Major Superficial White Matter Abnormalities in Huntington's Disease
Phillips, Owen R.; Joshi, Shantanu H.; Squitieri, Ferdinando; Sanchez-Castaneda, Cristina; Narr, Katherine; Shattuck, David W.; Caltagirone, Carlo; Sabatini, Umberto; Di Paola, Margherita
2016-01-01
Background: The late myelinating superficial white matter at the juncture of the cortical gray and white matter comprising the intracortical myelin and short-range association fibers has not received attention in Huntington's disease. It is an area of the brain that is late myelinating and is sensitive to both normal aging and neurodegenerative disease effects. Therefore, it may be sensitive to Huntington's disease processes. Methods: Structural MRI data from 25 Pre-symptomatic subjects, 24 Huntington's disease patients and 49 healthy controls was run through a cortical pattern-matching program. The surface corresponding to the white matter directly below the cortical gray matter was then extracted. Individual subject's Diffusion Tensor Imaging (DTI) data was aligned to their structural MRI data. Diffusivity values along the white matter surface were then sampled at each vertex point. DTI measures with high spatial resolution across the superficial white matter surface were then analyzed with the General Linear Model to test for the effects of disease. Results: There was an overall increase in the axial and radial diffusivity across much of the superficial white matter (p < 0.001) in Pre-symptomatic subjects compared to controls. In Huntington's disease patients increased diffusivity covered essentially the whole brain (p < 0.001). Changes are correlated with genotype (CAG repeat number) and disease burden (p < 0.001). Conclusions: This study showed broad abnormalities in superficial white matter even before symptoms are present in Huntington's disease. Since, the superficial white matter has a unique microstructure and function these abnormalities suggest it plays an important role in the disease. PMID:27242403
Borio, Stefano; Colombo, Silvia; La Rosa, Giuseppe; De Lucia, Michela; Damborg, Peter; Guardabassi, Luca
2015-10-01
There is a lack of studies comparing topical antiseptics to systemic antibiotics in the treatment of canine superficial pyoderma. To compare the efficacy of topical chlorhexidine with systemic amoxicillin-clavulanic acid for the treatment of canine superficial pyoderma. A randomized controlled trial was conducted in dogs with superficial pyoderma. Group T (n = 31) was treated topically with 4% chlorhexidine digluconate shampoo (twice weekly) and solution (once daily) for 4 weeks. Group S (n = 20) was treated orally with amoxicillin-clavulanic acid (25 mg/kg) twice daily for 4 weeks. Bacterial culture and susceptibility testing were performed on clinical specimens collected before treatment. Severity of lesions and number of intracellular bacteria were evaluated using four-point scales to calculate a total pyoderma score for each dog. Pruritus was assessed by owners using a visual analog scale (range 0-10). Scores were analysed for statistical differences between groups T and S. Staphylococcus pseudintermedius was isolated from 48 dogs, including eight meticillin-resistant strains (MRSP). Although the number of dogs was small, no significant differences in pyoderma and pruritus scores were observed between groups throughout the study except for day 1, when group S had a significantly higher total score than group T (P = 0.03). Treatment with chlorhexidine products resulted in resolution of clinical signs in all dogs including those infected with MRSP. Topical therapy with chlorhexidine digluconate products may be as effective as systemic therapy with amoxicillin-clavulanic acid. This finding supports the current recommendations to use topical antiseptics alone for the management of superficial pyoderma. © 2015 The Authors. Veterinary Dermatology published by John Wiley & Sons Ltd on behalf of the ESVD and ACVD.
Reimann-Berg, N; Murua Escobar, H; Kiefer, Y; Mischke, R; Willenbrock, S; Eberle, N; Nolte, I; Bullerdiek, J
2011-01-01
Human and canine lymphoid neoplasms are characterized by non-random cytogenetic abnormalities. However, due to the low mitotic activity of the B cells, cytogenetic analyses of B-cell lymphoid proliferations are difficult to perform. In the present study we stimulated canine B-cell lymphoma cells with the immunostimulatory CpG-oligonucleotide DSP30 in combination with interleukin-2 (IL-2) and obtained an adequate number of metaphases. Cytogenetic analyses revealed the loss of one X chromosome as the sole cytogenetic aberration. Chromosome analysis of the corresponding blood showed a normal female karyotype. Monosomy X as the sole clonal chromosomal abnormality is found in human hematopoietic malignancies as well, thus the dog may serve as a promising animal model. Copyright © 2011 S. Karger AG, Basel.
Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.
Directory of Open Access Journals (Sweden)
Da-Wei Yao
2014-06-01
Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.
Directory of Open Access Journals (Sweden)
Vânia Pais Cabral
2005-04-01
Full Text Available The lacrimal and third eyelid superficial glands produce the aqueous component of the preocular tear film. In this research, morphologic and morphometric assessments of the parenchyma and stroma of both lacrimal glands of healthy adult mongrel dogs were performed. Both lacrimal and third eyelid glands of fourteen dogs were collected, summing fifty-six samples. The macroscopic and morphometric data were statistically analyzed, according to the glandular type (lacrimal and third eyelid superficial glands and sexual dimorphism (male or female. The lacrimal glands were significantly larger and longer than the superficial glands of the third eyelid. Expressive morphometric differences of interlobular duct, lymphocytic infiltration, interlobular vessels and secretory parenchyma between the two glandular types were encountered. The lacrimal glands from the male subjects were significantly larger than those from female ones, as well as the superficial glands of the third eyelid were thicker. The higher lymphocyte infiltration and poorer secretor parenchyma in female dogs may be one of the reasons for the higher incidence of keratoconjunctiviti sicca (KCS in such canine population.As glândulas lacrimal e superficial da terceira pálpebra atuam produzindo o componente aquoso do filme lacrimal. Nesta pesquisa, estudaram-se aspectos morfológicos e morfométricos do parênquima e do estroma de ambas as glândulas em cães mestiços, hígidos, adultos (machos ou fêmeas. As glândulas lacrimal e superficial da terceira pálpebra de 14 cães foram colhidas, totalizando 56 amostras. Foram estudadas, à estatística, as variáveis macroscópicas e morfométricas, comparando-as quanto ao tipo glandular (lacrimal e superficial da terceira pálpebra e quanto ao dimorfismo sexual (macho e fêmea. Às glândulas lacrimais foram significativamente maiores comparativamente as superficiais da terceira pálpebra. Foram evidenciados diferenças morfom
Genomic instability and telomere fusion of canine osteosarcoma cells.
Directory of Open Access Journals (Sweden)
Junko Maeda
Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.
Grozdanic, Sinisa D; Kecova, Helga; Lazic, Tatjana
2013-09-01
To develop fast and reliable testing routines for diagnosing retina and optic nerve diseases in canine cataract patients based on chromatic properties of the pupillary light reflex response. Seventy-seven canine patients with a history of cataract and decreased vision (43 patients with cataracts and no evidence of retina or optic nerve disease, 21 patients with cataracts and retinal degeneration [RD], 13 patients with cataracts and retinal detachment [RDT]), 11 canine patients with optic neuritis (ON) and 23 healthy dogs were examined using chromatic pupillary light reflex (cPLR) analysis with red and blue light and electroretinography. Electroretinography analysis showed statistically significant deficits in a- and b-wave amplitudes in dogs with cataracts and RD, or cataracts and RDT, when compared to dogs with cataracts without evidence of retinal abnormalities. Evaluation of b-wave amplitudes showed that presence of 78.5-μV (or lower) amplitudes had high sensitivity of 100% (95% CI: 87.2-100%) and high specificity of 96.7% (95% CI: 88.4-100%) in RD and RDT. Evaluation of cPLR responses using red light showed that presence of the pupil end constriction diameter of 5.5 mm (or higher) had moderately high sensitivity of 76.5% (95% CI: 50.1-93.2%) and high specificity of 100% (95% CI: 91.2-100%) in detecting RD and RDT. Optic neuritis patients had absent cPLR responses, regardless of the visual status. Chromatic evaluation of the pupillary light reflex is a rapid and accurate test for diagnosing retina and optic nerve diseases in canine patients. © 2012 American College of Veterinary Ophthalmologists.
Larsen, Rikke; Boysen, Lene; Berg, June; Guardabassi, Luca; Damborg, Peter
2015-06-01
Antimicrobial resistance may be overestimated in bacterial isolates from clinical samples because veterinarians often submit samples in cases of treatment failure or recurrent cases, which are more frequently associated with resistant strains. To assess to what extent the prevalence of antimicrobial resistance in Staphylococcus pseudintermedius isolated from first-time superficial pyoderma differs from canine skin isolates from clinical samples with unknown clinical background. Two study groups were enrolled in Denmark between March 2012 and October 2013: 57 dogs with first-time superficial pyoderma and no prior antimicrobial treatment (Group A); and 289 different dogs for which skin specimens were submitted for culture during the study (Group B). One S. pseudintermedius isolate from each dog was confirmed by MALDI-TOF mass spectrometry and tested for antimicrobial susceptibility by broth microdilution. Resistance levels in the two groups were compared by Fisher's exact test. Clindamycin resistance was less frequent in Group A (14%) than in Group B (27%) (P = 0.02). Similar trends were observed for amoxicillin-clavulanic acid (1.8 versus 4.8%), chloramphenicol (8.8 versus 14.5%), enrofloxacin (1.8 versus 3.5%), oxacillin (1.8 versus 4.8%) and trimethoprim/sulfamethoxazole (3.5 versus 5.9%). Oxacillin resistance was significantly associated with resistance to six of seven non-β-lactams. The prevalence of lincosamide resistance is markedly influenced by patients' clinical and antimicrobial treatment history. To limit selection of multidrug-resistant bacteria, lincosamides are appropriate empirical choices for treatment of first-time superficial pyoderma even though resistance is not infrequent. Culture and susceptibility testing are, however, recommended for all pyoderma patients. © 2015 ESVD and ACVD.
Resident Macrophages and Lymphocytes in the Canine Endometrium.
Pires, M A; Payan-Carreira, R
2015-10-01
Resident immune cells play a major role in endometrial immunity and in tissue homoeostasis. This study aimed to analyse the distribution of macrophages, B and T lymphocytes (respectively, Mø, B-Lym and T-Lym) in the canine endometrium throughout the oestrous cycle and in late involution (at the proestrus stage post-parturition). An immunohistochemistry technique was used on samples from 50 post-pubertal healthy female dogs, of which five in late post-partum. The distribution of resident immune cells was analysed in three endometrial layers (superficial, intermediate and basal areas). Mø, B-Lym and T-Lym were demonstrated to reside in the endometrium in all the stages of the canine cycle; their numbers being considerably higher during late involution. T-Lym were scattered in the stroma or amidst the glandular epithelium, constituting the predominant immune cell population in anestrus and proestrus, but decreased in number at all other stages. Endometrial B-Lym remained fairly constant during the canine cycle, although its numbers were higher in late involution. Mø counts were higher during anestrus compared to the other stages, the cells being displaced into the superficial endometrial layer. Mø demonstrated the highest level in late involution samples, forming small aggregates below the surface epithelium. The number of immune cells was not normally distributed, suggesting the influence of individual factors, such as age or parity, not explored herein due to limited sample availability. Still, this study provides important information for the interpretation of endometrial biopsies in dogs and for the understanding of the increased susceptibility to uterine infection during dioestrus found in the bitch. © 2015 Blackwell Verlag GmbH.
Oberkirchner, Ursula; Linder, Keith E; Zadrozny, Leah; Olivry, Thierry
2010-10-01
Necrolytic migratory erythema (NME; also known as superficial necrolytic dermatitis) is a syndrome most often associated with certain chronic liver diseases or pancreatic glucagonomas. In humans with glucagonoma-associated NME, skin lesions usually respond to octreotide, a somatostatin analogue that inhibits glucagon release. In this report an 11-year-old golden retriever dog with pancreatic glucagonoma and metastasis to the regional lymph nodes, spleen and liver was diagnosed with NME. The dog exhibited erosions, ulcers and crusts on the paws, pressure points, muzzle, periocular area and prepuce. The dog was also anorexic and had difficulty walking. Because metastasis precluded surgery, treatment was initiated with subcutaneous octreotide (2 μg/kg twice daily). Skin lesions and systemic clinical signs improved markedly within 5 days. The dosage was increased to nearly 3 μg/kg twice daily and signs almost completely resolved within 10 days. Anorexia was the major adverse effect observed. During the following month, both dosage (1-3.7 μg/kg) and frequency (two to four times daily) of the octreotide injections were adjusted to permit control of clinical signs while maintaining adequate appetite. Temporary cessation of octreotide administration resulted in the rapid recurrence of skin lesions. Resuming injections led to improvement of clinical signs within 48 h. The dog was later euthanized because of progressive metastatic disease. In conclusion, subcutaneous octreotide injections were beneficial in this dog with glucagonoma-associated NME. This somatostatin analogue could be a valuable option to treat canine patients with non-resectable or relapsing pancreatic glucagonoma-associated NME. © 2010 The Authors. Journal compilation © 2010 ESVD and ACVD.
Cone beam computed tomography findings of impacted upper canines
Energy Technology Data Exchange (ETDEWEB)
Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)
2014-12-15
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Cone beam computed tomography findings of impacted upper canines
International Nuclear Information System (INIS)
Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio
2014-01-01
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Penetration of ASM 981 in canine skin: a comparative study.
Gutzwiller, Meret E Ricklin; Reist, Martin; Persohn, Elke; Peel, John E; Roosje, Petra J
2006-01-01
ASM 981 has been developed for topical treatment of inflammatory skin diseases. It specifically inhibits the production and release of pro-inflammatory cytokines. We measured the skin penetration of ASM 981 in canine skin and compared penetration in living and frozen skin. To make penetration of ASM 981 visible in dog skin, tritium labelled ASM 981 was applied to a living dog and to defrosted skin of the same dog. Using qualitative autoradiography the radioactive molecules were detected in the lumen of the hair follicles until the infundibulum, around the superficial parts of the hair follicles and into a depth of the dermis of 200 to 500 microm. Activity could not be found in deeper parts of the hair follicles, the dermis or in the sebaceous glands. Penetration of ASM 981 is low in canine skin and is only equally spread in the upper third of the dermis 24 hours after application. Penetration in frozen skin takes even longer than in living canine skin but shows the same distribution.
Definition, Classification, and Pathophysiology of Canine Glaucoma.
Pizzirani, Stefano
2015-11-01
Glaucoma is a common ocular condition in humans and dogs leading to optic nerve degeneration and irreversible blindness. Primary glaucoma is a group of spontaneous heterogeneous diseases. Multiple factors are involved in its pathogenesis and these factors vary across human ethnic groups and canine breeds, so the clinical phenotypes are numerous and their classification can be challenging and remain superficial. Aging and oxidative stress are major triggers for the manifestation of disease. Multiple, intertwined inflammatory and biochemical cascades eventually alter cellular and extracellular physiology in the optic nerve and trabecular meshwork and lead to vision loss. Copyright © 2015 Elsevier Inc. All rights reserved.
Targeting VEGF in canine oxygen-induced retinopathy - a model for human retinopathy of prematurity.
McLeod, D Scott; Lutty, Gerard A
2016-01-01
Development of the dog superficial retinal vasculature is similar to the mechanism of human retinal vasculature development; they both develop by vasculogenesis, differentiation, and assembly of vascular precursors called angioblasts. Canine oxygen-induced retinopathy (OIR) was first developed by Arnall Patz in an effort to experimentally determine the effects of hyperoxia on the development of the retinal vasculature. The canine OIR model has many characteristics in common with human retinopathy of prematurity. Exposure of 1-day-old dogs to hyperoxia for 4 days causes a vaso-obliteration throughout the retina. Vasoproliferation, after the animals have returned to room air, is robust. The initial small preretinal neovascular formations anastomose to form large preretinal membranes that eventually cause tractional retinal folds. The end-stage pathology of the canine model is similar to stage IV human retinopathy of prematurity. Therefore, canine OIR is an excellent forum to evaluate the response to drugs targeting VEGF and its receptors. Evaluation of an antibody to VEGF-R2 and the VEGF-Trap demonstrated that doses should be titered down so that preretinal neovascularization is inhibited but retinal revascularization is able to proceed, vascularizing peripheral retina and preventing it from being a source of VEGF.
Prostate histotripsy for BPH: initial canine results
Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.
2009-02-01
Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.
A compendium of canine normal tissue gene expression.
Directory of Open Access Journals (Sweden)
Joseph Briggs
Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.
Baldi, G; Soglia, F; Mazzoni, M; Sirri, F; Canonico, L; Babini, E; Laghi, L; Cavani, C; Petracci, M
2018-01-01
During the past few years, there has been an increasing prevalence of broiler breast muscle abnormalities, such as white striping (WS) and wooden breast conditions. More recently, a new muscular abnormality termed as spaghetti meat (SM) because of the altered structural integrity of the Pectoralis major muscle often associated with WS has emerged. Thus, this study aimed at evaluating the effects of WS and SM conditions, occurring alone or combined within the same P. major muscle, on meat quality traits and muscle histology. In two replications, 96 P. major muscles were classified into four classes: normal (N), WS, SM and WS/SM. The whole fillet was used for weight assessment and morphometric measurements, then each sample was cut in order to separate the superficial layer from the deep one and used to evaluate proximate composition, histological features, nuclear magnetic resonance relaxation times, functional properties and both myofibrillar and sarcoplasmic proteins profile. Fillets affected by WS and SM abnormalities exhibited higher weights and increased thickness and length. SM condition was associated with a relevant decrease in protein content coupled with a significant increase in moisture level, whereas fat content was affected only by the simultaneous presence of WS. Histological evaluations revealed that abnormal samples were characterized by several degenerative aspects that almost completely concerned the superficial layer of the fillets. White striped fillets exhibited necrosis and lysis of fibers, fibrosis, lipidosis, loss of cross striation and vacuolar degeneration. Moreover, SM samples were characterized by poor fiber uniformity and a progressive rarefaction of the endo- and peri-mysial connective tissue, whereas WS/SM fillets showed intermediate histological features. Nuclear magnetic resonance relaxation analysis revealed a higher proportion of extra-myofibrillar water in the superficial section of all the abnormal fillets, especially in SM
Kaplanoglu, Hatice; Beton, Osman
2017-04-01
To evaluate the abnormalities and variations of the arterial system of upper extremities and superficial palmar arch with computed tomography angiography and to guide the clinician during this procedure. A total of 156 upper extremities of 78 cases were retrospectively analyzed using computed tomography angiography. The study was approved by the local ethics committee of the hospital. From the analysis of the computed tomography angiography images, the following information was recorded; the diameters and abnormalities of radial, ulnar and brachial arteries in both upper extremities, the presence of atherosclerotic changes or stenosis in these arteries, whether the superficial palmar arch was complete or incomplete, and arterial dominance. Also, the computed tomography angiography classification of superficial palmar arch distribution and anatomic configuration was performed. The mean baseline diameters of the radial, ulnar and brachial arteries of the cases were; 2.8 ± 0.6, 2.5 ± 0.7, and 4.7 ± 0.6 mm, respectively. A complete superficial palmar arch was observed in 69.2 % of the right hands and 70.5 % of the left hands. For the superficial palmar arches on the right side, the radial artery was dominant in two and the ulnar artery was dominant in 47 with the remaining showing codominance. On the left side, the radial artery was dominant in one hand, with the ulnar artery being dominant in 49 cases, and in 28 cases, there was codominance. In the superficial palmar arch classification, four of the arches (A-D) were defined as complete and the remaining three (E-G) as incomplete. The current study clarified different variations in palmar circulation and forearm arteries to aid the surgeon during trans-radial or trans-ulnar catheterization, hemodialysis, or coronary artery bypass grafting.
Directory of Open Access Journals (Sweden)
Deli Liu
2015-06-01
Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.
Directory of Open Access Journals (Sweden)
W Ando
2012-09-01
Full Text Available The present study investigated the surface structure and mechanical properties of repair cartilage generated from a tissue engineered construct (TEC derived from synovial mesenchymal stem cells at six months post-implantation compared to those of uninjured cartilage. TEC-mediated repair tissue was cartilaginous with Safranin O staining, and had comparable macro-scale compressive properties with uninjured cartilage. However, morphological assessments revealed that the superficial zone of TEC-mediated tissue was more fibrocartilage-like, in contrast to the middle or deep zones that were more hyaline cartilage-like with Safranin O staining. Histological scoring of the TEC-mediated tissue was significantly lower in the superficial zone than in the middle and deep zones. Scanning electron microscopy showed a thick tangential bundle of collagen fibres at the most superficial layer of uninjured cartilage, while no corresponding structure was detected at the surface of TEC-mediated tissue. Immunohistochemical analysis revealed that PRG4 was localised in the superficial area of uninjured cartilage, as well as the TEC-mediated tissue. Friction testing showed that the lubrication properties of the two tissues was similar, however, micro-indentation analysis revealed that the surface stiffness of the TEC-repair tissue was significantly lower than that of uninjured cartilage. Permeability testing indicated that the TEC-mediated tissue exhibited lower water retaining capacity than did uninjured cartilage, specifically at the superficial zone. Thus, TEC-mediated tissue exhibited compromised mechanical properties at the superficial zone, properties which need improvement in the future for maintenance of long term repair cartilage integrity.
Ando, Wataru; Fujie, Hiromichi; Moriguchi, Yu; Nansai, Ryosuke; Shimomura, Kazunori; Hart, David A; Yoshikawa, Hideki; Nakamura, Norimasa
2012-09-28
The present study investigated the surface structure and mechanical properties of repair cartilage generated from a tissue engineered construct (TEC) derived from synovial mesenchymal stem cells at six months post-implantation compared to those of uninjured cartilage. TEC-mediated repair tissue was cartilaginous with Safranin O staining, and had comparable macro-scale compressive properties with uninjured cartilage. However, morphological assessments revealed that the superficial zone of TEC-mediated tissue was more fibrocartilage-like, in contrast to the middle or deep zones that were more hyaline cartilage-like with Safranin O staining. Histological scoring of the TEC-mediated tissue was significantly lower in the superficial zone than in the middle and deep zones. Scanning electron microscopy showed a thick tangential bundle of collagen fibres at the most superficial layer of uninjured cartilage, while no corresponding structure was detected at the surface of TEC-mediated tissue. Immunohistochemical analysis revealed that PRG4 was localised in the superficial area of uninjured cartilage, as well as the TEC-mediated tissue. Friction testing showed that the lubrication properties of the two tissues was similar, however, micro-indentation analysis revealed that the surface stiffness of the TEC-repair tissue was significantly lower than that of uninjured cartilage. Permeability testing indicated that the TEC-mediated tissue exhibited lower water retaining capacity than did uninjured cartilage, specifically at the superficial zone. Thus, TEC-mediated tissue exhibited compromised mechanical properties at the superficial zone, properties which need improvement in the future for maintenance of long term repair cartilage integrity.
Status of therapeutic gene transfer to treat canine dilated cardiomyopathy in dogs.
Sleeper, Meg M; Bish, Lawrence T; Sweeney, H Lee
2010-07-01
Therapeutic gene transfer holds promise as a way to treat dilated cardiomyopathy from any underlying cause because the approach attempts to address metabolic disturbances that occur at the molecular level of the failing heart. Calcium-handling abnormalities and increased rates of apoptosis are abnormalities that occur in many types of heart disease, and gene therapies that target these metabolic defects have proven to be beneficial in numerous rodent models of heart disease. The authors are currently evaluating this approach to treat canine idiopathic dilated cardiomyopathy.
Uncommon acute neurologic presentation of canine distemper in 4 adult dogs.
Galán, Alba; Gamito, Araceli; Carletti, Beatrice E; Guisado, Alicia; de las Mulas, Juana Martín; Pérez, José; Martín, Eva M
2014-04-01
Four uncommon cases of canine distemper (CD) were diagnosed in vaccinated adult dogs. All dogs had acute onset of neurologic signs, including seizures, abnormal mentation, ataxia, and proprioceptive deficits. Polymerase chain reaction for CD virus was positive on cerebrospinal fluid in 2 cases. Due to rapid deterioration the dogs were euthanized and CD was confirmed by postmortem examination.
Loeffler, A; Cobb, M A; Bond, R
2011-09-03
The clinical and antibacterial efficacy of two shampoos used as a sole antibacterial treatment in dogs with superficial pyoderma were investigated and compared. In a randomised, partially blinded study, a 3 per cent chlorhexidine gluconate shampoo (Chlorhex 3; Leo Animal Health) was compared against a 2.5 per cent benzoyl peroxide shampoo (Paxcutol; Virbac) in 22 dogs with superficial pyoderma. Dogs were washed two to three times weekly with a 10-minute contact time over 21 days. Clinical scores and bacterial counts were assessed on days 1, 8 and 22 and compared within and between treatment groups; overall response was assessed at the end of the study. Twenty dogs completed the study; 15 (68.2 per cent) showed an overall clinical improvement and the clinical signs resolved in three chlorhexidine-treated dogs. In the chlorhexidine-treated group, scores for papules/pustules (P<0.001), investigator-assessed pruritus (P=0.003), total bacterial counts (P=0.003) and counts for coagulase-positive staphylococci (P=0.003) were reduced after three weeks. Scores and bacterial counts did not vary significantly in the benzoyl peroxide-treated group.
Targeting VEGF in canine oxygen-induced retinopathy - a model for human retinopathy of prematurity
Directory of Open Access Journals (Sweden)
McLeod DS
2016-05-01
Full Text Available D Scott McLeod, Gerard A Lutty Department of Ophthalmology, Wilmer Ophthalmological Institute, Johns Hopkins Hospital, Baltimore, MD, USA Abstract: Development of the dog superficial retinal vasculature is similar to the mechanism of human retinal vasculature development; they both develop by vasculogenesis, differentiation, and assembly of vascular precursors called angioblasts. Canine oxygen-induced retinopathy (OIR was first developed by Arnall Patz in an effort to experimentally determine the effects of hyperoxia on the development of the retinal vasculature. The canine OIR model has many characteristics in common with human retinopathy of prematurity. Exposure of 1-day-old dogs to hyperoxia for 4 days causes a vaso-obliteration throughout the retina. Vasoproliferation, after the animals have returned to room air, is robust. The initial small preretinal neovascular formations anastomose to form large preretinal membranes that eventually cause tractional retinal folds. The end-stage pathology of the canine model is similar to stage IV human retinopathy of prematurity. Therefore, canine OIR is an excellent forum to evaluate the response to drugs targeting VEGF and its receptors. Evaluation of an antibody to VEGF-R2 and the VEGF-Trap demonstrated that doses should be titered down so that preretinal neovascularization is inhibited but retinal revascularization is able to proceed, vascularizing peripheral retina and preventing it from being a source of VEGF. Keywords: angioblasts, blood vessels, endothelial cells, oxygen, retinopathy, retina, vascular endothelial cell growth factor
Surgical treatments of the impacted canine tooth in young dogs
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Sasaki, K.; Taura, Y.; Nakama, S.; Yamanouchi, T.
1993-01-01
Surgical treatments of the impacted canine tooth were carried out in 8 young dogs, and the results were successful in 12 out of 14 cases (85.7%). The treatments consisting of surgical correction by immediate tipping movement, fenestration of the gingiva, and removal of the impacted tooth, were applied to 14 cases radiographically showing the immature tooth root and no abnormalities in the tooth root or alveolar bone. Impacted teeth were seen in 8 regions of the maxilla and 6 regions of the mandible. Mesioversion was seen in almost all maxillary impacted teeth, while linguoversion or lingual mesioversion in all mandibular cases. Surgical correction was carried out by immediate tipping movement after removal of the retained deciduous canine with or without resection of the alveolar bone. Fixation of the moved teeth was done using a wedge made from the deciduous canine root, which was driven into the vacant alveolar cavity after moving. An additional fixation using a steel wire and/or self-curing resin was done, if necessary
Direct magnetic resonance arthrography of the canine elbow
Directory of Open Access Journals (Sweden)
Yauheni Zhalniarovich
2017-01-01
Full Text Available This study compares the effects of four dilutions of the gadolinium-containing contrast media (1:100; 1:400; 1:800; 1:1,200 administered to the elbow on the quality of magnetic resonance images. All the examined dilutions had a positive effect on image quality, and 1:800 was regarded as the optimal dilution of gadolinium for viewing the elbow because it imparted good contrast to the joint cavity without obliterating the contours of articular surfaces. Transverse, sagittal, and dorsal low-field magnetic resonance images were obtained in 24 canine cadaver front limbs. The musculus biceps brachii, m. triceps brachii, m. extensor carpi radialis, m. flexor carpi ulnaris, the articular surfaces, the medial coronoid process and the anconeal process of the ulna were well visualized by High Resolution Gradient Echo, XBONE T2 and Spin Echo T1 sequences in the sagittal plane. The biceps brachii, pronator teres, flexor carpi radialis, extensor digitorum communis, extensor carpi radialis, deltoid muscle and the articular surface of the medial condyle of the humerus were very well visualized by 3D SST1 and XBONE T2 sequences in the transverse plane. The triceps brachii muscle, extensor digitorum lateralis muscle, superficial digital flexor, deep digital flexor and the medial condyle of the humerus were very well visualized by the Spin Echo T1 sequence in the dorsal plane. This article describes for the first time the use of the gadolinium contrast agent administered to the canine elbow joint during magnetic resonance modality. Magnetic resonance arthrography can be a helpful visualization technique in treating canine soft tissue elbow injury.
Genome-wide association study identifies a novel canine glaucoma locus.
Directory of Open Access Journals (Sweden)
Saija J Ahonen
Full Text Available Glaucoma is an optic neuropathy and one of the leading causes of blindness. Its hereditary forms are classified into primary closed-angle (PCAG, primary open-angle (POAG and primary congenital glaucoma (PCG. Although many loci have been mapped in human, only a few genes have been identified that are associated with the development of glaucoma and the genetic basis of the disease remains poorly understood. Glaucoma has also been described in many dog breeds, including Dandie Dinmont Terriers (DDT in which it is a late-onset (>7 years disease. We designed clinical and genetic studies to better define the clinical features of glaucoma in the DDT and to identify the genetic cause. Clinical diagnosis was based on ophthalmic examinations of the affected dogs and 18 additionally investigated unaffected DDTs. We collected DNA from over 400 DTTs and a genome wide association study was performed in a cohort of 23 affected and 23 controls, followed by a fine mapping, a replication study and candidate gene sequencing. The clinical study suggested that ocular abnormalities including abnormal iridocorneal angles and pectinate ligament dysplasia are common (50% and 72%, respectively in the breed and the disease resembles human PCAG. The genetic study identified a novel 9.5 Mb locus on canine chromosome 8 including the 1.6 Mb best associated region (p = 1.63 × 10(-10, OR = 32 for homozygosity. Mutation screening in five candidate genes did not reveal any causative variants. This study indicates that although ocular abnormalities are common in DDTs, the genetic risk for glaucoma is conferred by a novel locus on CFA8. The canine locus shares synteny to a region in human chromosome 14q, which harbors several loci associated with POAG and PCG. Our study reveals a new locus for canine glaucoma and ongoing molecular studies will likely help to understand the genetic etiology of the disease.
Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo
2018-01-23
To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.
Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.
Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D
2000-12-01
To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.
Directory of Open Access Journals (Sweden)
Mostfa Shahabi
2017-09-01
Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.
Expression of nociceptive ligands in canine osteosarcoma.
Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M
2015-01-01
Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.
Canine hepatozoonosis in Brazil: description of eight naturally occurring cases.
Gondim, L F; Kohayagawa, A; Alencar, N X; Biondo, A W; Takahira, R K; Franco, S R
1998-01-31
Eight cases of canine hepatozoonosis were diagnosed at the Veterinary Hospital (Faculdade de Medicina Veterinária e Zootecnia, Universidade Estadual Paulista, Campus de Botucatu), between October 1993 and April 1994. Clinical signs included anorexia, pale mucous membranes, weight loss, pain, diarrhoea, vomit, gait abnormalities, fever, polyuria and polydipsia. Haematologic findings revealed anaemia in seven cases, leucocytosis with neutrophilia in three cases, lymphopenia in three cases and monocytosis in four cases. Serum biochemistries included alterations in many parameters. The micrometry of Hepatozoon canis gametocytes ranged from 6.8 x 4.0 microns to 7.5 x 4.5 microns. Parasitaemia ranged from less than 0.5% to 2%. In all the cases reported other concurrent diseases were present. Diagnosis of canine hepatozoonosis was made by identifying H. canis gametocytes within leucocytes in stained blood smears.
Hume, Kelly R; Sylvester, Skylar R; Borlle, Lucia; Balkman, Cheryl E; McCleary-Wheeler, Angela L; Pulvino, Mary; Casulo, Carla; Zhao, Jiyong
2018-01-01
Doxycycline has antiproliferative effects in human lymphoma cells and in murine xenografts. We hypothesized that doxycycline would decrease canine lymphoma cell viability and prospectively evaluated its clinical tolerability in client-owned dogs with spontaneous, nodal, multicentric, substage a, B-cell lymphoma, not previously treated with chemotherapy. Treatment duration ranged from 1 to 8 weeks (median and mean, 3 weeks). Dogs were treated with either 10 ( n = 6) or 7.5 ( n = 7) mg/kg by mouth twice daily. One dog had a stable disease for 6 weeks. No complete or partial tumor responses were observed. Five dogs developed grade 3 and/or 4 metabolic abnormalities suggestive of hepatopathy with elevations in bilirubin, ALT, ALP, and/or AST. To evaluate the absorption of oral doxycycline in our study population, serum concentrations in 10 treated dogs were determined using liquid chromatography tandem mass spectrometry. Serum levels were variable and ranged from 3.6 to 16.6 µg/ml (median, 7.6 µg/ml; mean, 8.8 µg/ml). To evaluate the effect of doxycycline on canine lymphoma cell viability in vitro , trypan blue exclusion assay was performed on canine B-cell lymphoma cell lines (17-71 and CLBL) and primary B-cell lymphoma cells from the nodal tissue of four dogs. A doxycycline concentration of 6 µg/ml decreased canine lymphoma cell viability by 80%, compared to matched, untreated, control cells (mixed model analysis, p canine lymphoma, combination therapy may be worthwhile if future research determines that doxycycline can alter cell survival pathways in canine lymphoma cells. Due to the potential for metabolic abnormalities, close monitoring is recommended with the use of this drug in tumor-bearing dogs. Additional research is needed to assess the tolerability of chronic doxycycline therapy.
Effects of Carbenoxolone on the Canine Pituitary-Adrenal Axis.
Teshima, Takahiro; Matsumoto, Hirotaka; Okusa, Tomoko; Nakamura, Yumi; Koyama, Hidekazu
2015-01-01
Cushing's disease caused by pituitary corticotroph adenoma is a common endocrine disease in dogs. A characteristic biochemical feature of corticotroph adenomas is their relative resistance to suppressive negative feedback by glucocorticoids. The abnormal expression of 11beta-hydroxysteroid dehydrogenase (11HSD), which is a cortisol metabolic enzyme, is found in human and murine corticotroph adenomas. Our recent studies demonstrated that canine corticotroph adenomas also have abnormal expression of 11HSD. 11HSD has two isoforms in dogs, 11HSD type1 (HSD11B1), which converts cortisone into active cortisol, and 11HSD type2 (HSD11B2), which converts cortisol into inactive cortisone. It has been suggested that glucocorticoid resistance in corticotroph tumors is related to the overexpression of HSD11B2. Therefore it was our aim to investigate the effects of carbenoxolone (CBX), an 11HSD inhibitor, on the healthy dog's pituitary-adrenal axis. Dogs were administered 50 mg/kg of CBX twice each day for 15 days. During CBX administration, no adverse effects were observed in any dogs. The plasma adrenocorticotropic hormone (ACTH), and serum cortisol and cortisone concentrations were significantly lower at day 7 and 15 following corticotropin releasing hormone stimulation. After completion of CBX administration, the HSD11B1 mRNA expression was higher, and HSD11B2 mRNA expression was significantly lower in the pituitaries. Moreover, proopiomelanocortin mRNA expression was lower, and the ratio of ACTH-positive cells in the anterior pituitary was also significantly lower after CBX treatment. In adrenal glands treated with CBX, HSD11B1 and HSD11B2 mRNA expression were both lower compared to normal canine adrenal glands. The results of this study suggested that CBX inhibits ACTH secretion from pituitary due to altered 11HSD expressions, and is potentially useful for the treatment of canine Cushing's disease.
Pyne, John H; Myint, Esther; Barr, Elizabeth M; Clark, Simon P; David, Michael; Na, Renua; Hou, Ruihang
2017-08-01
Basal cell carcinoma (BCC) may present as superficial subtype alone (sBCC) or superficial combined with other subtypes. The objective of this study was to compare sBCC without or with other BCC subtypes by age, sex and anatomic site. We retrospectively collected superficial BCC with the above characteristics from an Australian center during 2009 to 2014. We recorded 1528 sBCC and 1622 superficial BCC combined with other BCC subtype cases. Males numbered 2007 and females 1140. On males, head sites (forehead, cheek, nose and ear combined) compared to limb plus trunk sites displayed a higher incidence of superficial BCC combined with either nodular and or aggressive BCC subtypes (OR 13.15 CI 95% 8.9-19.5 P < .0001). On females a similar comparison also found a higher incidence of superficial BCC combined with solid subtype BCC on head sites compared to trunk and limb sites (OR 9.66 CI 95% 5.8-16.1 P < .0001). Superficial BCC alone is more likely on younger females on trunk and limb sites. Small partial biopsies reported as sBCC may miss other BCC subtypes present with higher risk on facial sites for males and females. Males had smaller proportions of superficial only subtype BCC on facial and ear sites compared to females. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Canine and human gastrointestinal stromal tumors display similar mutations in c-KIT exon 11
International Nuclear Information System (INIS)
Gregory-Bryson, Emmalena; Bartlett, Elizabeth; Kiupel, Matti; Hayes, Schantel; Yuzbasiyan-Gurkan, Vilma
2010-01-01
Gastrointestinal stromal tumors (GISTs) are common mesenchymal neoplasms in the gastrointestinal tract of humans and dogs. Little is known about the pathogenesis of these tumors. This study evaluated the role of c-KIT in canine GISTs; specifically, we investigated activating mutations in exons 8, 9, 11, 13, and 17 of c-KIT and exons 12, 14, and 18 of platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), all of which have been implicated in human GISTs. Seventeen canine GISTs all confirmed to be positive for KIT immunostaining were studied. Exons 8, 9, 11, 13 and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA, were amplified from DNA isolated from formalin-fixed paraffin-embedded samples. Of these seventeen cases, six amplicons of exon 11 of c-KIT showed aberrant bands on gel electrophoresis. Sequencing of these amplicons revealed heterozygous in-frame deletions in six cases. The mutations include two different but overlapping six base pair deletions. Exons 8, 9, 13, and 17 of c-KIT and exons 12, 14, and 18 of PDGFRA had no abnormalities detected by electrophoresis and sequencing did not reveal any mutations, other than synonymous single nucleotide polymorphisms (SNPs) found in exon 11 of c-KIT and exons 12 and 14 of PDGFRA. The deletion mutations detected in canine GISTs are similar to those previously found in the juxtamembrane domain of c-KIT in canine cutaneous mast cell tumors in our laboratory as well as to those reported in human GISTs. Interestingly, none of the other c-KIT or PDGFRA exons showed any abnormalities in our cases. This finding underlines the critical importance of c-KIT in the pathophysiology of canine GISTs. The expression of KIT and the identification of these activating mutations in c-KIT implicate KIT in the pathogenesis of these tumors. Our results indicate that mutations in c-KIT may be of prognostic significance and that targeting KIT may be a rational approach to treatment of these malignant tumors. This study further
International Nuclear Information System (INIS)
Samaila, Modupeola O.; Rafindadi, Abdulmumini H.; Oluwole, Olabode P.; Adewuyi, Sunday A.
2007-01-01
Objective was to determine the underlying cause of superficial skin ulcers over a 15-year period. A retrospective histopathological analysis of 670 cases of superficial skin ulcers diagnosed in the Dept. of Pathology, Ahmadu Bello University Teaching Hospital, Zaria, Nigeria from January 1991 to December 2005. A total of 670 superficial skin ulcers were analyzed. The mail to female gender ratio was 409:261(1.5:1.0) and a peakage frequency of 44.3 %( 297) in the 5th and 6th decades. Spectrum of lesions encountered was categorized into inflammatory, infections, benign and malignant diseases. The malignant lesions were 309 (46.1%), non-specific inflammation 302 (45.1%), granulation tissue 25 (3.7%) and pseudoepitheliomatous hyperplasia 14 (2.1%). A total of 18(2.7%) specific infections were encountered, which included bacterial, fungal and viral infection. Benign lesions were 2(0.3%), comprising of neurofibroma and Bowen's disease. The most common malignant lesion was squamous cell carcinoma 203 (30.3%) with a male to female ratio of 128:75 (1.7:1.0). Of these 161 were well differentiated tumors. The lower limb was the prevalent site distribution of all the ulcers. Superficial ulcers may be harbinger of malignant diseases. Squamous cell carcinoma remains the most common malignant lesion arising from chronic superficial ulcers from our setting. Adequate tissue biopsy and early diagnosis may reduce the attendant morbidity of these ulcers. (author)
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos
Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.
2011-01-01
INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Emerging perspectives on hereditary glomerulopathies in canines
Directory of Open Access Journals (Sweden)
Littman MP
2015-04-01
Full Text Available Meryl P LittmanDepartment of Clinical Studies – Philadelphia, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA, USAAbstract: Familial glomerulopathies have been described in more than two dozen dog breeds. These canine spontaneous cases of glomerular disease are good models for their human counterparts. The dogs present clinically with protein-losing nephropathy and variable signs of hypertension, thromboembolic events, edema/effusions/nephrotic syndrome, or eventually with signs of renal disease such as anorexia, vomiting, weight loss, and/or polyuria/polydipsia. Laboratory changes include proteinuria, hypoalbuminemia, hypercholesterolemia, and eventually azotemia, hyperphosphatemia, anemia, and isosthenuria. Renal biopsies examined with transmission electron microscopy, immunofluorescence, and thin section light microscopy may show ultrastructural glomerular basement membrane abnormalities, glomerulosclerosis, amyloidosis, non-amyloid fibrillary deposition, or breed-associated predispositions for immune-complex glomerulonephritis. Genome-wide association studies and fine sequencing of candidate genes have led to the discovery of variant alleles associated with disease in some breeds; eg, 1 glomerular basement membrane ultrastructural abnormalities due to defective collagen type IV, caused by different premature stop codons in each of four breeds; ie, in COL4A5 in Samoyeds and Navasota mix breed dogs (X-linked, and in COL4A4 in English Cocker Spaniels and English Springer Spaniels (autosomal recessive; and 2 glomerulosclerosis-related podocytopathy with slit diaphragm protein anomalies of both nephrin and Neph3/filtrin due to non-synonymous single nucleotide polymorphisms in conserved regions of their encoding genes, NPHS1 and KIRREL2, in Soft Coated Wheaten Terriers and Airedale Terriers, with a complex mode of inheritance. Age at onset and progression to end-stage renal disease vary depending on the model. Genetic
Directory of Open Access Journals (Sweden)
Kelly R. Hume
2018-02-01
Full Text Available Doxycycline has antiproliferative effects in human lymphoma cells and in murine xenografts. We hypothesized that doxycycline would decrease canine lymphoma cell viability and prospectively evaluated its clinical tolerability in client-owned dogs with spontaneous, nodal, multicentric, substage a, B-cell lymphoma, not previously treated with chemotherapy. Treatment duration ranged from 1 to 8 weeks (median and mean, 3 weeks. Dogs were treated with either 10 (n = 6 or 7.5 (n = 7 mg/kg by mouth twice daily. One dog had a stable disease for 6 weeks. No complete or partial tumor responses were observed. Five dogs developed grade 3 and/or 4 metabolic abnormalities suggestive of hepatopathy with elevations in bilirubin, ALT, ALP, and/or AST. To evaluate the absorption of oral doxycycline in our study population, serum concentrations in 10 treated dogs were determined using liquid chromatography tandem mass spectrometry. Serum levels were variable and ranged from 3.6 to 16.6 µg/ml (median, 7.6 µg/ml; mean, 8.8 µg/ml. To evaluate the effect of doxycycline on canine lymphoma cell viability in vitro, trypan blue exclusion assay was performed on canine B-cell lymphoma cell lines (17-71 and CLBL and primary B-cell lymphoma cells from the nodal tissue of four dogs. A doxycycline concentration of 6 µg/ml decreased canine lymphoma cell viability by 80%, compared to matched, untreated, control cells (mixed model analysis, p < 0.0001; Wilcoxon signed rank test, p = 0.0313. Although the short-term administration of oral doxycycline is not associated with the remission of canine lymphoma, combination therapy may be worthwhile if future research determines that doxycycline can alter cell survival pathways in canine lymphoma cells. Due to the potential for metabolic abnormalities, close monitoring is recommended with the use of this drug in tumor-bearing dogs. Additional research is needed to assess the tolerability of chronic
Tawde, Shweta
Statement of Problem: Clinicians are inclined towards more aggressive teeth preparations to accommodate the thickness of the veneering material. The principle of conservative tooth preparation is compromised. Purpose: By using a conservative approach to treatment with porcelain veneers, long-lasting, esthetic and functional results may be achieved. Sacrificing as little tooth structure as possible and conserving the supporting tissues will facilitate prospective patients. Materials and Methods: Forty extracted human maxillary and mandibular canines were selected. The teeth were divided into one of two groups (pressable and stackable) and further subdivided according to tooth substrate (all-enamel or mixed enamel-dentin exposure). Twenty canine teeth were allotted to the pressable veneer group and 20 were allotted to the stackable veneer group. Of the 20 teeth in the pressable group, all were pressed with a lithium disilicate ceramic system (IPS e.max Press), 10 with labial tooth reduction of 0.3-0.5 mm maintaining superficial enamel (PEN) and the remaining 10 teeth with labial veneer reduction of 0.8-1.0 mm exposing superficial dentin (PDN). Of the 20 teeth in the stackable group, all were stacked/ layered with conventional feldspathic porcelain (Fortune; Williams/ Ivoclar); with labial veneer reduction of 0.3-0.5 mm maintaining superficial enamel (SEN) and the remaining 10 teeth with labial veneer reduction of 0.8-1.0 mm exposing superficial dentin (SDN). Silicon putty matrix was fabricated prior to teeth preparation to estimate the teeth reduction. The prepared facial reduction was limited to the incisal edge. No incisal or palatal/lingual reduction was performed. Impressions of the prepared teeth were taken in medium/light-bodied PVS. Master casts were made in Resin Rock. The stackable group specimens were made with fabricating refractory dies and after following the recommended steps of laboratory procedure, stackable veneers were processed. The pressable group
Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch
2017-01-01
Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...
Maxillary canine impactions related to impacted central incisors: two case reports.
Bayram, Mehmet; Ozer, Mete; Sener, Ismail
2007-09-01
The purpose of this case report is to describe the combined surgical and orthodontic treatment of two cases with an impacted maxillary central incisor and canine in the same quadrant and to discuss the causal relationship between them. The most common causes of canine impactions are usually the result of one or more factors such as a long path of eruption, tooth size-arch length discrepancies, abnormal position of the tooth bud, prolonged retention or early loss of the deciduous canine, trauma, the presence of an alveolar cleft, ankylosis, cystic or neoplastic formation, dilaceration of the root, supernumerary teeth, and odontomas. Although impaction of the maxillary central incisor is almost as prevalent as impacted canines its etiology is different. The principal factors involved in causing the anomaly are supernumerary teeth, odontomas, and trauma. Case #1: A 10.5-year-old girl in the early mixed dentition stage presented with a chief complaint of the appearance of her anterior teeth. She had a Class I skeletal pattern and a history of trauma to the maxillary central incisors at age five with premature exfoliation. Radiographs revealed an impacted upper right central incisor in the region of the nasal floor, delayed eruption of the maxillary permanent central incisor, and the adjacent lateral incisor was inclined toward the edentulous space. Treatment was done in two stages consisting of surgical exposure and traction of the impacted central incisor and fixed orthodontic treatment. Case #2: An 11.5-year-old girl presented for orthodontic treatment with the chief complaint of an unerupted tooth and the appearance of her upper anterior teeth. She was in the late mixed dentition period with a Class III skeletal pattern along with an anterior cross-bite with some maxillary transverse deficiency. The maxillary right canine and central incisor were absent, but the maxillary right deciduous canine was still present. Treatment included arch expansion followed by
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Fusion of a primary mandibular lateral incisor and canine: A rarity
Directory of Open Access Journals (Sweden)
Treville Pereira
2017-01-01
Full Text Available Fusion is a developmental anomaly of dental hard tissues characterized by the union of two adjacent teeth. It may be complete with the formation of an abnormally large tooth or incomplete with the union of crowns or roots only. The exact cause is still unknown. This report describes a case of unilateral fusion of the primary lateral incisor and canine in a 6-year-old female patient who accompanied her parents for dental treatment and later had a checkup herself during one of the visits to the dental clinic. Medical history was noncontributory while there was no family history of dental anomalies. An intraoral examination revealed that mandibular right primary lateral incisor was fused to the primary canine. The permanent central incisors were erupting lingually. The intraoral periapical radiograph showed a bifid pulp chamber with a normal-sized root canal. Since the tooth was noncarious, a preventive approach with a periodic follow-up was planned.
DEFF Research Database (Denmark)
Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold
2014-01-01
BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was
HIGH ORIGIN OF SUPERFICIAL ULNAR ARTERY- A CASE REPORT
Directory of Open Access Journals (Sweden)
Anjana Jayakumaran Nair
2017-03-01
Full Text Available BACKGROUND High origin and superficially placed ulnar artery is a rare anatomical variant that usually arises either in the axilla or arm and runs a superficial course in the forearm, enters the hand and participates in the formation of superficial palmar arch. During routine dissection of cadavers in our department, we observed a unilateral case of high origin and superficial ulnar artery in a human male cadaver. It originated from the brachial artery in the lower third of arm 4 cm above its bifurcation. From its origin, it passed downwards along the medial aspect of forearm, superficial to the flexors, entered hand superficial to the flexor retinaculum and formed superficial palmar arch. The knowledge of existence of a superficial ulnar artery is important during vascular and reconstructive surgery and also in evaluation of angiographic images. Superficial position makes it more vulnerable to trauma and more accessible to cannulation.
DEFF Research Database (Denmark)
Aludden, Hanna Cecilia; Jensen, Thomas
2016-01-01
Ankylosis is the abnormal adhesion of alveolar bone to dentin or cementum and commonly seen after traumatic dental injuries. Treatment of impacted and ankylosed teeth solely by orthodontics alignment may be challenging. Consequently, several treatment alternatives have been proposed for the manag....... A dentoalveolar segmental osteotomy with immediate repositioning of an upper canine was performed. One year after final orthodontic treatment a satisfying occlusal and esthetic treatment outcome was obtained....
Khodaee, Morteza
2017-02-15
Superficial bursitis most often occurs in the olecranon and prepatellar bursae. Less common locations are the superficial infrapatellar and subcutaneous (superficial) calcaneal bursae. Chronic microtrauma (e.g., kneeling on the prepatellar bursa) is the most common cause of superficial bursitis. Other causes include acute trauma/hemorrhage, inflammatory disorders such as gout or rheumatoid arthritis, and infection (septic bursitis). Diagnosis is usually based on clinical presentation, with a particular focus on signs of septic bursitis. Ultrasonography can help distinguish bursitis from cellulitis. Blood testing (white blood cell count, inflammatory markers) and magnetic resonance imaging can help distinguish infectious from noninfectious causes. If infection is suspected, bursal aspiration should be performed and fluid examined using Gram stain, crystal analysis, glucose measurement, blood cell count, and culture. Management depends on the type of bursitis. Acute traumatic/hemorrhagic bursitis is treated conservatively with ice, elevation, rest, and analgesics; aspiration may shorten the duration of symptoms. Chronic microtraumatic bursitis should be treated conservatively, and the underlying cause addressed. Bursal aspiration of microtraumatic bursitis is generally not recommended because of the risk of iatrogenic septic bursitis. Although intrabursal corticosteroid injections are sometimes used to treat microtraumatic bursitis, high-quality evidence demonstrating any benefit is unavailable. Chronic inflammatory bursitis (e.g., gout, rheumatoid arthritis) is treated by addressing the underlying condition, and intrabursal corticosteroid injections are often used. For septic bursitis, antibiotics effective against Staphylococcus aureus are generally the initial treatment, with surgery reserved for bursitis not responsive to antibiotics or for recurrent cases. Outpatient antibiotics may be considered in those who are not acutely ill; patients who are acutely ill
Larson, L J; Schultz, R D
2007-01-01
A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.
Pitman, Michael J; Cabin, Jonathan A; Iacob, Codrin E
2016-02-01
Evaluate the histologic effects of grafting porcine-derived small intestinal submucosa (SIS) into the vocal fold superficial lamina propria (SLP) layer for the potential treatment of vocal fold scar, sulcus and superficial lamina propria atrophy. Small intestinal submucosa was implanted into the right vocal fold SLP of 6 mongrel dogs. The left vocal fold served as a sham surgical control. At 2, 4, and 6 weeks postoperative, bilateral vocal fold specimens were evaluated histologically. At 2 and 4 weeks, respectively, SIS-implanted vocal folds demonstrated moderate and mild inflammation and acute and chronic inflammation. At 6 weeks, inflammation was minimal and chronic. The 6-week specimens showed copious amounts of newly generated hyaluronic acid (HA) within the graft. There was no reactive fibrosis at 6 weeks. In the canine model, SIS appears safe for SLP grafting. Inflammation is similar to that of sham surgery. Small intestinal submucosa results in newly generated HA without concomitant fibrosis. Small intestinal submucosa has potential to be used in treatment of disorders with SLP, including vocal fold scar, sulcus, and atrophy. Studies evaluating the effect of SIS implantation on vocal fold function, as well as the ultimate fate of the graft, are required. © The Author(s) 2015.
Directory of Open Access Journals (Sweden)
Anna McRee
2014-09-01
Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A
2014-09-05
Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
Webb, Craig; Twedt, David C
2003-09-01
Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.
Varied clinico-radiological presentations of transmigrated canines
Directory of Open Access Journals (Sweden)
Ishita Gupta
2015-01-01
Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.
Directory of Open Access Journals (Sweden)
A. Fernández García
2012-06-01
Full Text Available Los colgajos pediculados pueden sufrir edema y congestión debido a que su drenaje a trevés del sistema venoso superfical es imposible y el flujo hacia el sistema profundo a nivel del pedículo es precario. Esta situación suele evolucionar hacia la necrosis parcial o la pérdida total del colgajo en pocas horas. La apertura del sistema venoso superficial permite el drenaje adecuado de los tejidos transferidos y evita estas complicaciones. Este artículo analiza el papel de las anastomosis microquirúrgicas en el sistema venoso superficial de los colgajos pediculados. Esta técnica permite comunicar el sistema venoso superfical de los tejidos transferidos con el sistema venoso superficial del territorio que rodea al defecto. Presentamos los resultados obtenidos con esta técnica en colgajos de perforante en hélice, colgajos miocutáneos, colgajos neurocutáneos y colgajos fasciograsos volteados.The pedicled flaps can suffer edema and congestion due to the impossibility of drainage toward the superficial venous system and the precarious flow via the deep system at the level of the pedicle. The evolution of this situation is usually partial necrosis or total loss of the flap in a few hours. The opening of the venous superficial system achieves an appropriate drainage of the transfered tissues and avoids these complications. In this article we analyze the role of the microsurgical anastomosis at the level of the superficial venous system of pedicled flaps. This technique allows to communicate the superficial venous system of the transfered tissues with the superficial venous system of the territory around the defect. We report the results with this method in propeller perforator flaps, miocutaneous flaps, neurocutaneous flaps and adipofascial turn over flaps.
Chang, Jung Woo; Leem, Soo Seong; Choi, Hwan Jun; Lee, Jang Hyun
2017-05-01
A functional superficial parotidectomy can maintain salivary function by preserving the Stensen duct. However, this technique still brings the possibility of salivary leakage, because major branches of the parotid duct from the resected site do not get ligated. To reduce this complication, this study introduces a modified technique with major branch ligation. From December 2008 to February 2015, 14 patients who underwent superficial parotidectomy were divided into 2 groups. Group A was treated with the modified functional superficial parotidectomy involving the major branch between the superficial lobe and parotid duct. Group B was treated with the conventional superficial parotidectomy without involving the major branch of the parotid duct. The clinical complications, period of Hemovac usage, and surgical duration were noted in each group. Two of 8 patients in group A had a major branch from Stensen duct that was ligated, and there was no evidence of salivary leakage or sialocele in any of the patients of group A, whereas group B contained 2 cases of salivary leakage, one of which became sialocele. Group A had a significantly longer Hemovac maintenance period than group B (P < 0.05), and the duration of surgery was also significantly different between the 2 groups (P < 0.05). Because a solitary major branch of the main parotid duct occasionally extends toward the superficial lobe, our modified technique-functional superficial parotidectomy with ligation of the major branch toward the superficial lobe-is a useful option for treatment of a benign parotid mass in such cases.
Development of the canine tooth in the beagle
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.
1993-01-01
The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla
Gram, A; Boos, A; Kowalewski, M P
2014-06-01
Oxytocin (OT) plays an important role as an inducer of uterine contractility, acting together with its receptor (OTR) to increase synthesis of prostaglandins. Although OT is commonly used in the treatment for dystocia and uterine inertia in the bitch, little attention has been paid to the role of OT in mechanisms regulating parturition in the dog, so that knowledge about the expression of OTR in the canine uterus and placenta is sparse. Consequently, the expression and cellular localization of OTR were investigated in canine utero/placental compartments and interplacental sites throughout pregnancy and at normal and antigestagen-induced parturition, by real-time PCR, immunohistochemistry, western blot and in situ hybridization. The utero/placental and interplacental expression of OTR was constant from pre-implantation until mid-gestation, with a significant increase observed at prepartum luteolysis. In antigestagen-treated mid-pregnant dogs, OTR was upregulated in both interplacental and utero/placental samples. Besides clear myometrial signals, cellular localization of OTR was evident in the endometrial surface epithelial, stromal and vascular endothelial cells. Weaker signals were observed in superficial and deep uterine glandular epithelial cells. Placental OTR was localized in maternal decidual cells and capillary pericytes. Finally, OTR was colocalized with the progesterone receptor (PGR) in maternal decidual cells, coinciding with previously reported increased availability of prostaglandins in the foetal part of the placenta during normal and induced parturition. These findings suggest involvement of OTR in the signalling cascade leading to the prepartum release of prostaglandins from the pregnant canine uterus. © 2014 Blackwell Verlag GmbH.
Ontogeny of canine dimorphism in extant hominoids.
Schwartz, G T; Dean, C
2001-07-01
Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.
Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2005-01-01
A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.
Study on clinical symptoms in canine cardiac diseases
Directory of Open Access Journals (Sweden)
F. Karlette Anne
Full Text Available Cardiac diseases in canines are an extensively studied phenomenon all over the world but meagre information has been reported in India. Certain problems, including historical, physical, and laboratory abnormalities, are associated with cardiovascular or pulmonary disease. In India however, the recognition of canine cardiac diseases has been delayed, and ignored on account of lack of awareness and knowledge by the owner and inadequate diagnostic facility to a field veterinarian. Considering the above facts, the present study was undertaken in Gujarat to survey the prevalence of common cardiac diseases in hospital population of dogs along with the clinical symptoms which often goes undetected due to lack of proper diagnostic techniques to be implied and the most forms of heart disease may be present for many years before any evidence of failure develops. In the present study most of the clinical cases of cardiac diseases were presented with a history of nocturnal coughing (seven cases; 2.55%, exercise intolerance (five cases; 1.82%, partial or complete anorexia (five cases; 1.82%, swelling in abdominal area (four cases; 1.45%, dullness and depression (two cases; 0.72%, cachexia and hepatojugular pulsation (one case each; 0.36% each at times. [Vet World 2009; 2(8.000: 307-309
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki
2012-08-01
Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Delgado-Rosas, F; Gaytán, M; Morales, C; Gómez, R; Gaytán, F
2009-05-01
The superficial ovarian cortex constitutes the micro-environment where resting and early growing follicles reside. As small follicles do not possess an independent capillary network, both their survival and early growth depend on their proximity to the cortical vessels. Little is known about the possible changes in superficial ovarian cortex vascularization in normal women throughout reproductive life or in pathological conditions such as polycystic ovary syndrome (PCOS) involving abnormal early follicle growth. We studied the vascularization of the superficial and deep cortical stroma (DCS) in normal cycling ovaries from 21 to 50 years of age and in infertile women with PCOS. We used archival ovarian samples and specific CD34 immunostaining to determine blood vessel density and to analyse correlation with age and with the ovarian follicle reserve. Normal cycling ovaries showed an age-related increase in the superficial cortical stroma vascularization that was inversely correlated with the density of small (primordial and primary) follicles. In contrast, blood vessel density in the DCS significantly decreased in women aged >or=40 years. Ovaries from PCOS showed a 2-fold increase in blood vessel density in both superficial cortical stroma and DCS with respect to age-matched controls. The increased vascularization of the superficial cortical stroma in normal ovaries in relation to age and in ovaries from PCOS could have profound effects on cortical metabolic rate, primordial follicle survival/activation and early follicle growth, and may underline changes in follicle dynamics in mid-aged women and in PCOS.
Bilateral supernumerary primary maxillary canines
Directory of Open Access Journals (Sweden)
Santanu Mukhopadhyay
2018-01-01
Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.
9 CFR 113.306 - Canine Distemper Vaccine.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...
J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides
2002-01-01
Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...
Characterization of the canine urinary proteome.
Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E
2014-06-01
Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.
DEFF Research Database (Denmark)
Malmqvist, Lasse; Wegener, Marianne; Sander, Birgit A
2016-01-01
(P = 0.002) than eyes with buried ODD. There was a correlation between mean peripapillary RNFL thinning and visual field defects as measured by perimetric mean deviation (R-0.66; P = 0.0001). The most frequent visual field abnormalities were arcuate and partial arcuate defects. CONCLUSIONS...... of patients with ODD and to compare the peripapillary RNFL thickness to the extent of visual field defects and anatomic location (superficial or buried) of ODD. METHODS: Retrospective, cross sectional study. RESULTS: A total of 149 eyes of 84 ODD patients were evaluated. Sixty-five percent were female and 76......% had bilateral ODD. Of 149 eyes, 109 had superficial ODD and 40 had buried ODD. Peripapillary RNFL thinning was seen in 83.6% of eyes, where optical coherence tomography was performed (n = 61). Eyes with superficial ODD had greater mean peripapillary RNFL thinning (P ≤ 0.0001) and visual field defects...
Directory of Open Access Journals (Sweden)
Srinivasulu Reddy
2007-09-01
Full Text Available The principal arteries of the upper limb show a wide range of variation that is of considerable interest to orthopedic surgeons, plastic surgeons, radiologists and anatomists. We present here a case of superficial ulnar artery found during the routine dissection of right upper limb of a 50-year-old male cadaver. The superficial ulnar artery originated from the brachial artery, crossed the median nerve anteriorly and ran lateral to this nerve and the brachial artery. The superficial ulnar artery in the arm gave rise to a narrow muscular branch to the biceps brachii. At the elbow level the artery ran superficial to the bicipital aponeurosis where it was crossed by the median cubital vein. It then ran downward and medially superficial to the forearm flexor muscles, and then downward to enter the hand. At the palm, it formed the superficial and deep palmar arches together with the branches of the radial artery. The presence of a superficial ulnar artery is clinically important when raising forearm flaps in reconstructive surgery. The embryology and clinical significance of the variation are discussed.As principais artérias do membro superior apresentam uma ampla variação, que é relativamente importante a cirurgiões ortopédicos e plásticos, radiologistas e anatomistas.Apresentamosumcaso de artéria ulnar superficial encontrada durante dissecção de rotina de membro superior direito de um cadáver masculino de 50 anos de idade.Aartéria ulnar superficial originava-se da artéria braquial, cruzava o nervo mediano anteriormente e percorria lateralmente esse nervo e a artéria braquial. A artéria ulnar superficial no braço deu origem a um ramo muscular estreito do músculo bíceps braquial. Ao nível do cotovelo, a artéria percorria superficialmente a aponeurose bicipital, onde era cruzada pela veia cubital mediana. Percorria, então, em sentido descendente e medialmente superficial aos músculos flexores do antebraço, e então descendia para
Salazar Salazar, Luis Álvaro
1987-01-01
Este trabajo se propone poner al alcance de estudiantes de primeros semestres de carreras de aplicación de la matemática, un algoritmo proporcionado por el álgebra lineal, para tratar con mas generalidad, agilidad y libertad unos objetos de la geometría analítica de no fácil manipulación por otros métodos y que se conocen como superficies de segundo orden o superficies cuádricas. En este orden de ideas, el autor considera importante que con este tratamiento se incluya este tema en una asignat...
Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J
2012-12-01
To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki
2011-09-01
Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.
Ultrasonography of the canine pancreas
Directory of Open Access Journals (Sweden)
Michelle L Avante
2018-01-01
Full Text Available This study describes the ultrasonographic techniques currently used in the evaluation of the canine pancreas. Ultrasonography was the first method to enable direct visualization of the pancreas in humans and it has been subsequently applied to animals. Currently, it is the method of choice for pancreatic evaluation and is essential as a diagnostic tool in the detection of abnormalities, especially tumors. Innovative equipment technology has led to the emergence of techniques complementary to B-mode ultrasound; such as Doppler, elastography, and contrast-enhanced ultrasonography, which have enabled more accurate diagnosis. Doppler provides information on vascular architecture and the hemodynamic aspect of blood vessels in multiple organs. ARFI elastography provides detailed images of the alterations detected by conventional examination (qualitative method and assists in differentiating between benign and malignant processes (quantitative method. Microbubble contrast agents determine parameters related to homogeneous and heterogeneous filling of organs with microbubbles, mainly nodular areas, thus defining high and low intensity patterns.
Malmqvist, Lasse; Wegener, Marianne; Sander, Birgit A; Hamann, Steffen
2016-03-01
Optic disc drusen (ODD) are hyaline deposits located within the optic nerve head. Peripapillary retinal nerve fiber layer (RNFL) thinning is associated with the high prevalence of visual field defects seen in ODD patients. The goal of this study was to investigate the characteristics of patients with ODD and to compare the peripapillary RNFL thickness to the extent of visual field defects and anatomic location (superficial or buried) of ODD. Retrospective, cross sectional study. A total of 149 eyes of 84 ODD patients were evaluated. Sixty-five percent were female and 76% had bilateral ODD. Of 149 eyes, 109 had superficial ODD and 40 had buried ODD. Peripapillary RNFL thinning was seen in 83.6% of eyes, where optical coherence tomography was performed (n = 61). Eyes with superficial ODD had greater mean peripapillary RNFL thinning (P ≤ 0.0001) and visual field defects (P = 0.002) than eyes with buried ODD. There was a correlation between mean peripapillary RNFL thinning and visual field defects as measured by perimetric mean deviation (R-0.66; P = 0.0001). The most frequent visual field abnormalities were arcuate and partial arcuate defects. Peripapillary RNFL thickness correlates with anatomic location (superficial or buried) of ODD. Frequency and extent of visual field defects corresponded with anatomic location of ODD and peripapillary RNFL thickness, suggesting increased axonal damage in patients with superficial ODD.
New and emerging pathogens in canine infectious respiratory disease.
Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J
2014-03-01
Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.
Genetics of Human and Canine Dilated Cardiomyopathy.
Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.
2010-01-01
... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...
Directory of Open Access Journals (Sweden)
J. Van Heerden
2002-07-01
Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E
2002-03-01
Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
9 CFR 113.317 - Parvovirus Vaccine (Canine).
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...
Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L
2016-11-01
The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.
Genetics of Human and Canine Dilated Cardiomyopathy
Directory of Open Access Journals (Sweden)
Siobhan Simpson
2015-01-01
Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H
2014-07-01
This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.
Imaging of the most frequent superficial soft-tissue sarcomas
International Nuclear Information System (INIS)
Morel, Melanie; Taieb, Sophie; Ceugnart, Luc; Penel, Nicolas; Mortier, Laurent; Vanseymortier, Luc; Robin, Y.M.; Gosset, Pierre; Cotten, Anne
2011-01-01
Superficial soft-tissue sarcomas are malignant mesenchymal tumors located within the cutaneous and/or subcutaneous layers. Most superficial soft-tissue sarcomas are low-grade tumors; yet, the risk of local recurrence is high, and initial wide surgery is the main prognostic factor. Some of these superficial sarcomas may grow, following an infiltrative pattern, and their real extent may be underestimated clinically. Imaging techniques are useful to determine precisely the real margins of the tumor, especially in cases of clinically doubtful or recurrent or large superficial lesions. Imaging tools enable one to determine the relationship with the superficial fascia separating the subcutaneous layer from the underlying muscle. In our institution ultrasonographic examination is followed by magnetic resonance (MR) imaging when the size of the lesion exceeds 3-5 cm. Imaging assessment is performed prior to biopsy, enabling optimal surgical management. Imaging features of the main superficial sarcomas are detailed in the following article, according to their major locations: those arising in the epidermis and/or dermis, which are most often diagnosed by dermatologists, and the subcutaneous sarcomas. (orig.)
Imaging of the most frequent superficial soft-tissue sarcomas
Energy Technology Data Exchange (ETDEWEB)
Morel, Melanie; Taieb, Sophie; Ceugnart, Luc [Centre Oscar Lambret, Department of Radiology, Lille (France); Penel, Nicolas [Centre Oscar Lambret, Department of Oncology, Lille (France); Mortier, Laurent [Centre Hospitalier Universitaire de Lille, Department of Dermatology, Hopital Claude Huriez, Lille (France); Vanseymortier, Luc [Centre Oscar Lambret, Department of Surgery, Lille (France); Robin, Y.M. [Centre Oscar Lambret, Departement of Pathology, Lille (France); Gosset, Pierre [Groupement Hospitalier de l' Institut Catholique-Faculte Libre de Medecine de Lille, Department of Pathology, Hopital Saint-Philibert, Lomme (France); Cotten, Anne [Centre Hospitalier Universitaire de Lille, Department of Musculoskeletal Radiology, Centre Hopital Roger Salengro, Lille (France)
2011-03-15
Superficial soft-tissue sarcomas are malignant mesenchymal tumors located within the cutaneous and/or subcutaneous layers. Most superficial soft-tissue sarcomas are low-grade tumors; yet, the risk of local recurrence is high, and initial wide surgery is the main prognostic factor. Some of these superficial sarcomas may grow, following an infiltrative pattern, and their real extent may be underestimated clinically. Imaging techniques are useful to determine precisely the real margins of the tumor, especially in cases of clinically doubtful or recurrent or large superficial lesions. Imaging tools enable one to determine the relationship with the superficial fascia separating the subcutaneous layer from the underlying muscle. In our institution ultrasonographic examination is followed by magnetic resonance (MR) imaging when the size of the lesion exceeds 3-5 cm. Imaging assessment is performed prior to biopsy, enabling optimal surgical management. Imaging features of the main superficial sarcomas are detailed in the following article, according to their major locations: those arising in the epidermis and/or dermis, which are most often diagnosed by dermatologists, and the subcutaneous sarcomas. (orig.)
Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.
Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S
2017-06-03
Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.
Reliability of mandibular canines as indicators for sexual dichotomy.
Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa
2013-02-01
Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.
Approaches to canine health surveillance.
O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C
2014-01-01
Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.
Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y
2016-01-01
New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.
Platelets Inhibit Migration of Canine Osteosarcoma Cells.
Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C
2017-01-01
The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.
9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...
Superficial dose evaluation of four dose calculation algorithms
Cao, Ying; Yang, Xiaoyu; Yang, Zhen; Qiu, Xiaoping; Lv, Zhiping; Lei, Mingjun; Liu, Gui; Zhang, Zijian; Hu, Yongmei
2017-08-01
Accurate superficial dose calculation is of major importance because of the skin toxicity in radiotherapy, especially within the initial 2 mm depth being considered more clinically relevant. The aim of this study is to evaluate superficial dose calculation accuracy of four commonly used algorithms in commercially available treatment planning systems (TPS) by Monte Carlo (MC) simulation and film measurements. The superficial dose in a simple geometrical phantom with size of 30 cm×30 cm×30 cm was calculated by PBC (Pencil Beam Convolution), AAA (Analytical Anisotropic Algorithm), AXB (Acuros XB) in Eclipse system and CCC (Collapsed Cone Convolution) in Raystation system under the conditions of source to surface distance (SSD) of 100 cm and field size (FS) of 10×10 cm2. EGSnrc (BEAMnrc/DOSXYZnrc) program was performed to simulate the central axis dose distribution of Varian Trilogy accelerator, combined with measurements of superficial dose distribution by an extrapolation method of multilayer radiochromic films, to estimate the dose calculation accuracy of four algorithms in the superficial region which was recommended in detail by the ICRU (International Commission on Radiation Units and Measurement) and the ICRP (International Commission on Radiological Protection). In superficial region, good agreement was achieved between MC simulation and film extrapolation method, with the mean differences less than 1%, 2% and 5% for 0°, 30° and 60°, respectively. The relative skin dose errors were 0.84%, 1.88% and 3.90%; the mean dose discrepancies (0°, 30° and 60°) between each of four algorithms and MC simulation were (2.41±1.55%, 3.11±2.40%, and 1.53±1.05%), (3.09±3.00%, 3.10±3.01%, and 3.77±3.59%), (3.16±1.50%, 8.70±2.84%, and 18.20±4.10%) and (14.45±4.66%, 10.74±4.54%, and 3.34±3.26%) for AXB, CCC, AAA and PBC respectively. Monte Carlo simulation verified the feasibility of the superficial dose measurements by multilayer Gafchromic films. And the rank
Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao
2012-07-20
Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.
Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War
1981-06-05
anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges
Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes
2013-01-01
The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.
Directory of Open Access Journals (Sweden)
Mehdi Mohebali
2016-10-01
Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.
Clinical and Statistical Study on Canine Impaction
Directory of Open Access Journals (Sweden)
Adina-Simona Coșarcă
2013-08-01
Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic
Percutaneous intradiscal ozone (O3)-injection: an experimental study in canines
International Nuclear Information System (INIS)
Yu Zhijian; He Xiaofeng; Chen Yong; Zeng Qingle; Liu Chihong; Zhao Zhongqing; Lu Yong; Li Yanhao
2002-01-01
Objective: To evaluate the influence of ozone on normal nucleus pulpous and the safety of intradiscal ozone-injection for the treatment of herniated lumbar disc. Methods: Ozone was injected into selected lumbar discs (3 ml) and the para-spinal space (7 ml) with 20 G Chiba needle under fluoroscopy in five canines. The ozone concentration was 30 μg/ml and 50 μg/ml respectively. Two discs were selected for each concentration. Total 20 discs were injected. Three of the canines were given one-time ozone-injection and were sacrificed for pathology one week, one month and two months respectively after the procedure, and the other two canines were given two-time ozone-injection and were sacrificed one month and two months respectively after the procedure. The specimens including nucleus pulpous, end-plate, spinal cord, nerve root, and greater psoas muscle were observed macroscopically and microscopically. Results: No serious behavior abnormalities were observed in all animals. The atrophy of nucleus pulpous could be observed one month after ozone-injection due to significant reduction of water and extensive proliferation of collagenous fiber. The influence on the atrophy of nucleus pulpous demonstrated no apparent difference between the selected two concentrations of ozone, but was more apparent with two-time injection than that with one-time injection. The end-plates increased slightly or moderately in thickness in 16 simples and a few of fibers in greater psoas muscle suffered slight atrophy in 5 samples. Conclusion: It is suggested that percutaneous intradiscal ozone-injection is a safe method, and can cause gradual atrophy of nucleus pulpous. This study provides the evidence of the feasibility and value of this procedure's application in clinics
Podoplanin Expression in Canine Melanoma.
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-12-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.
Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W
2017-09-01
Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
Vaccines for canine leishmaniasis
Directory of Open Access Journals (Sweden)
Clarisa B. Palatnik-De-Sousa
2012-04-01
Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans
Canine adenovirus type 1 in a fennec fox (Vulpes zerda).
Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku
2014-12-01
A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.
Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y
2013-06-01
Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.
Scanning electron microscopy of superficial white onychomycosis*
de Almeida Jr., Hiram Larangeira; Boabaid, Roberta Oliveira; Timm, Vitor; Silva, Ricardo Marques e; de Castro, Luis Antonio Suita
2015-01-01
Superficial white onychomycosis is characterized by opaque, friable, whitish superficial spots on the nail plate. We examined an affected halux nail of a 20-year-old male patient with scanning electron microscopy. The mycological examination isolated Trichophyton mentagrophytes. Abundant hyphae with the formation of arthrospores were found on the nail's surface, forming small fungal colonies. These findings showed the great capacity for dissemination of this form of onychomycosis. PMID:26560225
Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review
Directory of Open Access Journals (Sweden)
Parviz Torkzaban
2016-09-01
Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.
9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).
2010-01-01
... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...
Orthodontic Traction of Impacted Canine Using Cantilever
Directory of Open Access Journals (Sweden)
Cláudia Nakandakari
2016-01-01
Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.
Transmigration of mandibular canine – case report
International Nuclear Information System (INIS)
Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia
2014-01-01
Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation
The effect of UV-blocking contact lenses as a therapy for canine chronic superficial keratitis.
Denk, Nora; Fritsche, Jens; Reese, Sven
2011-05-01
To evaluate the effect of UV-blocking soft contact lenses in treatment for chronic superficial keratitus (CSK). Twenty six dogs with CSK were treated continuously with UV-blocking contact lenses for 6 months. A contact lens was placed on one eye of each dog; the other eye remained without a lens as a control eye. After this primary study, five of the dogs were further treated and they wore then contact lenses in both eyes. Continuously, all patients were concurrently treated topically with cyclosporine. The contact lenses were changed every 4 weeks and an ophthalmic examination performed. Evaluation criteria included corneal alterations as pigmentation, edema, pannus and vascularization. To determine the transmittance characteristics of the contact lenses before and after use, 32 contact lenses were measured with a UV-vis-NIR spectrophotometer. Pigmentation increased in eyes wearing lenses and in control eyes over the evaluation period of 6 months. Corneal edema increased in the eyes wearing lenses, but remained unaffected in the control eyes. A significant difference in the incidence of pannus and the extent of corneal vascularisation could not be evaluated. Adverse effects were noted in six cases (corneal edema and vascularisation, conjunctivitis, blepharospasm). All new lenses studied reduced UV-radiation to a safe level, whereas used lenses did not maintain their transmittance characteristics. No positive effect of UV-blocking contact lenses could be proven with the study design used. © 2011 American College of Veterinary Ophthalmologists.
Clinico Mycological Study of Superficial Mycoses
Directory of Open Access Journals (Sweden)
Rachana J. Magdum
2016-10-01
Full Text Available Background: Generally it is well established fact that geographical distribution of the fungi may change from time to time; hence this study was planned. Aim and Objectives: To analyze the prevalence of superficial mycoses, its clinical presentation and species identification of the fungal isolates responsible for the disease. Material and Methods: A total 125 clinically diagnosed cases of superficial mycoses visiting Dermatology and Venereology outpatient department of Bharati Hospital, Sangli, for a period of one year were included in the study. Specimens like skin scrapping, nail clipping, hair were collected and subjected to KOH mount and culture. Identification of species was done by macroscopic examination of culture, tease mount and other physiological tests including Urease test, Hair perforation tests and Germ tube test. Results: Superficial mycosis was more common in the age group of 21-30 years (28% and in males (60.8%. The infection was more common in students (29.6%. Tinea corporis (42.4% was the commonest clinical type followed by tinea cruris (22.4%. 61.6% cases were positive by direct microscopy and 60.8% cases showed culture positive. Out of 125 samples, dermatophytes were grown in 63 cases (82.89% followed by non dermatophytic moulds in 10 cases (13.16% and Candida albicans in 3 cases (3.95%. The most common isolate among dermtophytosis was T. rubrum (46.05% followed by T. mentagrophyte (25%. Conclusion: It was concluded that along with dermatophytes, non dermatophytic moulds are also important to cause of superficial mycoses
Heat shock protein expression in canine malignant mammary tumours
International Nuclear Information System (INIS)
Romanucci, Mariarita; Marinelli, Alessia; Sarli, Giuseppe; Salda, Leonardo Della
2006-01-01
Abnormal levels of Heat Shock Proteins (HSPs) have been observed in many human neoplasms including breast cancer and it has been demonstrated that they have both prognostic and therapeutic implications. In this study, we evaluated immunohistochemical expression of HSPs in normal and neoplastic canine mammary glands and confronted these results with overall survival (OS), in order to understand the role of HSPs in carcinogenesis and to establish their potential prognostic and/or therapeutic value. Immunohistochemical expression of Hsp27, Hsp72, Hsp73 and Hsp90 was evaluated in 3 normal canine mammary glands and 30 malignant mammary tumours (10 in situ carcinomas, 10 invasive carcinomas limited to local structures without identifiable invasion of blood or lymphatic vessels, 10 carcinomas with invasion of blood or lymphatic vessels and/or metastases to regional lymph nodes). A semi-quantitative method was used for the analysis of the results. Widespread constitutive expression of Hsp73 and Hsp90 was detected in normal tissue, Hsp72 appeared to be focally distributed and Hsp27 showed a negative to rare weak immunostaining. In mammary tumours, a significant increase in Hsp27 (P < 0.01), Hsp72 (P < 0.05) and Hsp90 (P < 0.01) expression was observed as well as a significant reduction in Hsp73 (P < 0.01) immunoreactivity compared to normal mammary gland tissue. Hsp27 demonstrated a strong positivity in infiltrating tumour cells and metaplastic squamous elements of invasive groups. High Hsp27 expression also appeared to be significantly correlated to a shorter OS (P = 0.00087). Intense immunolabelling of Hsp72 and Hsp73 was frequently detected in infiltrative or inflammatory tumour areas. Hsp90 expression was high in all tumours and, like Hsp73, it also showed an intense positivity in lymphatic emboli. These results suggest that Hsp27, Hsp72 and Hsp90 are involved in canine mammary gland carcinogenesis. In addition, Hsp27 appears to be implicated in tumour invasiveness and
Canine Parvovirus: Current Perspective
Nandi, S.; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...
Characterization of a porcine model of chronic superficial varicose veins.
Jones, Gregory T; Grant, Mark W; Thomson, Ian A; Hill, B Geraldine; van Rij, André M
2009-06-01
Previous animal models of venous disease, while inducing venous hypertension and valvular insufficiency, do not produce superficial varicose veins. In this study, we aimed to develop and characterize a pig-based model of superficial varicose veins. Right femoral arteriovenous fistulae (AVF) were surgically fashioned in young adult pigs. Animals were examined at postoperative times up to 15 weeks to determine the development of varicose veins and measurement of both blood pressure and flow velocities within the superficial thigh veins. Histology and vascular corrosion casts were used to characterize the resulting structural venous alterations. Porcine pathophysiological features were compared with those of human primary superficial varicose veins. Gross superficial varicosities developed over the ipsilateral medial thigh region after an initial lag period of 1-2 weeks. Veins demonstrated retrograde filling with valvular incompetence, and a moderate, non-pulsatile, venous hypertension, which was altered by changes in posture and Valsalva. Venous blood flow velocities were elevated to 15-30 cm/s in varicose veins. Structurally, pig varicose veins were enlarged, tortuous, had valvular degeneration, and regions of focal medial atrophy with or without overlying intimal thickening. The superficial varicose veins, which developed within this model, have a pathophysiology that is consistent with that observed in humans. The porcine femoral AVF model is proposed as a suitable experimental model to evaluate the pathobiology of superficial venous disease. It may also be suitable for the evaluation of treatment interventions including drug therapy.
Superficial herpes simplex virus wound infection following lung transplantation.
Karolak, Wojtek; Wojarski, Jacek; Zegleń, Sławomir; Ochman, Marek; Urlik, Maciej; Hudzik, Bartosz; Wozniak-Grygiel, Elzbieta; Maruszewski, Marcin
2017-08-01
Surgical site infections (SSIs) are infections of tissues, organs, or spaces exposed by surgeons during performance of an invasive procedure. SSIs are classified into superficial, which are limited to skin and subcutaneous tissues, and deep. The incidence of deep SSIs in lung transplant (LTx) patients is estimated at 5%. No reports have been published as to the incidence of superficial SSIs specifically in LTx patients. Common sense would dictate that the majority of superficial SSIs would be bacterial. Uncommonly, fungal SSIs may occur, and we believe that no reports exist as to the incidence of viral wound infections in LTx patients, or in any solid organ transplant patients. We report a de novo superficial wound infection with herpes simplex virus following lung transplantation, its possible source, treatment, and resolution. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
MIYAKOSHI, Daisuke; SENBA, Hiroyuki; SHIKICHI, Mitsumori; MAEDA, Masaya; SHIBATA, Ryo; MISUMI, Kazuhiro
2017-01-01
This study aimed to evaluate whether radiographic abnormalities at yearling sales were associated with the failure to start racing at 2–3 years of age. Radiographic abnormalities in the carpal (n=852), tarsal (n=976), metacarpophalangeal (n=1,055), and metatarsophalangeal joints (n=1,031) from 1,082 horses, recorded at yearling sale, were reviewed. Eighty-two horses (7.6%) failed to start racing. Radiographic abnormalities such as wedged or collapsed tarsal bones, irregular lucency of a sagittal ridge at the distal aspect of the distal third metatarsal bone, and proximal dorsal fragmentation of the first phalanx in metatarsophalangeal joints were associated with failure to start racing in these horses. In the follow-up survey of 12 horses with one or more these radiographic abnormalities, the horses failed to start racing due to reasons unrelated to these radiographic abnormalities such as pelvic fractures (2 horses), fracture of a distal phalanx (1 horse), cervical stenotic myelopathy and proximal sesamoid fracture (1 horse), superficial digital flexor tendonitis (2 horses), laryngeal hemiplegia (1 horse), economic problems (2 horses) and unknown causes (3 horses). Although radiographic abnormalities at yearling sales can be associated with failure to start racing at 2–3 years of age, these radiographically detected abnormalities might not necessarily cause that failure. PMID:28993565
Miyakoshi, Daisuke; Senba, Hiroyuki; Shikichi, Mitsumori; Maeda, Masaya; Shibata, Ryo; Misumi, Kazuhiro
2017-11-10
This study aimed to evaluate whether radiographic abnormalities at yearling sales were associated with the failure to start racing at 2-3 years of age. Radiographic abnormalities in the carpal (n=852), tarsal (n=976), metacarpophalangeal (n=1,055), and metatarsophalangeal joints (n=1,031) from 1,082 horses, recorded at yearling sale, were reviewed. Eighty-two horses (7.6%) failed to start racing. Radiographic abnormalities such as wedged or collapsed tarsal bones, irregular lucency of a sagittal ridge at the distal aspect of the distal third metatarsal bone, and proximal dorsal fragmentation of the first phalanx in metatarsophalangeal joints were associated with failure to start racing in these horses. In the follow-up survey of 12 horses with one or more these radiographic abnormalities, the horses failed to start racing due to reasons unrelated to these radiographic abnormalities such as pelvic fractures (2 horses), fracture of a distal phalanx (1 horse), cervical stenotic myelopathy and proximal sesamoid fracture (1 horse), superficial digital flexor tendonitis (2 horses), laryngeal hemiplegia (1 horse), economic problems (2 horses) and unknown causes (3 horses). Although radiographic abnormalities at yearling sales can be associated with failure to start racing at 2-3 years of age, these radiographically detected abnormalities might not necessarily cause that failure.
Understanding the three-dimensional anatomy of the superficial lymphatics of the limbs.
Tourani, Saam S; Taylor, G Ian; Ashton, Mark W
2014-11-01
There are minimal data in the current literature regarding the depth of the superficial lymphatic collectors of the limbs in relation to the various subcutaneous tissue layers. Injection, microdissection, radiographic, and histologic studies of the superficial lymphatics and the subcutaneous tissues of 32 limbs from 15 human cadavers were performed. Five layers were consistently identified in the integument of all the upper and lower limb specimens: (1) skin, (2) subcutaneous fat, (3) superficial fascia, (4) loose areolar tissue, and (5) deep fascia. Layer 2 was further divided into superficial (2a) and deep (2c) compartments by a thin, transparent, horizontal septum (layer 2b). The main superficial veins and the superficial nerves coursed in layer 4. The lymphatic collectors were found at layer 2c and layer 4. The use of consistent nomenclature to describe the subcutaneous tissue layers facilitates a greater understanding and discussion of the anatomy. In lymphovenous anastomosis for the treatment of lymphedema, indocyanine green lymphography is an unreliable method for identification of the superficial collectors of the thigh. The medial proximal leg, the dorsum of the wrist over the anatomical snuffbox, and the volar proximal forearm provide suitable areas for locating superficial collectors with nearby matching size veins. In vertical medial thigh lift, choosing a dissection plane superficial to the great saphenous vein is unlikely to preserve the collectors of the ventromedial bundle.
Social network extraction based on Web: 1. Related superficial methods
Khairuddin Matyuso Nasution, Mahyuddin
2018-01-01
Often the nature of something affects methods to resolve the related issues about it. Likewise, methods to extract social networks from the Web, but involve the structured data types differently. This paper reveals several methods of social network extraction from the same sources that is Web: the basic superficial method, the underlying superficial method, the description superficial method, and the related superficial methods. In complexity we derive the inequalities between methods and so are their computations. In this case, we find that different results from the same tools make the difference from the more complex to the simpler: Extraction of social network by involving co-occurrence is more complex than using occurrences.
Evaluation of P16 expression in canine appendicular osteosarcoma.
Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K
2017-06-20
Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.
[Superficial venous thrombosis. A state of art].
Sándor, Tamás
2017-01-01
For a long time superficial thrombophlebitis has been thought to be a rather benign condition. Recently, when duplex ultrasound technique is used for the diagnosis more and more often, the disease is proved to be more dangerous than anticipated. Thrombosis propagates to the deep veins in 6-44% and pulmonary embolism was observed on the patients in 1,5-33%. We can calculate venous thromboembolic complications on every fourth patient. Diagnosis is clinical, but duplex ultrasound examination is mandatory, for estimation of the thrombus extent, for exclusion of the deep venous thrombosis and for follow up. Both legs should be checked with ultrasound, because simultaneous deep venous thrombosis can develop on the contralateral limb. Two different forms can be distinguished: superficial venous thrombosis with, or without varicose veins. In cases of spontaneous, non varicous form, especially when the process is migrating or recurrent, a careful clinical examination is necessery for exclusion of malignant diseases and thrombophilia. The treatment options are summarised on the basis of recent international consensus statements. The American and German guidelines are similar. Compression and mobilisation are cornerstones of the therapy. For a short segment thrombosis non steroidal antiinflammatory drugs are effective. For longer segments low molecular-weight heparins are preferred. Information on the effect of the novel oral anticoagulants for the therapy is lacking but they may appear to be effective in the future for this indication. When thrombus is close to the sapheno-femoral or sapheno-popliteal junction crossectomy (high ligation), or low molecular-weight heparin in therapeutic doses are indicated. The term superficial thrombophlebitis should be discouraged, because inflammation and infection is not the primary pathology. It should be called correctly superficial venous thrombosis in order to avoid the unnecessary administration of antibiotics and the misconception
International Nuclear Information System (INIS)
Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin
2015-01-01
Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)
Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.
Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano
2004-10-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.
Skeletal maturity assessment using mandibular canine calcification stages
Directory of Open Access Journals (Sweden)
Vildana Džemidžić
2016-11-01
Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.
A new method for rapid Canine retraction
Directory of Open Access Journals (Sweden)
"Khavari A
2001-06-01
Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.
Headley,Selwyn Arlington; Saito,Taís Berelli
2003-01-01
Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...
Novel canine circovirus strains from Thailand: Evidence for genetic recombination.
Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E
2018-05-14
Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.
International Nuclear Information System (INIS)
Roza, Marcello R.; Fioravanti, Maria Clorinda S.; Silva, Luiz Antonio F.; Barriviera, Mauricio; Januario, Alessandro L.; Bezerra, Ana Cristina B.
2011-01-01
The development of veterinary dentistry has substantially improved the ability to diagnose canine and feline dental abnormalities. Consequently, examinations previously performed only on humans are now available for small animals, thus improving the diagnostic quality. This has increased the need for technical qualification of veterinary professionals and increased technological investments. This study evaluated the use of cone beam computed tomography and intraoral radiography as complementary exams for diagnosing dental abnormalities in dogs and cats. Cone beam computed tomography was provided faster image acquisition with high image quality, was associated with low ionizing radiation levels, enabled image editing, and reduced the exam duration. Our results showed that radiography was an effective method for dental radiographic examination with low cost and fast execution times, and can be performed during surgical procedures
Magnetic resonance findings of the corpus callosum in canine and feline lysosomal storage diseases.
Hasegawa, Daisuke; Tamura, Shinji; Nakamoto, Yuya; Matsuki, Naoaki; Takahashi, Kimimasa; Fujita, Michio; Uchida, Kazuyuki; Yamato, Osamu
2013-01-01
Several reports have described magnetic resonance (MR) findings in canine and feline lysosomal storage diseases such as gangliosidoses and neuronal ceroid lipofuscinosis. Although most of those studies described the signal intensities of white matter in the cerebrum, findings of the corpus callosum were not described in detail. A retrospective study was conducted on MR findings of the corpus callosum as well as the rostral commissure and the fornix in 18 cases of canine and feline lysosomal storage diseases. This included 6 Shiba Inu dogs and 2 domestic shorthair cats with GM1 gangliosidosis; 2 domestic shorthair cats, 2 familial toy poodles, and a golden retriever with GM2 gangliosidosis; and 2 border collies and 3 chihuahuas with neuronal ceroid lipofuscinoses, to determine whether changes of the corpus callosum is an imaging indicator of those diseases. The corpus callosum and the rostral commissure were difficult to recognize in all cases of juvenile-onset gangliosidoses (GM1 gangliosidosis in Shiba Inu dogs and domestic shorthair cats and GM2 gangliosidosis in domestic shorthair cats) and GM2 gangliosidosis in toy poodles with late juvenile-onset. In contrast, the corpus callosum and the rostral commissure were confirmed in cases of GM2 gangliosidosis in a golden retriever and canine neuronal ceroid lipofuscinoses with late juvenile- to early adult-onset, but were extremely thin. Abnormal findings of the corpus callosum on midline sagittal images may be a useful imaging indicator for suspecting lysosomal storage diseases, especially hypoplasia (underdevelopment) of the corpus callosum in juvenile-onset gangliosidoses.
Magnetic resonance findings of the corpus callosum in canine and feline lysosomal storage diseases.
Directory of Open Access Journals (Sweden)
Daisuke Hasegawa
Full Text Available Several reports have described magnetic resonance (MR findings in canine and feline lysosomal storage diseases such as gangliosidoses and neuronal ceroid lipofuscinosis. Although most of those studies described the signal intensities of white matter in the cerebrum, findings of the corpus callosum were not described in detail. A retrospective study was conducted on MR findings of the corpus callosum as well as the rostral commissure and the fornix in 18 cases of canine and feline lysosomal storage diseases. This included 6 Shiba Inu dogs and 2 domestic shorthair cats with GM1 gangliosidosis; 2 domestic shorthair cats, 2 familial toy poodles, and a golden retriever with GM2 gangliosidosis; and 2 border collies and 3 chihuahuas with neuronal ceroid lipofuscinoses, to determine whether changes of the corpus callosum is an imaging indicator of those diseases. The corpus callosum and the rostral commissure were difficult to recognize in all cases of juvenile-onset gangliosidoses (GM1 gangliosidosis in Shiba Inu dogs and domestic shorthair cats and GM2 gangliosidosis in domestic shorthair cats and GM2 gangliosidosis in toy poodles with late juvenile-onset. In contrast, the corpus callosum and the rostral commissure were confirmed in cases of GM2 gangliosidosis in a golden retriever and canine neuronal ceroid lipofuscinoses with late juvenile- to early adult-onset, but were extremely thin. Abnormal findings of the corpus callosum on midline sagittal images may be a useful imaging indicator for suspecting lysosomal storage diseases, especially hypoplasia (underdevelopment of the corpus callosum in juvenile-onset gangliosidoses.
Magnetic Resonance Findings of the Corpus Callosum in Canine and Feline Lysosomal Storage Diseases
Hasegawa, Daisuke; Tamura, Shinji; Nakamoto, Yuya; Matsuki, Naoaki; Takahashi, Kimimasa; Fujita, Michio; Uchida, Kazuyuki; Yamato, Osamu
2013-01-01
Several reports have described magnetic resonance (MR) findings in canine and feline lysosomal storage diseases such as gangliosidoses and neuronal ceroid lipofuscinosis. Although most of those studies described the signal intensities of white matter in the cerebrum, findings of the corpus callosum were not described in detail. A retrospective study was conducted on MR findings of the corpus callosum as well as the rostral commissure and the fornix in 18 cases of canine and feline lysosomal storage diseases. This included 6 Shiba Inu dogs and 2 domestic shorthair cats with GM1 gangliosidosis; 2 domestic shorthair cats, 2 familial toy poodles, and a golden retriever with GM2 gangliosidosis; and 2 border collies and 3 chihuahuas with neuronal ceroid lipofuscinoses, to determine whether changes of the corpus callosum is an imaging indicator of those diseases. The corpus callosum and the rostral commissure were difficult to recognize in all cases of juvenile-onset gangliosidoses (GM1 gangliosidosis in Shiba Inu dogs and domestic shorthair cats and GM2 gangliosidosis in domestic shorthair cats) and GM2 gangliosidosis in toy poodles with late juvenile-onset. In contrast, the corpus callosum and the rostral commissure were confirmed in cases of GM2 gangliosidosis in a golden retriever and canine neuronal ceroid lipofuscinoses with late juvenile- to early adult-onset, but were extremely thin. Abnormal findings of the corpus callosum on midline sagittal images may be a useful imaging indicator for suspecting lysosomal storage diseases, especially hypoplasia (underdevelopment) of the corpus callosum in juvenile-onset gangliosidoses. PMID:24386203
Podoplanin Expression in Canine Melanoma
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-01-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...
Finite element analysis of rapid canine retraction through reducing resistance and distraction
Directory of Open Access Journals (Sweden)
Junjie XUE
2014-01-01
Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.
Canine scent detection of canine cancer: a feasibility study
Directory of Open Access Journals (Sweden)
Dorman DC
2017-10-01
Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of
The usefulness of dermoscopy in canine pattern alopecia: a descriptive study.
Zanna, Giordana; Roccabianca, Paola; Zini, Eric; Legnani, Sara; Scarampella, Fabia; Arrighi, Silvana; Tosti, Antonella
2017-02-01
Dermoscopic studies evaluating noninflammatory, nonpruritic progressive alopecia attributable to pattern alopecia are currently unavailable. To evaluate the dermoscopic features observed in healthy skin of short coated dogs and compare these findings with those observed in dogs affected by pattern alopecia diagnosed by clinical and dermatopathological examination. Thirty male and female, healthy, breed matched, young adult, short coated dogs (controls) and 30 male and female, young adult, short coated dogs affected by pattern alopecia. Dermoscopy was performed with a Fotofinder II videodermoscope equipped with software that allowed the measurement of structures visualized in magnified images (20×-40×-70×). Skin biopsy samples were obtained from the thorax and evaluated dermoscopically for dermoscopic-histological correlation in affected dogs. Dermoscopic findings in canine pattern alopecia were hair shaft thinning, circle hairs and follicular keratin plugs; in the affected sun exposed areas there was a honeycomb-like pattern of pigmentation. Arborizing red lines reflecting vascularization were classified as a nonspecific finding because they were also common in healthy dogs. Dermoscopic features correlated with histology for selected hair follicle abnormalities. Although canine pattern alopecia is a visually striking disease, this study supports the value of dermoscopy for clinical examination and also opens promising perspectives for the identification of diagnostic dermoscopic patterns that may be useful for other skin disorders. © 2016 ESVD and ACVD.
Venous anomalies and abnormalities of the posterior fossa
International Nuclear Information System (INIS)
Goulao, A.; Alvarez, H.; Garcia Monaco, R.; Pruvost, P.; Lasjaunias, P.
1990-01-01
The authors report a series of 16 patients with venous anomalies or abnormalities of the posterior fossa studied by angiography, CT and/or MRI. We believe that so-called 'venous angioma' are extreme anatomic variants that drain normal territories, and we prefer to call them developmental venous anomalies (DVA). Posterior fossa DVA, like the supra-tentorial ones are classified according to their drainage into deep and superficial type. They are exclusively located in the cerebellum or tectum. In 4 cases DVA was an incidental finding, in 3 an associated cerebral venous malformation (CVM) was found and felt to be the cause of the symptoms and only in one (Trigeminal pain) was a link between both suspected. Cavernous venous malformation (CVM) were found in frequent association with DVA (27%). 4 cases were single and 2 multiple. 5 CVM were located in the brain stem and 3 in the cerebellum. The clinical and radiological files were reviewed and a direct relationship between symptoms and localization was found in all patients with CVM. In 2 cases venous dysplasia was found: 1 Sturge-Weber and 1 First branchial arch syndrome. Both posterior fossa venous abnormalities were incidental findings. (orig.)
Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G
2006-11-25
The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.
Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald
2004-01-01
The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.
A rare case of canine anomaly - a possible algorithm for treating it.
Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore
2014-01-01
Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.
Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.
Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong
2017-06-01
Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.
Surgical considerations and management of bilateral labially impacted canines
Directory of Open Access Journals (Sweden)
Yu-Shan Huang
2016-06-01
Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.
Askar, Ibrahím; Sabuncuoglu, Bízden Tavíl
2002-01-01
Neurorraphy, conventional nerve grafting technique, and artificial nerve conduits are not enough for repair in severe injuries of peripheral nerves, especially when there is separation of motor nerve from muscle tissue. In these nerve injuries, reinnervation is indicated for neurotization. The distal end of a peripheral nerve is divided into fascicles and implanted into the aneural zone of target muscle tissue. It is not known how deeply fascicles should be implanted into muscle tissue. A comparative study of superficial and deep implantation of separated motor nerve into muscle tissue is presented in the gastrocnemius muscle of rabbits. In this experimental study, 30 white New Zealand rabbits were used and divided into 3 groups of 10 rabbits each. In the first group (controls, group I), only surgical exposure of the gastrocnemius muscle and motor nerve (tibial nerve) was done without any injury to nerves. In the superficial implantation group (group II), tibial nerves were separated and divided into their own fascicles. These fascicles were implanted superficially into the lateral head of gastrocnemius muscle-aneural zone. In the deep implantation group (group III), the tibial nerves were separated and divided into their own fascicles. These fascicles were implanted around the center of the muscle mass, into the lateral head of the gastrocnemius muscle-aneural zone. Six months later, histopathological changes and functional recovery of the gastrocnemius muscle were investigated. Both experimental groups had less muscular weight than in the control group. It was found that functional recovery was achieved in both experimental groups, and was better in the superficial implantation group than the deep implantation group. EMG recordings revealed that polyphasic and late potentials were frequently seen in both experimental groups. Degeneration and regeneration of myofibrils were observed in both experimental groups. New motor end-plates were formed in a scattered
Immunohistochemical Characterization of Canine Lymphomas
Directory of Open Access Journals (Sweden)
Roxana CORA
2017-11-01
Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.
Stem Cell-Associated Marker Expression in Canine Hair Follicles.
Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J
2016-03-01
Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.
Constable, Peter D; Stämpfli, Henry R
2005-01-01
Acid-base abnormalities frequently are present in sick dogs. The mechanism for an acid-base disturbance can be determined with the simplified strong ion approach, which requires accurate values for the total concentration of plasma nonvolatile buffers (A(tot)) and the effective dissociation constant for plasma weak acids (K(a)). The aims of this study were to experimentally determine A(tot) and K(a) values for canine plasma. Plasma was harvested from 10 healthy dogs; the concentrations of quantitatively important strong ions (Na+, K+, Ca2+, Mg2+, Cl-, L-lactate) and nonvolatile buffer ions (total protein, albumin, phosphate) were determined; and the plasma was tonometered with CO2 at 37 degrees C. Strong ion difference (SID) was calculated from the measured strong ion concentrations, and nonlinear regression was used to estimate values for A(tot) and K(a), which were validated with data from an in vitro and in vivo study. Mean (+/- SD) values for canine plasma were A(tot) = (17.4 +/- 8.6) mM (equivalent to 0.273 mmol/g of total protein or 0.469 mmol/g of albumin); K(a) = (0.17 +/- 0.11) x 10(-7); pK(a) = 7.77. The calculated SID for normal canine plasma (pH = 7.40; P(CO2) = 37 mm Hg; [total protein] = 64 g/L) was 27 mEq/L. The net protein charge for normal canine plasma was 0.25 mEq/g of total protein or 0.42 mEq/g of albumin. Application of the experimentally determined values for A(tot), K(a), and net protein charge should improve understanding of the mechanism for complex acid-base disturbances in dogs.
Chlamydia in canine or feline coronary arteriosclerotic lesions
Directory of Open Access Journals (Sweden)
Grabarevic Zeljko
2011-09-01
Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
Chlamydia in canine or feline coronary arteriosclerotic lesions.
Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas
2011-09-09
There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
A novel bocavirus in canine liver
Directory of Open Access Journals (Sweden)
Li Linlin
2013-02-01
Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.
HISTOPATHOLOGY OF MARGINAL SUPERFICIAL PERIODONTIUM AT MENOPAUSE
Directory of Open Access Journals (Sweden)
A. Georgescu
2012-03-01
Full Text Available Premises: Sexual hormones may affect the general health condition of women, as early as puberty, continuing during pregnancy and also after menopause. Variations of the hormonal levels may cause different – either local or general – pathological modifications. Sexual hormones may also affect periodontal status, favourizing gingival inflammations and reducing periodontal resistance to the action of the bacterial plaque. Scope: Establishment of the correlations between the debut or the manifestation of menopause and the modifications produced in the superficial periodontium. Materials and method: Clinical and paraclinical investigations were performed on female patients with ages between 45 and 66 years, involving macroscopic, microscopic and radiological recording of the aspect of the superificial periodontium (gingiva. Results: Analysis of the histological sections evidenced atrophic and involutive modifications in the marginal superficial periodontium of female patients at menopause. Conclusions: Sexual hormones intervene in the histological equilibrium of the marginal superficial periodontium, influencing the periodontal health status, which explains the correlation between the subjective symptomatology specific to menopause and the histopatological aspect at epithelial level.
Diagnosis and treatment of superficial esophageal cancer.
Barret, Maximilien; Prat, Frédéric
2018-01-01
Endoscopy allows for the screening, early diagnosis, treatment and follow up of superficial esophageal cancer. Endoscopic submucosal dissection has become the gold standard for the resection of superficial squamous cell neoplasia. Combinations of endoscopic mucosal resection and radiofrequency ablation are the mainstay of the management of Barrett's associated neoplasia. However, protruded, non-lifting or large lesions may be better managed by endoscopic submucosal dissection. Novel ablation tools, such as argon plasma coagulation with submucosal lifting and cryoablation balloons, are being developed for the treatment of residual Barrett's esophagus, since iatrogenic strictures still hamper the development of extensive circumferential resections in the esophagus. Optimal surveillance modalities after endoscopic resection are still to be determined. The assessment of the risk of lymph-node metastases, as well as of the need for additional treatments based on qualitative and quantitative histological criteria, balanced to the patient's condition, requires a dedicated multidisciplinary team decision process. The need for trained endoscopists, expert pathologists and surgeons, and specialized multidisciplinary meetings underlines the role of expert centers in the management of superficial esophageal cancer.
Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.
Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H
2016-06-01
Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.
Canine index – A tool for sex determination
Directory of Open Access Journals (Sweden)
Shankar M. Bakkannavar
2015-12-01
Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.
International Nuclear Information System (INIS)
Owczarek, G.; Miszczyk, L.
2005-01-01
Full text: The aim of this study is to evaluate the response of superficially located metastases and local toxicity to microwave hyperthermia combined with radiation therapy. From May 2003 through December 2004 58 patients (33 male, 25 female; mean age 60 years) with lymph nodes or skin metastases were treated with microwave superficial hyperthermia combined with low-dose radiation therapy. Hyperthermia was administered twice weekly with high frequency applicator (∼900 Mhz) with water bolus. The temperature was set to 43 o C for 45 minutes. Radiotherapy was performed daily with dose 2 Gy or 4 Gy per fraction, to a total dose 20 Gy. There were 47 patients with carcinoma, 4 with sarcoma, 7 with melanoma. Treated regions were: head and neck (37 patients), chest wall 8, abdomen wall and groins 4, upper and lower limb 2 and 8 patients respectively. Primary tumor sites were: head and neck region (9 patients), lung 15, alimentary tract 8, breast 5, soft tissue 8, urogenital 4 and 9 patients with primary tumor site unknown. The toxicity was evaluated using 6 step scale: 0-no skin reaction, 1-faint red mark, 2-distinct red mark, 3-blisters, 4-brown mark, 5-necrosis. Presence of pain and its intensity were also analyzed. Diameter of tumor after the treatment was observed. Complete response was achieved in 5 patients (8.5 %), and partial response in 29 patients (50 %), no response was observed in 12 patients (20 %) and progression of tumor in 7 patients (12 %). No skin reaction was observed in 3 patients, faint red mark in 14 patients, distinct red mark in 28 patients, blisters in 8 patients, brown mark in 4 patients and necrosis in 1 patient. The pain occurred in 9 patients but it was no the cause of stopping treatment. Local superficial hyperthermia combined with low-dose radiation therapy is an effective method of treatment in a proportion of patients with superficial metastases. This combination of treatment modalities is well tolerated and is useful for palliation
Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.
Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara
2018-04-01
Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.
Rate of retraction of anterior teeth after canine distraction
Directory of Open Access Journals (Sweden)
Litesh Singla
2017-01-01
Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.
Superficial parotidectomy via facelift incision
Lohuis, Peter J. F. M.; Tan, M. Liane; Bonte, Katrien; van den Brekel, Michiel W. M.; Balm, Alfons J. M.; Vermeersch, Hubert B.
2009-01-01
The stigma of a visually prominent facial scar following parotid surgery can be distressing to a young patient. The surgical technique of parotidectomy via a facelift incision is described and evaluated. Thirty patients with a benign lesion of the parotid gland underwent a partial superficial
Physiological Laterality of Superficial Cerebral Veins on Susceptibility-Weighted Imaging.
Matsushima, Satoshi; Shimizu, Tetsuya; Gomi, Taku; Fukuda, Kunihiko
The purpose of this study is to evaluate whether laterality of the superficial cerebral veins can be seen on susceptibility-weighted imaging (SWI) in patients with no intracranial lesions that affect venous visualization. We retrospectively evaluated 386 patients who underwent brain magnetic resonance imaging including SWI in our institute. Patients with a lesion with the potential to affect venous visualization on SWI were excluded. Two neuroradiologists visually evaluated the findings and scored the visualization of the superficial cerebral veins. Of the 386 patients, 315 (81.6%) showed no obvious laterality on venous visualization, 64 (16.6%) showed left-side dominant laterality, and 7 (1.8%) showed right-side dominant laterality. Left-side dominant physiological laterality exists in the visualization of the superficial cerebral veins on SWI. Therefore, when recognizing left-side dominant laterality of the superficial cerebral veins on SWI, the radiologist must also consider the possibility of physiological laterality.
Canine tooth size and fitness in male mandrills (Mandrillus sphinx).
Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean
2008-07-01
Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.
Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature
Directory of Open Access Journals (Sweden)
Gaurav Sharma
2011-01-01
Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.
Changes in canine electrocardiogram values from three thermal floors in Cundinamarca, Colombia
Directory of Open Access Journals (Sweden)
Marta Elena Sánchez Klinge
2008-06-01
Full Text Available The electrocardiogram is a written register of electric changes that take place in the heart during a heart cycle. The voltage changes are the result of depolarization and repolarization of heart muscle fibers that produce electric changes able to reach body surface and that are detected by electrodes connected to a galvanometer called electrocardiograph. Heart problems are detected with the electrocardiogram, but it is necessary to know the normal values of canine electrocardiogram in a tropical country because values can change compared with normal values reported in other places. The purpose is to show variations of electrocardiogram values from clinically healthy canines from Bogotá D. C at 2600 mosl, Fusagasugá at 1700 mosl and Girardot at 326 mosl. Studied animals were separated in six groups depending on the altitude over sea level and the animal weight (less than 15 Kg and more than 15 Kg. The electrocardiograms were taken with a one channel portable electrocardiograph and derivations I, II, III, aVR, aVL, aVF, CV6LL, CV6LU, CV5RL and V10 were included. Significant differences of electrocardiogram values were observed in derivation II, in relation to the altitude over sea level and to the animals weight, which acquires importance when a diagnose of heart abnormalities is needed from animals located at different altitudes over sea levels.
Asymmetry in development (mineralisation of permanent mandibular canine roots
Directory of Open Access Journals (Sweden)
Burić Mirjana V.
2012-01-01
Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.
Gram, Aykut; Fox, Barbara; Büchler, Urs; Boos, Alois; Hoffmann, Bernd; Kowalewski, Mariusz P
2014-12-01
The prepartum output of PGF2alpha in the bitch is associated with increased placental PGE2-synthase (PTGES) mRNA levels. Contrasting with this is a decreased expression of PGF2alpha-synthase (PGFS/AKR1C3) in uteroplacental compartments during prepartum luteolysis, suggesting an involvement of alternative synthetic pathways in PGF2alpha synthesis, for example, conversion of PGE2 to PGF2alpha. However, because the expression and possible functions of the respective PTGES proteins remained unknown, no further conclusion could be drawn. Therefore, a canine-specific PTGES antibody was generated and used to investigate the expression, cellular localization, and biochemical activities of canine uteroplacental PTGES throughout pregnancy and at prepartum luteolysis. Additionally, the biochemical activities of these tissues involved in the conversion of PGE2 to PGF2alpha were investigated. The endometrial PTGES was localized in the uterine surface epithelium at preimplantation and in superficial and deep uterine glands, endothelial cells, and myometrium throughout pregnancy and at parturition. Placental signals were mostly in the trophoblast. The biochemical properties of recombinant PTGES protein were confirmed. Additionally, expression of two PGE2-receptors, PTGER2/EP2 and PTGER4/EP4, revealed their decreasing expression during luteolysis. In contrast, the uteroplacental expression of prostaglandin transporter (PGT) was strongly elevated prior to parturition. These localization patterns resembled that of PTGES. The increased expression of PTGES and PGT at parturition, together with the accompanying decreased levels of PGE2-receptors and the capability of canine uterine and placental homogenates to take part in the conversion of PGE2 to PGF2alpha, as found in this study, suggest that PGE2 could be used locally as a substrate for prepartum PGF2alpha synthesis in the dog. © 2014 by the Society for the Study of Reproduction, Inc.
Orthodontic management of buccally erupted ectopic canine with two case reports
Directory of Open Access Journals (Sweden)
Avesh Sachan
2012-01-01
Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.
Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel
International Nuclear Information System (INIS)
Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.
2005-01-01
Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old
Canine parvovirus: current perspective.
Nandi, S; Kumar, Manoj
2010-06-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.
Consequences of crown shortening canine teeth in Greenland sled dogs
DEFF Research Database (Denmark)
Kortegaard, H E; Anthony Knudsen, T; Dahl, S
2015-01-01
OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...
Dental anomalies associated with buccally- and palatally-impacted maxillary canines.
Sajnani, Anand K; King, Nigel M
2014-08-01
The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.
SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.
Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi
2017-10-01
Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.
Overexpression of vimentin in canine prostatic carcinoma
DEFF Research Database (Denmark)
Rodrigues, M M P; Rema, A; Gärtner, F
2011-01-01
Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....
Computations in the deep vs superficial layers of the cerebral cortex.
Rolls, Edmund T; Mills, W Patrick C
2017-11-01
A fundamental question is how the cerebral neocortex operates functionally, computationally. The cerebral neocortex with its superficial and deep layers and highly developed recurrent collateral systems that provide a basis for memory-related processing might perform somewhat different computations in the superficial and deep layers. Here we take into account the quantitative connectivity within and between laminae. Using integrate-and-fire neuronal network simulations that incorporate this connectivity, we first show that attractor networks implemented in the deep layers that are activated by the superficial layers could be partly independent in that the deep layers might have a different time course, which might because of adaptation be more transient and useful for outputs from the neocortex. In contrast the superficial layers could implement more prolonged firing, useful for slow learning and for short-term memory. Second, we show that a different type of computation could in principle be performed in the superficial and deep layers, by showing that the superficial layers could operate as a discrete attractor network useful for categorisation and feeding information forward up a cortical hierarchy, whereas the deep layers could operate as a continuous attractor network useful for providing a spatially and temporally smooth output to output systems in the brain. A key advance is that we draw attention to the functions of the recurrent collateral connections between cortical pyramidal cells, often omitted in canonical models of the neocortex, and address principles of operation of the neocortex by which the superficial and deep layers might be specialized for different types of attractor-related memory functions implemented by the recurrent collaterals. Copyright © 2017 Elsevier Inc. All rights reserved.
Vaccines for Canine Leishmaniasis
Directory of Open Access Journals (Sweden)
Faeze Foroughi-Parvar
2014-01-01
Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.
Upper canine inclination influences the aesthetics of a smile.
Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S
2015-02-01
This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.
Echocardiography as an approach for canine cardiac disease diagnosis
Directory of Open Access Journals (Sweden)
P. Singh
2014-11-01
Full Text Available Aim: The aim of the study was to establish the methods for diagnosis various canine cardiac ailments using echocardiography. Materials and Methods: M-mode, two-dimensional echocardiography and Doppler studies were performed on 10 cases. Dogs showing signs of cardiac ailment either clinically, radiographic or via electrocardiographic examination were selected for study. Right parasternal short axis view was used for echocardiographic measurements. Right parasternal long axis and left parasternal apical views were used for Doppler studies. Doppler studies were performed at the level of aortic valve and atrioventricular valves for semi quantitative diagnosis of regurgitation. Results: Dogs were found affected with dilated cardiomyopathy (DCM (n=5, pericardial effusion (PE (n=1, combined PE and DCM (n=2 and remaining two showed abnormality on radiographic or electrographically evaluation but were found out to be normal echocardiographically (n=2. Conclusion: Echocardiography is an effective tool for diagnosis of various heart ailments.
Treatment modalities of palatal impacted canines
Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona
2012-01-01
Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...
Long-term evolution of superficial optic disc drusen
DEFF Research Database (Denmark)
Larsen, Lasse Malmqvist; Lund-Andersen, Henrik; Hamann, Steffen
2017-01-01
with hereditary ODD were included. Results: Mean age at initial and follow-up examination was, respectively, 16.8 and 73.3 years. The median follow-up time was 56 years. A minimal or non-existing change in superficial ODD anatomy (size and number) was seen in 10 of 12 eyes. There was a tendency towards more......Purpose: Optic disc drusen (ODD) is hyaline deposits in the optic nerve head seen in 1-2% of the population. Long-term evolution of ODD anatomy and visual field defects in ODD patients is a key factor for learning more about pathophysiology and prognosis of the condition. With a median follow......-up period of 56 years, this is the first study that evaluates superficial optic disc anatomy and visual fields in patients with ODD over a life span. Methods: Observational case series investigating progression of superficial optic disc anatomy and visual fields in ODD patients. Eight patients...
Oz, A Z; Ciger, S
2018-03-01
The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.
Comprehensive characterization of commercially available canine training aids.
Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A
2014-09-01
Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine
What factors control superficial lava dome explosivity?
Boudon, Georges; Balcone-Boissard, Hélène; Villemant, Benoît; Morgan, Daniel J
2015-09-30
Dome-forming eruption is a frequent eruptive style and a major hazard on numerous volcanoes worldwide. Lava domes are built by slow extrusion of degassed, viscous magma and may be destroyed by gravitational collapse or explosion. The triggering of lava dome explosions is poorly understood: here we propose a new model of superficial lava-dome explosivity based upon a textural and geochemical study (vesicularity, microcrystallinity, cristobalite distribution, residual water contents, crystal transit times) of clasts produced by key eruptions. Superficial explosion of a growing lava dome may be promoted through porosity reduction caused by both vesicle flattening due to gas escape and syn-eruptive cristobalite precipitation. Both processes generate an impermeable and rigid carapace allowing overpressurisation of the inner parts of the lava dome by the rapid input of vesiculated magma batches. The relative thickness of the cristobalite-rich carapace is an inverse function of the external lava dome surface area. Explosive activity is thus more likely to occur at the onset of lava dome extrusion, in agreement with observations, as the likelihood of superficial lava dome explosions depends inversely on lava dome volume. This new result is of interest for the whole volcanological community and for risk management.
Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P
2015-07-01
The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Superficie Específica y Estado Vital de la Materia
J. Hernando Ordoñez
1992-01-01
Se propone reemplazar el término de materia viva por el de estado vital de la materia por considerarlo adecuado, pues la materia es la misma, lo que cambia es su estado. Se estudia la relación entre la superficie específica y el estado vital de la materia. Constante del estado vital y el valor crítico de la superficie específica. Qué es la fuerza de inducción vital? Diferenciación funcional de las células. Cómo regula la unidad biológica su superficie específica? La materia que piens...
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...
99mTc-methoxy-isobutyl-isonitrile (sestamibi) imaging of malignant canine lymphoma
International Nuclear Information System (INIS)
Steyn, P.F.; Ogilvie, G.
1995-01-01
Technetium-99m methoxy-isobutyl-isonitrile (sestamibi) imaging of malignant canine lymphoma was performed in thirteen dogs 1 hour after intravenous injection of 99mTc-sestamibi at 13 MBq (0.35 mCi) per kilogram body weight. Abnormal tracer uptake was visualized in the liver, spleen, bone marrow, and mesenteric, inguinal, popliteal, sternal, cranial cervical and mandibular lymph nodes. Radiopharmaceutical uptake was also noted in a nasal mass. One large neoplastic renal mass did not have demonstrable sestamibi uptake. Other regions had no significant difference in the target:background ratios when compared with values from normal dogs (P > 0.05). 99mTc-sestamibi can be used to image malignant lymphoma, and has potential applications in the management of patients to document response to treatment and to stage of extent of disease
Evaluation of post-vaccination immunity to canine distemper and ...
African Journals Online (AJOL)
SERVER
2007-08-20
Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...
Canine as a biomedical research model: immunological, hematological, and oncological aspects
International Nuclear Information System (INIS)
Shifrine, M.; Wilson, F.D.
1980-01-01
The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies
SUPERFICIAL CERVICAL PLEXUS BLOCK
Directory of Open Access Journals (Sweden)
Komang Mega Puspadisari
2014-01-01
Full Text Available Superficial cervical plexus block is one of the regional anesthesia in neck were limited to thesuperficial fascia. Anesthesia is used to relieve pain caused either during or after the surgery iscompleted. This technique can be done by landmark or with ultrasound guiding. The midpointof posterior border of the Sternocleidomastoid was identified and the prosedure done on thatplace or on the level of cartilage cricoid.
Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan
2014-06-01
More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year
Directory of Open Access Journals (Sweden)
Sophia Pfahler
Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.
Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).
Christiansen, Per
2008-07-01
The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.
Canine length in wild male baboons: maturation, aging and social dominance rank.
Directory of Open Access Journals (Sweden)
Jordi Galbany
Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki
2012-10-01
The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.
IQGAP1 is an oncogenic target in canine melanoma.
Directory of Open Access Journals (Sweden)
Becky H Lee
Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.
Expression and function of survivin in canine osteosarcoma.
Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H
2012-01-01
Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.
American Canine Hepatozoonosis
Ewing, S. A.; Panciera, R. J.
2003-01-01
American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294
National clinical guidelines for management of the palatally ectopic maxillary canine.
Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M
2012-08-01
This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.
Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.
Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka
2016-07-01
Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.
Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.
Directory of Open Access Journals (Sweden)
Emily J Shields
Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.
Severe canine distemper outbreak in unvaccinated dogs in Mozambique
Directory of Open Access Journals (Sweden)
Julieta Zacarias
2016-07-01
Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique
Management of an Unusual Ectopic Eruption of Maxillary Canine.
Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula
2017-05-01
Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.
Cardiac involvement in canine babesiosis : review article
Directory of Open Access Journals (Sweden)
R.G. Lobetti
2005-06-01
Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.
The Ondersteport Canine distemper virus strain and measles ...
African Journals Online (AJOL)
Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...
Management of an impacted and transposed maxillary canine
Directory of Open Access Journals (Sweden)
Deepti A
2010-03-01
Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.
Aspects and clinical procedures of eruptive changes of permanent upper canines
Directory of Open Access Journals (Sweden)
Sheila Marcia Francisco
2012-04-01
Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.
Karami, Mohsen; Sagheb, Soodeh; Mazda, Keyvan
2014-01-01
In previous studies, many indicator factors have been proposed to select patients who need an MRI screening of the spinal canal. In current study, the clinical and radiologic factors including coronal parameters of the curve were evaluated to find out which indicator is more important. A prospective study included 143 consecutive patients with the diagnosis of adolescent idiopathic scoliosis who were treated between 2010 and 2013 at our spinal clinics. Only patients with normal or subtle neurologic findings were included. All patients were evaluated by a total spine MRI protocol for examination of neuroaxial abnormalities. Known indicators and also coronal shift were analysed in all patients with or without abnormal MRI. The incidence of neuroaxial abnormalities was 11.9% (17 of 143); only 5 patients (3.5%) were operated to treat their neuroaxial problem. The significant indicators of the abnormalities in our patients were: younger age at onset, asymmetric superficial abdominal reflex and, coronal shift more than 15 mm (P = 0.03). Some previously known indicators like atypical curves, male gender, double curves and absence of thoracic lordosis were not different between two groups of the patients. A total spine MRI is recommended at presentation in patients with younger age, abnormal neurologic findings and severe coronal shift.
Freeman, G L; Colston, J T; Miller, D D
1994-01-01
The purpose of this study was to evaluate whether abnormalities of free fatty acid metabolism are present before the onset of overt mechanical dysfunction in dogs with tachycardia-induced heart failure. We studied six dogs chronically instrumented to allow assessment of left ventricular function in the pressure-volume plane. Free fatty acid clearance was assessed according to the washout rate of a free fatty acid analog, iodophenylpentadecanoic acid ([123I]PPA or IPPA). IPPA clearance was measured within 1 hour of the hemodynamic assessment. The animals were studied under baseline conditions and 11.7 +/- 3.6 days after ventricular pacing at a rate of 240 beats/min. Hemodynamic studies after pacing showed a nonsignificant increase in left ventricular end-diastolic pressure (11.7 +/- 4.7 to 17.4 +/- 6.5 mm Hg) and a nonsignificant decrease in the maximum derivative of pressure with respect to time (1836 +/- 164 vs 1688 +/- 422 mm Hg/sec). There was also no change in the time constant of left ventricular relaxation, which was 34.8 +/- 7.67 msec before and 35.3 +/- 7.3 msec after pacing. However, a significant prolongation in the clearance half-time of [123I]PPA, from 86.1 +/- 23.9 to 146.5 +/- 22.6 minutes (p < 0.01) was found. Thus abnormal lipid clearance appears before the onset of significant mechanical dysfunction in tachycardia-induced heart failure. This suggests that abnormal substrate metabolism may play an important role in the pathogenesis of this condition.
A randomized clinical study of two interceptive approaches to palatally displaced canines.
Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela
2008-08-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.
International Nuclear Information System (INIS)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-01-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed
Sarbu, Luminita; Kitchell, Barbara E; Bergman, Philip J
2017-02-01
Objectives A xenogeneic human tyrosinase DNA vaccine was developed for treatment of dogs with oral malignant melanoma (Oncept; Merial). No studies have evaluated the safety or efficacy of this vaccine in cats. The purpose of this study was to evaluate the safety of the canine melanoma vaccine in cats diagnosed with melanoma. Methods Medical records were reviewed from cats diagnosed with malignant melanoma and treated with the canine melanoma DNA vaccine (Oncept). Data regarding signalment, melanoma location, treatments received, vaccine adverse effects and cause of death were collected. Results A total of 114 melanoma vaccines were administered to 24 cats. Seven cats (11.4%) had clinical adverse effects from a total of 13 vaccines classified as grade 1 or 2 based on the Veterinary Cooperative Oncology Group's common terminology criteria for adverse events v1.1. These included pain on vaccine administration, brief muscle fasciculation, transient inappetence, depression, nausea and mild increase in pigmentation at the injection site. Nineteen cats were deceased at study close. The most common cause of death was melanoma (14 cats). Hematological and biochemical changes were observed in six cats, five of which had concurrent disease or treatments that likely caused or greatly contributed to the laboratory abnormalities found. Therefore, these adverse events were considered unlikely to be caused by the melanoma vaccine. One cat had transient grade 1 hypoalbuminemia, which was possibly caused by the vaccination but not thoroughly evaluated. Conclusions and relevance The canine melanoma DNA vaccine can be safely administered to cats, with minimal risk of adverse effects.
Directory of Open Access Journals (Sweden)
Mostafa Zargham
2016-01-01
Full Text Available Introduction: It is well-known that pressure from orthodontic appliance can provoke root resorption in dentitions with short roots. The purpose of this case report is to demonstrate two clinical cases with focus on root length in dentitions exposed due to pressure from erupting teeth. This is a pilot study aimed to improve diagnostics for avoiding the resorption of lateral maxillary incisors by pressure from erupting canines. Case Report: The first reported case is of a girl who was 11 years and 7 months old when radiographs showed severe resorption of the lateral incisors, along with malformed central incisors and short roots. The intraoral photos demonstrated light crowding in the maxilla. The orthopantomogram of the girl’s mother demonstrated several short roots. The second reported case is of a girl who was 9 years and 5 months old when radiographs demonstrated nearly complete resorption on her lateral incisor roots, extremely short roots in the central incisors, and short roots. The intraoral photos demonstrated light crowding in the maxilla. The orthopantomogram of the girl’s mother demonstrated extremely short roots in general. Conclusion: This pilot study indicates that short root length in general and abnormal incisor morphology are phenotypic traits that were characteristic for both girls who presented with severe lateral incisor resorption due to erupting canines. Furthermore, short roots were also demonstrated in the mothers. Accordingly, short root length in general could be a phenotypic trait, which should be diagnosed early for preventing severe resorption of lateral incisors during canine eruption.
DETERMINATION OF SUPERFICIAL ABSORBED DOSE FROM EXTERNAL EXPOSURE OF WEAKLY PENETRATING RADIATIONS
Institute of Scientific and Technical Information of China (English)
陈丽姝
1994-01-01
The methods of determining the superficial absorbed dose distributions in a water phantom by means of the experiments and available theories have been reported.The distributions of beta dose were measured by an extrapolation ionization chamber at definite depthes corresponding to some superficial organs and tissues such as the radiosensitive layer of the skin,cornea,sclera,anterior chamber and lens of eyeball.The ratios among superficial absorbed dose D(0.07) and average absorbed doses at the depthes 1,2,3,4,5 and 6mm are also obtained with Cross's methods.They can be used for confining the deterministic effects of some superficial tissues and organs such as the skin and the components of eyeball for weakly penetrating radiations.
Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.
Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul
2017-02-01
The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Canine detection of free-ranging brown treesnakes on Guam
Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.
2011-01-01
We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.
Cryopreservation of microencapsulated canine sperm.
Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu
2011-03-01
The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.
Superficial Priming in Episodic Recognition
Dopkins, Stephen; Sargent, Jesse; Ngo, Catherine T.
2010-01-01
We explored the effect of superficial priming in episodic recognition and found it to be different from the effect of semantic priming in episodic recognition. Participants made recognition judgments to pairs of items, with each pair consisting of a prime item and a test item. Correct positive responses to the test item were impeded if the prime…
Pigmented basal cell carcinoma mimicking a superficial spreading melanoma
Directory of Open Access Journals (Sweden)
Paula Hasbún Acuña
2016-12-01
Full Text Available Resumen El carcinoma basocelular es el cáncer de piel más frecuente, especialmente en personas de edad avanzada. El carcinoma basocelular pigmentado es una variante poco común que se ha descrito en la literatura como una lesión nodular hiperpigmentada. En raras ocasiones puede presentarse en forma de una extensa placa pigmentada, la cual puede ser clínicamente indistinguible del melanoma maligno de extensión superficial y de la enfermedad de Bowen. La dermatoscopía tiene una alta sensibilidad en el diagnóstico del carcinoma basocelular, cuando se utilizan los criterios de Menzies, aunque el diagnóstico final es histopatológico. El objetivo del presente trabajo es reportar y analizar el caso de una paciente con un extenso carcinoma basocelular superficial pigmentado, que simula un melanoma maligno de extensión superficial.
Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2006-01-01
Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.
Management of impacted all canines with surgical exposure and alignment by orthodontic treatment
Directory of Open Access Journals (Sweden)
Radha Katiyar
2013-01-01
Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.
FLT3 mutations in canine acute lymphocytic leukemia
International Nuclear Information System (INIS)
Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L
2011-01-01
FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias
Vaccine-induced canine distemper in a lesser panda.
Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J
1976-11-01
A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.
Alpha-1-antitrypsin studies: canine serum and canine surfactant protein
International Nuclear Information System (INIS)
Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.
1974-01-01
Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)
Canine hip dysplasia: significance of early bony spurring
International Nuclear Information System (INIS)
Morgan, J.P.
1987-01-01
It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head
Radiographic assessment of dental anomalies in patients with ectopic maxillary canines
DEFF Research Database (Denmark)
Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul
2008-01-01
dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...
The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D
Directory of Open Access Journals (Sweden)
Markéta Vaňková
2016-01-01
Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Directory of Open Access Journals (Sweden)
Sumitra
2012-01-01
Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.
Difficulties in estimating the human burden of canine rabies.
Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H
2017-01-01
Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-10-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.
Superficial x-ray in-vivo dosimetry with MOSFET detectors
International Nuclear Information System (INIS)
Cheung, T.; Yu, P.K.N.; Butson, M.J.; Cancer Services, Wollongong, NSW
2004-01-01
Full text: This note investigates in-vivo dosimetry using a Metal Oxide Semiconductor Field Effect Transistor (MOSFET) for radiotherapy treatment at superficial and orthovoltage x-ray energies. This was performed within one fraction of the patient's treatment. Standard measurements along with energy response of the detector are given. Results showed that the MOSFET measurements in-vivo agreed with calculated results on average within ± 5.6% over all superficial and orthovoltage energies. These variations were slightly larger than TLD results with variations between measured and calculated results being ± 5.0% for the same patient measurements. The MOSFET device provides adequate in-vivo dosimetry for superficial and orthovoltage energy treatments with the accuracy of the measurements seeming to be relatively on par with TLD in our case. The MOSFET does have the advantage of returning a relatively immediate dosimetric result after irradiation. Copyright (2004) Australasian College of Physical Scientists and Engineers in Medicine
Lotspeich, Erica; Kitts, Kelley; Goodpaster, John
2012-07-10
It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar
2009-12-10
Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.
Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).
Glickman, L T; Appel, M J
1981-08-01
Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.
Current practices and research updates on diabetes mellitus in canine
Directory of Open Access Journals (Sweden)
Pankaj Kumar
2014-11-01
Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.
Eruption of the maxillary canines in relation to skeletal maturity.
Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica
2008-05-01
Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.
Citizen science: a new direction in canine behavior research.
Hecht, Julie; Spicer Rice, Eleanor
2015-01-01
Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.
Antiviral effect of lithium chloride on infection of cells by canine parvovirus.
Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun
2015-11-01
Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.
Clinicomycological Characterization of Superficial Mycoses from a Tertiary Care Hospital in Nepal.
Khadka, Sundar; Sherchand, Jeevan Bahadur; Pokharel, Dinesh Binod; Pokhrel, Bharat Mani; Mishra, Shyam Kumar; Dhital, Subhash; Rijal, Basista
2016-01-01
Background . Superficial mycosis is a common fungal infection worldwide, mainly caused by dermatophytes. However, the prevalence of species varies geographically. In addition, fungal treatment is best guided according to species isolated. This study was carried out to determine the clinical as well as mycological profile of superficial mycoses in a tertiary care hospital, Nepal. Methods . This was a prospective case-control laboratory based study conducted over a period of six months from January to June 2014 at Tribhuvan University Teaching Hospital, Nepal. A total of 200 specimens were collected from the patients suspected of superficial mycoses. The specimens were macroscopically as well as microscopically examined. The growth was observed up to 4 weeks. Results. Out of total 200 specimens from the patients suspected of superficial mycoses, tinea corporis 50 (25%) was most common clinical types. KOH mount was positive in 89 (44.5%) and culture was positive in 111 (55.5%). Trichophyton mentagrophytes 44 (39.6%) was the most common isolate. Conclusions. The diagnostic yields of KOH mount and culture were found to be complementary to each other. Thus both the methods added with clinical findings are equally important to establish superficial mycosis.
Clinicomycological Characterization of Superficial Mycoses from a Tertiary Care Hospital in Nepal
Directory of Open Access Journals (Sweden)
Sundar Khadka
2016-01-01
Full Text Available Background. Superficial mycosis is a common fungal infection worldwide, mainly caused by dermatophytes. However, the prevalence of species varies geographically. In addition, fungal treatment is best guided according to species isolated. This study was carried out to determine the clinical as well as mycological profile of superficial mycoses in a tertiary care hospital, Nepal. Methods. This was a prospective case-control laboratory based study conducted over a period of six months from January to June 2014 at Tribhuvan University Teaching Hospital, Nepal. A total of 200 specimens were collected from the patients suspected of superficial mycoses. The specimens were macroscopically as well as microscopically examined. The growth was observed up to 4 weeks. Results. Out of total 200 specimens from the patients suspected of superficial mycoses, tinea corporis 50 (25% was most common clinical types. KOH mount was positive in 89 (44.5% and culture was positive in 111 (55.5%. Trichophyton mentagrophytes 44 (39.6% was the most common isolate. Conclusions. The diagnostic yields of KOH mount and culture were found to be complementary to each other. Thus both the methods added with clinical findings are equally important to establish superficial mycosis.
Directory of Open Access Journals (Sweden)
Vanessa Miroski Gerente
2008-04-01
Full Text Available OBJETIVO: Avaliar a epidemiologia do trauma ocular por corpo estranho superficial de córnea. MÉTODOS: Os pacientes atendidos no Pronto-Socorro da Universidade Federal de São Paulo entre abril e junho de 2005 que apresentaram corpo estranho superficial de córnea foram entrevistados. Foram avaliados: sexo, idade, profissão, registro legal do emprego, uso, disponibilidade e tipo de equipamentos de proteção utilizados e a fiscalização do seu uso. O conhecimento das complicações deste tipo de acidente também foi avaliado. Os resultados foram analisados com teste do qui quadrado ou teste de Fisher. RESULTADOS: Foram entrevistados 123 pacientes. Apenas 3 eram do sexo feminino e a idade média foi de 36 anos. A maioria destes traumas ocorreu no ambiente de trabalho (86,2% e 58,4% não possuíam registro legal do emprego. As profissões mais freqüentemente envolvidas foram serralheiro, pedreiro e metalúrgico. Em 79,8% dos locais de trabalho havia equipamentos de proteção e 85,3% dos pacientes eram orientados a usá-los. Em 52,4% dos locais sua utilização era fiscalizada, mas apenas 34,2% usavam no momento do trauma. A utilização foi mais freqüente (p=0,008 e fiscalização mais presente (p=0,0415 entre pacientes com registro legal de emprego. Questionados sobre os riscos, 68,9% dos pacientes tinham consciência das complicações graves deste tipo de acidente. CONCLUSÃO: A maioria dos pacientes tem conhecimento sobre a gravidade do trauma ocular e este tipo de lesão ocorre mesmo em locais com equipamentos de proteção disponíveis, alguns deles até durante o seu uso. Os dados sugerem que enfoque maior da prevenção deve ser na fiscalização e utilização de equipamentos adequados.PURPOSE: To evaluate the epidemiology of superficial corneal foreign body. METHODS: Patients who were seen at the Emergency Service of the Federal University of São Paulo, from April/05 to June/05, were screened and those with superficial corneal
Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe
2018-04-01
Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.
Ultrasonographic evaluation of the canine shoulder.
Long, C D; Nyland, T G
1999-01-01
The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.
The Comparative Diagnostic Features of Canine and Human Lymphoma
Directory of Open Access Journals (Sweden)
Davis M. Seelig
2016-06-01
Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
The Comparative Diagnostic Features of Canine and Human Lymphoma.
Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A
2016-06-01
The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
Directory of Open Access Journals (Sweden)
Shalini Gupta
2014-01-01
Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.
[Nonsurgical endodontic treatment of an invaginated canine].
Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P
1989-01-01
We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.
Canine babesiosis: from molecular taxonomy to control
Directory of Open Access Journals (Sweden)
Irwin Peter J
2009-03-01
Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.
Genetic characterization of canine influenza A virus (H3N2) in Thailand.
Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn
2014-02-01
In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.
Ultrasound of musculoskeletal soft-tissue tumors superficial to the investing fascia.
Hung, Esther Hiu Yee; Griffith, James Francis; Ng, Alex Wing Hung; Lee, Ryan Ka Lok; Lau, Domily Ting Yi; Leung, Jason Chi Shun
2014-06-01
The objective of our study was to evaluate the diagnostic accuracy of ultrasound in assessing musculoskeletal soft-tissue tumors superficial to the investing fascia. Seven hundred fourteen superficial soft-tissue tumors evaluated with ultrasound by two musculoskeletal radiologists were retrospectively reviewed. In all ultrasound reports, the reporting radiologists provided one, two, or three diagnoses depending on their perceived level of diagnostic certainty. Two hundred forty-seven tumors had subsequent histologic correlation, thus allowing the accuracy of the ultrasound diagnosis to be determined. Images of the lesions with a discordant ultrasound diagnosis and histologic diagnosis were reviewed, and the ultrasound features were further classified as concordant with the known histologic diagnosis, concordant with the known histologic diagnosis with atypical features present, or discordant with the known histologic diagnosis. Four hundred sixty-seven tumors without pathologic confirmation were followed up clinically. Overall the accuracy of ultrasound examination for assessing superficial soft-tissue masses was 79.0% when all differential diagnoses were considered and 77.0% when only the first differential diagnosis was considered. The sensitivity and specificity of the first ultrasound diagnosis were 95.2% and 94.3%, respectively, for lipoma; 73.0% and 97.7% for vascular malformation; 80.0% and 95.4% for epidermoid cyst; and 68.8% and 95.2% for nerve sheath tumor. Reduced observer awareness of specific tumor entities tended to contribute to underdiagnosis more than poor specificity of ultrasound findings. Most tumors (236/247, 96%) were benign. The sensitivity and specificity of ultrasound for identifying malignant superficial soft-tissue tumors was 94.1% and 99.7%, respectively. The diagnostic accuracy of ultrasound in the assessment of superficial musculoskeletal soft-tissue tumors is high and can be improved through increased radiologist awareness of less
Glucosamine and chondroitin use in canines for osteoarthritis: A ...
African Journals Online (AJOL)
Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...
A case of unusual root morphology: Maxillary canine with two roots
Directory of Open Access Journals (Sweden)
Nagesh Bolla
2009-01-01
Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.
Volumetric Modulated Arc Therapy (VMAT) Treatment Planning for Superficial Tumors
International Nuclear Information System (INIS)
Zacarias, Albert S.; Brown, Mellonie F.; Mills, Michael D.
2010-01-01
The physician's planning objective is often a uniform dose distribution throughout the planning target volume (PTV), including superficial PTVs on or near the surface of a patient's body. Varian's Eclipse treatment planning system uses a progressive resolution optimizer (PRO), version 8.2.23, for RapidArc dynamic multileaf collimator volumetric modulated arc therapy planning. Because the PRO is a fast optimizer, optimization convergence errors (OCEs) produce dose nonuniformity in the superficial area of the PTV. We present a postsurgical cranial case demonstrating the recursive method our clinic uses to produce RapidArc treatment plans. The initial RapidArc treatment plan generated using one 360 o arc resulted in substantial dose nonuniformity in the superficial section of the PTV. We demonstrate the use of multiple arcs to produce improved dose uniformity in this region. We also compare the results of this superficial dose compensation method to the results of a recursive method of dose correction that we developed in-house to correct optimization convergence errors in static intensity-modulated radiation therapy treatment plans. The results show that up to 4 arcs may be necessary to provide uniform dose to the surface of the PTV with the current version of the PRO.
Superficial siderosis of the central nervous system - A case report
International Nuclear Information System (INIS)
Mannalini, S.
1997-01-01
There is little information on superficial siderosis of the central nervous system (CNS) in the literature, mainly due to the rarity of the disease, the difficulties in diagnosis (autopsy pre magnetic resonance imaging (MRI)) and the long latency of the symptoms. With the advent of MRI, for the first time we are able to make a positive in vivo diagnosis. But this comes at a time of less disease incidence, and little clinical awareness. MRI is able to make the diagnosis because of the strong paramagnetic effect of haemosiderin, the blood by-product that is deposited on the brain surface in superficial siderosis of the CNS. The ability of the brain to biosynthesize ferritin in response to prolonged contact with haemosiderin is thought to be the most important factor in the pathogenesis of superficial siderosis. (author)
Energy Technology Data Exchange (ETDEWEB)
Carrera G, L.M.; Garcia S, I.; Jimenez B, J.; Solache R, M.; Lopez M, B.; Bulbulian G, S.; Olguin G, M.T. [Departamento de Quimica, Gerencia de Ciencias Basicas, Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, 11801 Mexico D.F. (Mexico)
2000-07-01
The activated carbon is the resultant material of the calcination process of natural carbonated materials as coconut shells or olive little bones. It is an excellent adsorbent of diluted substances, so much in colloidal form, as in particles form. Those substances are attracted and retained by the carbon surface. In this work is make the volumetric and superficial characterization of activated carbon treated thermically (300 Centigrade) in function of the grain size average. (Author)
Purification and partial characterization of canine S100A12.
Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M
2010-12-01
Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the
Recent developments in Canine Cognitive Dysfunction Syndrome
Directory of Open Access Journals (Sweden)
Alejandro Seisdedos Benzal
2016-04-01
Full Text Available Canine Cognitive Dysfunction Syndrome (CCD is a neurodegenerative disease affecting aging dogs. CCD is an underdiagnosed disease that involves at least 14% of geriatric dogs, but apparently less than 2% of diseased dogs are diagnosed. There are several physiopathological similarities between Alzheimer disease (AD and CCD, developing amyloid-β deposits in brain parenchyma and blood vessels, brain atrophy and neuronal loss. The clinical signs lead to behavioural changes. They are unspecific and could appear as soon as seven years of age, but are more relevant in senior dogs. The abnormal behaviour could be classified following the acronym DISHA: Disorientation in the immediate environment; altered Interactions with humans and other animals; Sleep-wake cycle disturbances; House-soiling; and changes in Activity levels. There is no specific diagnostic test or biomarker to demonstrate the presence of CCD; therefore, it is often assessed by ruling out other diseases that may cause similar behavioural changes. Veterinarians have to be able to make an accurate account of veterinary history asking for abnormal behaviour that could be misreported by the owners. CCD is a neurodegenerative disorder that cannot be cured. It is possible to delay the progression of the clinical signs and improve the quality of life of patients, but like in AD, the progression of the illness will depend on the individual. There are three treatment pathways, which could be used in combination: drug therapy to improve cognition and reduce anxiety, antioxidant diet and nutraceutical supplements to reduce the progression of the illness, and finally, environmental enrichment to maintain brain activity. The aim of this review article is to contribute to the knowledge of the illness, presenting recent advances in the pathophysiology, diagnosis and treatment of the disease
Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E
2016-11-01
The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of
Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.
von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H
2008-05-01
Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.
Clinicopahological features of superficial basaloid squamous cell carcinoma of the esophagus.
Oguma, J; Ozawa, S; Kazuno, A; Nitta, M; Ninomiya, Y; Tomita, S
2017-12-01
Basaloid squamous cell carcinoma (BSC) of the esophagus is classified as an epithelial malignant tumor and is a rare variant of squamous cell carcinoma (SCC). Most previous reports have suggested that advanced BSC has a poorer prognosis than typical SCC because of its high biological malignancy, but the biological activity of superficial BSC remains unclear. Twenty cases of superficial BSC, which underwent surgical resection in Tokai University Hospital between January 2004 and December 2013, were analyzed retrospectively. Among these cases, 19 cases with a T1 depth of invasion (BSC group) were compared with 180 cases of SCC that were resected during the same period and were pathologically diagnosed as T1 (SCC group). The frequency of lymph node metastasis in the T1 BSC group was significantly lower (2 patients, 11%) than that in the SCC group (84 patients, 47%) (P = 0.005). The frequency of lymphatic invasion in the BSC group was also lower (9 patients, 47%) than that in the SCC group (131 patients, 73%) (P = 0.021). The pathological type of the metastatic lymph node was BSC in all the superficial BSC cases with lymph node metastasis. This study demonstrated that lymph node metastasis was less likely to occur in cases with superficial BSC than in cases with superficial SCC. © The Authors 2017. Published by Oxford University Press on behalf of International Society for Diseases of the Esophagus. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Orthodontic Traction of Impacted Canine Using Cantilever
Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé
2016-01-01
The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...
Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon
2016-02-01
To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Detection of canine pneumovirus in dogs with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe
2013-12-01
Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.
Directory of Open Access Journals (Sweden)
Patil Sandeep S
2012-01-01
Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.
Wilmes, Benedict; Drescher, Dieter
2009-05-01
In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.
Mylonakis, Mathios E; Leontides, Leonidas; Gonen, Liat; Billinis, Charalambos; Koutinas, Alexander F; Baneth, Gad
2005-05-15
The prevalence of IgG antibodies to Hepatozoon canis and the presence of gamonts in the blood and hemolymphatic tissues were studied in dogs with canine monocytic ehrlichiosis (CME) caused by Ehrlichia canis. Both pathogens are transmitted by the tick Rhipicephalus sanguineus. Forty-five out of 69 (65.2%) dogs with CME were seropositive to H. canis by an enzyme-linked immunosorbent assay (ELISA). Intra-neutrophilic gamonts of H. canis were found in 2 out of 69 dogs (2.9%) comprising 4.5% of the seropositive dogs. The present study indicated that the prevalence of antibodies to H. canis was high among dogs with CME in an area where both infections are endemic. However, previous exposure to H. canis was not found as an important contributor to clinical or clinicopathologic abnormalities found in dogs with CME.
Chen, Wei-Hsin; Lu, Ke-Miao; Liu, Shih-Hsien; Tsai, Chi-Ming; Lee, Wen-Jhy; Lin, Ta-Chang
2013-10-01
The reaction characteristics of four biomass materials (i.e. oil palm fiber, coconut fiber, eucalyptus, and Cryptomeria japonica) with non-oxidative and oxidative torrefaction at various superficial velocities are investigated where nitrogen and air are used as carrier gases. Three torrefaction temperatures of 250, 300, and 350 °C are considered. At a given temperature, the solid yield of biomass is not affected by N2 superficial velocity, revealing that the thermal degradation is controlled by heat and mass transfer in biomass. Increasing air superficial velocity decreases the solid yield, especially in oil palm fiber and coconut fiber, implying that the torrefaction reaction of biomass is dominated by surface oxidation. There exists an upper limit of air superficial velocity in the decrement of solid yield, suggesting that beyond this limit the thermal degradation of biomass is no longer governed by surface oxidation, but rather is controlled by internal mass transport. Copyright © 2013 Elsevier Ltd. All rights reserved.
Genetics of Human and Canine Dilated Cardiomyopathy
Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...
Orthodontic treatment of a complete transposed impacted maxillary canine
Directory of Open Access Journals (Sweden)
Pi-Huei Liu
2015-03-01
Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.
Aneurysm of the superficial femoral artery in an infant
Energy Technology Data Exchange (ETDEWEB)
Watanabe, M.; Komuro, H.; Matoba, K.; Kaneko, M. [Dept. of Paediatric Surgery, Inst. of Clinical Medicine, Univ. of Tsukuba, Ibaraki (Japan); Niitsu, M.; Itai, Y. [Dept. of Radiology, Inst. of Clinical Medicine, Univ. of Tsukuba, Ibaraki (Japan)
2003-04-01
An isolated arterial aneurysm in childhood is extremely rare. We report a 1-year-old girl with an aneurysm of the right superficial femoral artery, presenting as an asymptomatic mass of the thigh. The aneurysm involved the whole superficial femoral artery (9 cm in length), and surgical treatment would have required replacement of the affected artery. Conservative treatment was chosen, influenced by the patient's rapid growth at that time. Non-invasive, 3-D contrast-enhanced magnetic resonance angiography (MRA) was useful as an alternative to conventional angiography for detailed evaluation of the femoral arteries, including the aneurysm. (orig.)
Tooth fractures in canine clinical practice
International Nuclear Information System (INIS)
Capik, I.; Ledecky, V.; Sevcik, A.
2001-01-01
Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients
Micheels, Patrick; Besse, Stéphanie; Sarazin, Didier
2017-01-01
Background: Few hyaluronic acid fillers have been developed for superficial injection. Objective: To compare the diffusion and integration properties of cohesive polydensified matrix and Vycross® technology hyaluronic acid fillers with lidocaine following injection into the superficial reticular dermis. Methods and materials: Two subjects received two injections each of cohesive polydensified matrix and Vycross® hyaluronic acid (0.2mL/site) in the superficial reticular dermis of the buttock u...
Canine faecal contamination and parasitic risk in the city of Naples (southern Italy
Directory of Open Access Journals (Sweden)
Veneziano Vincenzo
2006-09-01
Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between
Current state of knowledge: the canine gastrointestinal microbiome.
Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S
2012-06-01
Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.
Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis
2014-04-23
Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from
Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio
2016-08-30
A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.
Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study
Directory of Open Access Journals (Sweden)
Zeeshan Iqbal Bhat
2013-01-01
Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.
Directory of Open Access Journals (Sweden)
Laura Nordio
2017-05-01
Full Text Available FXR1 (Fragile X mental retardation-related protein 1 is a cytoplasmic RNA binding protein, which genetic expression has been related to metastatic potential in human melanoma. The aims of the present study were: the validation of two commercially available clones of polyclonal anti-human FXR1 antibody in dogs; their application to investigate FXR1 expression in a group of canine oral melanomas. Anti-FXR1 antibody was not previously validated in the canine species. Two different commercially available polyclonal anti-FXR1 antibodies (respectively made in goat and in rabbit were used. FXR1 protein in canine serum was identified by western blot after SDS-PAGE, using human serum as control. FXR1 immunohistochemical expression was tested in a series of normal tissues, that are expected to express FXR1, and in 31 cases of oral melanomas. The final immunohistochemical protocol used heat-induced unmasking and overnight incubation. FXR1 protein bands in canine serum were detected by tested antibodies, in a more specific way by the rabbit antibody. FXR1 immunohistochemical staining was positive in all tested organs, with different levels of expression. FXR1 was also expressed in 31/31 tested melanomas, with variable intensity and percentage of positive cells (Figure 1. Equal results were achieved with the two antibodies in 8 cases of melanoma, whereas there were variable differences in 22, and one case stained only with goat antibody. The rabbit antibody gave less background staining. This study validated anti-FXR1 antibodies for use in the canine species. This protein was expressed in various normal tissues, as well as in the tested neoplasms. Significance of different level of expression is undergoing evaluation with further studies.
Models of experimental saccular aneurysms of carotid arteries in canine
International Nuclear Information System (INIS)
Zhang Haixia; Cheng Yingsheng; Li Minghua
2006-01-01
Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)
Testosterone biotransformation by the isolated perfused canine pancreas
International Nuclear Information System (INIS)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis
Testosterone biotransformation by the isolated perfused canine pancreas
Energy Technology Data Exchange (ETDEWEB)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.
Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations
Directory of Open Access Journals (Sweden)
Steiner JM
2014-10-01
Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test
Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.
Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H
2006-02-01
The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Sumitra
2012-01-01
A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811
Directory of Open Access Journals (Sweden)
Robert Cullen
2017-06-01
Full Text Available Objective: Iliopsoas injury and strain is a commonly diagnosed disease process, especially amongst working and sporting canines. There has been very little published literature regarding iliopsoas injuries and there is no information regarding the ultrasound evaluation of abnormal iliopsoas muscles. This manuscript is intended to describe the ultrasound findings in 73 canine agility athletes who had physical examination findings consistent with iliopsoas discomfort. The population was chosen given the high incidence of these animals for the development of iliopsoas injury; likely due to repetitive stress.Methods: Medical records of 73 agility performance canines that underwent musculoskeletal ultrasound evaluation of bilateral iliopsoas muscle groups were retrospectively reviewed. Data included signalment, previous radiographic findings, and ultrasound findings. A 3-tier grading scheme for acute strains was used while the practitioner also evaluated for evidence of chronic injury and bursitis.Results: The majority of pathologies were localised to the tendon of insertion, with the majority being low grade I-II strains (80.8%. Tendon fibre disruption (71.2% and indistinct hypoechoic lesions (91.8% were the most common of acute changes noted. Hyperechoic chronic changes were noted in 84.9 percent of cases. Acute and chronic changes were commonly seen together (62.8%.Conclusion: Diagnostic musculoskeletal ultrasound was used to identify lesions of the iliopsoas tendon consistent with acute and chronic injury, as well as identifying the region of pathology. The majority of agility performance dogs had low grade acute strains based on the tiered system, with mixed acute and chronic lesions being noted frequently.Application: Diagnostic musculoskeletal ultrasound provides a non-invasive diagnostic modality for patients suspected of having an iliopsoas strain.
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M
2018-01-01
Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Directory of Open Access Journals (Sweden)
Cecilia M Lopez
Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
Malignant transformation of superficial peritoneal endometriosis lesion.
Marchand, Eva; Hequet, Delphine; Thoury, Anne; Barranger, Emmanuel
2013-08-26
A 63-year-old woman with no medical history underwent an abdominal surgery with hysterectomy and bilateral salpingo-oophorectomy for a 10 cm peritoneal cyst with increased cancer antigene-125. A large suspicious tumour of the Douglas space, with contact to the uterus and the rectal wall was described. The rest of the exploration was normal, specially the rest of the peritoneum. Histopathology revealed a malignant transformation of a superficial peritoneal endometriosis. Secondary surgery was thus completed by laparoscopy with bilateral pelvic and para-aortic lymph node dissections, omentectomy and multiple peritoneal biopsies. All staging samples were free of cancer; therefore no complementary therapy was administered. After 18 months of follow-up, consisting of clinical examination and pelvis magnetic resonance imaging every 6 months, we did not observe any recurrence. Malignant transformation of superficial peritoneal endometriosis is a rare disease and surgical management seems to be the main treatment.
Castelli di carta. La piega per la costruzione di superfici articolate
Directory of Open Access Journals (Sweden)
Andrea Casale
2012-06-01
Full Text Available L’antica arte del piegare la carta, l’Origami, sta vivendo un rinnovato interesse che coinvolge molti aspetti della ricerca. Con il termine origami, si intende lo studio del modo di piegare il foglio di carta per imporgli una specifica forma. La superficie tassellata per mezzo di specifiche pieghe, si propone come un nuovo soggetto di studio: la superficie piegata articolata. La forma congiunta al movimento, assume un particolare interesse nella contemporanea ricerca geometrica e architettonica. Il panorama contemporaneo, propone opere di architettura “responsiva”, capaci di modificare le proprie caratteristiche per adeguarsi a nuove condizioni. La superficie piegata articolata sembra particolarmente adatta a descrivere questo modo d’intendere l’architettura, reagendo a diverse volontà e di conseguenza modificando la propria conformazione attraverso un attento controllo progettuale della forma.
Directory of Open Access Journals (Sweden)
Francisco Maduell
2015-05-01
Conclusión: El incremento del 40% y el 80% de la superficie conlleva un aumento del volumen convectivo de un 6 y un 16% respectivamente, aunque se evidenció una reducción en su máximo rendimiento, mostrando mínimas diferencias tanto en el volumen convectivo como en la capacidad depurativa cuando el CUF era superior a 45 ml/h/mmHg. Es recomendable optimizar el rendimiento de los dializadores a la mínima superficie posible adecuando la prescripción de tratamiento.
Homologous radioimmunoassay for canine prolactin and its application in various physiological states
International Nuclear Information System (INIS)
Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.
1977-01-01
The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)
Superficial fungal infections.
Schwartz, Robert A
Superficial fungal infections arise from a pathogen that is restricted to the stratum corneum, with little or no tissue reaction. In this Seminar, three types of infection will be covered: tinea versicolor, piedra, and tinea nigra. Tinea versicolor is common worldwide and is caused by Malassezia spp, which are human saprophytes that sometimes switch from yeast to pathogenic mycelial form. Malassezia furfur, Malassezia globosa, and Malassezia sympodialis are most closely linked to tinea versicolor. White and black piedra are both common in tropical regions of the world; white piedra is also endemic in temperate climates. Black piedra is caused by Piedraia hortae; white piedra is due to pathogenic species of the Trichosporon genus. Tinea nigra is also common in tropical areas and has been confused with melanoma.
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus
Directory of Open Access Journals (Sweden)
Lourdes M. B. Pessoa
2016-01-01
Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus)
Pessoa, Lourdes M. B.; Roza, Marcello; Farias, Anderson; Jesus, Pedro Henrique de; Campbell, Rita de Cassia; Pinho, Mariângela Pereira de
2016-01-01
The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas.
Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-10-01
Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.
Severe canine distemper outbreak in unvaccinated dogs in Mozambique.
Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G
2016-07-15
Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.
Echobiometrics kidney and renal artery triplex doppler of canine fetuses
Directory of Open Access Journals (Sweden)
M.A.R. Feliciano
2014-04-01
Full Text Available The aim of this study was to assess the sogographic parameters and biometry of canine fetal kidneys using the B mode, and to determinate the vascular index of the fetal renal arteries using the Doppler Triplex. Twenty four Shi-tzu and Pug, weighting between 4 and 10kg, aging between 4 and 6 years old were evaluated. The B mode, the fetal renal echobiometry and regularity of the renal surface, echotexture and cortex:medular ratio were evaluated during the 5th, 6th, 7th and 8th weeks of pregnancy. At the same time point of the B mode evaluation, the Doppler Triplex was carried out to assess the sistolic peak velocity (SPV, end diastolic velocity (EDV, vascular resistive (RI and pulsatility index (PI. B mode revealed no fetal renal abnormalities and echobiometry showed important measurements during fetal development (P0.05. B mode and Doppler Triplex were important tools for the assessment of fetal renal development, using echobiometry and renal arterial index in canie fetuses.
Experiments on the superficial irradiation of spherical vegetables and fruits
International Nuclear Information System (INIS)
Kalman, B.; Kiraly, Z.
1974-01-01
A revolving facility was made for the homogeneous superficial irradiation of spherical vegetables and fruits (apricot, peach, tomato, apple, etc.) with fast electrons. After the building of the technological apparatus described in detail, dosimetrical measurements were carried out by a Van de Graff generator of 2 MV and it was proved, that the superficial irradiation had a smaller effect on the quality of the fresh fruits, than of the stored ones. The developed apparatus can be altered according to the ripe-rate of the products. (K.A.)
[Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].
Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng
2009-09-01
To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.
Cellular endocytic compartment localization of expressed canine CD1 molecules
DEFF Research Database (Denmark)
Schjærff, Mette; Keller, Stefan M.; Affolter, Verena K.
2016-01-01
CD1 molecules are glycoproteins present primarily on dendritic cells (DCs), which recognize and presenta variety of foreign- and self-lipid antigens to T-cells. Humans have five different CD1 isoforms that sur-vey distinct cellular compartments allowing for recognition of a large repertoire...... onlya diminished GFP expression. In conclusion, canine CD1 transfectants show distinct localization patternsthat are similar to human CD1 proteins with the exception of the canine CD1d isoform, which most likelyis non-functional. These findings imply that canine CD1 localization overall resembles human...... CD1 traf-ficking patterns. This knowledge is important for the understanding of lipid antigen-receptor immunityin the dog....
Canine Gouging: A Taboo Resurfacing in Migrant Urban Population.
Noman, Anila Virani; Wong, Ferranti; Pawar, Ravikiran Ramakrishna
2015-01-01
Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. This case report is of a 15-year-old Somalian born boy, who presented at the dental institute with intermittent pain in his lower right permanent canine which was associated with a discharging intra oral buccal sinus. The tooth was endodontically treated and then restored with composite. General dental practitioners need to be vigilant when encountered with tooth presenting unusual morphology, unilateral missing tooth, and shift in the midline due to early loss of deciduous/permanent canines. Identification of any such dental mutilation practice will need further counselling of the individual and family members. It is the duty of every dental professional to educate and safeguard the oral and dental health of general public.
Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines
Directory of Open Access Journals (Sweden)
Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman
2011-01-01
Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.
Expression of the tumor suppressor genes NF2, 4.1B, and TSLC1 in canine meningiomas.
Dickinson, P J; Surace, E I; Cambell, M; Higgins, R J; Leutenegger, C M; Bollen, A W; LeCouteur, R A; Gutmann, D H
2009-09-01
Meningiomas are common primary brain tumors in dogs; however, little is known about the molecular genetic mechanisms involved in their tumorigenesis. Several tumor suppressor genes have been implicated in meningioma pathogenesis in humans, including the neurofibromatosis 2 (NF2), protein 4.1B (4.1 B), and tumor suppressor in lung cancer-1 (TSLC1) genes. We investigated the expression of these tumor suppressor genes in a series of spontaneous canine meningiomas using quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) (NF2; n = 25) and western blotting (NF2/merlin, 4.1B, TSLC1; n = 30). Decreased expression of 4.1B and TSLC1 expression on western blotting was seen in 6/30 (20%) and in 15/30 (50%) tumors, respectively, with 18/30 (60%) of meningiomas having decreased or absent expression of one or both proteins. NF2 gene expression assessed by western blotting and RT-PCR varied considerably between individual tumors. Complete loss of NF2 protein on western blotting was not seen, unlike 4.1B and TSLC1. Incidence of TSLC1 abnormalities was similar to that seen in human meningiomas, while perturbation of NF2 and 4.1B appeared to be less common than reported for human tumors. No association was observed between tumor grade, subtype, or location and tumor suppressor gene expression based on western blot or RT-PCR. These results suggest that loss of these tumor suppressor genes is a frequent occurrence in canine meningiomas and may be an early event in tumorigenesis in some cases. In addition, it is likely that other, as yet unidentified, genes play an important role in canine meningioma formation and growth.
Orthodontic management of bilaterally impacted mandibular canines in a growing patient
Directory of Open Access Journals (Sweden)
Rajaganesh J Gautam
2016-01-01
Full Text Available KK, an 11.9-year-old male patient, presented with the chief complaint of forwardly placed upper front teeth. Diagnosis revealed a Class II subdivision right malocclusion on an underlying Class I skeletal base with a horizontal growth pattern, bimaxillary proclination, crowding in the lower arch, over retained deciduous canines in the upper right and lower quadrants, an unerupted maxillary right permanent canine, and bilaterally impacted mandibular permanent canines, an increased overjet, and a deep overbite. He had a mild convex profile, a toothy smile with a nonconsonant smile arc and mildly protrusive lips. Treatment with a nonextraction treatment plan, which included surgical uncovering and orthodontic eruptive guidance of the impacted mandibular canines, with multibracket metallic fixed appliances, solved the patient′s complaints and achieved an esthetically pleasing and functionally adequate occlusal result.
Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.
McMaster, G K; Tratschin, J D; Siegl, G
1981-01-01
The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.
Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus
Directory of Open Access Journals (Sweden)
Sudarisman
2006-03-01
Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.
Comparative photoelastic study of dental and skeletal anchorages in the canine retraction
Directory of Open Access Journals (Sweden)
Cristiane Aparecida de Assis Claro
2014-01-01
Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.
Sajnani, Anand K
2015-02-01
The position of the permanent maxillary canine at the angle of the mouth is strategically significant in maintaining the harmony and symmetry of the occlusal relationship. However, the maxillary canine is the second most frequently impacted tooth, with prevalence reported to be between 1% and 2%. Moreover, treatment of this condition is often complex and involves substantial time and financial cost. Hence, it is only prudent to monitor the eruption and identify the etiological factors that lead to impaction of the maxillary canine. Numerous researchers have tried to identify specific and nonspecific etiological factors responsible for displacement of canines. The purpose of this review was to track the development processes of maxillary canines and determine the hindrances that affect the eruption at different ages. Awareness of the eruption process and etiology of noneruption will help to reduce the incidence of impacted canines by allowing for early recognition and interceptive treatment. © 2013 Wiley Publishing Asia Pty Ltd.
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Mann, Elizabeth; Whittington, Lisa
2014-01-01
Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4) was significantly higher (p < 0.05) than that in the control (0.83 ± 0.3) and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009). Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended. PMID:26770752
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Directory of Open Access Journals (Sweden)
Moges Woldemeskel
2014-11-01
Full Text Available Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4 was significantly higher (p < 0.05 than that in the control (0.83 ± 0.3 and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009. Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended.
Darmanin, Geraldine; Jaggard, Matthew; Hettiaratchy, Shehan; Nanchahal, Jagdeep; Jain, Abhilash
2013-06-01
It is common practice to elevate the limbs postoperatively to reduce oedema and hence optimise perfusion and facilitate rehabilitation. However, elevation may be counterproductive as it reduces the mean perfusion pressure. There are no clear data on the optimal position of the limbs even in normal subjects. The optimal position of limbs was investigated in 25 healthy subjects using a non-invasive micro-lightguide spectrophotometry system "O2C", which indirectly measures skin and superficial tissue perfusion through blood flow, oxygen saturation and relative haemoglobin concentration. We found a reduction in skin and superficial tissue blood flow of 17% (p=0.0001) on arm elevation (180° shoulder flexion) as compared to heart level and an increase in skin and superficial tissue blood flow of 25% (p=0.02) on forearm elevation of 45°. Lower limb skin and superficial tissue blood flow decreased by 15% (p=0.004) on elevation to 47 cm and by 70% on dependency (p=0.0001) compared to heart level. However, on elevation of the lower limb there was also a 28% reduction in superficial venous pooling (p=0.0001) compared to heart level. In the normal limb, the position for optimal superficial perfusion of the upper limb is with the arm placed at heart level and forearm at 45°. In the lower limb the optimal position for superficial perfusion would be at heart level. However, some degree of elevation may be useful if there is an element of venous congestion. Copyright © 2013 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
How far is the root apex of a unilateral impacted canine from the root apices' arch form?
Kim, Sung-Hun; Kim, You-Min; Oh, Sewoong; Kim, Seong-Sik; Park, Soo-Byung; Son, Woo-Sung; Kim, Yong-Il
2017-02-01
The purpose of this study was to determine the arch form of the root apices of normally erupting teeth and then determine the differences in the location of the apex of impacted canines relative to normally erupting canines. In addition, we sought to determine whether the labiopalatal position of the impacted canines influences the position of the apices. The study included 21 patients with unerupted canines that subsequently had a normal eruption, 21 patients with palatally impacted canines, 27 patients with labially impacted canines, and 17 patients with midalveolus impacted canines. Images were obtained using cone beam computed tomography, and the x, y, and z coordinates of the root apices were determined using Ondemand3D software (Cybermed Co., Seoul, Korea). Two-dimensional coordinates were converted from acquired 3-dimensional coordinates via projection on a palatal plane, and the Procrustes method was used to process the converted 2-dimensional coordinates and to draw the arch forms of the root apices. Finally, we measured the extent of root apex deviation from the arch forms of the root apices. Normally erupting canines showed that even though calcifications may be immature, their positions were aligned with a normal arch form. The root apices of the impacted canines were an average of 6.572 mm away from the root apices' arch form, whereas those of the contralateral nonimpacted canines were an average distance of 2.221 mm away, a statistically significant difference. The palatally impacted canines' root apices distribution tended toward the first premolar root apices. Incompletely calcified, unerupted teeth with a subsequent normal eruption showed a normal arch form of the root apices. The root apices of impacted canines were farther from the arch forms than were the nonimpacted canines. Also, the root apices of impacted canines in the palatal area showed distributions different from those of the other impacted canine groups. Copyright © 2017 American
The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.
Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki
2015-04-17
Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Automated tru-cut imaging-guided core needle biopsy of canine ...
African Journals Online (AJOL)
The purpose of this study was to evaluate the diagnostic value of imaging-guided core needle biopsy for canine orbital mass diagnosis. A second excisional biopsy obtained during surgery or necropsy was used as the reference standard. A prospective feasibility study was conducted in 23 canine orbital masses at a single ...
Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E
2014-05-01
Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1) mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50 = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly
Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors
International Nuclear Information System (INIS)
Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma
2006-01-01
Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs
Feline and canine coronaviruses: common genetic and pathobiological features.
Le Poder, Sophie
2011-01-01
A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
GaitKeeper: A System for Measuring Canine Gait
Directory of Open Access Journals (Sweden)
Cassim Ladha
2017-02-01
Full Text Available It is understood gait has the potential to be used as a window into neurodegenerative disorders, identify markers of subclinical pathology, inform diagnostic algorithms of disease progression and measure the efficacy of interventions. Dogs’ gaits are frequently assessed in a veterinary setting to detect signs of lameness. Despite this, a reliable, affordable and objective method to assess lameness in dogs is lacking. Most described canine lameness assessments are subjective, unvalidated and at high risk of bias. This means reliable, early detection of canine gait abnormalities is challenging, which may have detrimental implications for dogs’ welfare. In this paper, we draw from approaches and technologies used in human movement science and describe a system for objectively measuring temporal gait characteristics in dogs (step-time, swing-time, stance-time. Asymmetries and variabilities in these characteristics are of known clinical significance when assessing lameness but presently may only be assessed on coarse scales or under highly instrumented environments. The system consists an inertial measurement unit, containing a 3-axis accelerometer and gyroscope coupled with a standardized walking course. The measurement unit is attached to each leg of the dog under assessment before it is walked around the course. The data by the measurement unit is then processed to identify steps and subsequently, micro-gait characteristics. This method has been tested on a cohort of 19 healthy dogs of various breeds ranging in height from 34.2 cm to 84.9 cm. We report the system as capable of making precise step delineations with detections of initial and final contact times of foot-to-floor to a mean precision of 0.011 s and 0.048 s, respectively. Results are based on analysis of 12,678 foot falls and we report a sensitivity, positive predictive value and F-score of 0.81, 0.83 and 0.82 respectively. To investigate the effect of gait on system performance
Positron emission tomography studies in the normal and abnormal ageing of human brain
International Nuclear Information System (INIS)
Comar, D.; Baron, J.C.
1987-01-01
Until recently, the investigation of the neurophysiological correlates of normal and abnormal ageing of the human brain was limited by methodological constraints, as the technics available provided only a few parameters (e.g. electroencephalograms, cerebral blood flow) monitored in superficial brain structures in a grossly regional and poorly quantitative way. Lately several non invasive techniques have been developed which allow to investigate in vivo both quantitatively and on local basis a number of previously inaccessible important aspects of brain function. Among these techniques, such as single photon emission tomography imaging of computerized electric events, nuclear magnetic resonance, positron emission tomography stands out as the most powerful and promising method since it allows the in vivo measurement of biochemical and pharmacological parameters
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Directory of Open Access Journals (Sweden)
Otávio Valério Carvalho
2012-01-01
Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo
2012-01-01
Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403
Berger, Darren J; Lewis, Thomas P; Schick, Anthea E; Stone, Richard T
2012-10-01
Terbinafine, an allylamine antifungal, is used in pulsatile dose regimens for superficial mycoses in human medicine. To compare the clinical efficacy of twice-weekly versus once-daily terbinafine administration to determine whether preliminary proof-of-concept evidence exists for pulsatile administration of terbinafine in the treatment of canine Malassezia dermatitis and to determine whether twice-weekly treatment results in fewer clinical and owner-perceived adverse events. Twenty client-owned dogs with Malassezia dermatitis. In this randomized, single-blinded clinical trial, dogs were randomly assigned to receive terbinafine (30 mg/kg) either once daily for 21 days (n = 10) or once daily on two consecutive days per week for six doses (n = 10). On day 0 and day 21, a mean yeast count was calculated from eight anatomical locations via adhesive tape-strip cytology, clinical lesion scores were assigned to the same locations, and owners assessed pruritus using a visual analog scale. There was no significant difference between treatment groups with respect to the reduction in mean yeast count (P = 0.343) and clinical lesion scores (P = 0.887). Pruritus measured by visual analog scale was significantly decreased in the twice-weekly treatment group compared with the daily treatment group (P = 0.047). Seven of 20 dogs had a clinically measurable or owner-reported adverse event during treatment that included gastrointestinal disturbances, excessive panting and elevated hepatic enzymes, with no significant difference noted between treatment groups. This pilot study indicates that twice-weekly terbinafine administration may be an effective alternative treatment for canine Malassezia dermatitis and merits further investigation. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.
Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia
Directory of Open Access Journals (Sweden)
Víctor Acero P
2015-09-01
Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.
Compensatory canine angulation in angle Class II and III patients
Directory of Open Access Journals (Sweden)
Mauro Carlos Agner Busato
2009-09-01
Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.
MOSFET dosimetry in-vivo at superficial and orthovoltage x-ray energies
International Nuclear Information System (INIS)
Cheung, T.; Yu, P.K.N.; Butson, M.J.; Illawarra Cancer Care Centre, Wollongong, NSW
2003-01-01
This note investigates in-vivo dosimetry using a Metal Oxide Semiconductor Field Effect Transistor (MOSFET) for radiotherapy treatment at superficial and orthovoltage x-ray energies. This was performed within one fraction of the patients treatment. Standard measurements along with energy response of the detector are given. Results showed that the MOSFET measurements in-vivo agreed with calculated results on average within ± 5.6% over all superficial and orthovoltage energies. These variations were slightly larger than TLD results with variations between measured and calculated results being ± 5.0% for the same patient measurements. The MOSFET device provides adequate in-vivo dosimetry for superficial and orthovoltage energy treatments with the accuracy of the measurements seeming to be relatively on par with TLD in our case. The MOSFET does have the advantage of returning a relatively immediate dosimetric result after irradiation. Copyright (2003) Australasian College of Physical Scientists and Engineers in Medicine
European surveillance of emerging pathogens associated with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe
2017-12-01
Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.
Use of superficial peroneal nerve graft for treating peripheral nerve injuries
Directory of Open Access Journals (Sweden)
Samuel Ribak
2016-02-01
Full Text Available ABSTRACT OBJECTIVE: To evaluate the clinical results from treating chronic peripheral nerve injuries using the superficial peroneal nerve as a graft donor source. METHODS: This was a study on eleven patients with peripheral nerve injuries in the upper limbs that were treated with grafts from the sensitive branch of the superficial peroneal nerve. The mean time interval between the dates of the injury and surgery was 93 days. The ulnar nerve was injured in eight cases and the median nerve in six. There were three cases of injury to both nerves. In the surgery, a longitudinal incision was made on the anterolateral face of the ankle, thus viewing the superficial peroneal nerve, which was located anteriorly to the extensor digitorum longus muscle. Proximally, the deep fascia between the extensor digitorum longus and the peroneal longus muscles was dissected. Next, the motor branch of the short peroneal muscle (one of the branches of the superficial peroneal nerve was identified. The proximal limit of the sensitive branch was found at this point. RESULTS: The average space between the nerve stumps was 3.8 cm. The average length of the grafts was 16.44 cm. The number of segments used was two to four cables. In evaluating the recovery of sensitivity, 27.2% evolved to S2+, 54.5% to S3 and 18.1% to S3+. Regarding motor recovery, 72.7% presented grade 4 and 27.2% grade 3. There was no motor deficit in the donor area. A sensitive deficit in the lateral dorsal region of the ankle and the dorsal region of the foot was observed. None of the patients presented complaints in relation to walking. CONCLUSIONS: Use of the superficial peroneal nerve as a graft source for treating peripheral nerve injuries is safe and provides good clinical results similar to those from other nerve graft sources.
Gossellin, J; Wren, J A; Sunderland, S J
2007-08-01
Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.
Peracute Infectious Canine Hepatitis
Directory of Open Access Journals (Sweden)
A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam
2012-05-01
Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.
Radioresistant canine hematopoietic cells
International Nuclear Information System (INIS)
Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.
1987-01-01
Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells
Superficies in the form of the right to superpose
Directory of Open Access Journals (Sweden)
Simona CHIRICĂ
2015-06-01
Full Text Available The purpose of this paper is to present the current legal framework related to the superficies right in the form of the right to superpose, and especially to draw the attention and put certain question marks regarding the actuality or even the urgency of the need for regulation regarding the right to superpose. First, as a preliminary aspect, in order to emphasize the historical evolution of the superficies right, we will briefly present the development of this concept starting from the Roman law up to the present date. Second, by analysing the relevant legislation, the doctrine and the jurisprudence, the authors set themselves to present the main methods for constituting the superficies right. Third, the characteristics related to the right to superpose will be correlatively laid out. Fourth, the possibility to obtain a building permit on the basis of the right to superpose will also be analysed. Fifth, the recently entered-into-force legislative framework regarding the registration of the right to superpose and of the building thus erected is presented. Last but not least, the conclusions of this paper are presented, highlighting the necessity for more clearly defined rules regulating the legal status of the right to superpose, in order to avoid any confusions and inconsistencies in practice.
Surgical innovations in canine gonadectomy
Van Goethem, Bart
2016-01-01
In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated
Estudio comparativo de la rugosidad superficial en cerámicas de ultra baja fusión
Ccahuana Vásquez, Vanessa Zulema; Leite de Oliveira Morais, Andréia Alves; Sussumu Nishioka, Renato; Tomomitsu Kimpara, Estevão
2015-01-01
El objetivo de este trabajo fue comparar la rugosidad superficial en cerámicas de baja y ultra baja fusión, después del pulido mecánico y exposición a un medio corrosivo in vitro. El análisis de la superficie (Ra) fue realizado con un rugosímetro. Se confeccionaron 72 discos, divididos en cuatro grupos según el sistema cerámico utilizado: VitadurAplha (G1), Titankeramik (G2), HeraCeram (G3) y Finesse (G4), y según el tratamiento de superficie: (A) especímenes sin tratamiento de superficie. (B...
Maybody, Majid; Tang, Peter Q; Moskowitz, Chaya S; Hsu, Meier; Yarmohammadi, Hooman; Boas, F Edward
2017-03-01
Pneumodissection is described as a simple method for preventing skin injury during cryoablation of superficial musculoskeletal tumours. Superficial tumour cryoablations performed from 2009 to 2015 were retrospectively reviewed. Pneumodissection was performed in 13 patients when the shortest tumour-skin distance was less than 25 mm. Indications were pain palliation (n = 9) and local tumour control (n = 4). Patients, target tumours, technical characteristics and complications up to 60 days post ablation were reviewed. The ice ball-skin distances with and without pneumodissection were compared by a paired t-test and further assessed for association with covariates using ANCOVA. Technical success for ablation was 12 of 13. The mean shortest tumour-skin distance was 15.0 mm (3.2-24.5 mm). The mean thickness of pneumodissection was 9.6 mm (5.2-16.6 mm) resulting in mean elevation of skin of 3.4 mm (1.2-5.3 mm). Mean shortest ice ball-skin distance after pneumodissection was 10.5 mm (4.2-19.7 mm). No infection or systemic air embolism was noted. No intraprocedural frostbite was observed. Pneumodissection is feasible, effective and safe in protecting the skin during image-guided cryoablation of superficial tumours. • Frostbite during image-guided cryoablation of superficial tumours is commonly under-reported. • Frostbites are painful and may introduce infection into the superficial ablation zone. • Warm compress, saline and CO 2 have shortcomings in protecting the skin. • Pneumodissection is free, readily available, easy to use and safe and effective.
Use your eyes - metallographic versus superficial traces of the crafting of Bronze Age ornaments
DEFF Research Database (Denmark)
Nørgaard, Heide Wrobel
and superficial archaeological examinations can be used to understand prehistoric craft. Furthermore, it will show that with an intensive knowledge about previous scientific investigations the superficial traces preserved can reveal a great amount of information and could talk for themselves. Taking as an example...... the early and middle Bronze Age bronze ornaments from North Germany, superficial traces of the metal crafting process, visible with the naked eye, will be compared with metallographic images. The aim of this presentation is to give an overview over the crafting traces everybody could see (with a bit...
Stahl, Franka; Grabowski, Rosemarie
2003-05-01
The relationship between maxillary canine displacement and the simultaneous occurrence of "genetically determined predisposition to disturbed development of the dentition" as defined by Hoffmeister was investigated in 675 patients. Panoramic radiographs taken of each patient during the first and the second mixed dentition periods were evaluated. Canine inclination and the distance between the tip of the canine and a line connecting the cusps of the molars were computed in five different age groups according to Dausch-Neumann. Statistical analysis revealed 34 patients with "potential canine displacement", who exhibited further symptoms of "genetically determined predisposition to disturbed development of the dentition" significantly more frequently than the total group. The symptoms concerned were agenesia, displaced tooth buds, rotated or tilted incisors, aplasia and microdontia of lateral incisors. Careful follow-ups in patients with a predisposition to disturbed dental development enables risks to be anticipated and canine displacement to be detected at an early stage.
Wolf, Zena T.; Leslie, Elizabeth J.; Arzi, Boaz; Jayashankar, Kartika; Karmi, Nili; Jia, Zhonglin; Rowland, Douglas J.; Young, Amy; Safra, Noa; Sliskovic, Saundra; Murray, Jeffrey C.; Wade, Claire M.; Bannasch, Danika L.
2014-01-01
Cleft palate (CP) is one of the most commonly occurring craniofacial birth defects in humans. In order to study cleft palate in a naturally occurring model system, we utilized the Nova Scotia Duck Tolling Retriever (NSDTR) dog breed. Micro-computed tomography analysis of CP NSDTR craniofacial structures revealed that these dogs exhibit defects similar to those observed in a recognizable subgroup of humans with CP: Pierre Robin Sequence (PRS). We refer to this phenotype in NSDTRs as CP1. Individuals with PRS have a triad of birth defects: shortened mandible, posteriorly placed tongue, and cleft palate. A genome-wide association study in 14 CP NSDTRs and 72 unaffected NSDTRs identified a significantly associated region on canine chromosome 14 (24.2 Mb–29.3 Mb; praw = 4.64×10−15). Sequencing of two regional candidate homeobox genes in NSDTRs, distal-less homeobox 5 (DLX5) and distal-less homeobox 6 (DLX6), identified a 2.1 kb LINE-1 insertion within DLX6 in CP1 NSDTRs. The LINE-1 insertion is predicted to insert a premature stop codon within the homeodomain of DLX6. This prompted the sequencing of DLX5 and DLX6 in a human cohort with CP, where a missense mutation within the highly conserved DLX5 homeobox of a patient with PRS was identified. This suggests the involvement of DLX5 in the development of PRS. These results demonstrate the power of the canine animal model as a genetically tractable approach to understanding naturally occurring craniofacial birth defects in humans. PMID:24699068
Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features
Directory of Open Access Journals (Sweden)
Sophie Le Poder
2011-01-01
Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
THE REDUCED CANINE PANCREAS TO STUDY THE EFFECTS OF INTRAOPERATIVE RADIOTHERAPY
HEIJMANS, HJ; MEHTA, D; KLEIBEUKER, JH; SLUITER, WJ; HOEKSTRA, HJ
1993-01-01
A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of
Laparoscopic radical prostatectomy in the canine model.
Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M
1996-12-01
The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.
Intravesical Gemcitabine for Treatment of Superficial Bladder ...
African Journals Online (AJOL)
Objectives: Intravesical Bacillus Calmette-Guérin (BCG) vaccine is the mainstay of treatment and prophylaxis in superficial bladder cancer (SBC) as it reduces tumor recurrence and disease progression. About one-third of patients do not respond to BCG. The aim of this study was to determine the efficacy of intravesical ...
Mudalal, S; Lorenzi, M; Soglia, F; Cavani, C; Petracci, M
2015-04-01
One of the consequences of intense genetic selection for growth of poultry is the recent appearance of abnormalities in chicken breast muscles, such as white striping (characterised by superficial white striations) and wooden breast (characterised by pale and bulged areas with substantial hardness). The aim of this study was to evaluate the quality traits of chicken fillets affected by white striping and wooden breast abnormalities. In two replications, 192 fillets were divided into the following four classes: normal (n=48; absence of any visual defects), white striping (n=48, presence of white striations), wooden breast (n=48; diffusely presence of hardened areas) and white striping/wooden breast (n=48; fillets affected by both abnormalities). Morphology, raw meat texture and technological properties were assessed in both unprocessed (pH, colour, drip loss, cooking loss and cooked meat shear force) and marinated meat (marinade uptake, purge loss, cooking loss and cooked meat shear force). Fillets affected by white striping, wooden breast or both abnormalities exhibited higher breast weights compared with normal fillets (305.5, 298.7, 318.3 and 244.7 g, respectively; Pcooking losses than white-striped fillets for both unprocessed and marinated meats. On the other hand, white-striped fillets showed a moderate decline in marinade and cooking yield. Fillets affected by both abnormalities had the highest (Pcooked meat, drip loss, purge loss and cooked meat shear force were negligible or relatively low and of little practical importance. Thus, the presence of white striping and wooden breast abnormalities impair not only breast meat appearance but also the quality of both raw and marinated meats mainly by reducing water holding/binding abilities.
Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew
2011-11-01
Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.
Histopathological retrospective study of canine renal disease in Korea, 2003~2008
Yhee, Ji-Young; Yu, Chi-Ho; Kim, Jong-Hyuk; Im, Keum-Soon; Chon, Seung-Ki
2010-01-01
Renal disease includes conditions affecting the glomeruli, tubules, interstitium, pelvis, and vasculature. Diseases of the kidney include glomerular diseases, diseases of the tubules and interstitium, diseases of renal pelvis, and developmental abnormalities. Renal tissue samples (n = 70) submitted to the Department of Veterinary Pathology of Konkuk University from 2003 to 2008 were included in this study. Tissue histopathology was performed using light microscopy with hematoxylin and eosin stains. Masson's trichrome, Congo Red, and Warthin starry silver staining were applied in several individual cases. Glomerular diseases (22.9%), tubulointerstitial diseases (8.6%), neoplastic diseases (8.6%), conditions secondary to urinary obstruction (24.3%), and other diseases (35.7%) were identified. Glomerulonephritis (GN) cases were classified as acute proliferative GN (5.7%), membranous GN (4.3%), membranoproliferative GN (4.3%), focal segmental GN (2.9%), and other GN (4.2%). The proportion of canine GN cases presently identified was not as high as the proportions identified in human studies. Conversely, urinary obstruction and end-stage renal disease cases were relatively higher in dogs than in human populations. PMID:21113095
Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola
2014-07-01
An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.
Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.
Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J
2014-03-01
Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.
The Omental Pedicle Flap in Dogs Revised and Refined: A Cadaver Study.
Doom, Marjan; Cornillie, Pieter; Simoens, Paul; Huyghe, Stephanie; de Rooster, Hilde
2016-08-01
To expand current knowledge on the canine omental vasculature and refine the existing lengthening technique of the canine omentum. Ex vivo study. Canine cadavers (n=20). In 10 canine cadavers the omental arteries were mapped using intravascular latex injection and these results were used to create an omental pedicle flap based on the splenic artery in 10 additional cadavers. The operating range of the flap was recorded with particular attention to the main regions of interest for omental transposition in dogs (axillary and inguinal regions). The superficial and deep omental leaves were each predominantly supplied by a left and a right marginal omental artery that anastomosed near the caudal omental border into a superficial and a deep omental arch, respectively. Anastomoses between arteries of the superficial and the deep omental leaves were weak and inconsistent, except for 1 anastomosis that was found in 8 of 10 dogs. By transposing the intact omentum, the right axilla could be reached in 3 dogs, both axillae in 1 dog, and both groins in all cadavers. In all cases, the omental pedicle reached to and beyond the axillary and inguinal regions. By unfolding the pedicle leaves, the width of the pedicle tip could be doubled. When lengthening the omentum is necessary to reach extra-abdominal structures, the omental pedicle flap based on the splenic artery appears to preserve the omental vascular supply. These observations warrant further clinical trials to evaluate this new omtental flap technique in vivo. © Copyright 2016 by The American College of Veterinary Surgeons.
Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.
Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L
2016-02-19
Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.
Functional Characterization of Canine Interferon-Lambda
Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun
2014-01-01
In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142
Vascular patterns of upper limb: an anatomical study with accent on superficial brachial artery
Directory of Open Access Journals (Sweden)
David Kachlik
2011-02-01
Full Text Available The aim of the study was to evaluate the terminal segmentation of the axillary artery and to present four cases of anomalous branching of the axillary artery, the superficial brachial artery (arteria brachialis superficialis, which is defined as the brachial artery that runs superficially to the median nerve. Totally, 130 cadaveric upper arms embalmed by classical formaldehyde technique from collections of the Department of Anatomy, Third Faculty of Medicine, Charles University in Prague, were macroscopically dissected with special focus on the branching arrangement of the axillary artery. The most distal part of the axillary artery (infrapectoral part terminated in four cases as a bifurcation into two terminal branches: the superficial brachial artery and profunda brachii artery, denominated according to their relation to the median nerve. The profunda brachii artery primarily gave rise to the main branches of the infrapectoral part of the axillary artery. The superficial brachial artery descended to the cubital fossa where it assumed the usual course of the brachial artery in two cases and in the other two cases its branches (the radial and ulnar arteries passed superficially to the flexors. The incidence of the superficial brachial artery in our study was 5% of cases. The reported incidence is a bit contradictory, from 0.12% to 25% of cases. The anatomical knowledge of the axillary region is of crucial importance for neurosurgeons and specialists using the radiodiagnostic techniques, particularly in cases involving traumatic injuries. The improved knowledge would allow more accurate diagnostic interpretations and surgical treatment.
Superficial evolution and compacting aptitude of uranium dioxide powders
International Nuclear Information System (INIS)
Danroc, J.
1982-04-01
Long term storage of UO 2 powder improves slightly shaping and solidity of compacted powder. The aim of this work is the study of material evolution and the increase of this evolution rate for application to industrial fabrication. Aging in wet air at different temperatures is examined. Evolution of texture and superficial composition is followed. Below 80 0 C UO 3 , 2H 2 O is formed at crystal surface and thermal decomposition gives different hydrates. Kinetics of the transformation is studied. Oxidohydratation in liquid phase is rapid with hydrogen peroxide. The aged or treated material is compacted and mechanical behaviour is examined. Improvement is explained by inter-layer water molecule of the superficial hydrate giving lubricant and pseudo-plastic properties [fr
Caracterizacion dosimetrica del equipo de Terapia Superficial Therapax del Hospital Mexico
International Nuclear Information System (INIS)
Bernui De Vivanco, Maria Giselle; Rojas Rivas, Jorge; Cardenas Retuerto, Augusto
2007-01-01
The Servicio de Radioterapia of the Hospital Mexico in San Jose, Costa Rica has a Superficial Therapy equipment Therapax model DXT 300. It describes the measurements for the dosimetric characterization of the configurations 100 kVp, 25 mA and filter of 2.4 mm of Al, and 250 kVp, 10 mA and filter of 2.5 mm of Cu, taking into account that the uncertainties in the measurements of the superficial therapy equipment are higher than in the rank of the megavoltage [es
Orthodontic treatment of a stubborn palatally ectopic canine: a case report.
Al-Musfir, Tumadher M; Morris, David O
2014-03-01
This is a case report that highlights a different treatment approach in dealing with palatally ectopic canines. The modified transpalatal arch with an 'active' arm was used to align a palatally ectopic canine with 'push' mechanics after the initial use of more conventional 'pull' mechanics (piggy-back archwire technique) had failed.
Comportamiento a fatiga del acero sae 4140 usando alta rugosidad superficial y ambiente corrosivo
CEBALLOS, WILSON FERNANDO; GÓMEZ, ADOLFO LEÓN; CORONADO, JOHN JAIRO
2010-01-01
En este artículo se presenta el estudio del comportamiento a fatiga del acero SAE 4140 en condiciones diferentes: superficie pulida (acabado espejo), ambiente corrosivo (jugo de caña de azúcar), alta rugosidad superficial (superficie equivalente a la encontrada típicamente en los ejes de molino de caña) y una condición que involucra la combinación de las dos últimas. Las anteriores condiciones están presentes en los ejes de maza de molino de caña de azúcar durante el proceso de molienda. Se r...
COMPORTAMIENTO A FATIGA DEL ACERO SAE 4140 USANDO ALTA RUGOSIDAD SUPERFICIAL Y AMBIENTE CORROSIVO
CEBALLOS, WILSON FERNANDO; GÓMEZ, ADOLFO LEÓN; CORONADO, JOHN JAIRO
2010-01-01
En este artículo se presenta el estudio del comportamiento a fatiga del acero SAE 4140 en condiciones diferentes: superficie pulida (acabado espejo), ambiente corrosivo (jugo de caña de azúcar), alta rugosidad superficial (superficie equivalente a la encontrada típicamente en los ejes de molino de caña) y una condición que involucra la combinación de las dos últimas. Las anteriores condiciones están presentes en los ejes de maza de molino de caña de azúcar durante el proceso de molienda. Se r...
DEFF Research Database (Denmark)
Hillier, Andrew; Lloyd, David H.; Weese, J. Scott
2014-01-01
from diplomates of the American and European Colleges of Veterinary Dermatology. They describe optimal methods for the diagnosis and management of SBF, including isolation of the causative organism, antimicrobial susceptibility testing, selection of antimicrobial drugs, therapeutic protocols and advice......BACKGROUND: Superficial bacterial folliculitis (SBF) is usually caused by Staphylococcus pseudintermedius and routinely treated with systemic antimicrobial agents. Infection is a consequence of reduced immunity associated with alterations of the skin barrier and underlying diseases that may...... be difficult to diagnose and resolve; thus, SBF is frequently recurrent and repeated treatment is necessary. The emergence of multiresistant bacteria, particularly meticillin-resistant S. pseudintermedius (MRSP), has focused attention on the need for optimal management of SBF. OBJECTIVES: Provision...
Successful experimental challenge of dogs with canine parvovirus-2.
Carman, S; Povey, C
1982-01-01
Withholding food from dogs for 24 hours prior to, and for 48 hours following oral challenge with a gut mucosal homogenate of canine parvovirus-2, was a successful means of reproducing gastroenteric signs of canine parvovirus-2 infection. Twenty-one of 24 dogs, which had previously received various vaccine preparations of mink enteritis virus or were unvaccinated, and which were starved at challenge, developed soft or liquid feces with large or without large clots of mucus. Altered feces were ...
Isolated core vs. superficial cooling effects on virtual maze navigation.
Payne, Jennifer; Cheung, Stephen S
2007-07-01
Cold impairs cognitive performance and is a common occurrence in many survival situations. Altered behavior patterns due to impaired navigation abilities in cold environments are potential problems in lost-person situations. We investigated the separate effects of low core temperature and superficial cooling on a spatially demanding virtual navigation task. There were 12 healthy men who were passively cooled via 15 degrees C water immersion to a core temperature of 36.0 degrees C, then transferred to a warm (40 degrees C) water bath to eliminate superficial shivering while completing a series of 20 virtual computer mazes. In a control condition, subjects rested in a thermoneutral (approximately 35 degrees C) bath for a time-matched period before being transferred to a warm bath for testing. Superficial cooling and distraction were achieved by whole-body immersion in 35 degree water for a time-matched period, followed by lower leg immersion in 10 degree C water for the duration of the navigational tests. Mean completion time and mean error scores for the mazes were not significantly different (p > 0.05) across the core cooling (16.59 +/- 11.54 s, 0.91 +/- 1.86 errors), control (15.40 +/- 8.85 s, 0.82 +/- 1.76 errors), and superficial cooling (15.19 +/- 7.80 s, 0.77 +/- 1.40 errors) conditions. Separately reducing core temperature or increasing cold sensation in the lower extremities did not influence performance on virtual computer mazes, suggesting that navigation is more resistive to cooling than other, simpler cognitive tasks. Further research is warranted to explore navigational ability at progressively lower core and skin temperatures, and in different populations.
Adina Coșarcă; Mariana Păcurar; Cecilia Petrovan; Alina Ormenișan
2014-01-01
Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of t...
Functional compartmentalization of the human superficial masseter muscle.
Directory of Open Access Journals (Sweden)
Rodrigo A Guzmán-Venegas
Full Text Available Some muscles have demonstrated a differential recruitment of their motor units in relation to their location and the nature of the motor task performed; this involves functional compartmentalization. There is little evidence that demonstrates the presence of a compartmentalization of the superficial masseter muscle during biting. The aim of this study was to describe the topographic distribution of the activity of the superficial masseter (SM muscle's motor units using high-density surface electromyography (EMGs at different bite force levels. Twenty healthy natural dentate participants (men: 4; women: 16; age 20±2 years; mass: 60±12 kg, height: 163±7 cm were selected from 316 volunteers and included in this study. Using a gnathodynamometer, bites from 20 to 100% maximum voluntary bite force (MVBF were randomly requested. Using a two-dimensional grid (four columns, six electrodes located on the dominant SM, EMGs in the anterior, middle-anterior, middle-posterior and posterior portions were simultaneously recorded. In bite ranges from 20 to 60% MVBF, the EMG activity was higher in the anterior than in the posterior portion (p-value = 0.001.The center of mass of the EMG activity was displaced towards the posterior part when bite force increased (p-value = 0.001. The topographic distribution of EMGs was more homogeneous at high levels of MVBF (p-value = 0.001. The results of this study show that the superficial masseter is organized into three functional compartments: an anterior, a middle and a posterior compartment. However, this compartmentalization is only seen at low levels of bite force (20-60% MVBF.
[Occupational trauma due to superficial corneal foreign body].
Gerente, Vanessa Miroski; Melo, Gustavo Barreto de; Regatieri, Caio Vinícius Saito; Alvarenga, Lênio Souza; Martins, Elizabeth Nogueira
2008-01-01
To evaluate the epidemiology of superficial corneal foreign body. Patients who were seen at the Emergency Service of the Federal University of São Paulo, from April/05 to June/05, were screened and those with superficial corneal foreign body were interviewed. Data regarding gender, age, occupation, employment status, availability and use of protective devices and supervision of their use were collected. Awareness of the possible complications was also assessed. Results were analyzed using chi-square or Fisher exact test. One hundred twenty-three patients were interviewed. Only 3 patients were female. The mean age was 36 years. Most injuries occurred at the workplace (86.2%), and 58.4% of the patients did not have a legal employment registration. The occupational activities most frequently reported were construction related activities (44.3%) and welding/soldering (11.3%). In most workplaces (79.8%) protective devices were available and 85.3% of the patients were instructed to use them. A safety device was being used during the accident in 34.2% of the cases and this was more frequent among patients that had legal employment registry (p=0.008) and among those under supervision (p=0.0415). The majority of the patients (68.9%) were aware of the risk of severe complications. Most patients with superficial corneal foreign body are aware of its severe complications and injuries usually occur in places where safety devices are available and often during their use. Our findings suggest that prevention should focus on supervision and correct use of safety devices.
Bilateral Second Premolars Agenesia Together with a Unilateral Canine Radiculomegaly.
Kemoli, Arthur Musakulu; Junior, Thomas Munyao
2017-01-01
Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
DEFF Research Database (Denmark)
Zargham, Mostafa; Kjær, Inger
2016-01-01
Introduction: It is well-known that pressure from orthodontic appliance can provoke root resorption in dentitions with short roots. The purpose of this case report is to demonstrate two clinical cases with focus on root length in dentitions exposed due to pressure from erupting teeth...... resorption on her lateral incisor roots, extremely short roots in the central incisors, and short roots. The intraoral photos demonstrated light crowding in the maxilla. The orthopantomogram of the girl’s mother demonstrated extremely short roots in general. Conclusion: This pilot study indicates that short...... root length in general and abnormal incisor morphology are phenotypic traits that were characteristic for both girls who presented with severe lateral incisor resorption due to erupting canines. Furthermore, short roots were also demonstrated in the mothers. Accordingly, short root length in general...
Clinicomycological Characterization of Superficial Mycoses from a Tertiary Care Hospital in Nepal
Khadka, Sundar; Sherchand, Jeevan Bahadur; Pokharel, Dinesh Binod; Pokhrel, Bharat Mani; Mishra, Shyam Kumar; Dhital, Subhash; Rijal, Basista
2016-01-01
Background. Superficial mycosis is a common fungal infection worldwide, mainly caused by dermatophytes. However, the prevalence of species varies geographically. In addition, fungal treatment is best guided according to species isolated. This study was carried out to determine the clinical as well as mycological profile of superficial mycoses in a tertiary care hospital, Nepal. Methods. This was a prospective case-control laboratory based study conducted over a period of six months from Janua...
Mikuni, Yuko; Chiba, Shoji; Tonosaki, Yoshikazu
2013-01-01
We investigated correlations among the superficial veins, cutaneous nerves, arteries, and venous valves in 128 cadaveric arms in order to choose safe venipuncture sites in the cubital fossa. The running patterns of the superficial veins were classified into four types (I-IV) and two subtypes (a and b). In types I and II, the median cubital vein (MCV) was connected obliquely between the cephalic and basilic veins in an N-shape, while the median antebrachial vein (MAV) opened into the MCV in type I and into the basilic vein in type II. In type III, the MCV did not exist. In type IV, additional superficial veins above the cephalic and basilic veins were developed around the cubital fossa. In types Ib-IVb, the accessory cephalic vein was developed under the same conditions as seen in types Ia-IVa, respectively. The lateral cutaneous nerve of the forearm descended deeply along the cephalic vein in 124 cases (97 %), while the medial cutaneous nerve of the forearm descended superficially along the basilic vein in 94 (73 %). A superficial brachial artery was found in 27 cases (21 %) and passed deeply under the ulnar side of the MCV. A median superficial antebrachial artery was found in 1 case (1 %), which passed deeply under the ulnar side of the MCV and ran along the MAV. Venous valves were found at 239 points in 28 cases with superficial veins, with a single valve seen at 79 points (33 %) and double valves at 160 points (67 %). At the time of intravenous injection, caution is needed regarding the locations of cutaneous nerves, brachial and superficial brachial arteries, and venous valves. The area ranging from the middle segment of the MCV to the confluence between the MCV and cephalic vein appears to be a relatively safe venipuncture site.
Recent advances in canine leptospirosis: focus on vaccine development
Directory of Open Access Journals (Sweden)
Klaasen HLBM
2015-06-01
Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis
Managment of superficial infantile capillary hemangiomas with topical timolol maleate solution.
Rizvi, Syed Ali Raza; Yusuf, Faraz; Sharma, Rajeev; Rizvi, Syed Wajahat Ali
2015-01-01
Capillary hemangioma is the most common benign tumor of eyelids and orbit in children. Recently, a topical beta blocker has been reported as an effective treatment for superficial capillary hemangiomas. We present a case report of two children having large capillary hemangiomas who responded well to topical treatment by 0.5% timolol maleate solution. After 12 months of treatment, the lesion has significantly reduced in size, thickness, and color in both cases. Thus, we conclude that long-term use of topical 0.5% timolol maleate solution is safe and effective in treating superficial capillary hemangiomas.
Efficacy of feline anti-parvovirus antibodies in the treatment of canine parvovirus infection.
Gerlach, M; Proksch, A L; Unterer, S; Speck, S; Truyen, U; Hartmann, K
2017-07-01
This prospective, randomised, placebo-controlled, double-blinded study aimed to evaluate efficacy of commercially available feline anti-parvovirus antibodies in dogs with canine parvovirus infection. First, cross-protection of feline panleukopenia virus antibodies against canine parvovirus was evaluated in vitro. In the subsequent prospective clinical trial, 31 dogs with clinical signs of canine parvovirus infection and a positive faecal canine parvovirus polymerase chain reaction were randomly assigned to a group receiving feline panleukopenia virus antibodies (n=15) or placebo (n=16). All dogs received additional routine treatment. Clinical signs, blood parameters, time to clinical recovery and mortality were compared between the groups. Serum antibody titres and quantitative faecal polymerase chain reaction were compared on days 0, 3, 7, and 14. In vitro, canine parvovirus was fully neutralised by feline panleukopenia virus antibodies. There were no detected significant differences in clinical signs, time to clinical recovery, blood parameters, mortality, faecal virus load, or viral shedding between groups. Dogs in the placebo group showed a significant increase of serum antibody titres and a significant decrease of faecal virus load between day 14 and day 0, which was not detectable in dogs treated with feline panleukopenia virus antibodies. No significant beneficial effect of passively transferred feline anti-parvovirus antibodies in the used dosage regimen on the treatment of canine parvovirus infection was demonstrated. © 2017 British Small Animal Veterinary Association.
Impacted canines: Etiology, diagnosis, and orthodontic management
Directory of Open Access Journals (Sweden)
Ranjit Manne
2012-01-01
Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.
Leigh, S R; Jungers, W L
1994-12-01
A recent study suggests that differing populations of woolly spider monkeys exhibit a substantial degree of morphological, cytogenetic, and behavioral variation. We re-evaluate the differences between populations in the degree of canine tooth height sexual dimorphism and in the frequency of thumbs. Statistical analysis of variation in the degree of canine sexual dimorphism between these populations fails to provide strong evidence for subspecific variation: differences in the degree of canine dimorphism cannot be considered statistically significant. Differences between populations in the frequency of thumbs are, however, statistically significant. The lack of clear distinctions between populations in the degree of canine dimorphism complicates assessments of behavioral variation between these populations. We suggest that the level of geographic variation in woolly spider monkey canine dimorphism is not consistent with subspecific status.
Effects of pressure drop and superficial velocity on the bubbling fluidized bed incinerator.
Wang, Feng-Jehng; Chen, Suming; Lei, Perng-Kwei; Wu, Chung-Hsing
2007-12-01
Since performance and operational conditions, such as superficial velocity, pressure drop, particles viodage, and terminal velocity, are difficult to measure on an incinerator, this study used computational fluid dynamics (CFD) to determine numerical solutions. The effects of pressure drop and superficial velocity on a bubbling fluidized bed incinerator (BFBI) were evaluated. Analytical results indicated that simulation models were able to effectively predict the relationship between superficial velocity and pressure drop over bed height in the BFBI. Second, the models in BFBI were simplified to simulate scale-up beds without excessive computation time. Moreover, simulation and experimental results showed that minimum fluidization velocity of the BFBI must be controlled in at 0.188-3.684 m/s and pressure drop was mainly caused by bed particles.
Cost-effectiveness of canine vaccination to prevent human rabies in rural Tanzania.
Fitzpatrick, Meagan C; Hampson, Katie; Cleaveland, Sarah; Mzimbiri, Imam; Lankester, Felix; Lembo, Tiziana; Meyers, Lauren A; Paltiel, A David; Galvani, Alison P
2014-01-21
The annual mortality rate of human rabies in rural Africa is 3.6 deaths per 100 000 persons. Rabies can be prevented with prompt postexposure prophylaxis, but this is costly and often inaccessible in rural Africa. Because 99% of human exposures occur through rabid dogs, canine vaccination also prevents transmission of rabies to humans. To evaluate the cost-effectiveness of rabies control through annual canine vaccination campaigns in rural sub-Saharan Africa. We model transmission dynamics in dogs and wildlife and assess empirical uncertainty in the biological variables to make probability-based evaluations of cost-effectiveness. Epidemiologic variables from a contact-tracing study and literature and cost data from ongoing vaccination campaigns. Two districts of rural Tanzania: Ngorongoro and Serengeti. 10 years. Health policymaker. Vaccination coverage ranging from 0% to 95% in increments of 5%. Life-years for health outcomes and 2010 U.S. dollars for economic outcomes. Annual canine vaccination campaigns were very cost-effective in both districts compared with no canine vaccination. In Serengeti, annual campaigns with as much as 70% coverage were cost-saving. Across a wide range of variable assumptions and levels of societal willingness to pay for life-years, the optimal vaccination coverage for Serengeti was 70%. In Ngorongoro, although optimal coverage depended on willingness to pay, vaccination campaigns were always cost-effective and lifesaving and therefore preferred. Canine vaccination was very cost-effective in both districts, but there was greater uncertainty about the optimal coverage in Ngorongoro. Annual canine rabies vaccination campaigns conferred extraordinary value and dramatically reduced the health burden of rabies. National Institutes of Health.
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Identification and function analysis of canine stimulator of interferon gene (STING).
Zhang, Yuxiang; Zhu, Mengyan; Li, Gairu; Liu, Jie; Zhai, Xiaofeng; Wang, Ruyi; Zhang, Junyan; Xing, Gang; Gu, Jinyan; Yan, Liping; Lei, Jing; Sun, Haifeng; Shi, Zhiyu; Liu, Fei; Hu, Boli; Su, Shuo; Zhou, Jiyong
2017-12-01
Stimulator of interferon gene (STING) plays an important role in the cyclic GMP-AMP synthase (cGAS)-mediated activation of type I IFN responses. In this study, we identified and cloned canine STING gene. Full-length STING encodes a 375 amino acid product that shares the highest similarity with feline STING. Highest levels of mRNA of canine STING were detected in the spleen and lungs while the lowest levels in the heart and muscle. Analysis of its cellular localization showed that STING is localizes to the endoplasmic reticulum. STING overexpression induced the IFN response via the IRF3 and NF-κB pathways and up-regulated the expression of ISG15 and viperin. However, knockdown of STING did not inhibit the IFN-β response triggered by poly(dA:dT), poly(I:C), or SeV. Finally, overexpression of STING significantly inhibited the replication of canine influenza virus H3N2. Collectively, our findings indicate that STING is involved in the regulation of the IFN-β pathway in canine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population
Directory of Open Access Journals (Sweden)
Fouad Ayoub
2014-01-01
Full Text Available Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the School of Dentistry, Lebanese University, for two academic years who fulfilled the inclusion criteria. Canine widths and intercanine distance were measured by one operator directly on dental casts using a digital caliper. Results. One hundred thirty-three Lebanese dental students (54 males and 69 females aged 18–25 were included in the study. The intercanine distance was significantly greater in males (P value 0.05 and females (P value > 0.05. The mean width of canine was greater than 7.188 mm for males. Conclusion. The parameters measured in the present study are of great help in sex identification in forensic investigations in the Lebanese adult population.
Increasing Incidence of Canine Leptospirosis in Switzerland
Directory of Open Access Journals (Sweden)
Andrea Major
2014-07-01
Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.
Directory of Open Access Journals (Sweden)
Jennifer Ann Foltz
2016-11-01
Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.
Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers
van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G.; Favier, Robert P.; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C.
2012-01-01
In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic
2013-05-21
...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...
Directory of Open Access Journals (Sweden)
Kimon C. Kanelakis
2009-01-01
Full Text Available The heme-regulated inhibitor (HRI negatively regulates protein synthesis by phosphorylating eukaryotic initiation factor-2α (eIF2α thereby inhibiting protein translation. The importance of HRI in regulating hemoglobin synthesis in erythroid cells makes it an attractive molecular target in need of further characterization. In this work, we have cloned and expressed the canine form of the HRI kinase. The canine nucleotide sequence has 86%, 82%, and 81% identity to the human, mouse, and rat HRI, respectively. It was noted that an isoleucine residue in the ATP binding site of human, rat, and mouse HRI is replaced by a valine in the canine kinase. The expression of canine HRI protein by in vitro translation using wheat germ lysate or in Sf9 cells using a baculovirus expression system was increased by the addition of hemin. Following purification, the canine protein was found to be 72 kD and showed kinase activity determined by its ability to phosphorylate a synthetic peptide substrate. Quercetin, a kinase inhibitor known to inhibit mouse and human HRI, inhibits canine HRI in a concentration-dependent manner. Additionally, quercetin is able to increase de novo protein synthesis in canine reticulocytes. We conclude that the canine is a suitable model species for studying the role of HRI in erythropoiesis.
Hassan, Siba E; Hajeer, Mohammad Y; Alali, Osama H; Kaddah, Ayham S
2016-06-01
The results of previous studies about the efficacy of using self-ligating brackets (SLBs) in controlling canine movement during retraction are not in harmony. Therefore, the current study aimed to compare the effects of using new passive SLBs on maxillary canine retraction with sliding mechanics vs conventional ligating brackets (CLBs) tied with metal ligatures. The sample comprised 15 adult patients (4 males, 11 females; 18-24 years) requiring bilateral extraction of maxillary first premolars. Units of randomization are the left or right maxillary canines within the same patient. The two maxillary canines in each patient were randomly assigned to one of the two groups in a simple split-mouth design. The canines in the SLBs group (n = 15) were bracketed with SLBs (Damon Q™), while the canines in the CLBs group (n = 15) were bracketed with conventional brackets (Mini Master Series). Transpalatal bars were used for anchorage. After leveling and alignment, 0.019 × 0.025" stainless steel working archwires were placed. Canines were retracted using a nickel-titanium close-coil springs with a 150 gm force. The amount and rate of maxillary canine retraction, canine rotation, and loss of anchorage were measured on study models collected at the beginning of canine retraction (T0) and 12 weeks later (T1). Differences were analyzed using paired-samples t-tests. The effect differences were statistically significant (p brackets gave better results compared to the CLBs in terms of rate of movement, amount of canine rotation following extraction, and anchorage loss.
Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors.
Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F
2015-03-01
We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.
An RCT on treatment of palatally displaced canines with RME and/or a transpalatal arch.
Baccetti, Tiziano; Sigler, Lauren M; McNamara, James A
2011-12-01
To investigate the effect of rapid maxillary expansion (RME) and/or transpalatal arch (TPA) therapy in combination with deciduous canine extraction on the eruption of palatally displaced canines (PDCs). Hundred and twenty subjects were enrolled in an RCT based on PDCs diagnosed on panoramic radiographs and they were randomly assigned to one of four study groups. Three treatment groups (TGs) (RME followed by TPA therapy plus extraction of deciduous canines, RME/TPA/EC group, 40 subjects; TPA therapy plus extraction of deciduous canines, TPA/EC group, 25 subjects; extraction of deciduous canines, EC group, 25 subjects) were analyzed. A control group (CG, 30 subjects) received no orthodontic treatment. Prevalence rates of eruption of PDCs in the three TGs were compared with the CG at T2. Predictive features at T1 for successful canine eruption were tested in the three TGs. The prevalence of canine eruption was 80 per cent for the RME/TPA/EC group, 79 per cent for the TPA/EC group, 62.5 per cent for the EC group, versus 28 per cent in the CG, with statistically significant differences between all the groups, with the exception of the comparison between RME/TPA/EC and TPA/EC. Predictive pretreatment variables for the success of treatment were less severe sectors of canine displacement, prepubertal stages of skeletal maturity, and an open root apex of PDCs. The use of a TPA in absence of RME can be equally effective than the RME/TPA combination in PDC cases not requiring maxillary expansion, thus reducing the burden of treatment for the patient.
Bilateral second premolars agenesia together with a unilateral canine radiculomegaly
Directory of Open Access Journals (Sweden)
Arthur Musakulu Kemoli
2017-01-01
Full Text Available Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
Investigation of the behaviour of a LILW superficial repository under aircraft impact
International Nuclear Information System (INIS)
Lo Frano, Rosa; Stefanini, Lorenzo
2016-01-01
Highlights: • Safety assessment of a LILW superficial repository. • Investigation of the consequences of an aircraft impact with fuel burning. • Experimental material properties. • Numerical simulation of aircraft impact with fuel burning accident by MSC.MARC"© code. • Demonstration that the overall integrity resulted is guaranteed. - Abstract: Safety and security are the two fundamental aspects to guarantee when designing a LILW superficial repository. Because of its safety concern, we have to prove, and build confidence in, the primary and secondary consequences of the crashing will be acceptable. These goals are obtained generally by means of safety assessment supported by calculations. This study is intended to investigate the performance of a superficial repository subjected to aircraft impact and fuel burning. To the purpose a superficial repository similar to that of El Cabril has been considered. Moreover to be confident the facility is safe and that the consequences of such a type of accident on the environment and humans are negligible, an appropriate safety assessment was carried out. The potential damage that aircraft impact could bring into the repository has been therefore analysed and discussed. To attain the intent load functions, calculated according to the Riera approach, and the maximum temperature reached by fuel during its combustion have been considered. FEM (thermo-mechanical) simulations have been done, by MSC"© Marc code, assuming damaging phenomena of concrete and material properties variation with the temperature. The obtained results showed that an empty superficial repository with a wall thickness, ranging from 0.7 to 1 m, is not sufficient to avoid penetration. Nevertheless even in presence of a reduced strength and of (cone) cracking and plugging, the overall integrity resulted guaranteed.
Investigation of the behaviour of a LILW superficial repository under aircraft impact
Energy Technology Data Exchange (ETDEWEB)
Lo Frano, Rosa, E-mail: rosa.lofrano@ing.unipi.it; Stefanini, Lorenzo
2016-04-15
Highlights: • Safety assessment of a LILW superficial repository. • Investigation of the consequences of an aircraft impact with fuel burning. • Experimental material properties. • Numerical simulation of aircraft impact with fuel burning accident by MSC.MARC{sup ©} code. • Demonstration that the overall integrity resulted is guaranteed. - Abstract: Safety and security are the two fundamental aspects to guarantee when designing a LILW superficial repository. Because of its safety concern, we have to prove, and build confidence in, the primary and secondary consequences of the crashing will be acceptable. These goals are obtained generally by means of safety assessment supported by calculations. This study is intended to investigate the performance of a superficial repository subjected to aircraft impact and fuel burning. To the purpose a superficial repository similar to that of El Cabril has been considered. Moreover to be confident the facility is safe and that the consequences of such a type of accident on the environment and humans are negligible, an appropriate safety assessment was carried out. The potential damage that aircraft impact could bring into the repository has been therefore analysed and discussed. To attain the intent load functions, calculated according to the Riera approach, and the maximum temperature reached by fuel during its combustion have been considered. FEM (thermo-mechanical) simulations have been done, by MSC{sup ©} Marc code, assuming damaging phenomena of concrete and material properties variation with the temperature. The obtained results showed that an empty superficial repository with a wall thickness, ranging from 0.7 to 1 m, is not sufficient to avoid penetration. Nevertheless even in presence of a reduced strength and of (cone) cracking and plugging, the overall integrity resulted guaranteed.
In vitro development of canine somatic cell nuclear transfer embryos in different culture media.
Kim, Dong-Hoon; No, Jin-Gu; Choi, Mi-Kyung; Yeom, Dong-Hyeon; Kim, Dong-Kyo; Yang, Byoung-Chul; Yoo, Jae Gyu; Kim, Min Kyu; Kim, Hong-Tea
2015-01-01
The objective of the present study was to investigate the effects of three different culture media on the development of canine somatic cell nuclear transfer (SCNT) embryos. Canine cloned embryos were cultured in modified synthetic oviductal fluid (mSOF), porcine zygote medium-3 (PZM-3), or G1/G2 sequential media. Our results showed that the G1/G2 media yielded significantly higher morula and blastocyst development in canine SCNT embryos (26.1% and 7.8%, respectively) compared to PZM-3 (8.5% and 0%or mSOF (2.3% and 0%) media. In conclusion, this study suggests that blastocysts can be produced more efficiently using G1/G2 media to culture canine SCNT embryos.
MR-angiogram-added surface anatomy scanning of superficial cerebral arteriovenous malformations
Energy Technology Data Exchange (ETDEWEB)
Tsuchiya, Kazuhiro; Katase, Shichiro; Yoshino, Ayako; Hachiya, Junichi [Department of Radiology, Kyorin University School of Medicine, 6-20-2, Shinkawa, Mitaka, Tokyo 181-8611 (Japan); Shiokawa, Yoshiaki [Department of Neurosurgery, Kyorin University School of Medicine, 6-20-2, Shinkawa, Mitaka, Tokyo 181-8611 (Japan)
2002-09-01
Our purpose was to evaluate the utility of surface anatomy scanning (SAS) of the brain with superimposition of MR angiograms in the diagnosis and presurgical planning of superficial cerebral arteriovenous malformations (AVMs). We performed SAS in 15 patients with superficial cerebral AVMs. Two-dimensional phase-contrast MR angiograms were then obtained in the same section and superimposed on the SAS images. The images were assessed regarding the visualization of each AVM component using a four-point grading scale (3=excellent to 0=poor). In 13 of the patients, the assessment was made comparing with conventional angiograms. The images were also compared with the surgical findings in 5 patients. The added images agreed well with the angiographic findings and demonstrated the relationships between the AVM components and the adjacent brain surface. The average scores of the feeder(s), nidus, and drainer(s) were 2.27, 2.33, and 2.67, respectively. The surgical findings also correlated well with the added images. Our technique can noninvasively demonstrate superficial AVMs along with the brain surface and provide information useful for planning surgery. (orig.)
MR-angiogram-added surface anatomy scanning of superficial cerebral arteriovenous malformations
International Nuclear Information System (INIS)
Tsuchiya, Kazuhiro; Katase, Shichiro; Yoshino, Ayako; Hachiya, Junichi; Shiokawa, Yoshiaki
2002-01-01
Our purpose was to evaluate the utility of surface anatomy scanning (SAS) of the brain with superimposition of MR angiograms in the diagnosis and presurgical planning of superficial cerebral arteriovenous malformations (AVMs). We performed SAS in 15 patients with superficial cerebral AVMs. Two-dimensional phase-contrast MR angiograms were then obtained in the same section and superimposed on the SAS images. The images were assessed regarding the visualization of each AVM component using a four-point grading scale (3=excellent to 0=poor). In 13 of the patients, the assessment was made comparing with conventional angiograms. The images were also compared with the surgical findings in 5 patients. The added images agreed well with the angiographic findings and demonstrated the relationships between the AVM components and the adjacent brain surface. The average scores of the feeder(s), nidus, and drainer(s) were 2.27, 2.33, and 2.67, respectively. The surgical findings also correlated well with the added images. Our technique can noninvasively demonstrate superficial AVMs along with the brain surface and provide information useful for planning surgery. (orig.)
Superficial Velocity Effects on HZ-PAN and AgZ-PAN for Kr/Xe Capture
Energy Technology Data Exchange (ETDEWEB)
Welty, Amy Keil [Idaho National Lab. (INL), Idaho Falls, ID (United States); Garn, Troy Gerry [Idaho National Lab. (INL), Idaho Falls, ID (United States); Greenhalgh, Mitchell Randy [Idaho National Lab. (INL), Idaho Falls, ID (United States)
2016-04-01
Nearly all previous testing of HZ-PAN and AgZ-PAN was conducted at the same flow rate in order to maintain consistency among tests. This testing was sufficient for sorbent capacity determinations, but did not ensure that sorbents were capable of functioning under a range of flow regimes. Tests were conducted on both HZ-PAN and AgZ-PAN at superficial velocities between 20 and 700 cm/min. For HZ-PAN, Kr capacity increased from 60 mmol/kg to 110 mmol/kg as superficial velocity increased from 21 to 679 cm/min. Results for AgZ-PAN were similar, with capacity ranging from 72 to 124 mmol/kg over the same range of superficial. These results are promising for scaling up to process flows, demonstrating flexibility to operate in a broad range of superficial velocities while maintaining sorbent capacity. While preparing for superficial velocity testing it was also discovered that AgZ-PAN Xe capacity, previously observed to diminish over time, could be recovered with increased desorption temperature. Further, a substantial Xe capacity increase was observed. Previous room temperature capacities in the range of 22-25 mmol Xe/kg AgZ-PAN were increased to over 60 mmol Xe/kg AgZ-PAN. While this finding has not yet been fully explored to optimize activation and desorption temperatures, it is encouraging.
Myxoid stroma and delicate vasculature of a superficial angiomyxoma give rise to the red planet sign
Green, Margaret; Logemann, Nichola; Sulit, Daryl J
2014-01-01
Superficial angiomyxomas are uncommon benign mesenchymal tumors. They often recur locally if partially removed. This case report demonstrates not only the characteristic pathological findings of a superficial angiomyxoma in a 33- year-old man, but also shows a unique dermatoscopic image, which in our estimation resembles a celestial red planet such as the blood moon seen during a lunar eclipse. We propose to call this the “red planet” sign for a superficial angiomyxoma on dermoscopic examinat...
Green, Margaret; Logemann, Nichola; Sulit, Daryl J
2014-09-16
Superficial angiomyxomas are uncommon benign mesenchymal tumors. They often recur locally if partially removed. This case report demonstrates not only the characteristic pathological findings of a superficial angiomyxoma in a 33- year-old man, but also shows a unique dermatoscopic image, which in our estimation resembles a celestial red planet such as the blood moon seen during a lunar eclipse. We propose to call this the "red planet" sign for a superficial angiomyxoma on dermoscopic examination.
Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis
Directory of Open Access Journals (Sweden)
Jill Narak
2015-01-01
Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.
Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu
2011-10-01
The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.
Elevated serum creatinine and hyponatraemia as prognostic factors in canine acute pancreatitis.
Marchetti, V; Gori, E; Lippi, I; Luchetti, E; Manca, M L; Pierini, A
2017-11-01
To evaluate prognostic factors for canine acute pancreatitis (AP) based on clinical and laboratory data that can be easily assessed in veterinary practice. Retrospective study between January 2010 and December 2013. The diagnosis of AP was based on clinical signs and an abnormal SNAP® cPL™ test result, concurrently with an ultrasound pattern suggestive of pancreatitis. Dogs were divided into survivors and non-survivors. We evaluated 12 clinical and laboratory parameters: respiratory rate, rectal temperature, white blood cells, haematocrit, total serum proteins, albumin, creatinine, cholesterol, total and ionised calcium, sodium and potassium. Clinical and clinicopathological data were statistically compared between survivors and non-survivors. A value of P 212 μmol/L (2.4 mg/dL) were associated significantly with poor prognosis. Azotaemia (OR 12.5; 95% confidence interval (CI) 1.32-118.48) and hyponatraemia (OR 4.9; 95% CI 1.36-17.64) were associated with increased risk of death. In dogs with AP, hyponatraemia and azotaemia seem to be significantly associated with an increased risk of death. © 2017 Australian Veterinary Association.
Collett, A R; Fletcher, B
2000-12-01
A case report is detailed in which autotransplanted maxillary canines were removed and the spaces closed. Substantial surrounding bone loss was associated with the upper right canine, and a bone graft was needed to reestablish normal dentoalveolar ridge morphology. Bone was taken from the maxillary tuberosity and placed in the canine extraction site, fixed with a bone screw, and covered with GoreTex. Seven months after placement of the bone graft, the GoreTex and stabilizing screw were removed to allow for consolidation of the bone. The upper left canine and lower second premolars were extracted, and fixed appliances were placed in both arches to align the teeth and close the spaces. Protraction of the upper right first premolar and retraction of the lateral incisor into the graft site were kept slow and constant with continued periodontal assessment. During the space closure, there was some concern that the bone in the graft site might resorb, leaving the teeth with compromised periodontal support. However, no significant periodontal attachment loss occurred despite ongoing concern about the amount of keratinized tissue. Perhaps the relatively slow rate of tooth movement provided for bone to be maintained and recreated ahead of the tooth. Almost complete closure of the upper canine extraction spaces was achieved. The upper premolars were substituted for the maxillary canines, and unfavorable prosthetic options were thus avoided. The lower arch was aligned, and the extraction spaces completely closed.
Interdigital foot infections: Corynebacterium minutissimum and agents of superficial mycoses
Directory of Open Access Journals (Sweden)
Fatma Mutlu Sariguzel
2014-09-01
Full Text Available Interdigital foot infections are mostly caused initially by dermatophytes, yeasts and less frequently by bacteria. Erythrasma caused by Corynebacterium minutissimum can be confused with superficial mycoses. The aim of the study was to determine the prevalence of the etiologic agents of superficial mycoses and the frequency of Corynebacterium minutissimum in interdigital foot infections. All the samples obtained from the 121 patients with interdigital foot infections were examined directly with the use of 20% potassium hydroxide mounts and Gram stain under the microscope and cultured on Sabouraud's dextrose agar plates. In identification of superficial mycoses, the rate was found to be 14% with the cultural method and 14% with direct microscopic examination. Using a combination of direct microscopic examination and culture, a 33.8% ratio was achieved. In the culture of these samples, the most isolated factor was Trichophyton rubrum (33.7%. In 24 of the patients (19.8% Corynebacterium minutissimum was detected by Gram staining, in 6 of these patients Trichophyton rubrum was found, Trichophyton mentagrophytes was found in 2 and Trichosporon spp. was found in 1. The examination of interdigital foot lesions in the laboratory, the coexistence of erythrasma with dermatophytes and yeast should be considered.
Bacterias en superficies contactadas durante las tomas radiográficas intraorales
Lee, Guihan; Calderón-Ubaquí, Victor; Sacsaquispe-Contreras, Sonia
2016-01-01
Objetivo: Determinar la presencia de bacterias mediante el análisis microbiológico en las superficies contactadas por el operador durante la toma y procesado de radiografías intraorales en diferentes momentos del día en el Servicio de Radiología Oral de la UPCH. Materiales y métodos: Se realizó un muestreo en nueve superficies del servicio de radiología oral. Las muestras se tomaron en dos momentos por el mismo investigador; al inicio y al finalizar las actividades en el servicio, se realizó ...
"Fooling fido"--chemical and behavioral studies of pseudo-explosive canine training aids.
Kranz, William D; Strange, Nicholas A; Goodpaster, John V
2014-12-01
Genuine explosive materials are traditionally employed in the training and testing of explosive-detecting canines so that they will respond reliably to these substances. However, challenges arising from the acquisition, storage, handling, and transportation of explosives have given rise to the development of "pseudo-explosive" training aids. These products attempt to emulate the odor of real explosives while remaining inert. Therefore, a canine trained on a pseudo-explosive should respond to its real-life analog. Similarly, a canine trained on an actual explosive should respond to the pseudo-explosive as if it was real. This research tested those assumptions with a focus on three explosives: single-base smokeless powder, 2,4,6-trinitrotoluene (TNT), and a RDX-based plastic explosive (Composition C-4). Using gas chromatography-mass spectrometry with solid phase microextraction as a pre-concentration technique, we determined that the volatile compounds given off by pseudo-explosive products consisted of various solvents, known additives from explosive formulations, and common impurities present in authentic explosives. For example, simulated smokeless powders emitted terpenes, 2,4-dinitrotoluene, diphenylamine, and ethyl centralite. Simulated TNT products emitted 2,4- and 2,6-dinitrotoluene. Simulated C-4 products emitted cyclohexanone, 2-ethyl-1-hexanol, and dimethyldinitrobutane. We also conducted tests to determine whether canines trained on pseudo-explosives are capable of alerting to genuine explosives and vice versa. The results show that canines trained on pseudo-explosives performed poorly at detecting all but the pseudo-explosives they are trained on. Similarly, canines trained on actual explosives performed poorly at detecting all but the actual explosives on which they were trained.
Morphological study of maxillary canine region based on CT
International Nuclear Information System (INIS)
Yamada, Maiko; Takamori, Hitoshi; Ide, Yoshiaki; Yosue, Takashi
2010-01-01
The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)
Induction of superficial cortical layer neurons from mouse embryonic stem cells by valproic acid.
Juliandi, Berry; Abematsu, Masahiko; Sanosaka, Tsukasa; Tsujimura, Keita; Smith, Austin; Nakashima, Kinichi
2012-01-01
Within the developing mammalian cortex, neural progenitors first generate deep-layer neurons and subsequently more superficial-layer neurons, in an inside-out manner. It has been reported recently that mouse embryonic stem cells (mESCs) can, to some extent, recapitulate cortical development in vitro, with the sequential appearance of neurogenesis markers resembling that in the developing cortex. However, mESCs can only recapitulate early corticogenesis; superficial-layer neurons, which are normally produced in later developmental periods in vivo, are under-represented. This failure of mESCs to reproduce later corticogenesis in vitro implies the existence of crucial factor(s) that are absent or uninduced in existing culture systems. Here we show that mESCs can give rise to superficial-layer neurons efficiently when treated with valproic acid (VPA), a histone deacetylase inhibitor. VPA treatment increased the production of Cux1-positive superficial-layer neurons, and decreased that of Ctip2-positive deep-layer neurons. These results shed new light on the mechanisms of later corticogenesis. Copyright © 2011 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.
Pathophysiology, diagnosis, and treatment of canine hip dysplasia
International Nuclear Information System (INIS)
Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.
1996-01-01
Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education
Does contemporary canine diet cause cancer? ; A review
Directory of Open Access Journals (Sweden)
Joseph B Gentzel
2013-07-01
Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer
Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing
2014-06-01
The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.
Spectral characterization of superficial coal groups
International Nuclear Information System (INIS)
Ahmad, I.; Khan, M.A.; Ishaq, M.; Shakirullah; Bahadur, A.
2004-01-01
Spectral characterization of superficial coal groups was performed in KBr pellets. KBr Pellets were prepared for virgin and variously pretreated coal samples. Spectra of satisfactory resolution were obtained in wave number range-4000-400 cm /sup -1/. Presence of broad absorption bands corresponds to hydroxyl, carbonyl, carboxyl and phenolic functionalities in the spectra clearly define their presence in all samples understudy. Forced oxidation proved effective for oxidation of both aliphatic and aromatic configurations, which can be revealed from the respective spectra. (author)
Temperature distributions in 136 superficial radiothermotherapies
International Nuclear Information System (INIS)
Willich, N.; Duve, S.; Pfluger, T.; Bachmeier, K.
1992-01-01
Temperature distributions from 136 superficial radiothermotherapies in patients were analysed and three-dimensionally reconstructed. The calculation of mean values and standard deviations of the temperature measuring probes considering water bolus temperature, master probe temperature, site of the probes relatively to different applicator positions and site of the probes in the heated tissues yielded satisfactory temperature distributions for chest wall treatment in contrast to other regions of the body. Radiothermotherapy was statistically not superior to radiotherapy alone with respect to local tumor control. (authors)
Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.
Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D
2014-12-01
Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.
Canine parvovirus in asymptomatic feline carriers.
Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D
2012-05-25
Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog
Electroencephalography as a diagnostic technique for canine neurological diseases
Directory of Open Access Journals (Sweden)
Wrzosek Marcin
2016-06-01
Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.
Canine distemper virus detection in asymptomatic and non vaccinated dogs
Directory of Open Access Journals (Sweden)
Helen L. Del Puerto
2010-02-01
Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom
Investigation of nanodiamonds interactions in canine blood
WÄ sowicz, Michał; Marek, Kulka; Cićkiewicz, Maciej; Cymerman, Magdalena
2017-02-01
The whole blood contains red cells, white cells, and platelets suspended in plasma. In the following study we investigated an impact of nanodiamond particles on blood elements over various periods of time.The material used in the study consisted of samples taken from ten healthy canines (Canis lupus f. domestica) of various age, different blood types and both sexes. The markings were conducted by adding to the blood unmodified diamonds (SND), modified O2 (SO2) suspended in 0,9% NaCl. The blood was put under an impact of two diamond concentrations: 20μl and 100μl. The amount of abnormal cells increased with time. The percentage of echinocytes as a result of interaction with nanodiamonds in various time periods for individual specimens was scarce. In the examined microscopic image a summary was made for 100 white blood cells. Following cells were included in said group: band neutrophils, segmented neutrophils, eosinophils, basophils, lymphocytes, monocytes, lymphocytes with granulates, stimulated lymphocytes, lymphocytes with vacuoles, metamielocytes and smudge cells. The impact of the three diamond types had no clinical importance on red blood cells. After the diamonds mixed with white blood cells, atypical cells came into being, in the range of agranulocytes in stimulated form or with granulates and/or vacuoles. It is supposed that as a result of longlasting exposure a stimulation and vacuolisation takes place, because of the function of the cells.
Experimental study of pulmonary thromboembolism ischemia-reperfusion injury in canine model
International Nuclear Information System (INIS)
Li Jianjun; Zhai Renyou; Zhang Dongpo; Huang Qiang; Yu Ping; Dai Dingke; Bao Na
2009-01-01
Objective: To establish a canine model of pulmonary thromboembolism ischemia- reperfusion injury (PTE IRI) that may be used for imaging study. Methods: Ten male and 10 female healthy mongrel canines with (18.6±0.8) kg/body weight, were used. A Swan-Ganz catheter was introduced into the right internal jugular vein via a preset percutaneous sheath using the Seldinger technique, and then was with further insertion the pulmonary artery. Balloon occlusion of the right inferior lobe pulmonary artery for 4 hours was followed by removing the catheter and ending with 4 hours of reperfusion. CT was performed before ischemia, 4 h after ischemia and 4 h after reperfusion. At last, dogs were killed and the bilateral inferior lung tissues were prepared for the examination by light and electronic microscopy. Results: All canine models were successfully developed pulmonary thromboembolism ischemia-reperfusion injury. The examination of CT, light and electron microscopy consistently indicated the presence of permeability pulmonary edema after reperfusion. Conclusions: A closed-chest canine model in vivo of pulmonary thromboembolism ischemia-reperfusion injury can be established with virtual pathophysiological process in human and be as well as for imaging experimental study. (authors)
Kalli, Irida V; Adamama-Moraitou, Katerina K; Patsika, Michael N; Pardali, Dimitra; Steiner, Jörg M; Suchodolski, Jan S; Menexes, George; Brellou, Georgia D; Rallis, Timoleon S
2017-03-01
Pancreatic abnormalities during canine parvovirus (CPV) enteritis have not been studied prospectively. The objective of this study was to evaluate the diagnostic significance of canine serum pancreas-specific lipase (Spec cPL) concentration in dogs with CPV enteritis for the presence of acute pancreatitis (AP). Puppies with naturally occurring CPV enteritis were recruited and prospectively allocated into 2 groups according to normal or increased serum Spec cPL concentration. Clinical signs, laboratory findings, and pancreas-associated variables were compared between groups, and the impact of possible AP on disease course, duration of hospitalization, and outcome was assessed. Serum Spec cPL concentration in 35 puppies was above the upper limit of the RI in 17/35 (48.6%) dogs (Group A) and within the RI in 18 dogs (Group B). An increased serum lipase activity was present in 29/35 (82.9%) dogs, and Group A dogs had a higher serum lipase activity than Group B (P = .006). Serum Spec cPL in Group A dogs was positively correlated with serum lipase activity at the day of presentation (r = .667; P = .003) and day of discharge (r = .628; P = .007). No statistically significant difference was found between groups (P = .233) for the presence of systemic inflammatory response syndrome (SIRS) (6/17 or 35.3% dogs Group A, and 8/18 or 44.4% dogs Group B), the disease course, duration of hospitalization, or outcome between groups. Increased serum Spec cPL is relatively common in dogs with CPV enteritis. However, such increases do not seem to correlate with the outcome of disease. © 2017 American Society for Veterinary Clinical Pathology.
A survey of canine tick-borne diseases in India
Directory of Open Access Journals (Sweden)
Coleman Glen T
2011-07-01
Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.
Superficial Temporal Artery Pseudoaneurysm: A Conservative Approach in a Critically Ill Patient
International Nuclear Information System (INIS)
Grasso, Rosario Francesco; Quattrocchi, Carlo Cosimo; Crucitti, Pierfilippo; Carboni, Giampiero; Coppola, Roberto; Zobel, Bruno Beomonte
2007-01-01
A 71-year-old man affected by cardio- and cerebrovascular disease experienced an accidental fall and trauma to the fronto-temporal area of the head. A few weeks later a growing mass appeared on his scalp. A diagnosis of superficial temporal artery pseudoaneurysm was made following CT and color Doppler ultrasound. His clinical condition favoured a conservative approach by ultrasound-guided compression and subsequent surgical resection. A conservative approach should be considered the treatment of choice in critically ill patients affected by superficial temporal artery pseudoaneurysm
New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins
Directory of Open Access Journals (Sweden)
J. Michael Plavcan
2012-03-01
Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.
Molecular characterization of the canine HMGB1.
Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I
2003-01-01
Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel
Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I
2013-06-13
Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data
Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei
2013-01-01
Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666
Directory of Open Access Journals (Sweden)
Jiexia Wen
2013-01-01
Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.
3D enamel thickness in Neandertal and modern human permanent canines.
Buti, Laura; Le Cabec, Adeline; Panetta, Daniele; Tripodi, Maria; Salvadori, Piero A; Hublin, Jean-Jacques; Feeney, Robin N M; Benazzi, Stefano
2017-12-01
Enamel thickness figures prominently in studies of human evolution, particularly for taxonomy, phylogeny, and paleodietary reconstruction. Attention has focused on molar teeth, through the use of advanced imaging technologies and novel protocols. Despite the important results achieved thus far, further work is needed to investigate all tooth classes. We apply a recent approach developed for anterior teeth to investigate the 3D enamel thickness of Neandertal and modern human (MH) canines. In terms of crown size, the values obtained for both upper and lower unworn/slightly worn canines are significantly greater in Neandertals than in Upper Paleolithic and recent MH. The 3D relative enamel thickness (RET) is significantly lower in Neandertals than in MH. Moreover, differences in 3D RET values between the two groups appear to decrease in worn canines beginning from wear stage 3, suggesting that both the pattern and the stage of wear may have important effects on the 3D RET value. Nevertheless, the 3D average enamel thickness (AET) does not differ between the two groups. In both groups, 3D AET and 3D RET indices are greater in upper canines than in lower canines, and overall the enamel is thicker on the occlusal half of the labial aspect of the crown, particularly in MH. By contrast, the few early modern humans investigated show the highest volumes of enamel while for all other components of 3D enamel, thickness this group holds an intermediate position between Neandertals and recent MH. Overall, our study supports the general findings that Neandertals have relatively thinner enamel than MH (as also observed in molars), indicating that unworn/slightly worn canines can be successfully used to discriminate between the two groups. Further studies, however, are needed to understand whether these differences are functionally related or are the result of pleiotropic or genetic drift effects. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K
2011-04-09
Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...
Esophagectomy for Superficial Esophageal Neoplasia.
Watson, Thomas J
2017-07-01
Endoscopic therapies have become the standard of care for most cases of Barrett's esophagus with high-grade dysplasia or intramucosal adenocarcinoma. Despite a rapid and dramatic evolution in treatment paradigms, esophagectomy continues to occupy a place in the therapeutic armamentarium for superficial esophageal neoplasia. The managing physician must remain cognizant of the limitations of endoscopic approaches and consider surgical resection when they are exceeded. Esophagectomy, performed at experienced centers for appropriately selected patients with early-stage disease can be undertaken with the expectation of cure as well as low mortality, acceptable morbidity, and good long-term quality of life. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
TOSAKA, Masahiko; SATO, Koji; AMANUMA, Makoto; HIGUCHI, Tetsuya; ARAI, Motohiro; AISHIMA, Kaoru; SHIMIZU, Tatsuya; HORIGUCHI, Keishi; SUGAWARA, Kenichi; YOSHIMOTO, Yuhei
2015-01-01
Superficial siderosis is a rare condition caused by hemosiderin deposits in the central nervous system (CNS) due to prolonged or recurrent low-grade bleeding into the cerebrospinal fluid (CSF). CNS tumor could be one of the sources of bleeding, both pre- and postoperatively. We report an extremely rare case of superficial siderosis associated with purely third ventricle craniopharyngioma, and review previously reported cases of superficial siderosis associated with CNS tumor. A 69-year-old man presented with headache, unsteady gait, blurred vision, and progressive hearing loss. Brain magnetic resonance (MR) imaging with gadolinium revealed a well enhanced, intraventricular mass in the anterior part of the third ventricle. T2*-weighted gradient echo (GE) MR imaging revealed a hypointense rim around the brain particularly marked within the depth of the sulci. Superficial siderosis was diagnosed based on these findings. The tumor was diffusely hypointense on T2*-weighted GE imaging, indicating intratumoral hemorrhage. The lateral ventricles were dilated, suggesting hydrocephalus. [18F]fluorodeoxyglucose positron emission tomography revealed increased uptake in the tumor. The whole brain surface appeared dark ocher at surgery. Histological examination showed the hemorrhagic tumor was papillary craniopharyngioma. His hearing loss progressed after removal of the tumor. T2*-weighted GE MR imaging demonstrated not only superficial siderosis but also diffuse intratumoral hemorrhage in the tumor. Superficial siderosis and its related symptoms, including hearing loss, should be considered in patients with hemorrhagic tumor related to the CSF space. Purely third ventricle craniopharyngioma rarely has hemorrhagic character, which could cause superficial siderosis and progressive hearing loss. PMID:24670310
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA.
Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O
2018-01-01
Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA
Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O
2018-01-01
Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647
Canine Detection of Illict Drugs: Sensory Apparatus Technology
National Research Council Canada - National Science Library
Morrison, Edward
2000-01-01
This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...
A method for determination of the superficial charge density
International Nuclear Information System (INIS)
Vila, F.
1992-10-01
In this article is presented a new methodism for determination of superficial charge density in nonconducting materials which is based in the combination of laboratory calibrated experiments in conducting surfaces with theoretical calculations for nonconducting surfaces. (author). 19 refs, 7 figs, 1 tab
Frey′s Syndrome as a Sequela of Superficial Parotidectomy
Directory of Open Access Journals (Sweden)
Rishi Kumar Bali
2006-01-01
The disorder is characterized by unilateral sweating and flushing of facial skin in the area of parotid gland occurring during meals. We present a case of a patient who developed symptoms of Frey Syndrome 4 months after undergoing superficial parotidectomy on left side.
Treatment for superficial infusion thrombophlebitis of the upper extremity
Di Nisio, Marcello; Peinemann, Frank; Porreca, Ettore; Rutjes, Anne W. S.
2015-01-01
Although superficial thrombophlebitis of the upper extremity represents a frequent complication of intravenous catheters inserted into the peripheral veins of the forearm or hand, no consensus exists on the optimal management of this condition in clinical practice. To summarise the evidence from
Coryneform bacteria associated with canine otitis externa
DEFF Research Database (Denmark)
Aalbæk, Bent; Bemis, David A.; Schjærff, Mette
2010-01-01
This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...
Antigenic typing Polish isolates of canine parvovirus
Energy Technology Data Exchange (ETDEWEB)
Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)
1995-12-31
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.
Antigenic typing Polish isolates of canine parvovirus
International Nuclear Information System (INIS)
Mizak, B.; Plucienniczak, A.
1995-01-01
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs
Szarmach, I J; Szarmach, J; Waszkiel, D; Paniczko, A
2006-01-01
The aim of the study was to assess the effect of orthodontic movement of the impacted canines after surgical exposure and alignment on the periodontal status of the transpositioned and adjacent teeth as well as to compare certain parameters with those of spontaneously erupted teeth. Twenty-four patients (mean age 18.4 +/- 3.66) with unilaterally impacted 24 canines were enrolled in the study. The following parameters were assessed: pocket depth (PD), clinical attachment level (CAL), platelet index (PI) of Silness and Löe, and modified sulcus bleeding index (SBI). Optic density of the alveolar bone along the root surface of the aligned canine was analysed based on digital radiological images made with the right angle technique. Control group consisted of spontaneously erupted teeth. In comparison to the control group, in the orthodonticaly treated group PD was found to increase on the mesial buccal and palatal surfaces of the first premolar (p aligned canine (p aligned tooth were statistically significant (p alignment zone and the control, and there was no link between the method of treatment and periodontal status, either. The alignment of the impacted permanent maxillary canines poses a risk of periodontal deterioration. Patients subjected to surgical-orthodontic treatment require periodic periodontal follow-ups.
Energy Technology Data Exchange (ETDEWEB)
O' Keefe, Patrick; Reid, Janet; Morrison, Stuart [Cleveland Clinic Foundation, Department of Radiology, Cleveland, OH (United States); Vidimos, Allison [Cleveland Clinic Foundation, Department of Dermatology, Cleveland, OH (United States); DiFiore, John [Cleveland Clinic Foundation, Department of Pediatric Surgery, Cleveland, OH (United States)
2005-12-01
Plexiform neurofibroma is a pathognomonic, often disabling feature of neurofibromatosis type I. Although the target-like appearance of deep plexiform neurofibroma on T2-weighted MRI has been well-described, a second superficial form of plexiform neurofibroma has differing imaging features. We report a 15-year-old boy who presented with multiple cutaneous lesions exhibiting clinical and imaging characteristics of a venolymphatic malformation. These lesions were histologically proved to represent superficial plexiform neurofibromas. We wish to emphasize the unique MR findings of superficial plexiform neurofibromas; these findings are different from the imaging characteristics of the deep form and can be confused with a low-flow vascular malformation. (orig.)
Directory of Open Access Journals (Sweden)
D S Kothavade
2012-01-01
Full Text Available Aim : The purpose of the present study was to establish the relationship between the eruption of permanent maxillary canines and cervical vertebral maturation stages (CVMs to assess an alternative method for determining time of canine eruption in the late mixed dentition. Materials and Methods : One hundred and twenty subjects with erupting permanent maxillary canines were observed both intraorally and radiographically with orthopantamograms. Lateral cephalograms were recorded to divide subjects according to CVM stage into prepeak (CS1 and CS2, peak (CS3 and CS4 and postpeak (CS5 and CS6 groups of puberty. Statistical Analysis : The differences between the prevalence rates of canine eruption in different groups of puberty were estimated using ′z test′. Results : Prepeak group comprised of forty six subjects, peak group sixty eight subjects and postpeak group six subjects. The differences in prevalence rates between peak and prepeak and between peak and postpeak groups were noticed highly significant (p<0.001, while prevalence rates between peak and postpeak was found less significant ( p0 <0.01. Conclusion : Eruption of the permanent maxillary canine can occur at any CVM stage till end of the puberty or after puberty (CS1-CS6. Thus, an absence of maxillary canine during or after postpeak stage of puberty (CS5 or CS6 suggests delayed eruption and canine impaction.
Cathepsin K expression and activity in canine osteosarcoma.
Schmit, J M; Pondenis, H C; Barger, A M; Borst, L B; Garrett, L D; Wypij, J M; Neumann, Z L; Fan, T M
2012-01-01
Cathepsin K (CatK) is a lysosomal protease with collagenolytic activity, and its secretion by osteoclasts is responsible for degrading organic bone matrix. People with pathologic bone resorption have higher circulating CatK concentrations. Canine osteosarcoma (OS) cells will possess CatK, and its secretion will be cytokine inducible. Circulating CatK concentrations will be increased in dogs with OS, and will be a surrogate marker of bone resorption. Fifty-one dogs with appendicular OS and 18 age- and weight-matched healthy control dogs. In a prospective study, expressions of CatK mRNA and protein were investigated in OS cells. The inducible secretion and proteolytic activity of CatK from OS cells was assessed in vitro. Serum CatK concentrations were quantified in normal dogs and dogs with OS and its utility as a bone resorption marker was evaluated in dogs with OS treated with palliative radiation and antiresorptive agents. Canine OS cells contain preformed CatK within cytoplasmic vesicles. In OS cells, TGFβ1 induced the secretion of CatK, which degraded bone-derived type I collagen in vitro. CatK concentrations were higher in dogs with OS than healthy dogs (11.3 ± 5.2 pmol/L versus 8.1 ± 5.0 pmol/L, P = .03). In a subset of dogs with OS, pretreatment CatK concentrations gradually decreased after palliative radiation and antiresorptive treatment, from 9.3 ± 3.2 pmol/L to 5.0 ± 3.1 pmol/L, P = .03. Canine OS is associated with pathologic bone resorption, and CatK inhibitors might aid in the management of canine OS-related malignant osteolysis. Copyright © 2011 by the American College of Veterinary Internal Medicine.
Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa
Directory of Open Access Journals (Sweden)
Nozyechi Ngulube Chidumayo
2018-02-01
Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.
Canine trypanosomosis: Clinical observations and morphological ...
African Journals Online (AJOL)
Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...
Castro, Marcelo A.; Pham, Dzung L.; Butman, John
2016-03-01
Minimum intensity projection is a technique commonly used to display magnetic resonance susceptibility weighted images, allowing the observer to better visualize hemorrhages and vasculature. The technique displays the minimum intensity in a given projection within a thick slab, allowing different connectivity patterns to be easily revealed. Unfortunately, the low signal intensity of the skull within the thick slab can mask superficial tissues near the skull base and other regions. Because superficial microhemorrhages are a common feature of traumatic brain injury, this effect limits the ability to proper diagnose and follow up patients. In order to overcome this limitation, we developed a method to allow minimum intensity projection to properly display superficial tissues adjacent to the skull. Our approach is based on two brain masks, the largest of which includes extracerebral voxels. The analysis of the rind within both masks containing the actual brain boundary allows reclassification of those voxels initially missed in the smaller mask. Morphological operations are applied to guarantee accuracy and topological correctness, and the mean intensity within the mask is assigned to all outer voxels. This prevents bone from dominating superficial regions in the projection, enabling superior visualization of cortical hemorrhages and vessels.
Directory of Open Access Journals (Sweden)
Tracy Chew
2017-07-01
Full Text Available Progressive retinal atrophy is a common cause of blindness in the dog and affects >100 breeds. It is characterized by gradual vision loss that occurs due to the degeneration of photoreceptor cells in the retina. Similar to the human counterpart retinitis pigmentosa, the canine disorder is clinically and genetically heterogeneous and the underlying cause remains unknown for many cases. We use a positional candidate gene approach to identify putative variants in the Hungarian Puli breed using genotyping data of 14 family-based samples (CanineHD BeadChip array, Illumina and whole-genome sequencing data of two proband and two parental samples (Illumina HiSeq 2000. A single nonsense SNP in exon 2 of BBS4 (c.58A > T, p.Lys20* was identified following filtering of high quality variants. This allele is highly associated (PCHISQ = 3.425e−14, n = 103 and segregates perfectly with progressive retinal atrophy in the Hungarian Puli. In humans, BBS4 is known to cause Bardet–Biedl syndrome which includes a retinitis pigmentosa phenotype. From the observed coding change we expect that no functional BBS4 can be produced in the affected dogs. We identified canine phenotypes comparable with Bbs4-null mice including obesity and spermatozoa flagella defects. Knockout mice fail to form spermatozoa flagella. In the affected Hungarian Puli spermatozoa flagella are present, however a large proportion of sperm are morphologically abnormal and <5% are motile. This suggests that BBS4 contributes to flagella motility but not formation in the dog. Our results suggest a promising opportunity for studying Bardet–Biedl syndrome in a large animal model.
The unerupted maxillary canine - a post-surgical review.
LENUS (Irish Health Repository)
O'Dowling, Ian
2009-10-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
The unerupted maxillary canine--a post-surgical review.
O'Dowling, Ian
2009-01-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
Diagnostic and therapeutic challenges in superficial CNS siderosis
DEFF Research Database (Denmark)
Kondziella, Daniel; Lindelof, M.; Haziri, Donika
2015-01-01
the challenges related to the diagnosis and treatment of superficial siderosis. RESULTS: A potential bleeding aetiology was identified in all patients, but removal of the offending bleeding source was achieved only in three (33%). Symptom progression was halted in just one patient (11%), which suggests...... neurotoxicity due to accumulating iron toxicity. FUNDING: not relevant. TRIAL REGISTRATION: not relevant....
Canine distemper spillover in domestic dogs from urban wildlife.
Kapil, Sanjay; Yeary, Teresa J
2011-11-01
Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.
Relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction
Directory of Open Access Journals (Sweden)
Anísio Bueno de Carvalho
2012-12-01
Full Text Available OBJECTIVE: The purpose was to obtain information about the relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction. METHODS: Seventy-three patients with canine impaction and 73 control patients, without canine impaction, were evaluated. The mesiodistal distances of the maxillary lateral incisors adjacent to the impacted canines and the correspondent mandibular lateral incisors were measured. The adjacent lateral incisors were classified in: 1 - absent, 2 - small, 3 - peg-shaped, 4 - standard. RESULTS: The results showed that among the patients with impacted canines, there were 21 anomalous teeth (small and peg-shaped and among the control patients there were only three small and peg-shaped teeth, with a statistically significant difference (p = 0.001. No patients were found with impacted canines and absent lateral incisors. CONCLUSION: It was concluded that in patients with anomalous lateral incisors (small and peg-shaped there is a probability to present impacted canines and this must be considered.OBJETIVO: o objetivo foi obter informação sobre a relação existente entre a agenesia e/ou anomalia de forma de incisivos laterais superiores e impacção de caninos. MÉTODOS: foram avaliados 73 pacientes com impacção de caninos e 73 pacientes controle, sem impacção de caninos. Foram medidas as distâncias mesiodistais dos incisivos laterais superiores adjacentes aos caninos impactados e os incisivos laterais correspondentes inferiores. Os incisivos laterais adjacentes foram classificados em: 1 - ausentes; 2 - pequenos; 3 - conoides; 4 - normais. RESULTADOS: os resultados mostraram que no grupo de pacientes com caninos impactados foram encontrados 22 dentes anômalos (pequenos e conoides, e no grupo controle apenas três dentes pequenos e conoides, sendo uma diferença estatisticamente significativa (p=0,001. Não foram encontrados pacientes com canino impactado e incisivo lateral ausente. CONCLUS
Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis
International Nuclear Information System (INIS)
Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.
1988-01-01
Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)
International Nuclear Information System (INIS)
Alif, Sheikh Mohammad; Haque, Sejuty; Nimmi, Naima; Ashraf, Ali; Khan, Saeed Hossain; Khan, Mahfujul Haq
2011-01-01
This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x 2 ) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.
Gamma Activation Analysis in the Havana Bay superficial sediments
International Nuclear Information System (INIS)
Lopez, N.; Gelen, A.; Diaz Riso, O.; Manso, M.V.; Simon, M.J.; Maslov, A.G.; Gustova, M.V.; Beltran, J.; Soto, J.
2003-01-01
A preliminary study of 26 elements of Havana Bay superficial sediments were made using Gamma Activation Analysis. Samples from five zones of Havana Bay were analyzed. The results show a close interrelation between the concentration levels of the studied elements and the contaminant sources
A comparative study between mixed-type tumours from human salivary and canine mammary glands
International Nuclear Information System (INIS)
Genelhu, Marisa CLS; Cardoso, Sérgio V; Gobbi, Helenice; Cassali, Geovanni D
2007-01-01
In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations
In vivo high-resolution 3D photoacoustic imaging of superficial vascular anatomy
International Nuclear Information System (INIS)
Zhang, E Z; Laufer, J G; Beard, P C; Pedley, R B
2009-01-01
The application of a photoacoustic imaging instrument based upon a Fabry-Perot polymer film ultrasound sensor to imaging the superficial vasculature is described. This approach provides a backward mode-sensing configuration that has the potential to overcome the limitations of current piezoelectric based detection systems used in superficial photoacoustic imaging. The system has been evaluated by obtaining non-invasive images of the vasculature in human and mouse skin as well as mouse models of human colorectal tumours. These studies showed that the system can provide high-resolution 3D images of vascular structures to depths of up to 5 mm. It is considered that this type of instrument may find a role in the clinical assessment of conditions characterized by changes in the vasculature such as skin tumours and superficial soft tissue damage due to burns, wounds or ulceration. It may also find application in the characterization of small animal cancer models where it is important to follow the tumour vasculature over time in order to study its development and/or response to therapy.
Photoluminescence of a superficial Si nanolayer and an example of its use
International Nuclear Information System (INIS)
Ley, M.; Svrcek, V.; Kuznicki, Z.T.
2003-01-01
A characteristic photoluminescence of a superficial Si nanolayer realized by ion implantation has been observed. This effect, being totally independent of those shown recently for a nanoscale Si-layered system, is similar to that produced by Si nanocrystals (Si nc). To visualize the nature and give evidence of this effect, we fabricated samples in two different ways: (i) by incorporation of Si nc into thin SiO 2 films deposited on Si wafer by the spin-on-glass method and (ii) by a nanoscale superficial crystalline-Si modification using medium-energy ion implantation and thermal treatment. In both cases the UV-to-red light conversion has been observed to be independent of wafer post-implantation damage. To show the UV-to-red conversion contribution, we use the ion modified superficial Si layer with its well-defined potential barrier, the so-called carrier collection limit. Such a modified Si structure gives us a method of deconvoluting several optoelectronic features observed experimentally on modified Si. The practical realization is compatible with well-established Si technology
In vivo high-resolution 3D photoacoustic imaging of superficial vascular anatomy
Energy Technology Data Exchange (ETDEWEB)
Zhang, E Z; Laufer, J G; Beard, P C [Department of Medical Physics and Bioengineering, University College London, Gower Street, London, WC1E 6BT (United Kingdom); Pedley, R B [UCL Cancer Institute, Paul O' Gorman Building, University College London, 72 Huntley St, London WC1E 6BT (United Kingdom)
2009-02-21
The application of a photoacoustic imaging instrument based upon a Fabry-Perot polymer film ultrasound sensor to imaging the superficial vasculature is described. This approach provides a backward mode-sensing configuration that has the potential to overcome the limitations of current piezoelectric based detection systems used in superficial photoacoustic imaging. The system has been evaluated by obtaining non-invasive images of the vasculature in human and mouse skin as well as mouse models of human colorectal tumours. These studies showed that the system can provide high-resolution 3D images of vascular structures to depths of up to 5 mm. It is considered that this type of instrument may find a role in the clinical assessment of conditions characterized by changes in the vasculature such as skin tumours and superficial soft tissue damage due to burns, wounds or ulceration. It may also find application in the characterization of small animal cancer models where it is important to follow the tumour vasculature over time in order to study its development and/or response to therapy.
Dettwiler, M; Croci, M; Vaughan, L; Guscetti, F
2013-09-01
The BH3-only protein Bad is a proapoptotic Bcl-2 family member that acts as a sensitizer in intrinsic apoptosis by inactivating antiapoptotic members through heterodimer formation. Bad has been shown to contribute to tumorigenesis, including lymphoma formation in humans and mice, through alteration in expression or functional status. Here, its immunohistochemical expression was analyzed in canine nonneoplastic and lymphoma tissues using tissue microarrays. Bad was expressed in the cytoplasm of a wide range of nonneoplastic tissues, especially epithelial cells. Nonneoplastic lymph nodes displayed weak immunostaining in the follicular germinal centers only. Immunoblotting supported these observations but also revealed presence of nonspecific labeling in some organs. Of 81 lymphomas, 29 (35.8%) displayed moderate to strong immunohistochemical Bad labeling, and a significant expression increase was found in lymphomas (especially B cell and double negative) compared to nonneoplastic lymph nodes. These findings warrant further investigations of the functional status, the involvement of partner proteins, and a possible impact of Bad on prognosis in canine lymphoma.
Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T
1995-06-01
For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.
Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.
Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M
2013-09-01
Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.
Volumetric and superficial characterization of carbon activated
International Nuclear Information System (INIS)
Carrera G, L.M.; Garcia S, I.; Jimenez B, J.; Solache R, M.; Lopez M, B.; Bulbulian G, S.; Olguin G, M.T.
2000-01-01
The activated carbon is the resultant material of the calcination process of natural carbonated materials as coconut shells or olive little bones. It is an excellent adsorbent of diluted substances, so much in colloidal form, as in particles form. Those substances are attracted and retained by the carbon surface. In this work is make the volumetric and superficial characterization of activated carbon treated thermically (300 Centigrade) in function of the grain size average. (Author)
Directory of Open Access Journals (Sweden)
Tan Aik Kah
2011-09-01
Full Text Available We report a case of 10-year-old Indian girl with history of multiple superficial angiomyxoma, presented with three months history of painless right upper lid swelling. There were no visual dysfunctions. Previously, the patient had multiple superficial angiomyxoma (left pinna, left upper cheek, left upper limb, chest, right axilla, hard palate and epidermal cyst (chin. The histopathological specimens were negative to S-100 protein antibody. Systemic review and family history was unremarkable. Excision biopsy and upper lid reconstruction were performed. Intraoperatively the tumor was multilobulated, firm, well encapsulated and did not invade the underlying tarsal plate. Histopathological features of the upperlid tumor were consistent with nerves sheath myxoma (neurothekeoma. To the best of the authors’ knowledge, this is the first reported case of neurothekeoma in association with multiple superficial angiomyxoma.
Kah, Tan Aik; Yong, Ku Chui; Annuar, Faridah Hanom
2011-07-01
We report a case of 10-year-old Indian girl with history of multiple superficial angiomyxoma, presented with three months history of painless right upper lid swelling. There were no visual dysfunctions. Previously, the patient had multiple superficial angiomyxoma (left pinna, left upper cheek, left upper limb, chest, right axilla, hard palate) and epidermal cyst (chin). The histopathological specimens were negative to S-100 protein antibody. Systemic review and family history was unremarkable. Excision biopsy and upper lid reconstruction were performed. Intraoperatively the tumor was multilobulated, firm, well encapsulated and did not invade the underlying tarsal plate. Histopathological features of the upperlid tumor were consistent with nerves sheath myxoma (neurothekeoma). To the best of the authors' knowledge, this is the first reported case of neurothekeoma in association with multiple superficial angiomyxoma.
Corte y sellado reversible de dientes para obtener superficies internas de esmalte incólumes
Directory of Open Access Journals (Sweden)
Ana Milena Santiago-Medina
2015-07-01
Full Text Available Las superficies internas de los dientes, que se obtienen por cortes con discos, están generalmente desorganizadas por los giros, la velocidad y la rugosidad del disco. El calor altera la superficie y el agua de la refrigeración la composición química porque disuelve los componentes. En estudios de difusión, el perfil se borra por el corte, lo que anula resultados. Objetivo: desarrollar un método de sellado de superficies internas, ya cortadas antes de los ensayos de difusión, sin dejar trazas químicas o partículas. Materiales y metedos: se probó in vitro la habilidad de cuatro materiales de sellado con 40 especimenes, provenientes de 20 coronas de terceros molares, cortadas sagitalmente. Los especímenes se distribuyeron aleatoriamente en cuatro grupos (n = 10: G1: Teflón (Topex®, G2: Tela de caucho (Dental DAM®, G3: película de cloruro de polivinilo (Vinilpel® y G4: Cinta aislante (Tesa®. Se usó una solución de azul de metileno (AM al 2% por 6 días como indicadora de filtración. Por observación visual de cada muestra, se le asignó un valor (sí o no dependiendo de la presencia o ausencia de cualquier punto MB sobre la superficie de sellado. Los resultados fueron analizados siguiendo un modelo estadístico de respuesta binomial. Resultados: Siguiendo los procedimientos descritos, el teflón es el único material que previene la filtración de AM en la superficie interna expuesta por el corte. Conclusión: Se propone un protocolo de sellado reversible de las superficies internas con teflón, previo al corte de los dientes, para no alterar los resultados experimentales.
Altintas, M A; Altintas, A A; Guggenheim, M; Busch, K H; Niederbichler, A D; Aust, M C; Vogt, P M
2009-12-01
Regardless of the underlying cause, both sunburn and superficial thermal injuries are classified as first-degree burns, since data on morphological differences are scarce. Reflectance-Mode-Confocal Microscopy (RMCM) enables high-resolution non-invasive investigation of the human skin. We studied in vivo histomorphological alterations in both sunburn and superficial thermal injuries using RMCM. Ten patients (6 female, 4 male; aged 28.4 +/- 10.6 years) with first-degree thermal-contact Injuries (TI group), and 9 sunburned patients (SB group; 7 female, 2 male; aged 30.2 +/- 16.4 years), to a maximum extent of 10% of the body surface were evaluated 24 h after burn injury using RMCM. The following parameters were obtained using RMCM: stratum corneum thickness, epidermal thickness, basal layer thickness, granular cell size. Compared to the controls (12.8 +/- 2.5 microm), stratum corneum thickness decreased significantly to 10.6 +/- 2.1 microm in the TI group, whereas it increased significantly to 16.4 +/- 3.1 microm in the SB group. The epidermal thickness did not differ significantly in the TI group (47.9 +/- 2.3 microm) and SB group (49.1 +/- 3.5 microm); however, both increased significantly compared to their respective controls (41.8 +/- 1.4 microm). The basal layer thickness increased more in the SB group compared to the TI group (17.9 +/- 1.4 microm vs. 15.6 +/- 1.1 microm). Both differed also significantly compared to their controls (13.8 +/- 0.9 microm). The granular cell size increased significantly in both groups compared to the controls (731 +/- 42 microm); however, a significantly higher increase was observed in the TI group (852 +/- 58 microm) compared to the SB group (784 +/- 61 microm). Ultraviolet radiation seems to influence predominantly deeper epidermal layers, whereas heat-induced burns affect more superficial epidermal layers. The term 'First-degree burn' should not be used synonymously for sunburn and superficial thermal burn injuries. Conflicts of
Ultrathin endoscopy versus high-resolution endoscopy for diagnosing superficial gastric neoplasia.
Toyoizumi, Hirobumi; Kaise, Mitsuru; Arakawa, Hiroshi; Yonezawa, Jin; Yoshida, Yukinaga; Kato, Masayuki; Yoshimura, Noboru; Goda, Ken-ichi; Tajiri, Hisao
2009-08-01
Ultrathin endoscopy (UTE) is an acceptable and cost-effective alternative to EGD with the patient under sedation, although the diagnostic accuracy of UTE is not well established. To compare the diagnostic accuracy of UTE and high-resolution endoscopy (HRE) for superficial gastric neoplasia. Prospective comparative study. Academic center. Patients with or without superficial gastric neoplasia underwent peroral UTE and HRE, back-to-back in a random order while under standard sedation. The procedures were performed by 2 endoscopists who were blinded to the clinical information. The rate of missed lesions and misdiagnosis, sensitivity, and specificity for the diagnosis of gastric neoplasia when using pathology as the reference standard. In total, 126 lesions (41 superficial gastric neoplasias, 85 nonneoplastic lesions) were recorded in 57 enrolled patients. For the diagnosis of gastric neoplasia, the sensitivity of UTE (58.5%) was significantly (P = .021) lower than that of HRE (78%), and the specificity of UTE (91.8%) was significantly (P = .014) lower than that of HRE (100%). The rate of missed lesions and misdiagnosis of gastric neoplasias when using UTE (41.5%) was significantly (P > .001) higher than that of HRE (22.0%). The corresponding rate of neoplasias at the proximal portion (fornix and corpus) when using UTE (29%) was significantly (P = .002) higher than that of HRE (7.2%), although the rates of neoplasias at the distal portion (angulus and antrum) were comparable for UTE and HRE. Small sample numbers in an enriched population. The diagnostic accuracy of UTE is significantly lower than that of HRE for superficial gastric neoplasia, and this difference is particularly striking for neoplasias in the proximal stomach. For UTE to be used as an alternative modality, improvements in optical quality and the incorporation of additional procedures, including close-range observations and chromoendoscopy, are required to enhance visualization.
Superficial siderosis of the central nervous system | Govind | SA ...
African Journals Online (AJOL)
progression of clinical deterioration but halting the chronic subarachoid haemorrhage will reduce the iron load in the CSF and hence the cytotoxic risk. We present a case of superficial siderosis presenting with hearing loss and cerebellar signs highlighting the imaging findings. South African Journal of Radiology Vol.
Mechanical properties of canine osteosarcoma-affected antebrachia.
Steffey, Michele A; Garcia, Tanya C; Daniel, Leticia; Zwingenberger, Allison L; Stover, Susan M
2017-05-01
To determine the influence of neoplasia on the biomechanical properties of canine antebrachia. Ex vivo biomechanical study. Osteosarcoma (OSA)-affected canine antebrachia (n = 12) and unaffected canine antebrachia (n = 9). Antebrachia were compressed in axial loading until failure. A load-deformation curve was used to acquire the structural mechanical properties of neoplastic and unaffected specimens. Structural properties and properties normalized by body weight (BW) and radius length were compared using analysis of variance (ANOVA). Modes of failure were compared descriptively. Neoplastic antebrachia fractured at, or adjacent to, the OSA in the distal radial diaphysis. Unaffected antebrachia failed via mid-diaphyseal radial fractures with a transverse cranial component and an oblique caudal component. Structural mechanical properties were more variable in neoplastic antebrachia than unaffected antebrachia, which was partially attributable to differences in bone geometry related to dog size. When normalized by dog BW and radial length, strength, stiffness, and energy to yield and failure, were lower in neoplastic antebrachia than in unaffected antebrachia. OSA of the distal radial metaphysis in dogs presented for limb amputation markedly compromises the structural integrity of affected antebrachia. However, biomechanical properties of affected bones was sufficient for weight-bearing, as none of the neoplastic antebrachia fractured before amputation. The behavior of tumor invaded bone under cyclic loading warrants further investigations to evaluate the viability of in situ therapies for bone tumors in dogs. © 2017 The American College of Veterinary Surgeons.
Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro
Directory of Open Access Journals (Sweden)
Cintia Xavier de Mello
2014-12-01
Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.
Directory of Open Access Journals (Sweden)
Adina Coșarcă
2014-02-01
Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated
Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs
McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel
1985-01-01
Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B
2015-01-01
BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Gross anatomy of superficial fascia and future localised fat deposit areas of the abdomen in foetus
Directory of Open Access Journals (Sweden)
Pramod Kumar
2013-01-01
Full Text Available Background: The development and popularity of body contouring procedures such as liposuction and abdominoplasty has renewed interest in the anatomy of the superficial fascia and subcutaneous fat deposits of the abdomen. The study of anatomy of fascia and fetal adipose tissue was proposed as it may be of value in understanding the possible programing of prevention of obesity. Objectives: The present study was undertaken to understand the gross anatomy of superficial fascia of abdomen and to study the gross anatomy of future localized fat deposits (LFDs area of abdomen in fetus. Materials and Methods: Four fetus (two male & two female of four month of intrauterine life were dissected. Attachments & layers of superficial fascia and future subcutaneous fat deposit area of upper and lower abdomen were noted. Results: Superficial fascia of the abdomen was multi layered in mid line and number of layers reduced laterally as in adult. The future abdominal LFD (localized fat deposits area in fetus shows brownish-white blubbary tissue without well-defined adult fat lobules. Conclusion: The attachment and gross anatomy of superficial fascia of the fetus was similar to that in adults. The future LFD areas showed brownish white blubbary tissue with ill-defined fat lobules.
Nd : YAG surgical laser effects in canine prostate tissue: temperature and damage distribution
van Nimwegen, S. A.; L'Eplattenier, H. F.; Rem, A. I.; van der Lugt, J. J.; Kirpensteijn, J.
2009-01-01
An in vitro model was used to predict short-term, laser-induced, thermal damage in canine prostate tissue. Canine prostate tissue samples were equipped with thermocouple probes to measure tissue temperature at 3, 6, 9 and 12 mm depths. The tissue surface was irradiated with a Nd:YAG laser in contact
Nayak, Reshma; Nayak, Us Krishna; Hegde, Gautam
2010-01-01
Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. A total of 160 periapical radiographs (80 males and 80 females), of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian's stages of dental calcification and the modified MP3 stages. The correlation between the developmental stages of MP3 and the mandibular right canine in male and female groups, is of high statistical significance (p = 0.001). The correlation coefficient between MP3 stages and developmental stages of mandibular canine and chronological age in male and females was found to be not significant. The correlation between the mandibular canine calcification stages and MP3 stages was found to be significant. The developmental stages of the mandibular canine could be used very reliably as a sole indicator for assessment of skeletal maturity.
Directory of Open Access Journals (Sweden)
Pamela M. Ortiz
2018-01-01
Full Text Available Objectives. To investigate the association between unilateral/bilateral maxillary canine impaction and sella-turcica bridging using CBCT imaging. Methods. This retrospective comparative study analyzed 76 CBCT images of the craniofacial complex including sella-turcica. The impacted cuspid group consisted of thirty-eight subjects (7 males, 31 females; mean age, 14.6 ± 3.2 years diagnosed with unilateral (left n=14, right n=11 or bilateral (n=13 palatal canine impaction. The control group included thirty-eight subjects matched by sex (7 males, 31 females; mean age, 19.5 ± 3.6 years with no impaction. Multinomial logistic regression analysis was used to determine the association between unilateral/bilateral canine impaction and right and left sella-turcica bridging. Results. The prevalence of sella-turcica bridging was 59.3% and 50% in the impacted canine and control groups, respectively. Although the odds for unilateral canine impaction were increased in the right and left sella-turcica bridging groups compared to the controls, the difference was not statistically significant. The risk of bilateral impaction was different between the two sides of sella-turcica bridging, but, again, the findings were not statistically significant. Conclusion. Contrary to previous 2D studies, there is no statistically significant association between unilateral/bilateral palatal canine impaction and sella-turcica bridging when using 3D CBCT.
Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells
Directory of Open Access Journals (Sweden)
Michelle G. Ritt
2015-04-01
Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.
Automation of gender determination in human canines using artificial intelligence
Directory of Open Access Journals (Sweden)
F. Fidya
2017-09-01
Full Text Available Background: Gender determination is an important aspect of the identification process. The tooth represents a part of the human body that indicates the nature of sexual dimorphism. Artificial intelligence enables computers to perform to the same standard the same tasks as those carried out by humans. Several methods of classification exist within an artificial intelligence approach to identifying sexual dimorphism in canines. Purpose: This study aimed to quantify the respective accuracy of the Naive Bayes, decision tree, and multi-layer perceptron (MLP methods in identifying sexual dimorphism in canines. Methods: A sample of results derived from 100 measurements of the diameter of mesiodistal, buccolingual, and diagonal upper and lower canine jaw models of both genders were entered into an application computer program that implements the algorithm (MLP. The analytical process was conducted by the program to obtain a classification model with testing being subsequently carried out in order to obtain 50 new measurement results, 25 each for males and females. A comparative analysis was conducted on the program-generated information. Results: The accuracy rate of the Naive Bayes method was 82%, while that of the decision tree and MLP amounted to 84%. The MLP method had an absolute error value lower than that of its decision tree counterpart. Conclusion: The use of artificial intelligence methods produced a highly accurate identification process relating to the gender determination of canine teeth. The most appropriate method was the MLP with an accuracy rate of 84%.
Experimental research of covered stent implanted in canine hepatic artery
International Nuclear Information System (INIS)
Zhou Bing; Liu Linxiang; Li Minghua; Wang Yongli; Cheng Yongde
2007-01-01
Objective: To evaluate the feasibility of success rate of implantation, post-procedure stenosis rate, apposition ability and endothelialization level, etc. for implantation with balloon-expandable covered stent in canine hepatic artery. Methods: 8 adult canines were implanted with balloon-expendable stents covered by expandable poly Teflon ester membrane (e-PTFEM). Follow-up DSA was performed immediately, 2, 4 and 12 wk after the procedure. The canines were sacrificed for histopathologic examination and statistical analysis with correlation of implantation manenvor and angiographic manifestations. Results: 8 cases were all implanted with the covered stents in proper hepatic artery/right hepatic artery successfully; showing good apposition ability and non-opacification of the separated branches. 2 cases showed intraluminal obvious stenosis( > 50%)of the stent at 2 weeks follow-up, so did 3 cases at 12 weeks follow-up, and the total stenosis rate was 37.5% and 5 cases manifested full endothelialization (3 different locations of the sample all manifested full endothelialization), 3 cased manifested partial endothelialization (at least 1 location of the sample didn't show full endothelialization), and the two terminal parts were easier to get endothelialization than the central part. Before and after the stent implantation, hepatic function of all cases didn't demonstrate any obvious changes. Conclusions: Balloon-expandable covered stent can be implanted in canine hepatic artery. successfully, with good apposition ability, full endothelialization, and no influence on hepatic function. (authors)
Feeling Abnormal: Simulation of Deviancy in Abnormal and Exceptionality Courses.
Fernald, Charles D.
1980-01-01
Describes activity in which student in abnormal psychology and psychology of exceptional children classes personally experience being judged abnormal. The experience allows the students to remember relevant research, become sensitized to the feelings of individuals classified as deviant, and use caution in classifying individuals as abnormal.…
Extrusion processing : effects on dry canine diets
Tran, Q.D.
2008-01-01
Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.
Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the
International Nuclear Information System (INIS)
Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.
2011-01-01
Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology
Energy Technology Data Exchange (ETDEWEB)
Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)
2011-03-30
Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.
Sigler, Lauren M; Baccetti, Tiziano; McNamara, James A
2011-03-01
Our aim was to investigate the effect of rapid maxillary expansion and transpalatal arch therapy combined with deciduous canine extraction on the eruption rate of palatally displaced canines (PDCs) in patients in the late mixed dentition in a 2-center prospective study. Seventy subjects were enrolled based on PDCs diagnosed on panoramic radiographs. The treatment group (TG, 40 subjects) underwent RME followed by TPA therapy and extraction of the deciduous canines. The control group (CG, 30 subjects) received no orthodontic treatment. At the start of the trial, panoramic radiographs and dental casts were compared between the TG and the CG with the Mann-Whitney U test (P anomalies was reported. No statistically significant difference was found for any measurement at the start of the trial between the 2 groups. The prevalence rates of eruption of the maxillary canines were 80% for the TG and 28% in the CG, a statistically significant difference (chi-square =16.26, P mixed dentition with PDCs. Pretreatment variables indicating success of treatment on the eruption of PDCs were less severe sectors of displacement, prepubertal stages of skeletal maturity, and open root apices of PDCs. Several dental anomalies were associated significantly with PDCs, thus confirming the genetic etiology of this eruption disturbance. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.
Transdermal drug delivery: feasibility for treatment of superficial bone stress fractures.
Aghazadeh-Habashi, Ali; Yang, Yang; Tang, Kathy; Lőbenberg, Raimar; Doschak, Michael R
2015-12-01
Transdermal drug delivery offers the promise of effective drug therapy at selective sites of pathology whilst reducing systemic exposure to the pharmaceutical agents in off-target organs and tissues. However, that strategy is often limited to cells comprising superficial tissues of the body (rarely to deeper bony structures) and mostly indicated with small hydrophobic pharmacological agents, such as steroid hormones and anti-inflammatory gels to skin, muscle, and joints. Nonetheless, advances in transdermal liposomal formulation have rendered the ability to readily incorporate pharmacologically active hydrophilic drug molecules and small peptide biologics into transdermal dosage forms to impart the effective delivery of those bioactive agents across the skin barrier to underlying superficial tissue structures including bone, often enhanced by some form of electrical, chemical, and mechanical facilitation. In the following review, we evaluate transdermal drug delivery systems, with a particular focus on delivering therapeutic agents to treat superficial bone pain, notably stress fractures. We further introduce and discuss several small peptide hormones active in bone (such as calcitonins and parathyroid hormone) that have shown potential for transdermal delivery, often under the added augmentation of transdermal drug delivery systems that employ lipo/hydrophilicity, electric charge, and/or microprojection facilitation across the skin barrier.
Reducing the negative vocal effects of superficial laryngeal dehydration with humidification.
Levendoski, Elizabeth Erickson; Sundarrajan, Anusha; Sivasankar, M Preeti
2014-07-01
Environmental humidification is a simple, cost-effective method believed to reduce superficial laryngeal drying. This study sought to validate this belief by investigating whether humidification treatment would reduce the negative effects of superficial laryngeal dehydration on phonation threshold pressure (PTP). Phonation threshold pressure data analysis may be vulnerable to bias because of lack of investigator blinding. Consequently, this study investigated the extent of PTP analysis reliability between unblinded and blinded investigators. Healthy male and female adults were assigned to a vocal fatigue (n = 20) or control group (n = 20) based on their responses to a questionnaire. PTP was assessed after 2 hours of mouth breathing in low humidity (dehydration challenge), following a 5-minute break in ambient humidity, and after 2 hours of mouth breathing in high humidity (humidification). PTP significantly increased following the laryngeal dehydration challenge. After humidification, PTP returned toward baseline. These effects were observed in both subject groups. PTP measurements were highly correlated between the unblinded and blinded investigator. Humidification may be an effective approach to decrease the detrimental voice effects of superficial laryngeal dehydration. These data lay the foundation for future investigations aimed at preventing and treating the negative voice changes associated with chronic, surface laryngeal drying.
DEFF Research Database (Denmark)
Damborg, Peter; Guardabassi, Luca; Pedersen, Karl
2008-01-01
Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...
To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age.
Malik, Pooja; Rana, Vivek; Rehani, Usha
2012-01-01
The purpose of this study was to assess skeletal age and establish relationship between mandibular canine calcification and skeletal age. The study included 147 females aged 10 to 13 years. The subjects were divided into three groups: Group I-comprising of 10 to 11 years old female; Group II-comprising of 11 to 12 years old female; Group III-12 to 13 years female. OPG and hand and wrist radiographs of left side for each subject were taken with prior consent of their parents. The calcification status of canine was evaluated from orthopantomograms according to scores given in Demirjian's method. The stages of ossification of various carpal bones were evaluated using radiographic atlas of Greulich-Pyle and skeletal age was calculated. Data collected was statistically analyzed. The results drawn from this study showed that a strong correlation was observed for canine calcification stage F for 10 to 11 years and for stage G in 11 to 12 years and 12 to 13 years respectively. How to cite this article: Malik P, Rana V, Rehani U. To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age. Int J Clin Pediatr Dent 2012;5(1): 14-19.
Identification of a new genotype of canine distemper virus circulating in America.
Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón
2011-08-01
Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.
Dimopoulou, Maria; Kirpensteijn, Jolle; Moens, Hester; Kik, Marja
2008-07-01
To investigate the histologic characteristics of feline osteosarcoma (OS) and compare the histologic data with phenotypically comparable canine OS. The effects of histologic and clinical variables on survival statistics were evaluated. Retrospective study. Cats (n=62) and dogs (22). Medical records of 62 cats with OS were reviewed for clinically relevant data. Clinical outcome was obtained by telephone interview. Histologic characteristics of OS were classified using a standardized grading system. Histologic characteristics in 22 feline skeletal OS were compared with 22 canine skeletal OS of identical location and subtype. Prognostic variables for clinical outcome were determined using multivariate analysis. Feline OS was characterized by moderate to abundant cellular pleomorphism, low mitotic index, small to moderate amounts of matrix, high cellularity, and a moderate amount of necrosis. There was no significant difference between histologic variables in feline and canine OS. Histologic grade, surgery, and mitotic index significantly influenced clinical outcome as determined by multivariate analysis. Tumor invasion into vessels was not identified as a significant prognosticator. Feline and canine skeletal OS have similar histologic but different prognostic characteristics. Prognosis for cats with OS is related to histologic grade and mitotic index of the tumor.
Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted; Andresen, Lars; Chrièl, Mariann; Hagberg, Emma; Jensen, Mette Kragh; Hansen, Mette Sif; Hjulsager, Charlotte Kristiane; Struve, Tina
2015-09-30
During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in biosecurity on the mink farms. The aim of this study was to investigate the extent and association of specific biosecurity measures with the outbreak. The study was carried out in an epidemiological case-control design. The case group consisted of the 61 farms, which had a confirmed outbreak of canine distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case farms, indicating that the control farms had a better biosecurity or were not equally exposed to canine distemper virus. Generally, all farms had very few specific precautions at the gate entrance in respect to human visitors as well as animals. The use of biosecurity measures was very variable in both case and control farms. Not using plastic boot covers, presence of dogs and cats, presence of demarcated area for changing clothes when entering and leaving the farm area and presence of hand washing facilities significantly lowered the odds of the farm having a canine distemper virus outbreak. The results of the study indicate that consistent use of correct vaccination strategies, implementation of biosecurity measures and limiting human and animal access to the mink farm can be
A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article
Directory of Open Access Journals (Sweden)
S. Gur
2009-05-01
Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.
The effects of sulforaphane on canine osteosarcoma proliferation and invasion.
Rizzo, V L; Levine, C B; Wakshlag, J J
2017-09-01
Recent evidence in in vitro and in vivo models suggests that sulforaphane (SFN), found in raw cruciferous vegetables, may have utility in chemoprevention, as an antineoplastic agent and as a free radical scavenger. The effects of SFN alone or with doxorubicin on cell viability were examined, as well as cell cycle kinetics, invasion capabilities and apoptosis in three canine osteosarcoma cell line (D17, OS 2.4 and HMPOS). Results showed that SFN could not induce cell death at potentially physiological concentrations (canine osteosarcoma. © 2016 John Wiley & Sons Ltd.
Construct canine intracranial aneurysm model by endovascular technique
International Nuclear Information System (INIS)
Liang Xiaodong; Liu Yizhi; Ni Caifang; Ding Yi
2004-01-01
Objective: To construct canine bifurcation aneurysms suitable for evaluating the exploration of endovascular devices for interventional therapy by endovascular technique. Methods: The right common carotid artery of six dogs was expanded with a pliable balloon by means of endovascular technique, then embolization with detached balloon was taken at their originations DAS examination were performed on 1, 2, 3 d after the procedurse. Results: 6 aneurysm models were created in six dogs successfully with the mean width and height of the aneurysms decreasing in 3 days. Conclusions: This canine aneurysm model presents the virtue in the size and shape of human cerebral bifurcation saccular aneurysms on DSA image, suitable for developing the exploration of endovascular devices for aneurismal therapy. The procedure is quick, reliable and reproducible. (authors)
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
Energy Technology Data Exchange (ETDEWEB)
Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)
2014-04-15
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
International Nuclear Information System (INIS)
Kim, Jong-Hyuk; Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C.; Robinson, Sally; Sharkey, Leslie C.; O'Brien, Timothy D.; Dickerson, Erin B.; Modiano, Jaime F.
2014-01-01
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Wallis, Corrin V; Lowden, Preena; Marshall-Jones, Zoe V; Hilton, Anthony C
2018-02-26
Salmonella enterica is a recognised cause of diarrhoea in dogs and humans, yet the potential for transfer of salmonellosis between dogs and their owners is unclear, with reported evidence both for and against Salmonella as a zoonotic pathogen. A collection of 174 S. enterica isolates from clinical infections in humans and dogs were analysed for serotype distribution, carbon source utilisation, chemical and antimicrobial sensitivity profiles. The aim of the study was to understand the degree of conservation in phenotypic characteristics of isolates across host species. Serovar distribution across human and canine isolates demonstrated nine serovars common to both host species, 24 serovars present in only the canine collection and 39 solely represented within the human collection. Significant differences in carbon source utilisation profiles and ampicillin, amoxicillin and chloramphenicol sensitivity profiles were detected in isolates of human and canine origin. Differences between the human and canine Salmonella collections were suggestive of evolutionary separation, with canine isolates better able to utilise several simple sugars than their human counterparts. Generally higher minimum inhibitory concentrations of three broad-spectrum antimicrobials, commonly used in veterinary medicine, were also observed in canine S. enterica isolates. Differential carbon source utilisation and antimicrobial sensitivity profiles in pathogenic Salmonella isolated from humans and dogs are suggestive of distinct reservoirs of infection for these hosts. Although these findings do not preclude zoonotic or anthroponotic potential in salmonellae, the separation of carbon utilisation and antibiotic profiles with isolate source is indicative that infectious isolates are not part of a common reservoir shared frequently between these host species.
Canine and incisor microwear in pitheciids and Ateles reflects documented patterns of tooth use.
Delezene, Lucas K; Teaford, Mark F; Ungar, Peter S
2016-09-01
Platyrrhine species differ in the extent to and the manner in which they use their incisors and canines during food ingestion. For example, Ateles uses its anterior teeth to process mechanically nondemanding soft fruits, while the sclerocarp-harvesting pitheciids rely extensively on these teeth to acquire and process more demanding foods. Pitheciids themselves vary in anterior tooth use, with the pitheciines (Cacajao, Chiropotes, and Pithecia) noted to use their robust canines in a variety of ways to predate seeds, while Callicebus, which rarely predates seeds, uses its incisors and exceptionally short canines to scrape tough mesocarp from fruits. To investigate the relationship between tooth use and dental wear, microwear textures were investigated for the anterior teeth of these five genera of platyrrhine primates. Using a white light confocal microscope, 12 microwear texture attributes that reflect feature size, anisotropy, density, and complexity were recorded from high-resolution epoxy casts of the incisors and canines of adult wild-collected Brazilian specimens of Ateles, Callicebus, Cacajao, Chiropotes, and Pithecia. Pitheciine canines tend to have deep microwear features and complex, anisotropic microwear textures, while Ateles anterior teeth tend to have very small features, low feature density, and less complex and anisotropic surfaces. Callicebus incisor and canine microwear is generally intermediate in size and complexity between those extremes. These findings align with expectations from reported field observations of tooth use and illustrate the potential for using microwear texture analysis to infer patterns of anterior tooth use in extinct primates. Am J Phys Anthropol 161:6-25, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Development of an Arthroscopic Joint Capsule Injury Model in the Canine Shoulder.
Directory of Open Access Journals (Sweden)
David Kovacevic
Full Text Available The natural history of rotator cuff tears can be unfavorable as patients develop fatty infiltration and muscle atrophy that is often associated with a loss of muscle strength and shoulder function. To facilitate study of possible biologic mechanisms involved in early degenerative changes to rotator cuff muscle and tendon tissues, the objective of this study was to develop a joint capsule injury model in the canine shoulder using arthroscopy.Arthroscopic surgical methods for performing a posterior joint capsulectomy in the canine shoulder were first defined in cadavers. Subsequently, one canine subject underwent bilateral shoulder joint capsulectomy using arthroscopy, arthroscopic surveillance at 2, 4 and 8 weeks, and gross and histologic examination of the joint at 10 weeks.The canine subject was weight-bearing within eight hours after index and follow-up surgeries and had no significant soft tissue swelling of the shoulder girdle or gross lameness. Chronic synovitis and macroscopic and microscopic evidence of pathologic changes to the rotator cuff bony insertions, tendons, myotendinous junctions and muscles were observed.This study demonstrates feasibility and proof-of-concept for a joint capsule injury model in the canine shoulder. Future work is needed to define the observed pathologic changes and their role in the progression of rotator cuff disease. Ultimately, better understanding of the biologic mechanisms of early progression of rotator cuff disease may lead to clinical interventions to halt or slow this process and avoid the more advanced and often irreversible conditions of large tendon tears with muscle fatty atrophy.
Expression of monocarboxylate transporter 1 in oral and ocular canine melanocytic tumors.
Shimoyama, Y; Akihara, Y; Kirat, D; Iwano, H; Hirayama, K; Kagawa, Y; Ohmachi, T; Matsuda, K; Okamoto, M; Kadosawa, T; Yokota, H; Taniyama, H
2007-07-01
Solid tumors are composed of a heterogeneous population of cells surviving in various concentrations of oxygen. In a hypoxic environment, tumor cells generally up-regulate glycolysis and, therefore, generate more lactate that must be expelled from the cell through proton transporters to prevent intracellular acidosis. Monocarboxylate transporter 1 (MCT1) is a major proton transporter in mammalian cells that transports monocarboxylates, such as lactate and pyruvate, together with a proton across the plasma membrane. Melanocytic neoplasia occurs frequently in dogs, but the prognosis is highly site-dependent. In this study, 50 oral canine melanomas, which were subdivided into 3 histologic subtypes, and 17 ocular canine melanocytic neoplasms (14 melanocytomas and 3 melanomas) were used to examine and compare MCT1 expression. Immunohistochemistry using a polyclonal chicken anti-rat MCT1 antibody showed that most oral melanoma exhibited cell membrane staining, although there were no significant differences observed among the 3 histologic subtypes. In contrast, the majority of ocular melanocytic tumors were not immunoreactive. Additionally, we documented the presence of a 45-kDa band in cell membrane protein Western blots, and sequencing of a reverse transcriptase polymerase chain reaction band of expected size confirmed its identity as a partial canine MCT1 transcript in 3 oral tumors. Increased MCT1 expression in oral melanomas compared with ocular melanocytic tumors may reflect the very different biology between these tumors in dogs. These results are the first to document canine MCT1 expression in canine tumors and suggest that increased MCT1 expression may provide a potential therapeutic target for oral melanoma.
Migrastatin analogues inhibit canine mammary cancer cell migration and invasion.
Directory of Open Access Journals (Sweden)
Kinga Majchrzak
Full Text Available BACKGROUND: Cancer spread to other organs is the main cause of death of oncological patients. Migration of cancer cells from a primary tumour is the crucial step in the complex process of metastasis, therefore blocking this process is currently the main treatment strategy. Metastasis inhibitors derived from natural products, such as, migrastatin, are very promising anticancer agents. Thus, the aim of our study was to investigate the effect of six migrastatin analogues (MGSTA-1 to 6 on migration and invasion of canine mammary adenocarcinoma cell lines isolated from primary tumours and their metastases to the lungs. Canine mammary tumours constitute a valuable tool for studying multiple aspect of human cancer. RESULTS: OUR RESULTS SHOWED THAT TWO OF SIX FULLY SYNTHETIC ANALOGUES OF MIGRASTATIN: MGSTA-5 and MGSTA-6 were potent inhibitors of canine mammary cancer cells migration and invasion. These data were obtained using the wound healing test, as well as trans-well migration and invasion assays. Furthermore, the treatment of cancer cells with the most effective compound (MGSTA-6 disturbed binding between filamentous F-actin and fascin1. Confocal microscopy analyses revealed that treatment with MGSTA-6 increased the presence of unbound fascin1 and reduced co-localization of F-actin and fascin1 in canine cancer cells. Most likely, actin filaments were not cross-linked by fascin1 and did not generate the typical filopodial architecture of actin filaments in response to the activity of MGSTA-6. Thus, administration of MGSTA-6 results in decreased formation of filopodia protrusions and stress fibres in canine mammary cancer cells, causing inhibition of cancer migration and invasion. CONCLUSION: Two synthetic migrastatin analogues (MGSTA-5 and MGSTA-6 were shown to be promising compounds for inhibition of cancer metastasis. They may have beneficial therapeutic effects in cancer therapy in dogs, especially in combination with other anticancer drugs