard drinks of alcohol in the US), is associated with increased colorectal cancer risk for MMR gene mutation carriers. Impact Although these data suggested that alcohol consumption in MMR carriers was associated with increased colorectal cancer risk, there was no evidence of a dose-response, and not all types of alcohol consumption were associated with increased risk. PMID:27811119

  19. Fibrillin abnormalities and prognosis in Marfan syndrome and related disorders

    Energy Technology Data Exchange (ETDEWEB)

    Aoyama, T.; Furthmayr, H.; Francke, U.; Gasner, C. [Stanford Univ. Medical Center, CA (United States)

    1995-08-28

    Marfan syndrome (MFS), a multisystem autosomal-dominant disorder, is characterized by mutations of the fibrillin-1 (FBN1) gene and by abnormal patterns of synthesis, secretion, and matrix deposition of the fibrillin protein. To determine the sensitivity and specificity of fibrillin protein abnormalities in the diagnosis of MFS, we studied dermal fibroblasts from 57 patients with classical MFS, 15 with equivocal MFS, 8 with single-organ manifestations, and 16 with other connective tissue disorders including homocystinuria and Ehlers-Danlos syndrome. Abnormal fibrillin metabolism was identified in 70 samples that were classified into four different groups based on quantitation of fibrillin synthesis and matrix deposition. Significant correlations were found for phenotypic features including arachnodactyly, striae distensae, cardiovascular manifestations, and fibrillin groups II and IV, which included 70% of the MFS patients. In addition, these two groups were associated with shortened {open_quotes}event-free{close_quotes} survival and more severe cardiovascular complications than groups I and III. The latter included most of the equivocal MFS/single manifestation patients with fibrillin abnormalities. Our results indicate that fibrillin defects at the protein level per se are not specific for MFS, but that the drastically reduced fibrillin deposition, caused by a dominant-negative effect of abnormal fibrillin molecules in individuals defined as groups II and IV, is of prognostic and possibly diagnostic significance. 25 refs., 3 figs., 6 tabs.

  20. Analysis of CO{sub 2} draining in the supercritical subchannel of an MMR reactor using CFD techniques; Análise do escoamento de CO{sub 2} supercrítico no subcanal de um reator MMR usando técnicas de CFD

    Energy Technology Data Exchange (ETDEWEB)

    Dutra, Carolina S.B.; Ribeiro, Felipe P., E-mail: cdutra@poli.ufrj.br, E-mail: felipeportor@poli.ufrj.br [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Departamento de Engenharia Nuclear; Su, Jian, E-mail: sujian@nuclear.ufrj.br [Coordenacao de Pos-Graduacao e Pesquisa de Engenharia (COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Programa de Engenharia Nuclear

    2017-07-01

    This work aims to analyze the steady state thermal hydraulic behavior of the supercritical CO{sub 2} by means of the computational modeling of the triangular arrangement subchannel of the KAIST MMR (Korea Advanced Institute of Science and Technology). The mathematical model is composed of Navier-Stokes equations of Reynolds average (RANS), with the model of turbulence k-omega SST (Shear Stress Transport) for the fluid refrigerant in the subchannel and the heat conduction equation for the fuel and coating. The thermodynamic properties of CO{sub 2} are implemented from National Institute of Standards and Technology (NIST) data. The transport equations were solved using a commercial CFD (Fluid Dynamics) tool, ANSYS FLUENT. Initially, a geometric model was constructed, using the ICEM software, composed of fuel, interstice, coating, refrigerant and two adiabatic regions of the fuel rod. The numerical solution used was validated by simulation of a simpler vertical circular tube and by comparisons with numerical and experimental results available in the literature. Using these results, we performed the mesh convergence study and initialized the simulations in the subchannel.

  1. Abnormal thermography in Parkinson's disease.

    Science.gov (United States)

    Antonio-Rubio, I; Madrid-Navarro, C J; Salazar-López, E; Pérez-Navarro, M J; Sáez-Zea, C; Gómez-Milán, E; Mínguez-Castellanos, A; Escamilla-Sevilla, F

    2015-08-01

    An autonomic denervation and abnormal vasomotor reflex in the skin have been described in Parkinson's disease (PD) and might be evaluable using thermography with cold stress test. A cross-sectional pilot study was undertaken in 35 adults: 15 patients with PD and abnormal [(123)I]-metaiodobenzylguanidine cardiac scintigraphy and 20 healthy controls. Baseline thermography of both hands was obtained before immersing one in cold water (3 ± 1 °C) for 2 min. Continuous thermography was performed in: non-immersed hand (right or with lesser motor involvement) during immersion of the contralateral hand and for 6 min afterward; and contralateral immersed hand for 6 min post-immersion. The region of interest was the dorsal skin of the third finger, distal phalanx. PD patients showed a lower mean baseline hand temperature (p = 0.037) and greater thermal difference between dorsum of wrist and third finger (p = 0.036) and between hands (p = 0.0001) versus controls, regardless of the motor laterality. Both tests evidenced an adequate capacity to differentiate between groups: in the non-immersed hand, the PD patients did not show the normal cooling pattern or final thermal overshoot observed in controls (F = 5.29; p = 0.001), and there was an AUC of 0.897 (95%CI 0.796-0.998) for this cooling; in the immersed hand, thermal recovery at 6 min post-immersion was lesser in patients (29 ± 17% vs. 55 ± 28%, p = 0.002), with an AUC of 0.810 (95%CI 0.662-0.958). PD patients reveal abnormal skin thermal responses in thermography with cold stress test, suggesting cutaneous autonomic dysfunction. This simple technique may be useful to evaluate autonomic dysfunction in PD. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Abnormal Cervical Cancer Screening Test Results

    Science.gov (United States)

    ... lesion? • What are the different types of abnormal Pap test results? • What testing is needed after an abnormal ... that could lead to cancer. Screening includes the Pap test and, for some women, testing for a virus ...

  3. MR imaging of abnormal synovial processes

    International Nuclear Information System (INIS)

    Quinn, S.F.; Sanchez, R.; Murray, W.T.; Silbiger, M.L.; Ogden, J.; Cochran, C.

    1987-01-01

    MR imaging can directly image abnormal synovium. The authors reviewed over 50 cases with abnormal synovial processes. The abnormalities include Baker cysts, semimembranous bursitis, chronic shoulder bursitis, peroneal tendon ganglion cyst, periarticular abscesses, thickened synovium from rheumatoid and septic arthritis, and synovial hypertrophy secondary to Legg-Calve-Perthes disease. MR imaging has proved invaluable in identifying abnormal synovium, defining the extent and, to a limited degree, characterizing its makeup

  4. Abnormal secretion and function of recombinant human factor VII as the result of modification to a calcium binding site caused by a 15-base pair insertion in the F7 gene.

    Science.gov (United States)

    Peyvandi, F; Carew, J A; Perry, D J; Hunault, M; Khanduri, U; Perkins, S J; Mannucci, P M; Bauer, K A

    2001-02-15

    A case of a novel mutation in the F7 gene that results in factor VII coagulant activity (VII:c) of less than 1% and VII antigen (VII:Ag) levels of 10% is presented. DNA analysis revealed a homozygous 15-base pair (bp) in-frame insertion-type mutation at nucleotide 10554. This insertion consisted of a duplication of residues leucine (L)213 to aspartic acid (D)217 (leucine, serine, glutamic acid, histidine, and aspartic acid), probably arising by slipped mispairing between 2 copies of a direct repeat (GCGAGCACGAC) separated by 4 bp. Molecular graphic analyses showed that the insertion is located at the surface of the catalytic domain in an exposed loop stabilized by extensive salt-bridge and hydrogen bond formation at which the calcium binding site is located. The mutation probably interferes with protein folding during VII biosynthesis and/or diminishes functional activity through the loss of calcium binding. In vitro expression studies demonstrated that the levels of VII:Ag in lysates of cells transfected with wild type VII (VIIWT) were equivalent to those with mutant type VII (VIIMT), but the level of secreted VIIMT was 5% to 10% that of VIIWT. Pulse chase studies demonstrated that VIIMT did not accumulate intracellularly, and studies with inhibitors of protein degradation showed that recombinant VIIMT was partially degraded in the pre-Golgi compartment. Accordingly, only small amounts of VIIMT with undetectable procoagulant activity were secreted into conditioned media. These results demonstrate that a combination of secretion and functional defects is the mechanism whereby this insertion causes VII deficiency.

  5. Challenges in assessing pathogenicity based on frequency of variants in mismatch repair genes: an extreme case of a MSH2 variant and a meta-analysis.

    Science.gov (United States)

    Woo, Hye In; Woo, Young Min; Kim, Sollip; Lee, Seung-Tae; Ki, Chang-Seok; Kim, Jong-Won

    2014-08-10

    The clinical interpretation of variants in mismatch repair (MMR) genes associated with Lynch syndrome can be confusing when the functional nature of the variant is not clearly defined. We report an extreme case where a polymorphism in the MSH2 gene which had a low minor allele frequency, was misclassified as a mutation based on low evidential methods in the database and previous publications. We expanded this experience to perform a systematic meta-analysis in order to investigate other variants that have potentially been misclassified. Our results suggested that the interpretation of pathogenicity should be more cautious and emphasized the need for solid validation through multiple analyses including functional analysis for variants in MMR genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Abnormal visuomotor processing in schizophrenia

    Directory of Open Access Journals (Sweden)

    Siân E. Robson

    2016-01-01

    Full Text Available Subtle disturbances of visual and motor function are known features of schizophrenia and can greatly impact quality of life; however, few studies investigate these abnormalities using simple visuomotor stimuli. In healthy people, electrophysiological data show that beta band oscillations in sensorimotor cortex decrease during movement execution (event-related beta desynchronisation (ERBD, then increase above baseline for a short time after the movement (post-movement beta rebound (PMBR; whilst in visual cortex, gamma oscillations are increased throughout stimulus presentation. In this study, we used a self-paced visuomotor paradigm and magnetoencephalography (MEG to contrast these responses in patients with schizophrenia and control volunteers. We found significant reductions in the peak-to-peak change in amplitude from ERBD to PMBR in schizophrenia compared with controls. This effect was strongest in patients who made fewer movements, whereas beta was not modulated by movement in controls. There was no significant difference in the amplitude of visual gamma between patients and controls. These data demonstrate that clear abnormalities in basic sensorimotor processing in schizophrenia can be observed using a very simple MEG paradigm.

  7. Operator training for the abnormal

    International Nuclear Information System (INIS)

    Marzec, R.J.

    1977-01-01

    Training of nuclear power plant control room operators, on actions to be taken for an abnormal event, has classically been limited to discussion, on-shift and/or during requalification training classes, of symptoms, logical thought processes, systems analysis, and operator experience. The prerequisites for these discussions are a common technical vocabulary, and a minimum basic comprehension of nuclear power plant fundamentals, plant component theory of operation, system configuration, system control philosophy and operating procedures. Nuclear power plant control room operators are not the only personnel who are or should be involved in these discussions. The shift supervisors, operations management, and auxiliary equipment operators require continuing training in abnormal operations, as well. More in-depth training is necessary for shift supervisors and control room operators. The availability of vendor simulators has improved the effectiveness of training efforts for these individuals to some extent by displaying typical situations and plant performance characteristics and by providing a degree of ''hands on'' experience. The evolution of in-depth training with these simulators is reviewed

  8. A study of molecular signals deregulating mismatch repair genes in prostate cancer compared to benign prostatic hyperplasia.

    Directory of Open Access Journals (Sweden)

    Sanmitra Basu

    Full Text Available Prostate cancer is one of the leading causes of mortality among aging males. There is an unmet requirement of clinically useful biomarkers for early detection of prostate cancer to reduce the liabilities of overtreatment and accompanying morbidity. The present population-based study investigates the factors disrupting expression of multiple functionally related genes of DNA mismatch repair pathway in prostate cancer patients to identify molecular attributes distinguishing adenocarcinoma from benign hyperplasia of prostate. Gene expression was compared between tissue samples from prostate cancer and benign prostatic hyperplasia using real-time-PCR, western blot and immunohistochemistry. Assessment of genotypes of seven single-nucleotide-polymorphisms of three MMR genes was conducted using PCR-coupled RFLP and sequencing. Promoter methylation was interrogated by methylation-specific-PCR and bisulfite-sequencing. Interaction between microRNAs and MMR genes was verified by 3'UTR-based dual luciferase assays. Concurrent reduction of three MMR genes namely hMLH1, hMSH6 and hMSH2 (34-85%, P<0.05 was observed in prostate cancer tissues. hMSH6 polymorphism rs1800932(Pro92Pro conferred a borderline protection in cancer patients (OR = 0.33, 95% CI = 0.15-0.75. Relative transcript level of hMLH1 was inversely related (r = -0.59, P<0.05 with methylation quotient of its promoter which showed a significantly higher methylation density (P = 0.008, Z = -2.649 in cancer patients. hsa-miR-155, hsa-miR-141 and hsa-miR-21 gene expressions were significantly elevated (66-85%, P<0.05 in tumor specimens and negatively correlated (r = -0.602 to -0.527, P<0.05 with that of MMR genes. hsa-miR-155 & hsa-miR-141 and hsa-miR-155 & hsa-miR-21 were demonstrated to bind to their putative seed sequences in hMLH1 and hMSH6 3'UTRs respectively. Relatively higher expression of DNA methyl-transferases (DNMT1 and DNMT3b and HIF-1α genes (34-50%, P<0.05 were also detected in tumor

  9. Abnormal Event Detection Using Local Sparse Representation

    DEFF Research Database (Denmark)

    Ren, Huamin; Moeslund, Thomas B.

    2014-01-01

    We propose to detect abnormal events via a sparse subspace clustering algorithm. Unlike most existing approaches, which search for optimized normal bases and detect abnormality based on least square error or reconstruction error from the learned normal patterns, we propose an abnormality...... measurement based on the difference between the normal space and local space. Specifically, we provide a reasonable normal bases through repeated K spectral clustering. Then for each testing feature we first use temporal neighbors to form a local space. An abnormal event is found if any abnormal feature...

  10. THE ROLE OF NUTRIGENOMICS IN CORRECTION OF METABOLIC ABNORMALITIES

    Directory of Open Access Journals (Sweden)

    I. V. Misnikova

    2015-01-01

    Full Text Available In some patients, diet and increased physical exercise are not effective enough to prevent the development of type 2 diabetes mellitus. At present, a  new approach is proposed to elaborate the diet with consideration of specific need of an individual. Food components can cause changes in metabolism through their influence on activity of certain genes that subsequently influence human proteome and metabolome. It is assumed that nutrients may influence methylation of deoxyribonucleic acid. A number of studies established an interaction between some foods and genes associated with obesity and type 2 diabetes mellitus. Diet recommendations based on presence of certain gene polymorphisms have been developed. The spectrum of gene polymorphisms that is necessary to assess in individuals with metabolic abnormalities or with high risk of their development has been also defined.

  11. Abnormal Returns and Contrarian Strategies

    Directory of Open Access Journals (Sweden)

    Ivana Dall'Agnol

    2003-12-01

    Full Text Available We test the hypothesis that strategies which are long on portfolios of looser stocks and short on portfolios of winner stocks generate abnormal returns in Brazil. This type of evidence for the US stock market was interpreted by The Bondt and Thaler (1985 as reflecting systematic evaluation mistakes caused by investors overreaction to news related to the firm performance. We found evidence of contrarian strategies profitability for horizons from 3 months to 3 years in a sample of stock returns from BOVESPA and SOMA from 1986 to 2000. The strategies are more profitable for shorter horizons. Therefore, there was no trace of the momentum effect found by Jagadeesh and Titman (1993 for the same horizons with US data. There are remaing unexplained positive returns for contrarian strategies after accounting for risk, size, and liquidity. We also found that the strategy profitability is reduced after the Real Plan, which suggests that the Brazilian stock market became more efficient after inflation stabilization.

  12. Methylation Analysis of DNA Mismatch Repair Genes Using DNA Derived from the Peripheral Blood of Patients with Endometrial Cancer: Epimutation in Endometrial Carcinogenesis.

    Science.gov (United States)

    Takeda, Takashi; Banno, Kouji; Yanokura, Megumi; Adachi, Masataka; Iijima, Moito; Kunitomi, Haruko; Nakamura, Kanako; Iida, Miho; Nogami, Yuya; Umene, Kiyoko; Masuda, Kenta; Kobayashi, Yusuke; Yamagami, Wataru; Hirasawa, Akira; Tominaga, Eiichiro; Susumu, Nobuyuki; Aoki, Daisuke

    2016-10-14

    Germline mutation of DNA mismatch repair (MMR) genes is a cause of Lynch syndrome. Methylation of MutL homolog 1 ( MLH1 ) and MutS homolog 2 ( MSH2 ) has been detected in peripheral blood cells of patients with colorectal cancer. This methylation is referred to as epimutation. Methylation of these genes has not been studied in an unselected series of endometrial cancer cases. Therefore, we examined methylation of MLH1 , MSH2 , and MSH6 promoter regions of peripheral blood cells in 206 patients with endometrial cancer using a methylation-specific polymerase chain reaction (MSP). Germline mutation of MMR genes, microsatellite instability (MSI), and immunohistochemistry (IHC) were also analyzed in each case with epimutation. MLH1 epimutation was detected in a single patient out of a total of 206 (0.49%)-1 out of 58 (1.72%) with an onset age of less than 50 years. The patient with MLH1 epimutation showed high level MSI (MSI-H), loss of MLH1 expression and had developed endometrial cancer at 46 years old, complicated with colorectal cancer. No case had epimutation of MSH2 or MSH6 . The MLH1 epimutation detected in a patient with endometrial cancer may be a cause of endometrial carcinogenesis. This result indicates that it is important to check epimutation in patients with endometrial cancer without a germline mutation of MMR genes.

  13. Hemostatic abnormalities in liver cirrhosis

    Directory of Open Access Journals (Sweden)

    Kendal YALÇIN

    2009-06-01

    Full Text Available In this study, 44 patients with liver cirrhosis were investigated for hemostatic parameters. Patients with spontaneous bacterial peritonitis, hepatocellular carcinoma, hepatorenal syndrome and cholestatic liver diseases were excluded. Patients were classified by Child-Pugh criterion and according to this 4 patients were in Class A, 20 in Class B and 20 in C. Regarding to these results, it was aimed to investigate the haematological disturbances in liver cirrhotic patients.In the result there was a correlation between activated partial thromboplastin time, serum iron, ferritin, transferrin, haptoglobin and Child-Pugh classification. Besides there was no correlation between prothrombin time, factor 8 and 9, protein C and S, anti-thrombin 3, fibrinogen, fibrin degradation products, serum iron binding capacity, hemoglobin, leukocyte, mean corpuscular volume and Child-Pugh classification.There were significant difference, in terms of AST, ferritin, haptoglobulin, sex and presence of ascites between groups (p0.05. In the summary, we have found correlation between hemostatic abnormalities and disease activity and clinical prognosis in patients with liver cirrhosis which is important in the management of these patients. This is also important for identification of liver transplant candidiates earlier.

  14. Biochemical abnormalities in Pearson syndrome.

    Science.gov (United States)

    Crippa, Beatrice Letizia; Leon, Eyby; Calhoun, Amy; Lowichik, Amy; Pasquali, Marzia; Longo, Nicola

    2015-03-01

    Pearson marrow-pancreas syndrome is a multisystem mitochondrial disorder characterized by bone marrow failure and pancreatic insufficiency. Children who survive the severe bone marrow dysfunction in childhood develop Kearns-Sayre syndrome later in life. Here we report on four new cases with this condition and define their biochemical abnormalities. Three out of four patients presented with failure to thrive, with most of them having normal development and head size. All patients had evidence of bone marrow involvement that spontaneously improved in three out of four patients. Unique findings in our patients were acute pancreatitis (one out of four), renal Fanconi syndrome (present in all patients, but symptomatic only in one), and an unusual organic aciduria with 3-hydroxyisobutyric aciduria in one patient. Biochemical analysis indicated low levels of plasma citrulline and arginine, despite low-normal ammonia levels. Regression analysis indicated a significant correlation between each intermediate of the urea cycle and the next, except between ornithine and citrulline. This suggested that the reaction catalyzed by ornithine transcarbamylase (that converts ornithine to citrulline) might not be very efficient in patients with Pearson syndrome. In view of low-normal ammonia levels, we hypothesize that ammonia and carbamylphosphate could be diverted from the urea cycle to the synthesis of nucleotides in patients with Pearson syndrome and possibly other mitochondrial disorders. © 2015 Wiley Periodicals, Inc.

  15. Evaluation of Chromosomal Abnormalities and Common ...

    African Journals Online (AJOL)

    Evaluation of Chromosomal Abnormalities and Common Trombophilic Mutations in Cases with Recurrent Miscarriage. Ahmet Karatas, Recep Eroz, Mustafa Albayrak, Tulay Ozlu, Bulent Cakmak, Fatih Keskin ...

  16. White matter abnormalities in gene-positive myoclonus-dystonia

    NARCIS (Netherlands)

    van der Meer, Johan N.; Beukers, Richard J.; van der Salm, S. M. A.; Caan, Matthan W. A.; Tijssen, Marina A. J.; Nederveen, Aart J.

    2012-01-01

    Myoclonus-dystonia is an autosomal dominantly inherited movement disorder clinically characterized by myoclonic jerks and dystonic movements of the upper body. Functional imaging and structural gray matter imaging studies in M-D suggest defective sensorimotor integration and an association between

  17. Rai1 Haploinsufficiency Is Associated with Social Abnormalities in Mice

    Directory of Open Access Journals (Sweden)

    Nalini R. Rao

    2017-04-01

    Full Text Available Background: Autism is characterized by difficulties in social interaction, communication, and repetitive behaviors; with different degrees of severity in each of the core areas. Haploinsufficiency and point mutations of RAI1 are associated with Smith-Magenis syndrome (SMS, a genetic condition that scores within the autism spectrum range for social responsiveness and communication, and is characterized by neurobehavioral abnormalities, intellectual disability, developmental delay, sleep disturbance, and self-injurious behaviors. Methods: To investigate the relationship between Rai1 and social impairment, we evaluated the Rai1+/− mice with a battery of tests to address social behavior in mice. Results: We found that the mutant mice showed diminished interest in social odors, abnormal submissive tendencies, and increased repetitive behaviors when compared to wild type littermates. Conclusions: These findings suggest that Rai1 contributes to social behavior in mice, and prompt it as a candidate gene for the social behaviors observed in Smith-Magenis Syndrome patients.

  18. Repolarization abnormalities in the newborn.

    Science.gov (United States)

    Schwartz, Peter J; Stramba-Badiale, Marco

    2010-06-01

    The recognition of ventricular repolarization abnormalities in the newborn carries several and significant implications, because it calls attention to the possibility of dealing with an infant affected by the long QT syndrome (LQTS). This article provides key elements for the correct measurement of the QT interval in newborns and succinctly reviews some aspects of the disease. It gives normative values on the QT interval distribution in the first month of life based on a prospective study in more than 44,000 infants. It shows the probability, based on the QTc observed in two recordings, to find disease-causing mutations. The data indicate clearly that widespread electrocardiographic screening in the newborn allows early identification of most, if not all, the infants affected by LQTS with marked QT prolongation and thus of those at higher risk for life-threatening arrhythmias and sudden death. Through the affected infants, it becomes possible to identify the family members affected by LQTS, including the "silent mutation carriers"; our study shows that disease-causing mutations are found in 51% of the family members. Because early recognition leads to the implementation of effective preventive strategies, it follows that electrocardiographic screening will avoid preventable deaths either in the first year of life when they are usually labeled as "sudden infant death syndrome" or later in life. The case is made for medicolegal implications whenever neonatologists and pediatricians fail to inform the parents of a newborn child of the prevalence of LQTS (one in 2000), of the effectiveness of existing therapies, and of the diagnosis with a simple electrocardiogram.

  19. Polymorphisms in mismatch repair genes are associated with risk and microsatellite instability of gastric cancer, and interact with life exposures.

    Science.gov (United States)

    Zhu, Haifeng; Li, Xiaoqin; Zhang, Xiaomei; Chen, Deyu; Li, Dan; Ren, Jin; Gu, Hangang; Shu, Yongqian; Wang, Deqiang

    2016-03-15

    Epigenetic alterations of DNA mismatch repair (MMR) genes are associated with risk of gastric cancer (GC) by causing microsatellite instability (MSI). Less understood is the association of common polymorphisms in MMR genes with the risk and MSI phenotype of GC. A hospital-based study was conducted in China with 423 cases and 454 matched controls. Four potentially functional polymorphisms were selected and analyzed: rs1800734 in MLH1, rs2303428 in MSH2, rs735943 in EXO1, and rs11797 in TREX1. The rs1800734 G-allele was associated with decreased risk of GC (GA or GG vs AA, OR=0.72; 95% CI: 0.50-1.05; Ptrend=0.029). For combined effects, a dose-response manner was observed in which GC risk was increased with increasing number of at-risk genotypes (Ptrend=0.039); this manner mainly existed in MSI GC (Ptrend=0.047) rather than in microsatellite stability GC, though neither single polymorphism was linked with MSI. For exposures, modified effects were observed from green tea drinking and soy foods intake on rs11797 (P for interaction=0.007 and 0.016, respectively). The MLH1 rs1800734 polymorphism is associated with GC risk. Those at-risk genotypes have a joint effect on GC risk, which contributes to the MSI phenotype of GC. Life exposures modify GC risk, stratified by MMR genotypes. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Does risk of endometrial cancer for women without a germline mutation in a DNA mismatch repair gene depend on family history of endometrial cancer or colorectal cancer?

    Science.gov (United States)

    Bharati, Rajani; Jenkins, Mark A.; Lindor, Noralane M.; Marchand, Loïc Le; Gallinger, Steven; Haile, Robert W.; Newcomb, Polly A.; Hopper, John L.; Win, Aung Ko

    2014-01-01

    Objective To determine whether risk of endometrial cancer for women without a germline mutation in a DNA mismatch repair (MMR) gene depends on family history of endometrial or colorectal cancer. Methods We retrospectively followed a cohort of 79,166 women who were recruited to the Colon Cancer Family Registry, after exclusion of women who were relatives of a carrier of a MMR gene mutation. The Kaplan-Meier failure method was used to estimate the cumulative risk of endometrial cancer. Cox regression was used to estimate hazard ratios (HRs) and 95% confidence intervals (CIs) for association between family history of endometrial or colorectal cancer and risk of endometrial cancer. Results A total of 628 endometrial cancer cases were observed, with mean age at diagnosis of 54.4 (standard deviation 15.7) years. The cumulative risk of endometrial cancer to age 70 years was estimated to be 0.94% (95% CI 0.83–1.05) for women with no family history of endometrial cancer, and 3.80% (95% CI 2.75–4.98) for women with at least one first- or second-degree relative with endometrial cancer. Compared with women without family history, we found an increased risk of endometrial cancer for women with at least one first-or second-degree relative with endometrial cancer (HR 3.66, 95% CI 2.63–5.08), and for women with one first-degree relative with colorectal cancer diagnosed at age <50 years (HR 1.48, 95% CI 1.15–1.91). Conclusion An increased risk of endometrial cancer is associated with a family history of endometrial cancer or early-onset colorectal cancer for women without a MMR gene mutation; indicating for potential underlying genetic and environmental factors shared by colorectal and endometrial cancers other than caused by MMR gene mutations. PMID:24631449

  1. Embryos, genes, and birth defects

    National Research Council Canada - National Science Library

    Ferretti, Patrizia

    2006-01-01

    ... Structural anomalies The genesis of chromosome abnormalities Embryo survival The cause of high levels of chromosome abnormality in human embryos Relative parental risks - age, translocations, inversions, gonadal and germinal mosaics 33 33 34 35 36 44 44 45 4 Identification and Analysis of Genes Involved in Congenital Malformation Syndromes Peter J. Scambler Ge...

  2. Nail abnormalities in patients with vitiligo.

    Science.gov (United States)

    Topal, Ilteris Oguz; Gungor, Sule; Kocaturk, Ozgur Emek; Duman, Hatice; Durmuscan, Mustafa

    2016-01-01

    Vitiligo is an acquired pigmentary skin disorder affecting 0.1-4% of the general population. The nails may be affected in patients with an autoimmune disease such as psoriasis, and in those with alopecia areata. It has been suggested that nail abnormalities should be apparent in vitiligo patients. We sought to document the frequency and clinical presentation of nail abnormalities in vitiligo patients compared to healthy volunteers. We also examined the correlations between nail abnormalities and various clinical parameters. This study included 100 vitiligo patients and 100 healthy subjects. Full medical histories were collected from the subjects, who underwent thorough general and nail examinations. All nail changes were noted. In the event of clinical suspicion of a fungal infection, additional mycological investigations were performed. Nail abnormalities were more prevalent in the patients (78%) than in the controls (55%) (p=0.001). Longitudinal ridging was the most common finding (42%), followed by (in descending order): leukonychia, an absent lunula, onycholysis, nail bed pallor, onychomycosis, splinter hemorrhage and nail plate thinning. The frequency of longitudinal ridging was significantly higher in patients than in controls (pNail abnormalities were more prevalent in vitiligo patients than in controls. Systematic examination of the nails in such patients is useful because nail abnormalities are frequent. However, the causes of such abnormalities require further study. Longitudinal ridging and leukonychia were the most common abnormalities observed in this study.

  3. Effects of theophylline administration and intracranial abnormalities ...

    African Journals Online (AJOL)

    Objective: To determine effects of theophylline therapy for recurrent apnoea of prematurity and abnormal early (within the first 24 hours) cranial ultrasound abnormalities on protective neck turning response in preterm infants. Design: A cross sectional descriptive study. Setting: The Neonatal Unit of Hammersmith Hospital, ...

  4. Prevalence of biochemical and immunological abnormalities in ...

    African Journals Online (AJOL)

    Tile prevalence of biochemical and immunological abnormalities was studied in a group of 256 patients with rheumatoid arthritis (104 coloureds, 100 whites and 52 blacks). The most common biochemical abnormalities detected were a reduction in the serum creatinine value (43,4%), raised globulins (39,7%), raised serum ...

  5. First Trimester Ultrasound Screening for Congenital Abnormalities ...

    African Journals Online (AJOL)

    approach used, especially with the introduction of first trimester ultrasound as a reliable screening method. Objective: To give a comprehensive review of the basis for first trimester ultrasound screening for congenital abnormalities, it's utilization in the prenatal screening for chromosomal, structural and genetic abnormalities ...

  6. An Abnormal Psychology Community Based Interview Assignment

    Science.gov (United States)

    White, Geoffry D.

    1977-01-01

    A course option in abnormal psychology involves students in interviewing and observing the activities of individuals in the off-campus community who are concerned with some aspect of abnormal psychology. The technique generates student interest in the field when they interview people about topics such as drug abuse, transsexualism, and abuse of…

  7. Report to Congress on abnormal occurrences

    International Nuclear Information System (INIS)

    1993-06-01

    Section 208 of the Energy Reorganization Act of 1974 identifies an abnormal occurrence as an unscheduled incident or event that the Nuclear Regulatory Commission determines to be significant from the standpoint of public health and safety and requires a quarterly report of such events to be made to Congress. This report covers the period January through March 1993. There is one abnormal occurrence at a nuclear power plant disposed in this report that involved a steam generator tube rupture at Palo Verde Unit 2, and none for fuel cycle facilities. Three abnormal occurrences involving medical misadminstrations (two therapeutic and one diagnostic) at NRC-licensed facilities are also discussed in this report. No abnormal occurrences were reported by NRC's Agreement States. The report also contains information updating previously reported abnormal occurrences

  8. Differential Analysis of Genetic, Epigenetic, and Cytogenetic Abnormalities in AML

    Directory of Open Access Journals (Sweden)

    Mirazul Islam

    2017-01-01

    Full Text Available Acute myeloid leukemia (AML is a haematological malignancy characterized by the excessive proliferation of immature myeloid cells coupled with impaired differentiation. Many AML cases have been reported without any known cytogenetic abnormalities and carry no mutation in known AML-associated driver genes. In this study, 200 AML cases were selected from a publicly available cohort and differentially analyzed for genetic, epigenetic, and cytogenetic abnormalities. Three genes (FLT3, DNMT3A, and NPMc are found to be predominantly mutated. We identified several aberrations to be associated with genome-wide methylation changes. These include Del (5q, T (15; 17, and NPMc mutations. Four aberrations—Del (5q, T (15; 17, T (9; 22, and T (9; 11—are significantly associated with patient survival. Del (5q-positive patients have an average survival of less than 1 year, whereas T (15; 17-positive patients have a significantly better prognosis. Combining the methylation and mutation data reveals three distinct patient groups and four clusters of genes. We speculate that combined signatures have the better potential to be used for subclassification of AML, complementing cytogenetic signatures. A larger sample cohort and further investigation of the effects observed in this study are required to enable the clinical application of our patient classification aided by DNA methylation.

  9. Prevalence and Spectrum of Germline Cancer Susceptibility Gene Mutations Among Patients With Early-Onset Colorectal Cancer

    Science.gov (United States)

    Pearlman, Rachel; Frankel, Wendy L.; Swanson, Benjamin; Zhao, Weiqiang; Yilmaz, Ahmet; Miller, Kristin; Bacher, Jason; Bigley, Christopher; Nelsen, Lori; Goodfellow, Paul J.; Goldberg, Richard M.; Paskett, Electra; Shields, Peter G.; Freudenheim, Jo L.; Stanich, Peter P; Lattimer, Ilene; Arnold, Mark; Liyanarachchi, Sandya; Kalady, Matthew; Heald, Brandie; Greenwood, Carla; Paquette, Ian; Prues, Marla; Draper, David J.; Lindeman, Carolyn; Kuebler, J. Philip; Reynolds, Kelly; Brell, Joanna M.; Shaper, Amy A.; Mahesh, Sameer; Buie, Nicole; Weeman, Kisa; Shine, Kristin; Haut, Mitchell; Edwards, Joan; Bastola, Shyamal; Wickham, Karen; Khanduja, Karamjit S.; Zacks, Rosemary; Pritchard, Colin C.; Shirts, Brian H.; Jacobson, Angela; Allen, Brian; de la Chapelle, Albert; Hampel, Heather

    2017-01-01

    IMPORTANCE Hereditary cancer syndromes infer high cancer risks and require intensive cancer surveillance, yet the prevalence and spectrum of these conditions among unselected patients with early-onset colorectal cancer (CRC) is largely undetermined. OBJECTIVE To determine the frequency and spectrum of cancer susceptibility gene mutations among patients with early-onset CRC. DESIGN, SETTING, AND PARTICIPANTS Overall, 450 patients diagnosed with colorectal cancer younger than 50 years were prospectively accrued from 51 hospitals into the Ohio Colorectal Cancer Prevention Initiative from January 1, 2013, to June 20, 2016. Mismatch repair (MMR) deficiency was determined by microsatellite instability and/or immunohistochemistry. Germline DNA was tested for mutations in 25 cancer susceptibility genes using next-generation sequencing. MAIN OUTCOMES AND MEASURES Mutation prevalence and spectrum in patients with early-onset CRC was determined. Clinical characteristics were assessed by mutation status. RESULTS In total 450 patients younger than 50 years were included in the study, and 75 gene mutations were found in 72 patients (16%). Forty-eight patients (10.7%) had MMR-deficient tumors, and 40 patients (83.3%) had at least 1 gene mutation: 37 had Lynch syndrome (13, MLH1 [including one with constitutional MLH1 methylation]; 16, MSH2; 1, MSH2/monoallelic MUTYH; 2, MSH6; 5, PMS2); 1 patient had the APC c.3920T>A, p.I1307K mutation and a PMS2 variant; 9 patients (18.8%) had double somatic MMR mutations (including 2 with germline biallelic MUTYH mutations); and 1 patient had somatic MLH1 methylation. Four hundred two patients (89.3%) had MMR-proficient tumors, and 32 patients (8%) had at least 1 gene mutation: 9 had mutations in high-penetrance CRC genes (5, APC; 1, APC/PMS2; 2, biallelic MUTYH; 1, SMAD4); 13 patients had mutations in high- or moderate-penetrance genes not traditionally associated with CRC (3, ATM; 1, ATM/CHEK2; 2, BRCA1; 4, BRCA2; 1, CDKN2A; 2, PALB2); 10

  10. Next generation sequencing identifies abnormal Y chromosome and candidate causal variants in premature ovarian failure patients.

    Science.gov (United States)

    Lee, Yujung; Kim, Changshin; Park, YoungJoon; Pyun, Jung-A; Kwack, KyuBum

    2016-12-01

    Premature ovarian failure (POF) is characterized by heterogeneous genetic causes such as chromosomal abnormalities and variants in causal genes. Recently, development of techniques made next generation sequencing (NGS) possible to detect genome wide variants including chromosomal abnormalities. Among 37 Korean POF patients, XY karyotype with distal part deletions of Y chromosome, Yp11.32-31 and Yp12 end part, was observed in two patients through NGS. Six deleterious variants in POF genes were also detected which might explain the pathogenesis of POF with abnormalities in the sex chromosomes. Additionally, the two POF patients had no mutation in SRY but three non-synonymous variants were detected in genes regarding sex reversal. These findings suggest candidate causes of POF and sex reversal and show the propriety of NGS to approach the heterogeneous pathogenesis of POF. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Copy Number Variations Found in Patients with a Corpus Callosum Abnormality and Intellectual Disability.

    Science.gov (United States)

    Heide, Solveig; Keren, Boris; Billette de Villemeur, Thierry; Chantot-Bastaraud, Sandra; Depienne, Christel; Nava, Caroline; Mignot, Cyril; Jacquette, Aurélia; Fonteneau, Eric; Lejeune, Elodie; Mach, Corinne; Marey, Isabelle; Whalen, Sandra; Lacombe, Didier; Naudion, Sophie; Rooryck, Caroline; Toutain, Annick; Caignec, Cédric Le; Haye, Damien; Olivier-Faivre, Laurence; Masurel-Paulet, Alice; Thauvin-Robinet, Christel; Lesne, Fabien; Faudet, Anne; Ville, Dorothée; des Portes, Vincent; Sanlaville, Damien; Siffroi, Jean-Pierre; Moutard, Marie-Laure; Héron, Delphine

    2017-06-01

    To evaluate the role that chromosomal micro-rearrangements play in patients with both corpus callosum abnormality and intellectual disability, we analyzed copy number variations (CNVs) in patients with corpus callosum abnormality/intellectual disability STUDY DESIGN: We screened 149 patients with corpus callosum abnormality/intellectual disability using Illumina SNP arrays. In 20 patients (13%), we have identified at least 1 CNV that likely contributes to corpus callosum abnormality/intellectual disability phenotype. We confirmed that the most common rearrangement in corpus callosum abnormality/intellectual disability is inverted duplication with terminal deletion of the 8p chromosome (3.2%). In addition to the identification of known recurrent CNVs, such as deletions 6qter, 18q21 (including TCF4), 1q43q44, 17p13.3, 14q12, 3q13, 3p26, and 3q26 (including SOX2), our analysis allowed us to refine the 2 known critical regions associated with 8q21.1 deletion and 19p13.1 duplication relevant for corpus callosum abnormality; report a novel 10p12 deletion including ZEB1 recently implicated in corpus callosum abnormality with corneal dystrophy; and) report a novel pathogenic 7q36 duplication encompassing SHH. In addition, 66 variants of unknown significance were identified in 57 patients encompassed candidate genes. Our results confirm the relevance of using microarray analysis as first line test in patients with corpus callosum abnormality/intellectual disability. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Molecular analysis of Fanconi anemia and mismatch repair genes in patients with colorectal carcinoma.

    Science.gov (United States)

    Colombino, Maria; Avallone, Antonio; Izzo, Francesco; Tatangelo, Fabiana; Budroni, Mario; Cossu, Antonio; Galimi, Francesco; Comella, Pasquale; Botti, Gerardo; Sini, Maria Cristina; Tanda, Francesco; Palmieri, Giuseppe

    2011-04-01

    A cohort of 206 consecutively-collected patients with colorectal carcinoma (CRC) were screened for germline mutations in the principal DNA mismatch repair (MMR) genes, MLH1 and MSH2, and in the Fanconi anemia (FA) genes involved in homologous recombination DNA repair. Mutation analysis was performed by denaturing high-performance liquid chromatography (DHPLC) and automated sequencing. Available paraffin-embedded tumor tissues were evaluated for gene expression by immunohistochemistry. Genes of the FA pathway were found to participate in CRC pathogenesis, being silenced during disease progression and metastasis formation. Conversely, MLH1 and MSH2 genes seem to be inactivated at earlier stages of the disease. Finally, very few (about 5%) cases presented a simultaneous inactivation of the MMR and FA genes. Overall, our findings indicated that: i) mismatch DNA repair remains the main mechanism to be altered at both germline and somatic levels among CRC patients; ii) functional impairments of mismatch DNA repair and FA-related repair may represent two different pathogenetic alterations which are concurring in colorectal cancer progression.

  13. Promoter methylation and expression of MGMT and the DNA mismatch repair genes MLH1, MSH2, MSH6 and PMS2 in paired primary and recurrent glioblastomas.

    Science.gov (United States)

    Felsberg, Jörg; Thon, Niklas; Eigenbrod, Sabina; Hentschel, Bettina; Sabel, Michael C; Westphal, Manfred; Schackert, Gabriele; Kreth, Friedrich Wilhelm; Pietsch, Torsten; Löffler, Markus; Weller, Michael; Reifenberger, Guido; Tonn, Jörg C

    2011-08-01

    Epigenetic silencing of the O(6) -methylguanine-DNA methyltransferase (MGMT) gene promoter is associated with prolonged survival in glioblastoma patients treated with temozolomide (TMZ). We investigated whether glioblastoma recurrence is associated with changes in the promoter methylation status and the expression of MGMT and the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6 and PMS2 in pairs of primary and recurrent glioblastomas of 80 patients, including 64 patients treated with radiotherapy and TMZ after the first operation. Among the primary tumors, the MGMT promoter was methylated in 31 patients and unmethylated in 49 patients. In 71 patients (89%), the MGMT promoter methylation status of the primary tumor was retained at recurrence. MGMT promoter methylation, but not MGMT protein expression, was associated with longer progression-free survival, overall survival and postrecurrence survival (PRS). Moreover, PRS was increased under salvage chemotherapy. Investigation of primary and recurrent glioblastomas of 43 patients did not identify promoter methylation in any of the four MMR genes. However, recurrent glioblastomas demonstrated significantly lower MSH2, MSH6 and PMS2 protein expression as detected by immunohistochemistry. In conclusion, reduced expression of MMR proteins, but not changes in MGMT promoter methylation, is characteristic of glioblastomas recurring after the current standards of care. Copyright © 2011 UICC.

  14. Chromosomal abnormalities in patients with sperm disorders

    Directory of Open Access Journals (Sweden)

    L. Y. Pylyp

    2013-02-01

    Full Text Available Chromosomal abnormalities are among the most common genetic causes of spermatogenic disruptions. Carriers of chromosomal abnormalities are at increased risk of infertility, miscarriage or birth of a child with unbalanced karyotype due to the production of unbalanced gametes. The natural selection against chromosomally abnormal sperm usually prevents fertilization with sperm barring in cases of serious chromosomal abnormalities. However, assisted reproductive technologies in general and intracytoplasmic sperm injection in particular, enable the transmission of chromosomal abnormalities to the progeny. Therefore, cytogenetic studies are important in patients with male factor infertility before assisted reproduction treatment. The purpose of the current study was to investigate the types and frequencies of chromosomal abnormalities in 724 patients with infertility and to estimate the risk of chromosomal abnormalities detection in subgroups of patients depending on the severity of spermatogenic disruption, aiming at identifying groups of patients in need of cytogenetic studies. Karyotype analysis was performed in 724 blood samples of men attending infertility clinic. Chromosomal preparation was performed by standard techniques. At least 20 GTG-banded metaphase plates with the resolution from 450 to 750 bands per haploid set were analysed in each case. When chromosomal mosaicism was suspected, this number was increased to 50. Abnormal karyotypes were observed in 48 (6.6% patients, including 67% of autosomal abnormalities and 33% of gonosomal abnormalities. Autosomal abnormalities were represented by structural rearrangements. Reciprocal translocations were the most common type of structural chromosomal abnormalities in the studied group, detected with the frequency of 2.6% (n = 19, followed by Robertsonian translocation, observed with the frequency of 1.2% (n = 9. The frequency of inversions was 0.6% (n = 4. Gonosomal abnormalities included 14 cases

  15. Rare cytogenetic abnormalities and alteration of microRNAs in acute myeloid leukemia and response to therapy

    OpenAIRE

    Mohammad Shahjahani; Elham Khodadi; Mohammad Seghatoleslami; Javad Mohammadi Asl; Neda Golchin; Zeynab Deris Zaieri; Najmaldin Saki

    2015-01-01

    Acute myeloid leukemia (AML) is the most common acute leukemia in adults, which is heterogeneous in terms of morphological, cytogenetic and clinical features. Cytogenetic abnormalities, including karyotype aberrations, gene mutations and gene expression abnormalities are the most important diagnostic tools in diagnosis, classification and prognosis in acute myeloid leukemias. Based on World Health Organization (WHO) classification, acute myeloid leukemias can be divided to four groups. Due to...

  16. Genetic abnormalities in chronic lymphocytic leukemia and their clinical and prognostic implications.

    Science.gov (United States)

    Dierlamm, J; Michaux, L; Criel, A; Wlodarska, I; Van den Berghe, H; Hossfeld, D K

    1997-03-01

    Clonal chromosome abnormalities can be detected in approximately 50% of patients with chronic lymphocytic leukemia (CLL). The most common changes are trisomy 12, followed by structural abnormalities of 13q, 11q, 6q, and 14q. By fluorescence in situ hybridization (FISH), these aberrations can be demonstrated even in cases with insufficient mitotic yield or a normal karyotype. The biologic consequences of trisomy 12 are unknown, but a gene dosage effect is suspected and studies on partial trisomy 12 indicate that the region 12q13 to 12q22 might be of particular pathogenetic importance. Trisomy 12 is strongly associated with atypical lymphocyte morphology and seems to be a secondary event in leukemogenesis, as shown by combined immunophenotyping and interphase FISH. Structural abnormalities of 13q frequently involve hetero- and homozygous deletions of a region in 13q14, distal to the retinoblastoma gene, which may be the site of a tumor suppressor gene. In contrast to a normal karyotype or structural changes of 13q, complex karyotypic abnormalities, high percentage of abnormal metaphases, trisomy 12 and structural changes involving the P53 tumor suppressor gene on 17p13 are adverse prognostic indicators. Cytogenetic and molecular findings provide important diagnostic, clinical, and prognostic information which can contribute to treatment decisions and follow-up of CLL patients.

  17. Numerically abnormal chromosome constitutions in humans

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1993-12-31

    Chapter 24, discusses numerically abnormal chromosome constitutions in humans. This involves abnormalities of human chromosome number, including polyploidy (when the number of sets of chromosomes increases) and aneuploidy (when the number of individual normal chromosomes changes). Chapter sections discuss the following chromosomal abnormalities: human triploids, imprinting and uniparental disomy, human tetraploids, hydatidiform moles, anomalies caused by chromosomal imbalance, 13 trisomy (D{sub 1} trisomy, Patau syndrome), 21 trisomy (Down syndrome), 18 trisomy syndrome (Edwards syndrome), other autosomal aneuploidy syndromes, and spontaneous abortions. The chapter concludes with remarks on the nonrandom participation of chromosomes in trisomy. 69 refs., 3 figs., 4 tabs.

  18. Prediction of heart abnormality using MLP network

    Science.gov (United States)

    Hashim, Fakroul Ridzuan; Januar, Yulni; Mat, Muhammad Hadzren; Rizman, Zairi Ismael; Awang, Mat Kamil

    2018-02-01

    Heart abnormality does not choose gender, age and races when it strikes. With no warning signs or symptoms, it can result to a sudden death of the patient. Generally, heart's irregular electrical activity is defined as heart abnormality. Via implementation of Multilayer Perceptron (MLP) network, this paper tries to develop a program that allows the detection of heart abnormality activity. Utilizing several training algorithms with Purelin activation function, an amount of heartbeat signals received through the electrocardiogram (ECG) will be employed to condition the MLP network.

  19. Association of a novel point mutation in MSH2 gene with familial multiple primary cancers

    Directory of Open Access Journals (Sweden)

    Hai Hu

    2017-10-01

    Full Text Available Abstract Background Multiple primary cancers (MPC have been identified as two or more cancers without any subordinate relationship that occur either simultaneously or metachronously in the same or different organs of an individual. Lynch syndrome is an autosomal dominant genetic disorder that increases the risk of many types of cancers. Lynch syndrome patients who suffer more than two cancers can also be considered as MPC; patients of this kind provide unique resources to learn how genetic mutation causes MPC in different tissues. Methods We performed a whole genome sequencing on blood cells and two tumor samples of a Lynch syndrome patient who was diagnosed with five primary cancers. The mutational landscape of the tumors, including somatic point mutations and copy number alternations, was characterized. We also compared Lynch syndrome with sporadic cancers and proposed a model to illustrate the mutational process by which Lynch syndrome progresses to MPC. Results We revealed a novel pathologic mutation on the MSH2 gene (G504 splicing that associates with Lynch syndrome. Systematical comparison of the mutation landscape revealed that multiple cancers in the proband were evolutionarily independent. Integrative analysis showed that truncating mutations of DNA mismatch repair (MMR genes were significantly enriched in the patient. A mutation progress model that included germline mutations of MMR genes, double hits of MMR system, mutations in tissue-specific driver genes, and rapid accumulation of additional passenger mutations was proposed to illustrate how MPC occurs in Lynch syndrome patients. Conclusion Our findings demonstrate that both germline and somatic alterations are driving forces of carcinogenesis, which may resolve the carcinogenic theory of Lynch syndrome.

  20. [Dental abnormalities after treatment for childhood cancer].

    Science.gov (United States)

    Mladosievičová, B; Jurkovič, R; Izakovičová Hollá, L

    2015-01-01

    Childhood cancer therapy often increases the risk of dental complications, such as tooth and roots agenesis, microdontia, abnormal development of tooth enamel, increased risk of cavity and other abnormalities. In a comparison with other late adverse effects of chemotherapy, radiotherapy and hematopoietic stem cell transplantion, a relative small number of clinical stud-ies observing patients for more than two years after completion of anticancer treatment was published. In this article, we review the incidence of dental abnormalities caused by commonly used anticancer treatment modalities as well as discuss their risk factors. Early identification of high-risk patients, early detection and management of dental abnormalities and better education of patients or their guardians, may have an impact on quality of life of cancer survivors.

  1. On two abnormal sharks from Gujarat

    Digital Repository Service at National Institute of Oceanography (India)

    Gopalan, U.K.

    The description of the two abnormal sharks, Carchariaswalbeehmi and Eulamia dussumieri collected from Gujarat, India, is given Of these C walbeehmi was double-headed The other shark E dussumieri had thumb snouted albino...

  2. Video Traffic Analysis for Abnormal Event Detection

    Science.gov (United States)

    2010-01-01

    We propose the use of video imaging sensors for the detection and classification of abnormal events to be used primarily for mitigation of traffic congestion. Successful detection of such events will allow for new road guidelines; for rapid deploymen...

  3. Low-set ears and pinna abnormalities

    Science.gov (United States)

    ... because they do not affect hearing. However, sometimes cosmetic surgery is recommended. Skin tags may be tied off, ... 5 years old. More severe abnormalities may require surgery for cosmetic reasons as well as for function. Surgery to ...

  4. Report to Congress on abnormal occurrences

    International Nuclear Information System (INIS)

    1990-10-01

    Section 208 of the Energy Reorganization Act of 1974 identifies an abnormal occurrence as an unscheduled incident or event that the Nuclear Regulatory Commission determines to be significant from the standpoint of public health or safety and requires a quarterly report of such events to be made to Congress. This report covers the period from April 1 through June 30, 1990. The report discusses six abnormal occurrences, none involving a nuclear power plant. There were five abnormal occurrences at NRC licensees: (1) deficiencies in brachytherapy program; (2) a radiation overexposure of a radiographer; (3) a medical diagnostic misadministration; (4) administration of iodine-131 to a lactating female with subsequent uptake by her infant; and (5) a medical therapy misadministration. An Agreement State (Arizona) reported an abnormal occurrence involving a medical diagnostic misadministration. The report also contains information that updates a previously reported occurrence

  5. Errata :Chromosomal Abnormalities in Couples with Recurrent ...

    African Journals Online (AJOL)

    Chromosomal Abnormalities in Couples with Recurrent Abortions in Lagos, Nigeria. Akinde OR, Daramola A O, Taiwo I A, Afolayan M O and Akinsola Af. Sonographic Mammary Gland Density Pattern in Women in Selected ommunities of Southern Nigeria.

  6. Video traffic analysis for abnormal event detection.

    Science.gov (United States)

    2010-01-01

    We propose the use of video imaging sensors for the detection and classification of abnormal events to : be used primarily for mitigation of traffic congestion. Successful detection of such events will allow for : new road guidelines; for rapid deplo...

  7. Prevalence of asymptomatic urinary abnormalities among adolescents

    Directory of Open Access Journals (Sweden)

    Mohamed Fouad

    2016-01-01

    Full Text Available To determine the prevalence of asymptomatic urinary abnormalities in adolescents, first morning clean mid-stream urine specimens were obtained from 2500 individuals and examined by dipstick and light microscopy. Adolescents with abnormal screening results were reexamined after two weeks and those who had abnormal results twice were subjected to systemic clinical examination and further clinical and laboratory investigations. Eight hundred and three (32.1% individuals had urinary abnormalities at the first screening, which significantly decreased to 345 (13.8% at the second screening, (P <0.001. Hematuria was the most common urinary abnormalities detected in 245 (9.8% adolescents who had persistent urine abnormalities; 228 (9.1% individuals had non glomerular hematuria. The hematuria was isolated in 150 (6% individuals, combined with leukocyturia in 83 (3.3% individuals, and combined with proteinuria in 12 (0.5% individuals. Leukocyturia was detected in 150 (6% of all studied adolescents; it was isolated in 39 (1.6% individuals and combined with proteinuria in 28 (1.1% of them. Asymp- tomatic bacteriuria was detected in 23 (0.9% of all studied adolescents; all the cases were females. Proteinuria was detected in 65 (2.6% of all the studied adolescents; 45 (1.8% indivi- duals had <0.5 g/day and twenty (0.8% individuals had 0.5-3 g/day. Asymptomatic urinary abnormalities were more common in males than females and adolescents from rural than urban areas (P <0.01 and (P <0.001, respectively. The present study found a high prevalence of asymptomatic urinary abnormalities among adolescents in our population.

  8. Abnormal ''Contamination' Levels On Garden Appliances

    International Nuclear Information System (INIS)

    German, U.; Levinson, S.; Elmelech, V.; Pelled, O.; Tshuva, A.; Laichter, Y.

    1999-01-01

    During routine contamination checks we encountered an abnormal high level of Alpha and Beta emitting radioisotopes on working gloves of employees of the gardening department. It came out that the source was due to ''contamination'' levels on steering wheels of some gardening machines. In order to ensure that no real contamination of these workers was involved , a series of checks was started to identity the source of the abnormal levels found during monitoring

  9. Normal and Abnormal Behavior in Early Childhood

    OpenAIRE

    Spinner, Miriam R.

    1981-01-01

    Evaluation of normal and abnormal behavior in the period to three years of age involves many variables. Parental attitudes, determined by many factors such as previous childrearing experience, the bonding process, parental psychological status and parental temperament, often influence the labeling of behavior as normal or abnormal. This article describes the forms of crying, sleep and wakefulness, and affective responses from infancy to three years of age.

  10. Familial eccrine syringofibroadenomatosis with associated ophthalmologic abnormalities.

    Science.gov (United States)

    Chen, S; Palay, D; Templeton, S F

    1998-08-01

    Eccrine syringofibroadenoma (ESFA) is a rare benign adnexal tumor, generally with sporadic occurrence and not linked to other diseases. Only one familial occurrence of ESFA has been reported. We describe the familial occurrence of multiple ESFAs in a father and his two sons, all of whom also had similar eyelid abnormalities and progressive corneal scarring. This description of hereditary ESFA is the first to link ESFA with periocular and ocular abnormalities.

  11. [Hysteroscopic polypectomy, treatment of abnormal uterine bleeding].

    Science.gov (United States)

    de Los Rios, P José F; López, R Claudia; Cifuentes, P Carolina; Angulo, C Mónica; Palacios-Barahona, Arlex U

    2015-07-01

    To evaluate the effectiveness of the hysteroscopic polypectomy in terms of the decrease of the abnormal uterine bleeding. A cross-sectional and analytical study was done with patients to whom a hysteroscopic polypectomy was done for treating the abnormal uterine bleeding, between January 2009 and December 2013. The response to the treatment was evaluated via a survey given to the patients about the behavior of the abnormal uterine bleeding after the procedure and about overall satisfaction. The results were obtained after a hysteroscopic polypectomy done to 128 patients and were as follows. The average time from the polypectomy applied until the survey was 30.5 months, with a standard deviation of 18 months. 67.2% of the patients reported decreased abnormal uterine bleeding and the 32.8% reported a persistence of symptoms. On average 82.8% of the. patients were satisfied with the treatment. Bivariate and multivariate analysis showed no association between the variables studied and no improvement of abnormal uterine bleeding after surgery (polypectomy). There were no complications. Hysteroscopic polypectomy is a safe surgical treatment, which decreases on two of three patients the abnormal uterine bleeding in the presence of endometrial polyps, with an acceptable level of satisfaction.

  12. Cytogenetic and molecular abnormalities in chronic myelomonocytic leukemia.

    Science.gov (United States)

    Patnaik, M M; Tefferi, A

    2016-02-05

    Chronic myelomonocytic leukemia (CMML) is a clonal stem cell disorder associated with peripheral blood monocytosis and an inherent tendency to transform to acute myeloid leukemia. CMML has overlapping features of myelodysplastic syndromes and myeloproliferative neoplasms. Clonal cytogenetic changes are seen in ~30%, whereas gene mutations are seen in >90% of patients. Common cytogenetic abnormalities include; trisomy 8, -Y, -7/del(7q), trisomy 21 and del(20q), with the Mayo-French risk stratification effectively risk stratifying patients based on cytogenetic abnormalities. Gene mutations frequently involve epigenetic regulators (TET2 ~60%), modulators of chromatin (ASXL1 ~40%), spliceosome components (SRSF2 ~50%), transcription factors (RUNX1 ~15%) and signal pathways (RAS ~30%, CBL ~15%). Of these, thus far, only nonsense and frameshift ASXL1 mutations have been shown to negatively impact overall survival. This has resulted in the development of contemporary, molecularly integrated (inclusive of ASXL1 mutations) CMML prognostic models, including Molecular Mayo Model and the Groupe Français des Myélodysplasies model. Better understanding of the prevalent genetic and epigenetic dysregulation has resulted in emerging targeted treatment options for some patients. The development of an integrated (cytogenetic and molecular) prognostic model along with CMML-specific response assessment criteria are much needed future goals.

  13. Cytogenetic and molecular abnormalities in chronic myelomonocytic leukemia

    International Nuclear Information System (INIS)

    Patnaik, M M; Tefferi, A

    2016-01-01

    Chronic myelomonocytic leukemia (CMML) is a clonal stem cell disorder associated with peripheral blood monocytosis and an inherent tendency to transform to acute myeloid leukemia. CMML has overlapping features of myelodysplastic syndromes and myeloproliferative neoplasms. Clonal cytogenetic changes are seen in ~30%, whereas gene mutations are seen in >90% of patients. Common cytogenetic abnormalities include; trisomy 8, -Y, -7/del(7q), trisomy 21 and del(20q), with the Mayo–French risk stratification effectively risk stratifying patients based on cytogenetic abnormalities. Gene mutations frequently involve epigenetic regulators (TET2 ~60%), modulators of chromatin (ASXL1 ~40%), spliceosome components (SRSF2 ~50%), transcription factors (RUNX1 ~15%) and signal pathways (RAS ~30%, CBL ~15%). Of these, thus far, only nonsense and frameshift ASXL1 mutations have been shown to negatively impact overall survival. This has resulted in the development of contemporary, molecularly integrated (inclusive of ASXL1 mutations) CMML prognostic models, including Molecular Mayo Model and the Groupe Français des Myélodysplasies model. Better understanding of the prevalent genetic and epigenetic dysregulation has resulted in emerging targeted treatment options for some patients. The development of an integrated (cytogenetic and molecular) prognostic model along with CMML-specific response assessment criteria are much needed future goals

  14. Premanifest Huntington's disease: Examination of oculomotor abnormalities in clinical practice.

    Science.gov (United States)

    Winder, Jessica Y; Roos, Raymund A C

    2018-01-01

    Different oculomotor abnormalities have been reported to occur in premanifest Huntington's disease. The aim of this study is to investigate which oculomotor items of the Unified Huntington's Disease Rating Scale (UHDRS) are affected in premanifest individuals compared to healthy controls, and if CAG repeat length and age are correlated with oculomotor abnormalities in premanifest Huntington's disease gene carriers. We compared baseline data of 70 premanifest individuals and 27 controls who participated in the Enroll-HD study at the Leiden University Medical Center, the Netherlands. Premanifest gene carriers were divided in individuals near to disease onset and individuals far from disease onset. Using a logistic regression model, only horizontal ocular pursuit of the six oculomotor items of the UHDRS was significantly more frequently affected in premanifest individuals close to disease onset compared to controls (p = 0.044, OR 13.100). Age was significantly higher in premanifest individuals with affected horizontal ocular pursuit (p = 0.016, OR 1.115) and with affected vertical ocular pursuit (p = 0.030, OR 1.065) compared to premanifest individuals without ocular pursuit deficits. Our results suggest that horizontal ocular pursuit is the only affected oculomotor item of the UHDRS in premanifest individuals and could be used to assess early clinical signs of Huntington's disease. Saccade initiation and saccade velocity do not seem useful for detecting differences between premanifest individuals and controls.

  15. Ocular abnormalities in healthy Standardbred foals.

    Science.gov (United States)

    Barsotti, Giovanni; Sgorbini, Micaela; Marmorini, Paola; Corazza, Michele

    2013-07-01

    To determine the prevalence and describe ocular abnormalities in healthy Standardbred foals within 48 h of birth. One hundred and two neonatal foals. All foals had an unassisted delivery. On the basis of physical examination and the results of hematological and biochemical parameters, all foals were unaffected by systemic diseases. A complete ophthalmic examination was performed within 48 h of birth. Foals with ocular hemorrhages were re-examined weekly until the abnormalities were resolved. 65/102 (63.7%) foals did not show ocular abnormalities, while in 37/102 (36.3%) cases, ocular abnormalities were present. Retinal and subconjunctival hemorrhages were recorded in 19/102 (18.6%), and in 13/102 (12.7%), respectively. In 4/102 (3.9%) animals, an entropion of the lower eyelid was present. Only one foal (1%) showed a congenital nuclear unilateral cataract. No other ocular abnormalities were detected. However, all foals showed various degrees of remnants of hyaloid system. One week after the first ocular examination, retinal hemorrhages had resolved in 100% of the eyes, whereas subconjunctival hemorrhages had disappeared in all eyes by the second week following the first examination. The acquired ocular lesions observed with relatively high frequency in the examined healthy Standardbred foals were ocular hemorrhages, which always showed a good outcome. Although these abnormalities were present at birth, they were not considered strictly congenital but likely acquired during parturition. Instead, congenital ocular abnormalities were rarely diagnosed, and the entropion of the lower eyelid was the most common disease in the breed. © 2012 American College of Veterinary Ophthalmologists.

  16. Detecting Kidney and Urinary Tract Abnormalities Before Birth

    Science.gov (United States)

    ... Guide Detecting Kidney and Urinary Tract Abnormalities Before Birth Print Email Ultrasound examinations are often done as ... What causes urinary tract abnormalities to occur before birth? In about one of 500 births, some abnormality ...

  17. Transcriptome Analysis for Abnormal Spike Development of the Wheat Mutant dms.

    Directory of Open Access Journals (Sweden)

    Xin-Xin Zhu

    Full Text Available Wheat (Triticum aestivum L. spike development is the foundation for grain yield. We obtained a novel wheat mutant, dms, characterized as dwarf, multi-pistil and sterility. Although the genetic changes are not clear, the heredity of traits suggests that a recessive gene locus controls the two traits of multi-pistil and sterility in self-pollinating populations of the medium plants (M, such that the dwarf genotype (D and tall genotype (T in the progeny of the mutant are ideal lines for studies regarding wheat spike development. The objective of this study was to explore the molecular basis for spike abnormalities of dwarf genotype.Four unigene libraries were assembled by sequencing the mRNAs of the super-bulked differentiating spikes and stem tips of the D and T plants. Using integrative analysis, we identified 419 genes highly expressed in spikes, including nine typical homeotic genes of the MADS-box family and the genes TaAP2, TaFL and TaDL. We also identified 143 genes that were significantly different between young spikes of T and D, and 26 genes that were putatively involved in spike differentiation. The result showed that the expression levels of TaAP1-2, TaAP2, and other genes involved in the majority of biological processes such as transcription, translation, cell division, photosynthesis, carbohydrate transport and metabolism, and energy production and conversion were significantly lower in D than in T.We identified a set of genes related to wheat floral organ differentiation, including typical homeotic genes. Our results showed that the major causal factors resulting in the spike abnormalities of dms were the lower expression homeotic genes, hormonal imbalance, repressed biological processes, and deficiency of construction materials and energy. We performed a series of studies on the homeotic genes, however the other three causal factors for spike abnormal phenotype of dms need further study.

  18. Transcriptome Analysis for Abnormal Spike Development of the Wheat Mutant dms.

    Science.gov (United States)

    Zhu, Xin-Xin; Li, Qiao-Yun; Shen, Chun-Cai; Duan, Zong-Biao; Yu, Dong-Yan; Niu, Ji-Shan; Ni, Yong-Jing; Jiang, Yu-Mei

    2016-01-01

    Wheat (Triticum aestivum L.) spike development is the foundation for grain yield. We obtained a novel wheat mutant, dms, characterized as dwarf, multi-pistil and sterility. Although the genetic changes are not clear, the heredity of traits suggests that a recessive gene locus controls the two traits of multi-pistil and sterility in self-pollinating populations of the medium plants (M), such that the dwarf genotype (D) and tall genotype (T) in the progeny of the mutant are ideal lines for studies regarding wheat spike development. The objective of this study was to explore the molecular basis for spike abnormalities of dwarf genotype. Four unigene libraries were assembled by sequencing the mRNAs of the super-bulked differentiating spikes and stem tips of the D and T plants. Using integrative analysis, we identified 419 genes highly expressed in spikes, including nine typical homeotic genes of the MADS-box family and the genes TaAP2, TaFL and TaDL. We also identified 143 genes that were significantly different between young spikes of T and D, and 26 genes that were putatively involved in spike differentiation. The result showed that the expression levels of TaAP1-2, TaAP2, and other genes involved in the majority of biological processes such as transcription, translation, cell division, photosynthesis, carbohydrate transport and metabolism, and energy production and conversion were significantly lower in D than in T. We identified a set of genes related to wheat floral organ differentiation, including typical homeotic genes. Our results showed that the major causal factors resulting in the spike abnormalities of dms were the lower expression homeotic genes, hormonal imbalance, repressed biological processes, and deficiency of construction materials and energy. We performed a series of studies on the homeotic genes, however the other three causal factors for spike abnormal phenotype of dms need further study.

  19. Sequencing Chromosomal Abnormalities Reveals Neurodevelopmental Loci that Confer Risk across Diagnostic Boundaries

    DEFF Research Database (Denmark)

    Talkowski, Michael E.; Rosenfeld, Jill A.; Blumenthal, Ian

    2012-01-01

    Sequencing of balanced chromosomal abnormalities, combined with convergent genomic studies of gene expression, copy-number variation, and genome-wide association, identifies 22 new loci that contribute to autism and related neurodevelopmental disorders. These data support a polygenic risk model f...... for autism and provide new insight into how different types of mutations of the same genes can lead to variable disease phenotypes that manifest at different stages of life....

  20. Congenital abnormalities (a bibliography with abstracts). Report for 1964-Nov 77

    Energy Technology Data Exchange (ETDEWEB)

    Harrison, E.A.

    1977-11-01

    Radiation hazards, food additives, gene mutations, musculoskeletal diseases, neoplasms, leukemia, rubella and chromosomes as related to congenital abnormalities are topics covered by the citations of research reports in the bibliography. (This updated bibliography contains 141 abstracts, 30 of which are new entries to the previous edition.)

  1. Congenital abnormalities (a bibliography with abstracts). Report for 1964-November 1979

    Energy Technology Data Exchange (ETDEWEB)

    Harrison, E.A.

    1979-12-01

    Radiation hazards, food additives, gene mutations, musculoskeletal diseases, neoplasms, leukemia, rubella and chromosomes as related to congenital abnormalities are topics covered by the citations of research reports in the bibliography. (This updated bibliography contains 184 abstracts, 18 of which are new entries to the previous edition.)

  2. Chromosomal abnormality in patients with secondary amenorrhea.

    Science.gov (United States)

    Safai, Akbar; Vasei, Mohammad; Attaranzadeh, Armin; Azad, Fariborz; Tabibi, Narjes

    2012-04-01

    Secondary amenorrhea is a condition in which there is cessation of menses after at least one menstruation. It is a symptom of different diseases, such as hormonal disturbances which range from pituitary to ovarian origin, as well as chromosomal abnormalities. Knowledge of the distinct cause of secondary amenorrhea is of tremendous benefit for the management and monitoring of patients. In this study, we determine the chromosomal abnormalities in patients with secondary amenorrhea in Southwest Iran. We selected 94 patients with secondary amenorrhea who referred to our Cytogenetic Ward from 2004 until 2009. For karyotyping, peripheral blood lymphocyte cultures were set up by conventional technique. In this study, 5.3% (n=5) of patients with secondary amenorrhea presented with chromosomal abnormalities, of which all contained an X element. The chromosomal abnormalities were: i) 45, X (n=1); ii) 47, XXX (n=1); iii) 45, X [13]/ 45, Xi(X)q[17] (n=1);  iv) 45, X[12]/46,X,+mar[12] (n=1); and v) 46,X,del(Xq)(q23q28) (n=1). Our study revealed that some causes of secondary amenorrhea could be due to chromosomal abnormalities. Therefore, cytogenetic studies should be important tests in the evaluation of patients with secondary amenorrhea.

  3. Cardiac abnormality prediction using HMLP network

    Science.gov (United States)

    Adnan, Ja'afar; Ahmad, K. A.; Mat, Muhamad Hadzren; Rizman, Zairi Ismael; Ahmad, Shahril

    2018-02-01

    Cardiac abnormality often occurs regardless of gender, age and races but depends on the lifestyle. This problem sometimes does not show any symptoms and usually detected once it already critical which lead to a sudden death to the patient. Basically, cardiac abnormality is the irregular electrical signal that generate by the pacemaker of the heart. This paper attempts to develop a program that can detect cardiac abnormality activity through implementation of Hybrid Multilayer Perceptron (HMLP) network. A certain amount of data of the heartbeat signals from the electrocardiogram (ECG) will be used in this project to train the MLP and HMLP network by using Modified Recursive Prediction Error (MRPE) algorithm and to test the network performance.

  4. Radiographic abnormalities in tricyclic acid overdose

    International Nuclear Information System (INIS)

    Varnell, R.M.; Richardson, M.L.; Vincent, J.M.; Godwin, J.D.

    1987-01-01

    Several case reports have described adult respiratory distress syndrome (ARDS) secondary to tricyclic acid (TCA) overdose. During a 1-year period 83 patients requiring intubation secondary to drug overdose were evaluated. Abnormalities on chest radiographs occurred in 26 (50%) of the 54 patients with TCA overdose, compared to six (21%) of the 29 patients overdosed with other drugs. In addition, five (9%) of the patients with TCA overdose subsequently had radiographic and clinical abnormalities meeting the criteria for ARDS. Only one (3%) of the patients with non-TCA overdose subsequently had change suggesting ARDS. TCAs should be added to the list of drugs associated with ARDS, and TCA overdose should be considered a major risk factor in the development of radiographically evident abnormalities

  5. Schizophrenia and abnormal brain network hubs.

    Science.gov (United States)

    Rubinov, Mikail; Bullmore, Ed

    2013-09-01

    Schizophrenia is a heterogeneous psychiatric disorder of unknown cause or characteristic pathology. Clinical neuroscientists increasingly postulate that schizophrenia is a disorder of brain network organization. In this article we discuss the conceptual framework of this dysconnection hypothesis, describe the predominant methodological paradigm for testing this hypothesis, and review recent evidence for disruption of central/hub brain regions, as a promising example of this hypothesis. We summarize studies of brain hubs in large-scale structural and functional brain networks and find strong evidence for network abnormalities of prefrontal hubs, and moderate evidence for network abnormalities of limbic, temporal, and parietal hubs. Future studies are needed to differentiate network dysfunction from previously observed gray- and white-matter abnormalities of these hubs, and to link endogenous network dysfunction phenotypes with perceptual, behavioral, and cognitive clinical phenotypes of schizophrenia.

  6. Abnormal cervical cytology and health care use

    DEFF Research Database (Denmark)

    Frederiksen, Maria Eiholm; Baillet, Miguel Vázquez-Prada; Dugué, Pierre-Antoine

    2015-01-01

    OBJECTIVE: This study aimed to assess the long-term use of health care services in women with abnormal cytology results compared to women with normal cytology results. METHODS: We did a nationwide population-based study, using women aged 23 to 59years participating in the national organized...... cervical cancer screening program. We included a study population of 40,153 women with abnormal cytology (exposed) and 752,627 women with normal cytology (non-exposed). We retrieved data from the Danish Civil Registration System, the Danish Pathology Data Bank, the National Health Service, the National...... the "before" to the "after" period. This increase was significantly higher for exposed than non-exposed women regarding contacts to GP, admissions to hospitals, and drug use. CONCLUSION: Women with abnormal cytology results constitute a selected group with a higher health care use than other women even before...

  7. Abnormal Grain Growth Suppression in Aluminum Alloys

    Science.gov (United States)

    Hales, Stephen J. (Inventor); Claytor, Harold Dale (Inventor); Alexa, Joel A. (Inventor)

    2015-01-01

    The present invention provides a process for suppressing abnormal grain growth in friction stir welded aluminum alloys by inserting an intermediate annealing treatment ("IAT") after the welding step on the article. The IAT may be followed by a solution heat treatment (SHT) on the article under effectively high solution heat treatment conditions. In at least some embodiments, a deformation step is conducted on the article under effective spin-forming deformation conditions or under effective superplastic deformation conditions. The invention further provides a welded article having suppressed abnormal grain growth, prepared by the process above. Preferably the article is characterized with greater than about 90% reduction in area fraction abnormal grain growth in any friction-stir-welded nugget.

  8. Enhanced monitoring of abnormal emergency department demands

    KAUST Repository

    Harrou, Fouzi

    2016-06-13

    This paper presents a statistical technique for detecting signs of abnormal situation generated by the influx of patients at emergency department (ED). The monitoring strategy developed was able to provide early alert mechanisms in the event of abnormal situations caused by abnormal patient arrivals to the ED. More specifically, This work proposed the application of autoregressive moving average (ARMA) models combined with the generalized likelihood ratio (GLR) test for anomaly-detection. ARMA was used as the modelling framework of the ARMA-based GLR anomaly-detection methodology. The GLR test was applied to the uncorrelated residuals obtained from the ARMA model to detect anomalies when the data did not fit the reference ARMA model. The ARMA-based GLR hypothesis testing scheme was successfully applied to the practical data collected from the database of the pediatric emergency department (PED) at Lille regional hospital center, France. © 2015 IEEE.

  9. Report on Congress on abnormal occurrences

    International Nuclear Information System (INIS)

    1991-06-01

    Section 208 of the energy Reorganization Act of 1974 identifies an abnormal occurrence as an unscheduled incident or event that the Nuclear Regulatory Commission determines to be significant from the standpoint of public health or safety and requires a quarterly report of such events to be made to Congress. This report covers the period from January 1 through March 31, 1991. The report discusses six abnormal occurrences, none of which involved a nuclear power plant. Five of the events occurred at NRC-licensed facilities: one involved a significant degradation of plant safety at a nuclear fuel cycle facility, one involved a medical diagnostic misadministration, and three involved medical therapy misadministrations. An Agreement State (Arizona) reported one abnormal occurrence that involved medical therapy misadministrations

  10. Abnormal fetal head shape: aetiology and management

    DEFF Research Database (Denmark)

    Petersen, Olav Bjørn; David, Anna; Thomasson, Louise

    2007-01-01

    and define management pathways for fetuses with an abnormal skull shape. Methods: Our FMU databases were searched to ascertain all fetuses with an abnormal skull shape. Sonographic findings, diagnosis and outcome were reviewed. Results: Of the 370 cases identified, 31.6% were associated with spinabifida......Background: Abnormal head shape is an uncommon finding on prenatal ultrasound, often associated with breech presentation, spinabifida, aneuploidy or secondary to oligohydramnios or fetal position. Other aetiologies are rarer and may be more difficult to define. Objective: To determine the aetiology...... incidence of genetic syndromes, in the absence of a clear diagnosis, referral to a tertiary centre and genetic input is advised as detection of subtle sonographic features may aid diagnosis, allowing for targeted molecular analysis. An algorithm for management will be proposed....

  11. Osseous temporomandibular joint abnormalities in rheumatic disease

    International Nuclear Information System (INIS)

    Larheim, T.A.; Kolbenstvedt, A.; Rikshospitalet, Oslo

    1990-01-01

    Computed tomography (CT) of the temporomandibular joint (TMJ) was compared with hypocycloidal tomography in 30 joints of 15 adults with rheumatic disease. CT included 1.5 mm thick axial scans (at 1.0 mm intervals) with reformatted oblique sagittal and oblique coronal sections. Multisection (at 2.0 mm intervals) tomography included oblique sagittal and occasionally, oblique coronal sections. CT demonstrated bone abnormalities in 21 and tomography in 20 joints, indicating high agreement between the imaging modalities regarding number of abnormal TMJs. Bone structures were, however, better visualized by multiplanar CT due to superior contrast and spatial resolution particularly in the most lateral and medial parts of the joint, indicating superiority of CT for depicting subtle bony TMJ abnormalities in patients with rheumatic disease. (orig.)

  12. [Abnormal peripheral circulation in heart failure].

    Science.gov (United States)

    Cohen-Solal, A; Laperche, T; Caviezel, B; Dahan, M; Gourgon, R

    1994-06-01

    Left ventricular failure leads to circulatory failure which causes clinical symptoms and in which regional blood flow changes play an important role. An abnormality of systemic vasodilatation on exercise or on pharmacological intervention has been shown. This affects both the resistance and conductive vessels and is mainly functional, related to neurohormonal stimulation with a predominance of vasoconstrictive factors amongst which increased adrenergic tone probably plays an essential part. A modification of the endothelium-dependent response has recently been confirmed. The presence of structural vascular abnormalities (increase in parietal sodium and water concentrations, "remodelling" remains debatable in the human. These abnormalities have a common factor in their chronicity and take time to regress with medical treatment or after cardiac transplantation. Physical training seems to induce more marked and, above all, more rapid effects.

  13. Abnormal vibration induced illusion of movement in essential tremor: evidence for abnormal muscle spindle afferent function

    OpenAIRE

    Frima, N; Grunewald, R

    2005-01-01

    Objectives: Vibration induced illusion of movement (VIIM) is abnormal in patients with idiopathic focal dystonia, an abnormality which corrects with fatigue of the vibrated muscle. Since dystonia and essential tremor sometimes coexist in families, we investigated the perception of VIIM and the effect of fatigue on VIIM in patients with essential tremor.

  14. Nonpathologizing trauma interventions in abnormal psychology courses.

    Science.gov (United States)

    Hoover, Stephanie M; Luchner, Andrew F; Pickett, Rachel F

    2016-01-01

    Because abnormal psychology courses presuppose a focus on pathological human functioning, nonpathologizing interventions within these classes are particularly powerful and can reach survivors, bystanders, and perpetrators. Interventions are needed to improve the social response to trauma on college campuses. By applying psychodynamic and feminist multicultural theory, instructors can deliver nonpathologizing interventions about trauma and trauma response within these classes. We recommend class-based interventions with the following aims: (a) intentionally using nonpathologizing language, (b) normalizing trauma responses, (c) subjectively defining trauma, (d) challenging secondary victimization, and (e) questioning the delineation of abnormal and normal. The recommendations promote implications for instructor self-reflection, therapy interventions, and future research.

  15. Temporomandibular joint abnormalities in rheumatoid arthritis

    International Nuclear Information System (INIS)

    Larheim, T.A.; Tveito, L.; Dale, K.; Ruud, A.F.

    1981-01-01

    Transantral (infraorbital, transmaxillary) examination of the temporomandibular joint was compared with conventional transcranial examination and lateral tomography of patients with rheumatoid arthritis aged 23 to 83. Abnormalities were most frequently found at tomography, and equally frequent at transantral and transcranial examinations. The various examinations appeared to be rather supplementary. Bone erosion was frequently observed at transantral examination, which appeared to be the preferable radiographic method for detecting arthritis of this joint. Combined with transcranial examination, the method is recommended for the evaluation of temporomandibular joint abnormalities in rheumatoid arthritis if tomographic equipment is not available. (Auth.)

  16. Temporal abnormalities in children with developmental dyscalculia.

    Science.gov (United States)

    Vicario, Carmelo Mario; Rappo, Gaetano; Pepi, Annamaria; Pavan, Andrea; Martino, Davide

    2012-01-01

    Recent imaging studies have associated Developmental dyscalculia (DD) to structural and functional alterations corresponding Parietal and the Prefrontal cortex (PFC). Since these areas were shown also to be involved in timing abilities, we hypothesized that time processing is abnormal in DD. We compared time processing abilities between 10 children with pure DD (8 years old) and 11 age-matched healthy children. Results show that the DD group underestimated duration of a sub-second scale when asked to perform a time comparison task. The timing abnormality observed in our DD participants is consistent with evidence of a shared fronto-parietal neural network for representing time and quantity.

  17. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  18. Abnormal islet sphingolipid metabolism in type 1 diabetes.

    Science.gov (United States)

    Holm, Laurits J; Krogvold, Lars; Hasselby, Jane P; Kaur, Simranjeet; Claessens, Laura A; Russell, Mark A; Mathews, Clayton E; Hanssen, Kristian F; Morgan, Noel G; Koeleman, Bobby P C; Roep, Bart O; Gerling, Ivan C; Pociot, Flemming; Dahl-Jørgensen, Knut; Buschard, Karsten

    2018-04-18

    Sphingolipids play important roles in beta cell physiology, by regulating proinsulin folding and insulin secretion and in controlling apoptosis, as studied in animal models and cell cultures. Here we investigate whether sphingolipid metabolism may contribute to the pathogenesis of human type 1 diabetes and whether increasing the levels of the sphingolipid sulfatide would prevent models of diabetes in NOD mice. We examined the amount and distribution of sulfatide in human pancreatic islets by immunohistochemistry, immunofluorescence and electron microscopy. Transcriptional analysis was used to evaluate expression of sphingolipid-related genes in isolated human islets. Genome-wide association studies (GWAS) and a T cell proliferation assay were used to identify type 1 diabetes related polymorphisms and test how these affect cellular islet autoimmunity. Finally, we treated NOD mice with fenofibrate, a known activator of sulfatide biosynthesis, to evaluate the effect on experimental autoimmune diabetes development. We found reduced amounts of sulfatide, 23% of the levels in control participants, in pancreatic islets of individuals with newly diagnosed type 1 diabetes, which were associated with reduced expression of enzymes involved in sphingolipid metabolism. Next, we discovered eight gene polymorphisms (ORMDL3, SPHK2, B4GALNT1, SLC1A5, GALC, PPARD, PPARG and B4GALT1) involved in sphingolipid metabolism that contribute to the genetic predisposition to type 1 diabetes. These gene polymorphisms correlated with the degree of cellular islet autoimmunity in a cohort of individuals with type 1 diabetes. Finally, using fenofibrate, which activates sulfatide biosynthesis, we completely prevented diabetes in NOD mice and even reversed the disease in half of otherwise diabetic animals. These results indicate that islet sphingolipid metabolism is abnormal in type 1 diabetes and suggest that modulation may represent a novel therapeutic approach. The RNA expression data is

  19. Ophthalmologic abnormalities among deaf students in Kaduna ...

    African Journals Online (AJOL)

    Background: The association between deafness and ocular problems is well established; however the nature and prevalence of these problems are diverse across the globe. Objective: The aim of this study is to determine the nature and prevalence of ophthalmologic abnormalities in deaf students and offer treatment to ...

  20. Developmental abnormalities of mid and hindbrain

    African Journals Online (AJOL)

    1Pediatric Neurology Department, Cairo University, 2Clinical Genetics ... Research Centre,3Human Cytogenetics Department, Human Genetics and. Genome ..... cVH. 2/23 cri du chat. 1/23 del. 18q21.1- qter. 1/23. Breathing abnormalities. 3. 13. 3. -. 1. -. -. -. -. Feeding problems. 8. 34.8. -. 5. 2. -. -. 1. -. Autistic behavior. 3. 13.

  1. Prevelence and Pattern of Electrocardiographic Abnormalities Seen ...

    African Journals Online (AJOL)

    Objective: There is paucity of published data on the prevalence and pattern of electrocardiographic abnormalities (ECGA) seen in adult Nigerians referred for this investigation. This study determined the prevalence and pattern of some ECGA in Nigerian adults. Methods: This is a hospital based audit to determine the ...

  2. immunological arthritis Prevalence of biochemical and abnormalities ...

    African Journals Online (AJOL)

    1991-02-02

    Feb 2, 1991 ... Tile prevalence of biochemical and immunological abnormali- ties was studied in a group of 256 patients with rheumatoid arthritis (104 coloureds, 100 whites and 52 blacks). The most common biochemical abnormalities detected were a reduction in the serum creatinine value (43,4%), raised globulins (39 ...

  3. Prevalence Of Dental Abnormalities Among Handicapped Children ...

    African Journals Online (AJOL)

    Over 34% of them had various dental abnormalities, the most commonly encountered being enamel hypoplasia which constituted 12.3%, and more than half of which was chronologic (58.9%). This was predominant among the mentally handicapped (13.5%) and the blind (12.5%). Tetracyline staining was also a common ...

  4. Dynamic Abnormal Grain Growth in Refractory Metals

    Science.gov (United States)

    Noell, Philip J.; Taleff, Eric M.

    2015-11-01

    High-temperature plastic deformation of the body-centered cubic (BCC) refractory metals Mo and Ta can initiate and propagate abnormal grains at significantly lower temperatures and faster rates than is possible by static annealing alone. This discovery reveals a new and potentially important aspect of abnormal grain growth (AGG) phenomena. The process of AGG during plastic deformation at elevated temperatures, termed dynamic abnormal grain growth (DAGG), was observed at homologous temperatures between 0.52 and 0.72 in both Mo and Ta sheet materials; these temperatures are much lower than those for previous observations of AGG in these materials during static annealing. DAGG was used to repeatedly grow single crystals several centimeters in length. Investigations to date have produced a basic understanding of the conditions that lead to DAGG and how DAGG is affected by microstructure in BCC refractory metals. The current state of understanding for DAGG is reviewed in this paper. Attention is given to the roles of temperature, plastic strain, boundary mobility and preexisting microstructure. DAGG is considered for its potential useful applications in solid-state crystal growth and its possibly detrimental role in creating undesired abnormal grains during thermomechanical processing.

  5. Somatic chromosomal abnormalities in couples undergoing infertility ...

    Indian Academy of Sciences (India)

    1999). Oligozoospermia is .... age of abnormal metaphases needed to distinguish between low level and true mosaicism. This borderline ... Moore A. K., Lynch K., Arny M. J. and Grow D. R. 2008 Turner mosaicism (45,X/46,XX) diagnosed in a ...

  6. Heat stress protection in abnormally hot environments.

    CSIR Research Space (South Africa)

    Schutte, PC

    1994-11-01

    Full Text Available The present report presents the findings of SIMRAC project GAP 045 entitled ‘Heat stress protection in abnormally hot environments’. It is intended as a reference to develop guidelines which, in turn would assist mine management in establishing safe...

  7. The prevalence of electroencephalographic abnormalities and ...

    African Journals Online (AJOL)

    Adele

    2004-05-20

    May 20, 2004 ... South African studies. There is little South African data examining either prevalence or usefulness of EEG abnormalities among adult psychiatric patients. Some work has been done in adolescents. Szabo1 reviewed all admissions to the adolescent inpatient unit at Tara. Hospital between 1990 and 1995.

  8. Lentiginosis, Deafness and Cardiac Abnormalities | Cronje | South ...

    African Journals Online (AJOL)

    Three members of a family with features of the 'leopard' syndrome are described. The important findings were generalized lentigo, deafness, and cardiac and electrocardiographic abnormalities. Progressive obstructive cardiomyopathy and arrhythmias are features of the condition which may be present, and are potentially ...

  9. Craniofacial abnormalities among patients with Edwards Syndrome

    Directory of Open Access Journals (Sweden)

    Rafael Fabiano M. Rosa

    2013-09-01

    Full Text Available OBJECTIVE To determine the frequency and types of craniofacial abnormalities observed in patients with trisomy 18 or Edwards syndrome (ES. METHODS This descriptive and retrospective study of a case series included all patients diagnosed with ES in a Clinical Genetics Service of a reference hospital in Southern Brazil from 1975 to 2008. The results of the karyotypic analysis, along with clinical data, were collected from medical records. RESULTS: The sample consisted of 50 patients, of which 66% were female. The median age at first evaluation was 14 days. Regarding the karyotypes, full trisomy of chromosome 18 was the main alteration (90%. Mosaicism was observed in 10%. The main craniofacial abnormalities were: microretrognathia (76%, abnormalities of the ear helix/dysplastic ears (70%, prominent occiput (52%, posteriorly rotated (46% and low set ears (44%, and short palpebral fissures/blepharophimosis (46%. Other uncommon - but relevant - abnormalities included: microtia (18%, orofacial clefts (12%, preauricular tags (10%, facial palsy (4%, encephalocele (4%, absence of external auditory canal (2% and asymmetric face (2%. One patient had an initial suspicion of oculo-auriculo-vertebral spectrum (OAVS or Goldenhar syndrome. CONCLUSIONS: Despite the literature description of a characteristic clinical presentation for ES, craniofacial alterations may be variable among these patients. The OAVS findings in this sample are noteworthy. The association of ES with OAVS has been reported once in the literature.

  10. Somatic chromosomal abnormalities in couples undergoing infertility ...

    Indian Academy of Sciences (India)

    1996; Johnson 1998). Consid- ering pooled data obtained from more than 9000 azoosper- mic and oligozoospermic men, a 5.8% incidence of chromo- somal abnormalities has been found. Of these, 4.2% affect the gonosomes and 1.5% the autosomes, respectively (John- son 1998). In detail, sex chromosome anomalies ...

  11. Fetal chromosome abnormalities and congenital malformations: an ...

    African Journals Online (AJOL)

    Objective: Our objective were to determine and evaluate the role of genetic counseling and amniocentesis in early detection of chromosomal abnormalities or congenital malformations among women at risk. Patients and Methods: The study was performed on 784 pregnant women. Results: The cause for seeking genetic ...

  12. Structural and molecular hair abnormalities in trichothiodystrophy.

    Science.gov (United States)

    Liang, Christine; Morris, Andrea; Schlücker, Sebastian; Imoto, Kyoko; Price, Vera H; Menefee, Emory; Wincovitch, Stephen M; Levin, Ira W; Tamura, Deborah; Strehle, Katrin R; Kraemer, Kenneth H; DiGiovanna, John J

    2006-10-01

    We examined hair from 15 patients with trichothiodystrophy (TTD), a rare inherited disorder with brittle, cystine-deficient hair. They had a wide variety of phenotypes, from brittle hair only to severe intellectual impairment and developmental delay. Polarizing light microscopic examination showed alternating light and dark (tiger tail) bands under polarizing microscopy. Confocal microscopy captured structural features of breaks in intact TTD hairs. The autofluorescent appearance was regular and smooth in normal donors and markedly irregular in sections of TTD hairs possibly reflecting abnormalities in melanin distribution. Scanning electron microscopy revealed numerous surface irregularities. All TTD hair samples had reduced sulfur content. We observed an inverse correlation (R(val)=0.9) between sulfur content and percent of hairs with shaft abnormalities (trichoschisis, trichorrhexis nodosa, or ribbon/twist). There was no association between clinical disease severity and percent of abnormal hairs. Raman spectra of hairs from TTD patients and normal donors revealed a larger contribution of energetically less favored disulfide conformers in TTD hairs. Our data indicate that the brittleness of the TTD hair is dependent upon abnormalities at several levels of organization. These changes make TTD hairs excessively prone to breakage and weathering.

  13. Correcting abnormal speaking through communication partners ...

    African Journals Online (AJOL)

    The listed characteristics are called speech disorders. Abnormal speaking attracts some penalties to the speaker. The penalties are usually very disturbing to the speaker that undertaking some therapeutic measures becomes inevitable. Communication partners strategy is a speech correction approach which makes use of ...

  14. Teaching Abnormal Psychology in a Multimedia Classroom.

    Science.gov (United States)

    Brewster, JoAnne

    1996-01-01

    Examines the techniques used in teaching an abnormal psychology class in a multimedia environment with two computers and a variety of audiovisual equipment. Students respond anonymously to various questions via keypads mounted on their desks, then immediately view and discuss summaries of their responses. (MJP)

  15. Schizophrenogenic Parenting in Abnormal Psychology Textbooks.

    Science.gov (United States)

    Wahl, Otto F.

    1989-01-01

    Considers the treatment of family causation of schizophrenia in undergraduate abnormal psychology textbooks. Reviews texts published only after 1986. Points out a number of implications for psychologists which arise from the inclusion in these texts of the idea that parents cause schizophrenia, not the least of which is the potential for…

  16. Abnormal interhemispheric connectivity in male psychopathic offenders.

    Science.gov (United States)

    Hoppenbrouwers, Sylco S; De Jesus, Danilo R; Sun, Yinming; Stirpe, Tania; Hofman, Dennis; McMaster, Jeff; Hughes, Ginny; Daskalakis, Zafiris J; Schutter, Dennis J L G

    2014-01-01

    Psychopathic offenders inevitably violate interpersonal norms and frequently resort to aggressive and criminal behaviour. The affective and cognitive deficits underlying these behaviours have been linked to abnormalities in functional interhemispheric connectivity. However, direct neurophysiological evidence for dysfunctional connectivity in psychopathic offenders is lacking. We used transcranial magnetic stimulation combined with electroencephalography to examine interhemispheric connectivity in the dorsolateral and motor cortex in a sample of psychopathic offenders and healthy controls. We also measured intracortical inhibition and facilitation over the left and right motor cortex to investigate the effects of local cortical processes on interhemispheric connectivity. We enrolled 17 psychopathic offenders and 14 controls in our study. Global abnormalities in right to left functional connectivity were observed in psychopathic offenders compared with controls. Furthermore, in contrast to controls, psychopathic offenders showed increased intracortical inhibition in the right, but not the left, hemisphere. The relatively small sample size limited the sensitivity to show that the abnormalities in interhemispheric connectivity were specifically related to the dorsolateral prefrontal cortex in psychopathic offenders. To our knowledge, this study provides the first neurophysiological evidence for abnormal interhemispheric connectivity in psychopathic offenders and may further our understanding of the disruptive antisocial behaviour of these offenders.

  17. Psychology Faculty Perceptions of Abnormal Psychology Textbooks

    Science.gov (United States)

    Rapport, Zachary

    2011-01-01

    The problem. The purpose of the current study was to investigate the perceptions and opinions of psychology professors regarding the accuracy and inclusiveness of abnormal psychology textbooks. It sought answers from psychology professors to the following questions: (1) What are the expectations of the psychology faculty at a private university of…

  18. Plant abnormality monitoring method and device therefor

    International Nuclear Information System (INIS)

    Isobe, Yusuke; Uchida, Shunsuke; Fujimori, Haruo.

    1997-01-01

    The present invention provides a method and a device capable of detecting abnormal symptoms of equipments having failed portions and portions to be repaired and requiring concentrated monitoring in a plant during operation, for example, nuclear power plants, in an early stage without losing reliability. Namely, the abnormality of the plant is judged based on the comparison of plant operation parameters and their allowable values in the method of monitoring plant abnormality. In this case, the allowable values of the plant operation parameters allowed to be changed based on the information on the state of equipments which shows the state of constitutional equipments of the plant. In addition, when a measured plant operation parameter exceeds the allowable value of each of the previously set plant operation parameters, allowable values of other plant operation parameters having relation with the plant operation parameters can be changed. According to the present invention, since the allowable range of the plant operation parameters for the equipments to be repaired and failed equipments can be made narrower than that of ordinary equipments, abnormal symptoms can be detected on the normal side in an early stage. (I.S.)

  19. ORIGINAL ARTICLE EEG changes and neuroimaging abnormalities ...

    African Journals Online (AJOL)

    salah

    Background:Autism is currently viewed as a genetically determined neurode- velopmental disorder although its definite underlying etiology remains to be established. Aim of the Study: Our purpose was to assess autism related morphological neuroimaging changes of the brain and EEG abnormalities in correlation to the.

  20. Craniocervical junction abnormalities with atlantoaxial subluxation ...

    African Journals Online (AJOL)

    Craniocervical junction abnormalities with atlantoaxial subluxation caused by ventral subluxation of C2 were diagnosed in a 6-month-old female Pomeranian with tetraplegia as a clinical sign. Lateral survey radiography of the neck with flexion revealed atlantoaxial subluxation with ventral subluxation of C2. Computed ...

  1. Recurrent chromosome 6 abnormalities in malignant mesothelioma.

    Science.gov (United States)

    Ribotta, M; Roseo, F; Salvio, M; Castagneto, B; Carbone, M; Procopio, A; Giordano, A; Mutti, L

    1998-04-01

    The long latency period between asbestos exposure and the onset of malignant mesothelioma (MM) suggests that a multistep tumorigenesis process occurs whilst the capability of asbestos fibres to interfere directly with chromosomes focuses on the critical role of the chromosomal abnormalities in this neoplasm. The aim of our study was to identify any recurrent chromosomal changes in ten primary MM cell cultures derived from pleural effusions of patients with MM from the same geographic area and environmental and/or occupational exposure to asbestos fibers. Cytogenetic analysis was performed in accordance with International System for Human Cytogenetic Nomenclature. Our results confirmed a great number of cytogenetic abnormalities in MM cells. Recurrent loss of the long arms of chromosome 6 (6q-) was the most frequent abnormality detected (four epithelial and two mixed subtypes) while, on the whole, abnormalities of chromosome 6 were found in nine out of ten cases whereas chromosome 6 was normal only in the case with fibromatous subtype. Monosomy 13 and 17 was found in five cases, monosomy 14 in four cases and 22 in three cases. Since deletion of 6q- was detected even in relatively undisturbed karyotype, we hypothesize a multistep carcinogenic process in which deletion of 6q- is an early event in the development and progression of malignant mesothelioma.

  2. Ophthalmological abnormalities in wild European hedgehogs ...

    African Journals Online (AJOL)

    In this study we aimed to examine wild European hedgehogs (Erinaceus europaeus) in rescue centres and to determine ocular abnormalities in this animal population. Three hundred animals varying in age from 2 months to 5 years were examined, 147 being male and 153 female. All animals were evaluated with direct ...

  3. Gastric emptying abnormal in duodenal ulcer

    International Nuclear Information System (INIS)

    Holt, S.; Heading, R.C.; Taylor, T.V.; Forrest, J.A.; Tothill, P.

    1986-01-01

    To investigate the possibility that an abnormality of gastric emptying exists in duodenal ulcer and to determine if such an abnormality persists after ulcer healing, scintigraphic gastric emptying measurements were undertaken in 16 duodenal ulcer patients before, during, and after therapy with cimetidine; in 12 patients with pernicious anemia, and in 12 control subjects. No difference was detected in the rate or pattern of gastric emptying in duodenal ulcer patients before and after ulcer healing with cimetidine compared with controls, but emptying of the solid component of the test meal was more rapid during treatment with the drug. Comparison of emptying patterns obtained in duodenal ulcer subjects during and after cimetidine treatment with those obtained in pernicious anemia patients and controls revealed a similar relationship that was characterized by a tendency for reduction in the normal differentiation between the emptying of solid and liquid from the stomach. The similarity in emptying patterns in these groups of subjects suggests that gastric emptying of solids may be influenced by changes in the volume of gastric secretion. The failure to detect an abnormality of gastric emptying in duodenal ulcer subjects before and after ulcer healing calls into question the widespread belief that abnormally rapid gastric emptying is a feature with pathogenetic significance in duodenal ulcer disease

  4. Abnormalities of cerebellar foliation and fissuration: classification, neurogenetics and clinicoradiological correlations

    Energy Technology Data Exchange (ETDEWEB)

    Demaerel, P. [University Hospital, Department of Radiology, Herestraat 49, 3000 Leuven (Belgium)

    2002-08-01

    Several genes have been found to influence the different cells involved in the processes of foliation and fissuration in the mouse and rat cerebellum. In the light of these new concepts and on the basis of the imaging findings in 42 patients, a classification is proposed for abnormalities of foliation and fissuration. On the basis of recent genetic and experimental evidence on mechanisms which control the origin of the cerebellum, it is suggested that abnormalities of foliation and fissuration form a single group, with a spectrum of severity. Some patients have only abnormal fissuration of the anterior lobe (type 1a) and others additional dysplasia of the anterior and part of the posterior lobe (type 1b). Extension of abnormalities into the hemispheres is often seen in the latter group. A second group has vermian and hemisphere abnormalities (type 2). In addition to the malformation of the anterior lobe of the vermis, three different hemispheric lesions can be seen in this group: cortical dysgenesis, hypertrophy of the cerebellar cortex, and malorientation of the folia. The mild abnormalities (type 1a) can be considered an incidental observation without clinical relevance. The moderate and severe cerebellar anomalies (type 1b and 2) are always associated with cerebellar symptoms and/or signs. (orig.)

  5. Abnormalities of cerebellar foliation and fissuration: classification, neurogenetics and clinicoradiological correlations

    International Nuclear Information System (INIS)

    Demaerel, P.

    2002-01-01

    Several genes have been found to influence the different cells involved in the processes of foliation and fissuration in the mouse and rat cerebellum. In the light of these new concepts and on the basis of the imaging findings in 42 patients, a classification is proposed for abnormalities of foliation and fissuration. On the basis of recent genetic and experimental evidence on mechanisms which control the origin of the cerebellum, it is suggested that abnormalities of foliation and fissuration form a single group, with a spectrum of severity. Some patients have only abnormal fissuration of the anterior lobe (type 1a) and others additional dysplasia of the anterior and part of the posterior lobe (type 1b). Extension of abnormalities into the hemispheres is often seen in the latter group. A second group has vermian and hemisphere abnormalities (type 2). In addition to the malformation of the anterior lobe of the vermis, three different hemispheric lesions can be seen in this group: cortical dysgenesis, hypertrophy of the cerebellar cortex, and malorientation of the folia. The mild abnormalities (type 1a) can be considered an incidental observation without clinical relevance. The moderate and severe cerebellar anomalies (type 1b and 2) are always associated with cerebellar symptoms and/or signs. (orig.)

  6. Abnormal Selective Attention Normalizes P3 Amplitudes in PDD

    Science.gov (United States)

    Hoeksma, Marco R.; Kemner, Chantal; Kenemans, J. Leon; van Engeland, Herman

    2006-01-01

    This paper studied whether abnormal P3 amplitudes in PDD are a corollary of abnormalities in ERP components related to selective attention in visual and auditory tasks. Furthermore, this study sought to clarify possible age differences in such abnormalities. Children with PDD showed smaller P3 amplitudes than controls, but no abnormalities in…

  7. Corpus callosum abnormalities: neuroradiological and clinical correlations.

    Science.gov (United States)

    Al-Hashim, Aqeela H; Blaser, Susan; Raybaud, Charles; MacGregor, Daune

    2016-05-01

    To study neuroradiological features in pediatric patients with corpus callosum abnormalities, using new functional subtyping for the corpus callosum, and to correlate the features with the clinical presentation. We performed a retrospective review of 125 patients with radiologically identified abnormalities of the corpus callosum seen between 1999 and 2012. The study reviewed clinical features, genetic etiology, and chromosomal microarray (CMA) results. We used a new functional classification for callosal abnormalities based on embryological and anatomical correlations with four classes: complete agenesis, anterior agenesis (rostrum, genu, body), posterior agenesis (isthmus, splenium), and complete hypoplasia (thinning). We also studied the presence of extracallosal abnormalities. The new functional callosal subtyping did not reveal significant differences between the various subtypes in association with neurological outcome; however, the presence of cardiac disease was found more frequently in the group with complete agenesis. Thirty-seven per cent (46/125) had identifiable causes: of these, 48% (22/46) had a monogenic disorder, 30% (14/46) had a pathogenic chromosomal copy-number variant detected by CMA or karyotype, and 22% (10/46) had a recognizable clinical syndrome for which no confirmatory genetic test was available (namely Aicardi syndrome/septo-optic dysplasia and Goldenhar syndrome). The diagnostic yield for a significant CMA change was 19%. The presence of Probst bundles was found to be associated with a better neurodevelopmental outcome. The functional classification system alone 'without clinical data' cannot predict the functional outcome. The presence of extracallosal brain abnormalities and an underlying genetic diagnosis predicted a worse neurodevelopmental outcome. This study highlights the importance of CMA testing and cardiac evaluation as part of a routine screen. © 2015 Mac Keith Press.

  8. Hemostatic Abnormalities in Multiple Myeloma Patients

    Science.gov (United States)

    Gogia, Aarti; Sikka, Meera; Sharma, Satender; Rusia, Usha

    2018-01-27

    Background: Multiple myeloma (MM) is a neoplastic plasma cell disorder characterized by clonal proliferation of plasma cells in the bone marrow. Diverse hemostatic abnormalities have been reported in patients with myeloma which predispose to bleeding and also thrombosis. Methods: Complete blood count, biochemical parameters and parameters of hemostasis i.e. platelet count, prothrombin time (PT), activated partial thromboplastin time (APTT), thrombin time (TT), factor VIII assay results, plasma fibrinogen, D-dimer and lupus anticoagulant, were assessed in 29 MM patients and 30 age matched controls. Results: The most frequent abnormal screening parameter was APTT. Of the six indicative of a bleeding tendency i.e. thrombocytopenia, prolonged PT, APTT, TT, reduced plasma fibrinogen and factor VIII, at least one was abnormal in 8 (27.6%) patients. Of the four prothrombotic markers, lupus anticoagulant, D-dimer, elevated factor VIII and plasma fibrinogen, one or more marker was present in 24 (82.7%). D-dimer was the most common prothrombotic marker, being elevated in 22 (75.9%) patients. One or more laboratory parameter of hemostasis was abnormal in all 29 (100%) patients. Though thrombotic complications are reported to be less frequent as compared to hemorrhagic manifestations, one or more marker of thrombosis was present in 24 (82.7%) patients. Conclusion: This study provided laboratory evidence of hemostatic dysfunction which may be associated with thrombotic or bleeding complications at diagnosis in all MM patients. Hence, screening for these abnormalities at the time of diagnosis should help improved prognosis in such cases. Creative Commons Attribution License

  9. Parenchymal abnormalities associated with developmental venous anomalies

    Energy Technology Data Exchange (ETDEWEB)

    San Millan Ruiz, Diego; Gailloud, Philippe [Johns Hopkins Hospital, Division of Interventional Neuroradiology, Baltimore, MD (United States); Delavelle, Jacqueline [Geneva University Hospital, Neuroradiology Section, Department of Radiology and Medical Informatics, Geneva (Switzerland); Yilmaz, Hasan; Ruefenacht, Daniel A. [Geneva University Hospital, Section of Interventional Neuroradiology, Department of Clinical Neurosciences, Geneva (Switzerland); Piovan, Enrico; Bertramello, Alberto; Pizzini, Francesca [Verona City Hospital, Service of Neuroradiology, Verona (Italy)

    2007-12-15

    To report a retrospective series of 84 cerebral developmental venous anomalies (DVAs), focusing on associated parenchymal abnormalities within the drainage territory of the DVA. DVAs were identified during routine diagnostic radiological work-up based on magnetic resonance imaging (MRI) (60 cases), computed tomography (CT) (62 cases) or both (36 cases). Regional parenchymal modifications within the drainage territory of the DVA, such as cortical or subcortical atrophy, white matter density or signal alterations, dystrophic calcifications, presence of haemorrhage or a cavernous-like vascular malformation (CVM), were noted. A stenosis of the collecting vein of the DVA was also sought for. Brain abnormalities within the drainage territory of a DVA were encountered in 65.4% of the cases. Locoregional brain atrophy occurred in 29.7% of the cases, followed by white matter lesions in 28.3% of MRI investigations and 19.3% of CT investigations, CVMs in 13.3% of MRI investigations and dystrophic calcification in 9.6% of CT investigations. An intracranial haemorrhage possibly related to a DVA occurred in 2.4% cases, and a stenosis on the collecting vein was documented in 13.1% of cases. Parenchymal abnormalities were identified for all DVA sizes. Brain parenchymal abnormalities were associated with DVAs in close to two thirds of the cases evaluated. These abnormalities are thought to occur secondarily, likely during post-natal life, as a result of chronic venous hypertension. Outflow obstruction, progressive thickening of the walls of the DVA and their morphological organization into a venous convergence zone are thought to contribute to the development of venous hypertension in DVA. (orig.)

  10. Arginase Inhibition Ameliorates Hepatic Metabolic Abnormalities in Obese Mice

    Science.gov (United States)

    Moon, Jiyoung; Do, Hyun Ju; Cho, Yoonsu; Shin, Min-Jeong

    2014-01-01

    Objectives We examined whether arginase inhibition influences hepatic metabolic pathways and whole body adiposity in diet-induced obesity. Methods and Results After obesity induction by a high fat diet (HFD), mice were fed either the HFD or the HFD with an arginase inhibitor, Nω-hydroxy-nor-L-arginine (nor-NOHA). Nor-NOHA significantly prevented HFD-induced increases in body, liver, and visceral fat tissue weight, and ameliorated abnormal lipid profiles. Furthermore, nor-NOHA treatment reduced lipid accumulation in oleic acid-induced hepatic steatosis in vitro. Arginase inhibition increased hepatic nitric oxide (NO) in HFD-fed mice and HepG2 cells, and reversed the elevated mRNA expression of hepatic genes in lipid metabolism. Expression of phosphorylated 5′ AMPK-activated protein kinase α was increased by arginase inhibition in the mouse livers and HepG2 cells. Conclusions Arginase inhibition ameliorated obesity-induced hepatic lipid abnormalities and whole body adiposity, possibly as a result of increased hepatic NO production and subsequent activation of metabolic pathways involved in hepatic triglyceride metabolism and mitochondrial function. PMID:25057910

  11. Approach to Investigating Congenital Skeletal Abnormalities in Livestock.

    Science.gov (United States)

    Dittmer, K E; Thompson, K G

    2015-09-01

    Congenital skeletal abnormalities may be genetic, teratogenic, or nutritional in origin; distinguishing among these different causes is essential in the management of the disease but may be challenging. In some cases, teratogenic or nutritional causes of skeletal abnormalities may appear very similar to genetic causes. For example, chondrodysplasia associated with intrauterine zinc or manganese deficiency and mild forms of hereditary chondrodysplasia have very similar clinical features and histologic lesions. Therefore, historical data are essential in any attempt to distinguish genetic and acquired causes of skeletal lesions; as many animals as possible should be examined; and samples should be collected for future analysis, such as genetic testing. Acquired causes of defects often show substantial variation in presentation and may improve with time, while genetic causes frequently have a consistent presentation. If a disease is determined to be of genetic origin, a number of approaches may be used to detect mutations, each with advantages and disadvantages. These approaches include sequencing candidate genes, single-nucleotide polymorphism array with genomewide association studies, and exome or whole genome sequencing. Despite advances in technology and increased cost-effectiveness of these techniques, a good clinical history and description of the pathology and a reliable diagnosis are still key components of any investigation. © The Author(s) 2015.

  12. Targeted next-generation sequencing of 22 mismatch repair genes identifies Lynch syndrome families.

    Science.gov (United States)

    Talseth-Palmer, Bente A; Bauer, Denis C; Sjursen, Wenche; Evans, Tiffany J; McPhillips, Mary; Proietto, Anthony; Otton, Geoffrey; Spigelman, Allan D; Scott, Rodney J

    2016-05-01

    Causative germline mutations in mismatch repair (MMR) genes can only be identified in ~50% of families with a clinical diagnosis of the inherited colorectal cancer (CRC) syndrome hereditary nonpolyposis colorectal cancer (HNPCC)/Lynch syndrome (LS). Identification of these patients are critical as they are at substantially increased risk of developing multiple primary tumors, mainly colorectal and endometrial cancer (EC), occurring at a young age. This demonstrates the need to develop new and/or more thorough mutation detection approaches. Next-generation sequencing (NGS) was used to screen 22 genes involved in the DNA MMR pathway in constitutional DNA from 14 HNPCC and 12 sporadic EC patients, plus 2 positive controls. Several softwares were used for analysis and functional annotation. We identified 5 exonic indel variants, 42 exonic nonsynonymous single-nucleotide variants (SNVs) and 1 intronic variant of significance. Three of these variants were class 5 (pathogenic) or class 4 (likely pathogenic), 5 were class 3 (uncertain clinical relevance) and 40 were classified as variants of unknown clinical significance. In conclusion, we have identified two LS families from the sporadic EC patients, one without a family history of cancer, supporting the notion for universal MMR screening of EC patients. In addition, we have detected three novel class 3 variants in EC cases. We have, in addition discovered a polygenic interaction which is the most likely cause of cancer development in a HNPCC patient that could explain previous inconsistent results reported on an intronic EXO1 variant. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  13. La "infancia anormal" en el Consejo Nacional de Educación (1920-1930: Orígenes y consecuencias prácticas de esta concepción: la internación y la salud pública vs. la escuela y la educación pública "Abnormal infancy" in the National Council of Education (1920-1930: Origins and practical consequences of this conception: hospitalization and public health vs. school and public education

    Directory of Open Access Journals (Sweden)

    Gabriela Rojas Breu

    2005-12-01

    Full Text Available Dada la importancia del concepto de "infancia anormal" en la historia de la psicología en el campo de la educación argentina, este trabajo releva los antecedentes de dicho constructo y su posterior cristalización en el Consejo Nacional de Educación con la creación del Instituto de Psicología Experimental (1929. Mediante el relevamiento de fuentes primarias y el análisis histórico, se delimitan los orígenes tanto locales como internacionales de este concepto, se sitúan sus consecuencias prácticas y se delinean los debates pertinentes al respecto, atendiendo a la contribución de la Psicología en dichas derivaciones. Se detectan en el centro del debate las posturas que designan a la salud pública como tutora de la "infancia anormal" en contraposición con quienes reclaman que es de incumbencia de la instrucción pública. Se recuperan las tesis de Varela y Álvarez Uría, Guillain, Carli y Fornari.Given the importance of the meaning of "abnormal infancy" in the psychology history in the education field in Argentina, this research attempts to recover its precedents its in the National Council of Education materialized in the foundation of the Institute of Experimental Psychology (1929. Local and international origins of this concept, its practical consequences and the characteristics of debates are identified, using the historical analysis and survey of primary sources. Contributions of psychology in these questions are emphasized. Two positions are considered: the first one situates "abnormal infancy" in the public health realm, whereas the second one places this concept in public education. Varela and Álvarez Uría, Guillain, Carli and Fornari thesis are considered.

  14. Aseptic meningitis in a large MMR vaccine campaign (590,609 people) in Curitiba, Paraná, Brazil, 1998 Meningite asséptica na campanha de vacinação pública tríplice viral (590.609 indivíduos) em Curitiba, Paraná, Brasil, 1998

    OpenAIRE

    Walter Oleschko ARRUDA; Charles KONDAGESKI

    2001-01-01

    The aseptic meningitis after Measles-Mumps-Rubella vaccine (MMR) is a well recognized complication, and different incidences have been observed in several studies. We retrospectively analyzed forty cases of aseptic meningitis, during a large public immunization campaign (1998) in Curitiba, Southern Brazil (590,609 people), admitted in our Service. The vaccine utilized was Leningrad-3-Zagreb mumps strain, Edmonston-Zagreb measles strain, and RA 27#3 rubella strain. In all county, a total numbe...

  15. Alcohol Consumption and the Risk of Colorectal Cancer for Mismatch Repair Gene Mutation Carriers.

    Science.gov (United States)

    Dashti, S Ghazaleh; Buchanan, Daniel D; Jayasekara, Harindra; Ait Ouakrim, Driss; Clendenning, Mark; Rosty, Christophe; Winship, Ingrid M; Macrae, Finlay A; Giles, Graham G; Parry, Susan; Casey, Graham; Haile, Robert W; Gallinger, Steven; Le Marchand, Loïc; Thibodeau, Stephen N; Lindor, Noralane M; Newcomb, Polly A; Potter, John D; Baron, John A; Hopper, John L; Jenkins, Mark A; Win, Aung Ko

    2017-03-01

    Background: People with germline mutation in one of the DNA mismatch repair (MMR) genes have increased colorectal cancer risk. For these high-risk people, study findings of the relationship between alcohol consumption and colorectal cancer risk have been inconclusive. Methods: 1,925 MMR gene mutations carriers recruited into the Colon Cancer Family Registry who had completed a questionnaire on lifestyle factors were included. Weighted Cox proportional hazard regression models were used to estimate hazard ratios (HR) and 95% confidence intervals (CI) for the association between alcohol consumption and colorectal cancer. Results: Colorectal cancer was diagnosed in 769 carriers (40%) at a mean (SD) age of 42.6 (10.3) years. Compared with abstention, ethanol consumption from any alcoholic beverage up to 14 g/day and >28 g/day was associated with increased colorectal cancer risk (HR, 1.50; 95% CI, 1.09-2.07 and 1.69; 95% CI, 1.07-2.65, respectively; P trend = 0.05), and colon cancer risk (HR, 1.78; 95% CI, 1.27-2.49 and 1.94; 95% CI, 1.19-3.18, respectively; P trend = 0.02). However, there was no clear evidence for an association with rectal cancer risk. Also, there was no evidence for associations between consumption of individual alcoholic beverage types (beer, wine, spirits) and colorectal, colon, or rectal cancer risk. Conclusions: Our data suggest that alcohol consumption, particularly more than 28 g/day of ethanol (∼2 standard drinks of alcohol in the United States), is associated with increased colorectal cancer risk for MMR gene mutation carriers. Impact: Although these data suggested that alcohol consumption in MMR carriers was associated with increased colorectal cancer risk, there was no evidence of a dose-response, and not all types of alcohol consumption were associated with increased risk. Cancer Epidemiol Biomarkers Prev; 26(3); 366-75. ©2016 AACR . ©2016 American Association for Cancer Research.

  16. Occurrence of cancer in a cohort of 183 persons with constitutional chromosome 7 abnormalities

    DEFF Research Database (Denmark)

    Hasle, H; Olsen, J H; Hansen, J

    1998-01-01

    with constitutional abnormalities involving chromosome 7, including 16 patients with Williams syndrome. By linkage to the Danish Cancer Registry, we found five persons with cancer, including one thyroid carcinoma, three carcinomas of the digestive tract, and one malignant melanoma. There were no cases of leukemia......Cytogenetic abnormalities in human malignancies frequently involve chromosome 7. The existence of several tumor suppressor genes on the long arm of chromosome 7 has been suggested in both epithelial and hematologic malignancies. From the Danish Cytogenetic Register, we identified 183 persons...

  17. Hidden chromosomal abnormalities in pleuropulmonary blastomas identified by multiplex FISH

    International Nuclear Information System (INIS)

    Quilichini, Benoit; Andre, Nicolas; Bouvier, Corinne; Chrestian, Marie-Anne; Rome, Angelique; Intagliata, Dominique; Coze, Carole; Lena, Gabriel; Zattara, Helene

    2006-01-01

    Pleuropulmonary blastoma (PPB) is a rare childhood dysontogenetic intrathoracic neoplasm associated with an unfavourable clinical behaviour. We report pathological and cytogenetic findings in two cases of PPB at initial diagnosis and recurrence. Both tumors were classified as type III pneumoblastoma and histological findings were similar at diagnosis and relapse. In both cases, conventional cytogenetic techniques revealed complex numerical and structural chromosomal abnormalities. Molecular cytogenetic analysis (interphase/metaphase FISH and multicolor FISH) identified accurately chromosomal aberrations. In one case, TP53 gene deletion was detected on metaphase FISH. To date, only few cytogenetic data have been published about PPB. The PPB genetic profile remains to be established and compared to others embryonal neoplasia. Our cytogenetic data are discussed reviewing cytogenetics PPBs published cases, illustrating the contribution of multicolor FISH in order to identify pathogenetically important recurrent aberrations in PPB

  18. Chromosome abnormalities and the genetics of congenital corneal opacification

    Science.gov (United States)

    Mataftsi, A.; Islam, L.; Kelberman, D.; Sowden, J.C.

    2011-01-01

    Congenital corneal opacification (CCO) encompasses a broad spectrum of disorders that have different etiologies, including genetic and environmental. Terminology used in clinical phenotyping is commonly not specific enough to describe separate entities, for example both the terms Peters anomaly and sclerocornea have been ascribed to a clinical picture of total CCO, without investigating the presence or absence of iridocorneal adhesions. This is not only confusing but also unhelpful in determining valid genotype-phenotype correlations, and thereby revealing clues for pathogenesis. We undertook a systematic review of the literature focusing on CCO as part of anterior segment developmental anomalies (ASDA), and analyzed its association specifically with chromosomal abnormalities. Genes previously identified as being associated with CCO are also summarized. All reports were critically appraised to classify phenotypes according to described features, rather than the given diagnosis. Some interesting associations were found, and are discussed. PMID:21738392

  19. Cerebral volumetric abnormalities in Neurofibromatosis type 1: associations with parent ratings of social and attention problems, executive dysfunction, and autistic mannerisms

    NARCIS (Netherlands)

    Huijbregts, S.C.; Loitfelder, M.; Rombouts, S.A.R.B.; Swaab, H.; Verbist, B.M.; Arkink, E.B.; Buchem, M.A. van; Veer, I.M.

    2015-01-01

    Neurofibromatosis type 1 (NF1) is a single-gene neurodevelopmental disorder, in which social and cognitive problems are highly prevalent. Several commonly observed central nervous system (CNS) abnormalities in NF1 might underlie these social and cognitive problems. Cerebral volumetric abnormalities

  20. Towards gene-and gender-based risk estimates in Lynch syndrome; Age-specific incidences for 13 extra-colorectal cancer types

    DEFF Research Database (Denmark)

    Therkildsen, Christina; Ladelund, Steen; Smith-Hansen, Lars

    2017-01-01

    Background:In Lynch syndrome, inherited mismatch repair (MMR) defects predispose to colorectal cancer and to a wide spectrum of extra-colorectal tumours. Utilising a cohort study design, we aimed to determine the risk of extra-colorectal cancer and to identify yet unrecognised tumour types...... were identified for 13 cancer types with differences related to gender, age and disease-predisposing gene. The different cancer types showed variable peak age incidence rates (IRs) with the highest IRs for ovarian cancer at age 30-49 years, for endometrial cancer, breast cancer, renal cell cancer...... incidences in relation to age, gender and gene suggest a need for individualised surveillance....

  1. Migraine and structural abnormalities in the brain

    DEFF Research Database (Denmark)

    Hougaard, Anders; Amin, Faisal Mohammad; Ashina, Messoud

    2014-01-01

    PURPOSE OF REVIEW: The aim is to provide an overview of recent studies of structural brain abnormalities in migraine and to discuss the potential clinical significance of their findings. RECENT FINDINGS: Brain structure continues to be a topic of extensive research in migraine. Despite advances...... in neuroimaging techniques, it is not yet clear if migraine is associated with grey matter changes. Recent large population-based studies sustain the notion of increased prevalence of white matter abnormalities in migraine, and possibly of silent infarct-like lesions. The clinical relevance of this association...... is not clear. Structural changes are not related to cognitive decline, but a link to an increased risk of stroke, especially in patients with aura, cannot be ruled out. SUMMARY: Migraine may be a risk factor for structural changes in the brain. It is not yet clear how factors such as migraine sub-type, attack...

  2. [Otoneurologic abnormalities in insulin-dependent diabetes].

    Science.gov (United States)

    Jáuregui-Renaud, K; Domínguez-Rubio, B; Ibarra-Olmos, A; González-Bárcena, D

    1998-01-01

    To assess the auditory and vestibular function in patients with diabetes. We studied and followed for three years, 10 patients (6 females) of 20.6 years of age (SD 5.5 years), with insulindependent diabetes mellitus of 9.5 years (SD 3.7 years). The patients were selected for having peripheral neuropathy without prolipherative retinopathy and otologic disease or individual factors which could cause neurootologic symptoms. Their glomerular filtration rate and renal plasma flow were 150 mL/min (SD 50) and 543 mL/min (SD 113). Initially all patients had normal audiologic responses, including auditory brainstem responses, but had abnormally and simetrically diminished horizontal vestibulo-ocular responses. A year later one patient had vertigo and asymmetric vestibulo-ocular responses. In the third year, another patient showed similar abnormalities and a third one showed sensorineural hearing loss. Our results suggest that patients with insulindependent diabetes mellitus may suffer neuro-otological deterioration.

  3. Chromosomal abnormalities in a psychiatric population

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, K.E.; Lubetsky, M.J.; Wenger, S.L.; Steele, M.W. [Univ. of Pittsburgh Medical Center, PA (United States)

    1995-02-27

    Over a 3.5 year period of time, 345 patients hospitalized for psychiatric problems were evaluated cytogenetically. The patient population included 76% males and 94% children with a mean age of 12 years. The criteria for testing was an undiagnosed etiology for mental retardation and/or autism. Cytogenetic studies identified 11, or 3%, with abnormal karyotypes, including 4 fragile X positive individuals (2 males, 2 females), and 8 with chromosomal aneuploidy, rearrangements, or deletions. While individuals with chromosomal abnormalities do not demonstrate specific behavioral, psychiatric, or developmental problems relative to other psychiatric patients, our results demonstrate the need for an increased awareness to order chromosomal analysis and fragile X testing in those individuals who have combinations of behavioral/psychiatric, learning, communication, or cognitive disturbance. 5 refs., 1 fig., 2 tabs.

  4. Cardiovascular Abnormalities in Cirrhosis: the Possible Mechanisms

    Directory of Open Access Journals (Sweden)

    Leila Moezi

    2007-12-01

    Full Text Available Cirrhosis is characterized by marked abnormalities in the cardiovascular system. A hyperdynamic splanchnic and systemic circulation is typical of cirrhotic patients and has been observed in all experimental forms of portal hypertension. The hyperdynamic circulation is most likely initiated by arterial vasodilatation, leading to central hypovolemia, sodium retention, and an increased intravascular volume. Despite the baseline increase in cardiac output, ventricular inotropic and chronotropic responses to stimuli are blunted, a condition known as cirrhotic cardiomyopathy. This review briefly examines the major mechanisms that may underlie these cardiovascular abnormalities, concentrating on nitric oxide, endocannabinoids, prostaglandins, carbon monoxide, endogenous opioids, and adrenergic receptor changes. Future work should address the complex interrelationships between these systems.

  5. Selective mutism and abnormal electroencephalography (EEG) tracings.

    Science.gov (United States)

    Politi, Keren; Kivity, Sara; Goldberg-Stern, Hadassa; Halevi, Ayelet; Shuper, Avinoam

    2011-11-01

    Epileptic discharges are not considered a part of the clinical picture of selective mutism, and electroencephalography is generally not recommended in its work-up. This report describes 6 children with selective mutism who were found to have a history of epilepsy and abnormal interictal or subclinical electroencephalography recordings. Two of them had benign epilepsy of childhood with centro-temporal spikes. The mutism was not related in time to the presence of active seizures. While seizures could be controlled in all children by medications, the mutism resolved only in 1. Although the discharges could be coincidental, they might represent a co-morbidity of selective mutism or even play a role in its pathogenesis. Selective mutism should be listed among the psychiatric disorders that may be associated with electroencephalographic abnormalities. It can probably be regarded as a symptom of a more complicated organic brain disorder.

  6. Are the common genetic variants associated with colorectal cancer risk for DNA mismatch repair gene mutation carriers?

    Science.gov (United States)

    Win, Aung Ko; Hopper, John L.; Buchanan, Daniel D.; Young, Joanne P.; Tenesa, Albert; Dowty, James G.; Giles, Graham G.; Goldblatt, Jack; Winship, Ingrid; Boussioutas, Alex; Young, Graeme P.; Parry, Susan; Baron, John A.; Duggan, David; Gallinger, Steven; Newcomb, Polly A.; Haile, Robert W.; Le Marchand, Loïc; Lindor, Noralane M.; Jenkins, Mark A.

    2013-01-01

    Background Genome-wide association studies have identified at least 15 independent common genetic variants associated with colorectal cancer (CRC) risk. The aim of this study was to investigate whether 11 of these variants are associated with CRC risk for carriers of germline mutations in DNA mismatch repair (MMR) genes. Methods A total of 927 MMR gene mutation carriers (360 MLH1, 442 MSH2, 85 MSH6 and 40 PMS2) from 315 families enrolled in the Colon Cancer Family Registry, were genotyped for the SNPs: rs16892766 (8q23.3), rs6983267 (8q24.21), rs719725 (9p24), rs10795668 (10p14), rs3802842 (11q23.1), rs4444235 (14q22.2), rs4779584 (15q13.3), rs9929218 (16q22.1), rs4939827 (18q21.1), rs10411210 (19q13.1) and rs961253 (20p12.3). We used a weighted Cox regression to estimate CRC risk for homozygous and heterozygous carriers of the risk allele compared with homozygous non-carriers as well as for an additive per allele model (on the log scale). Results Over a total of 40,978 person-years observation, 426 (46%) carriers were diagnosed with CRC at a mean age of 44.3 years. For all carriers combined, we found no evidence of an association between CRC risk and the total number of risk alleles (hazard ratio [HR] per risk allele=0.97, 95% confidence interval [CI]=0.88–1.07, p=0.52). Conclusions We found no evidence that the SNPs associated with CRC in the general population are modifiers of the risk for MMR gene mutation carriers overall, and therefore any evidence of proven clinical utility in Lynch syndrome. PMID:23434150

  7. Dysglycemia induces abnormal circadian blood pressure variability

    Directory of Open Access Journals (Sweden)

    Kumarasamy Sivarajan

    2011-11-01

    Full Text Available Abstract Background Prediabetes (PreDM in asymptomatic adults is associated with abnormal circadian blood pressure variability (abnormal CBPV. Hypothesis Systemic inflammation and glycemia influence circadian blood pressure variability. Methods Dahl salt-sensitive (S rats (n = 19 after weaning were fed either an American (AD or a standard (SD diet. The AD (high-glycemic-index, high-fat simulated customary human diet, provided daily overabundant calories which over time lead to body weight gain. The SD (low-glycemic-index, low-fat mirrored desirable balanced human diet for maintaining body weight. Body weight and serum concentrations for fasting glucose (FG, adipokines (leptin and adiponectin, and proinflammatory cytokines [monocyte chemoattractant protein-1 (MCP-1 and tumor necrosis factor-α (TNF-α] were measured. Rats were surgically implanted with C40 transmitters and blood pressure (BP-both systolic; SBP and diastolic; DBP and heart rate (HR were recorded by telemetry every 5 minutes during both sleep (day and active (night periods. Pulse pressure (PP was calculated (PP = SBP-DBP. Results [mean(SEM]: The AD fed group displayed significant increase in body weight (after 90 days; p Conclusion These data validate our stated hypothesis that systemic inflammation and glycemia influence circadian blood pressure variability. This study, for the first time, demonstrates a cause and effect relationship between caloric excess, enhanced systemic inflammation, dysglycemia, loss of blood pressure control and abnormal CBPV. Our results provide the fundamental basis for examining the relationship between dysglycemia and perturbation of the underlying mechanisms (adipose tissue dysfunction induced local and systemic inflammation, insulin resistance and alteration of adipose tissue precursors for the renin-aldosterone-angiotensin system which generate abnormal CBPV.

  8. Computed tomography in abnormalities of the hip

    Energy Technology Data Exchange (ETDEWEB)

    Visser, J.D.; Jonkers, A.; Klasen, H.J. (Rijksuniversiteit Groningen (Netherlands). Academisch Ziekenhuis); Hillen, B. (Rijksuniversiteit Groningen (Netherlands). Lab. voor Anatomie en Embryologie)

    1982-06-26

    The value of computed tomography in the assessment of abnormalities of the hip is demonstrated with the aid of an anatomical preparation and in patients with, respectively, congenital dislocation of a hip, dislocation of the hip in spina bifida, an acetabular fracture and a Ewing tumour. The anteversion of the acetabulum and femur and the instability index of the hip joint can be measured by means of computed tomography.

  9. Renal abnormalities in congenital chloride diarrhea

    International Nuclear Information System (INIS)

    Al-Hamad, Nadia M.; Al-Eisa, Amal A.

    2004-01-01

    Congenital chloride diarrhea CLD is a rare autosomal recessive disorder caused by a defect in the chloride/ bicarbonate exchange in the ileum and colon. It is characterized by watery diarrhea, abdominal distension, hypochloremic hypokalemic metabolic alkalosis with high fecal content of chloride >90 mmol/l. We report 3 patients with CLD associated with various renal abnormalities including chronic renal failure secondary to renal hypoplasia, nephrocalcinosis and congenital nephrotic syndrome. (author)

  10. [Nutritional abnormalities in chronic obstructive pulmonary disease].

    Science.gov (United States)

    Gea, Joaquim; Martínez-Llorens, Juana; Barreiro, Esther

    2014-07-22

    Nutritional abnormalities are associated with chronic obstructive pulmonary disease with a frequency ranging from 2 to 50%, depending on the geographical area and the study design. Diagnostic tools include anthropometry, bioelectrical impedance, dual energy radioabsortiometry and deuterium dilution, being the body mass and the lean mass indices the most frequently used parameters. While the most important consequences of nutritional abnormalities are muscle dysfunction and exercise limitation, factors implicated include an imbalance between caloric intake and consumption, and between anabolic and catabolic hormones, inflammation, tobacco smoking, poor physical activity, hypoxemia, some drugs and aging/comorbidities. The most important molecular mechanism for malnutrition associated with chronic obstructive pulmonary disease appears to be the mismatching between protein synthesis and breakdown. Among the therapeutic measures proposed for these nutritional abnormalities are improvements in lifestyle and nutritional support, although the use of anabolic drugs (such as secretagogues of the growth hormone) offers a new therapeutic strategy. Copyright © 2013 Elsevier España, S.L. All rights reserved.

  11. Content difference between normal and abnormal obsessions.

    Science.gov (United States)

    Rassin, Eric; Cougle, Jesse R; Muris, Peter

    2007-11-01

    Although it has long been thought that experiencing an obsession is a psychiatric symptom, more recent literature, has seen the normalisation of obsessions and other presumably clinical phenomena. That is, not only people suffering from psychiatric disorders experience obsessions but non-clinical individuals also do so. Furthermore, it has been argued that such normal obsessions are very similar to abnormal ones, in terms of content. However, in the present study, evidence was obtained indicating that normal and abnormal obsessions do differ in content. A sample of 133 healthy undergraduates was given a list of 70 obsessions, with some originating from obsessive-compulsive disorder (OCD) patients, and others stemming from healthy volunteers. Participants were asked to indicate whether they had ever experienced these obsessions. Participants endorsed significantly more normal than abnormal obsessions, suggesting that the two kinds of obsessions do differ from each other. In addition, the experience of clinical obsessions was more strongly associated with scores on a measure of OCD symptoms, than was the experience of normal obsessions.

  12. Abnormal Activity Detection Using Pyroelectric Infrared Sensors

    Directory of Open Access Journals (Sweden)

    Xiaomu Luo

    2016-06-01

    Full Text Available Healthy aging is one of the most important social issues. In this paper, we propose a method for abnormal activity detection without any manual labeling of the training samples. By leveraging the Field of View (FOV modulation, the spatio-temporal characteristic of human activity is encoded into low-dimension data stream generated by the ceiling-mounted Pyroelectric Infrared (PIR sensors. The similarity between normal training samples are measured based on Kullback-Leibler (KL divergence of each pair of them. The natural clustering of normal activities is discovered through a self-tuning spectral clustering algorithm with unsupervised model selection on the eigenvectors of a modified similarity matrix. Hidden Markov Models (HMMs are employed to model each cluster of normal activities and form feature vectors. One-Class Support Vector Machines (OSVMs are used to profile the normal activities and detect abnormal activities. To validate the efficacy of our method, we conducted experiments in real indoor environments. The encouraging results show that our method is able to detect abnormal activities given only the normal training samples, which aims to avoid the laborious and inconsistent data labeling process.

  13. Spermatogenesis Abnormalities following Hormonal Therapy in Transwomen

    Directory of Open Access Journals (Sweden)

    Sirachai Jindarak

    2018-01-01

    Full Text Available Objective. To measure spermatogenesis abnormalities in transwomen at the time of sex reassignment surgery (SRS and to analyze the association between hormonal therapy duration and infertility severity. Design. Retrospective study. Setting. University hospital. Patients. One-hundred seventy-three transwomen who underwent SRS from January 2000 to December 2015. Interventions. All orchidectomy specimens were retrospectively reviewed and classified. History of hormonal therapy duration was retrieved from medical records. Main Outcome Measures. Histological examinations of orchidectomy specimens were performed to assess spermatogenesis. Results. One-hundred seventy-three orchidectomy specimens were evaluated. Histological examinations showed maturation arrest in 36.4%, hypospermatogenesis in 26%, Sertoli cell-only syndrome in 20.2%, normal spermatogenesis in 11%, and seminiferous tubule hyalinization in 6.4% of the specimens. Spermatogenesis abnormality severity was not associated with the total therapy duration (P=0.81 or patient age at the time of surgery (P=0.88. Testicular volumes and sizes were associated with spermatogenesis abnormality severity (P=0.001 and P=0.026, right testicle and left testicle, resp.. Conclusion(s. Feminizing hormonal treatment leads to reductions in testicular germ cell levels. All transwomen should be warned about this consequence, and gamete preservation should be offered before starting hormonal treatment.

  14. Association of common variants in mismatch repair genes and breast cancer susceptibility: a multigene study

    Directory of Open Access Journals (Sweden)

    Pina Julieta

    2009-09-01

    Full Text Available Abstract Background MMR is responsible for the repair of base-base mismatches and insertion/deletion loops. Besides this, MMR is also associated with an anti-recombination function, suppressing homologous recombination. Losses of heterozygosity and/or microsatellite instability have been detected in a large number of skin samples from breast cancer patients, suggesting a potential role of MMR in breast cancer susceptibility. Methods We carried out a hospital-based case-control study in a Caucasian Portuguese population (287 cases and 547 controls to estimate the susceptibility to non-familial breast cancer associated with some polymorphisms in mismatch repair genes (MSH3, MSH4, MSH6, MLH1, MLH3, PMS1 and MUTYH. Results Using unconditional logistic regression we found that MLH3 (L844P, G>A polymorphism GA (Leu/Pro and AA (Pro/Pro genotypes were associated with a decreased risk: OR = 0.65 (0.45-0.95 (p = 0.03 and OR = 0.62 (0.41-0.94 (p = 0.03, respectively. Analysis of two-way SNP interaction effects on breast cancer revealed two potential associations to breast cancer susceptibility: MSH3 Ala1045Thr/MSH6 Gly39Glu - AA/TC [OR = 0.43 (0.21-0.83, p = 0.01] associated with a decreased risk; and MSH4 Ala97Thr/MLH3 Leu844Pro - AG/AA [OR = 2.35 (1.23-4.49, p = 0.01], GG/AA [OR = 2.11 (1.12-3,98, p = 0.02], and GG/AG [adjusted OR = 1.88 (1.12-3.15, p = 0.02] all associated with an increased risk for breast cancer. Conclusion It is possible that some of these common variants in MMR genes contribute significantly to breast cancer susceptibility. However, further studies with a large sample size will be needed to support our results.

  15. Congenital abnormalities associated with hemivertebrae in relation to hemivertebrae location.

    Science.gov (United States)

    Bollini, Gerard; Launay, Franck; Docquier, Pierre-Louis; Viehweger, Elke; Jouve, Jean-Luc

    2010-01-01

    Numerous congenital abnormalities have been reported in association with hemivertebrae (HV). No data exist about their incidence depending on the location of the HV. From 1980 to 2003, 75 patients with 80 HV responsible for evolutive congenital scoliosis were managed by HV resection using a double approach and short anterior and posterior convex fusion. The associated abnormalities were evaluated with MRI, echocardiography and renal ultrasound. Associated genitourinary abnormalities were found in 24% of patients, cardiac abnormalities in 8% and intrathecal abnormalities in 15%. Medullar abnormalities were more frequent in case of vertebral malformations at lumbosacral level.

  16. [Correlation between C-MYC protein expression and genetic abnormalities in diffuse large B-cell lymphoma].

    Science.gov (United States)

    Yu, H; Wang, H; Zhang, N; Gao, S M; Zhang, Y X

    2018-03-08

    Objective: To study the correlation between expression of oncogene C-MYC protein and gene abnormality in diffuse large B-cell lymphoma (DLBCL). Methods: The expression of C-MYC protein and gene abnormality were detected by immunohistochemistry and fluorescence in situ hybridization (FISH), respectively, in 42 cases of paraffin-embedded DLBCL. All cases were collected at Department of Pathology, Weifang People's Hospital during January 2015 to October 2016. Results: The positive rate of C-MYC protein expression was 47.6% (20/42) and the rate of abnormal C-MYC gene by FISH was 26.2%(11/42), including translocation (23.8%, 10/42) and gene amplification (2.4%, 1/42). There was a close relationship between the protein expression and gene translocation (χ(2)=11.813; P =0.001) and gene translocation occurred primarily in GCB (χ(2)=4.029; P =0.045). Conclusion: The high expression (≥40%) of C-MYC protein is associated with its gene translocation, suggesting that C-MYC protein detection can be used as a surrogate marker for C-MYC gene translocation in DLBCL.

  17. Abnormal motor cortex plasticity in premanifest and very early manifest Huntington's disease

    Science.gov (United States)

    Orth, M; Schippling, S; Schneider, SA; Bhatia, KP; Talelli, P; Tabrizi, SJ; Rothwell, JC

    2010-01-01

    Background Cognition is affected early in Huntington's disease, and in HD animal models there is evidence that this reflects abnormal synaptic plasticity. We investigated whether there is evidence for abnormal synaptic plasticity using the human motor cortex-rTMS model, and if so, if there is any difference between premanifest HD gene carriers and very early manifest HD patients or any relationship with ratings of the severity of motor signs. Methods Fifteen HD gene carriers (7 premanifest, 8 very early manifest) and 14 control participants were given a continuous train of 100 bursts of theta burst stimulation (cTBS: three pulses at 50 Hz and 80% AMT repeated every 200ms). The size of the motor evoked potential was measured at regular intervals until 21 minutes after cTBS. Results HD gene carriers and controls responded differently to theta burst stimulation (F4.9,131.9=1.37, p=0.048) with controls having more inhibition than HD gene carriers (F1,27=13.3, p=0.001). Across all time points mean inhibition differed between the groups (F2,26=6.32, p=0.006); controls had more inhibition than either HD gene carrier subgroup (p=0.006 for premanifest and p=0.009 for early symptomatic) whereas there was no difference between premanifest and early symptomatic HD gene carriers. The measure of cortical plasticity was not associated with any clinical ratings (UHDRS motor score, estimate of age at onset). Conclusions Motor cortex plasticity is abnormal in HD gene carriers but is not closely linked to the development of motor signs of HD. PMID:19828482

  18. Abnormal uterine artery Doppler velocimetry predicts adverse outcomes in patients with abnormal analytes.

    Science.gov (United States)

    Roeder, Hilary A; Dejbakhsh, Sheila Z; Parast, Mana M; Laurent, Louise C; Woelkers, Douglas A

    2014-10-01

    Our aim was to determine if uterine artery (UtA) Doppler studies would risk-stratify women with abnormal serum analytes on prenatal genetic screening into those at baseline and increased risk for preeclampsia and small-for-gestational age (SGA). This retrospective cohort study examined outcomes of patients with ⩾one abnormal analyte (PAPP-A3.0, AFP>2.5, inhibin>2.0, or unconjugated estriolUtA pulsatility index (PI). Preeclampsia, preterm preeclampsia, SGA (birthweight (BW) one abnormal analyte, UtA Doppler screening, and delivery outcomes. Twenty-four (18%) had an elevated UtA PI (PI>1.6); preeclampsia occurred in 16 (12%) and 26 (20%) delivered a SGA neonate. Abnormal UtA Doppler PI increased the likelihood of a composite outcome of preeclampsia or SGA from 27% to 71% (LR 6.48 (2.93, 14.30)); a negative UtA Doppler PI reduced the likelihood to 18% (LR 0.57 (0.42, 0.78)). Abnormal UtA Doppler PI increased the likelihood of a more severe composite outcome of preterm preeclampsia or IUGR from 11% to 39% (LR 5.49 (3.03, 9.97)); a negative UtA Doppler study reduced the likelihood to 4% (LR 0.35 (0.16, 0.80)). In patients with abnormal serum analytes, abnormal UtA Doppler PI is significantly associated with preeclampsia or SGA and improves the prediction of these adverse outcomes by 9-15-fold. Providers can incorporate UtA Doppler PI into an abbreviated surveillance regimen; they can be reassured that a normal study markedly decreases the risk of a severe early adverse outcome. Copyright © 2014 International Society for the Study of Hypertension in Pregnancy. Published by Elsevier B.V. All rights reserved.

  19. Abnormality of Auricular Muscles in Congenital Auricular Deformities.

    Science.gov (United States)

    Yotsuyanagi, Takatoshi; Yamauchi, Makoto; Yamashita, Ken; Sugai, Asuka; Gonda, Ayako; Kitada, Ayaka; Saito, Tamotsu; Urushidate, Satoshi

    2015-07-01

    It has been suggested that there is a close association of abnormality in auricular muscles with various congenital auricular deformities. However, there has been no investigation to determine what muscles are involved and how they affect the deformity. The authors examined abnormalities of auricular muscles for patients with various auricular deformities. The authors examined 77 auricles of 62 patients with congenital auricular deformities, including cryptotia, Stahl's ear, prominent ear, lop ear, and others. The superior and posterior auricular muscles from the extrinsic auricular muscle group and the auricular oblique and transverse muscles from the auricular intrinsic muscle group were investigated. The authors found characteristic features of the abnormality of the muscle for each auricular deformity. In nearly all cases of cryptotia, abnormality was found in the superior auricular, auricular oblique, and auricular transverse muscles. Abnormal insertion was found mainly in the superior auricular muscle and was the main cause of cryptotia. In Stahl's ear, the major abnormality was abnormal insertion of the auricular transverse muscle, which creates an abnormal cartilaginous prominence in the scapha. The abnormality in cases of prominent ear was clearly limited mostly to the auricular transverse muscle and, in some cases, to the posterior auricular muscle. In lop ear, abnormality was mostly found in the auricular transverse muscle, with elongation, and in the superior auricular or auricular oblique muscle in some cases. There is a tendency for a specific muscle abnormality to be found in each deformity. It is important to identify the abnormal muscle and correct the abnormality during the operation.

  20. MRI study on urinary abnormalities of fetus

    International Nuclear Information System (INIS)

    Liu Ming; Zhang Yuzhen; Wang Qiuyan; Zhang Zhongyang; Li Yuhua

    2007-01-01

    Objective: To illustrate the important complemental function of MRI in dignosing the urinary abnormalities of the fetus by analyzing MR features. Methods: MRI findings in 34 fetal urinary abnormalities were retrospectively analyzed. Results: Upper urinary tract dilatation was found in 12 cases: one case presented obstructed right renal dysplasia and was on the follow-up, postnatal MR imaging proved the duplex anomaly in one case, one case showed left PUJO on postnatal US imaging and prepared to surgery, 7 cases were normal on postnatal US imaging, 2 cases were lost to follow up. Bilateral urinary anomalies were found in 7 cases: Muhicystic renal dysplasia (n=3), Combined horseshoe kidney in 2 fetuses and bilateral renal aplasia in one case. Bilateral renal dysplasia was diagnosed in 2 cases, one was still bom and proved by autopsy and the other was lost to follow up. The case of bilateral renal agenesis displayed the appearance of sirenomelia on general specimen. The case of right renal agenesis associated contralateral kidney dyspalsia (n=1) was lost to follow up. MR imaging showed low signal intensity of lung and oligohydramnios in the bilateral anomalies. Unilateral urinary anomalies was found in 15 cases, including 9 cases of unilateral renal dysplasia. Two fetuses were aborted and 3 fetuses were proved with postnatal US or MR. One was lost to follow up; 3 cases were on the follow-up. There were 4 cases of unilateral renal agenesis, two fetuses were aborted and 2 fetuses were proved with postnatal US or MR imaging. The case of ectopic kidney was proved with postnatal US imaging. One case of urachal cyst was aborted without autopsy. In the unilateral anomalies, the volume of amniotic fluid was normal, and the fetal lung presented homogenious high signal intensity. Conclusion: As a complemental method, MRI is of great value in displaying and dignosing the urinary abnormalities of fetus. (authors)

  1. Remnants of occipital vertebrae: proatlas segmentation abnormalities.

    Science.gov (United States)

    Menezes, Arnold H; Fenoy, Kathleen A

    2009-05-01

    Developmental remnants around the foramen magnum, or proatlas segmentation abnormalities, have been recorded in postmortem studies but very rarely in a clinical setting. Because of their rarity, the pathological anatomy has been misunderstood, and treatment has been fraught with failures. The objectives of this prospective study were to understand the correlative anatomy, pathology, and embryology and to recognize the clinical presentation and gain insights on the treatment and management. Our craniovertebral junction (CVJ) database started in 1977 and comprises 5200 cases. This prospective study has retrieval capabilities. Neurodiagnostic studies changed with the evolution of imaging. Seventy-two patients were recognized as having symptomatic proatlas segmentation abnormalities. Ventral bony masses from the clivus or medial occipital condyle occurred in 66% (44/72), lateral or anterolateral compressive masses in 37% (27 of 72 patients), and dorsal bony compression in 17% (12 of 72 patients). Hindbrain herniation was associated in 33%. The age at presentation was 3 to 23 years. Motor symptoms occurred in 72% (52 of 72 patients); palsies in Cranial Nerves IX, X, and XII in 33% (24 of 72 patients); and vertebrobasilar symptoms in 25% (18 of 72 patients). Trauma precipitated symptoms in 55% (40 of 72 patients). The best definition of the abnormality was demonstrated by 3-dimensional computed tomography combined with magnetic resonance imaging. Treatment was aimed at decompression of the pathology and stabilization. Remnants of the occipital vertebrae around the foramen magnum were recognized in 72 of 5200 CVJ cases (7.2%). Magnetic resonance imaging with 3-dimensional computed tomography of the CVJ provides the best definition and understanding of the lesions. Brainstem myelopathy and lower cranial nerve deficits are common clinical presentations in the first and second decades of life. Treatment is aimed at decompression of the pathology and CVJ stabilization.

  2. Haematological abnormalities in systemic lupus erythematosus.

    Science.gov (United States)

    Aleem, Aamer; Al Arfaj, Abdurahman Saud; khalil, Najma; Alarfaj, Husain

    2014-01-01

    This study was conducted to evaluate the frequency and pattern of haematological abnormalities (HA) in SLE patients at the time of diagnosis and last follow-up, and their relationship with organ involvement. This retrospective study included patients who were diagnosed and treated for SLE from 1982 to 2008 at King Khalid University hospital, Riyadh. Demographic and haematological parameters at diagnosis and the last follow-up, disease manifestations, organ involvement and clinical hematological complications were recorded. Association of HA with organ involvement was explored by multivariate analysis. A total of 624 patients (90.7% females, mean age 34.3±11.9 years) were studied. HA were present in 516 (82.7 %) patients at the time of diagnosis. Anemia was the most frequent HA in 63.0% patients followed by lymphopenia in 40.3%, leukopenia in 30.0%, thrombocytopenia in 10.9% and autoimmune hemolytic anemia (AIHA) in 4.6% patients. Deep vein thrombosis and pulmonary embolism were diagnosed in 7.4% and 2.6% patients respectively. After a mean follow-up of 9.3±5.3 years, 329/491 (67%) patients still had some HA present. Anemia remained the most common abnormality (51.7% patients) followed by lymphopenia in 33.1%, and thrombocytopenia in 4.8% patients. Leucopenia was associated with oral ulcers (p=0.021) and alopecia (p=0.031), anemia with renal disease (p=0.017), AIHA with neurological involvement (p=0.003), elevated IgG with malar rash (p=0.027), and low C3 with serositis (p=0.026). HA are very common at the time of diagnosis and during follow-up in SLE, and some of these abnormalities are associated with organ damage. This information may help in better management planning of SLE patients.

  3. Acute Radiological Abnormalities after Bronchial Thermoplasty: A Prospective Cohort Trial

    NARCIS (Netherlands)

    d'Hooghe, Julia N. S.; van den Berk, Inge A. H.; Annema, Jouke T.; Bonta, Peter I.

    2017-01-01

    Background: Bronchial thermoplasty (BT) is a novel treatment for severe asthma based on radiofrequency energy delivery to the larger airways. Although impressive radiological abnormalities have been reported, the incidence, pattern, and behavior over time of acute radiological abnormalities

  4. Comparisons of stomatal parameters between normal and abnormal ...

    African Journals Online (AJOL)

    ED), guard cell length (GCL) and guard cell width (GCW) of normal and abnormal leaf of Bougainvillea spectabilis Willd were studied. This can be useful for further research of physical mechanism of abnormal leaf. Epidermal cells were ...

  5. Abnormal brain activation in excoriation (skin-picking) disorder

    DEFF Research Database (Denmark)

    Odlaug, Brian L.; Hampshire, Adam; Chamberlain, Samuel R

    2016-01-01

    encompassing bilateral dorsal striatum (maximal in right caudate), bilateral anterior cingulate and right medial frontal regions. These abnormalities were, for the most part, outside the dorsal planning network typically activated by executive planning tasks. Conclusions: Abnormalities of neural regions...

  6. Phenotype abnormality: 41 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 41 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u547i abnormal for trait of behavioral...ganelle ... abnormal ... anatomical structure arrangement ... behavioral quality

  7. Phenotype abnormality: 38 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 38 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u544i abnormal for trait of behavioral...idermis ... abnormal ... anatomical structure arrangement ... behavioral quality

  8. Phenotype abnormality: 36 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 36 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u542i abnormal for trait of behavioral...tyledon ... abnormal ... anatomical structure arrangement ... behavioral quality

  9. Genetics Home Reference: X-linked lissencephaly with abnormal genitalia

    Science.gov (United States)

    ... agenesis) of the tissue connecting the left and right halves of the brain ( corpus callosum ). The brain abnormalities can cause severe intellectual disability and developmental delay, abnormal muscle stiffness (spasticity), weak ...

  10. Evidence of brain abnormality in patients with psychogenic nonepileptic seizures.

    NARCIS (Netherlands)

    Reuber, M.; Fernandez, G.S.E.; Bauer, J.; Singh, D.D.; Elger, C.E.

    2002-01-01

    Markers of brain abnormalities in patients with psychogenic nonepileptic seizures (PNES) were studied to explore whether physical brain disorder is associated with an increased risk of PNES. Evidence of epileptiform EEG changes, MRI abnormalities, and neuropsychological (NPS)

  11. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    International Nuclear Information System (INIS)

    Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova; Slamka, Tomas; Martinicky, David; Ilencikova, Denisa; Bartosova, Zdena

    2009-01-01

    Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or

  12. Torpedo maculopathy: A primary choroidal capillary abnormality?

    Directory of Open Access Journals (Sweden)

    Rohan Chawla

    2018-01-01

    Full Text Available A 26-year-old healthy male patient's fundus revealed findings consistent with torpedo maculopathy. Swept-source optical coherence tomography (OCT showed a dome-shaped elevation of the retina at the level of ellipsoid zone. On OCT angiography segmented at the level of the choriocapillaris, a cluster of convoluted fine vessels was seen, and further, deeper scans of the larger choroidal vessels showed a slower flow. From these observations along with the embryological correlation of choriocapillaris development, a possibility of an abnormality preventing proper fenestration of the choriocapillaris along the horizontal raphe being responsible for this anomaly is suggested.

  13. MR imaging of cerebral abnormalities in utero.

    Science.gov (United States)

    Thickman, D; Mintz, M; Mennuti, M; Kressel, H Y

    1984-12-01

    In view of the lack of ionizing radiation, ability to image in a variety of planes, and high contrast resolution, magnetic resonance (MR) imaging may have a role in obstetrical management. Three fetuses with severe cerebral abnormalities were studied by MR in utero. The findings were correlated with ultrasound examinations and with autopsy results. Ventricular dilatation and progression of hydrocephalus were detected by MR. Although fetal motion may affect image quality, diagnostically useful images were obtained with imaging times of 2.5 min.

  14. Radiological and orthopedic abnormalities in Satoyoshi syndrome

    International Nuclear Information System (INIS)

    Haymon, M.L.; Willis, R.B.; Ehlayel, M.S.; Louisiana State Medical Center, New Orleans, LA; Lacassie, Y.; Louisiana State Medical Center, New Orleans, LA; Children's Hospital, New Orleans, LA

    1997-01-01

    Satoyoshi syndrome is a are disorder on unknown etiology characterized by progressive, painful intermittent muscle spasms, serve skeletal abnormalities mimicking a skeletal dyplasia, malabsorption, alopecia, and amenorrhea. We further report on a 20 1 / 2 -year-old Caucasian woman whith characteristic manifestation of the syndrome. Since the establishment of the diagnostic 1 year ago, she has been treated with prednisone with good response. However, treatment of the multiple deformities and fractures has been difficult and challenging. The early recognition and treatment of this disorder is of utmost importance, as the skeletal deformities and fractures seem to be secondary to the muscular spasms, as suggested by Satoyoshi

  15. Radiological and orthopedic abnormalities in Satoyoshi syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Haymon, M.L. [Children`s Hospital, New Orleans, LA (United States). Dept. of Radiology; Willis, R.B. [Children`s Hospital, New Orleans, LA (United States). Dept. of Orthopedics; Ehlayel, M.S. [Div. of Genetics, Dept. of Pediatrics, Louisiana State Univ. Medical Center, Orleans, LA (United States)]|[Louisiana State Medical Center, New Orleans, LA (United States). Center for Molecular and Human Genetics; Lacassie, Y. [Div. of Genetics, Dept. of Pediatrics, Louisiana State Univ. Medical Center, Orleans, LA (United States)]|[Louisiana State Medical Center, New Orleans, LA (United States). Center for Molecular and Human Genetics]|[Children`s Hospital, New Orleans, LA (United States). Dept. of Pediatrics

    1997-05-01

    Satoyoshi syndrome is a are disorder on unknown etiology characterized by progressive, painful intermittent muscle spasms, serve skeletal abnormalities mimicking a skeletal dyplasia, malabsorption, alopecia, and amenorrhea. We further report on a 20{sup 1}/{sub 2}-year-old Caucasian woman whith characteristic manifestation of the syndrome. Since the establishment of the diagnostic 1 year ago, she has been treated with prednisone with good response. However, treatment of the multiple deformities and fractures has been difficult and challenging. The early recognition and treatment of this disorder is of utmost importance, as the skeletal deformities and fractures seem to be secondary to the muscular spasms, as suggested by Satoyoshi.

  16. Childhood autism and auditory system abnormalities.

    Science.gov (United States)

    Hitoglou, Magdalini; Ververi, Athina; Antoniadis, Alexandros; Zafeiriou, Dimitrios I

    2010-05-01

    Hearing disorders are common among children with autism, ranging from peripheral and sensorineural hearing deficit or loss to auditory hypersensitivity with bizarre reactions to sounds. The auditory abnormalities and consequent sensory deprivation exacerbate the communication deficit of autism, and early auditory assessment holds an important place in the planning of intervention and the overall prognosis of patients. Physiologic, pathologic, imaging, and neurochemical studies have revealed an array of aberrations in the perception and processing of the audiologic stimuli, including (among others) maturational defects, atypical lateralization, and serotonin dysfunction. Copyright 2010 Elsevier Inc. All rights reserved.

  17. Adverse Pregnancy Outcomes after Abnormal First Trimester Screening for Aneuploidy

    OpenAIRE

    Goetzl, Laura

    2010-01-01

    Women with abnormal first trimester screening but with a normal karyotype are at risk for adverse pregnancy outcomes. A nuchal translucency >3.5mm is associated with an increased risk of subsequent pregnancy loss, fetal infection, fetal heart abnormalities and other structural abnormalities. Abnormal first trimester analytes are also associated with adverse pregnancy outcomes but the predictive value is less impressive. As a single marker, PAPP-A

  18. Chromosomal Abnormalities Associated with Neural Tube Defects (I): Full Aneuploidy

    OpenAIRE

    Chih-Ping Chen

    2007-01-01

    Fetuses with neural tube defects (NTDs) carry a risk of chromosomal abnormalities. The risk varies with maternal age, gestational age at diagnosis, association with other structural abnormalities, and family history of chromosome aberrations. This article provides an overview of chromosomal abnormalities associated with NTDs in embryos, fetuses, and newborn patients, and a comprehensive review of numerical chromosomal abnormalities associated with NTDs, such as trisomy 18, trisomy 13, triploi...

  19. MMR Vaccine (Measles, Mumps, and Rubella)

    Science.gov (United States)

    Attenuvax® Measles Vaccine ... R-Vax® II (as a combination product containing Measles Vaccine, Rubella Vaccine) ... M-R® II (as a combination product containing Measles Vaccine, Mumps Vaccine, Rubella Vaccine)

  20. Phenotype abnormality - Arabidopsis Phenome Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ion of ontology terms and properties. Phenotypes for morphology are standardized using Plant Ontology... (PO) or Trait Ontology (TO), with Phenotype Ontology (PATO). PATO is the vocabulary cov... tolerance can be expressed using Gene Ontology (GO), ChEBI etc. Some phenotypes are observed under some spe...h URL http://togodb.biosciencedbc.jp/togodb/view/cpp_abnormality#en Data acquisition method Plant Ontology, Phenotype Ontology

  1. Association of loss of heterozygosity with cytogenetic abnormalities in acute myeloid leukemia and myelodysplastic syndrome

    Directory of Open Access Journals (Sweden)

    R.F. Pinheiro

    2008-07-01

    Full Text Available Deletions on chromosomes 5 and 7 are frequently seen in myelodysplastic syndrome (MDS and acute myeloid leukemia (AML. It is assumed that these deletions indicate loss of tumor suppressor genes on these chromosomes and until these tumor suppressor genes are identified, the functional consequences of these deletions and the molecular basis of these myeloid disorders cannot be completely understood. We evaluated loss of heterozygosity (LOH in 44 patients (18 MDS and 26 AML, diagnosed according to WHO classification criteria at diagnosis, using a four-microsatellite marker panel: an intragenic marker on the 7th intron of gene IRF-1 of the 5q31.1 region and three markers located inside the 7q31.1 region and correlated the LOH with karyotype abnormalities. The microsatellites chosen corresponded to chromosome regions frequently deleted in MDS/AML. The samples with Q (peak area less than or equal to 0.50 were indicative of LOH. The percent of informative samples (i.e., heterozygous for the intragenic microsatellite in gene IRF-1 and in loci D7S486, D7S515 and D7S522 were 66.6, 73.7, 75.5, and 48.8%, respectively. Cytogenetic abnormalities by G-banding were found in 36% (16/44 of the patients (2 of 18 MDS and 14 of 26 AML patients. We found a significantly positive association of the occurrence of LOH with abnormal karyotype (P < 0.05; chi-square test and there were cases with LOH but the karyotype was normal (by G-banding. These data indicate that LOH in different microsatellite markers is possibly an event previous to chromosomal abnormalities in these myeloid neoplasias.

  2. Microenvironmental abnormalities induced by viral cooperation: Impact on lymphomagenesis.

    Science.gov (United States)

    De Paoli, Paolo; Carbone, Antonino

    2015-10-01

    When stringent criteria have been used, the Epstein Barr virus (EBV), the Kaposi's sarcoma herpesvirus (KSHV), human immunodeficiency virus type 1 (HIV-1) and human hepatitis C virus (HCV) have been identified with sufficient evidence to be causative agents of non-Hodgkin's Lymphomas. Initially, single viral infection was considered fully responsible for the oncogenic properties of each virus, while it is now established that in many cases, multiple viral agents collaborate as cofactors in inducing lymphomas, especially in the presence of HIV-dependent immunodeficiency. Viruses cooperate by using their specific pathogenetic mechanisms in different combinations. The aim of this review is to describe the cooperation between different viruses in the development of lymphomas including the evidences supporting their pathogenetic role. Viral cooperation, a mechanism by which different viruses coinfecting human tissues have synergistic or regulatory effects on carcinogenesis, targets neoplastic B cells as well as cells of the microenvironment, such as reactive T-cells, B cells and macrophages, as well as non-immune cells such as endothelial cells, that contribute to tumor microenvironment. The most important viral genes involved in cooperation include HIV-1 tat and vpu, EBV LMP-1 and EBNA-2 and KSHV KIE2, Rta and LANA. Lymphomagenesis related to viral cooperation represents an interesting topic where microenvironmental abnormalities may be particularly relevant, particularly because antiviral targeted therapies and therapies producing the reconstitution of the immune system may constitute areas of interest aiming at improving the outcome of virus associated lymphomas. While the immune component of the lymphoma microenvironment can be easily studied by immunological and molecular techniques, the definition of the non-immune component of the lymphoma microenvironment is largely incomplete and may be the issue of future investigations. Understanding the pathogenetic role of

  3. Prevalence of cervical cytology abnormalities among HIV infected ...

    African Journals Online (AJOL)

    Objectives: To establish the prevalence of cervical cytology abnormalities, determine the correlation between CD4+ cell count and abnormal Pap smear, determine the correlation between WHO-HIV staging and abnormal pap smear among HIV infected women attending HIV clinic at Rwanda Military Hospital. Design: ...

  4. Abnormal Behavior in Relation to Cage Size in Rhesus Monkeys

    Science.gov (United States)

    Paulk, H. H.; And Others

    1977-01-01

    Examines the effects of cage size on stereotyped and normal locomotion and on other abnormal behaviors in singly caged animals, whether observed abnormal behaviors tend to co-occur, and if the development of an abnormal behavior repertoire leads to reduction in the number of normal behavior categories. (Author/RK)

  5. Abnormally large magnetospheric electric field on 9 November 2004 ...

    Indian Academy of Sciences (India)

    There was a solar event around 1850 UT on 9th November 2004, associated with an abnormally large solar wind flow pressure and large southward interplanetary magnetic field, causing an abnormally large prompt penetration electric field between 1850 and 2100 UT. Abnormally large vertical F-region drifts by Jicamarca ...

  6. ECG classification and abnormality detection using cascade forward ...

    African Journals Online (AJOL)

    This paper describes the use of MATLAB based artificial neural network tools for ECG analysis for finding out whether the ECG is normal or abnormal and if it is abnormal, what is the abnormality. There are various arrhythmia like Ventricular premature beats, asystole, couplet, bigeminy, fusion beats etc. To classify this,

  7. [Utility of immunohistochemistry in detecting alterations of mismatch repair genes of DNA. A series of 48 cases of colorectal cancer].

    Science.gov (United States)

    Ziadi, Sonia; Gacem, Riath Ben; Haoues, Imen; Hachana, Mouhamed; Amara, Khaled; Trimeche, Mounir; Golli, Lamia; Mokni, Moncef; Korbi, Sadok

    2011-01-01

    Hereditary non-polyposis colorectal cancer (HNPCC) is associated in more than 95% to a germline mutation in the genes of the mismatch repair (MMR) of DNA. The aim of this study was to assess the utility of immunohistochemistry, a simple and fast technique, in the triage of families where HNPCC is suspected. Tumor samples included in this study were from patients with resection for colorectal cancer, examined in our laboratory between 2004 and 2007. For each case, a formalin-fixed paraffin-embedded tissue block containing tumor tissue and normal adjacent mucosa was selected. Tumor specimens were examined with immunohistochemistry for the presence of hMLH1, hMSH2, and hMSH6 proteins. Scoring of the tumor staining was performed without any knowledge of patients' family history. The loss of protein expression was noted in four patients among 48 cases tested: two cases with isolated loss of hMSH2, a case with isolated loss of hMSH6 and one case with combined loss of MSH2/MSH6. No case has shown a suppression of hMLH1 protein. Comparing the immunohistochemical results for clinical has revealed a clear correlation between loss of protein expression demonstrated by immunohistochemistry and clinical data. Indeed, three cases among the four who showed no expression of MMR proteins showed at least one clinical criterion predictive of HNPCC. In conclusion, our study support the potential utility of immunohistochemistry to identify a significant portion of colorectal tumors derived from germline mutation of MMR genes and can be used as an adjunct measure in the identification of HNPCC.

  8. Altered expression of the mismatch repair genes in DF-1 cells infected with the avian leukosis virus subgroup A.

    Science.gov (United States)

    Yao, Da-Wei; Zhan, Li; Hong, Yu-Fang; Liu, Jian-Xin; Xu, Jia-Rong; Yang, De-Ji

    2016-01-01

    The absence or deficiency of DNA mismatch repair (MMR) activity results in microsatellite instability (MSI) in cancer. The avian leukosis virus (ALV) causes neoplastic disease in chickens. In this study, the status of MMR, MSI, the cell cycle and apoptosis were detected in DF-1 cells after avian leukosis virus subgroup A infection. Flow cytometry analysis results indicated that there was no significant difference in cell apoptosis between the control and infected groups. The percentage of cells in S and G2 phases were increased in the infected group. MSI and mutation of MSH2 and MLH1 gene exons were absent in DF-1 cells after infection. Levels of MSH2 and MLH1 mRNA were dramatically increased in DF-1 cells after infection. These results demonstrated that ALV RAV-1 infection may promote the expression of MSH2 and MLH1 genes rather than resulting in gene mutations. Mismatch repair functions were normal and may be have relationships with the arrest of S phase and G2 phase.

  9. Abnormal and normal obsessions: a reconsideration.

    Science.gov (United States)

    Rassin, Eric; Muris, Peter

    2007-05-01

    Contemporary cognitive approaches to obsession assume that the content of clinical obsessions does not differ from non-clinical obsessive intrusions. This assumption goes back to a classic study by Rachman and De Silva [(1978). Abnormal and normal obsessions. Behaviour Research and Therapy, 16, 233-248]. In the present paper, it is argued that Rachman and De Silva did not postulate a complete indifference between clinical and non-clinical obsessions. Study 1 is a simple statistical analysis of data presented by Rachman and De Silva. This analysis suggested that psychologists are able to discriminate clinical and non-clinical obsessions beyond chance level, merely by looking at the content of obsessions. In study 2, a list of 23 clinical and 47 non-clinical obsessions was presented to 11 psychotherapists and 90 psychology undergraduates. Both therapists and students were able to distinguish clinical and non-clinical obsession beyond chance level. It is concluded that some clinical obsessions can be identified as being evidently abnormal, and that additional theory and research is needed to identify the causes of these recognisable obsessions.

  10. Screening human populations for abnormal radiosensitivity

    International Nuclear Information System (INIS)

    Gentner, N.E.; Morrison, D.P.

    1990-07-01

    A relatively rapid and inexpensive in vitro growback assay was developed that uses the irradiated versus the unirradiated re-growth responses of lymphoblastoid cell lines developed from individual donors as an estimator of donor radioresponse. The purpose of this project was to furnish an estimate of the proportion of strains derived from various study populations that may be regarded as exhibiting abnormal radioresponse. The emphasis in this study was on hypersensitivity, because of the known radiation-hypersensitivity and cancer proneness associated with the genetic disorder ataxia-telangiectasia. Using methods developed especially for survival analyses, the percentage of significantly hypersensitive responses was 5.5% in a donor population composed of ostensibly normal individuals. We also examined lines derived from an unselected cancer patient population. These were not enriched, compared to the reference normal population, for hypersensitive responses. We thus conclude that hypersensitivity in vitro is not associated with increased risk for spontaneous development of cancer. However, the failure to observe an association between hypersensitivity and spontaneous cancer does not preclude a correlation between such sensitivity and radiogenic cancer. At the present stage, we would caution against the application of this assay or related in vitro tests to the situation of an individual, as opposed to a population. While we have clear indications that hypersensitivity in vitro is associated with abnormal radioresponse in vivo, this study has identified sources of variation that must be understood before attempts are made to unambiguously attribute a particular type of radioresponse to an individual

  11. Abnormal Fixational Eye Movements in Amblyopia.

    Science.gov (United States)

    Shaikh, Aasef G; Otero-Millan, Jorge; Kumar, Priyanka; Ghasia, Fatema F

    2016-01-01

    Fixational saccades shift the foveal image to counteract visual fading related to neural adaptation. Drifts are slow eye movements between two adjacent fixational saccades. We quantified fixational saccades and asked whether their changes could be attributed to pathologic drifts seen in amblyopia, one of the most common causes of blindness in childhood. Thirty-six pediatric subjects with varying severity of amblyopia and eleven healthy age-matched controls held their gaze on a visual target. Eye movements were measured with high-resolution video-oculography during fellow eye-viewing and amblyopic eye-viewing conditions. Fixational saccades and drifts were analyzed in the amblyopic and fellow eye and compared with controls. We found an increase in the amplitude with decreased frequency of fixational saccades in children with amblyopia. These alterations in fixational eye movements correlated with the severity of their amblyopia. There was also an increase in eye position variance during drifts in amblyopes. There was no correlation between the eye position variance or the eye velocity during ocular drifts and the amplitude of subsequent fixational saccade. Our findings suggest that abnormalities in fixational saccades in amblyopia are independent of the ocular drift. This investigation of amblyopia in pediatric age group quantitatively characterizes the fixation instability. Impaired properties of fixational saccades could be the consequence of abnormal processing and reorganization of the visual system in amblyopia. Paucity in the visual feedback during amblyopic eye-viewing condition can attribute to the increased eye position variance and drift velocity.

  12. Functional neuroimaging abnormalities in idiopathic generalized epilepsy

    Directory of Open Access Journals (Sweden)

    Megan L. McGill

    2014-01-01

    Full Text Available Magnetic resonance imaging (MRI techniques have been used to quantitatively assess focal and network abnormalities. Idiopathic generalized epilepsy (IGE is characterized by bilateral synchronous spike–wave discharges on electroencephalography (EEG but normal clinical MRI. Dysfunctions involving the neocortex, particularly the prefrontal cortex, and thalamus likely contribute to seizure activity. To identify possible morphometric and functional differences in the brains of IGE patients and normal controls, we employed measures of thalamic volumes, cortical thickness, gray–white blurring, fractional anisotropy (FA measures from diffusion tensor imaging (DTI and fractional amplitude of low frequency fluctuations (fALFF in thalamic subregions from resting state functional MRI. Data from 27 patients with IGE and 27 age- and sex-matched controls showed similar thalamic volumes, cortical thickness and gray–white contrast. There were no differences in FA values on DTI in tracts connecting the thalamus and prefrontal cortex. Functional analysis revealed decreased fALFF in the prefrontal cortex (PFC subregion of the thalamus in patients with IGE. We provide minimum detectable effect sizes for each measure used in the study. Our analysis indicates that fMRI-based methods are more sensitive than quantitative structural techniques for characterizing brain abnormalities in IGE.

  13. Brain Abnormalities in Neuromyelitis Optica Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Woojun Kim

    2012-01-01

    Full Text Available Neuromyelitis optica (NMO is an idiopathic inflammatory syndrome of the central nervous system that is characterized by severe attacks of optic neuritis (ON and myelitis. Until recently, NMO was considered a disease without brain involvement. However, since the discovery of NMO-IgG/antiaqaporin-4 antibody, the concept of NMO was broadened to NMO spectrum disorder (NMOSD, and brain lesions are commonly recognized. Furthermore, some patients present with brain symptoms as their first manifestation and develop recurrent brain symptoms without ON or myelitis. Brain lesions with characteristic locations and configurations can be helpful in the diagnosis of NMOSD. Due to the growing recognition of brain abnormalities in NMOSD, these have been included in the NMO and NMOSD diagnostic criteria or guidelines. Recent technical developments such as diffusion tensor imaging, MR spectroscopy, and voxel-based morphometry reveal new findings related to brain abnormalities in NMOSD that were not identified using conventional MRI. This paper focuses on the incidence and characteristics of the brain lesions found in NMOSD and the symptoms that they cause. Recent studies using advanced imaging techniques are also introduced.

  14. Skeleton-Based Abnormal Gait Detection

    Directory of Open Access Journals (Sweden)

    Trong-Nguyen Nguyen

    2016-10-01

    Full Text Available Human gait analysis plays an important role in musculoskeletal disorder diagnosis. Detecting anomalies in human walking, such as shuffling gait, stiff leg or unsteady gait, can be difficult if the prior knowledge of such a gait pattern is not available. We propose an approach for detecting abnormal human gait based on a normal gait model. Instead of employing the color image, silhouette, or spatio-temporal volume, our model is created based on human joint positions (skeleton in time series. We decompose each sequence of normal gait images into gait cycles. Each human instant posture is represented by a feature vector which describes relationships between pairs of bone joints located in the lower body. Such vectors are then converted into codewords using a clustering technique. The normal human gait model is created based on multiple sequences of codewords corresponding to different gait cycles. In the detection stage, a gait cycle with normality likelihood below a threshold, which is determined automatically in the training step, is assumed as an anomaly. The experimental results on both marker-based mocap data and Kinect skeleton show that our method is very promising in distinguishing normal and abnormal gaits with an overall accuracy of 90.12%.

  15. Abnormal sex chromosome constitution and longitudinal growth

    DEFF Research Database (Denmark)

    Aksglaede, Lise; Skakkebaek, Niels E; Juul, Anders

    2008-01-01

    Growth is a highly complex process regulated by the interaction between sex steroids and the GH IGF-axis. However, other factors such as sex chromosome-related genes play independent roles.......Growth is a highly complex process regulated by the interaction between sex steroids and the GH IGF-axis. However, other factors such as sex chromosome-related genes play independent roles....

  16. Cytogenetic abnormalities and fragile-x syndrome in Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Reddy Kavita S

    2005-01-01

    Full Text Available Abstract Background Autism is a behavioral disorder with impaired social interaction, communication, and repetitive and stereotypic behaviors. About 5–10 % of individuals with autism have 'secondary' autism in which an environmental agent, chromosome abnormality, or single gene disorder can be identified. Ninety percent have idiopathic autism and a major gene has not yet been identified. We have assessed the incidence of chromosome abnormalities and Fragile X syndrome in a population of autistic patients referred to our laboratory. Methods Data was analyzed from 433 patients with autistic traits tested using chromosome analysis and/or fluorescence in situ hybridization (FISH and/or molecular testing for fragile X syndrome by Southern and PCR methods. Results The median age was 4 years. Sex ratio was 4.5 males to 1 female [354:79]. A chromosome (cs abnormality was found in 14/421 [3.33 %] cases. The aberrations were: 4/14 [28%] supernumerary markers; 4/14 [28%] deletions; 1/14 [7%] duplication; 3/14 [21%] inversions; 2/14 [14%] translocations. FISH was performed on 23 cases for reasons other than to characterize a previously identified cytogenetic abnormality. All 23 cases were negative. Fragile-X testing by Southern blots and PCR analysis found 7/316 [2.2 %] with an abnormal result. The mutations detected were: a full mutation (fM and abnormal methylation in 3 [43 %], mosaic mutations with partial methylation of variable clinical significance in 3 [43%] and a permutation carrier [14%]. The frequency of chromosome and fragile-X abnormalities appears to be within the range in reported surveys (cs 4.8-1.7%, FRAX 2–4%. Limitations of our retrospective study include paucity of behavioral diagnostic information, and a specific clinical criterion for testing. Conclusions Twenty-eight percent of chromosome abnormalities detected in our study were subtle; therefore a high resolution cytogenetic study with a scrutiny of 15q11.2q13, 2q37 and Xp23

  17. La supuesta asociación entre la vacuna triple vírica y el autismo y el rechazo a la vacunación The putative link between the MMR vaccine and autism and refusal to vaccinate

    Directory of Open Access Journals (Sweden)

    Andreu Segura Benedicto

    2012-08-01

    Full Text Available La publicación del artículo de Wakefield et al. en The Lancet desencadenó una reacción de rechazo a la vacuna triple vírica, a pesar de que se trataba solo de una serie de casos y la asociación entre la vacunación y el autismo hubiera podido muy bien ser anecdótica. Sin embargo, más tarde se comprobó que tal asociación era espuria, debido no solo a sesgos ocultados sino también a alteraciones interesadas de los datos y a otros comportamientos impropios de dos de los autores que por ello fueron expulsados del colegio de médicos. Finalmente el artículo fue retirado de la revista. Este episodio invita a reflexionar sobre la credibilidad y la confianza que merecen las autoridades y los profesionales a la población, así como sobre los recelos que pueden plantearse cuando se producen potenciales conflictos de intereses entre los profesionales, la industria, las revistas y la población. Un aspecto de particular interés es el de las expectativas distorsionadas sobre las posibilidades de las intervenciones sanitarias, incluida la vacunación, especialmente respecto de la dimensión individual y la colectiva de la prevención.The paper of Wakefield et al. in The Lancet, triggered a negative reaction to the MMR vaccine, even though it was just a series of cases and the association between vaccination and autism could well be anecdotal. However, it was found that this association was spurious, not only because of hidden biases but also to alterations of the data and other improper behavior of the two authors that they were expelled from medical council. Finally, the article was removed from the magazine. This episode invites to think about the credibility and trust in the authorities and professionals to the population, as well as the suspicions that may arise when there are potential conflicts of interest among professionals, industry magazines and the population. A special area of interest is on the distorted expectations of health

  18. Report to congress on abnormal occurrences: January--March 1992

    International Nuclear Information System (INIS)

    1992-07-01

    Section 208 of the Energy Reorganization Act of 1974 identifies an abnormal occurrence as abnormal occurrence as an unscheduled incident or event that the Nuclear Regulatory Commission determines to be significant from the standpoint of public health or safety and requires a quarterly report of such events to be made to congress. This report covers the period from January 1 through March 31, 1992. The abnormal occurrences involving medical therapy misadministrations at NRC-licensed facilities are discussed in this report. There were no abnormal occurrences at a nuclear power plant, and none were reported by NRC's Agreement States. The report also contains information updating some previously reported abnormal occurrences

  19. Report to Congress on abnormal occurrences, October--December 1992

    International Nuclear Information System (INIS)

    1993-03-01

    Section 208 of the Energy Reorganization Act of 1974 identifies an abnormal occurrence as an unscheduled incident or event that the Nuclear Regulatory Commission determines to be significant from the standpoint of public health or safety and requires a quarterly report of such events to be made to Congress. This report covers the period from October 1 through December 31, 1992. There are two abnormal occurrences at nuclear power plants and six abnormal occurrences involving medical misadministration (all therapeutic) at NRC-licensed facilities discussed in this report. No abnormal occurrences were reported by the NRC's Agreement States. The report also contains information updating three previously reported abnormal occurrences

  20. Real-time Multiple Abnormality Detection in Video Data

    DEFF Research Database (Denmark)

    Have, Simon Hartmann; Ren, Huamin; Moeslund, Thomas B.

    2013-01-01

    Automatic abnormality detection in video sequences has recently gained an increasing attention within the research community. Although progress has been seen, there are still some limitations in current research. While most systems are designed at detecting specific abnormality, others which...... are capable of detecting more than two types of abnormalities rely on heavy computation. Therefore, we provide a framework for detecting abnormalities in video surveillance by using multiple features and cascade classifiers, yet achieve above real-time processing speed. Experimental results on two datasets...... show that the proposed framework can reliably detect abnormalities in the video sequence, outperforming the current state-of-the-art methods....

  1. Integration of gene expression and DNA-methylation profiles improves molecular subtype classification in acute myeloid leukemia

    NARCIS (Netherlands)

    Taskesen, E.; Babaei, S.; Reinders, M.J.M.; De Ridder, J.

    2015-01-01

    Background Acute Myeloid Leukemia (AML) is characterized by various cytogenetic and molecular abnormalities. Detection of these abnormalities is important in the risk-classification of patients but requires laborious experimentation. Various studies showed that gene expression profiles (GEP), and

  2. Gynecologic anatomic abnormalities following anorectal malformations repair.

    Science.gov (United States)

    Vilanova-Sanchez, Alejandra; Reck, Carlos A; McCracken, Kate A; Lane, Victoria A; Gasior, Alessandra C; Wood, Richard J; Levitt, Marc A; Hewitt, Geri D

    2018-04-01

    Patients may present with gynecologic concerns after previous posterior sagittal anorectoplasty (PSARP) for repair of an anorectal malformation (ARM). Common findings include an inadequate or shortened perineal body, as well as introital stenosis, retained vaginal septum, and remnant rectovestibular fistula. An inadequate or shortened perineal body may impact fecal continence, sexual function and recommendations regarding obstetrical mode of delivery. We describe our experience with female patients referred to our center for evaluation of their previously repaired ARM, with a specific focus on perineal body anatomy and concomitant gynecologic abnormalities. We outline our collaborative evaluation process and findings as well as subsequent repair and outcomes. A single site retrospective chart review from May 2014 to May 2016 was performed. Female patients with a history of prior ARM repair who required subsequent reoperative surgical repair with perineoplasty were included. The decision for reoperation was made collaboratively after a multidisciplinary evaluation by colorectal surgery, urology, and gynecology which included examination under anesthesia (EUA) with cystoscopy, vaginoscopy, rectal examination, and electrical stimulation of anal sphincters. The type of original malformation, indication for reoperative perineoplasty, findings leading to additional procedures performed at time of perineoplasty, postoperative complications, and the length of follow up were recorded. During the study period 28 patients were referred for evaluation after primary ARM repair elsewhere and 15 patients (60%) met inclusion criteria. Thirteen patients (86.6%) originally had a rectovestibular fistula with prior PSARP and 2 patients (13.4%) originally had a cloacal malformation with prior posterior sagittal anorectovaginourethroplasty. The mean age at the time of the subsequent perineoplasty was 4.6years (0.5-12). Patients had an inadequate perineal body requiring reoperative

  3. Immunogenicity and safety of a combined DTaP-IPV vaccine compared with separate DTaP and IPV vaccines when administered as pre-school booster doses with a second dose of MMR vaccine to healthy children aged 4-6 years.

    Science.gov (United States)

    Black, Steven; Friedland, Leonard R; Schuind, Anne; Howe, Barbara

    2006-08-28

    Combination vaccines represent one solution to the problem of increased numbers of injections during single clinic visits. A combined DTaP-IPV (Infanrix-IPV) vaccine has been developed for use as a pre-school booster. Four hundred healthy children aged 4-6 years previously primed with 4 doses of DTaP vaccine (Infanrix), 3 doses of poliovirus vaccine and 1 dose of MMR vaccine were randomized to receive single doses of either the combined DTaP-IPV vaccine or separate DTaP and IPV vaccines in a Phase II trial (DTaP-IPV-047). All children also received a second dose of MMR vaccine. Immunogenicity was assessed in serum samples taken before and 1 month after booster administration. Safety was actively assessed for 42 days post-vaccination. Non-inferiority of the DTaP-IPV vaccine to separate DTaP and IPV vaccines was demonstrated for all DTaP antigen booster response rates and poliovirus geometric mean titers of antibody ratios. Post-vaccination, > or =99.4% of children in both groups had seroprotective levels of anti-diphtheria and anti-tetanus antibodies (> or =0.1IU/mL) and seroprotective anti-poliovirus antibody titers (> or =1:8). All children in both groups were seropositive for measles, mumps and rubella antibodies, with similar post-vaccination geometric mean concentrations/titers. No significant differences were observed in the incidence of solicited local or general symptoms, unsolicited symptoms and serious adverse events between the two groups. This combined DTaP-IPV appeared safe and immunogenic when given as a booster dose at 4-6 years of age. The DTaP-IPV vaccine had no negative effect on the response to co-administered MMR vaccine, making it well-suited for use as a pre-school booster.

  4. Morphological Abnormalities of Thalamic Subnuclei in Migraine

    DEFF Research Database (Denmark)

    Magon, Stefano; May, Arne; Stankewitz, Anne

    2015-01-01

    UNLABELLED: The thalamus contains third-order relay neurons of the trigeminal system, and animal models as well as preliminary imaging studies in small cohorts of migraine patients have suggested a role of the thalamus in headache pathophysiology. However, larger studies using advanced imaging...... techniques in substantial patient populations are lacking. In the present study, we investigated changes of thalamic volume and shape in a large multicenter cohort of patients with migraine. High-resolution T1-weighted MRI data acquired at 3 tesla in 131 patients with migraine (38 with aura; 30.8 ± 9 years...... a fully automated multiatlas approach. Deformation-based shape analysis was performed to localize surface abnormalities. Differences between patients with migraine and healthy subjects were assessed using an ANCOVA model. After correction for multiple comparisons, performed using the false discovery rate...

  5. Abnormal neuronal migration: radiologic-clinic study

    International Nuclear Information System (INIS)

    Martinez Fernandez, M.; Menor Serrano, F.; Bordon Ferre, F.; Garcia Tena, J.; Esteban Hernandez, E.; Sanguesa Nebot, C.; Marti Bonnati, L.

    1994-01-01

    We present our experience in 18 pediatric patients with abnormal neuronal migration. Seven cases of heterotopia of the gray matter, 7 agyria-pachygyria complexes, 1 case of polymicrogyria, 2 cases of schizencephaly and 1 case of hemimegalencephaly were diagnosed by means of ultrasonography, computed tomography and magnetic resonance. The clinical picture was reviewed in each case, with special attention to the occurrence of convulsions, psycho motor development and visual changes. In general, the greater the morphological change, the greater the neurological involvement in these patients. However, the two cases of schizencephaly presented mild clinical expression. Magnetic resonance increases the diagnostic yield in neuronal migration disorders. Nevertheless, either ultrasonography or, especially, computed tomography is useful as a first diagnostic approach in these malformative disorders. (Author)

  6. Congenital abnormalities of the posterior fossa.

    Science.gov (United States)

    Bosemani, Thangamadhan; Orman, Gunes; Boltshauser, Eugen; Tekes, Aylin; Huisman, Thierry A G M; Poretti, Andrea

    2015-01-01

    The frequency and importance of the evaluation of the posterior fossa have increased significantly over the past 20 years owing to advances in neuroimaging. Nowadays, conventional and advanced neuroimaging techniques allow detailed evaluation of the complex anatomic structures within the posterior fossa. A wide spectrum of congenital abnormalities has been demonstrated, including malformations (anomalies due to an alteration of the primary developmental program caused by a genetic defect) and disruptions (anomalies due to the breakdown of a structure that had a normal developmental potential). Familiarity with the spectrum of congenital posterior fossa anomalies and their well-defined diagnostic criteria is crucial for optimal therapy, an accurate prognosis, and correct genetic counseling. The authors discuss the spectrum of posterior fossa malformations and disruptions, with emphasis on neuroimaging findings (including diagnostic criteria), neurologic presentation, systemic involvement, prognosis, and risk of recurrence. RSNA, 2015

  7. Abnormal epidermal changes after argon laser treatment

    Energy Technology Data Exchange (ETDEWEB)

    Neumann, R.A.; Knobler, R.M.; Aberer, E.; Klein, W.; Kocsis, F.; Ott, E. (Univ. of Vienna (Austria))

    1991-02-01

    A 26-year-old woman with a congenital port-wine stain on the forehead was treated three times at 2-month intervals with an argon laser. Six months after the last treatment, moderate blanching and mild scaling confined to the treated area was observed. A biopsy specimen of the treated area revealed a significant decrease in ectatic vessels. However, epidermal changes similar to those of actinic keratosis with disorganized cell layers and marked cytologic abnormalities were seen. Analysis of peripheral blood lymphocytes for a defect in DNA repair was negative. Multiple, argon laser-induced photothermal effects may be responsible for the changes observed in our case and may lead to premalignant epidermal transformation.

  8. Persistent Pain and Sensory Abnormalities after Abdominoplasty

    DEFF Research Database (Denmark)

    Presman, Benjamin; Finnerup, Kenneth; Andresen, Sven R

    2015-01-01

    and characteristics of persistent pain after abdominoplasty, which is one of the most frequent cosmetic surgical procedures. METHODS: In September 2014, a link to a web-based questionnaire was mailed to 217 patients who had undergone abdominoplasty between 2006 and 2014 at the Department of Plastic Surgery, Aalborg......BACKGROUND: Persistent postsurgical pain is a well-recognized problem after a number of common surgical procedures, such as amputation, thoracotomy, and inguinal hernia repair. Less is known about persistent pain after cosmetic surgical procedures. We, therefore, decided to study the incidence...... University Hospital, Denmark. The questionnaire included questions about pain and sensory abnormalities located to the abdominal skin, and physical and psychological function; patient satisfaction with surgery was rated on a 4-point scale. RESULTS: One hundred seventy patients answered the questionnaire...

  9. Striatal morphology correlates with sensory abnormalities in unaffected relatives of cervical dystonia patients.

    LENUS (Irish Health Repository)

    Walsh, Richard A

    2012-02-01

    Structural grey matter abnormalities have been described in adult-onset primary torsion dystonia (AOPTD). Altered spatial discrimination thresholds are found in familial and sporadic AOPTD and in some unaffected relatives who may be non-manifesting gene carriers. Our hypothesis was that a subset of unaffected relatives with abnormal spatial acuity would have associated structural abnormalities. Twenty-eight unaffected relatives of patients with familial cervical dystonia, 24 relatives of patients with sporadic cervical dystonia and 27 control subjects were recruited. Spatial discrimination thresholds (SDTs) were determined using a grating orientation task. High-resolution magnetic resonance imaging (MRI) images (1.5 T) were analysed using voxel-based morphometry. Unaffected familial relatives with abnormal SDTs had reduced caudate grey matter volume (GMV) bilaterally relative to those with normal SDTs (right Z = 3.45, left Z = 3.81), where there was a negative correlation between SDTs and GMV (r = -0.76, r(2) = 0.58, p < 0.0001). Familial relatives also had bilateral sensory cortical expansion relative to unrelated controls (right Z = 4.02, left Z = 3.79). Unaffected relatives of patients with sporadic cervical dystonia who had abnormal SDTs had reduced putaminal GMV bilaterally compared with those with normal SDTs (right Z = 3.96, left Z = 3.45). Sensory abnormalities in some unaffected relatives correlate with a striatal substrate and may be a marker of genetic susceptibility in these individuals. Further investigation of grey matter changes as a candidate endophenotype may assist future genetic studies of dystonia.

  10. Glutamatergic system abnormalities in posttraumatic stress disorder.

    Science.gov (United States)

    Nishi, Daisuke; Hashimoto, Kenji; Noguchi, Hiroko; Hamazaki, Kei; Hamazaki, Tomohito; Matsuoka, Yutaka

    2015-12-01

    Accumulating evidence suggests involvement of the glutamatergic system in the biological mechanisms of posttraumatic stress disorder (PTSD), but few studies have demonstrated an association between glutamatergic system abnormalities and PTSD diagnosis or severity. We aimed to examine whether abnormalities in serum glutamate and in the glutamine/glutamate ratio were associated with PTSD diagnosis and severity in severely injured patients at risk for PTSD and major depressive disorder (MDD). This is a nested case-control study in TPOP (Tachikawa project for prevention of posttraumatic stress disorder with polyunsaturated fatty acid) trial. Diagnosis and severity of PTSD were assessed 3 months after the accidents using the Clinician-Administered PTSD Scale. The associations of glutamate levels and the glutamine/glutamate ratio with diagnosis and severity of PTSD and MDD were investigated by univariate and multiple linear regression analyses. Ninety-seven of 110 participants (88 %) completed assessments at 3 months. Serum glutamate levels were significantly higher for participants with full or partial PTSD than for participants without PTSD (p = 0.049) and for participants with MDD than for participants without MDD (p = 0.048). Multiple linear regression analyses showed serum glutamate levels were significantly positively associated with PTSD severity (p = 0.02) and MDD severity (p = 0.03). The glutamine/glutamate ratio was also significantly inversely associated with PTSD severity (p = 0.03), but not with MDD severity (p = 0.07). These findings suggest that the glutamatergic system may play a major role in the pathogenesis of PTSD and the need for new treatments targeting the glutamatergic system to be developed for PTSD.

  11. Spectrum of Cytogenomic Abnormalities Revealed by Array Comparative Genomic Hybridization on Products of Conception Culture Failure and Normal Karyotype Samples.

    Science.gov (United States)

    Zhou, Qinghua; Wu, Shen-Yin; Amato, Katherine; DiAdamo, Autumn; Li, Peining

    2016-03-20

    Approximately 30% of pregnancies after implantation end up in spontaneous abortions, and 50% of them are caused by chromosomal abnormalities. However, the spectrum of genomic copy number variants (CNVs) in products of conception (POC) and the underlying gene-dosage-sensitive mechanisms causing spontaneous abortions remain largely unknown. In this study, array comparative genomic hybridization (aCGH) analysis was performed as a salvage procedure for 128 POC culture failure (POC-CF) samples and as a supplemental procedure for 106 POC normal karyotype (POC-NK) samples. Chromosomal abnormalities were detected in 10% of POC-CF and pathogenic CNVs were detected in 3.9% of POC-CF and 5.7% of POC-NK samples. Compiled results from this study and relevant case series through a literature review demonstrated an abnormality detection rate (ADR) of 35% for chromosomal abnormalities in POC-CF samples, 3.7% for pathogenic CNVs in POC-CF samples, and 4.6% for pathogenic CNVs in POC-NK samples. Ingenuity Pathway Analysis (IPA) was performed on the genes from pathogenic CNVs found in POC samples. The denoted primary gene networks suggested that apoptosis and cell proliferation pathways are involved in miscarriage. In summary, a similar spectrum of cytogenomic abnormalities was observed in POC culture success and POC-CF samples. A threshold effect correlating the number of dosage-sensitive genes in a chromosome with the observed frequency of autosomal trisomy is proposed. A rationalized approach using firstly fluorescence in situ hybridization (FISH) testing with probes of chromosomes X/Y/18, 13/21, and 15/16/22 for common aneuploidies and polyploidies and secondly aCGH for other cytogenomic abnormalities is recommended for POC-CF samples. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  12. Body mass index in early adulthood and colorectal cancer risk for carriers and non-carriers of germline mutations in DNA mismatch repair genes.

    Science.gov (United States)

    Win, A K; Dowty, J G; English, D R; Campbell, P T; Young, J P; Winship, I; Macrae, F A; Lipton, L; Parry, S; Young, G P; Buchanan, D D; Martínez, M E; Jacobs, E T; Ahnen, D J; Haile, R W; Casey, G; Baron, J A; Lindor, N M; Thibodeau, S N; Newcomb, P A; Potter, J D; Le Marchand, L; Gallinger, S; Hopper, J L; Jenkins, M A

    2011-06-28

    Carriers of germline mutations in DNA mismatch repair (MMR) genes have a high risk of colorectal cancer (CRC), but the modifiers of this risk are not well established. We estimated an association between body mass index (BMI) in early adulthood and subsequent risk of CRC for carriers and, as a comparison, estimated the association for non-carriers. A weighted Cox regression was used to analyse height and weight at 20 years reported by 1324 carriers of MMR gene mutations (500 MLH1, 648 MSH2, 117 MSH6 and 59 PMS2) and 1219 non-carriers from the Colon Cancer Family Registry. During 122,304 person-years of observation, we observed diagnoses of CRC for 659 carriers (50%) and 36 non-carriers (3%). For carriers, the risk of CRC increased by 30% for each 5 kg m(-2) increment in BMI in early adulthood (hazard ratio, HR: 1.30; 95% confidence interval, CI: 1.08-1.58; P=0.01), and increased by 64% for non-carriers (HR: 1.64; 95% CI: 1.02-2.64; P=0.04) after adjusting for sex, country, cigarette smoking and alcohol drinking (and the MMR gene that was mutated in carriers). The difference in HRs for carriers and non-carriers was not statistically significant (P=0.50). For MLH1 and PMS2 (MutLα heterodimer) mutation carriers combined, the corresponding increase was 36% (HR: 1.36; 95% CI: 1.05-1.76; P=0.02). For MSH2 and MSH6 (MutSα heterodimer) mutation carriers combined, the HR was 1.26 (95% CI: 0.96-1.65; P=0.09). There was no significant difference between the HRs for MutLα and MutSα heterodimer carriers (P=0.56). Body mass index in early adulthood is positively associated with risk of CRC for MMR gene mutation carriers and non-carriers.

  13. Hematological abnormalities and 22q11.2 deletion syndrome

    Directory of Open Access Journals (Sweden)

    Rafael Fabiano Machado Rosa

    2011-01-01

    Full Text Available The 22q11.2 deletion syndrome (22q11DS is a common genetic disease characterized by broad phenotypic variability. Despite the small number of studies describing hematological alterations in individuals with 22q11DS, it appears that these abnormalities are more frequent than previously imagined. Thus, the objective of our study was to report on a patient with 22q11DS presenting thrombocytopenia and large platelets and to review the literature. The patient, a 13-year-old boy, was originally evaluated due to craniofacial dysmorphia and speech delay. He also had a history of behavioral changes, neuropsychomotor delay and recurrent otitis/sinusitis. The identification of a 22q11.2 microdeletion by fluorescent in situ hybridization diagnosed the syndrome. Despite his hematological alterations, he only had a history of epistaxis and bruising of the upper and lower limbs. Assessments of the prothrombin time, thrombin time, partial thromboplastin time, bleeding time, fibrinogen levels and platelet aggregation (including the ristocetin induced platelet aggregation test were all normal. Hematological alterations observed in 22q11DS are directly related to the genetic disorder itself (especially in respect to deletion of the GPIb gene and secondary to some clinical findings, such as immunodeficiency. Macrothrombocytopenia is increasingly being considered a feature of the broad spectrum of 22q11DS and may potentially be a clinical marker for the syndrome.

  14. Abnormal epidermal barrier in the pathogenesis of psoriasis.

    Science.gov (United States)

    Wolf, Ronni; Orion, Edith; Ruocco, Eleonora; Ruocco, Vincenzo

    2012-01-01

    Almost 2 decades ago, Williams and Elias suggested a unifying concept for the pathogenesis of disorders of cornification, according to which the integrity of the epidermal barrier and its effective function is an important factor in the regulation of epidermal DNA synthesis. Interference with the barrier integrity or function will result in epidermal hyperplasia and may be the primary event leading to hyperproliferative skin diseases, such as psoriasis. We have analyzed alterations to several structures of the epidermal barrier that might be responsible for barrier dysfunction and thus lead to hyperproliferation of the epidermis in an attempt to repair the barrier and, as a result, might be inducers of psoriasis. There are several convincing reports indicating that inhibiting of epidermal transglutaminase may lead to epidermal hyperproliferation and that this stimulus might trigger psoriasis among genetically predisposed patients. Disturbance of epidermal barrier function caused by derangement of lipid or cholesterol or ceramide synthesis leads to increased DNA synthesis and epidermal hyperplasia and as a result might be an inducer of psoriasis. We could find little evidence to show that defective defense of the epidermis or an abnormal response of it to bacteria plays a role in the pathogenesis of psoriasis. Accumulating data indicate that there is an association of psoriasis and mutations of genes within the epidermal differentiation complex, which are crucial for the development, maturation, cornification, cross-linking, and terminal differentiation of the epidermis, called psoriasis susceptibility locus 4. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Two abnormalities of hexosaminidase A in clinically normal individuals.

    Science.gov (United States)

    Grebner, E E; Mansfield, D A; Raghavan, S S; Kolodny, E H; d'Azzo, A; Neufeld, E F; Jackson, L G

    1986-01-01

    Two abnormalities of beta-hexosaminidase A (HEX A) activity are described. One, found in two unrelated Jewish children, was characterized by the complete absence of HEX A activity in serum, but low levels of activity in leukocytes and fibroblasts using artificial substrate. The other, found in a non-Jewish man, was characterized by uniformly low levels of HEX A activity in leukocytes, fibroblasts, and serum against artificial substrate. In all cases, the pH optimum of HEX A was normal, there was no increased lability at 37 degrees C, and no inhibitor was detected to account for the deficiency of activity. Cultured fibroblasts of these individuals were capable of synthesizing and processing alpha- and beta-subunits of HEX A and capable of cleaving GM2 ganglioside. The patients, ranging in age from 6 to 30 years, are clinically normal. They are probably genetic compounds carrying the classical Tay-Sachs gene and a differently mutated allele that imparts the anomalous phenotypic features observed. Images Fig. 2 PMID:2939713

  16. Relation of calcitonin gene-related peptide to systemic vasodilatation and central hypovolaemia in cirrhosis

    DEFF Research Database (Denmark)

    Møller, Søren; Bendtsen, Flemming; Schifter, S

    1996-01-01

    BACKGROUND: The aetiology of the reduced systemic vascular resistance and abnormal 'filling' of the vascular bed in cirrhosis is still obscure. As increased concentrations of the potent vasodilator calcitonin gene-related peptide (CGRP) have recently been reported in cirrhosis, we related CGRP......-central blood volume (P abnormal distribution of the blood volume, which may lead to abnormal sodium and water handling....

  17. pitx2 Deficiency results in abnormal ocular and craniofacial development in zebrafish.

    Science.gov (United States)

    Liu, Yi; Semina, Elena V

    2012-01-01

    Human PITX2 mutations are associated with Axenfeld-Rieger syndrome, an autosomal-dominant developmental disorder that involves ocular anterior segment defects, dental hypoplasia, craniofacial dysmorphism and umbilical abnormalities. Characterization of the PITX2 pathway and identification of the mechanisms underlying the anomalies associated with PITX2 deficiency is important for better understanding of normal development and disease; studies of pitx2 function in animal models can facilitate these analyses. A knockdown of pitx2 in zebrafish was generated using a morpholino that targeted all known alternative transcripts of the pitx2 gene; morphant embryos generated with the pitx2(ex4/5) splicing-blocking oligomer produced abnormal transcripts predicted to encode truncated pitx2 proteins lacking the third (recognition) helix of the DNA-binding homeodomain. The morphological phenotype of pitx2(ex4/5) morphants included small head and eyes, jaw abnormalities and pericardial edema; lethality was observed at ∼6-8-dpf. Cartilage staining revealed a reduction in size and an abnormal shape/position of the elements of the mandibular and hyoid pharyngeal arches; the ceratobranchial arches were also decreased in size. Histological and marker analyses of the misshapen eyes of the pitx2(ex4/5) morphants identified anterior segment dysgenesis and disordered hyaloid vasculature. In summary, we demonstrate that pitx2 is essential for proper eye and craniofacial development in zebrafish and, therefore, that PITX2/pitx2 function is conserved in vertebrates.

  18. pitx2 Deficiency results in abnormal ocular and craniofacial development in zebrafish.

    Directory of Open Access Journals (Sweden)

    Yi Liu

    Full Text Available Human PITX2 mutations are associated with Axenfeld-Rieger syndrome, an autosomal-dominant developmental disorder that involves ocular anterior segment defects, dental hypoplasia, craniofacial dysmorphism and umbilical abnormalities. Characterization of the PITX2 pathway and identification of the mechanisms underlying the anomalies associated with PITX2 deficiency is important for better understanding of normal development and disease; studies of pitx2 function in animal models can facilitate these analyses. A knockdown of pitx2 in zebrafish was generated using a morpholino that targeted all known alternative transcripts of the pitx2 gene; morphant embryos generated with the pitx2(ex4/5 splicing-blocking oligomer produced abnormal transcripts predicted to encode truncated pitx2 proteins lacking the third (recognition helix of the DNA-binding homeodomain. The morphological phenotype of pitx2(ex4/5 morphants included small head and eyes, jaw abnormalities and pericardial edema; lethality was observed at ∼6-8-dpf. Cartilage staining revealed a reduction in size and an abnormal shape/position of the elements of the mandibular and hyoid pharyngeal arches; the ceratobranchial arches were also decreased in size. Histological and marker analyses of the misshapen eyes of the pitx2(ex4/5 morphants identified anterior segment dysgenesis and disordered hyaloid vasculature. In summary, we demonstrate that pitx2 is essential for proper eye and craniofacial development in zebrafish and, therefore, that PITX2/pitx2 function is conserved in vertebrates.

  19. Spectrum of temporal bone abnormalities in patients with Waardenburg syndrome and SOX10 mutations.

    Science.gov (United States)

    Elmaleh-Bergès, M; Baumann, C; Noël-Pétroff, N; Sekkal, A; Couloigner, V; Devriendt, K; Wilson, M; Marlin, S; Sebag, G; Pingault, V

    2013-01-01

    Waardenburg syndrome, characterized by deafness and pigmentation abnormalities, is clinically and genetically heterogeneous, consisting of 4 distinct subtypes and involving several genes. SOX10 mutations have been found both in types 2 and 4 Waardenburg syndrome and neurologic variants. The purpose of this study was to evaluate both the full spectrum and relative frequencies of inner ear malformations in these patients. Fifteen patients with Waardenburg syndrome and different SOX10 mutations were studied retrospectively. Imaging was performed between February 2000 and March 2010 for cochlear implant work-up, diagnosis of hearing loss, and/or evaluation of neurologic impairment. Eleven patients had both CT and MR imaging examinations, 3 had MR imaging only, and 1 had CT only. Temporal bone abnormalities were bilateral. The most frequent pattern associated agenesis or hypoplasia of ≥1 semicircular canal, an enlarged vestibule, and a cochlea with a reduced size and occasionally an abnormal shape, but with normal partition in the 13/15 cases that could be analyzed. Three patients lacked a cochlear nerve, bilaterally in 2 patients. In addition, associated abnormalities were found when adequate MR imaging sequences were available: agenesis of the olfactory bulbs (7/8), hypoplastic or absent lacrimal glands (11/14), hypoplastic parotid glands (12/14), and white matter signal anomalies (7/13). In the appropriate clinical context, bilateral agenesis or hypoplasia of the semicircular canals or both, associated with an enlarged vestibule and a cochlear deformity, strongly suggests a diagnosis of Waardenburg syndrome linked to a SOX10 mutation.

  20. Clustered Mutation Signatures Reveal that Error-Prone DNA Repair Targets Mutations to Active Genes.

    Science.gov (United States)

    Supek, Fran; Lehner, Ben

    2017-07-27

    Many processes can cause the same nucleotide change in a genome, making the identification of the mechanisms causing mutations a difficult challenge. Here, we show that clustered mutations provide a more precise fingerprint of mutagenic processes. Of nine clustered mutation signatures identified from >1,000 tumor genomes, three relate to variable APOBEC activity and three are associated with tobacco smoking. An additional signature matches the spectrum of translesion DNA polymerase eta (POLH). In lymphoid cells, these mutations target promoters, consistent with AID-initiated somatic hypermutation. In solid tumors, however, they are associated with UV exposure and alcohol consumption and target the H3K36me3 chromatin of active genes in a mismatch repair (MMR)-dependent manner. These regions normally have a low mutation rate because error-free MMR also targets H3K36me3 chromatin. Carcinogens and error-prone repair therefore redistribute mutations to the more important regions of the genome, contributing a substantial mutation load in many tumors, including driver mutations. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Detection of chromosomal abnormalities, congenital abnormalities and transfusion syndrome in twins

    DEFF Research Database (Denmark)

    Sperling, Lene; Kiil, C; Larsen, L U

    2007-01-01

    observational study were women with twin pregnancies diagnosed before 14 + 6 gestational weeks. The monochorionic pregnancies were scanned every second week until 23 weeks in order to rule out early TTTS. All pregnancies had an anomaly scan in week 19 and fetal echocardiography in week 21 that was performed...... by specialists in fetal echocardiography. Zygosity was determined by DNA analysis in all twin pairs with the same sex. RESULTS: Among the 495 pregnancies the prenatal detection rate for severe structural abnormalities including chromosomal aneuploidies was 83% by the combination of a first-trimester nuchal...... translucency scan and the anomaly scan in week 19. The incidence of severe structural abnormalities was 2.6% and two-thirds of these anomalies were cardiac. There was no significant difference between the incidence in monozygotic and dizygotic twins, nor between twins conceived naturally or those conceived...

  2. Circadian abnormalities in mouse models of Smith-Magenis syndrome: evidence for involvement of RAI1.

    Science.gov (United States)

    Lacaria, Melanie; Gu, Wenli; Lupski, James R

    2013-07-01

    Smith-Magenis syndrome (SMS; OMIM 182290) is a genomic disorder characterized by multiple congenital anomalies, intellectual disability, behavioral abnormalities, and disordered sleep resulting from an ~3.7 Mb deletion copy number variant (CNV) on chromosome 17p11.2 or from point mutations in the gene RAI1. The reciprocal duplication of this region results in another genomic disorder, Potocki-Lupski syndrome (PTLS; OMIM 610883), characterized by autism, intellectual disability, and congenital anomalies. We previously used chromosome-engineering and gene targeting to generate mouse models for PTLS (Dp(11)17/+), and SMS due to either deletion CNV or gene knock-out (Df(11)17-2/+ and Rai1(+/-) , respectively) and we observed phenotypes in these mouse models consistent with their associated human syndromes. To investigate the contribution of individual genes to the circadian phenotypes observed in SMS, we now report the analysis of free-running period lengths in Rai1(+/-) and Df(11)17-2/+ mice, as well as in mice deficient for another known circadian gene mapping within the commonly deleted/duplicated region, Dexras1, and we compare these results to those previously observed in Dp(11)17/+ mice. Reduced free-running period lengths were seen in Df(11)17-2/+, Rai1(+/-) , and Dexras1(-/-) , but not Dexras1(+/-) mice, suggesting that Rai1 may be the primary gene underlying the circadian defects in SMS. However, we cannot rule out the possibility that cis effects between multiple haploinsufficient genes in the SMS critical interval (e.g., RAI1 and DEXRAS1) either exacerbate the circadian phenotypes observed in SMS patients with deletions or increase their penetrance in certain environments. This study also confirms a previous report of abnormal circadian function in Dexras1(-/-) mice. Copyright © 2013 Wiley Periodicals, Inc.

  3. The mutational oncoprint of recurrent cytogenetic abnormalities in adult patients with de novo acute myeloid leukemia.

    Science.gov (United States)

    Eisfeld, A-K; Mrózek, K; Kohlschmidt, J; Nicolet, D; Orwick, S; Walker, C J; Kroll, K W; Blachly, J S; Carroll, A J; Kolitz, J E; Powell, B L; Wang, E S; Stone, R M; de la Chapelle, A; Byrd, J C; Bloomfield, C D

    2017-10-01

    Recurrent chromosomal abnormalities and gene mutations detected at the time of diagnosis of acute myeloid leukemia (AML) are associated with particular disease features, treatment response and survival of AML patients, and are used to denote specific disease entities in the World Health Organization classification of myeloid neoplasms and acute leukemia. However, large studies that integrate cytogenetic and comprehensive mutational information are scarce. We created a comprehensive oncoprint of mutations associated with recurrent cytogenetic findings by combining the information on mutational patterns of 80 cancer- and leukemia-associated genes with cytogenetic findings in 1603 adult patients with de novo AML. We show unique differences in the mutational profiles among major cytogenetic subsets, identify novel associations between recurrent cytogenetic abnormalities and both specific gene mutations and gene functional groups, and reveal differences in cytogenetic and mutational features between patients younger than 60 years and those aged 60 years or older. The identified associations between cytogenetic and molecular genetic data may help guide mutation testing in AML, and result in more focused application of targeted therapy in patients with de novo AML.

  4. Imaging Characteristics of Venous Parenchymal Abnormalities.

    Science.gov (United States)

    Arnoux, Audrey; Triquenot-Bagan, Aude; Andriuta, Daniela; Wallon, David; Guegan-Massardier, Evelyne; Leclercq, Claire; Martinaud, Olivier; Castier-Amouyel, Mélody; Godefroy, Olivier; Bugnicourt, Jean-Marc

    2017-12-01

    There are few published data on the patterns of parenchymal imaging abnormalities in a context of cerebral venous thrombosis (CVT). The objectives of the present study were to describe the patterns of parenchymal lesions associated with CVT and to determine the lesion sites. We included 44 consecutively hospitalized patients with CVT and parenchymal lesions on magnetic resonance imaging. The diagnosis of CVT had been confirmed by magnetic resonance imaging/magnetic resonance venography. Magnetic resonance imaging patterns for CVT were retrospectively analyzed with regard to the lesion's type, shape, and site. The most frequent stroke subtype was hemorrhagic ischemia (in 56.8% of cases), followed by intracerebral hematoma (in 22.72% of cases) and nonhemorrhagic ischemia (in 20.45% of cases). Although there were no significant differences between these 3 groups with regard to the clinical and radiological characteristics, we observed a nonsignificant trend ( P =0.08) toward a shorter time interval between hospital admission and magnetic resonance imaging for nonhemorrhagic stroke. The CVT parenchymal abnormalities were centered on 6 main foci and were related to the site of venous occlusion: (1) the inferior parietal lobule (n=20; 44.5%), associated mainly with occlusion of the transverse sinus (n=10) or pure cortical veins (n=10); (2) the inferior and posterior temporal regions (n=10; 22.75%), associated mainly with occlusion of the transverse sinus (n=9); (3) the parasagittal frontal region (n=6; 13.6%), associated mainly with occlusion of the superior sagittal sinus (n=4) or the transverse sinus (n=4); (4) the thalamus (n=5; 11.3%) associated with occlusion of the straight sinus (n=5); (5) the cerebellar hemisphere (n=2; 4.5%), associated in both cases with occlusion of the transverse sinus; and (6) the deep hemispheric regions (n=3; 6.8%), associated with occlusion of the superior sagittal sinus in all cases. Parenchymal lesions caused by CVT display specific

  5. Antenatal diagnosis and management of urinary abnormalities.

    Science.gov (United States)

    Colodny, A H

    1987-10-01

    Although much time, effort, and money have been expended in the area of fetal surgery and even though considerable unfortunate media publicity has resulted, the actual clinical problem is not one of great magnitude. Currently all those interested in this area agree that consideration of any intrauterine manipulation or surgery should be reserved for a fetus who has bilateral involvement that is progressive, destructive, and associated with oligohydramnios. Except for rare instances, this eliminates all fetuses except those with some type of urethral obstruction. Significant urethral obstruction accounts for approximately 10 per cent of all patients who have a prenatal diagnosis of a urologic abnormality. Of this 10 per cent, some will not be progressive, some will not be destructive, some will not involve both kidneys, and some will not develop oligohydramnios. Some of these patients will be diagnosed early enough in pregnancy to allow termination of the pregnancy if the involvement is significant and if termination is acceptable to the family. Some will be diagnosed late enough in pregnancy so that if the lungs are mature or can be stimulated to mature, early delivery and postnatal management can be elected. Some will have other associated lethal anomalies that can be diagnosed and would preclude any consideration of intrauterine manipulation or therapy. Some will have irreversible renal failure. Occasionally, the mother may refuse any proposed intrauterine therapy. Thus we are probably considering, on a theoretic basis, well under 1 per cent of all fetuses who have a prenatal diagnosis of urologic abnormalities. There may be some unusual situations that justify intrauterine manipulation. One that we encountered involved a fetus with an abdominal mass so large that a cesarean section was deemed necessary (Figs. 12 and 13). Aspiration of the mass just before delivery was performed to allow a vaginal delivery. Another case involved a pregnant woman who developed

  6. Electrocardiogram Abnormalities and Coronary Calcification in Postmenopausal Women

    Directory of Open Access Journals (Sweden)

    Siamak Sabour

    2010-03-01

    Results: LVH was found in 2.7% (n = 15 of the women. The prevalence of T-axis abnormality was 6% (n = 34, whereas 8.5% (n = 48 had a QRS-T angle abnormality. CAC was found in 62% of the women. Compared to women with a normal T-axis, women with borderline or abnormal T-axes were 3.8 fold more likely to have CAC (95% CI: 1.4-10.2. Similarly, compared to women with a normal QRS-T angle, in women with borderline or abnormal QRS-T angle, CAC was 2.0 fold more likely to be present (95% CI: 1.0-4.1. Conclusion: Among women with ECG abnormalities reflecting subclinical ischemia, CAC is commonly found and may in part explain the increased coronary heart disease risk associated with these ECG abnormalities.

  7. Abnormality degree detection method using negative potential field group detectors

    Science.gov (United States)

    Zhang, Hongli; Liu, Shulin; Li, Dong; Shi, Kunju; Wang, Bo; Cui, Jiqiang

    2015-09-01

    Online monitoring methods have been widely used in many major devices, however the normal and abnormal states of equipment are estimated mainly based on the monitoring results whether monitored parameters exceed the setting thresholds. Using these monitoring methods may cause serious false positive or false negative results. In order to precisely monitor the state of equipment, the problem of abnormality degree detection without fault sample is studied with a new detection method called negative potential field group detectors(NPFG-detectors). This method achieves the quantitative expression of abnormality degree and provides the better detection results compared with other methods. In the process of Iris data set simulation, the new algorithm obtains the successful results in abnormal detection. The detection rates for 3 types of Iris data set respectively reach 100%, 91.6%, and 95.24% with 50% training samples. The problem of Bearing abnormality degree detection via an abnormality degree curve is successfully solved.

  8. Chromosomal Abnormalities in Offspring of Young Cancer Survivors

    DEFF Research Database (Denmark)

    Nielsen, Betina Frydenlund; Schmidt, Anne Aarslev; Mulvihill, John J

    2018-01-01

    Danish cancer survivors and 40 859 offspring (40 794 live-born children and 65 fetuses) of 19 536 siblings. Chromosomal abnormalities include numeric and structural abnormalities. Odds ratios were estimated by multiple logistic regression models comparing the risk of chromosomal abnormalities among...... compared with their siblings' offspring (odds ratio = 0.99, 95% confidence interval = 0.67 to 1.44, two-sided P = .94), with similar risk between male and female survivors. Cancer survivors were not more likely than their siblings to have children with a chromosomal abnormality.......To examine whether cancer survivors diagnosed before age 35 years are more likely to have offspring with chromosomal abnormalities than their siblings, chromosomal abnormalities were determined in a population-based cohort of 14 611 offspring (14 580 live-born children and 31 fetuses) of 8945...

  9. Incidence of fetal chromosome abnormalities in insulin dependent diabetic women

    DEFF Research Database (Denmark)

    Henriques, C U; Damm, P; Tabor, A

    1991-01-01

    In order to screen for fetal neural tube defects and chromosome abnormalities, amniocentesis was carried out in 334 women with insulin-dependent diabetes mellitus (IDDM) between 1979 and 1987. Two cases (0.6%; 95% confidence limits 0.1-2.2%) of fetal chromosome abnormality were found: one case...... of Klinefelter's syndrome and one case of de novo translocation. This is comparable to the overall incidence of chromosome abnormality found at birth and is also comparable to the incidence of fetal chromosome abnormality (1.0%) found by amniocentesis at our Department in a group of 2,264 young non......-diabetic women with little risk of contracting genetic disorders. The results suggest that maternal IDDM does not increase the risk of fetal chromosome abnormality and consequently screening by amniocentesis for chromosome abnormalities among diabetic women does not seem to be indicated....

  10. The time of onset of abnormal calcification in spondylometaepiphyseal dysplasia, short limb-abnormal calcification type.

    Science.gov (United States)

    Tüysüz, Beyhan; Gazioğlu, Nurperi; Ungür, Savaş; Aji, Dolly Yafet; Türkmen, Seval

    2009-01-01

    A 1-month-old boy with shortness of extremities on prenatal US was referred to our department with a provisional diagnosis of achondroplasia. His height was normal but he had short extremities and platyspondyly, premature carpal epiphyses on both hands, and short tubular bones with irregular metaphyses on radiographs. Re-evaluation of the patient at the age of 1 year revealed very short height and premature calcification of the costal cartilages and epiphyses. Spondylometaepiphyseal dysplasia (SMED), short limb-abnormal calcification type was diagnosed. This condition is a very rare autosomal recessively inherited disorder, and most of the patients die in early childhood due to neurological involvement. At the age of 2 years and 5 months, a CT scan showed narrowing of the cervical spinal canal. One month later he died suddenly because of spinal cord injury. In conclusion early diagnosis is very important because the recurrence risk is high and patients may die due to early neurological complications. The time of onset of abnormal calcifications, a diagnostic finding of the disease, is at the age of around 1 year in most patients. When abnormal calcifications are not yet present, but radiological changes associated with SMED are present, this rare disease must be considered.

  11. The time of onset of abnormal calcification in spondylometaepiphyseal dysplasia, short limb-abnormal calcification type

    Energy Technology Data Exchange (ETDEWEB)

    Tueysuez, Beyhan [Istanbul University, Department of Pediatric Genetics, Cerrahpasa Medical School, Istanbul (Turkey); Gazioglu, Nurperi [Istanbul University, Department of Neurosurgery, Cerrahpasa Medical School, Istanbul (Turkey); Uenguer, Savas [Istanbul University, Department of Pediatric Radiology, Cerrahpasa Medical School, Istanbul (Turkey); Aji, Dolly Yafet [Istanbul University, Department of Pediatrics, Cerrahpasa Medical School, Istanbul (Turkey); Tuerkmen, Seval [Istanbul University, Department of Pediatric Genetics, Cerrahpasa Medical School, Istanbul (Turkey); Universitatsklinikum Berlin, Charite Virchow-Klinik, Berlin (Germany)

    2009-01-15

    A 1-month-old boy with shortness of extremities on prenatal US was referred to our department with a provisional diagnosis of achondroplasia. His height was normal but he had short extremities and platyspondyly, premature carpal epiphyses on both hands, and short tubular bones with irregular metaphyses on radiographs. Re-evaluation of the patient at the age of 1 year revealed very short height and premature calcification of the costal cartilages and epiphyses. Spondylometaepiphyseal dysplasia (SMED), short limb-abnormal calcification type was diagnosed. This condition is a very rare autosomal recessively inherited disorder, and most of the patients die in early childhood due to neurological involvement. At the age of 2 years and 5 months, a CT scan showed narrowing of the cervical spinal canal. One month later he died suddenly because of spinal cord injury. In conclusion early diagnosis is very important because the recurrence risk is high and patients may die due to early neurological complications. The time of onset of abnormal calcifications, a diagnostic finding of the disease, is at the age of around 1 year in most patients. When abnormal calcifications are not yet present, but radiological changes associated with SMED are present, this rare disease must be considered. (orig.)

  12. A comparison of 12-gene colon cancer assay gene expression in African American and Caucasian patients with stage II colon cancer.

    Science.gov (United States)

    Govindarajan, Rangaswamy; Posey, James; Chao, Calvin Y; Lu, Ruixiao; Jadhav, Trafina; Javed, Ahmed Y; Javed, Awais; Mahmoud, Fade A; Osarogiagbon, Raymond U; Manne, Upender

    2016-06-18

    African American (AA) colon cancer patients have a worse prognosis than Caucasian (CA) colon cancer patients, however, reasons for this disparity are not well understood. To determine if tumor biology might contribute to differential prognosis, we measured recurrence risk and gene expression using the Oncotype DX® Colon Cancer Assay (12-gene assay) and compared the Recurrence Score results and gene expression profiles between AA patients and CA patients with stage II colon cancer. We retrieved demographic, clinical, and archived tumor tissues from stage II colon cancer patients at four institutions. The 12-gene assay and mismatch repair (MMR) status were performed by Genomic Health (Redwood City, California). Student's t-test and the Wilcoxon rank sum test were used to compare Recurrence Score data and gene expression data from AA and CA patients (SAS Enterprise Guide 5.1). Samples from 122 AA and 122 CA patients were analyzed. There were 118 women (63 AA, 55 CA) and 126 men (59 AA, 67 CA). Median age was 66 years for AA patients and 68 for CA patients. Age, gender, year of surgery, pathologic T-stage, tumor location, the number of lymph nodes examined, lymphovascular invasion, and MMR status were not significantly different between groups (p = 0.93). The mean Recurrence Score result for AA patients (27.9 ± 12.8) and CA patients (28.1 ± 11.8) was not significantly different and the proportions of patients with high Recurrence Score values (≥41) were similar between the groups (17/122 AA; 15/122 CA). None of the gene expression variables, either single genes or gene groups (cell cycle group, stromal group, BGN1, FAP, INHBA1, Ki67, MYBL2, cMYC and GADD45B), was significantly different between the racial groups. After controlling for clinical and pathologic covariates, the means and distributions of Recurrence Score results and gene expression profiles showed no statistically significant difference between patient groups. The distribution of

  13. A comparison of 12-gene colon cancer assay gene expression in African American and Caucasian patients with stage II colon cancer

    International Nuclear Information System (INIS)

    Govindarajan, Rangaswamy; Posey, James; Chao, Calvin Y.; Lu, Ruixiao; Jadhav, Trafina; Javed, Ahmed Y.; Javed, Awais; Mahmoud, Fade A.; Osarogiagbon, Raymond University; Manne, Upender

    2016-01-01

    African American (AA) colon cancer patients have a worse prognosis than Caucasian (CA) colon cancer patients, however, reasons for this disparity are not well understood. To determine if tumor biology might contribute to differential prognosis, we measured recurrence risk and gene expression using the Oncotype DX® Colon Cancer Assay (12-gene assay) and compared the Recurrence Score results and gene expression profiles between AA patients and CA patients with stage II colon cancer. We retrieved demographic, clinical, and archived tumor tissues from stage II colon cancer patients at four institutions. The 12-gene assay and mismatch repair (MMR) status were performed by Genomic Health (Redwood City, California). Student’s t-test and the Wilcoxon rank sum test were used to compare Recurrence Score data and gene expression data from AA and CA patients (SAS Enterprise Guide 5.1). Samples from 122 AA and 122 CA patients were analyzed. There were 118 women (63 AA, 55 CA) and 126 men (59 AA, 67 CA). Median age was 66 years for AA patients and 68 for CA patients. Age, gender, year of surgery, pathologic T-stage, tumor location, the number of lymph nodes examined, lymphovascular invasion, and MMR status were not significantly different between groups (p = 0.93). The mean Recurrence Score result for AA patients (27.9 ± 12.8) and CA patients (28.1 ± 11.8) was not significantly different and the proportions of patients with high Recurrence Score values (≥41) were similar between the groups (17/122 AA; 15/122 CA). None of the gene expression variables, either single genes or gene groups (cell cycle group, stromal group, BGN1, FAP, INHBA1, Ki67, MYBL2, cMYC and GADD45B), was significantly different between the racial groups. After controlling for clinical and pathologic covariates, the means and distributions of Recurrence Score results and gene expression profiles showed no statistically significant difference between patient groups. The distribution of Recurrence Score

  14. Adenosine deaminase organic effect in normal and abnormal cerebrospinal fluid

    International Nuclear Information System (INIS)

    Hamad, A.M.; Samarai, M.A.

    2007-01-01

    To study the effect of the organic substances on adenosine deaminase (ADA) activity in normal and abnormal cerebrospinal fluid (CSF). Various concentrations of 2-mercaptopurine, Ame-tycine, Adenosine analogues (Guanine, Thymine) and ATP were tested to see their effect on ADA activity in normal and abnormal CSF. ADA activity in normal and abnormal CSF was remarkably decreased with the increasing of concentrations of substances tested. These effects may have important therapeutic implications. (author)

  15. Brain MRI abnormalities in neuromyelitis optica

    Energy Technology Data Exchange (ETDEWEB)

    Wang Fei, E-mail: feiwang1973@gmail.com [Department of Radiology, Xuanwu Hospital, Capital University of Medical Sciences, 45 Chang-Chun St, Xuanwu District, Beijing 100053 (China); Liu Yaou, E-mail: asiaeurope80@gmail.com [Department of Radiology, Xuanwu Hospital, Capital University of Medical Sciences, 45 Chang-Chun St, Xuanwu District, Beijing 100053 (China); Duan Yunyun, E-mail: duanyun2003@sohu.com [Department of Radiology, Xuanwu Hospital, Capital University of Medical Sciences, 45 Chang-Chun St, Xuanwu District, Beijing 100053 (China); Li Kuncheng, E-mail: kunchengli@yahoo.com.cn [Department of Radiology, Xuanwu Hospital, Capital University of Medical Sciences, 45 Chang-Chun St, Xuanwu District, Beijing 100053 (China); Education Ministry Key Laboratory for Neurodegenerative Disease, Xuanwu Hospital, Capital University of Medical Sciences, 45 Chang-Chun St, Xuanwu District, Beijing 100053 (China)

    2011-11-15

    Objective: The purpose of this study was to explore brain MRI findings in neuromyelitis optica (NMO) and to investigate specific brain lesions with respect to the localization of aquaporin-4 (AQP-4). Materials and methods: Forty admitted patients (36 women) who satisfied the 2006 criteria of Wingerchuk et al. for NMO were included in this study. All patients received a neurological examination and MRI scanning including brain and spinal cord. MRIs were classified as normal, nonspecific, multiple sclerosis-like, typical abnormalities. MS-like lesions were too few to satisfy the Barkhof et al. criteria for MS. Confluent lesions involving high AQP-4 regions were considered typical. Non-enhancing deep white matter lesions other than MS-like lesions or typical lesions were classified as nonspecific. Results: Brain MRI lesions were delineated in 12 patients (25%). Four patients (10%) had hypothalamus, brainstem or periventricle lesions. Six (15%) patients were nonspecific, and 2 (5%) patients had multiple sclerosis-like lesions. Conclusion: Brain MRIs are negative in most NMO, and brain lesions do not exclude the diagnosis of NMO. Hypothalamus, brainstem or periventricle lesions, corresponding to high sites of AQP-4 in the brain, are indicative of lesions of NMO.

  16. Pathophysiology of somatosensory abnormalities in Parkinson disease.

    Science.gov (United States)

    Conte, Antonella; Khan, Nashaba; Defazio, Giovanni; Rothwell, John C; Berardelli, Alfredo

    2013-12-01

    Changes in sensory function that have been described in patients with Parkinson disease (PD) can be either 'pure' disorders of conscious perception such as elevations in sensory threshold, or disorders of sensorimotor integration, in which the interaction between sensory input and motor output is altered. In this article, we review the extensive evidence for disrupted tactile, nociceptive, thermal and proprioceptive sensations in PD, as well as the influences exerted on these sensations by dopaminergic therapy and deep brain stimulation. We argue that abnormal spatial and temporal processing of sensory information produces incorrect signals for the preparation and execution of voluntary movement. Sensory deficits are likely to be a consequence of the dopaminergic denervation of the basal ganglia that is the hallmark of PD. A possible mechanism to account for somatosensory deficits is one in which disease-related dopaminergic denervation leads to a loss of response specificity, resulting in transmission of noisier and less-differentiated information to cortical regions. Changes in pain perception might have a different explanation, possibly involving disease-related effects outside the basal ganglia, including involvement of peripheral pain receptors, as well as structures such as the periaqueductal grey matter and non-dopaminergic neurotransmitter systems.

  17. Electroencephalographic abnormalities in antisocial personality disorder.

    Science.gov (United States)

    Calzada-Reyes, Ana; Alvarez-Amador, Alfredo; Galán-García, Lídice; Valdés-Sosa, Mitchell

    2012-01-01

    The presence of brain dysfunction in violent offenders has been frequently examined with inconsistent results. The aim of the study was to assess the EEG of 84 violent offenders by visual inspection and frequency-domain quantitative analysis in 84 violent prisoners. Low-resolution electromagnetic tomography (LORETA) was also employed for theta band of the EEG spectra. Antisocial personality disorder (ASPD) was present in 50 of the offenders and it was absent in the remaining 34. The prevalence of EEG abnormalities, by visual inspection, was similar for both the ASPD group (82%) and non-ASPD group (79%). The brain topography of these anomalies also did not differ between groups, in contrast to results of the EEG quantitative analysis (QEEG) and LORETA that showed remarkable regional differences between both groups. QEEG analysis showed a pattern of excess of theta-delta activities and decrease of alpha band on the right fronto-temporal and left temporo-parietal regions in the ASPD group. LORETA signified an increase of theta activity (5.08 Hz) in ASPD group relative to non-ASPD group within left temporal and parietal regions. Findings indicate that QEEG analysis and techniques of source localization may reveal differences in brain electrical activity among offenders with ASPD, which was not obvious to visual inspection. Copyright © 2011 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  18. Abnormal parietal function in conversion paresis.

    Directory of Open Access Journals (Sweden)

    Marije van Beilen

    Full Text Available The etiology of medically unexplained symptoms such as conversion disorder is poorly understood. This is partly because the interpretation of neuroimaging results in conversion paresis has been complicated by the use of different control groups, tasks and statistical comparisons. The present study includes these different aspects in a single data set. In our study we included both normal controls and feigners to control for conversion paresis. We studied both movement execution and imagery, and we contrasted both within-group and between-group activation. Moreover, to reveal hemisphere-specific effects that have not been reported before, we performed these analyses using both flipped and unflipped data. This approach resulted in the identification of abnormal parietal activation which was specific for conversion paresis patients. Patients also showed reduced activity in the prefrontal cortex, supramarginal gyrus and precuneus, including hemisphere-specific activation that is lateralized in the same hemisphere, regardless of right- or left-sided paresis. We propose that these regions are candidates for an interface between psychological mechanisms and disturbed higher-order motor control. Our study presents an integrative neurophysiological view of the mechanisms that contribute to the etiology of this puzzling psychological disorder, which can be further investigated with other types of conversion symptoms.

  19. Salivary abnormalities in Prader-Willi Syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Hart, S.; Poshva, C. [Bowman Gray School of Medicine, Winston-Salem, NC (United States)

    1994-09-01

    Although abnormal saliva is a well documented finding in PWS, little is known about the saliva in these individuals. We have recently undertaken a study to characterize the salivary composition from PW patients and to see if there is any correlation with their underlying molecular diagnosis (deletion vs. disomy). We have collected whole saliva on 3 patients; 2 had normal high-resolution karyotype analysis (Cases 1 & 3) and 1 had a deletion of 15q11q13 (Case 3). For all parameters, Case 3`s values were notably different from those of his unaffected sibling. The salivary flow rates and concentrations for all 3 PW patients are similar and are significantly different from normal controls (mean {plus_minus} SE) (p<0.05). Although this data is from only 3 PW patients, it provides valuable information. First, decreased flow appears to be due to an effect of PWS and not medications since Cases 2 & 3 are not on any medications. Second, decreased flow appears to be present in younger as well as older individuals. Third, deviations from normal in the salivary composition are evident. It is possible that these alterations are concentration effects relative to a decrease in flow rate. We are currently obtaining saliva from more PW individuals to see if these alterations are present in all PW patients and whether they can be applied as a screening test.

  20. Imaging findings in fetal diaphragmatic abnormalities

    Energy Technology Data Exchange (ETDEWEB)

    Alamo, Leonor; Gudinchet, Francois [University Hospital Center of Lausanne, Unit of Radiopediatrics, Department of Radiology, Lausanne (Switzerland); Meuli, Reto [University Hospital Center of Lausanne, Department of Radiology, Lausanne (Switzerland)

    2015-12-15

    Imaging plays a key role in the detection of a diaphragmatic pathology in utero. US is the screening method, but MRI is increasingly performed. Congenital diaphragmatic hernia is by far the most often diagnosed diaphragmatic pathology, but unilateral or bilateral eventration or paralysis can also be identified. Extralobar pulmonary sequestration can be located in the diaphragm and, exceptionally, diaphragmatic tumors or secondary infiltration of the diaphragm from tumors originating from an adjacent organ have been observed in utero. Congenital abnormalities of the diaphragm impair normal lung development. Prenatal imaging provides a detailed anatomical evaluation of the fetus and allows volumetric lung measurements. The comparison of these data with those from normal fetuses at the same gestational age provides information about the severity of pulmonary hypoplasia and improves predictions about the fetus's outcome. This information can help doctors and families to make decisions about management during pregnancy and after birth. We describe a wide spectrum of congenital pathologies of the diaphragm and analyze their embryological basis. Moreover, we describe their prenatal imaging findings with emphasis on MR studies, discuss their differential diagnosis and evaluate the limits of imaging methods in predicting postnatal outcome. (orig.)