WorldWideScience

Sample records for abietic acid aa

  1. C-11 Acid and the Stereochemistry of Abietic Acid

    Indian Academy of Sciences (India)

    IAS Admin

    organic chemistry' and of the theoretical treatment of the chemical bond, essential to an understanding of how natural products are formed through biosynthetic processes (enzyme mediated synthe- sis of complex structures from substrates of primary structure). C-11 and C-12 Acids. Oxidation of abietic acid or its methyl ...

  2. C-11 Acid and the Stereochemistry of Abietic Acid

    Indian Academy of Sciences (India)

    IAS Admin

    developed by Barton (1969 Chemistry Nobel Prize) to the solution of an important configurational problem, as we shall see. The presently accepted structure of abietic acid is the result of intensive chemical researches extending over a period of more than a century. The subject is an important part of authoritative treatises.

  3. Abietic acid isolated from pine resin (Resina Pini) enhances angiogenesis in HUVECs and accelerates cutaneous wound healing in mice.

    Science.gov (United States)

    Park, Jun Yeon; Lee, Yun Kyung; Lee, Dong-Soo; Yoo, Jeong-Eun; Shin, Myoung-Sook; Yamabe, Noriko; Kim, Su-Nam; Lee, Seulah; Kim, Ki Hyun; Lee, Hae-Jeung; Roh, Seok Sun; Kang, Ki Sung

    2017-05-05

    Resin known as Resina Pini is listed in the Korean and Japanese pharmacopoeias and has been used for treating skin wounds and inflammation. Resin is composed of more than 50% abietic acid and 10% neutral substances. In the present study, the wound-healing effects of abietic acid and the possible underlying mechanism of action were investigated in various in vitro and in vivo models. The effects of abietic acid on tube formation and migration were measured in human umbilical vein vascular endothelial cells (HUVECs). Protein expression of mitogen-activated protein kinase (MAPK) activation was evaluated via Western blotting analysis. The wound-healing effects of abietic acid were assessed using a mouse model of cutaneous wounds. The results showed that abietic acid enhanced cell migration and tube formation in HUVECs. Abietic acid induced significant angiogenic potential, which is associated with upregulation of extracellular signal-regulated kinase (ERK) and p38 expression. Additionally, 0.8μM abietic acid-treated groups showed accelerated wound closure compared to the controls in a mouse model of cutaneous wounds. The current data indicate that abietic acid treatment elevated cell migration and tube formation in HUVECs by the activation of ERK and p38 MAPKs. We suggest that abietic acid can be developed as a wound-healing agent. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Terpenoid biotransformation in mammals. IV Biotransformation of (+)-longifolene, (-)-caryophyllene, (-)-caryophyllene oxide, (-)-cyclocolorenone, (+)-nootkatone, (-)-elemol, (-)-abietic acid and (+)-dehydroabietic acid in rabbits.

    Science.gov (United States)

    Asakawa, Y; Ishida, T; Toyota, M; Takemoto, T

    1986-08-01

    The metabolism of (+)-longifolene, (-)-caryophyllene, (-)-caryophyllene oxide, (-)-cyclocolorenone, (+)-nootkatone, (-)-elemol, (-)-abietic acid and (+)-dehydroabietic acid was studied in rabbits. Each of these sesquiterpenoids was converted to primary, secondary or tertiary alcohols, among which the primary alcohol was predominant. A vinylic methyl group and an exomethylene group were easily hydroxylated and converted to a glycol via an epoxide in many cases. Eight new metabolites were determined by chemical and spectroscopic methods.

  5. Effect of supplementation of arachidonic acid (AA) or a combination of AA plus docosahexaenoic acid on breastmilk fatty acid composition

    NARCIS (Netherlands)

    Smit, EN; Koopmann, M; Boersma, ER; Muskiet, FAJ

    We investigated whether supplementation with arachidonic acid (20:4 omega 6; AA), ora combination of AA and docosahexaenoic acid (22:6 omega 3; DHA) would affect human milk polyunsaturated fatty acid (PUFA) composition. Ten women were daily supplemented with 300 mg AA, eight with 300 mg AA, 110 mg

  6. [Risk control of traditional Chinese medicines containing aristolochis acids (AAs) based on influencing factors of content of AAs].

    Science.gov (United States)

    Tian, Jing-Zhuo; Liang, Ai-Hua; Liu, Jing; Zhang, Bo-Li

    2017-12-01

    Aristolochic acids (AAs) widely exist in such plants as Aristolochia and Asarum. The renal toxicity of AAs as well as its carcinogenicity to urinary system have been widely known. In 2003 and 2004, China prohibited the use of Aristolochiae Radix, Aristolochiae Manshuriensis Caulis and Aristolochiae Fangchi Radix, and required administering other AAs-containing medicines in accordance with the regulations for prescription drugs. In this paper, we retrieved literatures on the content determination of AAs in recent 10 years in China. It suggested that the AAs content is lower in Asarum herb, especially in its roots and rhizomes, and most of which do not show detectable amount of AA-I. Some of traditional Chinese medicines show fairly small amount of detectable AA-I. The AAs content in Aristolochia herb (including Fructus Aristolochiae, kaempfer dutchmanspipe root) is relatively high; however, there are fewer literatures for studying the content determination of AAs in Chinese patent medicines. There were many factors affecting AAs content, including the parts used, origins, processing methods, extraction process. It suggested that we should pay attention to the toxicity of Chinese medicines containing AAs and use these decoction pieces and traditional Chinese medicines cautiously. In addition, basic studies for the origins, processing methods and extraction process of Chinese patent medicines containing AAs, as well as supervision and detection of AAs content in traditional Chinese medicinal materials, decoction pieces and Chinese patent medicines shall be strengthened for reducing medication risk and guaranteeing clinical medication safety. Copyright© by the Chinese Pharmaceutical Association.

  7. Intrauterine, postpartum and adult relationships between arachidonic acid (AA) and docosahexaenoic acid (DHA)

    NARCIS (Netherlands)

    Kuipers, Remko S.; Luxwolda, Martine F.; Dijck-Brouwer, D. A. Janneke; Muskiet, Frits A. J.

    2011-01-01

    Erythrocyte (RBC) fatty acid compositions from populations with stable dietary habits but large variations in RBC-arachidonic (AA) and RBC-docosahexaenoic acid (DHA) provided us with insight into relationships between DHA and AA. It also enabled us to estimate the maternal RBC-DHA (mRBC-DHA) status

  8. Maternal and fetal brain contents of docosahexaenoic acid (DHA) and arachidonic acid (AA) at various essential fatty acid (EFA), DHA and AA dietary intakes during pregnancy in mice

    NARCIS (Netherlands)

    van Goor, Saskia A; Dijck-Brouwer, D A Janneke; Fokkema, M Rebecca; van der Iest, Theo Hans; Muskiet, Frits A J

    We investigated essential fatty acids (EFA) and long-chain polyunsaturated fatty acids (LCP) in maternal and fetal brain as a function of EFA/LCP availability to the feto-maternal unit in mice. Diets varying in parent EFA, arachidonic acid (AA), and docosahexaenoic acid (DHA) were administered from

  9. Biotransformation of arachidonic acid (AA) and eicosapentaenoic acid (EPA) into lipoxins and lipoxenes by porcine leukocytes

    Energy Technology Data Exchange (ETDEWEB)

    Wong, P.Y.K.; Spur, B.; Hirai, A.; Yoshida, S.; Tamura, Y.; Lam, B.K.

    1986-03-05

    Lipoxins and lipoxenes have been reported to be formed after incubation of 15-hydroperoxyeicosatetraenoic acid and 15-hydroperoxyeicosapentaenoic acid with human leukocytes and porcine leukocytes, respectively. The authors examined the ability of porcine leukocytes to metabolize (/sup 14/C)-AA and (/sup 14/C)-EPA (100 ..mu..M) to lipoxins and lipoxenes. Incubation products were separated by RP-HPLC and identified by U.V. spectrum and GC/MS. Porcine leukocytes metabolized both AA and EPA to form lipoxins and lipoxenes in addition to mono- and di-hydroxyl fatty acids. Quantitative analysis from U.V. absorbance after RP-HPLC revealed that about 0.05% of AA was converted to lipoxins A and B and 0.1% of EPA was converted to lipoxenes A and B. In addition, treatment of leukotriene A/sub 4/ and leukotriene A/sub 5/ with 15-lipoxygenase also gave rise to several isomers of lipoxin and lipoxene. Thus, lipoxins and lipoxenes would have been derived from AA and EPA after dioxygenation by 5-lipoxygenase and 15-lipoxygenase, respectively. When tested for biological activity, lipoxene A (2 ..mu..M), like lipoxin A, induced superoxide anion generation in canine neutrophils but had no effect on lysosomal enzyme release on neutrophil aggregation.

  10. Localization of aristolochic acid in mouse kidney tissues by immunohistochemistry using an anti-AA-I and AA-II monoclonal antibody.

    Science.gov (United States)

    Li, Xiao-Wei; Yokota, Sadaki; Wang, Dan; Wang, Xuan; Shoyama, Yukihiro; Cai, Shao-Qing

    2014-01-01

    Aristolochic acids (AAs) are found in herbal medicines of Aristolochiaceae plants, including Aristolochia and Asarum species. AAs are associated with a rapidly progressive interstitial nephritis, which is called aristolochic acid nephropathy (AAN). However, the in-situ localization of AAs in the target organ, the kidney, has not been investigated yet. In the present study, the accumulation of aristolochic acid I (AA-I) in mouse kidney was revealed by immunoperoxidase light microscopy as well as colloidal gold immunoelectron microscopy (IEM) based on an anti-AA-I and AA-II monoclonal antibody (mAb). Male BALB/c mice were treated with 1.25 or 2.50 mg kg(-1) of AA-I per day for 5 days. Paraffin sections and ultra-thin sections of kidney tissue were respectively prepared. Under light microscopy, the apical surface of proximal tubules was strongly stained for AA-I, whereas no obvious immunostaining was found in the distal tubules and glomerulus, which remained relatively intact. Under electron microscopy, epithelial cells of the proximal tubules, distal tubules and collecting tubules were broken to various degrees. Gold labeling in the proximal and distal tubules was stronger than that in the collecting tubules. In renal tubules, immunogold signals of AA-I tended to accumulate in the mitochondria and peroxisomes, though the signals could be observed all over the cell. Gold signals were also found in the erythrocytes of glomeruli. The MAb against AA-I and AA-II provides a clue for the identification of proteins or factors which might interact with AA-I and thus induce targeted damage of kidney.

  11. Clinical implications of eicosapentaenoic acid/arachidonic acid ratio (EPA/AA) in adult patients with congenital heart disease.

    Science.gov (United States)

    Kanoh, Miki; Inai, Kei; Shinohara, Tokuko; Tomimatsu, Hirofumi; Nakanishi, Toshio

    2017-12-01

    Recent studies showed that a low ratio between the levels of eicosapentaenoic acid and those of arachidonic acid (EPA/AA) is associated with higher incidence of coronary artery disease and poor prognosis of heart failure, arrhythmia, and cardiac sudden death. However, the clinical implications of EPA/AA in adult patients with congenital heart disease remain unclear. We aimed to assess the prognostic value of EPA/AA regarding cardiac events in adult patients with congenital heart disease. We measured the serum levels of eicosapentaenoic acid and arachidonic acid in 130 adult patients (median age, 31 years) stratified into two groups according to their EPA/AA (low, ≤0.22; high, >0.22). We prospectively analyzed the association between EPA/AA and incidence of cardiac events during a mean observation period of 15 months, expressed in terms of hazard ratio (HR) with 95% confidence interval (95% CI). In the subgroup of patients with biventricular circulation (2VC) (n = 76), we analyzed the same clinical endpoints. In our study population, EPA/AA was not associated with the incidence of arrhythmic events (HR, 1.52; 95% CI, 0.82-2.85; p = 0.19), but low EPA/AA was a predictor of heart failure hospitalization (HR, 2.83; 95% CI, 1.35-6.30; p heart failure hospitalization (HR, 5.20; 95% CI, 1.78-18.1; p congenital heart disease.

  12. Anodic galvanostatic polarization of AA2024-T3 aircraft alloy in conventional mineral acids

    Energy Technology Data Exchange (ETDEWEB)

    Kozhukharov, S., E-mail: stephko1980@abv.bg [Department of Chemical Sciences, University of Chemical Technology and Metallurgy, 8 “Kliment Okhridski” Blvd, 1756, Sofia (Bulgaria); Girginov, Ch. [Department of Chemical Sciences, University of Chemical Technology and Metallurgy, 8 “Kliment Okhridski” Blvd, 1756, Sofia (Bulgaria); Avramova, I. [Institute of General and Inorganic Chemistry, Bulgarian Academy of Science, 11 “Georgi Bonchev” Str., 1113, Sofia (Bulgaria); Machkova, M. [Department of Chemical Sciences, University of Chemical Technology and Metallurgy, 8 “Kliment Okhridski” Blvd, 1756, Sofia (Bulgaria)

    2016-09-01

    The present study is devoted to the determination of the impact of the anodization of AA2024-T3 alloys in HCl, HNO{sub 3}, H{sub 2}SO{sub 4} or H{sub 3}PO{sub 4} on the samples’ surface morphology and properties. Subsequent systematic assessments were performed by Scanning Electron Microscopy (SEM), Energy Dispersion X-Ray Spectroscopy (EDX) and X-ray Photoelectron Spectroscopy (XPS). These observations were combined with Linear Voltammetry (LVA) and Electrochemical Impedance Spectroscopy (EIS) after 48 and 168 h of exposure to a 3.5% NaCl model corrosive medium. The main result is, that completely different effects were observed in accordance to the acid used. It was established that the monoprotonic acids have a deep destructive effect due to dissolution of the alloy components, whereas the polyprotonic ones possess either indistinguishable influence, or surface film formation. - Highlights: • AA2024 was polarized anodically in 15%{sub wt} acid solutions at 15 mA cm{sup −2} for 2 h. • Four mineral acids were selected for investigation: HCl, HNO{sub 3}, H{sub 2}SO{sub 4} and H{sub 3}PO{sub 4}. • SEM, EDX and XPS were applied for morphological description. • Electrochemical characterizations were performed by EIS and linear voltammetry. • The acid used predetermines completely different interaction with the AA2024 alloy.

  13. Bardoxolone methyl (BARD) ameliorates aristolochic acid (AA)-induced acute kidney injury through Nrf2 pathway

    International Nuclear Information System (INIS)

    Wu, Juan; Liu, Xinhui; Fan, Jinjin; Chen, Wenfang; Wang, Juan; Zeng, Youjia; Feng, Xiaorang; Yu, Xueqing; Yang, Xiao

    2014-01-01

    Bardoxolone methyl (BARD) is an antioxidant modulator that acts through induction of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway. This study aimed to investigate the role of BARD in protecting kidneys from aristolochic acid (AA)-induced acute kidney injury (AKI). Male C57BL/6 mice received intraperitoneal (i.p.) injections of aristolochic acid I (AAI) (5 mg/kg/day) for 5 days to produce acute AA nephropathy (AAN) model. BARD (10 mg/kg/day, i.p.) was applied for 7 consecutive days, starting 2 days prior to AAI administration. The mice in the AA group showed AKI as evidenced by worsening kidney function evaluated by blood urea nitrogen (BUN) and serum creatinine (SCr) levels, and severe tubulointerstitial injury marked by massive tubule necrosis in kidney tissues. BARD significantly reduced BUN and SCr levels which were elevated by AAI. Additionally, AAI-induced histopathological renal damage was ameliorated by BARD. Furthermore, the expression of Nrf2 was reduced, and its repressor Kelch-like ECH-associated protein 1 (Keap1) was increased significantly, whereas heme oxygenase-1 (HO-1) was upregulated and NAD(P)H quinone oxidoreductase-1 (NQO1) was barely increased in the cytoplasm of tubules in kidneys after treatment with AAI. BARD significantly upregulated renal Nrf2, NQO1 and HO-1 expression and downregulated Keap1 expression compared with those in the AA group. Moreover, it was found that Nrf2 was expressed both in the cytoplasm and nuclear of glomeruli and tubules, whereas NQO1 and HO-1 were localized in the cytoplasm of tubules only. In conclusion, AA-induced acute renal injury was associated with impaired Nrf2 activation and expression of its downstream target genes in renal tissues. BARD prevented renal damage induced by AAI, and this renoprotective effect may be exerted by activating the Nrf2 signaling pathway and increasing expression of the downstream target genes

  14. AA-PMe, a novel asiatic acid derivative, induces apoptosis and suppresses proliferation, migration, and invasion of gastric cancer cells.

    Science.gov (United States)

    Jing, Yue; Wang, Gang; Ge, Ying; Xu, Minjie; Tang, Shuainan; Gong, Zhunan

    2016-01-01

    Asiatic acid (AA; 2α,3β,23-trihydroxyurs-12-ene-28-oic acid) is widely used for medicinal purposes in many Asian countries due to its various bioactivities. A series of AA derivatives has been synthesized in attempts to improve its therapeutic potencies. Herein we investigated the anti-tumor activities of N-(2α,3β,23-acetoxyurs-12-en-28-oyl)-l-proline methyl ester (AA-PMe), a novel AA derivative. AA-PMe exhibited a stronger anti-cancer activity than its parent compound AA. AA-PMe inhibited the proliferation of SGC7901 and HGC27 human gastric cancer cells in a dose-dependent manner but had no significant toxicity in human gastric mucosa epithelial cells (GES-1). AA-PMe induced cell cycle arrest in G0/G1 phase and blocked G1-S transition, which correlated well with marked decreases in levels of cyclin D1, cyclin-dependent kinase CKD4, and phosphorylated retinoblastoma protein, and increase in cyclin-dependent kinase inhibitor P15. Further, AA-PMe induced apoptosis of human gastric cancer cells by affecting Bcl-2, Bax, c-Myc, and caspase-3. Moreover, AA-PMe suppressed the migration and invasion of human gastric cancer cells (SGC7901 and HGC27) cells by downregulating the expression of MMP-2 and MMP-9. Overall, this study investigated the potential anti-cancer activities of AA-PMe including inducing apoptosis and suppressing proliferation, migration and invasion of gastric cancer cells, as well as the underlying mechanisms, suggesting that AA-PMe is a promising anti-cancer drug candidate in gastric cancer therapy.

  15. Bardoxolone methyl (BARD) ameliorates aristolochic acid (AA)-induced acute kidney injury through Nrf2 pathway.

    Science.gov (United States)

    Wu, Juan; Liu, Xinhui; Fan, Jinjin; Chen, Wenfang; Wang, Juan; Zeng, Youjia; Feng, Xiaorang; Yu, Xueqing; Yang, Xiao

    2014-04-06

    Bardoxolone methyl (BARD) is an antioxidant modulator that acts through induction of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway. This study aimed to investigate the role of BARD in protecting kidneys from aristolochic acid (AA)-induced acute kidney injury (AKI). Male C57BL/6 mice received intraperitoneal (i.p.) injections of aristolochic acid I (AAI) (5mg/kg/day) for 5 days to produce acute AA nephropathy (AAN) model. BARD (10mg/kg/day, i.p.) was applied for 7 consecutive days, starting 2 days prior to AAI administration. The mice in the AA group showed AKI as evidenced by worsening kidney function evaluated by blood urea nitrogen (BUN) and serum creatinine (SCr) levels, and severe tubulointerstitial injury marked by massive tubule necrosis in kidney tissues. BARD significantly reduced BUN and SCr levels which were elevated by AAI. Additionally, AAI-induced histopathological renal damage was ameliorated by BARD. Furthermore, the expression of Nrf2 was reduced, and its repressor Kelch-like ECH-associated protein 1 (Keap1) was increased significantly, whereas heme oxygenase-1 (HO-1) was upregulated and NAD(P)H quinone oxidoreductase-1 (NQO1) was barely increased in the cytoplasm of tubules in kidneys after treatment with AAI. BARD significantly upregulated renal Nrf2, NQO1 and HO-1 expression and downregulated Keap1 expression compared with those in the AA group. Moreover, it was found that Nrf2 was expressed both in the cytoplasm and nuclear of glomeruli and tubules, whereas NQO1 and HO-1 were localized in the cytoplasm of tubules only. In conclusion, AA-induced acute renal injury was associated with impaired Nrf2 activation and expression of its downstream target genes in renal tissues. BARD prevented renal damage induced by AAI, and this renoprotective effect may be exerted by activating the Nrf2 signaling pathway and increasing expression of the downstream target genes. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. Storage Stability Improvement of Copolymer Grafted Polypropylene-AcrylicAcid (PP-AA), by means of Various After Treatment Processes

    International Nuclear Information System (INIS)

    Gitopadmojo, Isminingsih

    2000-01-01

    Polypropylene yams that have been subjected to irradiation induced graftco-polymerization with acrylic acid, have gained its moisture regain and dyeability, that fulfilled the requirement as textile material for garment.However, the copolymer grafted PP-AA has suffered from degradation in thestorage, which was indicated in the previous study that the strengthretention has dropped tremendously by photo-oxidation or photo-degradation.After treatments of PP-AA yams with chemical compound that was able toprevent further photo-oxidation, will be expected to improve the stability ofPP-AA in storage. In this research activity, the polypropylene (PP) yams weresubjected to irradiation induced graft co-polymerization by means ofγ-Ray Co-60 as irradiation source with acrylic acid (AA) as monomer.Various after treatments were subjected to the grafted PP-AA yams such asalkalisation process; dyeing (anionic dyes, cationic dyes and nonionic dyes);as well as processing with optical brightening agent and UV stabilizer,separately. The PP-AA yams (before and after treatment) were subjected tostorage from 1 month up to 42 months, and then being tested for theirmoisture regain, strength retention and elongation at breaks. The samplesbeing stored for 12 months were subjected to radical analysis. It isconcluded from the experiment that after treatment of grafted PP-AA by meansof those various processes were able to improve the stability of copolymergrafted PP-AA in storage. The presence of peroxide radical in the ESR(electron spin resonance) spectrum on PP-AA yams before treatment and theones after treated with alkaline and being stored for 12 months haveindicated the presence of photo oxidation or photo degradation, while thepresence of poly enyl radical in the ESR spectrum of after treated PP-AA withdyes having azo and azine compound as chromophore, as well as with UVstabilizer with carbonyl as chromophore and being stored for 12 months haveproved that its presence have protected such

  17. Eicosapentaenoic acid to arachidonic acid (EPA/AA) ratio as an associated factor of high risk plaque on coronary computed tomography in patients without coronary artery disease.

    Science.gov (United States)

    Nagahara, Yasuomi; Motoyama, Sadako; Sarai, Masayoshi; Ito, Hajime; Kawai, Hideki; Takakuwa, Yoko; Miyagi, Meiko; Shibata, Daisuke; Takahashi, Hiroshi; Naruse, Hiroyuki; Ishii, Junichi; Ozaki, Yukio

    2016-07-01

    Coronary computed tomography angiography (CCTA)-verified high risk plaque (HRP) characteristics including positive remodeling and low attenuation plaque have been associated with acute coronary syndromes. Several studies reported that the n-3 polyunsaturated fatty acids have been associated with cardiovascular events. However, the relationship between serum eicosapentaenoic acid to arachidonic acid (EPA/AA) ratio and CCTA-verified HRP in patients without known coronary artery disease (CAD) is unclear. We aimed at investigating the relation between EPA/AA and CCTA-verified HRP in patients without known CAD. We included 193 patients undergoing CCTA without known CAD (65.5 ± 12.0 years, 55.0% male). No patient has been treated with EPA. The relation of coronary risk factors, lipid profile, high-sensitivity C-reactive protein, coronary artery calcification score (CACS), number of vessel disease, plaque burden, and EPA/AA with the presence of HRP was evaluated by logistic regression analysis. Incremental value of EPA/AA to predict HRP was also analyzed by C-index, NRI, and IDI. A Cox proportional hazards model was used to estimate the time to cardiovascular event. HRP was observed in 37 (19%) patients. Multivariable logistic regression analysis revealed that current smoking (OR 2.58; p=0.046), number of vessel disease (OR 1.87; p=0.031), and EPA/AA ratio (OR 0.65; p=0.0006) were independent associated factors of HRP on CCTA. Although the addition of EPA/AA to the baseline model did not significantly improve C-index, both NRI (0.60, p=0.0049) and IDI (0.054, p=0.0072) were significantly improved. Patients with HRP had significantly higher rate of events compared with patients without HRP (14% vs. 3%, Logrank p=0.0004). On multivariable Cox hazard analysis, baseline EPA/AA ratio was an independent predictor (HR 0.57, p=0.047). Low EPA/AA was an associated factor of HRP on CCTA in patients without CAD. In addition to conventional coronary risk factors and CACS, EPA/AA

  18. Tape-stripping as a method for measuring dermal exposure to resin acids during wood pellet production.

    Science.gov (United States)

    Eriksson, Kåre; Hagström, Katja; Axelsson, Sara; Nylander-French, Leena

    2008-03-01

    The purpose of this study was to develop a sensitive and specific method for quantifying dermal exposure to the resin acids 7-oxodehydroabietic acid (7-OXO), dehydroabietic acid (DHAA), abietic acid (AA), and pimaric acid (PA). In addition the method was evaluated in occupational settings during production of wood pellets. Tape-strips were spiked with the substances to evaluate the recovery of the acids from the tape. The removal efficiency of the tape was assessed by tape-stripping a specified area on a glass plate spiked with resin acids. The recovery of the acids from human skin in vivo was evaluated by applying acids in methanol onto the skin of volunteers. Occupational dermal exposure to the resin acids was assessed by tape-stripping the skin of workers involved in the production of wood pellets. The resin acids were analyzed by liquid chromatography mass spectrometry (LC-MS). The limit of detection was 15 pg (7-OXO), 150 pg (DHAA), 285 pg (AA) and 471 pg (PA) per injection. The recovery from spiked tapes was in general 100%. The removal efficiency of the tape was 48-101%. Recovery tests from human skin in vivo showed a mean recovery of 27%. Quantifiable amounts of resin acids were observed on four different skin areas with an increase in exposure during a work shift. This study shows that occupational dermal exposure to resin acids can be assessed by tape-stripping and quantified by LC-MS.

  19. Variation of amino acid sequences of serum amyloid a (SAA) and immunohistochemical analysis of amyloid a (AA) in Japanese domestic cats.

    Science.gov (United States)

    Tei, Meina; Uchida, Kazuyuki; Chambers, James K; Watanabe, Ken-Ichi; Tamamoto, Takashi; Ohno, Koichi; Nakayama, Hiroyuki

    2018-02-02

    Amyloid A (AA) amyloidosis, a fatal systemic amyloid disease, occurs secondary to chronic inflammatory conditions in humans. Although persistently elevated serum amyloid A (SAA) levels are required for its pathogenesis, not all individuals with chronic inflammation necessarily develop AA amyloidosis. Furthermore, many diseases in cats are associated with the elevated production of SAA, whereas only a small number actually develop AA amyloidosis. We hypothesized that a genetic mutation in the SAA gene may strongly contribute to the pathogenesis of feline AA amyloidosis. In the present study, genomic DNA from four Japanese domestic cats (JDCs) with AA amyloidosis and from five without amyloidosis was analyzed using polymerase chain reaction (PCR) amplification and direct sequencing. We identified the novel variation combination of 45R-51A in the deduced amino acid sequences of four JDCs with amyloidosis and five without. However, there was no relationship between amino acid variations and the distribution of AA amyloid deposits, indicating that differences in SAA sequences do not contribute to the pathogenesis of AA amyloidosis. Immunohistochemical analysis using antisera against the three different parts of the feline SAA protein-i.e., the N-terminal, central, and C-terminal regions-revealed that feline AA contained the C-terminus, unlike human AA. These results indicate that the cleavage and degradation of the C-terminus are not essential for amyloid fibril formation in JDCs.

  20. A synergistic combination of tetraethylorthosilicate and multiphosphonic acid offers excellent corrosion protection to AA1100 aluminum alloy

    Science.gov (United States)

    Dalmoro, Viviane; dos Santos, João H. Z.; Armelin, Elaine; Alemán, Carlos; Azambuja, Denise S.

    2013-05-01

    This work describes a new mechanism for the incorporation of organophosphonic acid into silane self-assembly monolayers, which has been used to protect AA1100 aluminum alloy. The protection improvement has been attributed to the fact that phosphonic structures promote the formation of strongly bonded and densely packed monolayer films, which show higher surface coverage and better adhesion than conventional silane systems. In order to evaluate the linking chemistry offered by phosphonic groups, two functionalized organophosphonic groups have been employed, 1,2-diaminoethanetetrakis methylenephosphonic acid (EDTPO) and aminotrimethylenephosphonic acid (ATMP), and combined with tetraethylorthosilicate (TEOS) films prepared by sol-gel synthesis. Results suggest that phosphonic acids may interact with the surface through a monodentate and bidentate coordination mode and, in addition, form one or more strong and stable linkages with silicon through non-hydrolysable bonds. Therefore, the incorporation of a very low concentration of phosphonic acids on TEOS solutions favors the complete coverage of the aluminum substrate during the silanization process, which is not possible using TEOS alone. The linking capacity of phosphonic acid has been investigated by FTIR-RA spectroscopy, SEM and EDX analysis, X-ray photoelectron spectroscopy (XPS), and quantum mechanical calculations. Finally, electrochemical impedance spectroscopy has been used to study the corrosion protection revealing that EDTPO-containing films afforded more protection to the AA1100 substrate than ATMP-containing films.

  1. A synergistic combination of tetraethylorthosilicate and multiphosphonic acid offers excellent corrosion protection to AA1100 aluminum alloy

    Energy Technology Data Exchange (ETDEWEB)

    Dalmoro, Viviane [Instituto de Química, Universidade Federal do Rio Grande do Sul (UFRGS) Av. Bento Gonçalves 9500 - CEP 91501-970, Porto Alegre, RS (Brazil); Departament d’Enginyeria Química, ETSEIB, Universitat Politècnica de Catalunya (UPC), Avda. Diagonal 647, Barcelona E-08028 (Spain); Center for Research in Nano-Engineering (CRnE), Universitat Politècnica de Catalunya (UPC), Campus Sud, Edifici C’, C/Pasqual i Vila s/n, Barcelona E-08028 (Spain); Santos, João H.Z. dos [Instituto de Química, Universidade Federal do Rio Grande do Sul (UFRGS) Av. Bento Gonçalves 9500 - CEP 91501-970, Porto Alegre, RS (Brazil); Armelin, Elaine, E-mail: elaine.armelin@upc.edu [Departament d’Enginyeria Química, ETSEIB, Universitat Politècnica de Catalunya (UPC), Avda. Diagonal 647, Barcelona E-08028 (Spain); Center for Research in Nano-Engineering (CRnE), Universitat Politècnica de Catalunya (UPC), Campus Sud, Edifici C’, C/Pasqual i Vila s/n, Barcelona E-08028 (Spain); Alemán, Carlos, E-mail: carlos.aleman@upc.edu [Departament d’Enginyeria Química, ETSEIB, Universitat Politècnica de Catalunya (UPC), Avda. Diagonal 647, Barcelona E-08028 (Spain); Center for Research in Nano-Engineering (CRnE), Universitat Politècnica de Catalunya (UPC), Campus Sud, Edifici C’, C/Pasqual i Vila s/n, Barcelona E-08028 (Spain); and others

    2013-05-15

    This work describes a new mechanism for the incorporation of organophosphonic acid into silane self-assembly monolayers, which has been used to protect AA1100 aluminum alloy. The protection improvement has been attributed to the fact that phosphonic structures promote the formation of strongly bonded and densely packed monolayer films, which show higher surface coverage and better adhesion than conventional silane systems. In order to evaluate the linking chemistry offered by phosphonic groups, two functionalized organophosphonic groups have been employed, 1,2-diaminoethanetetrakis methylenephosphonic acid (EDTPO) and aminotrimethylenephosphonic acid (ATMP), and combined with tetraethylorthosilicate (TEOS) films prepared by sol–gel synthesis. Results suggest that phosphonic acids may interact with the surface through a monodentate and bidentate coordination mode and, in addition, form one or more strong and stable linkages with silicon through non-hydrolysable bonds. Therefore, the incorporation of a very low concentration of phosphonic acids on TEOS solutions favors the complete coverage of the aluminum substrate during the silanization process, which is not possible using TEOS alone. The linking capacity of phosphonic acid has been investigated by FTIR-RA spectroscopy, SEM and EDX analysis, X-ray photoelectron spectroscopy (XPS), and quantum mechanical calculations. Finally, electrochemical impedance spectroscopy has been used to study the corrosion protection revealing that EDTPO-containing films afforded more protection to the AA1100 substrate than ATMP-containing films.

  2. A synergistic combination of tetraethylorthosilicate and multiphosphonic acid offers excellent corrosion protection to AA1100 aluminum alloy

    International Nuclear Information System (INIS)

    Dalmoro, Viviane; Santos, João H.Z. dos; Armelin, Elaine; Alemán, Carlos

    2013-01-01

    This work describes a new mechanism for the incorporation of organophosphonic acid into silane self-assembly monolayers, which has been used to protect AA1100 aluminum alloy. The protection improvement has been attributed to the fact that phosphonic structures promote the formation of strongly bonded and densely packed monolayer films, which show higher surface coverage and better adhesion than conventional silane systems. In order to evaluate the linking chemistry offered by phosphonic groups, two functionalized organophosphonic groups have been employed, 1,2-diaminoethanetetrakis methylenephosphonic acid (EDTPO) and aminotrimethylenephosphonic acid (ATMP), and combined with tetraethylorthosilicate (TEOS) films prepared by sol–gel synthesis. Results suggest that phosphonic acids may interact with the surface through a monodentate and bidentate coordination mode and, in addition, form one or more strong and stable linkages with silicon through non-hydrolysable bonds. Therefore, the incorporation of a very low concentration of phosphonic acids on TEOS solutions favors the complete coverage of the aluminum substrate during the silanization process, which is not possible using TEOS alone. The linking capacity of phosphonic acid has been investigated by FTIR-RA spectroscopy, SEM and EDX analysis, X-ray photoelectron spectroscopy (XPS), and quantum mechanical calculations. Finally, electrochemical impedance spectroscopy has been used to study the corrosion protection revealing that EDTPO-containing films afforded more protection to the AA1100 substrate than ATMP-containing films.

  3. Diffusion coefficient, porosity measurement, dynamic and equilibrium swelling studies of Acrylic acid/Polyvinyl alcohol (AA/PVA hydrogels

    Directory of Open Access Journals (Sweden)

    Nazar Mohammad Ranjha

    2015-06-01

    Full Text Available Objective of the present work was to synthesize hydrogels of acrylic acid/polyvinyl alcohol (AA/PVA by free radical polymerization by using glutaradehyde (GA as crosslinkers. The hydrogels were evaluated for swelling, diffusion coefficient and network parameters like the average molecular weight between crosslink’s, polymer volume fraction in swollen state, number of repeating units between crosslinks and crosslinking density by using Flory-Huggins theory. It was found that the degree of swelling of AA/PVA hydrogels increases greatly within the pH range 5-7. The gel fraction and porosity increased by increasing the concentration of AA or PVA. Increase in degree of crosslinking, decreased the porosity and inverse was observed in gel fraction. Selected samples were loaded with metoprolol tartrate. Drug release was studied in USP hydrochloric acid solution of pH 1.2 and phosphate buffer solutions of pH 5.5 and 7.5. Various kinetics models like zero order, first order, Higuchi and Peppas model were used for in vitro kinetic studies. The results showed that the drug release followed concentration dependent effect (First order kinetics with non-Fickian diffusion. FTIR and SEM used to study the structure, crystallinity, compatibility, thermal stability and morphology of prepared and drug loaded hydrogels respectively.

  4. Mildly abnormal general movement quality in infants is associated with higher Mead acid and lower arachidonic acid and shows a U-shaped relation with the DHA/AA ratio.

    Science.gov (United States)

    van Goor, S A; Schaafsma, A; Erwich, J J H M; Dijck-Brouwer, D A J; Muskiet, F A J

    2010-01-01

    We showed that docosahexaenoic acid (DHA) supplementation during pregnancy and lactation was associated with more mildly abnormal (MA) general movements (GMs) in the infants. Since this finding was unexpected and inter-individual DHA intakes are highly variable, we explored the relationship between GM quality and erythrocyte DHA, arachidonic acid (AA), DHA/AA and Mead acid in 57 infants of this trial. MA GMs were inversely related to AA, associated with Mead acid, and associated with DHA/AA in a U-shaped manner. These relationships may indicate dependence of newborn AA status on synthesis from linoleic acid. This becomes restricted during the intrauterine period by abundant de novo synthesis of oleic and Mead acids from glucose, consistent with reduced insulin sensitivity during the third trimester. The descending part of the U-shaped relation between MA GMs and DHA/AA probably indicates DHA shortage next to AA shortage. The ascending part may reflect a different developmental trajectory that is not necessarily unfavorable. Copyright 2009 Elsevier Ltd. All rights reserved.

  5. Maleopimaric acid acetic acid solvate

    OpenAIRE

    Zhang, Meng; Zhou, Yong-hong; Guo, Xiao-xin; Hu, Li-hong

    2009-01-01

    The title compound, C24H32O5·C2H4O2, is a derivative of abietic acid. The two fused and unbridged cyclohexane rings have chair conformations and the anhydride ring is planar. Of the other three six-membered rings, two have boat conformations and one has a twist-boat conformation. The crystal structure is stabilized by intermolecular O—H...O and C—H...O hydrogen bonds.

  6. Ionic liquid based on α-amino acid anion and N7,N9-dimethylguaninium cation ([dMG][AA]): theoretical study on the structure and electronic properties.

    Science.gov (United States)

    Shakourian-Fard, Mehdi; Fattahi, Alireza; Bayat, Ahmad

    2012-06-07

    The interactions between five amino acid based anions ([AA](-) (AA = Gly, Phe, His, Try, and Tyr)) and N7,N9-dimethylguaninium cation ([dMG](+)) have been investigated by the hybrid density functional theory method B3LYP together with the basis set 6-311++G(d,p). The calculated interaction energy was found to decrease in magnitude with increasing side-chain length in the amino acid anion. The interaction between the [dMG](+) cation and [AA](-) anion in the most stable configurations of ion pairs is a hydrogen bonding interaction. These hydrogen bonds (H bonds) were analyzed by the quantum theory of atoms in molecules (QTAIM) and natural bond orbital (NBO) analysis. Finally, several correlations between electron densities in bond critical points of hydrogen bonds and interaction energy as well as vibrational frequencies in the most stable configurations of ion pairs have been checked.

  7. Effect of Dietary L-ascorbic Acid (L-AA on Production Performance, Egg Quality Traits and Fertility in Japanese Quail ( at Low Ambient Temperature

    Directory of Open Access Journals (Sweden)

    N. Shit

    2012-07-01

    Full Text Available Environmental stress boosts the levels of stress hormones and accelerates energy expenditure which subsequently imbalance the body’s homeostasis. L-ascorbic acid (L-AA has been recognized to mitigate the negative impact of environmental stress on production performances in birds. The present investigation was carried out to elucidate the effect of different dietary levels of L-AA on production performance, egg quality traits and fertility in Japanese quail at low ambient temperature. Sixty matured females (15 wks were equally divided into three groups (20/group based on the different dietary levels of L-AA (0, 250 and 500 ppm and coupled with an equal number of males (1:1 obtained from the same hatch. They were managed in uniform husbandry conditions without restriction of feed and water at 14 h photo-schedule. Except for feed efficiency, body weight change, feed consumption and hen-day egg production were recorded highest in 500 ppm L-AA supplemented groups. Among the all egg quality traits studied, only specific gravity, shell weight and thickness differed significantly (p<0.05 in the present study. Fertility was improved significantly (p<0.01 to a dose dependent manner of L-AA. The findings of the present study concluded that dietary L-AA can be a caring management practice at least in part to alleviate the adverse effect of cold induced stress on production performance in Japanese quail.

  8. AA Index

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa index provides a long climatology of global geomagnetic activity using 2 antipodal observatories at Greenwich and Melbourne- IAGA Bulletin 37,...

  9. Effect of Amino Acid Substitutions in the GerAA Protein on the Function of the Alanine-Responsive Germinant Receptor of Bacillus subtilis Spores▿

    Science.gov (United States)

    Mongkolthanaruk, Wiyada; Cooper, Gareth R.; Mawer, Julia S. P.; Allan, Raymond N.; Moir, Anne

    2011-01-01

    Spores of Bacillus subtilis require the GerAA, GerAB, and GerAC receptor proteins for l-alanine-induced germination. Mutations in gerAA, both random and site directed, result in phenotypes that identify amino acid residues important for receptor function in broad terms. They highlight the functional importance of two regions in the central, integral membrane domain of GerAA. A P324S substitution in the first residue of a conserved PFPP motif results in a 10-fold increase in a spore's sensitivity to alanine; a P326S change results in the release of phase-dark spores, in which the receptor may be in an “activated” or “quasigerminated” state. Substitutions in residues 398 to 400, in a short loop between the last two likely membrane-spanning helices of this central domain, all affect the germination response, with the G398S substitution causing a temperature-sensitive defect. In others, there are wider effects on the receptor: if alanine is substituted for conserved residue N146, H304, or E330, a severe defect in l-alanine germination results. This correlates with the absence of GerAC, suggesting that the assembly or stability of the entire receptor complex has been compromised by the defect in GerAA. In contrast, severely germination-defective mutants such as E129K, L373F, S400F, and M409N mutants retain GerAC at normal levels, suggesting more local and specific effects on the function of GerAA itself. Further interpretation will depend on progress in structural analysis of the receptor proteins. PMID:21378197

  10. Interactions of collagen molecules in the presence of N-hydroxysuccinimide activated adipic acid (NHS-AA) as a crosslinking agent.

    Science.gov (United States)

    Zhang, Min; Wu, Kun; Li, Guoying

    2011-11-01

    The effect of crosslinking agent on pepsin-soluble bovine collagen solution was examined using N-hydroxysuccinimide activated adipic acid (NHS-AA) as a crosslinker. Electrophoretic patterns indicated that crosslinks formed when NHS-AA was added. A higher polarity level deduced from the changes in the fluorescence emission spectrum of pyrene in the crosslinked collagen solution indicated that the formation of well-ordered aggregates was suppressed. The random aggregation of collagens was also observed by atomic force microscopy (AFM). Furthermore, the association of collagens into fibrils was influenced by crosslinking. Self-assembly was suppressed at 37°C; however, as temperature was increased to 39°C, a small amount of NHS-AA leaded to an improvement in the ability of self-aggregation. Although more random structure was brought about by crosslinking, self-aggregation might still be promoted as temperature was increased, accompanying by the thermal stability improvement of fibrils. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Abia, AA

    African Journals Online (AJOL)

    Abia, AA. Vol 4, No 6 (2010) - Articles Studies on the kinetics and intraparticle diffusivities of BOD, colour and TSS reduction from palm oil mill effluent (POME) using boiler fly ash. Abstract PDF. ISSN: 1996-0786. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More ...

  12. Adejumo, AA

    African Journals Online (AJOL)

    Adejumo, AA. Vol 6, No 2 (2014) - Articles Assessment of Tourists Flow and Revenue Generation in Kainji Lake National Park, Nigeria Abstract PDF. ISSN: 2141-1778. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and ...

  13. Adepeju, AA

    African Journals Online (AJOL)

    Adepeju, AA. Vol 19, No 2 (2010) - Articles Assessment of Ethical and Other Professional Standards in Private Medical Laboratories; Osun State Experience. Abstract. ISSN: 1116-1043. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  14. Wornyo, AA

    African Journals Online (AJOL)

    Wornyo, AA. Vol 2, No 1 (2012) - Articles Addressing the Difficulties of Learners in the Reading Class Abstract. ISSN: 2026-6081. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and Conditions of Use · Contact AJOL ...

  15. Influence of steam-based pre-treatment using acidic chemistries on the adhesion performance of powder coated aluminium alloy AA6060

    DEFF Research Database (Denmark)

    Din, Rameez Ud; Nikogeorgos, Nikolaos; Jellesen, Morten Stendahl

    2017-01-01

    treatment prior toapplication of the powder coating. A focussed ion beam technique was used to examine the cross section of the powder coating, interface adhesion, and fracture morphology after the boiling test and interface indentation method. Transmission electron microscopy was used to study the fracture......In this study, the adhesion of a commercially applied powder coating on a steam treated AA6060 surface withpure steam and steam with citric and phosphoric acid chemistries has been investigated. Contact angle,roughness, and nanoscale pull off forces were determined as a function of the steam...

  16. Targeting fatty acid amide hydrolase and transient receptor potential vanilloid-1 simultaneously to modulate colonic motility and visceral sensation in the mouse: A pharmacological intervention with N-arachidonoyl-serotonin (AA-5-HT).

    Science.gov (United States)

    Bashashati, M; Fichna, J; Piscitelli, F; Capasso, R; Izzo, A A; Sibaev, A; Timmermans, J-P; Cenac, N; Vergnolle, N; Di Marzo, V; Storr, M

    2017-12-01

    Endocannabinoid anandamide (AEA) inhibits intestinal motility and visceral pain, but it may also be proalgesic through transient receptor potential vanilloid-1 (TRPV1). AEA is degraded by fatty acid amide hydrolase (FAAH). This study explored whether dual inhibition of FAAH and TRPV1 reduces diarrhea and abdominal pain. Immunostaining was performed on myenteric plexus of the mouse colon. The effects of the dual FAAH/TRPV1 inhibitor AA-5-HT on electrically induced contractility, excitatory junction potential (EJP) and fast (f) and slow (s) inhibitory junction potentials (IJP) in the mouse colon, colonic propulsion and visceromotor response (VMR) to rectal distension were studied. The colonic levels of endocannabinoids and fatty acid amides were measured. CB1-positive neurons exhibited TRPV1; only some TRPV1 positive neurons did not express CB1. CB1 and FAAH did not colocalize. AA-5-HT (100 nM-10 μM) decreased colonic contractility by ~60%; this effect was abolished by TRPV1 antagonist 5'-IRTX, but not by CB1 antagonist, SR141716. AA-5-HT (1 μM-10 μM) inhibited EJP by ~30% and IJPs by ~50%. The effects of AA-5-HT on junction potentials were reversed by SR141716 and 5`-IRTX. AA-5-HT (20 mg/kg; i.p.) inhibited colonic propulsion by ~30%; SR141716 but not 5`-IRTX reversed this effect. AA-5-HT decreased VMR by ~50%-60%; these effects were not blocked by SR141716 or 5`-IRTX. AA-5-HT increased AEA in the colon. The effects of AA-5-HT on visceral sensation and colonic motility are differentially mediated by CB1, TRPV1 and non-CB1/TRPV1 mechanisms, possibly reflecting the distinct neuromodulatory roles of endocannabinoid and endovanilloid FAAH substrates in the mouse intestine. © 2017 John Wiley & Sons Ltd.

  17. 40 CFR Appendix A to Subpart Aa of... - Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA

    Science.gov (United States)

    2010-07-01

    ... (40 CFR Part 63, Subpart A) to Subpart AA A Appendix A to Subpart AA of Part 63 Protection of... Hazardous Air Pollutants From Phosphoric Acid Manufacturing Plants Pt. 63, Subpt. AA, App. A Appendix A to Subpart AA of Part 63—Applicability of General Provisions (40 CFR Part 63, Subpart A) to Subpart AA 40 CFR...

  18. Influence of 4,4’-azobis (4-cyanopentanoic acid in Transmission and Reflection Gratings Stored in a PVA/AA Photopolymer

    Directory of Open Access Journals (Sweden)

    Elena Fernandez

    2016-03-01

    Full Text Available Holographic transmission gratings with a spatial frequency of 2658 lines/mm and reflection gratings with a spatial frequency of 4553 lines/mm were stored in a polyvinyl alcohol (PVA/acrylamide (AA based photopolymer. This material can reach diffraction efficiencies close to 100% for spatial frequencies about 1000 lines/mm. However, for higher spatial frequencies, the diffraction efficiency decreases considerably as the spatial frequency increases. To enhance the material response at high spatial frequencies, a chain transfer agent, the 4,4’-azobis (4-cyanopentanoic acid, ACPA, is added to the composition of the material. Different concentrations of ACPA are incorporated into the main composition of the photopolymer to find the concentration value that provides the highest diffraction efficiency. Moreover, the refractive index modulation and the optical thickness of the transmission and reflection gratings were obtained, evaluated and compared to procure more information about the influence of the ACPA on them.

  19. Studies of transformation and particle-binding of resin acids during oxidative treatment of effluent from two New Zealand pulp mills.

    Science.gov (United States)

    Kanber, S A; Langdon, A G; Wilkins, A L

    2008-02-01

    Reactor studies of aerobic degradation of effluent from the first and last ponds of the treatment system of two New Zealand pulp and paper mills indicated that filterable BOD(5), resin acids and transformed resin acids, free and bound, degraded at similar rates. During oxidative treatment the resin acids of untreated effluent became increasingly bound to particulate material and a sediment high in abiet-13-enoic acid was formed.

  20. Site-saturation engineering of lysine 47 in cyclodextrin glycosyltransferase from Paenibacillus macerans to enhance substrate specificity towards maltodextrin for enzymatic synthesis of 2-O-D-glucopyranosyl-L-ascorbic acid (AA-2G).

    Science.gov (United States)

    Han, Ruizhi; Liu, Long; Shin, Hyun-dong; Chen, Rachel R; Du, Guocheng; Chen, Jian

    2013-07-01

    In this work, the site-saturation engineering of lysine 47 in cyclodextrin glycosyltransferase (CGTase) from Paenibacillus macerans was conducted to improve the specificity of CGTase towards maltodextrin, which can be used as a cheap and easily soluble glycosyl donor for the enzymatic synthesis of 2-O-D-glucopyranosyl-L-ascorbic acid (AA-2G) by CGTase. When using maltodextrin as glycosyl donor, four mutants K47F (lysine→ phenylalanine), K47L (lysine→ leucine), K47V (lysine→ valine) and K47W (lysine→ tryptophan) showed higher AA-2G yield as compared with that produced by the wild-type CGTase. The transformation conditions (temperature, pH and the mass ratio of L-ascorbic acid to maltodextrin) were optimized and the highest titer of AA-2G produced by the mutant K47L could reach 1.97 g/l, which was 64.2% higher than that (1.20 g/l) produced by the wild-type CGTase. The reaction kinetics analysis confirmed the enhanced maltodextrin specificity, and it was also found that compared with the wild-type CGTase, the four mutants had relatively lower cyclization activities and higher disproportionation activities, which was favorable for AA-2G synthesis. The mechanism responsible for the enhanced substrate specificity was further explored by structure modeling and it was indicated that the enhancement of maltodextrin specificity may be due to the short residue chain and the removal of hydrogen bonding interactions between the side chain of residue 47 and the sugar at -3 subsite. Here the obtained mutant CGTases, especially the K47L, has a great potential in the production of AA-2G with maltodextrin as a cheap and easily soluble substrate.

  1. Aa Ah Nak

    Science.gov (United States)

    Tha, Na Gya; Wus, Thay

    2017-01-01

    In this article, Aa Ah Nak, the authors' methodology presents not only various reflections but also diverse contradictions about the Aa Nii language as well as language revitalization. This article explores language foundation and how the Aa Nii language revitalization is inextricably linked to the genocide and resulting historic trauma pervasive…

  2. A novel Cry9Aa with increased toxicity for Spodoptera exigua (Hübner)

    NARCIS (Netherlands)

    Naimov, S.; Nedyalkova, R.; Staykov, N.; Weemen-Hendriks, M.; Minkov, I.; Maagd, de R.A.

    2014-01-01

    Cry9Aa, produced by Bacillus thuringiensis is reported to be not active against Spodoptera exigua (beet armyworm). In this study we have cloned a new cry9Aa5 gene encoding a protoxin with increased activity against S. exigua as compared to Cry9Aa1. When aligned to Cry9Aa1, four amino acid

  3. Oxidative potential of ambient water-soluble PM2.5 in the southeastern United States: contrasts in sources and health associations between ascorbic acid (AA and dithiothreitol (DTT assays

    Directory of Open Access Journals (Sweden)

    T. Fang

    2016-03-01

    Full Text Available The ability of certain components of particulate matter to induce oxidative stress through the generation of reactive oxygen species (ROS in vivo may be one mechanism accounting for observed linkages between ambient aerosols and adverse health outcomes. A variety of assays have been used to measure this so-called aerosol oxidative potential. We developed a semi-automated system to quantify oxidative potential of filter aqueous extracts utilizing the dithiothreitol (DTT assay and report here the development of a similar semi-automated system for the ascorbic acid (AA assay. Approximately 500 PM2.5 filter samples collected in contrasting locations in the southeastern US were analyzed for a host of aerosol species, along with AA and DTT activities. We present a detailed contrast in findings from these two assays. Water-soluble AA activity was higher in summer and fall than in winter, with highest levels near heavily trafficked highways, whereas DTT activity was higher in winter compared to summer and fall and more spatially homogeneous. AA activity was nearly exclusively correlated with water-soluble Cu (r  =  0.70–0.94 at most sites, whereas DTT activity was correlated with organic and metal species. Source apportionment models, positive matrix factorization (PMF and a chemical mass balance method with ensemble-averaged source impact profiles (CMB-E, suggest a strong contribution from traffic emissions and secondary processes (e.g., organic aerosol oxidation or metals mobilization by secondary acids to both AA and DTT activities in urban Atlanta. In contrast, biomass burning was a large source for DTT activity, but insignificant for AA. AA activity was not correlated with PM2.5 mass, while DTT activity co-varied strongly with mass (r  =  0.49–0.86 across sites and seasons. Various linear models were developed to estimate AA and DTT activities for the central Atlanta Jefferson Street site, based on the CMB-E sources. The

  4. EFSA ND A Panel ( EFSA Panel on Dietetic Products, Nutrition and Allergies), 2013. Scientific Opinion on the substantiation of a health claim related to eicosapentanoic acid (EPA) and “ reduces the AA/EPA ratio in blood. A high AA/EPA level is a risk factor in the d evelopment of attention difficulties in children with ADHD - like symptoms ” pursuant to Article 14 of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    hyperactivity and/or coexisting oppositional behaviour”. Upon a request by EFSA for clarification, the applicant indicated that the disease was ADHD, which is classified as such in accordance with the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV), that the risk factor for the disease...... of a health claim related to eicosapentaenoic acid (EPA) and “reduces the AA/EPA ratio in blood. A high AA/EPA level is a risk factor in the development of attention difficulties in children with attention deficit hyperactivity disorder (ADHD)-like symptoms”. The food constituent, EPA, which is the subject...

  5. Comparison between the AA/EPA ratio in depressed and non depressed elderly females: omega-3 fatty acid supplementation correlates with improved symptoms but does not change immunological parameters

    Directory of Open Access Journals (Sweden)

    Rizzo Angela

    2012-10-01

    Full Text Available Abstract Background Depression is one of the most frequently missed diagnoses in elderly people, with obvious negative effects on quality of life. Various studies have shown that long chain omega-3 polyunsaturated fatty acids (n-3 PUFA may be useful in its management. Our objective was to evaluate whether a supplement containing n-3 PUFA improves depressive symptoms in depressed elderly patients, and whether the blood fatty acid pattern is correlated with these changes. Methods The severity of depressive symptoms according to the Geriatric Depression Scale (GDS, blood fatty acid composition and erythrocyte phospholipids were analyzed in 46 depressed females aged 66-95y, diagnosed with depression according to DSMIV, within the context of a randomized, double-blind, placebo-controlled trial. 22 depressed females were included in the intervention group (2.5 g/day of n-3 PUFA for 8 weeks, and 24 in the placebo group. We also measured immunological parameters (CD2, CD3, CD4, CD8, CD16, CD19 and cytokines (IL-5, IL-15. Results The mean GDS score and AA/EPA ratio, in whole blood and RBC membrane phospholipids, were significantly lower after 2 months supplementation with n-3 PUFA. A significant correlation between the amelioration of GDS and the AA/EPA ratio with some immunological parameters, such as CD2, CD19, CD4, CD16 and the ratio CD4/CD8, was also found. Nevertheless, omega-3 supplementation did not significantly improve the studied immunological functions. Conclusions n-3 PUFA supplementation ameliorates symptoms in elderly depression. The n-3 PUFA status may be monitored by means of the determination of whole blood AA/EPA ratio.

  6. AA under construction

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The AA at an early stage of construction, in the newly built AA-Hall. Cable-trays already outline the shape of the accumulator ring. To the right are huge cable-drums for the pulse-forming-network (PFN) of the injection kicker. Seeing this picture, can one imagine that only 8 months later beams were circulating in the completed accumulator ring ?

  7. Single amino acid insertions in extracellular loop 2 of Bombyx mori ABCC2 disrupt its receptor function for Bacillus thuringiensis Cry1Ab and Cry1Ac but not Cry1Aa toxins.

    Science.gov (United States)

    Tanaka, Shiho; Miyamoto, Kazuhisa; Noda, Hiroaki; Endo, Haruka; Kikuta, Shingo; Sato, Ryoichi

    2016-04-01

    In a previous report, seven Cry1Ab-resistant strains were identified in the silkworm, Bombyx mori; these strains were shown to have a tyrosine insertion at position 234 in extracellular loop 2 of the ABC transporter C2 (BmABCC2). This insertion was confirmed to destroy the receptor function of BmABCC2 and confer the strains resistance against Cry1Ab and Cry1Ac. However, these strains were susceptible to Cry1Aa. In this report, we examined the mechanisms of the loss of receptor function of the transporter by expressing mutations in Sf9 cells. After replacement of one or two of the five amino acid residues in loop 2 of the susceptible BmABCC2 gene [BmABCC2_S] with alanine, cells still showed susceptibility, retaining the receptor function. Five mutants with single amino acid insertions at position 234 in BmABCC2 were also generated, resulting in loop 2 having six amino acids, which corresponds to replacing the tyrosine insertion in the resistant BmABCC2 gene [BmABCC2_R(+(234)Y)] with another amino acid. All five mutants exhibited loss of function against Cry1Ab and Cry1Ac. These results suggest that the amino acid sequence in loop 2 is less important than the loop size (five vs. six amino acids) or loop structure for Cry1Ab and Cry1Ac activity. Several domain-swapped mutant toxins were then generated among Cry1Aa, Cry1Ab, and Cry1Ac, which are composed of three domains. Swapped mutants containing domain II of Cry1Ab or Cry1Ac did not kill Sf9 cells expressing BmABCC2_R(+(234)Y), suggesting that domain II of the Cry toxin is related to the interaction with the receptor function of BmABCC2. This also suggests that different reactions against Bt-toxins in some B. mori strains, that is, Cry1Ab resistance or Cry1Aa susceptibility, are attributable to structural differences in domain II of Cry1A toxins. Copyright © 2016. Published by Elsevier Inc.

  8. Isolation and characterization of isopimaric acid-degrading bacteria from a sequencing batch reactor.

    OpenAIRE

    Wilson, A E; Moore, E R; Mohn, W W

    1996-01-01

    We isolated two aerobic, gram-negative bacteria which grew on the diterpene resin acid isopimaric acid (IpA) as the sole carbon source and electron donor. The source of the isolates was a sequencing batch reactor treating a high-strength process stream from a paper mill. The isolates, IpA-1 and IpA-2, also grew on pimaric and dehydroabietic acids, and IpA-1 grew on abietic acid. Both strains used fatty acids, but neither strain used camphor, sitosterol, or betulin. Strain IpA-1 grew anaerobic...

  9. Geomagnetic aa Indices

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The geomagnetic aa indices are the continuation of the series beginning in the year 1868. A full description of these indices is given in the International...

  10. Human milk arachidonic acid and docosahexaenoic acid contents increase following supplementation during pregnancy and lactation

    NARCIS (Netherlands)

    van Goor, Saskia A.; Dijick-Brouwer, D. A. Janneke; Hadders-Algra, Mijna; Doornbos, Bennard; Erwich, Jan Jaap H. M.; Schaafsma, Anne; Muskiet, Frits A. J.; Djick-Brouwer, D.A.J.

    Introduction: Docosahexaenoic acid (DHA) and arachidonic acid (AA) are important for neurodevelopment. Maternal diet influences milk DHA, whereas milk AA seems rather constant. We investigated milk AA, DHA and DHA/AA after supplementation of AA plus DHA, or DHA alone during pregnancy and lactation.

  11. Detection of biologically active diterpenoic acids by Raman Spectroscopy

    DEFF Research Database (Denmark)

    Talian, Ivan; Orinak, Andrej; Efremov, Evtim V.

    2010-01-01

    is not suitable for their unambiguous identification, especially not in solution. We attempted to increase the sensitivity by applying UV-resonance Raman spectroscopy and surface-enhanced Raman spectroscopy (SERS) techniques. The UV-Raman spectra of the three compounds in ethanol/water 50 : 50 showed only very......Three poorly detectable, biologically active diterpenoic acids, kaurenoic, abietic, and gibberellic acid, were studied by using different modes of Raman spectroscopy. Because of their structural similarities, in the absence of strongly polarizable groups, conventional Raman spectroscopy...

  12. The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Akira [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Bainy, Afonso C.D. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Departamento de Bioquímica, CCB, Universidade Federal de Santa Catarina, Florianopolis, SC 88040-900 (Brazil); Woodin, Bruce R.; Goldstone, Jared V. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

    2013-10-01

    The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs. On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with

  13. Fecal transmission of AA amyloidosis in the cheetah contributes to high incidence of disease

    Science.gov (United States)

    Zhang, Beiru; Une, Yumi; Fu, Xiaoying; Yan, Jingmin; Ge, FengXia; Yao, Junjie; Sawashita, Jinko; Mori, Masayuki; Tomozawa, Hiroshi; Kametani, Fuyuki; Higuchi, Keiichi

    2008-01-01

    AA amyloidosis is one of the principal causes of morbidity and mortality in captive cheetahs (Acinonyx jubatus), which are in danger of extinction, but little is known about the underlying mechanisms. Given the transmissible characteristics of AA amyloidosis, transmission between captive cheetahs may be a possible mechanism involved in the high incidence of AA amyloidosis. In this study of animals with AA amyloidosis, we found that cheetah feces contained AA amyloid fibrils that were different from those of the liver with regard to molecular weight and shape and had greater transmissibility. The infectious activity of fecal AA amyloid fibrils was reduced or abolished by the protein denaturants 6 M guanidine·HCl and formic acid or by AA immunodepletion. Thus, we propose that feces are a vehicle of transmission that may accelerate AA amyloidosis in captive cheetah populations. These results provide a pathogenesis for AA amyloidosis and suggest possible measures for rescuing cheetahs from extinction. PMID:18474855

  14. Fred-Jaiyesimi, AA

    African Journals Online (AJOL)

    Fred-Jaiyesimi, AA. Vol 12 (2008) - Articles Hypoglycaemic And Alpha-Amylase Inhibitory Activities Of Fermented Seeds Of Parkia Biglobosa (Jacq) Benth Abstract. ISSN: 1118-6267. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  15. AL SAHLI, AA; OKOLI, JU

    African Journals Online (AJOL)

    ADOWIE PERE

    bioline.org.br/ja. The Use of Soil Palynomorphs in Forensics. *. 1. ABDULRAHAMAN, AA;. 2. AL SAHLI, AA;. 1. OKOLI, JU. 1Applied Plant Anatomy and Wood Technology Laboratory, Department of Plant Biology, University of Ilorin, Ilorin, Nigeria.

  16. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    Section 06 - 08*) of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A vacuum-tank, two bending magnets (BST06 and BST07 in blue) with a quadrupole (QDN07, in red) in between, another vacuum-tank, a wide quadrupole (QFW08) and a further tank . The tanks are covered with heating tape for bake-out. The tank left of BST06 contained the stack core pickup for stochastic cooling (see 7906193, 7906190, 8005051), the two other tanks served mainly as vacuum chambers in the region where the beam was large. Peter Zettwoch works on BST06. *) see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984)

  17. AA, bending magnet, BLG

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The very particular lattice of the AA required 2 types of dipole (bending magnets; BLG, long and narrow; BST, short and wide). The BLG had a steel length of 4.70 m, a good field width of 0.24 m, and a weight of about 70 t. Jean-Claude Brunet inspects the lower half of a BLG. For the BST magnets see 7811105 and 8006036.

  18. The Antiproton Accumulator (AA)

    CERN Multimedia

    1980-01-01

    A section of the AA where the dispersion (and hence the horizontal beam size) is large. One can distinguish (left to right): A large vacuum-tank, a quadrupole (QDN09*), a bending magnet (BST08), another vacuum-tank, a wide quadrupole (QFW08) and (in the background) a further bending magnet (BST08). The tanks are covered with heating tape for bake-out. The tank left of QDN09 contained the kickers for stochastic pre-cooling (see 790621, 8002234, 8002637X), the other one served mainly as vacuum chamber in the region where the beam was large. Peter Zettwoch works on QFW08. * see: H. Koziol, Antiproton Accumulator Parameter List, PS/AA/Note 84-2 (1984) See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  19. Differential Ratios of Omega Fatty Acids (AA/EPA+DHA Modulate Growth, Lipid Peroxidation and Expression of Tumor Regulatory MARBPs in Breast Cancer Cell Lines MCF7 and MDA-MB-231.

    Directory of Open Access Journals (Sweden)

    Prakash P Mansara

    Full Text Available Omega 3 (n3 and Omega 6 (n6 polyunsaturated fatty acids (PUFAs have been reported to exhibit opposing roles in cancer progression. Our objective was to determine whether different ratios of n6/n3 (AA/EPA+DHA FAs could modulate the cell viability, lipid peroxidation, total cellular fatty acid composition and expression of tumor regulatory Matrix Attachment Region binding proteins (MARBPs in breast cancer cell lines and in non-cancerous, MCF10A cells. Low ratios of n6/n3 (1:2.5, 1:4, 1:5, 1:10 FA decreased the viability and growth of MDA-MB-231 and MCF7 significantly compared to the non-cancerous cells (MCF10A. Contrarily, higher n6/n3 FA (2.5:1, 4:1, 5:1, 10:1 decreased the survival of both the cancerous and non-cancerous cell types. Lower ratios of n6/n3 selectively induced LPO in the breast cancer cells whereas the higher ratios induced in both cancerous and non-cancerous cell types. Interestingly, compared to higher n6/n3 FA ratios, lower ratios increased the expression of tumor suppressor MARBP, SMAR1 and decreased the expression of tumor activator Cux/CDP in both breast cancer and non-cancerous, MCF10A cells. Low n6/n3 FAs significantly increased SMAR1 expression which resulted into activation of p21WAF1/CIP1 in MDA-MB-231 and MCF7, the increase being ratio dependent in MDA-MB-231. These results suggest that increased intake of n3 fatty acids in our diet could help both in the prevention as well as management of breast cancer.

  20. Intestinal drug transport via the proton-coupled amino acid transporter PAT1 (SLC36A1) is inhibited by Gly-X(aa) dipeptides

    DEFF Research Database (Denmark)

    Frølund, Sidsel; Langthaler, Louise; Kall, Morten A

    2012-01-01

    -Sar as substrates of the amino acid transporter PAT1. The aim of the present study is to investigate if other Gly-containing dipeptides interact with PAT1, and whether they can inhibit PAT1 mediated drug absorption, in vitro and in vivo. The in vitro methods included two-electrode voltage clamp measurements on h...... of different dipeptides. The in vivo part consisted of a pharmacokinetic study in rats following oral administration of gaboxadol and preadministration of 200 mg/kg dipeptide. The results showed that in hPAT1 expressing oocytes Gly-Tyr, Gly-Pro, and Gly-Phe inhibited currents induced by drug substances......, the present study identifies selected dipeptides as inhibitors of PAT1 mediated drug absorption in various in vitro models....

  1. AAS 227: Day 1

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or at astrobites.com, or catch ourlive-tweeted updates from the @astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto have so many people tell us that they already know about and useastrobites, and we were excited to introduce a new cohort of students at AAS to astrobites for the first time.Tuesday morning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended today.Opening Address (by Becky Smethurst)The President of the AAS, aka our fearless leader Meg Urry kicked off the meeting this morning at the purely coffee powered hour of 8am this morning. She spoke about the importance of young astronomers at the meeting (heres looking at you reader!) and also the importance of the new Working Group for Accessibility and Disabilities (aka WGAD pronounced like wicked) at the AAS. The Society has made extra effort this year to make the conference accessible to all,a message which was very well received by everyone in attendance.Kavli Lecture: New Horizons Alan Stern (by Becky Smethurst)We were definitely spoilt with the first Plenary lecture at this years conference Alan Stern gave us a a review of the New Horizons mission of the Pluto Fly By (astrobites covered the mission back in July with this post). We were treated to beautiful images, wonderful results and a foray into geology.Before (Hubble) and after #NewHorizons. #thatisall #science #astro alanstern #aas227 pic.twitter.com/kkMt6RsSIR Science News (@topsciencething) January 5, 2016Some awesome facts from the lecture that blew my mind:New Horizons is now 2AU (!) beyond Pluto

  2. AAS 227: Day 2

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 2 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Plenary Session: Black Hole Physics with the Event Horizon Telescope (by Susanna Kohler)If anyone needed motivation to wake up early this morning, they got it in the form of Feryal Ozel (University of Arizona) enthralling us all with exciting pictures, videos, and words about black holes and the Event Horizon Telescope. Ozel spoke to a packed room (at 8:30am!) about where the project currently stands, and where its heading in the future.The EHT has pretty much the coolest goal ever: actually image the event horizons of black holes in our universe. The problem is that the largest black hole we can look at (Sgr A*, in the center of our galaxy) has an event horizon size of 50 as. For this kind of resolution roughly equivalent to trying to image a DVD on the Moon! wed need an Earth-sized telescope. EHT has solved this problem by linking telescopes around the world, creating one giant, mm-wavelength effective telescope with a baseline the size of Earth.Besides producing awesome images, the EHT will be able to test properties of black-hole spacetime, the no-hair theorem, and general relativity (GR) in new regimes.Ozel walked us through some of the theory prep work we need to do now in order to get the most science out of the EHT, including devising new

  3. AAS 227: Day 3

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 3 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Henry Norris Russell Lecture: Viewing the Universe with Infrared Eyes: The Spitzer Space Telescope (by Erika Nesvold)The Henry Norris Russell Award is the highest honor given by the AAS, for a lifetime of eminence in astronomy research. This years award went to Giovanni Fazio of the Harvard-Smithsonian Center for Astrophysics. Fazio became a leader in gamma ray astronomy before switching mid-career to the study of infrared astronomy, and he gave his award lecture on the latter subject, specifically on the Spitzer Space Telescope, one of the most successful infrared telescopes of all time.Artists rendering of the Spitzer space telescope. [NASA/JPL-Caltech]Spitzer has been operating for more than twelve years, and has resulted in over six thousand papers in refereed journals in that time. The telescope sits in an Earth-trailing orbit around the Sun, and is now farther from the Earth (1.4 AU) than the Earth is from the Sun. Fazio gave the audience a fascinating overview of the science done by Spitzer over more than a decade. One of the most productive areas of research for Spitzer is the study of exoplanets, which hadnt even been discovered when the Spitzer Telescope was first conceived. Spitzers high sensitivity and ability to observe exoplanets over

  4. Core-corona PSt/P(BA-AA) composite particles by two-stage emulsion polymerization

    Science.gov (United States)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya; Liao, Shijun

    2016-03-01

    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA-AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA-AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core-corona composite particles, P(St/P(BA-AA)), could be regulated and controlled by varying the concentrations of P(BA-AA) or the mass ratio of BA:AA in P(BA-AA). The experimental results indicate that 3.0-6.0 wt% of P(BA-AA) is required to obtain stable composite emulsions, and P(BA-AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core-corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA-A). The regular morphology of the colloidal film is expected to facilitate potential application of core-corona particles in the field of light scattering. Furthermore, the diversity of core-corona particles can be expanded by replacing P(BA-AA) corona particles with other amphiphilic particles.

  5. AAS 228: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note: Lastweek we were at the 228th AAS Meeting in San Diego, CA. Here is a final post aboutselectedevents on the last day of the meeting, written by authors fromastrobites.com, a grad-student collaborative project with which we recently announced a new partnership! Starting in July,keep an eye out for astrobites postsat AAS Nova in between Highlights(i.e., on Tuesdays and Thursdays).Were excited to be working together to bring you more recent astronomy research from AAS journals!Extrasolar Planets: Detection (by Leonardo dos Santos)Thursdays first session on exoplanets was about detecting these distant worlds, and the opening talk was given by Robert Siverd (Las Cumbres Observatory). He describes the NRES, a network of spectrographs that will look for exoplanets using the radial velocity method. One of the coolest aspects of this instrument is that it will feature an on the fly scheduling system that will perform observations as efficiently as possible. The spectrograph is still being tested, but a unit will be deployed at CTIO later this year.@lcogt contracted by @NASA_TESS for follow up of their candidates. #aas228 Jessie Christiansen (@aussiastronomer) June 16, 2016Measuring the depths of transits and eclipses in Spitzer has been problematic in the past, since the Spitzer instrument IRAC (InfraRed Array Camera) has a non-uniform response in its detectors pixels. But, as reported by James Ingalls (Spitzer Science Center, Caltech), observers are circumventing this issue by using what they call the staring mode (avoiding large pointing jumps) and an algorithm to pick sweet spot pixels. Moreover, the results from the IRAC Data Challenge are helping to better understand its behavior. Giuseppe Morello (University College London), on the other hand, explained how his research group gets rid of instrumental effects from IRAC using machine learning. This method removes systematics from exoplanet transit data no matter if the noise source is from an instrument or

  6. The Drentsche Aa valley system

    International Nuclear Information System (INIS)

    Gans, W. de.

    1981-01-01

    This thesis is composed of five papers concerned with Late Quaternary geology and geomorphology of the Aa valley system. The correlation and chronostratigraphic position of the layers have been established by radiocarbon dating. (Auth.)

  7. AAS 227: Day 4

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This week were at the 227th AAS Meeting in Kissimmee, FL. Along with several fellow authors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting at the end of each day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Welcome to Day 4 of the winter American Astronomical Society (AAS) meeting in Kissimmee! Several of us are attending the conference this year, and we will report highlights from each day here on astrobites. If youd like to see more timely updates during the day, we encourage you to follow @astrobites on twitter or search the #aas227 hashtag.Helen B. Warner Prize: Origins of Structure in Planetary Systems (by Erika Nesvold)Another excellent prize lecture started off todays sessions. The Helen B. Warner Prize is awarded for achievement in observational or theoretical astrophysics by a young researcher (no more than eight years after their Ph.D.). This years Warner Prize was presented to Ruth Murray-Clay of UC Santa Barbara. For her award lecture, Murray-Clay told us all about planetary system architecture: the number, masses, and orbits of planets in a given system.Ruth Murray-Clay [photo from http://web.physics.ucsb.edu/ ~murray/biocv.html]The underlying question motivating this type of research is: How rare is the Solar System? In other words, how likely is it that a given planetary system will have rocky planets close to their star, gas giants farther out, and ice giants at the outer reaches of the system? Answering this question will help us solve the physics problem of how and where planets form, and will also help us on our search for other planets like Earth.The data on exoplanet population from transit and radial velocity observations and from direct imaging tell us that our Solar System is not common (many systems we observe have much more eccentric gas giants), but that doesnt

  8. Oxidation of resin acids in colophony (rosin) and its implications for patch testing.

    Science.gov (United States)

    Sadhra, S; Foulds, I S; Gray, C N

    1998-08-01

    Commercial preparations of colophony (rosin) used for patch testing are made from unmodified rosin in pet. and may be stored for some considerable time before being used. This would be satisfactory if the composition and dermatological activity of the preparations were both reproducible and stable, but investigations by the authors have shown that the resin acids undergo progressive and substantial oxidation and that the dermatological activity of the preparations increases significantly with time. This may be a cause of inconsistent patch test results unless the composition can be stabilized. Gas liquid chromatography (GLC) analysis of a raw rosin sample and its commercial patch test preparation has shown that they both contained the same resin acids, but the concentration of the abietic type resin acids was found to be lower in the patch test preparations. The degradation of resin acids is due to their atmospheric oxidation, which may occur during the preparation and storage of the commercial rosin patch test preparation. The susceptibility of individual resin acids to atmospheric oxidation was demonstrated by analysing a sample of raw Portuguese gum rosin, which was then left exposed to air and light. Most of the resin acids were found to undergo oxidation at a rate which gradually diminished. More importantly, it is presumed that the concentration of oxidized resin acids increased correspondingly, and these have been shown to be more dermatologically active than the unoxidised resin acids. The rate of decrease of resin acid concentration was found to be in the following order: neoabietic>levopimaric and palustric>abietic>dehydroabetic acid. The pimaric type resin acids were found to be relatively inert to atmospheric oxidation when compared with the abietic type resin acids. Patch testing with the resulting partly oxidized Portuguese rosin produced positive reactions at a 35% higher frequency than the raw Portuguese rosin. The study demonstrates that the

  9. Core–corona PSt/P(BA–AA) composite particles by two-stage emulsion polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya, E-mail: cexyzh@scut.edu.cn; Liao, Shijun [South China University of Technology, School of Chemistry and Chemical Engineering (China)

    2016-03-15

    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA–AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA–AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core–corona composite particles, P(St/P(BA–AA)), could be regulated and controlled by varying the concentrations of P(BA–AA) or the mass ratio of BA:AA in P(BA–AA). The experimental results indicate that 3.0–6.0 wt% of P(BA–AA) is required to obtain stable composite emulsions, and P(BA–AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core–corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA–A). The regular morphology of the colloidal film is expected to facilitate potential application of core–corona particles in the field of light scattering. Furthermore, the diversity of core–corona particles can be expanded by replacing P(BA–AA) corona particles with other amphiphilic particles.

  10. Core–corona PSt/P(BA–AA) composite particles by two-stage emulsion polymerization

    International Nuclear Information System (INIS)

    Xie, Delong; Ren, Xiaolin; Zhang, Xinya; Liao, Shijun

    2016-01-01

    Raspberry-shaped composite particles with polystyrene (PSt) as core and poly(n-butyl acrylate-co-acrylic acid) (P(BA–AA)) as corona were synthesized via emulsion polymerization. The random copolymer, P(BA–AA), was pre-prepared and used as a polymeric surfactant, its emulsifying properties adjusted by changing the mass ratio of BA and AA. The morphology of the resulting core–corona composite particles, P(St/P(BA–AA)), could be regulated and controlled by varying the concentrations of P(BA–AA) or the mass ratio of BA:AA in P(BA–AA). The experimental results indicate that 3.0–6.0 wt% of P(BA–AA) is required to obtain stable composite emulsions, and P(BA–AA) with a mass ratio of BA:AA = 1:2 is able to generate distinct core–corona structures. A mechanism of composite particle formation is proposed based on the high affinity between the PSt core and the hydrophobic segments of P(BA–A). The regular morphology of the colloidal film is expected to facilitate potential application of core–corona particles in the field of light scattering. Furthermore, the diversity of core–corona particles can be expanded by replacing P(BA–AA) corona particles with other amphiphilic particles.

  11. Chimeric vip3Aa16TC Gene Encoding the Toxic Core of the Vegetative Insecticidal Protein Enhanced Bacillus thuringiensis Entomopathogenicity

    OpenAIRE

    Sameh Sellami; Maroua Cherif; Samir Jaoua; Kaïs Jamoussi

    2015-01-01

    Vip3 insecticidal protein is produced by Bacillus thuringiensis during the vegetative stage. Its proteolysis by the midgut juice of susceptible larvae formed four major products of approximately 66, 45, 33 and 22 kDa. In this study, we cloned the vip3Aa16TC DNA encoding the “Vip3Aa16 toxic core (TC)” of 33 kDa corresponding to the Vip3Aa16 region from amino acid 200 to 456. The vip3Aa16TC chimeric gene carried by the pHT-vip3Aa16TC plasmid was under the control of the sporulation ...

  12. Immobilization of glucose isomerase onto radiation synthesized P(AA-co-AMPS hydrogel and its application

    Directory of Open Access Journals (Sweden)

    H. Kamal

    2014-04-01

    Full Text Available Isomerization of glucose to fructose was carried out using Glucose isomerase (GI that immobilized by entrapment into Poly(acrylic acid P(AA and Poly(acrylic acid-co-2-Acrylamido 2-methyl Propane sulfonic acid P(AA-co-AMPS polymer networks, the enzyme carriers were prepared by radiation induced copolymerization in the presence of (Methylene-bisacrylamide (MBAA as a crosslinking agent. The maximum gel fraction of pure P(AA and P(AA-co-AMPS hydrogel was found to be 95.2% and 89.6% for P(AA and P(AA-co-AMPS, respectively at a total dose of 20 kGy. Effects of immobilization conditions such as radiation dose, MBAA concentration, comonomer composition and amount of GI were investigated. The influence of reaction conditions on the activity of immobilized GI were studied, the optimum pH value of the reaction solution is 7.5 and reaction temperature is 65 °C. The immobilized GI into P(AA-co-AMPS and P(AA polymer networks retained 81% and 69%, respectively of its initial activity after recycled for 15 times while it retained 87% and 71%, respectively of its initial activity after stored at 4 °C for 48 days. The Km values of free and immobilized GI onto P(AA-co-AMPS and onto P(AA matrices were found to be 34, 29.2 and 14.5 mg/mL, respectively while the Vmax Values calculated to be 3.87, 1.6 and 0.79 mg/mL min, respectively. GI entrapped into P(AA-co-AMPS hydrogel show promising behavior that may be useful as the newly glucose isomerase reactor in biomedical applications.

  13. Preparation and Characteristics of Corn Straw-Co-AMPS-Co-AA Superabsorbent Hydrogel

    OpenAIRE

    Cheng, Wei-Min; Hu, Xiang-Ming; Wang, De-Ming; Liu, Guo-Hua

    2015-01-01

    In this study, the corn straw after removing the lignin was grafted with 2-acrylamido-2-methylpropanesulfonic acid (AMPS) to prepare sulfonated cellulose. The grafting copolymerization between the sulfonated cellulose and acrylic acid (AA) was performed using potassium persulfate and N,N′-methylenebisacrylamide as the initiator and crosslinking agent, respectively, to prepare corn straw-co-AMPS-co-AA hydrogels. The structure and properties of the resulting hydrogels were characterized by Four...

  14. Antiangiogenic effects of AA-PMe on HUVECs in vitro and zebrafish in vivo

    Directory of Open Access Journals (Sweden)

    Jing Y

    2018-04-01

    Full Text Available Yue Jing,1,2,* Gang Wang,1,* Qi Xiao,1 Yachun Zhou,1 Yingjie Wei,3 Zhunan Gong1 1Center for New Drug Research and Development, College of Life Science, Nanjing Normal University, Nanjing, China; 2Central Laboratory of Stomatology, Nanjing Stomatological Hospital, Medical School of Nanjing University, Nanjing, China; 3Key Laboratory of Oral Drug Delivery System of Chinese Materia Medica of State Administration of Traditional Chinese Medicine, Jiangsu Branch of China Academy of Chinese Medical Science, Nanjing, China *These authors contributed equally to this work Abstract: Angiogenesis plays a vital role in many physiological and pathological processes and several diseases are connected with its dysregulation. Asiatic acid (AA has demonstrated anticancer properties and we suspect this might be attributable to an effect on angiogenesis. A modified derivative of AA, N-(2α,3β,23-acetoxyurs-12-en-28-oyl-L-proline methyl ester (AA-PMe, has improved efficacy over its parent compound, but its effect on blood vessel development remains unclear. Methods: In this study, we investigated the antiangiogenic activity of AA and AA-PMe in zebrafish embryos and human umbilical vein endothelial cells (HUVECs. First of all, we treated HUVECs with increasing concentrations of AA-PMe or AA, with or without vascular endothelial growth factor (VEGF present, and assessed cell viability, tube formation, and cell migration and invasion. Quantitative real-time polymerase chain reaction and Western blot analysis were later used to determine the role of vascular endothelial growth factor receptor 2 (VEGFR2-mediated signaling in AA-PMe inhibition of angiogenesis. We extended these studies to follow angiogenesis using Tg(fli:EGFP transgenic zebrafish embryos. For these experiments, embryos were treated with varying concentrations of AA-PMe or AA from 24 to 72 hours postfertilization prior to morphological observation, angiogenesis assessment, and endogenous alkaline

  15. Systemic AA amyloidosis in the red fox (Vulpes vulpes).

    Science.gov (United States)

    Rising, Anna; Cederlund, Ella; Palmberg, Carina; Uhlhorn, Henrik; Gaunitz, Stefan; Nordling, Kerstin; Ågren, Erik; Ihse, Elisabet; Westermark, Gunilla T; Tjernberg, Lars; Jörnvall, Hans; Johansson, Jan; Westermark, Per

    2017-11-01

    Amyloid A (AA) amyloidosis occurs spontaneously in many mammals and birds, but the prevalence varies considerably among different species, and even among subgroups of the same species. The Blue fox and the Gray fox seem to be resistant to the development of AA amyloidosis, while Island foxes have a high prevalence of the disease. Herein, we report on the identification of AA amyloidosis in the Red fox (Vulpes vulpes). Edman degradation and tandem MS analysis of proteolyzed amyloid protein revealed that the amyloid partly was composed of full-length SAA. Its amino acid sequence was determined and found to consist of 111 amino acid residues. Based on inter-species sequence comparisons we found four residue exchanges (Ser31, Lys63, Leu71, Lys72) between the Red and Blue fox SAAs. Lys63 seems unique to the Red fox SAA. We found no obvious explanation to how these exchanges might correlate with the reported differences in SAA amyloidogenicity. Furthermore, in contrast to fibrils from many other mammalian species, the isolated amyloid fibrils from Red fox did not seed AA amyloidosis in a mouse model. © 2017 The Protein Society.

  16. Antiangiogenic effects of AA-PMe on HUVECs in vitro and zebrafish in vivo.

    Science.gov (United States)

    Jing, Yue; Wang, Gang; Xiao, Qi; Zhou, Yachun; Wei, Yingjie; Gong, Zhunan

    2018-01-01

    Angiogenesis plays a vital role in many physiological and pathological processes and several diseases are connected with its dysregulation. Asiatic acid (AA) has demonstrated anticancer properties and we suspect this might be attributable to an effect on angio-genesis. A modified derivative of AA, N-(2α,3β,23-acetoxyurs-12-en-28-oyl)-L-proline methyl ester (AA-PMe), has improved efficacy over its parent compound, but its effect on blood vessel development remains unclear. In this study, we investigated the antiangiogenic activity of AA and AA-PMe in zebrafish embryos and human umbilical vein endothelial cells (HUVECs). First of all, we treated HUVECs with increasing concentrations of AA-PMe or AA, with or without vascular endothelial growth factor (VEGF) present, and assessed cell viability, tube formation, and cell migration and invasion. Quantitative real-time polymerase chain reaction and Western blot analysis were later used to determine the role of vascular endothelial growth factor receptor 2 (VEGFR2)-mediated signaling in AA-PMe inhibition of angiogenesis. We extended these studies to follow angiogenesis using Tg(fli:EGFP) transgenic zebrafish embryos. For these experiments, embryos were treated with varying concentrations of AA-PMe or AA from 24 to 72 hours postfertilization prior to morphological observation, angiogenesis assessment, and endogenous alkaline phosphatase assay. VEGFR2 expression in whole embryos following AA-PMe treatment was also determined. We found AA-PMe decreased cell viability and inhibited migration and tube formation in a dose-dependent manner in HUVECs. Similarly, AA-PMe disrupted the formation of intersegmental vessels, the dorsal aorta, and the posterior cardinal vein in zebrafish embryos. Both in vitro and in vivo AA-PMe surpassed AA in its ability to block angiogenesis by suppressing VEGF-induced phosphorylation of VEGFR2 and disrupting downstream extracellular regulated protein kinase and AKT signaling. For the first time

  17. AaERF1 positively regulates the resistance to Botrytis cinerea in Artemisia annua.

    Directory of Open Access Journals (Sweden)

    Xu Lu

    Full Text Available Plants are sessile organisms, and they can not move away under abiotic or biotic stresses. Thus plants have evolved a set of genes that response to adverse environment to modulate gene expression. In this study, we characterized and functionally studied an ERF transcription factor from Artemisia annua, AaERF1, which plays an important role in biotic stress responses. The AaERF1 promoter had been cloned and GUS staining results of AaERF1 promoter-GUS transgenic A. annua showed that AaERF1 is expressed ubiquitiously in all organs. Several putative cis-acting elements such as W-box, TGA-box and Py-rich element, which are involved in defense responsiveness, are present in the promoter. The expression of AaERF1 can be induced vigorously by methyl jasmonate as well as by ethephon and wounding, implying that AaERF1 may activate some of the defense genes via the jasmonic acid and ethylene signaling pathways of A. annua. The results of electrophoretic mobility shift assay (EMSA and yeast one-hybrid experiments showed that AaERF1 was able to bind to the GCC box cis-acting element in vitro and in yeast. Ectopic expression of AaERF1 could enhance the expression levels of the defense marker genes PLANT DEFENSIN1.2 (PDF1.2 and BASIC CHITINASE (ChiB, and increase the resistance to Botrytis cinerea in the 35S::AaERF1 transgenic Arabidopsis. The down-regulated expression level of AaERF1 evidently reduced the resistance to B. cinerea in A. annua. The overall results showed that AaERF1 positively regulated the resistance to B. cinerea in A. annua.

  18. Carbon-11 and Fluorine-18 Labeled Amino Acid Tracers for Positron Emission Tomography Imaging of Tumors

    Directory of Open Access Journals (Sweden)

    Aixia Sun

    2018-01-01

    Full Text Available Tumor cells have an increased nutritional demand for amino acids (AAs to satisfy their rapid proliferation. Positron-emitting nuclide labeled AAs are interesting probes and are of great importance for imaging tumors using positron emission tomography (PET. Carbon-11 and fluorine-18 labeled AAs include the [1-11C] AAs, labeling alpha-C- AAs, the branched-chain of AAs and N-substituted carbon-11 labeled AAs. These tracers target protein synthesis or amino acid (AA transport, and their uptake mechanism mainly involves AA transport. AA PET tracers have been widely used in clinical settings to image brain tumors, neuroendocrine tumors, prostate cancer, breast cancer, non-small cell lung cancer (NSCLC and hepatocellular carcinoma. This review focuses on the fundamental concepts and the uptake mechanism of AAs, AA PET tracers and their clinical applications.

  19. A.A., constructivism, and reflecting teams.

    Science.gov (United States)

    Nevels, B

    1997-12-01

    Numerous studies and clinical anecdotes reveal a relationship between attendance at A.A. meetings and/or degree of involvement in A.A. and maintenance of sobriety. Hypotheses as to how A.A. and/or the A.A. meeting is helpful to its members have ranged from a focus on factors common to all therapy groups, to aspects of A.A. "treatment" which are behavioral in nature. Presented here is another way of understanding A.A.'s effectiveness within the frame of more recent, constructivistic approaches to family therapy. In particular, the A.A. topic meeting is compared to the reflecting team concept of Tom Anderson.

  20. [Effect of soil phenolic acids on soil microbe of coal-mining depressed land after afforestation restoration by different tree species].

    Science.gov (United States)

    Ji, Li; Yang, Li Xue

    2017-12-01

    Phenolic acids are one of the most important factors that influence microbial community structure. Investigating the dynamic changes of phenolic acids and their relationship with the microbial community structure in plantation soils with different tree species could contribute to better understanding and revealing the mechanisms of microbial community changes under afforestation restoration in coal-mining subsidence areas. In this study, plantations of three conifer and one deciduous species (Pinus koraiensis, Larix gmelinii, Pinus sylvestris var. mongolica, and Populus ussuriensis) were established on abandoned coal-mining subsidence areas in Baoshan District, Shuangyashan City. The contents of soil phenols, 11 types of phenolic acids, and microbial communities in all plots were determined. The results showed that the contents of soil complex phenol in plantations were significantly higher than that of abandoned land overall. Specifically, soils in larch and poplar plantations had higher contents of complex phenol, while soils in larch and Korean pine plantations had greater contents of total phenol. Moreover, soil in the P. koraiensis plantation had a higher content of water-soluble phenol compared with abandoned lands. The determination of 11 phenolic acids indicated that the contents of ferulic acid, abietic acid, β-sitosterol, oleanolic acid, shikimic acid, linoleic acid, and stearic acid were higher in plantation soils. Although soil phenol contents were not related with soil microbial biomass, the individual phenolic acids showed a significant relationship with soil microbes. Ferulic acid, abietic acid, and β-sitosterol showed significant promoting effects on soil microbial biomass, and they showed positive correlations with fungi and fungi/bacteria ratio. These three phenolic acids had higher contents in the poplar plantation, suggesting that poplar affo-restation had a beneficial effect on soil quality in coal-mining subsidence areas.

  1. Laboratory Astrophysics Division of the AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-01-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  2. Laboratory Astrophysics Division of The AAS (LAD)

    Science.gov (United States)

    Salama, Farid; Drake, R. P.; Federman, S. R.; Haxton, W. C.; Savin, D. W.

    2012-10-01

    The purpose of the Laboratory Astrophysics Division (LAD) is to advance our understanding of the Universe through the promotion of fundamental theoretical and experimental research into the underlying processes that drive the Cosmos. LAD represents all areas of astrophysics and planetary sciences. The first new AAS Division in more than 30 years, the LAD traces its history back to the recommendation from the scientific community via the White Paper from the 2006 NASA-sponsored Laboratory Astrophysics Workshop. This recommendation was endorsed by the Astronomy and Astrophysics Advisory Committee (AAAC), which advises the National Science Foundation (NSF), the National Aeronautics and Space Administration (NASA), and the U.S. Department of Energy (DOE) on selected issues within the fields of astronomy and astrophysics that are of mutual interest and concern to the agencies. In January 2007, at the 209th AAS meeting, the AAS Council set up a Steering Committee to formulate Bylaws for a Working Group on Laboratory Astrophysics (WGLA). The AAS Council formally established the WGLA with a five-year mandate in May 2007, at the 210th AAS meeting. From 2008 through 2012, the WGLA annually sponsored Meetings in-a-Meeting at the AAS Summer Meetings. In May 2011, at the 218th AAS meeting, the AAS Council voted to convert the WGLA, at the end of its mandate, into a Division of the AAS and requested draft Bylaws from the Steering Committee. In January 2012, at the 219th AAS Meeting, the AAS Council formally approved the Bylaws and the creation of the LAD. The inaugural gathering and the first business meeting of the LAD were held at the 220th AAS meeting in Anchorage in June 2012. You can learn more about LAD by visiting its website at http://lad.aas.org/ and by subscribing to its mailing list.

  3. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles QFW, at maximum dispersion. See also 8001372, 8001383, 8010045

  4. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The wide ones (very wide indeed: 70 cm), like the one we see here, were placed inside the vacuum chamber of the wide quadrupoles, QFW, at maximum dispersion. See also 8001372,8001383, 8010042

  5. AA, closed orbit observation pickup

    CERN Multimedia

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. See also 8001372, 8010042, 8010045

  6. AA, closed orbit observation pickup

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Electrostatic pickups around the circumference of the AA served for the measurement of the closed orbits across the wide momentum range of +- 3% to either side of central orbit. The pickups were of the "shoebox" type, with diagonal cuts, a horizontal and a vertical one mechanically coupled together. They were located where they would not require extra space. The small ones, like the one we see here, were inserted into the vacuum chamber of the BLG (long and narrow) bending magnets. Werner Sax contemplates his achievement. See also 8001383, 8010042, 8010045.

  7. Zeolite-Encapsulated Copper(II) Amino Acid Complexes: Synthesis, Spectroscopy, and Catalysis

    NARCIS (Netherlands)

    Weckhuysen, B.M.; Verberckmoes, A.A.; Fu, L.; Schoonheydt, R.A.

    1995-01-01

    The spectroscopic properties and catalytic behavior of Cu(AA)n m+ complexes (AA ) amino acid (glycine, lysine, histidine, alanine, serine, proline, tyrosine, phenylalanine, glutamine, glutamic acid, cysteine, tryptophan, leucine, and arginine)) in faujasite-type zeolites have been investigated.

  8. AAS 228: Day 3 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Wikipedia Year of Science Editathon (by Meredith Rawls)Whats your first go-to source for an unfamiliar topic on the internet? If you said Wikipedia, youre not alone. For many people, Wikipedia is the primary source of information about astronomy and science. However, many Wikipedia articles about science topics are incomplete or missing, and women are underrepresented among scientists with biographies.To address this, the AAS Astronomy Education Board teamed up with the Wiki Education Foundation to host an edit-a-thon as part of the Wikipedia Year of Science. More than forty attendees spent the better part of three hours working through tutorials, creating new articles, and editing existing ones. The session was generously sponsored by the Simons Foundation.The Year of Science initiative seeks to bring Wikipedia editing skills to the classroom and help new editors find sustainable ways to contribute to Wikipedia in the long term. Anybody can create a free account and start editing!As a first-time Wikipedia contributor, I took the time to go through nearly all the tutorial exercises and familiarize myself with the process of editing a page. I decided to flesh out one section in an existing page about asteroseismology. Others created biography pages from scratch or selected various astronomical topics to write about. To me, the editing process felt like a cross between writing a blog post and a journal article, in a hack day type environment. Working through the tutorial and some examples renewed my empathy for learners who are tackling a new skill set for the first time. A full summary of our

  9. Dietary arachidonic acid in perinatal nutrition

    DEFF Research Database (Denmark)

    Lauritzen, Lotte; Fewtrell, Mary; Agostoni, Carlo

    2015-01-01

    Arachidonic acid (AA) is supplied together with docosahexaenoic acid (DHA) in infant formulas, but we have limited knowledge about the effects of supplementation with either of these long-chain polyunsaturated fatty acids (LCPUFA) on growth and developmental outcomes. AA is present in similar lev...

  10. AAS 228: Day 1 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Come visit astrobites at the AAS booth we have swag!Things kicked off last night at our undergraduate reception booth. Thanks to all of you who stopped by we were delightedto hear from undergrads who already know and love the site, educators who want to use it in their classrooms, and students who had not yet been introduced to astrobites and were excited about a new resource!For the rest of the meeting we will be stationed at theAAS booth in the exhibit hall (booth #211-213), so drop by if you want to learn more (or pick up swag: weve got lots of stickers and sunglasses)!Mondaymorning was the official start of the meeting. Here are just a few of the talks and workshops astrobiters attended this morning.Opening Address(by Susanna Kohler)AAS President Meg Urry kicked off the meeting this morning at 8am with an overview of some of the great endeavors AAS is supporting. We astrobiters had personal motivation to drag ourselves out of bed that early: during this session, Urryannounced the new partnership between AAS and astrobites!Urry touched on some difficult topics in her welcome, including yesterdays tragedy in Orlando. Shereiteratedthe AASs support fortheCommittee for Sexual-Orientation and Gender Minorities in Astronomy (SGMA). She also reminded meeting attendees about the importance ofkeeping conference interactions professional, and pointed to the meetings anti-harassment policy.Partnership Announcement (by Michael Zevin)This morning, the American Astronomical Society announced the new partnership that it will have with Astrobites! We are beyond excited to embark on this new partnership with the

  11. Stability in fish feed and bioavailability to rainbow trout of two ascorbic acid forms

    DEFF Research Database (Denmark)

    Skelbaek, T.; Andersen, Niels Gerner; Winning, M.

    1990-01-01

    The stability in warm pelleted fish feed and the bioavailability to rainbow trout of crystalline ascorbic acid (AA) and a synthetic polymer-coated AA product (PCAA) were compared. The AA loss during pelleting was 29% for crystalline AA and 19% for PCAA. After 6 weeks at room temperature 73% of PCAA...

  12. Enforcement of the ban on aristolochic acids in Chinese traditional herbal preparations on the Dutch market

    NARCIS (Netherlands)

    Martena, M.J.; Wielen, van der J.C.A.; Laak, van de L.F.J.; Konings, E.J.M.; Groot, de H.N.; Rietjens, I.M.C.M.

    2007-01-01

    In traditional chinese medicine several Aristolochia species are used. Aristolochia spp. contain a mixture of aristolochic acids (AAs), mainly AA I and AA II which are nephrotoxicants and carcinogens. After AA-related nephropathy (AAN) and urothelial cancer were described in female patients in

  13. (PCL/AA) hydrogel for controlled drug delivery

    Indian Academy of Sciences (India)

    Administrator

    PCL-g-AA) on the .... Solvent replacement method was used for porosity meas- urement. Weighed dried discs were immersed in .... Regression coefficient (r) values obtained from PCL/AA hydrogels at varying contents of AA and EGDMA are.

  14. Risk assessment of plant food supplements and other herbal products containing aristolochic acids using the margin of exposure (MOE) approach

    NARCIS (Netherlands)

    Abdullah, Rozaini; Diaz, Leolean Nyle; Wesseling, Sebas; Rietjens, Ivonne M.C.M.

    2016-01-01

    After the incidences of induction of aristolochic acid nephropathy after consumption of herbal weight loss preparations that accidentally contained aristolochic acids (AAs), several countries defined national restrictions on the presence of AAs in food, including plant food supplements (PFS) and

  15. Carbon-11 and Fluorine-18 Labeled Amino Acid Tracers for Positron Emission Tomography Imaging of Tumors

    Science.gov (United States)

    Sun, Aixia; Liu, Xiang; Tang, Ganghua

    2017-12-01

    Tumor cells have an increased nutritional demand for amino acids(AAs) to satisfy their rapid proliferation. Positron-emitting nuclide labeled AAs are interesting probes and are of great importance for imaging tumors using positron emission tomography (PET). Carbon-11 and fluorine-18 labeled AAs include the [1-11C] amino acids, labeling alpha-C- amino acids, the branched-chain of amino acids and N-substituted carbon-11 labeled amino acids. These tracers target protein synthesis or amino acid(AA) transport, and their uptake mechanism mainly involves AA transport. AA PET tracers have been widely used in clinical settings to image brain tumors, neuroendocrine tumors, prostate cancer, breast cancer, non–small cell lung cancer (NSCLC) and hepatocellular carcinoma. This review focuses on the fundamental concepts and the uptake mechanism of AAs, AA PET tracers and their clinical applications.

  16. Construction and characterization of the interdomain chimeras using Cry11Aa and Cry11Ba from Bacillus thuringiensis and identification of a possible novel toxic chimera.

    Science.gov (United States)

    Sun, Yunjun; Zhao, Qiang; Zheng, Dasheng; Ding, Xuezhi; Wang, Jingfang; Hu, Quanfang; Yuan, Zhiming; Park, Hyun-Woo; Xia, Liqiu

    2014-01-01

    Three structural domains of mosquitocidal Cry11Aa and Cry11Ba from Bacillus thuringiensis were exchanged to produce interdomain chimeras [BAA (11Ba/11Aa/11Aa), ABA (11Aa/11Ba/11Aa), AAB (11Aa/11Aa/11Ba), ABB (11Aa/11Ba/11Ba), BAB (11Ba/11Aa/11Ba), BBA (11Ba/11Ba/11Aa]. Chimeras BAB, BAA, BBA, and AAB formed inclusion bodies in the crystal-negative B. thuringiensis host and produced expected protein bands on SDS-PAGE gel. However, no inclusion body or target protein could be found for chimeras ABA and ABB. In bioassays using the fourth-instar larvae of Culex quinquefasciatus and Aedes aegypti, AAB had ~50 % lethal concentrations of 4.8 and 2.2 μg ml(-1), respectively; however, the rest of chimeras were not toxic. This study thus helps to understand the domain-function relationships of the Cry11Aa and Cry11Ba toxins. The toxic chimera, AAB, might be a candidate for mosquito control as its amino acid sequence is different from the two parental toxins.

  17. Dependence of intestinal amino acid uptake on dietary protein or amino acid levels

    International Nuclear Information System (INIS)

    Karasov, W.H.; Solberg, D.H.; Diamond, J.M.

    1987-01-01

    To understand how intestinal amino acid (AA) transport is regulated by dietary substrate levels, the authors measured uptake of seven radioactively-labelled AAs and glucose across the jejunal brush-border membrane of mice kept on one of three isocaloric rations differing in nitrogen content. In the high-protein ration, uptake increased by 77-81% for the nonessential, less toxic AAs, proline, and aspartate but only by 32-61% for the more toxic essential AAs tested. In the nitrogen-deficient ration, uptake decreased for the nonessential aspartate and proline but stayed constant or increased for essential AAs and for the nonessential alanine. These patterns imply independent regulation of the intestine's various AA transporters. With decreasing dietary AA (or protein), the imino acid and acidic AA private transporters are repressed, while activities of the basic AA transporter and the neutral AA public transporter decrease to an asymptote or else go through a minimum. These regulatory patterns can be understood as a compromise among conflicting constraints imposed by protein's multiple roles as a source of calories, nitrogen, and essential AAs and by the toxicity of essential AAs at high concentrations

  18. Structural evidence for the DPPH radical-scavenging mechanism of 2-O-α-d-glucopyranosyl-l-ascorbic acid.

    Science.gov (United States)

    Tai, Akihiro; Iomori, Atsuko; Ito, Hideyuki

    2017-10-15

    2-O-α-d-Glucopyranosyl-l-ascorbic acid (AA-2G) exhibits biological activities after enzymatic hydrolysis to ascorbic acid (AA) by α-glucosidase. We have found that AA-2G per se exerted radical-scavenging activity toward 1,1-diphenyl-2-picrylhydrazyl radical (DPPH radical). The radical-scavenging property of AA-2G was greatly different from that of AA; that is, the reaction rate with DPPH radical of AA-2G was far slower than that of AA, but the long-lasting radical-scavenging ability per one molecule of AA-2G was superior to that of AA. We purified key intermediates for the characteristic radical-scavenging reaction of AA-2G and carried out time-course studies of the radical-scavenging reactions of the intermediates, AA-2G and AA to determine both the reaction rate and stoichiometry of AA-2G with DPPH radical. One mole of AA-2G quenched 2.7mol of DPPH radical over a period of 120min, while one mole of AA quenched 1.9mol of the radical. The high reaction stoichiometry of AA-2G against DPPH radical was associated with adduct formation of AA-2G with DPPH radical. The radical-scavenging reaction mechanism of AA-2G consists of the following three steps: (1) At an early stage of the reaction, AA-2G scavenged DPPH radical to generate AA-2G radical, (2) AA-2G radical immediately reacted with an additional DPPH radical to give two types of AA-2G-DPPH adducts and (3) AA-2G-DPPH adducts slowly quenched the other DPPH radical to generate several reaction products. Our results suggest the practical value of AA-2G, even before being converted into AA, as a beneficial antioxidant in food and cosmetic applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Supplementation with a powdered blend of PUFAs normalizes DHA and AA levels in patients with PKU.

    Science.gov (United States)

    Jans, Judith J; de Sain-van der Velden, Monique G M; van Hasselt, Peter M; van den Hurk, Dorine T A M; Vaz, Frederic M; Visser, Gepke; Verhoeven-Duif, Nanda M

    2013-06-01

    Patients with phenylketonuria (PKU) have a poor LC-PUFA status and require supplementation. The objective of this study was to evaluate the LC-PUFA status of PKU patients supplemented with fish oil or the fatty acid supplement KeyOmega. Plasma and erythrocyte docosahexaenoic acid (DHA) and arachidonic acid (AA) levels were determined in 54 patients (1-18.5years of age) with confirmed PKU. The influence of supplementation with fish oil versus KeyOmega, a powdered blend of DHA and AA, on LC-PUFA status was investigated and compared to the status in samples obtained from unsupplemented patients. Differential effects on LC-PUFA status were observed upon suppletion with fish oil versus KeyOmega. Whereas supplementation with fish oil increased the level of DHA, the AA concentration did not increase to normal values in these patients. In contrast, both DHA and AA levels increased and reached reference values upon supplementation with KeyOmega. these results indicate that KeyOmega offers additional benefit over fish oil since both AA and DHA status are normalized in PKU patients supplemented with KeyOmega. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.56 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are too numerous to name them all, but the 3 most prominent ones are at the centre (left to right): Roy Billinge (Joint AA Project Leader, with his hand on the control box), Eifionydd Jones (white shirt), Simon van der Meer (spiritus rector and Joint AA Project Leader). The first antiprotons were injected, made to circulate and cooled soon after, on 14 July 1980.

  1. AAS 228: Day 3 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session 2015 Newton Lacy Pierce Prize Lecture: The Elephant in the Room: Effects of Distant, Massive Companions on Planetary System Architectures (by Leonardo dos Santos)The first session on Wednesday at 228th AAS Meeting was the Newton Lacy Pierce Prize Lecture by Heather Knutson (California Institute of Technology). This talk featured a broad range of research efforts on exoplanets, with the main focus on how we study the composition of their atmospheres, and how multi-body interactions carve the structure of the planetary systems we observe.One of her first points is the well-known idea that the Solar System is an oddball, compared to the exoplanet systems we have found so far: most of these systems contain hot Jupiters and mini-Neptunes at very close-in orbits around their host stars. Moreover, even when studying their transmission spectra, it is difficult to know the exact composition of their atmospheres.Knutson: it is difficult to constrain atmospheric composition of exoplanets (H-poor or H-rich+clouds?) #aas228pic.twitter.com/LdyN4o9RC7 astrobites (@astrobites) June 15, 2016The main proposal on how these systems formed is the migration scenario. In order to validate this idea, Dr. Knutson and her group The Friends of Hot Jupiters study systems with close-in gas giants and their frequency of binary companions, which are supposed to be the main culprits causing gas-giant migration. They found that approximately half of the observed systems have long-distance companions, providing strong validation of the migration scenario. Moreover, Dr. Knutson speculates that wide binaries have more

  2. The influence of supplemental docosahexaenoic and arachidonic acids during pregnancy and lactation on neurodevelopment at eighteen months

    NARCIS (Netherlands)

    van Goor, Saskia A.; Dijck-Brouwer, D. A. Janneke; Erwich, Jan Jaap H. M.; Schaafsma, Anne; Hadders-Algra, Mijna

    2011-01-01

    Docosahexaenoic acid (DHA) and arachidonic acid (AA) are important for neurodevelopment. The effects of DHA (220 mg/day, n=41), DHA+AA (220 mg/day, n=39) or placebo (n=34) during pregnancy and lactation on neurodevelopment at 18 months, and the relations between umbilical cord DHA, AA and Mead acid

  3. AA/12-lipoxygenase signaling contributes to inhibitory learning in Hermissenda Type B photoreceptors

    Directory of Open Access Journals (Sweden)

    Tony L Walker

    2010-08-01

    Full Text Available Conditioned inhibition (CI is a major category of associative learning that occurs when an organism learns that one stimulus predicts the absence of another. In addition to being important in its own right, CI is interesting because its occurrence implies that the organism has formed an association between stimuli that are non-coincident. In contrast to other categories of associative learning that are dependent upon temporal contiguity (pairings of stimuli, the neurobiology of CI is virtually unexplored. We have previously described a simple form of CI learning in Hermissenda, whereby animals’ phototactic behavior is increased by repeated exposures to explicitly unpaired (EU presentations of light and rotation. EU conditioning also produces characteristic reductions in the excitability and light response, and increases several somatic K+ currents in Type B photoreceptors. Type B photoreceptors are a major site of plasticity for classical conditioning in Hermissenda. Because arachidonic acid (AA and/or its metabolites open diverse K+ channels in many cell types, we examined the potential contribution of AA to CI. Our results indicate that AA contributes to one of the major effects of EU-conditioning on Type B photoreceptors: decreases in light-evoked spike activity. We find that AA increases the transient (IA somatic K+ current in Type B photoreceptors, further mimicking CI training. In addition, our results indicate that metabolism of AA by a 12-lipoxygenase enzyme is critical for these effects of AA, and further that 12-lipoxygenase metabolites are apparently generated during CI training.

  4. AAS 228: Day 1 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session: From Space Archeology to Serving the World Today: A 20-year Journey from the Jungles of Guatemala to a Network of Satellite Remote Sensing Facilities Around the World(by Michael Zevin)In the conferences second plenary session, NASAs Daniel Irwin turned the eyes of the conference back to Earth by highlighting the huge impact that NASA missions play in protecting and developing our own planet.Daniel Irwin: using satellite imagery to detect differences in vegetation and find ancient Mayan cities. #aas228 pic.twitter.com/9LFPQdCHTM astrobites (@astrobites) June 13, 2016Irwin came to be involved in NASA through his work mapping Guatemalan jungles, where he would spend 22 days at a time exploring the treacherous jungles on foot armed with a 1st generation GPS, a compass, and a machete. A colleague introduced Irwin to the satellite imagery thathe was exploring, demonstratinghow these images are a strong complement to field work. The sharing of this satellite data with nearby villages helped to show the encroachment of agriculture and the necessity of connecting space to the village. Satellite imagery also played a role in archeological endeavors, uncovering dozens of Mayan cities that have been buried for over a millennia by vegetation, and it provided evidence that the fall of the Mayan civilization may have been due to massive deforestation that ledto drought.Glacial retreat in Chile imaged by ISERV.Irwin displayed the constellation of NASAs Earth-monitoring satellites that have played an integral role in conserving our planet and alerting the world of natural disasters. He also showed

  5. pH regulates pore formation of a protease activated Vip3Aa from Bacillus thuringiensis.

    Science.gov (United States)

    Kunthic, Thittaya; Watanabe, Hirokazu; Kawano, Ryuji; Tanaka, Yoshikazu; Promdonkoy, Boonhiang; Yao, Min; Boonserm, Panadda

    2017-11-01

    Vip3Aa insecticidal protein is produced from Bacillus thuringiensis and exerts a broad spectrum of toxicity against lepidopteran insect species. Although Vip3Aa has been effectively used as part of integrated pest management strategies, the mechanism of the toxin remains unclear. Here, we investigated the effect of pH in a range from 5.0 to 10.0 on the pore-forming activity of the trypsin activated Vip3Aa (actVip3Aa) by in vitro pore-forming assays. Based on calcein release assay, actVip3Aa could permeabilize the artificial neutral liposomes under all the pH tested, except pH10.0. The maximum membrane permeability of actVip3Aa was detected at pH8.0 and the permeability decreased and abolished when exposing to acidic and alkaline conditions, respectively. The planar lipid bilayer experiment revealed that actVip3Aa formed ion channels at pH5.0-8.0 but no current signals were detected at pH10.0, consistent with the observation from calcein release assay. The toxin formed ion channels with a diameter of 1.4nm at pH8.0 and pore size was gradually decreased when reducing the pH. This study provided a view of the molecular mechanism of Vip3Aa by which the pore-forming activity is regulated by pH. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Inhibition of platelet aggregation by diterpene acids from Pinus massoniana resin.

    Science.gov (United States)

    Cheung, H T; Fu, S L; Smal, M A

    1994-01-01

    The acidic fraction of the resin of Pinus massoniana Lamb. from China was converted to the p-nitrophenyl esters, and the esters separated by chromatography. The separated p-nitrophenyl esters were individually hydrolysed by potassium hydroxide in acetone-water at room temperature to 8 diterpene acids of the pimarane and abietane groups: pimaric acid (8(14),15-pimaradien-18-oic acid) (1), levopimaric acid (8(14),12-abietadien-18-oic acid) (2), palustric acid (8,13-abietadien-18-oic acid) (3), neobietic acid (8(14),13(15)-abietadien-18-oic acid) (4), abietic acid (7,13-abietadien-18-oic acid) (5), dehydroabietic acid (8,11,13-abietatrien-18-oic acid) (6), 7-oxodehydroabietic acid (7-oxo-8,11,13-abietatrien-18-oic acid) (7) and 7 alpha-hydroxydehydroabietic acid (7 alpha-hydroxy-8,11,13-abietatrien-18-oic acid) (8). The structure (and stereochemistry) of the diterpene acids were substantiated by nuclear magnetic resonance spectroscopy (proton and carbon-13, one and two dimensional), by mass spectrometry (electron impact and methane chemical ionization) and by rotation measurements. The 8 diterpene acids were tested for their ability to inhibit the aggregation of washed rabbit platelets induced by platelet activating factor (PAF), adenosine diphosphate (ADP) and by calcium ionophore A23187. With platelet aggregation induced by the latter two agonists, activities comparable with or higher than linolenic acid were given by the first 4 acids. With aggregation induced by PAF, the first 3 acids show activity, but at a level significantly lower than that of linolenic acid. Levopimaric acid has the highest activity among the diterpene acids tested. It is proposed that this activity is related to the folded shape of the molecule.

  7. Magnetic horn of the Antiproton Accumulator (AA)

    CERN Multimedia

    Photographic Service

    1988-01-01

    In the 1960s, the invention of this "current sheet lens" has helped to greatly improve the flux of neutrino beams. It was used again at the AA, collecting antiprotons from the production target at angles too large to fit into the acceptance of the AA. It was machined from aluminium to a thickness of 1.4 mm and pulsed at 400 kA for 15 microseconds (half-sine).

  8. Metabolism of eicosapentaenoic acid relative to arachidonic acid in the phospholipids of human platelets

    Energy Technology Data Exchange (ETDEWEB)

    Weaver, B.J.

    1987-01-01

    The platelet phospholipids of human subjects consuming fish or fish oil contain decreased levels of arachidonic acid (AA) and increased levels of eicosapentaenoic acid (EPA). Furthermore, the ratio of AA/EPA in phosphatidylcholine (PC) is much lower than that in phosphatidylinositol (PI). This thesis examines the metabolic and remodeling pathways for fatty acid selectivity which might account for the decrease in arachidonate and the differences in AA/EPA ratios among the individual phospholipids PC, PI, phosphatidylethanolamine (PE), and phosphatidylserine (PS). The incorporation of AA and EPA into the phospholipids of washed human platelets and human platelet microsomes was studied using radiolabeled fatty acids ((/sup 14/C)AA alone or (/sup 3/H)AA plus (/sup 14/C)EPA).

  9. Preparation and Characteristics of Corn Straw-Co-AMPS-Co-AA Superabsorbent Hydrogel

    Directory of Open Access Journals (Sweden)

    Wei-Min Cheng

    2015-11-01

    Full Text Available In this study, the corn straw after removing the lignin was grafted with 2-acrylamido-2-methylpropanesulfonic acid (AMPS to prepare sulfonated cellulose. The grafting copolymerization between the sulfonated cellulose and acrylic acid (AA was performed using potassium persulfate and N,N′-methylenebisacrylamide as the initiator and crosslinking agent, respectively, to prepare corn straw-co-AMPS-co-AA hydrogels. The structure and properties of the resulting hydrogels were characterized by Fourier transform infrared spectroscopy, X-ray diffraction, scanning electron microscopy, thermogravimetric analysis, and dynamic rheometry. The effects of initiator, crosslinker, monomer neutralization degree, and temperature on the swelling ratio of the hydrogels were studied. The water retention, salt resistance, and recyclability of the corn straw-co-AMPS-co-AA hydrogels were also investigated. The optimum water absorptivity of the corn straw hydrogels was obtained at a polymerization temperature of 50 °C with 1.2% crosslinker, 1:7 ratio of the pretreated corn straw and AA, 2% initiator, and 50% neutralized AA.

  10. Molecular cloning and functional analysis of Growth arrest and DNA damage-inducible 45 aa and ab (Gadd45aa and Gadd45 ab) in Ctenopharyngodon idella.

    Science.gov (United States)

    Fang, Yuan; Xu, Xiao-Yan; Shen, Yubang; Li, Jiale

    2018-03-29

    The Gadd45aa and Gadd45 ab genes are members of the Gadd45 family, which are critically involved in immunological and apoptosis functions. In this study, we isolated and characterized Gadd45aa and Gadd45 ab cDNA from grass carp (Ctenopharyngodon idella) (designated CiGadd45aa and CiGadd45 ab). The CiGadd45aa and CiGadd45 ab fragments spanned 1272 bp/1248 bp, which contained 474 bp/480 bp open reading frames encoding 157/159 amino acid proteins. BLAST analysis revealed that CiGadd45aa and CiGadd45 ab shared high similarity with known Gadd45a sequences. qRT-PCR analysis showed widespread and abundant expression of CiGadd45aa in gill, intestine, kidney, brain, blood, skin and fin, but low in liver, spleen, head kidney, heart, and muscle. CiGadd45 ab was expressed highly in liver, spleen and blood but at low levels in gill, intestine, kidney, head kidney, heart, brain, skin, muscle, and fin. Following challenge of grass carp with Aeromonas hydrophila, CiGadd45aa and CiGadd45 ab expression was upregulated. In immune-relevant tissues and MAPK family genes (p38, JNK and ERK) were upregulated by CiGadd45aa and CiGadd45 ab overexpression and partly downregulated by interfered in the CIK grass carp kidney cell line. In addition, transcription of the cytokine-encoding il-8 gene was upregulated/downregulated by CiGadd45aa and CiGadd45 ab overexpression and interference. These results suggest that CiGadd45aa and CiGadd45 ab play roles in innate immune responses against A. hydrophila in grass carp. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Obesity is a significant susceptibility factor for idiopathic AA amyloidosis.

    Science.gov (United States)

    Blank, Norbert; Hegenbart, Ute; Dietrich, Sascha; Brune, Maik; Beimler, Jörg; Röcken, Christoph; Müller-Tidow, Carsten; Lorenz, Hanns-Martin; Schönland, Stefan O

    2018-01-24

    To investigate obesity as susceptibility factor in patients with idiopathic AA amyloidosis. Clinical, biochemical and genetic data were obtained from 146 patients with AA amyloidosis. Control groups comprised 40 patients with long-standing inflammatory diseases without AA amyloidosis and 56 controls without any inflammatory disease. Patients with AA amyloidosis had either familial Mediterranean fever (FMF) or long-standing rheumatic diseases as underlying inflammatory disease (n = 111, median age 46 years). However, in a significant proportion of patients with AA amyloidosis no primary disease was identified (idiopathic AA; n = 37, median age 60 years). Patients with idiopathic AA amyloidosis were more obese and older than patients with AA amyloidosis secondary to FMF or rheumatic diseases. Serum leptin levels correlated with the body mass index (BMI) in all types of AA amyloidosis. Elevated leptin levels of more than 30 µg/l were detected in 18% of FMF/rheumatic + AA amyloidosis and in 40% of patients with idiopathic AA amyloidosis (p = .018). Finally, the SAA1 polymorphism was confirmed as a susceptibility factor for AA amyloidosis irrespective of the type of the disease. Obesity, age and the SAA1 polymorphism are susceptibility factors for idiopathic AA amyloidosis. Recent advances in treatment of FMF and rheumatic disorders will decrease the incidence of AA amyloidosis due to these diseases. Idiopathic AA, however, might be an emerging problem in the ageing and increasingly obese population.

  12. AAS 228: Day 2 afternoon

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.The Limits of Scientific Cosmology: Setting the Stage: Accepted Facts, and Testing Limitations in Theory and Data (by Gourav Khullar)With a stellar lineup of speakers to talk about current and future prospects of cosmology and its limits (or lack thereof), the first session kicked off with talks by Risa Wechsler, Joseph Silk, and Sean Carroll (his talk on Multiverses is described below, by Nathan Sanders). Risa set the stage with an elaborate description of the current accepted facts in the era of precision cosmology including the standard model of concordance cosmology, described by seven parameters and an accepted Lambda-CDM paradigm (with a cosmological constant and cold dark matter). The talk stressed on the fact that all these parameters are understood to a percent order precision, which is a remarkable deviation from the time in 1990s when according to Risa, Alan Guth never thought that any of these numbers could be measured precisely!Risa Wechsler describing our current constraints on what Dark Matter could constitute.Joseph Silk discussing limits on cosmological parameters.The CMB measurements, Big Bang Nucleosynthesis estimates and galaxy clustering statistics all contribute to locking down the description of our universe. She emphasized on the tensions between different probes to measure expansion rate H0 of the universe, and small scale predictions of cold dark matter simulations, but she is hopeful that these shall be resolved eventually. Joe Silk followed this up with his interpretation of trying to understand our place in the universe and placing limits on different parameters and

  13. Inorganic arsenic - SPE HG-AAS method for RICE tested in-house and collaboratively

    DEFF Research Database (Denmark)

    Rasmussen, Rie Romme; Qian, Yiting; Sloth, Jens Jørgen

    and DMA) was done by off-line solidphase extraction (SPE) followed by hydride generation atomic absorption spectrometry (HG-AAS) detection. Water bath heating (90 °C, 60 min) of samples with dilute nitric acid and hydrogen peroxide solubilised and oxidized all iAs to arsenate (AsV). Loading of buffered...... reference samples. The limit of detection was 0.02 mg/kg, and repeatability and intra-laboratory reproducibility were less than 6 and 9 %, respectively. The SPE HG-AAS method produced similar results compared to parallel high-performance liquid chromatography coupled to inductively coupled plasma mass...

  14. The AA disappearing under concrete shielding

    CERN Multimedia

    CERN PhotoLab

    1982-01-01

    When the AA started up in July 1980, the machine stood freely in its hall, providing visitors with a view through the large window in the AA Control Room. The target area, in which the high-intensity 26 GeV/c proton beam from the PS hit the production target, was heavily shielded, not only towards the outside but also towards the AA-Hall. However, electrons and pions emanating from the target with the same momentum as the antiprotons, but much more numerous, accompanied these through the injection line into the AA ring. The pions decayed with a half-time corresponding to approximately a revolution period (540 ns), whereas the electrons lost energy through synchrotron radiation and ended up on the vacuum chamber wall. Electrons and pions produced the dominant component of the radiation level in the hall and the control room. With operation times far exceeding original expectations, the AA had to be buried under concrete shielding in order to reduce the radiation level by an order of magnitude.

  15. AAS 228: Day 2 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    Editors Note:This week were at the 228th AAS Meeting in San Diego, CA. Along with a team ofauthors from astrobites.com, I will bewritingupdates on selectedevents at themeeting and posting twiceeach day. Follow along here or atastrobites.com, or catch ourlive-tweeted updates from the@astrobites Twitter account. The usual posting schedule for AAS Nova will resumenext week.Plenary Session (Day 1) The Galaxy Zoo(by Benny Tsang)Galaxy Zoo was so hot that the servers hosting the galaxy images got melted down soon after being launched.Kevin Schawinski from ETH Zurich took us on a tour ofhis wonderful Galaxy Zoo. It is a huge zoo with about a quarter million zookeepers, they are citizen astronomers who collaboratively classify galaxies by their looks as an attempt to understand galaxy evolution. The big question that is being answered is: how do blue, actively star-forming galaxies evolve into red, quiescent (non-star-forming) galaxies? The Zoo helped reveal that blue galaxies turn into red galaxies via two possible paths galaxies might run out of supply of gas and shut off star formation slowly; or they could merge with one another and turn off star formation by destroying the gas reservoir rapidly!The Galaxy Zoo project also led to the discoveries of:Green Peas: they are the living fossils of galaxy evolution; compact, bright, green galaxies that are actively forming starsOverlapping galaxies: they are pairs of galaxies that are separated physically but happen to lie on the same line of sight; they provide excellent laboratories for studying dust extinctionHannys Voorwerp: an unusual object named after Hanny the discoverer, which is believed to be the first detection of quasar light echoThe idea of Galaxy Zoo in getting help from citizen scientists was further extended into an award-winningproject known as the Zooniverse, which is an online platform for streamlined crowd-sourcing for scientific research that requires human input. The future of astronomy is going to be

  16. Detection of AA76, a Common Form of Amyloid A Protein, as a Way of Diagnosing AA Amyloidosis.

    Science.gov (United States)

    Sato, Junji; Okuda, Yasuaki; Kuroda, Takeshi; Yamada, Toshiyuki

    2016-01-01

    Reactive amyloid deposits consist of amyloid A (AA) proteins, the degradation products of serum amyloid A (SAA). Since the most common species of AA is the amino terminal portion produced by cleavage between residues 76 and 77 of SAA (AA76), the presence of AA76 in tissues could be a consequence of AA amyloid deposition. This study assessed the diagnostic significance of the detection of AA76 for AA amyloidosis using two different approaches. Biopsy specimens (n=130 from 54 subjects) from gastroduodenal mucosa or abdominal fat (n=9 from 9 subjects) of patients who had already been diagnosed with or were suspected of having AA amyloidosis were used. Fixed mucosal sections were subjected to immunohistochemistry using a newly developed antibody recognizing the carboxyl terminal end of AA76 (anti-AA76). The non-fixed materials from gastroduodenal mucosa or abdominal fat were subjected to immunoblotting for detection of the size of AA76. Among the gastroduodenal specimens (n=115) from already diagnosed patients, the positive rates of Congo red staining, immunohistochemistry using anti-AA76, and immunoblotting were 68.4%, 73.0%, and 92.2%, respectively. The anti-AA76 did not stain the supposed SAA in the blood or leakage, which was stained by anti-SAA antibody. AA76 was not detected either by immunohistochemistry or by immunoblot in the materials from patients in whom AA amyloidosis had been ruled out. In the abdominal fat, the immunoblot detected AA76 in 8 materials from 8 already diagnosed patients and did not in 1 patient whose gastroduodenal mucosa was negative. In conclusion, the detection of AA76 may alter the ability to diagnose AA amyloidosis. In immunohistochemistry for fixed specimens, the new anti-AA76 antibody can improve the specificity. Immunoblot for non-fixed materials, which can considerably improve the sensitivity, should be beneficial for small materials like abdominal fat. © 2016 by the Association of Clinical Scientists, Inc.

  17. Determining the Optimum Dietary Tryptophan to Lysine Ratio in Growing Pigs Fed Diets Formulated with Hhigher Levels of Other Essential Amino Acids

    Science.gov (United States)

    Studies on amino acid (AA) ratios require the first limiting AA (generally Lys) to be set below the requirement estimate. Graded levels of the AA being investigated are then fed to determine the required ratio. Essential AA (EAA) not under investigation are often set at their presumed requirement ra...

  18. Dicty_cDB: FC-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA02Q.Seq.d/ Representative seq. ID FC-AA...02Z (Link to Original site) Representative DNA sequence >FC-AA02 (FC-AA02Q) /CSM/FC/FC-AA/FC-AA02Q.Seq.d/ XXXXXXXXXXCAAAAA...GGCTCCTGGTCCGGAAGGATTGGGTAATCATTTGAATTTCCTAC GTAACTGGGCTTGATCTTTGTAATTATTGATCATAAACGAGGAATTCCTTGTAAGCGTAA

  19. Dicty_cDB: FCL-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA04 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA04Z ...(Link to Original site) - - FCL-AA04Z 530 - - - - Show FCL-AA04 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA04Q.Seq.d/ Representative seq. ID FCL-AA...04Z (Link to Original site) Representative DNA sequence >FCL-AA04 (FCL-AA04Q) /CSM/FCL/FCL-AA/FCL-AA...04Q.Seq.d/ XXXXXXXXXXCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTTCAGTCAAAGAAATT AAAAGAGGTATGGTCGCTGGTGACTCCAAAAACGATCCACCACAAGAAA

  20. Dicty_cDB: FCL-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA03 (Link to dictyBase) - - - Contig-U15092-1 FCL-AA03E ...(Link to Original site) - - - - - - FCL-AA03E 627 Show FCL-AA03 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA03Q.Seq.d/ Representative seq. ID FCL-AA...03E (Link to Original site) Representative DNA sequence >FCL-AA03 (FCL-AA03Q) /CSM/FCL/FCL-AA/FCL-AA...03Q.Seq.d/ ACATAATGTTCCAAAAGAAAGCAATTGTTATTGATGGCAAAGGTCATTTGTTAGGTCGTT TAGCCTCCGTTGTTGCTAAATCCCTCCTCTCTGGTCAAAA

  1. Dicty_cDB: FCL-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA09 (Link to dictyBase) - - - Contig-U16453-1 FCL-AA09F ...(Link to Original site) FCL-AA09F 485 - - - - - - Show FCL-AA09 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ Representative seq. ID FCL-AA...09F (Link to Original site) Representative DNA sequence >FCL-AA09 (FCL-AA09Q) /CSM/FCL/FCL-AA/FCL-AA09Q.Seq.d/ GACAA...AAGTAAATAAAACATGTCCGCAAGTAATAAAGATGACCAACTCATGAAAAATGAG TTCGAAAGTACCTACGACAAAATTGTCGATTCATTCGACAA

  2. Dicty_cDB: FCL-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA08 (Link to dictyBase) - - - Contig-U16200-1 FCL-AA08Z ...(Link to Original site) - - FCL-AA08Z 574 - - - - Show FCL-AA08 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA08Q.Seq.d/ Representative seq. ID FCL-AA...08Z (Link to Original site) Representative DNA sequence >FCL-AA08 (FCL-AA08Q) /CSM/FCL/FCL-AA/FCL-AA...08Q.Seq.d/ XXXXXXXXXXTCGAAGCCAAAGGTCGTCTCGAAGAAGAATTCCATCGCTCGTACCAACTC TGATCGTTCAAGAAAGAGACTCGAAGCTGAAA

  3. Dicty_cDB: FCL-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA10 (Link to dictyBase) - - - Contig-U16455-1 FCL-AA10Z ...(Link to Original site) - - FCL-AA10Z 627 - - - - Show FCL-AA10 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA10Q.Seq.d/ Representative seq. ID FCL-AA...10Z (Link to Original site) Representative DNA sequence >FCL-AA10 (FCL-AA10Q) /CSM/FCL/FCL-AA/FCL-AA...10Q.Seq.d/ XXXXXXXXXXTAAACCAGGTATGGTCGTCACCTTTTGCCCCAGCTGGTCTCTCAACTGAA GTCAAATCAGTCGAAATGCATCACGAACAACTCCCAGAA

  4. Dicty_cDB: FC-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA01 (Link to dictyBase) - - - Contig-U15084-1 FC-AA01E (Li...nk to Original site) - - - - - - FC-AA01E 701 Show FC-AA01 Library FC (Link to library) Clone ID FC-AA01 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA01Q.Seq.d/ Representative seq. ID FC-AA...01E (Link to Original site) Representative DNA sequence >FC-AA01 (FC-AA01Q) /CSM/FC/FC-AA/FC-AA01Q.Seq.d/ GAGAAATATTTCTTATTAA...CAATTGCATGCGTTGTATTCAACCCAACATGGTGGAATATT ACAGCAAGAATGGAATATAATGCTAATAAATAACAACCATTTTCTTTACTTCCACAAA

  5. Dicty_cDB: FC-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA20 (Link to dictyBase) - - - Contig-U16455-1 FC-AA20Z (Li...nk to Original site) - - FC-AA20Z 607 - - - - Show FC-AA20 Library FC (Link to library) Clone ID FC-AA20 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA20Q.Seq.d/ Representative seq. ID FC-AA...20Z (Link to Original site) Representative DNA sequence >FC-AA20 (FC-AA20Q) /CSM/FC/FC-AA/FC-AA20Q.Seq....d/ XXXXXXXXXXCTTTGCCCCAGCTGGTCTCTCAACTGAAGTCAAATCAGTCGAAATGCATC ACGAACAACTCCCAGAAGCCCGTCCAGGTGACAATGTAGGTTTCAACGTTAAAAACGTTT CAGTCAA

  6. Dicty_cDB: FC-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA13 (Link to dictyBase) - - - Contig-U15674-1 FC-AA13Z (Li...nk to Original site) - - FC-AA13Z 528 - - - - Show FC-AA13 Library FC (Link to library) Clone ID FC-AA13 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA13Q.Seq.d/ Representative seq. ID FC-AA...13Z (Link to Original site) Representative DNA sequence >FC-AA13 (FC-AA13Q) /CSM/FC/FC-AA/FC-AA13Q.Seq.d/ XXXXXXXXXXAAAGCAAA...CTCGTGCTGGTCAACGTACCCGTTTCAAGGCTTTCGTCGTTG TTGGTGATCACAACGGTCATGTAGGTCTCGGTGTTAAATGCGCTAAGGAA

  7. Dicty_cDB: FCL-AA02 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA02 (Link to dictyBase) - - - Contig-U16560-1 FCL-AA02F ...(Link to Original site) FCL-AA02F 620 - - - - - - Show FCL-AA02 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ Representative seq. ID FCL-AA...02F (Link to Original site) Representative DNA sequence >FCL-AA02 (FCL-AA02Q) /CSM/FCL/FCL-AA/FCL-AA02Q.Seq.d/ ATTAA...ATACAAAATACAAATACAAATAACAAATACTTTACTATAGCTTTTTTTTCTTATT TATTTCTCCAAATAATTTTTTAATATGCAAATCTTTGTTAAAA

  8. Dicty_cDB: FCL-AA24 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA24 (Link to dictyBase) - - - Contig-U16467-1 FCL-AA24E ...(Link to Original site) - - - - - - FCL-AA24E 779 Show FCL-AA24 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA24Q.Seq.d/ Representative seq. ID FCL-AA...24E (Link to Original site) Representative DNA sequence >FCL-AA24 (FCL-AA24Q) /CSM/FCL/FCL-AA/FCL-AA...24Q.Seq.d/ CTAGAAATTTCTAAACAATTATTTATTTGAAGAGGTTTTTTAAAAAAAGAAAAAAATCAG AGCATCCAAATAATAACCGCAGTAAGGGGGGGATGGTTGTTAA

  9. Dicty_cDB: FCL-AA20 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA20 (Link to dictyBase) - - - Contig-U15052-1 FCL-AA20E ...(Link to Original site) - - - - - - FCL-AA20E 1159 Show FCL-AA20 Library FCL (Link to library) Clone ID FCL-AA...L http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ Representative seq. ID FCL-AA...20E (Link to Original site) Representative DNA sequence >FCL-AA20 (FCL-AA20Q) /CSM/FCL/FCL-AA/FCL-AA20Q.Seq.d/ AAAA...CATTTACAAATGATGACCACAGAAGATGTACAACCAATTGAAACTACCAAAGATGG TGTAGTAGTATTAAATTATAGCGATTTAATTGCAGGTAAA

  10. Dicty_cDB: FCL-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA15 (Link to dictyBase) - - - Contig-U16011-1 FCL-AA15Z ...(Link to Original site) - - FCL-AA15Z 442 - - - - Show FCL-AA15 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA15Q.Seq.d/ Representative seq. ID FCL-AA...15Z (Link to Original site) Representative DNA sequence >FCL-AA15 (FCL-AA15Q) /CSM/FCL/FCL-AA/FCL-AA...15Q.Seq.d/ XXXXXXXXXXCCATTCATCTGTCCAATCGATTGTCGTCGTGGTCTCTACAAGAATATCGT CTTATCTGGTGGTTCAACCATGTTTAAAGATTTTGGTAAACGTCTTCAA

  11. Dicty_cDB: FC-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA14 (Link to dictyBase) - - - Contig-U15088-1 FC-AA14E (Li...nk to Original site) - - - - - - FC-AA14E 431 Show FC-AA14 Library FC (Link to library) Clone ID FC-AA14 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA14Q.Seq.d/ Representative seq. ID FC-AA...14E (Link to Original site) Representative DNA sequence >FC-AA14 (FC-AA14Q) /CSM/FC/FC-AA/FC-AA14Q.Seq.d/ CTATGTCTGAAATCAAAA...CTGAAGAACTCGCTTGCATCTACTCCGGTCTTTTATTACAAG ATGACGGTATTGAAATCACCGCTGATAAAATCAAAACCTTATTAGAAGCTGCCAA

  12. Dicty_cDB: FC-AA09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA09 (Link to dictyBase) - - - Contig-U15086-1 FC-AA09E (Li...nk to Original site) - - - - - - FC-AA09E 562 Show FC-AA09 Library FC (Link to library) Clone ID FC-AA09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA09Q.Seq.d/ Representative seq. ID FC-AA...09E (Link to Original site) Representative DNA sequence >FC-AA09 (FC-AA09Q) /CSM/FC/FC-AA/FC-AA09Q.Seq....d/ GATACATTATCACCATGGCAGGAAAAAAAGTCAAATCTAACACACCAAAACAAGACTTAT CTGTCTCTAAATCAAAGCTCACCAGCATTAAAGCCCCAGCTGCTGCCATCAAAGCTAAA

  13. Dicty_cDB: FCL-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA05 (Link to dictyBase) - - - Contig-U16473-1 FCL-AA05Z ...(Link to Original site) - - FCL-AA05Z 603 - - - - Show FCL-AA05 Library FCL (Link to library) Clone ID FCL-AA... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA05Q.Seq.d/ Representative seq. ID FCL-AA...05Z (Link to Original site) Representative DNA sequence >FCL-AA05 (FCL-AA05Q) /CSM/FCL/FCL-AA/FCL-AA...05Q.Seq.d/ XXXXXXXXXXTGGCGCCATCATTACTGGTGGAGGTGGTGTTGCTATCACTCAAGCTCAAC CATCATACCAAGCTGATGCCGTTGCCACTTACATCAAAA

  14. Dicty_cDB: FC-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA19 (Link to dictyBase) - - - Contig-U16072-1 FC-AA19F (Li...nk to Original site) FC-AA19F 539 - - - - - - Show FC-AA19 Library FC (Link to library) Clone ID FC-AA19 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA19Q.Seq.d/ Representative seq. ID FC-AA...19F (Link to Original site) Representative DNA sequence >FC-AA19 (FC-AA19Q) /CSM/FC/FC-AA/FC-AA19Q.Seq.d/ CAGAAA...TCACTGGTTTTTCATTCCAATTATTTAATATTATCAGTATTTGGAATGTTGATC AAACATCATTCAATAGCTACAGTCTTCCAATTTGGTTACCAGCCATTCAA

  15. Age differences of salivary alpha-amylase levels of basal and acute responses to citric acid stimulation between Chinese children and adults

    Directory of Open Access Journals (Sweden)

    Zemin eYang

    2015-11-01

    Full Text Available It remains unclear how salivary alpha-amylase (sAA levels respond to mechanical stimuli in different age groups. In addition, the role played by the sAA gene (AMY1 copy number and protein expression (glycosylated and non-glycosylated in sAA activity has also been rarely reported. In this study, we analyzed saliva samples collected before and after citric acid stimulation from 47 child and 47 adult Chinese subjects. We observed that adults had higher sAA activity and sAA glycosylated levels (glycosylated sAA amount/total sAA amount in basal and stimulated saliva when compared with children, while no differences were found in total or glycosylated sAA amount between them. Interestingly, adults showed attenuated sAA activity levels increase over those of children after stimulation. Correlation analysis showed that total sAA amount, glycosylated sAA amount, and AMY1 copy number×total sAA amount were all positively correlated with sAA activity before and after stimulation in both groups. Interestingly, correlation r between sAA levels (glycosylated sAA amount and total sAA amount and sAA activity decreased after stimulation in children, while adults showed an increase in correlation r. In addition, the correlation r between AMY1 copy number×total sAA amount and sAA activity was higher than that between AMY1 copy number, total sAA amount and sAA activity, respectively. Taken together, our results suggest that total sAA amount, glycosylated sAA amount, and the positive interaction between AMY1 copy number and total sAA amount are crucial in influencing sAA activity before and after stimulation in children and adults.

  16. Arachidonic acid has a dominant effect to regulate lipogenic genes in 3T3-L1 adipocytes compared to omega-3 fatty acids

    Directory of Open Access Journals (Sweden)

    Hitesh Vaidya

    2015-03-01

    Full Text Available Background: The effects of long-chain n-3 and n-6 polyunsaturated fatty acids (PUFA on the regulation of adipocytes metabolism are well known. These fatty acids are generally consumed together in our diets; however, the metabolic regulation of adipocytes in the presence of these fatty acids when given together is not known. Objective: To investigate the effects of n-3 PUFA and arachidonic acid (AA, an n-6 PUFA, on the regulation of adipogenic and lipogenic genes in mature 3T3-L1 adipocytes. Methods: 3T3-L1 adipocytes were incubated in the presence or absence of 100 µM of eicosapentaenoic acid, EPA; docosahexaenoic acid, DHA; docosapentaenoic acid, DPA and AA, either alone or AA+n-3 PUFA; control cells received bovine serum albumin alone. The mRNA expression of adipogenic and lipogenic genes was measured. The fatty acid composition of adipocytes was analyzed using gas chromatography. Results: Individual n-3 PUFA or AA had no effect on the mRNA expression of peroxisome-proliferator-activated receptor-γ; however, AA+EPA and AA+DPA significantly increased (P<0.05 the expression compared to control cells (38 and 42%, respectively. AA and AA+EPA increased the mRNA expression of acetyl-CoA carboxylase 1 (P<0.05. AA treatment decreased the mRNA expression of stearoyl-CoA desaturase (SCD1 (P<0.01, while n-3 PUFA, except EPA, had no effect compared to control cells. AA+DHA and AA+DPA inhibited SCD1 gene expression (P<0.05 suggesting a dominant effect of AA. Fatty acids analysis of adipocytes revealed a higher accretion of AA compared to n-3 PUFA. Conclusions: Our findings reveal that AA has a dominant effect on the regulation of lipogenic genes in adipocytes.

  17. AA, sandwich line with magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    Continuation from 8010293: Finally, the sandwich line with the horn is placed on the ground, for the horn to be inspected and, if needed, exchanged for a new one. The whole procedure was trained with several members of the AA team, for quick and safe handling, and to share the radiation dose amongst them.

  18. Overall view of AA (Bld 193)

    CERN Multimedia

    1980-01-01

    See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  19. Overview of the Antiproton Accumulator (AA)

    CERN Multimedia

    1982-01-01

    See photo 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  20. Overall view of AA in Bld. 193

    CERN Multimedia

    1980-01-01

    See under 7911303, 7911597X, 8004261 and 8202324. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  1. AA, mating of BST magnet halves

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The AA had 2 types of bending magnets: BLG (window-frame,long and narrow) and BST (H-type, short and wide). The BST had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the mating of two BST halves.

  2. AA, vacuum tank for stochastic precooling

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The vaccum tank in which the fast stochastic precooling kicker was installed. It is clad with heating jackets for bake-out to 200 deg C, indispensable for reaching the operational vacuum of 7E-11 Torr. Alain Poncet, responsible for AA vacuum, is looking on. See also 7910268, 8002234.

  3. Longitudinal study of experimental induction of AA amyloidosis in mice seeded with homologous and heterologous AA fibrils.

    Science.gov (United States)

    Muhammad, Naeem; Murakami, Tomoaki; Inoshima, Yasuo; Ishiguro, Naotaka

    2016-09-01

    To investigate pathogenesis and kinetics of experimentally induced murine AA amyloidosis seeded with homologous (murine) and heterologous (bovine) AA fibrils. Experimental AA amyloidosis was induced by administration of inflammatory stimulus and preformed AA fibrils to a total of 111 female C57/Black mice. In this longitudinal study, heterologous (bovine) as well as homologous (murine) AA fibrils were injected intraperitoneally to mice in various combinations. Re-stimulation was done at 120 or 300 days post first inoculation. To analyze the intensity of amyloid depositions in mice organs, immunohistochemical techniques and image J software were used. Assessment of cytokines level in sera was done using a Mouse Th1/Th2/Th17 Cytokine CBA Kit. Incidence and severity of AA amyloidosis were quite low in mice inoculated with heterologous bovine AA fibrils than homologous murine one. Homologous AA fibrils administration at first and second inoculation caused maximum amount of amyloid depositions and severe systemic form of amyloidosis. Increase in the level of pro-inflammatory cytokine IL-6 was observed after first inoculation, while second inoculation caused a further increase in the level of anti-inflammatory cytokine IL-10. AA amyloidosis can be induced by heterologous as well as homologous AA fibrils. Severity of AA amyloidosis induced with homologous AA fibrils is higher compared to heterologous AA fibrils.

  4. Systemic AA amyloidosis: epidemiology, diagnosis, and management.

    Science.gov (United States)

    Real de Asúa, Diego; Costa, Ramón; Galván, Jose María; Filigheddu, María Teresa; Trujillo, Davinia; Cadiñanos, Julen

    2014-01-01

    The term "amyloidosis" encompasses the heterogeneous group of diseases caused by the extracellular deposition of autologous fibrillar proteins. The global incidence of amyloidosis is estimated at five to nine cases per million patient-years. While amyloid light-chain (AL) amyloidosis is more frequent in developed countries, amyloid A (AA) amyloidosis is more common in some European regions and in developing countries. The spectrum of AA amyloidosis has changed in recent decades owing to: an increase in the median age at diagnosis; a percent increase in the frequency of primary AL amyloidosis with respect to the AA type; and a substantial change in the epidemiology of the underlying diseases. Diagnosis of amyloidosis is based on clinical organ involvement and histological evidence of amyloid deposits. Among the many tinctorial characteristics of amyloid deposits, avidity for Congo red and metachromatic birefringence under unidirectional polarized light remain the gold standard. Once the initial diagnosis has been made, the amyloid subtype must be identified and systemic organ involvement evaluated. In this sense, the (123)I-labeled serum amyloid P component scintigraphy is a safe and noninvasive technique that has revolutionized the diagnosis and monitoring of treatment in systemic amyloidosis. It can successfully identify anatomical patterns of amyloid deposition throughout the body and enables not only an initial estimation of prognosis, but also the monitoring of the course of the disease and the response to treatment. Given the etiologic diversity of AA amyloidosis, common therapeutic strategies are scarce. All treatment options should be based upon a greater control of the underlying disease, adequate organ support, and treatment of symptoms. Nevertheless, novel therapeutic strategies targeting the formation of amyloid fibrils and amyloid deposition may generate new expectations for patients with AA amyloidosis.

  5. Influences of AMY1 gene copy number and protein expression on salivary alpha-amylase activity before and after citric acid stimulation in splenic asthenia children.

    Science.gov (United States)

    Yang, Zemin; Lin, Jing; Chen, Longhui; Zhang, Min; Yang, Xiaorong; Chen, Weiwen

    2015-06-01

    To compare the correlations between salivary alpha-amylase (sAA) activity and amylase, alpha 1 (salivary) gene (AMYl) copy number or its gene expression between splenic asthenia and healthy children, and investigate the reasons of attenuated sAA activity ratio before and after citric acid stimulation in splenic asthenia children. Saliva samples from 20 splenic asthenia children and 29 healthy children were collected before and after citric acid stimulation. AMYl copy number, sAA activity, and total sAA and glycosylated sAA contents were determined, and their correlations were analyzed. Although splenic asthenia and healthy children had no differences in AMY1 copy number, splenic asthenia children had positive correlations between AMY1 copy number and sAA activity before or after citric acid stimulation. Splenic asthenia children had a higher sAA glycosylated proportion ratio and glycosylated sAA content ratio, while their total sAA content ratio and sAA activity ratio were lower compared with healthy children. The glycosylated sAA content ratio was higher than the total sAA content ratio in both groups. Splenic asthenia and healthy children had positive correlations between total sAA or glycosylated sAA content and sAA activity. However, the role played by glycosylated sAA content in sAA activity in healthy children increased after citric acid stimulation, while it decreased in splenic asthenia children. Genetic factors like AMY1 copy number variations, and more importantly, sAA glycosylation abnormalities leading to attenuated sAA activity after citric acid stimulation, which were the main reasons of the attenuated sAA activity ratio in splenic asthenia children compared with healthy children.

  6. Bioinformatic flowchart and database to investigate the origins and diversity of clan AA peptidases.

    Science.gov (United States)

    Llorens, Carlos; Futami, Ricardo; Renaud, Gabriel; Moya, Andrés

    2009-01-27

    Clan AA of aspartic peptidases relates the family of pepsin monomers evolutionarily with all dimeric peptidases encoded by eukaryotic LTR retroelements. Recent findings describing various pools of single-domain nonviral host peptidases, in prokaryotes and eukaryotes, indicate that the diversity of clan AA is larger than previously thought. The ensuing approach to investigate this enzyme group is by studying its phylogeny. However, clan AA is a difficult case to study due to the low similarity and different rates of evolution. This work is an ongoing attempt to investigate the different clan AA families to understand the cause of their diversity. In this paper, we describe in-progress database and bioinformatic flowchart designed to characterize the clan AA protein domain based on all possible protein families through ancestral reconstructions, sequence logos, and hidden markov models (HMMs). The flowchart includes the characterization of a major consensus sequence based on 6 amino acid patterns with correspondence with Andreeva's model, the structural template describing the clan AA peptidase fold. The set of tools is work in progress we have organized in a database within the GyDB project, referred to as Clan AA Reference Database http://gydb.uv.es/gydb/phylogeny.php?tree=caard. The pre-existing classification combined with the evolutionary history of LTR retroelements permits a consistent taxonomical collection of sequence logos and HMMs. This set is useful for gene annotation but also a reference to evaluate the diversity of, and the relationships among, the different families. Comparisons among HMMs suggest a common ancestor for all dimeric clan AA peptidases that is halfway between single-domain nonviral peptidases and those coded by Ty3/Gypsy LTR retroelements. Sequence logos reveal how all clan AA families follow similar protein domain architecture related to the peptidase fold. In particular, each family nucleates a particular consensus motif in the

  7. Engineering posttranslational proofreading to discriminate nonstandard amino acids

    OpenAIRE

    Kunjapur, Aditya M.; Stork, Devon A.; Kuru, Erkin; Vargas-Rodriguez, Oscar; Landon, Matthieu; Söll, Dieter; Church, George M.

    2018-01-01

    Incorporation of nonstandard amino acids (nsAAs) leads to chemical diversification of proteins, which is an important tool for the investigation and engineering of biological processes. However, the aminoacyl-tRNA synthetases crucial for this process are polyspecific in regard to nsAAs and standard amino acids. Here, we develop a quality control system called “posttranslational proofreading” to more accurately and rapidly evaluate nsAA incorporation. We achieve this proofreading by hijacking ...

  8. Simultaneous detection of ascorbic acid, uric acid and homovanillic acid at copper modified electrode

    International Nuclear Information System (INIS)

    Selvaraju, T.; Ramaraj, R.

    2007-01-01

    The copper was deposited on glassy carbon (GC) and indium tin oxide (ITO) electrodes by electrochemical method. The copper structures on electrode were characterized by atomic force microscope, X-ray diffractometeric pattern and differential pulse voltammetric studies. Optimal conditions for uniform growth of copper structures on the electrode were established. Voltammetric sensor was fabricated using the copper deposited GC electrode for the simultaneous detection and determination of uric acid (UA) and homovanillic acid (HVA) in the presence of excess concentrations of ascorbic acid (AA). The voltammetric signals due to AA and UA oxidation were well separated with a potential difference of 400 mV and AA did not interfere with the measurement of UA and HVA at the GC/Cu electrode. Linear calibration curves were obtained in the concentration range 1-40 μM for AA and 20-50 μM for UA at physiological pH and a detection limit of 10 nM of UA in the presence of 10-fold excess concentrations of AA was achieved. The simultaneous detection of submicromolar concentrations of AA, UA and HVA was achieved at the GC/Cu electrode. The practical utility of the present GC/Cu modified electrode was demonstrated by measuring the AA content in Vitamin C tablet, UA content in human urine and blood serum samples with satisfactory results

  9. Aristolochic acid and its derivatives as inhibitors of snake venom L-amino acid oxidase.

    Science.gov (United States)

    Bhattacharjee, Payel; Bera, Indrani; Chakraborty, Subhamoy; Ghoshal, Nanda; Bhattacharyya, Debasish

    2017-11-01

    Snake venom L-amino acid oxidase (LAAO) exerts toxicity by inducing hemorrhage, pneumorrhagia, pulmonary edema, cardiac edema, liver cell necrosis etc. Being well conserved, inhibitors of the enzyme may be synthesized using the template of the substrate, substrate binding site and features of the catalytic site of the enzyme. Previous findings showed that aristolochic acid (AA), a major constituent of Aristolochia indica, inhibits Russell's viper venom LAAO enzyme activity since, AA interacts with DNA and causes genotoxicity, derivatives of this compound were synthesized by replacing the nitro group to reduce toxicity while retaining the inhibitory potency. The interactions of AA and its derivatives with LAAO were followed by inhibition kinetics and surface plasmon resonance. Similar interactions with DNA were followed by absorption spectroscopy and atomic force microscopy. LAAO-induced cytotoxicity was evaluated by generation of reactive oxygen species (ROS), cell viability assays, confocal and epifluorescence microscopy. The hydroxyl (AA-OH) and chloro (AA-Cl) derivatives acted as inhibitors of LAAO but did not interact with DNA. The derivatives significantly reduced LAAO-induced ROS generation and cytotoxicity in human embryonic kidney (HEK 293) and hepatoma (HepG2) cell lines. Confocal images indicated that AA, AA-OH and AA-Cl interfered with the binding of LAAO to the cell membrane. AA-OH and AA-Cl significantly inhibited LAAO activity and reduced LAAO-induced cytotoxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. SPE and HPLC/UV of resin acids in colophonium-containing products.

    Science.gov (United States)

    Nilsson, Ulrika; Berglund, Naghmeh; Lindahl, Fredrik; Axelsson, Sara; Redeby, Theres; Lassen, Pia; Karlberg, Ann-Therese

    2008-08-01

    A new method, involving SPE and HPLC/UV diode-array detection (DAD), was developed for the quantification of colophonium components in different consumer products, such as cosmetics. Colophonium is a common cause of contact dermatitis since its components can oxidize into allergens on exposure to air. Three different resin acids were used as markers for native and oxidized colophonium, abietic acid (AbA), dehydroabietic acid (DeA), and 7-oxodehydroabietic acid (7-O-DeA). The SPE method, utilizing a mixed-mode hydrophobic and anion exchange retention mechanism, was shown to yield very clean extracts. The use of a urea-embedded C(12) HPLC stationary phase improved the separation of the resin acids compared to common C(18). Concentrations higher than 2 mg/g of both AbA and DeA were detected in wax strips. In this product also 7-O-DeA, a marker for oxidized colophonium, was detected at a level of 28 microg/g. The LODs were in the range of 7-19 microg/g and the LOQs 22-56 microg/g. The method is simple to use and can be applied on many types of technical products, not only cosmetics. For the first time, a method for technical products was developed, which separates AbA from pimaric acid.

  11. Absorption spectra of AA-stacked graphite

    International Nuclear Information System (INIS)

    Chiu, C W; Lee, S H; Chen, S C; Lin, M F; Shyu, F L

    2010-01-01

    AA-stacked graphite shows strong anisotropy in geometric structures and velocity matrix elements. However, the absorption spectra are isotropic for the polarization vector on the graphene plane. The spectra exhibit one prominent plateau at middle energy and one shoulder structure at lower energy. These structures directly reflect the unique geometric and band structures and provide sufficient information for experimental fitting of the intralayer and interlayer atomic interactions. On the other hand, monolayer graphene shows a sharp absorption peak but no shoulder structure; AA-stacked bilayer graphene has two absorption peaks at middle energy and abruptly vanishes at lower energy. Furthermore, the isotropic features are expected to exist in other graphene-related systems. The calculated results and the predicted atomic interactions could be verified by optical measurements.

  12. Enantioselective analysis of proteinogenic amino acids in cerebrospinal fluid by capillary electrophoresis–mass spectrometry

    NARCIS (Netherlands)

    Prior, Amir; Sánchez-Hernández, Laura; Sastre-Toraño, Javier|info:eu-repo/dai/nl/304840424; Marina, Maria Luisa; de Jong, Gerhardus J.|info:eu-repo/dai/nl/080685072; Somsen, Govert W.

    2016-01-01

    d-Amino acids (AAs) are increasingly being recognized as essential molecules in biological systems. Enantioselective analysis of proteinogenic AAs in biological samples was accomplished by CE–MS employing β-CD as chiral selector and ESI via sheath-liquid (SL) interfacing. Prior to analysis, AAs were

  13. Ascorbic acid, cognitive function, and Alzheimer’s disease: a current review and future direction

    OpenAIRE

    Bowman, Gene L.

    2012-01-01

    This narrative review appraises the human and animal studies implicating ascorbic acid (AA) in normal cognitive function and Alzheimer’s disease. A research framework for how nutrition affects brain aging is proposed with emphasis on AA intake, status, metabolism, and transport into brain tissue. A final synopsis highlights areas for future research regarding AA nourishment and healthy brain aging.

  14. L-ascorbic acid losses in Kenyan vegetables during cooking as ...

    African Journals Online (AJOL)

    The loss of L-ascorbic acid (L-AA) in 14 different cooked local vegetables found in Nairobi markets was determined by high performance liquid chromatography. The effect of quantity of water on the loss of L-AA during cooking was studied with cowpea leaves. It was found that more L-AA was lost when larger amount of ...

  15. First circulating beam in the AA

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    On 3 July 1980, two years after project authorization, beam circulated for the first time in the AA. It was a 3.5 GeV/c proton test beam. We see an expecting crowd, minutes before the happy event. The persons are to numerous to name them all. Heribert Koziol, apparently asleep, is answering the call from an impatient director. See also 8007094.

  16. AA, assembly of wide bending magnet

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The very particular lattice of the AA required 2 types of dipoles (bending magnets; BST, short and wide; BLG, long and narrow). The wide ones had a steel length of 2.71 m, a "good field" width of 0.564 m, and a weight of about 75 t. Here we see the copper coils being hoisted onto the lower half of a BST. See also 7811105, 8006050. For a BLG, see 8001044.

  17. AA, inner conductor of a magnetic horn

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    At the start-up of the AA and during its initial operation, magnetic horns focused the antiprotons emanating from the production target. These "current-sheet lenses" had a thin inner conductor (for minimum absorption of antiprotons), machined from aluminium to wall thicknesses of 0.7 or 1 mm. The half-sine pulses rose to 150 kA in 8 microsec. The angular acceptance was 50 mrad.

  18. Bacillus thuringiensis Crystal Protein Cry6Aa Triggers Caenorhabditis elegans Necrosis Pathway Mediated by Aspartic Protease (ASP-1.

    Directory of Open Access Journals (Sweden)

    Fengjuan Zhang

    2016-01-01

    Full Text Available Cell death plays an important role in host-pathogen interactions. Crystal proteins (toxins are essential components of Bacillus thuringiensis (Bt biological pesticides because of their specific toxicity against insects and nematodes. However, the mode of action by which crystal toxins to induce cell death is not completely understood. Here we show that crystal toxin triggers cell death by necrosis signaling pathway using crystal toxin Cry6Aa-Caenorhabditis elegans toxin-host interaction system, which involves an increase in concentrations of cytoplasmic calcium, lysosomal lyses, uptake of propidium iodide, and burst of death fluorescence. We find that a deficiency in the necrosis pathway confers tolerance to Cry6Aa toxin. Intriguingly, the necrosis pathway is specifically triggered by Cry6Aa, not by Cry5Ba, whose amino acid sequence is different from that of Cry6Aa. Furthermore, Cry6Aa-induced necrosis pathway requires aspartic protease (ASP-1. In addition, ASP-1 protects Cry6Aa from over-degradation in C. elegans. This is the first demonstration that deficiency in necrosis pathway confers tolerance to Bt crystal protein, and that Cry6A triggers necrosis represents a newly added necrosis paradigm in the C. elegans. Understanding this model could lead to new strategies for nematode control.

  19. Molecular cloning and expression analysis of the aqp1aa gene in half-smooth tongue sole (Cynoglossus semilaevis.

    Directory of Open Access Journals (Sweden)

    Hua Guo

    Full Text Available Aquaporin 1 (AQP1 is a member of the transmembrane water channel family of proteins with special structural features, and two AQP1 paralogous genes (aqp1aa and aqp1ab are reported in teleosts. In the present study, the aqp1aa gene of half-smooth tongue sole (Cynoglossus semilaevis was cloned and characterized. The full-length cDNA of aqp1aa is 1411 bp with a 786 bp open reading frame encoding a 261-amino acid putative protein with a characteristic structure consisting of 6 membrane-spanning α-helical domains and two highly conserved asparagine-proline-alanine motifs. Real-time quantitative PCR revealed that aqp1aa mRNA is expressed predominantly in the testis of males and pseudo-males, while its expression is low in the ovary and lowest in doublesex and mab-3-related transcription factor 1(DMRT1 knock out fish and triploid males. In situ hybridization indicated that aqp1aa mRNA is expressed mainly in the germ cells of males and pseudo-males, especially in spermatozoa and spermatids. These results suggest that the aqp1aa may play a role in spermatogenesis of C. semilaevis.

  20. Developmental nephrotoxicity of aristolochic acid in a zebrafish model

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Yu-Ju; Chen, Yau-Hung, E-mail: yauhung@mail.tku.edu.tw

    2012-05-15

    Aristolochic acid (AA) is a component of Aristolochia plant extracts which is used as a treatment for different pathologies and their toxicological effects have not been sufficiently studied. The aim of this study was to evaluate AA-induced nephrotoxicity in zebrafish embryos. After soaking zebrafish embryos in AA, the embryos displayed malformed kidney phenotypes, such as curved, cystic pronephric tubes, pronephric ducts, and cases of atrophic glomeruli. The percentages of embryos with malformed kidney phenotypes increased as the exposure dosages of AA increased. Furthermore, AA-treated embryos exhibited significantly reduced glomerular filtration rates (GFRs) in comparison with mock-control littermates (mock-control: 100 ± 2.24% vs. 10 ppm AA treatment for 3–5 h: 71.48 ± 18.84% ∼ 39.41 ± 15.88%), indicating that AA treatment not only caused morphological kidney changes but also induced renal failure. In addition to kidney malformations, AA-treated zebrafish embryos also exhibited deformed hearts, swollen pericardiums, impaired blood circulation and the accumulation(s) of red blood cells. Whole-mount in situ hybridization studies using cmlc2 and wt1b as riboprobes indicated that the kidney is more sensitive than the heart to AA damage. Real-time PCR showed that AA can up-regulate the expression of proinflammatory genes like TNFα, cox2 and mpo. These results support the following conclusions: (1) AA-induced renal failure is mediated by inflammation, which causes circulation dysfunction followed by serious heart malformation; and (2) the kidney is more sensitive than the heart to AA injury. -- Highlights: ► Zebrafish were used to evaluate aristolochic acid (AA)-induced nephrotoxicity. ► AA-treated zebrafish embryos exhibited deformed heart as well as malformed kidney. ► Kidney is more sensitive to AA injury than the heart.

  1. Dicty_cDB: FC-AA10 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA10 (Link to dictyBase) - - - Contig-U16358-1 FC-AA10P (Li...nk to Original site) FC-AA10F 659 FC-AA10Z 544 FC-AA10P 1203 - - Show FC-AA10 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA10Q.Seq.d/ Representative seq. ID FC-AA...10P (Link to Original site) Representative DNA sequence >FC-AA10 (FC-AA10Q) /CSM/FC/FC-AA/FC-AA10Q.Seq.d/ AA...ATGACTACCTTTAACGAATATCCATTCTTGGCTGAATTAGGCATTAAAGCTGAAAATA ATGATGGAGTCTTCAATGGAAAATGGGGAGGTGCTGGTGAAATCATCAA

  2. Dicty_cDB: FC-AA04 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA04 (Link to dictyBase) - - - Contig-U15354-1 FC-AA04P (Li...nk to Original site) FC-AA04F 546 FC-AA04Z 484 FC-AA04P 1030 - - Show FC-AA04 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA04Q.Seq.d/ Representative seq. ID FC-AA...04P (Link to Original site) Representative DNA sequence >FC-AA04 (FC-AA04Q) /CSM/FC/FC-AA/FC-AA04Q.Seq.d/ AA...TAATACACATAAAAAATTTATTAAATAAAAATGACTACAACAACAACAAATGAAGTTT ATATAGTTGATTGTATTCGTACACCAATTGGTAGAGGATATAGTAA

  3. Dicty_cDB: FC-AA03 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA03 (Link to dictyBase) - - - Contig-U15331-1 FC-AA03P (Li...nk to Original site) FC-AA03F 595 FC-AA03Z 546 FC-AA03P 1141 - - Show FC-AA03 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA03Q.Seq.d/ Representative seq. ID FC-AA...03P (Link to Original site) Representative DNA sequence >FC-AA03 (FC-AA03Q) /CSM/FC/FC-AA/FC-AA03Q.Seq.d/ AA...AATGTCATCTTATTTATTCACTAGTGAATCCGTCACCGAAGTCATCCAGATAAAATCT GTGATCAAGTATCAGATGCTGTTCTCGATGCTTGTTTAGCTCAA

  4. _. AA~ AA, _ _

    Indian Academy of Sciences (India)

    It is probably very difficult to find a person who has not been charmed by the exquisite beauty of soap bubbles. Invariably, our appre- ciation of soap bubbles ends with an admira- tion of their shapes and colours. We do not realise that there is a profound science behind their beauty. The best book to start learning.

  5. Associations With Eicosapentaenoic Acid to Arachidonic Acid Ratio and Mortality in Hospitalized Heart Failure Patients.

    Science.gov (United States)

    Watanabe, Shunsuke; Yoshihisa, Akiomi; Kanno, Yuki; Takiguchi, Mai; Yokokawa, Tetsuro; Sato, Akihiko; Miura, Shunsuke; Shimizu, Takeshi; Abe, Satoshi; Sato, Takamasa; Suzuki, Satoshi; Oikawa, Masayoshi; Sakamoto, Nobuo; Yamaki, Takayoshi; Sugimoto, Koichi; Kunii, Hiroyuki; Nakazato, Kazuhiko; Suzuki, Hitoshi; Saitoh, Shu-Ichi; Takeishi, Yasuchika

    2016-12-01

    Intake of n-3 polyunsaturated fatty acids (n-3 PUFAs) lowers the risk of atherosclerotic cardiovascular events, particularly ischemic heart disease. In addition, the ratio of eicosapentaenoic acid (EPA; n-3 PUFA) to arachidonic acid (AA; n-6 PUFA) has recently been recognized as a risk marker of cardiovascular disease. In contrast, the prognostic impact of the EPA/AA ratio on patients with heart failure (HF) remains unclear. A total of 577 consecutive patients admitted for HF were divided into 2 groups based on median of the EPA/AA ratio: low EPA/AA (EPA/AA <0.32 mg/dl, n = 291) and high EPA/AA (EPA/AA ≥0.32, n = 286) groups. We compared laboratory data and echocardiographic findings and followed cardiac mortality. Although body mass index, blood pressure, B-type natriuretic peptide, hemoglobin, estimated glomerular filtration rate, total protein, albumin, sodium, C-reactive protein, and left ventricular ejection fraction did not differ between the 2 groups, cardiac mortality was significantly higher in the low EPA/AA group than in the high EPA/AA group (12.7 vs 5.9%, log-rank P = .004). Multivariate Cox proportional hazard analysis revealed that the EPA/AA ratio was an independent predictor of cardiac mortality (hazard ratio 0.677, 95% confidence interval 0.453-0.983, P = .041) in patients with HF. The EPA/AA ratio was an independent predictor of cardiac mortality in patients with HF; therefore, the prognosis of patients with HF may be improved by taking appropriate management to control the EPA/AA balance. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  6. Acetic acid-water complex: The first observation of structures containing the higher-energy acetic acid conformer

    Science.gov (United States)

    Lopes, Susy; Fausto, Rui; Khriachtchev, Leonid

    2016-02-01

    Non-covalent interaction of acetic acid (AA) and water is studied experimentally by IR spectroscopy in a nitrogen matrix and theoretically at the MP2 and coupled-cluster with single and double and perturbative triple excitations [CCSD(T)]/6-311++G(2d,2p) levels of theory. This work is focused on the first preparation and characterization of complexes of higher-energy (cis) conformer of AA with water. The calculations show three 1:1 structures for the trans-AA⋯H2O complexes and three 1:1 structures for the cis-AA⋯H2O complexes. Two trans-AA⋯H2O and two cis-AA⋯H2O complexes are found and structurally assigned in the experiments. The two cis-AA⋯ ṡ H2O complexes are obtained by annealing of a matrix containing water and cis-AA molecules prepared by selective vibrational excitation of the ground-state trans form. The less stable trans-AA⋯H2O complex is obtained by vibrational excitation of the less stable cis-AA⋯H2O complex. In addition, the 1:2 complexes of trans-AA and cis-AA with water molecules are studied computationally and the most stable forms of the 1:2 complexes are experimentally identified.

  7. Conifer Diterpene Resin Acids Disrupt Juvenile Hormone-Mediated Endocrine Regulation in the Indian Meal Moth Plodia interpunctella.

    Science.gov (United States)

    Oh, Hyun-Woo; Yun, Chan-Seok; Jeon, Jun Hyoung; Kim, Ji-Ae; Park, Doo-Sang; Ryu, Hyung Won; Oh, Sei-Ryang; Song, Hyuk-Hwan; Shin, Yunhee; Jung, Chan Sik; Shin, Sang Woon

    2017-07-01

    Diterpene resin acids (DRAs) are important components of oleoresin and greatly contribute to the defense strategies of conifers against herbivorous insects. In the present study, we determined that DRAs function as insect juvenile hormone (JH) antagonists that interfere with the juvenile hormone-mediated binding of the JH receptor Methoprene-tolerant (Met) and steroid receptor coactivator (SRC). Using a yeast two-hybrid system transformed with Met and SRC from the Indian meal moth Plodia interpunctella, we tested the interfering activity of 3704 plant extracts against JH III-mediated Met-SRC binding. Plant extracts from conifers, especially members of the Pinaceae, exhibited strong interfering activity, and four active interfering DRAs (7α-dehydroabietic acid, 7-oxodehydroabietic acid, dehydroabietic acid, and sandaracopimaric acid) were isolated from roots of the Japanese pine Pinus densiflora. The four isolated DRAs, along with abietic acid, disrupted the juvenile hormone-mediated binding of P. interpunctella Met and SRC, although only 7-oxodehydroabietic acid disrupted larval development. These results demonstrate that DRAs may play a defensive role against herbivorous insects via insect endocrine-disrupting activity.

  8. Determination of trace amounts of cadmium in zirconium and its alloys by graphite furnace AAS

    International Nuclear Information System (INIS)

    Takashima, Kyoichiro; Toida, Yukio

    1994-01-01

    Trace amount of cadmium in zirconium and its alloys was determined by graphite furnace atomic absorption spectrometry (GF-AAS) after ion exchange separation. A 2g chip sample was decomposed with 20ml of hydrofluoric acid (1+9) and a few drops of nitric acid. A trace amount of cadmium was separated from zirconium by strongly acidic cation-exchange resin (MCI GEL CK 08P) using 50ml of hydrochloric acid as an eluent. The solution was gently evaporated to dryness on an electric hot plate heater and under an infrared lamp. The residue was dissolved in 1ml of nitric acid (1+14) and diluted to 10ml in a volumetric glass flask with distilled water. Ten microliters of this solution was injected into a graphite furnace and then atomized at 2200degC for 4s in argon at a flow rate of 3.0l/min. Acids used in the analytical procedure were purified by azeotropic distillation and cation-exchange resin. The limit of determination (3σ BK ) for cadmium was 0.5ngCd/g and the relative standard deviation (RSD) at 1ngCd/g level was less than 20% for the GF-AAS. The accuracy of this technique was confirmed by NIST SRM 1643b (trace elements in water). (author)

  9. Dicty_cDB: FC-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA18 (Link to dictyBase) - - - Contig-U15943-1 FC-AA18P (Li...nk to Original site) FC-AA18F 506 FC-AA18Z 293 FC-AA18P 799 - - Show FC-AA18 Library FC (Link to library) Clone ID FC-AA...al site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA18Q.Seq.d/ Representative seq. ID FC-AA...18P (Link to Original site) Representative DNA sequence >FC-AA18 (FC-AA18Q) /CSM/FC/FC-AA/FC-AA18Q.Seq.d/ AAA...AGATAGAGAAGAAAGAAAACTTGAACGTGAGAAGGAACTTGAACGTGAACGTGAGAA AGAACTTGAGCGTGAGCGTGAACGTGAACAACGTCGTCTTGAAA

  10. Dicty_cDB: FCL-AA12 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA12 (Link to dictyBase) - - - Contig-U16034-1 FCL-AA12P ...(Link to Original site) FCL-AA12F 629 FCL-AA12Z 540 FCL-AA12P 1169 - - Show FCL-AA12 Library FCL (Link to library) Clone ID FCL-AA...4-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA12Q....Seq.d/ Representative seq. ID FCL-AA12P (Link to Original site) Representative DNA sequence >FCL-AA12 (FCL-AA12Q) /CSM/FCL/FCL-AA.../FCL-AA12Q.Seq.d/ ATCAAATGTTTATTCAACAACAACCATCAGATTCAATTGTTTGTAATCGTTATATTCATC CAGCCATTGTTGTTTTGGTTGACCAA

  11. Dicty_cDB: FCL-AA01 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA01 (Link to dictyBase) - - - Contig-U16033-1 FCL-AA01P ...(Link to Original site) FCL-AA01F 603 FCL-AA01Z 411 FCL-AA01P 1014 - - Show FCL-AA01 Library FCL (Link to library) Clone ID FCL-AA...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA01Q....Seq.d/ Representative seq. ID FCL-AA01P (Link to Original site) Representative DNA sequence >FCL-AA01 (FCL-AA01Q) /CSM/FCL/FCL-AA.../FCL-AA01Q.Seq.d/ GCAAATAATAATATTATGGGTATTGACTTTGGTACACATTTCGCATGTGTTGGTATTTTC AAGAATGAAAGAATTGAAATCTGTCCAAA

  12. Dicty_cDB: FCL-AA07 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA07 (Link to dictyBase) - - - Contig-U14973-1 FCL-AA07P ...(Link to Original site) FCL-AA07F 527 FCL-AA07Z 253 FCL-AA07P 780 - - Show FCL-AA07 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA07Q....Seq.d/ Representative seq. ID FCL-AA07P (Link to Original site) Representative DNA sequence >FCL-AA07 (FCL-AA07Q) /CSM/FCL/FCL-AA.../FCL-AA07Q.Seq.d/ CAAAATAAAAAATGTTATCAAATTTTTTAAAAGTCAACAGTAAAGCACTAGGACATATAA GAACTTTTGCCTCAAAGAGTGGTGAAATTAAA

  13. Dicty_cDB: FCL-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA21 (Link to dictyBase) - - - Contig-U14936-1 FCL-AA21P ...(Link to Original site) FCL-AA21F 520 FCL-AA21Z 356 FCL-AA21P 876 - - Show FCL-AA21 Library FCL (Link to library) Clone ID FCL-AA...-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA21Q....Seq.d/ Representative seq. ID FCL-AA21P (Link to Original site) Representative DNA sequence >FCL-AA21 (FCL-AA21Q) /CSM/FCL/FCL-AA.../FCL-AA21Q.Seq.d/ ATCATAATCATATATTTTTAATAGATATTGATATATATATTTAAAAAAATAAAATAAAAT AAAATAAAAAATGTCAACAGAGGAAACAAAAA

  14. Dicty_cDB: FC-AA11 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA11 (Link to dictyBase) - - - Contig-U16273-1 FC-AA11P (Li...nk to Original site) FC-AA11F 631 FC-AA11Z 502 FC-AA11P 1133 - - Show FC-AA11 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA11Q.Seq.d/ Representative seq. ID FC-AA...11P (Link to Original site) Representative DNA sequence >FC-AA11 (FC-AA11Q) /CSM/FC/FC-AA/FC-AA...11Q.Seq.d/ GGTGAATTAATTGTTGAACCAGTTGATCAAAAATATATTTTCAAGACTGAACGTAAAGTT CCAAGAATGGGTGTTATGATTGTTGGTTTATGTGGTAACAATGGTACAA

  15. Dicty_cDB: FC-AA08 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA08 (Link to dictyBase) - - - Contig-U15942-1 FC-AA08P (Li...nk to Original site) FC-AA08F 620 FC-AA08Z 510 FC-AA08P 1130 - - Show FC-AA08 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA08Q.Seq.d/ Representative seq. ID FC-AA...08P (Link to Original site) Representative DNA sequence >FC-AA08 (FC-AA08Q) /CSM/FC/FC-AA/FC-AA...08Q.Seq.d/ ATCAGTTACATGTACTGCACCAGTTAATATTGCAGTTATCAAATATTGGGGAAAGAGAGA TGAAAATATTATTTTACCATTAAATTCATCACTCAGTGGAA

  16. Dicty_cDB: FC-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA06 (Link to dictyBase) - - - Contig-U15909-1 FC-AA06P (Li...nk to Original site) FC-AA06F 532 FC-AA06Z 501 FC-AA06P 1033 - - Show FC-AA06 Library FC (Link to library) Clone ID FC-AA...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA06Q.Seq.d/ Representative seq. ID FC-AA...06P (Link to Original site) Representative DNA sequence >FC-AA06 (FC-AA06Q) /CSM/FC/FC-AA/FC-AA...06Q.Seq.d/ GTGAATATAACGATTTAGATTTAGTGTATGATAAAGATGTTTATCAAAAATTAATAGAGA ATGGTGTAGATTCATTATTATCAAAA

  17. Dicty_cDB: FCL-AA13 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA13 (Link to dictyBase) - - - - FCL-AA13P (Link to Original site) FCL-AA...13F 635 FCL-AA13Z 350 FCL-AA13P 985 - - Show FCL-AA13 Library FCL (Link to library) Clone ID FCL-AA...dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ Representative seq. ID FCL-AA...13P (Link to Original site) Representative DNA sequence >FCL-AA13 (FCL-AA13Q) /CSM/FCL/FCL-AA/FCL-AA13Q.Seq.d/ CATATTTATAA...TTATATCTTTTTTGTTTAATAAAAAAGAAAGAATACCAACATGAGACTT TTATTGTGTTTAATTTTCTTAGTTTTTGTTTTCAATTTTGCATTATCAA

  18. AA, Inner Conductor of Magnetic Horn

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    Antiprotons emerging at large angles from the production target (hit by an intense 26 GeV proton beam from the PS), were focused into the acceptance of the injection line of the AA by means of a "magnetic horn" (current-sheet lens). Here we see an early protype of the horn's inner conductor, machined from solid aluminium to a thickness of less than 1 mm. The 1st version had to withstand pulses of 150 kA, 15 us long, every 2.4 s. See 8801040 for a later version.

  19. Molecular characterization of branchial aquaporin 1aa and effects of seawater acclimation, emersion or ammonia exposure on its mRNA expression in the gills, gut, kidney and skin of the freshwater climbing perch, Anabas testudineus.

    Directory of Open Access Journals (Sweden)

    Yuen K Ip

    Full Text Available We obtained a full cDNA coding sequence of aquaporin 1aa (aqp1aa from the gills of the freshwater climbing perch, Anabas testudineus, which had the highest expression in the gills and skin, suggesting an important role of Aqp1aa in these organs. Since seawater acclimation had no significant effects on the branchial and intestinal aqp1aa mRNA expression, and since the mRNA expression of aqp1aa in the gut was extremely low, it can be deduced that Aqp1aa, despite being a water channel, did not play a significant osmoregulatory role in A. testudineus. However, terrestrial exposure led to significant increases in the mRNA expression of aqp1aa in the gills and skin of A. testudineus. Since terrestrial exposure would lead to evaporative water loss, these results further support the proposition that Aqp1aa did not function predominantly for the permeation of water through the gills and skin. Rather, increased aqp1aa mRNA expression might be necessary to facilitate increased ammonia excretion during emersion, because A. testudineus is known to utilize amino acids as energy sources for locomotor activity with increased ammonia production on land. Furthermore, ammonia exposure resulted in significant decreases in mRNA expression of aqp1aa in the gills and skin of A. testudineus, presumably to reduce ammonia influx during ammonia loading. This corroborates previous reports on AQP1 being able to facilitate ammonia permeation. However, a molecular characterization of Aqp1aa from A. testudineus revealed that its intrinsic aquapore might not facilitate NH3 transport. Hence, ammonia probably permeated the central fifth pore of the Aqp1aa tetramer as suggested previously. Taken together, our results indicate that Aqp1aa might have a greater physiological role in ammonia excretion than in osmoregulation in A. testudineus.

  20. Experimental immunologically mediated aplastic anemia (AA) in mice: cyclosporin A fails to protect against AA

    International Nuclear Information System (INIS)

    Knospe, W.H.; Steinberg, D.; Gratwohl, A.; Speck, B.

    1984-01-01

    Immunologically mediated aplastic anemia (AA) in mice was induced by the i.v. injection of 10(7) lymph node cells (LNC) from H-2k identical but Mls mismatched CBA/J donor mice into previously irradiated (600 rad total body gamma) C3H/HeJ mice. Cyclosporin A (CsA), 25 mg/kg, was administered subcutaneously from day -1 to day 30. Control mice included C3H/HeJ mice which received 600 rad alone, C3H/HeJ mice which received 600 rad plus CsA as above, and C3H/HeJ mice which received 600 rad total body irradiation followed by 10(7) LNC from CBA/J donors. CsA failed to prevent lethal AA. These results suggest that the pathogenetic mechanisms operating in immunologically mediated AA differ from the mechanisms operating in rodents transplanted with allogeneically mismatched marrow or spleen cells which develop graft-versus-host disease. The results are consistent with a non-T cell-dependent mechanism causing the AA

  1. Simon van der Meer in the AA Control Room

    CERN Multimedia

    CERN PhotoLab

    1984-01-01

    Simon van der Meer, spiritus rector of the Antiproton Accumulator, in the AA Control Room. Inventor of stochastic cooling, on which the AA was based, and of the magnetic horn, with which the antiprotons were focused, he also wrote most of the software with which the AA was controlled, and spent uncountable numbers of hours in this chair to tickle the AA to top performance. 8 months after this picture was taken, he received, in October 1984, the Nobel prize, together with Carlo Rubbia, the moving force behind the whole Proton-Antiproton Collider project that led to the discovery, in 1983, of the W and Z intermediate bosons.

  2. Flow Injection and Atomic Absorption Spectrometry (FI-AAS) -

    DEFF Research Database (Denmark)

    Hansen, Elo Harald

    1996-01-01

    One of the advantages of the flow injection (FI) concept is that it is compatible with virtually all detection techniques. Being a versatile vehicle for enhancing the performance of the individual detection devices, the most spectacular results have possibly been obtained in conjunction with atomic...... absorption spectrometry (AAS). Initially with flame-AAS (fAAS) procedures, later for hydride generation (HG) techniques, and most recently in combination with electrothermal AAS (ETAAS). The common denominator for all these procedures is the inherently precise and strictly reproducible timing in FI from...

  3. Distinct Plasma Profile of Polar Neutral Amino Acids, Leucine, and Glutamate in Children with Autism Spectrum Disorders

    Science.gov (United States)

    Tirouvanziam, Rabindra; Obukhanych, Tetyana V.; Laval, Julie; Aronov, Pavel A.; Libove, Robin; Banerjee, Arpita Goswami; Parker, Karen J.; O'Hara, Ruth; Herzenberg, Leonard A.; Herzenberg, Leonore A.; Hardan, Antonio Y.

    2012-01-01

    The goal of this investigation was to examine plasma amino acid (AA) levels in children with Autism Spectrum Disorders (ASD, N = 27) and neuro-typically developing controls (N = 20). We observed reduced plasma levels of most polar neutral AA and leucine in children with ASD. This AA profile conferred significant post hoc power for discriminating…

  4. Moessbauer spectrometer MsAa-3

    International Nuclear Information System (INIS)

    Gornicki, R.; Blachowski, A.; Ruebenbauer, K.

    2007-01-01

    The paper is aimed at the description of the newly developed Moessbauer spectrometer MsAa-3. The spectrometer MsAa-3 consists of a high quality γ--ray spectrometer including either a proportional gas detector head or a scintillation detector head, a transducer driving system including the transducer, data storage system, and data communication system based on the TCP/IP protocol. Additionally, the Michelson-Morley interferometer is provided for precise calibration of the transducer velocity. The spectrometer is equipped with an integrated simple temperature controller. All the essential functions are remotely controlled over the TCP/IP link allowing for the spectrometer set-up as the stand-alone unit in the computer network, e.g. on the Internet. External γ-ray detectors or external complete nuclear blocks could be used as well. The spectrometer is equipped with software allowing for setting all the functions, to perform on-line control, and retrieve data. The Moessbauer data processing software MOSGRAF is enclosed as well. The latter software allows for the calculation of the variety of velocity reference functions. (authors)

  5. Transcriptome profiling of the intoxication response of Tenebrio molitor larvae to Bacillus thuringiensis Cry3Aa protoxin.

    Science.gov (United States)

    Oppert, Brenda; Dowd, Scot E; Bouffard, Pascal; Li, Lewyn; Conesa, Ana; Lorenzen, Marcé D; Toutges, Michelle; Marshall, Jeremy; Huestis, Diana L; Fabrick, Jeff; Oppert, Cris; Jurat-Fuentes, Juan Luis

    2012-01-01

    Bacillus thuringiensis (Bt) crystal (Cry) proteins are effective against a select number of insect pests, but improvements are needed to increase efficacy and decrease time to mortality for coleopteran pests. To gain insight into the Bt intoxication process in Coleoptera, we performed RNA-Seq on cDNA generated from the guts of Tenebrio molitor larvae that consumed either a control diet or a diet containing Cry3Aa protoxin. Approximately 134,090 and 124,287 sequence reads from the control and Cry3Aa-treated groups were assembled into 1,318 and 1,140 contigs, respectively. Enrichment analyses indicated that functions associated with mitochondrial respiration, signalling, maintenance of cell structure, membrane integrity, protein recycling/synthesis, and glycosyl hydrolases were significantly increased in Cry3Aa-treated larvae, whereas functions associated with many metabolic processes were reduced, especially glycolysis, tricarboxylic acid cycle, and fatty acid synthesis. Microarray analysis was used to evaluate temporal changes in gene expression after 6, 12 or 24 h of Cry3Aa exposure. Overall, microarray analysis indicated that transcripts related to allergens, chitin-binding proteins, glycosyl hydrolases, and tubulins were induced, and those related to immunity and metabolism were repressed in Cry3Aa-intoxicated larvae. The 24 h microarray data validated most of the RNA-Seq data. Of the three intoxication intervals, larvae demonstrated more differential expression of transcripts after 12 h exposure to Cry3Aa. Gene expression examined by three different methods in control vs. Cry3Aa-treated larvae at the 24 h time point indicated that transcripts encoding proteins with chitin-binding domain 3 were the most differentially expressed in Cry3Aa-intoxicated larvae. Overall, the data suggest that T. molitor larvae mount a complex response to Cry3Aa during the initial 24 h of intoxication. Data from this study represent the largest genetic sequence dataset for T. molitor

  6. Transcriptome profiling of the intoxication response of Tenebrio molitor larvae to Bacillus thuringiensis Cry3Aa protoxin.

    Directory of Open Access Journals (Sweden)

    Brenda Oppert

    Full Text Available Bacillus thuringiensis (Bt crystal (Cry proteins are effective against a select number of insect pests, but improvements are needed to increase efficacy and decrease time to mortality for coleopteran pests. To gain insight into the Bt intoxication process in Coleoptera, we performed RNA-Seq on cDNA generated from the guts of Tenebrio molitor larvae that consumed either a control diet or a diet containing Cry3Aa protoxin. Approximately 134,090 and 124,287 sequence reads from the control and Cry3Aa-treated groups were assembled into 1,318 and 1,140 contigs, respectively. Enrichment analyses indicated that functions associated with mitochondrial respiration, signalling, maintenance of cell structure, membrane integrity, protein recycling/synthesis, and glycosyl hydrolases were significantly increased in Cry3Aa-treated larvae, whereas functions associated with many metabolic processes were reduced, especially glycolysis, tricarboxylic acid cycle, and fatty acid synthesis. Microarray analysis was used to evaluate temporal changes in gene expression after 6, 12 or 24 h of Cry3Aa exposure. Overall, microarray analysis indicated that transcripts related to allergens, chitin-binding proteins, glycosyl hydrolases, and tubulins were induced, and those related to immunity and metabolism were repressed in Cry3Aa-intoxicated larvae. The 24 h microarray data validated most of the RNA-Seq data. Of the three intoxication intervals, larvae demonstrated more differential expression of transcripts after 12 h exposure to Cry3Aa. Gene expression examined by three different methods in control vs. Cry3Aa-treated larvae at the 24 h time point indicated that transcripts encoding proteins with chitin-binding domain 3 were the most differentially expressed in Cry3Aa-intoxicated larvae. Overall, the data suggest that T. molitor larvae mount a complex response to Cry3Aa during the initial 24 h of intoxication. Data from this study represent the largest genetic sequence

  7. Regulation of amino acid transporters in the mammary gland from late pregnancy to peak lactation in the sow.

    Science.gov (United States)

    Chen, Fang; Zhang, Shihai; Deng, Zixiao; Zhou, Qiqi; Cheng, Lin; Kim, Sung Woo; Chen, Jun; Guan, Wutai

    2018-01-01

    Milk protein is crucial for milk quality in sows and health of newborn piglets. Plasma amino acids (AA) in sows are important precursors for milk protein synthesis in the mammary gland. In order to study the regulation of AA transported in sow mammary glands and possible underlying mechanisms, we measured the expression of genes coding for milk proteins, AA transporter expressions, and plasma AA concentrations in sows at three different physiological stages (D-17, D1 and D17 of lactation), and then further investigated the regulation of AA transport across the cell membrane by adaptive mechanisms using pig mammary epithelial cells (PMEC) as an in vitro model. PMEC were cultured in DMEM:F12 with 4 amino acid concentrations (0 × AA complex, 1 × AA complex, 5 × AA complex, and 25 × AA complex). Classes of AA complexes evaluated in this study included neutral AAs ( L -Ala + L -Ser +  L -Cys), acidic AAs ( L -Asp, L -Glu) and neutral + basic AAs ( L -Ala + L -Ser +  L -Cys +  L -Lys). Our results indicated that mRNA expression of genes coding for milk protein (αs1-casein, αs2-casein, β-casein and κ-casein) increased significantly with the advance of physiological stage ( P  SLC1A4 , and SLC6A14 also increased in EBSS cell medium compared to DMEM/F12. However, only mRNA expression of SLC38A decreased when AA complex was added into EBSS ( P  < 0.05). AA transportation was positively regulated in sow mammary glands with the advance of physiological stage from late pregnancy to peak of lactation and AA transporters in PMECs were adaptively regulated by changed AA concentrations.

  8. Bacillus thuringiensis Cry3Aa protoxin intoxication of Tenebrio molitor induces widespread changes in the expression of serine peptidase transcripts.

    Science.gov (United States)

    Oppert, Brenda; Martynov, Alexander G; Elpidina, Elena N

    2012-09-01

    The yellow mealworm, Tenebrio molitor, is a pest of stored grain products and is sensitive to the Bacillus thuringiensis (Bt) Cry3Aa toxin. As digestive peptidases are a determining factor in Cry toxicity and resistance, we evaluated the expression of peptidase transcripts in the midgut of T. molitor larvae fed either a control or Cry3Aa protoxin diet for 24 h (RNA-Seq), or in larvae exposed to the protoxin for 6, 12, or 24 h (microarrays). Cysteine peptidase transcripts (9) were similar to cathepsins B, L, and K, and their expression did not vary more than 2.5-fold in control and Cry3Aa-treated larvae. Serine peptidase transcripts (48) included trypsin, chymotrypsin and chymotrypsin-like, elastase 1-like, and unclassified serine peptidases, as well as homologs lacking functional amino acids. Highly expressed trypsin and chymotrypsin transcripts were severely repressed, and most serine peptidase transcripts were expressed 2- to 15-fold lower in Cry3Aa-treated larvae. Many serine peptidase and homolog transcripts were found only in control larvae. However, expression of a few serine peptidase transcripts was increased or found only in Cry3Aa-treated larvae. Therefore, Bt intoxication significantly impacted the expression of serine peptidases, potentially important in protoxin processing, while the insect maintained the production of critical digestive cysteine peptidases. Published by Elsevier Inc.

  9. Valorizing Dairy Waste: Thermophilic Biosynthesis of a Novel Ascorbic Acid Derivative.

    Science.gov (United States)

    Yang, Jingwen; Pérez, Bianca; Anankanbil, Sampson; Li, Jingbo; Zhou, Ye; Gao, Renjun; Guo, Zheng

    2017-10-18

    l-Ascorbic acid (l-AA) is an essential nutrient that is extremely unstable and cannot be synthesized by the human body. Therefore, attempts have been performed to develop biologically active l-AA derivatives with improved stability. This work presents a facile, scalable, and efficient enzymatic transgalactosylation of lactose to l-AA using β-glucosidase (TN0602) from Thermotoga naphthophila RKU-10. β-Glucosidase TN0602 displays high transgalactosylation activity at pH 5.0, 75 °C, and l-AA/lactose ratio of 2:1 to form a novel l-AA derivative [2-O-β-d-galactopyranosyl-l-ascorbic acid (l-AA-Gal)] with a maximal productivity of 138.88 mmol L -1 in 12 h, which is higher than most reports of enzymatic synthesis of l-AA-α-glucoside. Synthetic l-AA-Gal retains most l-AA antioxidant capability and presents dramatically higher stability than l-AA in an oxidative environment (Cu 2+ ). In conclusion, this work reports a new way to valorize dairy waste lactose into a novel molecule l-AA-Gal, which could be a promising l-AA derivative to be used in a wide range of applications.

  10. An equation to estimate the difference between theoretically predicted and SDS PAGE-displayed molecular weights for an acidic peptide.

    Science.gov (United States)

    Guan, Yihong; Zhu, Qinfang; Huang, Delai; Zhao, Shuyi; Jan Lo, Li; Peng, Jinrong

    2015-08-27

    The molecular weight (MW) of a protein can be predicted based on its amino acids (AA) composition. However, in many cases a non-chemically modified protein shows an SDS PAGE-displayed MW larger than its predicted size. Some reports linked this fact to high content of acidic AA in the protein. However, the exact relationship between the acidic AA composition and the SDS PAGE-displayed MW is not established. Zebrafish nucleolar protein Def is composed of 753 AA and shows an SDS PAGE-displayed MW approximately 13 kDa larger than its predicted MW. The first 188 AA in Def is defined by a glutamate-rich region containing ~35.6% of acidic AA. In this report, we analyzed the relationship between the SDS PAGE-displayed MW of thirteen peptides derived from Def and the AA composition in each peptide. We found that the difference between the predicted and SDS PAGE-displayed MW showed a linear correlation with the percentage of acidic AA that fits the equation y = 276.5x - 31.33 (x represents the percentage of acidic AA, 11.4% ≤ x ≤ 51.1%; y represents the average ΔMW per AA). We demonstrated that this equation could be applied to predict the SDS PAGE-displayed MW for thirteen different natural acidic proteins.

  11. cDNA cloning and expression of Bacillus thuringiensis Cry1Aa toxin binding 120 kDa aminopeptidase N from Bombyx mori.

    Science.gov (United States)

    Yaoi, K; Nakanishi, K; Kadotani, T; Imamura, M; Koizumi, N; Iwahana, H; Sato, R

    1999-01-18

    Bacillus thuringiensis Cry1Aa toxin binds to a 120 kDa putative receptor protein in the Bombyx mori midgut. Recently, this protein was purified and identified as glycosyl-phosphatidylinositol (GPI) anchored aminopeptidase N (APN). In this study, a full-length cDNA thought to encode this 120 kDa APN was isolated and sequenced. It has a 2958 bp ORF encoding 986 amino acids. In the deduced amino acid sequence, we identified GPI-anchor and zinc-metallopeptidase signals, which are the same as those of APNs of other insects that are reported to be putative Cry1 toxin receptors. The B. mori APN amino acid sequence also has a high similarity with those of the other APNs. Subsequently, the recombinant APN was expressed by Escherichia coli and its Cry1Aa toxin binding ability was analyzed. Ligand blotting showed that Cry1Aa toxin bound to the recombinant APN.

  12. Adsorption characteristics of anionic nutrients onto the PP-g-AA-Am non-woven fabric prepared by photoinduced graft and subsequent chemical modification.

    Science.gov (United States)

    Park, Hyun-Ju; Na, Choon-Ki

    2009-07-30

    PP-g-AA-Am non-woven fabric, which possesses anionic exchangeable function, was prepared by chemical modification of carboxyl group in PP-g-AA non-woven fabric to amine group using diethylene triamine. Its sorption characteristics for anionic nutrients including isotherm, kinetics, effects of pH and co-anions, and regeneration efficiency were studied by batch sorption experiments. Sorption equilibriums of PO(4)-P on PP-g-AA-Am fabric were well described by the Langmuir isotherm model, and their sorption energies were ranged between 9.94 and 15.96 kJ/mol indicating an ion exchange process as primary sorption mechanism. Sorption kinetic data fitted with pseudo-second-order kinetic model and indicated that both external and intraparticle diffusion took part in sorption processes. The uptake of PO(4)-P by PP-g-AA-Am fabric increased with increasing pH of solution and its optimum pH region was in pH >or=4, whereas the uptake of NO(3)-N and NO(2)-N was higher in weak and strong acidic pH region, respectively. The sorption selectivity for anions by PP-g-AA-Am fabric was increased in the order: SO(4)>or=PO(4)>NO(3)>Cl. The PP-g-AA-Am fabric could be regenerated by a simple acid washing process without lowering the sorption capacity or physical durability.

  13. Idiopathic systemic AA-amyloidosis in a skunk (Mephitis mephitis).

    Science.gov (United States)

    Elhensheri, Mohamed; Linke, Reinhold P; Blankenburg, Anja; Beineke, Andreas

    2012-03-01

    This report describes a case of systemic amyloidosis in a captive striped skunk. At necropsy, bilateral alopecia, as well as reno-, hepato-, and splenomegaly were present. Congo red staining and immunohistochemistry revealed depositions of AA-amyloid in different organs. The lack of a predisposing disease is suggestive of idiopathic systemic AA-amyloidosis.

  14. Partially melted zone cracking in AA6061 welds

    International Nuclear Information System (INIS)

    Prasad Rao, K.; Ramanaiah, N.; Viswanathan, N.

    2008-01-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043

  15. Partially melted zone cracking in AA6061 welds

    Energy Technology Data Exchange (ETDEWEB)

    Prasad Rao, K. [Department of Metallurgical and Materials Engineering, Indian Institute of Technology Madras, Chennai (India)], E-mail: kpr@iitm.ac.in; Ramanaiah, N. [Sri Kalahasteeswara Institute of Technology, Srikalahasti (India); Viswanathan, N. [Defence Research and Development Laboratory, Hyderabad (India)

    2008-07-01

    Partially melted zone (PMZ) cracking susceptibility in AA6061 alloy was studied. Role of prior thermal history, gas tungsten arc welding techniques such as continuous current (CC) and pulsed current (PC) and use of different fillers (AA4043 and AA5356) were studied. Role of different grain refiners such as scandium, zirconium and Tibor in the above fillers was studied. Varestraint test was used to study the PMZ cracking susceptibility. Metallurgical analysis was done to corroborate the results. PMZ cracking was severe in T6 temper than in T4 irrespective of filler material. PMZ cracking susceptibility was more with AA5356 than in AA4043. It was less with pulsed current GTAW. PMZ cracking susceptibility was reduced with addition of grain refiners. Out of all, lowest PMZ cracking susceptibility was observed with 0.5%Sc addition to fusion zone through AA4043 filler and PC technique. The concentrations of magnesium and silicon were reduced at the PMZ grain boundaries with grain refiner additions to fusion zone through AA5356 or AA4043.

  16. The Use of Soil Palynomorphs in Forensics * ABDULRAHAMAN, AA ...

    African Journals Online (AJOL)

    ADOWIE PERE

    The Use of Soil Palynomorphs in Forensics. *. 1. ABDULRAHAMAN, AA;. 2. AL SAHLI, AA;. 1. OKOLI, JU. 1Applied Plant Anatomy and Wood Technology Laboratory, Department of Plant Biology, University of Ilorin, Ilorin, Nigeria. 2Department of Botany and Microbiology, College of Science, King Saud University, Riyadh, ...

  17. Evolution of geomagnetic aa index near sunspot minimum

    Directory of Open Access Journals (Sweden)

    R. P. Kane

    2002-10-01

    Full Text Available The smoothed values of the minima of sunspot number Rz and the geomagnetic index aa were compared for sunspot cycles 12–23. In one cycle, aa(min occurred earlier than Rz(min, but remained at that low from a few months before Rz(min to a few months after Rz(min. In two cycles, Rz(min and aa(min coincided within a month or two. In nine cycles, aa(min occurred more than three months later than Rz(min. The aa(min coincided with the minima of some solar radio emission indices originating in the solar corona. For sunspot cycles 21, 22, 23, the minimum of solar wind velocity V occurred 0–9 months later than the aa(min. The minimum of solar wind total magnetic field B occurred near Rz(min. The solar wind ion density N had maxima (instead of minima near Rz(min, and again near Rz(max, indicating a  ~5-year periodicity, instead of an 11-year periodicity. The maxima of aa, V and B occurred near Rz(max and/or later in the declining phase of Rz. The aa index was very well correlated with the functions BV and BV 2.Key words. Geomagnetism and paleomagnetism (time variations, diurnal to secular – time variations, secular and long term Interplanetary physics (interplanetary magnetic field

  18. Media optimization of Parietochloris incisa for arachidonic acid accumulation in an outdoor vertical tubular photobioreactor

    OpenAIRE

    Tababa, Hazel Guevarra; Hirabayashi, Seishiro; Inubushi, Kazuyuki

    2011-01-01

    The green alga Parietochloris incisa contains a significant amount of the nutritionally valuable polyunsaturated fatty acid and arachidonic acid (AA) and is being considered for mass cultivation for commercial AA production. This study was primarily aimed to define a practical medium formulation that can be used in commercial mass cultivation that will contribute to a substantial increase in the AA productivity of P. incisa with concomitant reduction of nutritional cost. The effect of nutrien...

  19. AA, shims and washers on quadrupole ends

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    Due to the fact that much of the field of the quadrupoles was outside the iron (in particular with the wide quadrupoles) and that thus the fields of quadrupoles and bending magnets interacted, the lattice properties of the AA could not be predicted with the required accuracy. After a first running period in 1980, during which detailed measurements were made with proton test beams, corrections to the quadrupoles were made in 1981, in the form of laminated shims at the ends of the poles, and with steel washers. With the latter ones, further refinements were made in an iterative procedure with measurements on the circulating beam. This eventually resulted, amongst other things, in a very low chromaticity, with the Q-values being constant to within +- 0.001 over the total momentum range of 6 %. Here we see the shims and washers on a narrow qudrupole (QFN, QDN). See also 8103203, 8103204, 8103205, 8103206.

  20. Hot stamping of AA7075 aluminum sheets

    Science.gov (United States)

    Mendiguren, J.; Saenz de Argandona, E.; Galdos, L.

    2016-11-01

    In this work the formability of a high strength aluminium alloy (AA7075-T6) for the stamping of an automotive component has been studied. Due to the low formability of the selected alloy, two different heat assisted forming strategies have been analysed. On the one hand, the W-temper process, where the thermal process is carried out prior to the forming operation. On the other hand, the hot stamping process, where the thermal process is carried out at the same time as the forming. The results showed that both technology were able to form the component avoiding any failure of the material. On the contrary, both processes reduced the final mechanical properties of the material compared to the as received material condition. However, the obtained mechanical properties doubled the strength of commonly used 5xxx and 6xxx aluminium alloys.

  1. AAS and spectrophotometric determination of propranolol HCl and metoprolol tartrate.

    Science.gov (United States)

    El-Ries, M A; Abou Attia, F M; Ibrahim, S A

    2000-12-15

    Two simple and accurate spectrophotometric methods are described for the determination of propranolol hydrochloride (I) and metoprolol tartrate (II). The methods are based on the reaction of each drug as a secondary amine: (a) with carbon disulphide, the formed complex extracted into iso-butyl methyl ketone (IBMK) after chelation with Cu(II) ions at pH 7.5, followed by measuring the absorbance at 435.4 nm or indirectly for the drug by flame atomic absorption spectrophotometry (AAS). The calibration graph is linear up to 40 and 60 microg ml(-1) with apparent molar absorptivities of 6.89 x 10(3) and 1.08 x 104 l mol(-1) cm(-1) and correlation coefficients of 0.9994 and 0.9995 for propranolol and metoprolol, respectively; (b) with pi-acceptors, tetracyanoethylene (TCNE), or chloranilic acid (CLA) to give highly coloured complex species. The coloured products are quantitated spectrophotometrically at 415 or 510 nm for the two drugs with TCNE and CLA, respectively, and obey Beer's Law with RSD less than 2.0. The methods were applied to the determination of these drugs in pharmaceutical preparation without interferences.

  2. Dicty_cDB: FC-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA17 (Link to dictyBase) - - - Contig-U15091-1 FC-AA17E (Li...nk to Original site) - - - - - - FC-AA17E 347 Show FC-AA17 Library FC (Link to library) Clone ID FC-AA17 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA17Q.Seq.d/ Representative seq. ID FC-AA...17E (Link to Original site) Representative DNA sequence >FC-AA17 (FC-AA17Q) /CSM/FC/FC-AA/FC-AA17Q.Seq.d/ CCCAAAAGCCCGTAA...GACTCACTGTGTCAAGTGCAACAAACACACCCCACACAAGGTTAC CCAATACAAAGCTGGTAAACCAAGTCTTTTCGCACAAGGTAAAAGACGTTACGATCGTAA ACAA

  3. Dicty_cDB: FCL-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA22 (Link to dictyBase) - G01758 DDB0229949 Contig-U15119-1 FCL-AA...22E (Link to Original site) - - - - - - FCL-AA22E 840 Show FCL-AA22 Library FCL (Link to library) Clone ID FCL-AA...g-U15119-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...22Q.Seq.d/ Representative seq. ID FCL-AA22E (Link to Original site) Representative DNA sequence >FCL-AA22 (FCL-AA...22Q) /CSM/FCL/FCL-AA/FCL-AA22Q.Seq.d/ AAAATGAGCAAAATCTCAAGCGACCAAGTTAGATCAATCGTCTCCCAACTTTTCAAAGAA GCACAAGAATCCAAAA

  4. Dicty_cDB: FC-AA05 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA05 (Link to dictyBase) - G01143 DDB0190243 Contig-U15085-1 FC-AA...05E (Link to Original site) - - - - - - FC-AA05E 675 Show FC-AA05 Library FC (Link to library) Clone ID FC-AA...5-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA05Q.Se...q.d/ Representative seq. ID FC-AA05E (Link to Original site) Representative DNA sequence >FC-AA05 (FC-AA05Q) /CSM/FC/FC-AA/FC-AA...05Q.Seq.d/ AAACAAAAAAAAAAGGTATGGAAATTTTTGCATTTGTACCATTAGCAGTGTTAACAGCAT TATGTGTTGTTATTTCACTCTTTGTTAAAAGAGAGAAA

  5. Dicty_cDB: FC-AA16 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA16 (Link to dictyBase) - G22556 DDB0204121 Contig-U15090-1 FC-AA...16E (Link to Original site) - - - - - - FC-AA16E 933 Show FC-AA16 Library FC (Link to library) Clone ID FC-AA...0-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA16Q.Se...q.d/ Representative seq. ID FC-AA16E (Link to Original site) Representative DNA sequence >FC-AA16 (FC-AA16Q) /CSM/FC/FC-AA/FC-AA...16Q.Seq.d/ GGGCAGGATCATCATTTAATACTAAAGATTCAACAATAATTGCAAAAACTCAATTTTATC AAAAAAATATTCAAATTTATAAAGGTGATCAA

  6. Dicty_cDB: FCL-AA06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA06 (Link to dictyBase) - G24322 DDB0216974 Contig-U15228-1 FCL-AA...06E (Link to Original site) - - - - - - FCL-AA06E 791 Show FCL-AA06 Library FCL (Link to library) Clone ID FCL-AA...g-U15228-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...06Q.Seq.d/ Representative seq. ID FCL-AA06E (Link to Original site) Representative DNA sequence >FCL-AA06 (FCL-AA...06Q) /CSM/FCL/FCL-AA/FCL-AA06Q.Seq.d/ AAAATCCCAATTTCATTAGCAGTGGAAGTAACGGAATGAATTGGGGTGGTTCTTTGAACA CTTGTGACTCTGGAGGATTCAA

  7. Dicty_cDB: FC-AA15 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA15 (Link to dictyBase) - G01144 DDB0204372 Contig-U15089-1 FC-AA...15E (Link to Original site) - - - - - - FC-AA15E 522 Show FC-AA15 Library FC (Link to library) Clone ID FC-AA...9-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA15Q.Se...q.d/ Representative seq. ID FC-AA15E (Link to Original site) Representative DNA sequence >FC-AA15 (FC-AA15Q) /CSM/FC/FC-AA/FC-AA...15Q.Seq.d/ CAAATCACACATAAAAGTTTAATATAAAAATGGGTACACCAATTAAAAAGATTAGTACAG TAATTATTAAAATGGTTTCATCAGCCAA

  8. Dicty_cDB: FC-AA21 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA21 (Link to dictyBase) - - - Contig-U15450-1 FC-AA21E (Li...nk to Original site) - - - - - - FC-AA21E 839 Show FC-AA21 Library FC (Link to library) Clone ID FC-AA21 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA21Q.Seq.d/ Representative seq. ID FC-AA...21E (Link to Original site) Representative DNA sequence >FC-AA21 (FC-AA21Q) /CSM/FC/FC-AA/FC-AA21Q.Seq.d/ AATTATTTTCATTAA...TTTTAGCTTTATTCCTTGTCAACTCCGCTGTTGTCTCTTCACTCG ACTCATGTAGTATTTGTGTTGATTTTGTTGGTAACTCACTCAATGATCTTTTAAATATTA TCCTTAA

  9. Dicty_cDB: FCL-AA23 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA23 (Link to dictyBase) - G01759 DDB0201558 Contig-U15118-1 FCL-AA...23E (Link to Original site) - - - - - - FCL-AA23E 1045 Show FCL-AA23 Library FCL (Link to library) Clone ID FCL-AA...ig-U15118-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...23Q.Seq.d/ Representative seq. ID FCL-AA23E (Link to Original site) Representative DNA sequence >FCL-AA23 (FCL-AA...23Q) /CSM/FCL/FCL-AA/FCL-AA23Q.Seq.d/ ATAACTATATAACTATGTCTAACCAAAAGAAAAACGACGTATCTTCATTTGTTAAAGATT CTTTAA

  10. Dicty_cDB: FCL-AA18 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA18 (Link to dictyBase) - G24323 DDB0191144 Contig-U15229-1 FCL-AA...18Z (Link to Original site) - - FCL-AA18Z 623 - - - - Show FCL-AA18 Library FCL (Link to library) Clone ID FCL-AA...g-U15229-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...18Q.Seq.d/ Representative seq. ID FCL-AA18Z (Link to Original site) Representative DNA sequence >FCL-AA18 (FCL-AA...18Q) /CSM/FCL/FCL-AA/FCL-AA18Q.Seq.d/ XXXXXXXXXXGTCAATGTCATTATTGGTGAACAATCTGATGGTTCGTTGGAACAAATCGC TAGAAATCCACAACCAA

  11. Dicty_cDB: FC-AA22 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FC (Link to library) FC-AA22 (Link to dictyBase) - - - Contig-U14948-1 FC-AA22E (Li...nk to Original site) - - - - - - FC-AA22E 576 Show FC-AA22 Library FC (Link to library) Clone ID FC-AA22 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AA/FC-AA22Q.Seq.d/ Representative seq. ID FC-AA...22E (Link to Original site) Representative DNA sequence >FC-AA22 (FC-AA22Q) /CSM/FC/FC-AA/FC-AA22Q.Seq.d/ ATGAA...TACGATGATAGTGATTCAGACTTTTGACCAATTGAAAAAACCAGCAACAGAAATG GTACTGGTTTGGTCTCCTCCACTTTTAAGGTTGCCCCTTCCTTCTCTACCATTCAAAAAC AACAA

  12. States' Flexibility Waiver Plans for Alternate Assessments Based on Alternate Achievement Standards (AA-AAS). Synthesis Report 96

    Science.gov (United States)

    Lazarus, Sheryl S.; Edwards, Lynn M.; Thurlow, Martha L.; Hodgson, Jennifer R.

    2014-01-01

    All states have alternate assessments based on alternate achievement standards (AA-AAS) for students with the most significant cognitive disabilities. For accountability purposes, the Elementary and Secondary Education Act (ESEA) allows up to 1% of students to be counted as proficient with this assessment option. In 2011 the U.S. Department of…

  13. Ameliorative effects of ascorbic acid on rectal temperature ...

    African Journals Online (AJOL)

    This experiment was performed with the aim of investigating the effects of ascorbic acid (AA) on stress due to road transportation of rabbits. Nine rabbits administered AA served as the treated animals, while seven others given sterile water were used as the controls. All the rabbits were transported by road for 2 h under ...

  14. Modulatory Role of Ascorbic Acid on Behavioural Responses of Pigs ...

    African Journals Online (AJOL)

    Experiments were performed on adult local pigs with the aim of investigating the modulatory role of ascorbic acid (AA) on their behavioural responses to 4-h, road transportation during the harmattan season. Sixteen adult pigs administered with AA at the dose of 250 mg/kg dissolve in sterile water served as experimental ...

  15. Ascorbic acid promotes a TGFβ1-induced myofibroblast phenotype switch

    NARCIS (Netherlands)

    Piersma, Bram; Wouters, Olaf Y; de Rond, Saskia; Boersema, Miriam; Gjaltema, Rutger A F; Bank, Ruud A

    2017-01-01

    l-Ascorbic acid (AA), generally known as vitamin C, is a crucial cofactor for a variety of enzymes, including prolyl-3-hydroxylase (P3H), prolyl-4-hydroxylase (P4H), and lysyl hydroxylase (LH)-mediated collagen maturation. Here, we investigated whether AA has additional functions in the regulation

  16. Effect of supplemental Ascorbic acid and disturbance stress on the ...

    African Journals Online (AJOL)

    The study was conducted with four hundred day-old Anak broilers to determine the effects of dietary Ascorbic acid (AA) and disturbance (D) dress on the performance of broiler chickens in a tropical environment. There were four treatments consisting of two levels of disturbance (ID) and (4D) and two levels of dietary AA (0 ...

  17. ASCORBID ACID IS DECREASED IN INDUCED SPUTUM OF MILD ASTHMATICS

    Science.gov (United States)

    ABSTRACTEvidence suggests that the antioxidant ascorbic acid (AA), plays an essential role in defending against oxidant attack in the airways. Decreased levels of AA have been reported in asthmatics but not at the site directly proximal to asthma pathology, i.e. the bronchial...

  18. Ameliorative effects of ascorbic acid on rectal temperature ...

    African Journals Online (AJOL)

    Jane

    2011-08-29

    Aug 29, 2011 ... This experiment was performed with the aim of investigating the effects of ascorbic acid (AA) on stress due to road transportation ... evaluate the role of AA on rectal temperature (RT), behavioural and liveweight ... (Electron thermometer, COCET, China) for about 1 to 2 min into the rectum of each rabbit until ...

  19. Role of N-Arachidonoyl-Serotonin (AA-5-HT) in Sleep-Wake Cycle Architecture, Sleep Homeostasis, and Neurotransmitters Regulation.

    Science.gov (United States)

    Murillo-Rodríguez, Eric; Di Marzo, Vincenzo; Machado, Sergio; Rocha, Nuno B; Veras, André B; Neto, Geraldo A M; Budde, Henning; Arias-Carrión, Oscar; Arankowsky-Sandoval, Gloria

    2017-01-01

    The endocannabinoid system comprises several molecular entities such as endogenous ligands [anandamide (AEA) and 2-arachidonoylglycerol (2-AG)], receptors (CB 1 and CB 2 ), enzymes such as [fatty acid amide hydrolase (FAHH) and monoacylglycerol lipase (MAGL)], as well as the anandamide membrane transporter. Although the role of this complex neurobiological system in the sleep-wake cycle modulation has been studied, the contribution of the blocker of FAAH/transient receptor potential cation channel subfamily V member 1 (TRPV1), N -arachidonoyl-serotonin (AA-5-HT) in sleep has not been investigated. Thus, in the present study, varying doses of AA-5-HT (5, 10, or 20 mg/Kg, i.p.) injected at the beginning of the lights-on period of rats, caused no statistical changes in sleep patterns. However, similar pharmacological treatment given to animals at the beginning of the dark period decreased wakefulness (W) and increased slow wave sleep (SWS) as well as rapid eye movement sleep (REMS). Power spectra analysis of states of vigilance showed that injection of AA-5-HT during the lights-off period diminished alpha spectrum across alertness in a dose-dependent fashion. In opposition, delta power spectra was enhanced as well as theta spectrum, during SWS and REMS, respectively. Moreover, the highest dose of AA-5-HT decreased wake-related contents of neurotransmitters such as dopamine (DA), norepinephrine (NE), epinephrine (EP), serotonin (5-HT) whereas the levels of adenosine (AD) were enhanced. In addition, the sleep-inducing properties of AA-5-HT were confirmed since this compound blocked the increase in W caused by stimulants such as cannabidiol (CBD) or modafinil (MOD) during the lights-on period. Additionally, administration of AA-5-HT also prevented the enhancement in contents of DA, NE, EP, 5-HT and AD after CBD of MOD injection. Lastly, the role of AA-5-HT in sleep homeostasis was tested in animals that received either CBD or MOD after total sleep deprivation (TSD). The

  20. Role of N-Arachidonoyl-Serotonin (AA-5-HT in Sleep-Wake Cycle Architecture, Sleep Homeostasis, and Neurotransmitters Regulation

    Directory of Open Access Journals (Sweden)

    Eric Murillo-Rodríguez

    2017-05-01

    Full Text Available The endocannabinoid system comprises several molecular entities such as endogenous ligands [anandamide (AEA and 2-arachidonoylglycerol (2-AG], receptors (CB1 and CB2, enzymes such as [fatty acid amide hydrolase (FAHH and monoacylglycerol lipase (MAGL], as well as the anandamide membrane transporter. Although the role of this complex neurobiological system in the sleep–wake cycle modulation has been studied, the contribution of the blocker of FAAH/transient receptor potential cation channel subfamily V member 1 (TRPV1, N-arachidonoyl-serotonin (AA-5-HT in sleep has not been investigated. Thus, in the present study, varying doses of AA-5-HT (5, 10, or 20 mg/Kg, i.p. injected at the beginning of the lights-on period of rats, caused no statistical changes in sleep patterns. However, similar pharmacological treatment given to animals at the beginning of the dark period decreased wakefulness (W and increased slow wave sleep (SWS as well as rapid eye movement sleep (REMS. Power spectra analysis of states of vigilance showed that injection of AA-5-HT during the lights-off period diminished alpha spectrum across alertness in a dose-dependent fashion. In opposition, delta power spectra was enhanced as well as theta spectrum, during SWS and REMS, respectively. Moreover, the highest dose of AA-5-HT decreased wake-related contents of neurotransmitters such as dopamine (DA, norepinephrine (NE, epinephrine (EP, serotonin (5-HT whereas the levels of adenosine (AD were enhanced. In addition, the sleep-inducing properties of AA-5-HT were confirmed since this compound blocked the increase in W caused by stimulants such as cannabidiol (CBD or modafinil (MOD during the lights-on period. Additionally, administration of AA-5-HT also prevented the enhancement in contents of DA, NE, EP, 5-HT and AD after CBD of MOD injection. Lastly, the role of AA-5-HT in sleep homeostasis was tested in animals that received either CBD or MOD after total sleep deprivation (TSD. The

  1. Lipoic acid and ascorbic acid affect plasma free amino acids selectively in the teleost fish pacu (Piaractus mesopotamicus).

    Science.gov (United States)

    Terjesen, Bendik F; Park, Kwan; Tesser, Marcelo B; Portella, Maria C; Zhang, Yongfang; Dabrowski, Konrad

    2004-11-01

    Most studies on the antioxidants, lipoic acid (LA) and ascorbic acid (AA), focused on species that, unlike teleost fish, are not scurvy-prone, and are able to synthesize AA. The antioxidant properties of LA may make it useful in aquaculture nutrition, but several effects must first be investigated, and we address here plasma free amino acids (FAA). In mammals, LA and AA in high doses were claimed to alter plasma FAA profile; to our knowledge, however, no data are available in fish. We therefore studied the effects of dietary LA and AA on plasma FAA in the South American teleost fish pacu, which is being used increasingly in aquaculture. LA treatment decreased concentrations of 18 of 23 individual FAA; specifically, dispensable and total FAA were significantly affected. Ornithine was elevated (+26%) in LA-treated fish and significantly decreased ratios of plasma [Arg]/[Orn] and other individual [FAA]/[Orn] were observed. LA and AA both affected sulfur FAA concentrations. Plasma cystine levels were significantly increased in the LA-supplemented groups. AA had little effect on most amino acids, and no interaction with LA was detected. AA supplementation did, however, significantly lower taurine (-42%) and cystathionine (-31%) levels in plasma. No effect on the branched chain:aromatic amino acid ratios was observed. The data indicate that at the dietary level studied, LA and AA independently affect selected plasma FAA in pacu, and suggest that any use of LA in particular as a dietary supplement should take into account an altered plasma FAA profile.

  2. Selected resin acids in effluent and receiving waters derived from a bleached and unbleached kraft pulp and paper mill

    Science.gov (United States)

    Quinn, B.P.; Booth, M.M.; Delfino, J.J.; Holm, S.E.; Gross, T.S.

    2003-01-01

    Water samples were collected on three dates at 24 sites influenced by effluent from Georgia-Pacific's Palatka Pulp and Paper Mill Operation, a bleached and unbleached kraft mill near Palatka, Florida, USA. The sampling sites were located within the mill retention ponds, Rice Creek, and the St. John's River. Samples were analyzed by gas chromatography-mass spectrometry for abietic, dehydroabietic, and isopimaric acids, all of which are potentially toxic by-products of pulp production. Isopimaric acid concentrations greater than 12 mg/L were measured at the mill's effluent outfall but were less than 20 ??g/L at the end of Rice Creek. This result indicates that the waters of Rice Creek provide dilution or conditions conducive for degradation or sorption of these compounds. Large differences in resin acid concentrations were observed between sampling events. In two sampling events, the maximum observed concentrations were less than 2 mg/L for each analyte. In a third sampling event, all of the compounds were detected at concentrations greater than 10 mg/L. Data from the three sample dates showed that resin acid concentrations were below 20 ??g/L before the confluence of Rice Creek and the St. John's River in all cases.

  3. Isolation and characterization of isopimaric acid-degrading bacteria from a sequencing batch reactor.

    Science.gov (United States)

    Wilson, A E; Moore, E R; Mohn, W W

    1996-09-01

    We isolated two aerobic, gram-negative bacteria which grew on the diterpene resin acid isopimaric acid (IpA) as the sole carbon source and electron donor. The source of the isolates was a sequencing batch reactor treating a high-strength process stream from a paper mill. The isolates, IpA-1 and IpA-2, also grew on pimaric and dehydroabietic acids, and IpA-1 grew on abietic acid. Both strains used fatty acids, but neither strain used camphor, sitosterol, or betulin. Strain IpA-1 grew anaerobically with nitrate as an electron acceptor. Strains IpA-1 and IpA-2 had growth yields of 0.19 and 0.23 g of protein per g of IpA, respectively. During growth, both strains transformed IpA carbon to approximately equal amounts of biomass, carbon dioxide, and dissolved organic carbon. In both strains, growth on IpA induced an enzymatic system which caused cell suspensions to transform all four of the above resin acids. Cell suspensions of IpA-1 and IpA-2 removed IpA at rates of 0.56 and 0.13 mumol mg of protein-1 h-1, respectively. Cultures and cell suspensions of both strains failed to completely consume pimaric acid and yielded small amounts of an apparent metabolite from this acid. Cultures and cell suspensions of both strains yielded large amounts of three apparent metabolites from dehydroabietic acid. Analysis of 16S rDNA sequences indicated that the isolates are distinct members of the genus Pseudomonas sensu stricto.

  4. The multiplicity of spinal AA-5-HT anti-nociceptive action in a rat model of neuropathic pain.

    Science.gov (United States)

    Malek, Natalia; Kostrzewa, Magdalena; Makuch, Wioletta; Pajak, Agnieszka; Kucharczyk, Mateusz; Piscitelli, Fabiana; Przewlocka, Barbara; Di Marzo, Vincenzo; Starowicz, Katarzyna

    2016-09-01

    There is considerable evidence to support the role of anandamide (AEA), an endogenous ligand of cannabinoid receptors, in neuropathic pain modulation. AEA also produces effects mediated by other biological targets, of which the transient receptor potential vanilloid type 1 (TRPV1) has been the most investigated. Both, inhibition of AEA breakdown by fatty acid amide hydrolase (FAAH) and blockage of TRPV1 have been shown to produce anti-nociceptive effects. Recent research suggests the usefulness of dual-action compounds, which may afford greater anti-allodynic efficacy. Therefore, in the present study, we examined the effect of N-arachidonoyl-serotonin (AA-5-HT), a blocker of FAAH and TRPV1, in a rat model of neuropathic pain after intrathecal administration. We found that treatment with AA-5-HT increased the pain threshold to mechanical and thermal stimuli, with highest effect at the dose of 500nM, which was most strongly attenuated by AM-630, CB2 antagonist, administration. The single action blockers PF-3845 (1000nM, for FAAH) and I-RTX (1nM, for TRPV1) showed lower efficacy than AA-5-HT. Moreover AA-5-HT (500nM) elevated AEA and palmitoylethanolamide (PEA) levels. Among the possible targets of these mediators, only the mRNA levels of CB2, GPR18 and GPR55, which are believed to be novel cannabinoid receptors, were upregulated in the spinal cord and/or DRG of CCI rats. It was previously reported that AA-5-HT acts in CB1 and TRPV1-dependent manner after systemic administration, but here for the first time we show that AA-5-HT action at the spinal level involves CB2, with potential contributions from GRP18 and/or GPR55 receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Arachidonic acid is a chemoattractant for Dictyostelium discoideum

    Indian Academy of Sciences (India)

    Arachidonic acid is a chemoattractant for Dictyostelium discoideum cells ... Arachidonic acid; chemotaxis; fatty acids; iplA ... Previously, we have shown that arachidonic acid (AA) induces an increase in the cytosolic Ca2+ concentration by causing the release of Ca2+ from intracellular stores and activating influx of ...

  6. Corrosion issues of powder coated AA6060 aluminium profiles

    DEFF Research Database (Denmark)

    Din, Rameez Ud; Valgarðsson, Smári; Jellesen, Morten Stendahl

    2015-01-01

    In this study detailed microstructural investigation of the reason for unexpected corrosion of powder coated aluminium alloy AA6060 windows profiles has been performed. The results from this study reveals that the failure of the window profiles was originated from the surface defects present...... on the extruded AA6060 aluminium profile after metallurgical process prior to powder coating. Surface defects are produced due to intermetallic particles in the alloy, which disturb the flow during the extrusion process. The corrosion mechanism leading to the failure of the powder coated AA6060 aluminium profiles...

  7. Software papers and citation in the AAS Journals

    Science.gov (United States)

    Robitaille, Thomas; Lintott, Chris

    2018-01-01

    At the start of 2016, AAS Publishing released a policy statement that officially opened the door for papers describing novel software to be published in the AAS Journals without a requirement for novel results to also be included. This statement also describes how the use of software should be cited in articles. In this talk, I will give an overview of this policy and will give an overview of the growth of software papers and software citation in AAS Journals over the last two years.

  8. Effect of pressurized steam on AA1050 aluminium

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Møller, Per; Ambat, Rajan

    2012-01-01

    Purpose - The purpose of this paper is to understand the effect of pressurized steam on surface changes, structures of intermetallic particles and corrosion behavior of AA1050 aluminium. Design/methodology/approach - Industrially pure aluminium (AA1050, 99.5 per cent) surfaces were exposed...... reactivities was observed due to the formation of the compact oxide layer. Originality/value - This paper reveals a detailed investigation of how pressurized steam can affect the corrosion behaviour of AA1050 aluminium and the structure of Fe-containing intermetallic particles....

  9. WatAA: Atlas of Protein Hydration. Exploring synergies between data mining and ab initio calculations.

    Science.gov (United States)

    Černý, Jiří; Schneider, Bohdan; Biedermannová, Lada

    2017-07-14

    Water molecules represent an integral part of proteins and a key determinant of protein structure, dynamics and function. WatAA is a newly developed, web-based atlas of amino-acid hydration in proteins. The atlas provides information about the ordered first hydration shell of the most populated amino-acid conformers in proteins. The data presented in the atlas are drawn from two sources: experimental data and ab initio quantum-mechanics calculations. The experimental part is based on a data-mining study of a large set of high-resolution protein crystal structures. The crystal-derived data include 3D maps of water distribution around amino-acids and probability of occurrence of each of the identified hydration sites. The quantum mechanics calculations validate and extend this primary description by optimizing the water position for each hydration site, by providing hydrogen atom positions and by quantifying the interaction energy that stabilizes the water molecule at the particular hydration site position. The calculations show that the majority of experimentally derived hydration sites are positioned near local energy minima for water, and the calculated interaction energies help to assess the preference of water for the individual hydration sites. We propose that the atlas can be used to validate water placement in electron density maps in crystallographic refinement, to locate water molecules mediating protein-ligand interactions in drug design, and to prepare and evaluate molecular dynamics simulations. WatAA: Atlas of Protein Hydration is freely available without login at .

  10. Dicty_cDB: FCL-AA14 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA14 (Link to dictyBase) - G03263 DDB0218474 Contig-U16035-1 FCL-AA...14P (Link to Original site) FCL-AA14F 647 FCL-AA14Z 550 FCL-AA14P 1197 - - Show FCL-AA14 Library F...CL (Link to library) Clone ID FCL-AA14 (Link to dictyBase) Atlas ID - NBRP ID G03263 dictyBase ID DDB0218474... Link to Contig Contig-U16035-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA14Q.Seq.d/ Representative seq. ID FCL-AA14P (Link to Original site) Representative DNA sequence >FCL-AA

  11. Dicty_cDB: FCL-AA19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA19 (Link to dictyBase) - G01757 DDB0230128 Contig-U16036-1 FCL-AA...19P (Link to Original site) FCL-AA19F 246 FCL-AA19Z 568 FCL-AA19P 814 - - Show FCL-AA19 Library FC...L (Link to library) Clone ID FCL-AA19 (Link to dictyBase) Atlas ID - NBRP ID G01757 dictyBase ID DDB0230128 ...Link to Contig Contig-U16036-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA/FCL-AA...19Q.Seq.d/ Representative seq. ID FCL-AA19P (Link to Original site) Representative DNA sequence >FCL-AA

  12. Dicty_cDB: FCL-AA17 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AA17 (Link to dictyBase) - G03264 DDB0191099 Contig-U15602-1 FCL-AA...17P (Link to Original site) FCL-AA17F 547 FCL-AA17Z 610 FCL-AA17P 1157 - - Show FCL-AA17 Library F...CL (Link to library) Clone ID FCL-AA17 (Link to dictyBase) Atlas ID - NBRP ID G03264 dictyBase ID DDB0191099... Link to Contig Contig-U15602-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AA.../FCL-AA17Q.Seq.d/ Representative seq. ID FCL-AA17P (Link to Original site) Representative DNA sequence >FCL-AA

  13. Steam based conversion coating on AA6060 alloy: Effect of sodium silicate chemistry and corrosion performance

    Science.gov (United States)

    Din, Rameez Ud; Bordo, Kirill; Tabrizian, Naja; Jellesen, Morten Stendahl; Ambat, Rajan

    2017-11-01

    Surface treatment of aluminium alloy AA6060 using an industrially applicable pilot steam jet system with and without silicate chemistry has been investigated. Treatment using steam alone and steam with silicate, resulted in an oxide layer formation with thickness ∼425 nm and ∼160 nm, respectively. Moreover, the use of sodium silicate resulted in the formation of distinct microstructure and incorporation of silicate into the oxide film. These oxide films reduced the anodic activity 4 times, while the corrosion protection by silicate containing oxide was the function of its concentration. Further, in acid salt spray and filiform corrosion tests, oxide layer containing silicate exhibited two times higher corrosion resistance.

  14. Microstructure and Salt Fog Corrosion Behavior of AA2219 Friction-Stir-Welded Aluminum Alloy

    Science.gov (United States)

    Srinivasa Rao, G.; Subba Rao, V. V.; Rao, S. R. K.

    2017-07-01

    Plates (8.1-mm-thick) from aluminum alloy AA2219-T87 are studied after friction stir welding. The plates are subjected to salt fog corrosion tests according to ASTM B117 at different pH values and different spraying times. The regions affected by corrosion are studied in different zones of welded joints by the methods of optical and transmission electron microscopy. The corrosion resistance is determined in acid, basic and neutral solutions. The resistances of the base metal and of the zones of welded joints are compared.

  15. Simulation de la formabilite des alliages d'aluminium AA5754 et AA6063

    Science.gov (United States)

    Eljaafari, Samira

    Les besoins de reduction du poids se sont concretement traduits par l'introduction de nouvelles nuances plus legeres dans les structures automobiles. Ainsi, des alliages d'aluminium ont commence a etre integres dans les pieces de structure de plusieurs vehicules. La faible masse volumique des alliages d'aluminium (2,7g/cm3) permet d'alleger le poids du vehicule qui entraine une diminution de la consommation de carburant et, donc, des emissions de gaz a effet de serre. La striction et la rupture sont les principaux modes de defaillance qui entrainent le rebut systematique des pieces. C'est pourquoi, ameliorer la prediction d'apparition de ces defauts lors de la simulation va dans le sens d'une meilleure maitrise du procede. Dans le cadre de ce travail doctoral, deux modeles sont developpes pour simuler le comportement a grandes deformations d'alliages d'aluminium: un modele polycristallin de type Taylor et un modele a un ou plusieurs elements finis par grain. Les diagrammes limites de formage (DLF) pour les deux alliages d'aluminium AA5754 et AA6063 ont ete simules numeriquement en utilisant une formulation par elements finis pour les polycristaux basee sur l'hypothese de Taylor. Les DLF conventionnels et de l'hydroformage ont ete traces. L'effet des chemins de deformation sur la formabilite des alliages d'aluminium a aussi ete etudie. Finalement, des simulations numeriques avec les donnees de diffraction des electrons retrodiffuses (EBSD) pour 1'alliage d'aluminium AA5754 ont ete effectuees en utilisant le modele a un ou plusieurs elements par grain. Ces simulations sont executees avec differents modeles du durcissement (Asaro, Bassani et puissance). Mots-cles: Formabilite; Alliage d'aluminium; Hydroformage; Glissement cristallographique; Durcissement; Calcul parallele; Diagramme limite de formage (DLF); Diffraction electron.

  16. Exogenous amino acids suppress glucose oxidation and potentiate hepatic glucose production in late gestation fetal sheep.

    Science.gov (United States)

    Brown, Laura D; Kohn, Jaden R; Rozance, Paul J; Hay, William W; Wesolowski, Stephanie R

    2017-05-01

    Acute amino acid (AA) infusion increases AA oxidation rates in normal late gestation fetal sheep. Because the fetal oxygen consumption rate does not change with increased AA oxidation, we hypothesized that AA infusion would suppress glucose oxidation pathways and that the additional carbon supply from AA would activate hepatic glucose production. To test this, late gestation fetal sheep were infused intravenously for 3 h with saline or exogenous AA (AA). Glucose tracer metabolic studies were performed and skeletal muscle and liver tissues samples were collected. AA infusion increased fetal arterial plasma branched chain AA, cortisol, and glucagon concentrations. Fetal glucose utilization rates were similar between basal and AA periods, yet the fraction of glucose oxidized and the glucose oxidation rate were decreased by 40% in the AA period. AA infusion increased expression of PDK4 , an inhibitor of glucose oxidation, nearly twofold in muscle and liver. In liver, AA infusion tended to increase PCK1 gluconeogenic gene and PCK1 correlated with plasma cortisol concentrations. AA infusion also increased liver mRNA expression of the lactate transporter gene ( MCT1) , protein expression of GLUT2 and LDHA, and phosphorylation of AMPK, 4EBP1, and S6 proteins. In isolated fetal hepatocytes, AA supplementation increased glucose production and PCK1 , LDHA , and MCT1 gene expression. These results demonstrate that AA infusion into fetal sheep competitively suppresses glucose oxidation and potentiates hepatic glucose production. These metabolic patterns support flexibility in fetal metabolism in response to increased nutrient substrate supply while maintaining a relatively stable rate of oxidative metabolism. Copyright © 2017 the American Physiological Society.

  17. Amino acid composition of rumen bacteria and protozoa in cattle.

    Science.gov (United States)

    Sok, M; Ouellet, D R; Firkins, J L; Pellerin, D; Lapierre, H

    2017-07-01

    Because microbial crude protein (MCP) constitutes more than 50% of the protein digested in cattle, its AA composition is needed to adequately estimate AA supply. Our objective was to update the AA contributions of the rumen microbial AA flowing to the duodenum using only studies from cattle, differentiating between fluid-associated bacteria (FAB), particle-associated bacteria (PAB), and protozoa, based on published literature (53, 16, and 18 treatment means were used for each type of microorganism, respectively). In addition, Cys and Met reported concentrations were retained only when an adequate protection of the sulfur groups was performed before the acid hydrolysis. The total AA (or true protein) fraction represented 82.4% of CP in bacteria. For 10 AA, including 4 essential AA, the AA composition differed between protozoa and bacteria. The most noticeable differences were a 45% lower Lys concentration and 40% higher Ala concentration in bacteria than in protozoa. Differences between FAB and PAB were less pronounced than differences between bacteria and protozoa. Assuming 33% FAB, 50% PAB, and 17% of protozoa in MCP duodenal flow, the updated concentrations of AA would decrease supply estimates of Met, Thr, and Val originating from MCP and increase those of Lys and Phe by 5 to 10% compared with those calculated using the FAB composition reported previously. Therefore, inclusion of the contribution of PAB and protozoa to the duodenal MCP flow is needed to adequately estimate AA supply from microbial origin when a factorial method is used to estimate duodenal AA flow. Furthermore, acknowledging the fact that hydrolysis of 1 kg of true microbial protein yields 1.16 kg of free AA substantially increases the estimates of AA supply from MCP. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. Amino acids – Guidelines on Parenteral Nutrition, Chapter 4

    Directory of Open Access Journals (Sweden)

    Working group for developing the guidelines for parenteral nutrition of The German Association for Nutritional Medicine

    2009-11-01

    Full Text Available Protein catabolism should be reduced and protein synthesis promoted with parenteral nutrion (PN. Amino acid (AA solutions should always be infused with PN. Standard AA solutions are generally used, whereas specially adapted AA solutions may be required in certain conditions such as severe disorders of AA utilisation or in inborn errors of AA metabolism. An AA intake of 0.8 g/kg/day is generally recommended for adult patients with a normal metabolism, which may be increased to 1.2–1.5 g/kg/day, or to 2.0 or 2.5 g/kg/day in exceptional cases. Sufficient non-nitrogen energy sources should be added in order to assure adequate utilisation of AA. A nitrogen calorie ratio of 1:130 to 1:170 (g N/kcal or 1:21 to 1:27 (g AA/kcal is recommended under normal metabolic conditions. In critically ill patients glutamine should be administered parenterally if indicated in the form of peptides, for example 0.3–0.4 g glutamine dipeptide/kg body weight/day (=0.2–0.26 g glutamine/kg body weight/day. No recommendation can be made for glutamine supplementation in PN for patients with acute pancreatitis or after bone marrow transplantation (BMT, and in newborns. The application of arginine is currently not warranted as a supplement in PN in adults. N-acetyl AA are only of limited use as alternative AA sources. There is currently no indication for use of AA solutions with an increased content of glycine, branched-chain AAs (BCAA and ornithine-α-ketoglutarate (OKG in all patients receiving PN. AA solutions with an increased proportion of BCAA are recommended in the treatment of hepatic encephalopathy (III–IV.

  19. d-Amino Acids Are Exuded by Arabidopsis thaliana Roots to the Rhizosphere.

    Science.gov (United States)

    Hener, Claudia; Hummel, Sabine; Suarez, Juan; Stahl, Mark; Kolukisaoglu, Üner

    2018-04-07

    Proteinogenic l-amino acids (l-AAs) are essential in all kingdoms as building blocks of proteins. Their d-enantiomers are also known to fulfill important functions in microbes, fungi, and animals, but information about these molecules in plants is still sparse. Previously, it was shown that d-amino acids (d-AAs) are taken up and utilized by plants, but their ways to reduce excessive amounts of them still remained unclear. Analyses of plant d-AA content after d-Ala and d-Glu feeding opened the question if exudation of d-AAs into the rhizosphere takes place and plays a role in the reduction of d-AA content in plants. The exudation of d-Ala and d-Glu could be confirmed by amino acid analyses of growth media from plants treated with these d-AAs. Further tests revealed that other d-AAs were also secreted. Nevertheless, treatments with d-Ala and d-Glu showed that plants are still able to reduce their contents within the plant without exudation. Further exudation experiments with transport inhibitors revealed that d-AA root exudation is rather passive and comparable to the secretion of l-AAs. Altogether, these observations argued against a dominant role of exudation in the regulation of plant d-AA content, but may influence the composition of the rhizosphere.

  20. Arachidonic Acid Enhances Reproduction in Daphnia magna and Mitigates Changes in Sex Ratios Induced by Pyriproxyfen

    Science.gov (United States)

    Ginjupalli, Gautam K.; Gerard, Patrick D.; Baldwin, William S.

    2016-01-01

    Arachidonic acid (AA) is one of only two unsaturated fatty acids retained in the ovaries of crustaceans, and an inhibitor of HR97g, a nuclear receptor expressed in adult ovaries. We hypothesized that as a key fatty acid, AA may be associated with reproduction and potentially environmental sex determination in Daphnia. Reproduction assays with AA indicate that it alters female/male sex ratios by increasing female production. This reproductive effect only occurred during a restricted P. subcapitata diet. Next, we tested whether enriching a poorer algal diet (C. vulgaris) with AA enhances overall reproduction and sex ratios. AA enrichment of a C. vulgaris diet also enhances fecundity at 1.0 and 4.0μM by 30–40% in the presence and absence of pyriproxyfen. This indicates that AA is crucial in reproduction regardless of environmental sex determination. Furthermore, our data indicates that P. subcapitata may provide a threshold concentration of AA needed for reproduction. Diet switch experiments from P. subcapitata to C. vulgaris mitigate some but not all of AA’s effects when compared to a C. vulgaris only diet, suggesting that some AA provided by P. subcapitata is retained. In summary, AA supplementation increases reproduction and represses pyriproxyfen-induced environmental sex determination in D. magna in restricted diets. A diet rich in AA may provide protection from some reproductive toxicants such as the juvenile hormone agonist, pyriproxyfen. PMID:25393616

  1. Ionization of amphiphilic acidic block copolymers.

    Science.gov (United States)

    Colombani, Olivier; Lejeune, Elise; Charbonneau, Céline; Chassenieux, Christophe; Nicolai, Taco

    2012-06-28

    The ionization behavior of an amphiphilic diblock copolymer poly(n-butyl acrylate(50%)-stat-acrylic acid(50%))(100)-block-poly(acrylic acid)(100) (P(nBA(50%)-stat-AA(50%))(100)-b-PAA(100), DH50) and of its equivalent triblock copolymer P(nBA(50%)-stat-AA(50%))(100)-b-PAA(200)-b-P(nBA(50%)-stat-AA(50%))(100) (TH50) were studied by potentiometric titration either in pure water or in 0.5 M NaCl. These polymers consist of a hydrophilic acidic block (PAA) connected to a hydrophobic block, P(nBA(50%)-stat-AA(50%))(100), whose hydrophobic character has been mitigated by copolymerization with hydrophilic units. We show that all AA units, even those in the hydrophobic block could be ionized. However, the AA units within the hydrophobic block were less acidic than those in the hydrophilic block, resulting in the preferential ionization of the latter block. The preferential ionization of PAA over that of P(nBA(50%)-stat-AA(50%))(100) was stronger at higher ionic strength. Remarkably, the covalent bonds between the PAA and P(nBA(50%)-stat-AA(50%))(100) blocks in the diblock or the triblock did not affect the ionization of each block, although the self-association of the block copolymers into spherical aggregates modified the environment of the PAA blocks compared to when PAA was molecularly dispersed.

  2. A&A Painting and Restoration Co., Inc. Information Sheet

    Science.gov (United States)

    A&A Painting and Restoration Co., Inc. (the Company) is located in Great Mills, Maryland. The settlement involves renovation activities conducted at properties constructed prior to 1978, located in Drayden, Maryland.

  3. LC/ESI-MS/MS method for determination of salivary eicosapentaenoic acid concentration to arachidonic acid concentration ratio.

    Science.gov (United States)

    Ogawa, Shoujiro; Tomaru, Koki; Matsumoto, Nagisa; Watanabe, Shui; Higashi, Tatsuya

    2016-01-01

    A simple liquid chromatography/electrospray ionization-tandem mass spectrometry (LC/ESI-MS/MS) method for determination of the eicosapentaenoic acid (EPA) concentration to arachidonic acid (AA) concentration ratio in human saliva has been developed. The EPA/AA ratio in serum or plasma is widely recognized as a useful indicator in identifying the risk of cardiovascular disease, especially atherosclerosis. The salivary EPA/AA ratio is expected to be a convenient alternative to the serum or plasma EPA/AA ratio, because saliva offers the advantages of easy and noninvasive sampling. The saliva was deproteinized with acetonitrile, purified using an Oasis HLB cartridge, and derivatized with 1-[(4-dimethylaminophenyl)carbonyl]piperazine (DAPPZ). The derivatized EPA and AA were subjected to LC/ESI-MS/MS, and the EPA/AA ratio was determined using the selected reaction monitoring mode. The DAPPZ-derivatization increased the ESI sensitivity by 100- and 300-fold for EPA and AA, respectively, and enabled the detection of trace fatty acids in saliva using a 200 μL sample. The assay reproducibility was satisfactory (relative standard deviation, <5.0%). The method was successfully applied to the measurement of the salivary EPA/AA ratios of healthy Japanese subjects and their changes owing to the supplementation of EPA. Copyright © 2015 John Wiley & Sons, Ltd.

  4. Development of a new analytical method for determination of acetylsalicylic and salicylic acids in tablets by reversed phase liquid chromatography

    OpenAIRE

    Aguiar, José Luiz Neves de; Leandro, Katia Christina; Abrantes, Shirley de Mello Pereira; Albert, André Luis Mazzei

    2009-01-01

    Acetylsalicylic acid (AAS) is a drug utilized as analgesic, anti-inflammatory, and antipyretic medication, available worldwide and commonly used in Brazil. Salicylic acid (AS) is a precursor in AAS synthesis and is also produced during its degradation. The official United States Pharmacopoeia (USP) suggests the determination of these drugs by high performance liquid chromatography (HPLC), with ultraviolet detection, but this method has neither a high sensitivity (S AAS=0.12 mAbs/(μg/mL) ...

  5. Characteristics of AA amyloidosis patients in San Francisco.

    Science.gov (United States)

    Lejmi, Hiba; Jen, Kuang-Yu; Olson, Jean L; James, Sam H; Sam, Ramin

    2016-04-01

    AA amyloidosis due to subcutaneous injection of drugs of abuse has been described in the USA, but all the existing literature is from more than 20 years ago. There is more recent literature from Europe. We have observed a high incidence of AA amyloidosis in the county hospital in San Francisco. Here, we describe 24 patients who had kidney biopsy-proven AA amyloidosis from our hospital from 1998 to 2013. All the patients were thought to have AA amyloidosis from skin popping of illicit drugs after having exhausted the intravenous route. These patients with biopsy-proven AA amyloidosis were analysed further. All patients were found to have hepatitis C infection, hypertension was not common, most had advanced kidney failure, and acidosis was common as was tubulointerstitial involvement on the kidney biopsy. Other organ involvement included hepatomegaly and splenomegaly in a number of patients; direct myocardial involvement was not seen, but pulmonary hypertension, history of deep vein thrombosis and pulmonary embolism were common. The prognosis of these patients was poor. The mortality rate approached 50% 1 year after biopsy, and most of the patient needed dialysis shortly after diagnosis. Cessation of drug use seemed beneficial but rarely achievable. AA amyloidosis from skin popping is common in San Francisco. Most patients with renal involvement end up on dialysis, and mortality rates are exceedingly high. © 2015 Asian Pacific Society of Nephrology.

  6. Bake hardening of nanograin AA7075 aluminum alloy

    International Nuclear Information System (INIS)

    Dehghani, Kamran

    2011-01-01

    Highlights: ► The bake hardening behavior of AA7075 was studied and compared with its coarse-grain counterpart. ► Nanograin AA7075 exhibited 88–100% increase in bake hardenability. ► Nanograin AA7075 exhibited 36–38% increase in final yield strength after baking. ► Maximum bake hardenability and final yield stress were about 185 MPa and 719 MPa. - Abstract: In the present work, the bake hardening of nanostructured AA7075 aluminum alloy was compared with that of its coarse-grain counterpart. Surface severe plastic deformation (SSPD) was used to produce nanograin layers on both surfaces of workpieces. The nanostructured layers were characterized using scanning electron microscopy (SEM) and atomic force microscopy (AFM) techniques. The thickness of nanostructured layer, having the grains of 50–110 nm, was about 75 μm on each side of workpiece. The bake hardenability of nanograin and coarse-grain AA7075 was then compared by pre-straining to 2, 4 and 6% followed by baking at 100 °C and 200 °C for 20 min. Comparing to coarse-grain case, there was about 88–100% increase in bake hardenability and about 36–38% increase in yield strength after the bake hardening of present nanograin AA7075. Such an increase in bake hardenability and strength was achieved when the thickness of two nanograin layers was about only one-tenth of the whole thickness.

  7. Cytopathological effects of Bacillus sphaericus Cry48Aa/Cry49Aa toxin on binary toxin-susceptible and -resistant Culex quinquefasciatus larvae.

    Science.gov (United States)

    de Melo, Janaina Viana; Jones, Gareth Wyn; Berry, Colin; Vasconcelos, Romero Henrique Teixeira; de Oliveira, Cláudia Maria Fontes; Furtado, André Freire; Peixoto, Christina Alves; Silva-Filha, Maria Helena Neves Lobo

    2009-07-01

    The Cry48Aa/Cry49Aa mosquitocidal two-component toxin was recently characterized from Bacillus sphaericus strain IAB59 and is uniquely composed of a three-domain Cry protein toxin (Cry48Aa) and a binary (Bin) toxin-like protein (Cry49Aa). Its mode of action has not been elucidated, but a remarkable feature of this protein is the high toxicity against species from the Culex complex, besides its capacity to overcome Culex resistance to the Bin toxin, the major insecticidal factor in B. sphaericus-based larvicides. The goal of this work was to investigate the ultrastructural effects of Cry48Aa/Cry49Aa on midgut cells of Bin-toxin-susceptible and -resistant Culex quinquefasciatus larvae. The major cytopathological effects observed after Cry48Aa/Cry49Aa treatment were intense mitochondrial vacuolation, breakdown of endoplasmic reticulum, production of cytoplasmic vacuoles, and microvillus disruption. These effects were similar in Bin-toxin-susceptible and -resistant larvae and demonstrated that Cry48Aa/Cry49Aa toxin interacts with and displays toxic effects on cells lacking receptors for the Bin toxin, while B. sphaericus IAB59-resistant larvae did not show mortality after treatment with Cry48Aa/Cry49Aa toxin. The cytopathological alterations in Bin-toxin-resistant larvae provoked by Cry48Aa/Cry49Aa treatment were similar to those observed when larvae were exposed to a synergistic mixture of Bin/Cry11Aa toxins. Such effects seemed to result from a combined action of Cry-like and Bin-like toxins. The complex effects caused by Cry48Aa/Cry49Aa provide evidence for the potential of these toxins as active ingredients of a new generation of biolarvicides that conjugate insecticidal factors with distinct sites of action, in order to manage mosquito resistance.

  8. Influence of Process Parameters in the Friction Surfacing of AA 6082-T6 over AA 2024-T3

    OpenAIRE

    Gandra, J.; Pereira, D.; Miranda, R.M.; Vilaça, P.

    2013-01-01

    VK: T20309 Friction Surfacing is a solid state coating technique with applications in hardfacing, corrosion protection and repair. Since it doesn’t require the fusion of the materials involved, it is suitable to join aluminium alloys while avoiding several of their processing difficulties. The present study addresses the deposition of AA 6082-T6 coatings on AA 2024-T3 substrates, while focusing on the effect of process parameters, such as, axial force, rotation and travel speed. Sound alum...

  9. L-ascorbic acid losses in Kenyan vegetables during cooking as determined by high performance liquid chromatography

    OpenAIRE

    N.M.N. Wekesa; S.C. Chhabra; H.M. Thairu

    2001-01-01

    The loss of L-ascorbic acid (L-AA) in 14 different cooked local vegetables found in Nairobi markets was determined by high performance liquid chromatography. The effect of quantity of water on the loss of L-AA during cooking was studied with cowpea leaves. It was found that more L-AA was lost when larger amount of water was used than when smaller amount was used. The effect of the sharpness of the knife on the loss of L-AA was studied with spinach. It was found that more loss of L-AA occurred...

  10. [Effect of citric acid stimulation on salivary alpha-amylase, total protein, salivary flow rate and pH value in Pi deficiency children].

    Science.gov (United States)

    Yang, Ze-min; Chen, Long-hui; Lin, Jing; Zhang, Min; Yang, Xiao-rong; Chen, Wei-wen

    2015-02-01

    To compare the effect of citric acid stimulation on salivary alpha-amylase (sAA), total protein (TP), salivary flow rate, and pH value between Pi deficiency (PD) children and healthy children, thereby providing evidence for Pi controlling saliva theory. Twenty PD children were recruited, and 29 healthy children were also recruited at the same time. Saliva samples from all subjects were collected before and after citric acid stimulation. The sAA activity and amount, TP contents, salivary flow rate, and pH value were determined and compared. (1) Citric acid stimulation was able to significantly increase salivary flow rate, pH value, sAA activities, sAA specific activity and sAA amount (including glycosylated and non-glycosylated sAA amount) in healthy children (Pvalue, and glycosylated sAA levels in PD children (P0.05), salivary indices except salivary flow rate and glycosylated sAA levels decreased more in PD children. There was statistical difference in sAA activity ratio, sAA specific activity ratio, and the ratio of glycosylated sAA levels between PD children and healthy children (P<0.05). PD children had decreased response to citric acid stimulation.

  11. Factors that affect leaf extracellular ascorbic acid content and redox status

    Energy Technology Data Exchange (ETDEWEB)

    Burkey, K.O.; Fiscus, E.L. [North Carolina State Univ., United States dept. og Agriculture-Agricultural Research Service and Dept. of Crop Science, Raleigh, NC (United States); Eason, G. [North Carolina, State Univ., United States Dept. of Plant Pathology, Raleigh, NC (United States)

    2003-01-01

    Leaf ascorbic acid content and redox status were compared in ozone-tolerant (Provider) and ozone-sensitive (S156) genotypes of snap bean (Phaseolus vulgaris L.). Plants were grown in pots for 24 days under charcoal-filtered air (CF) conditions in open-top field chambers and then maintained as CF controls (29 nmol mol{sup 1} ozone) or exposed to elevated ozone (71 nmol mol{sup 1} ozone). Following a 10-day treatment, mature leaves of the same age were harvested early in the morning (06:00-08:00 h) or in the afternoon (13:00-15:00 h) for analysis of ascorbic acid (AA) and dehydroascorbic acid (DHA). Vacuum infiltration methods were used to separate leaf AA into apoplast and symplast fractions. The total ascorbate content [AA + DHA] of leaf tissue averaged 28% higher in Provider relative to S156, and Provider exhibited a greater capacity to maintain [AA + DHA] content under ozone stress. Apoplast [AA + DHA] content was 2-fold higher in tolerant Provider (360 nmol g{sup 1} FW maximum) relative to sensitive S156 (160 nmol g1 FW maximum) regardless of sampling period or treatment, supporting the hypothesis that extracellular AA is a factor in ozone tolerance. Apoplast [AA + DHA] levels were significantly higher in the afternoon than early morning for both genotypes, evidence for short-term regulation of extracellular ascorbate content. Total leaf ascorbate was primarily reduced with AA/[AA + DHA] ratios of 0.81-0.90. In contrast, apoplast AA/[AA + DHA] ratios were 0.01-0.60 and depended on genotype and ozone treatment. Provider exhibited a greater capacity to maintain extracellular AA/[AA + DHA] ratios under ozone stress, suggesting that ozone tolerance is associated with apoplast ascorbate redox status. (au)

  12. Ruminal bacteria and protozoa composition, digestibility, and amino acid profile determined by multiple hydrolysis times.

    Science.gov (United States)

    Fessenden, S W; Hackmann, T J; Ross, D A; Foskolos, A; Van Amburgh, M E

    2017-09-01

    Microbial samples from 4 independent experiments in lactating dairy cattle were obtained and analyzed for nutrient composition, AA digestibility, and AA profile after multiple hydrolysis times ranging from 2 to 168 h. Similar bacterial and protozoal isolation techniques were used for all isolations. Omasal bacteria and protozoa samples were analyzed for AA digestibility using a new in vitro technique. Multiple time point hydrolysis and least squares nonlinear regression were used to determine the AA content of omasal bacteria and protozoa, and equivalency comparisons were made against single time point hydrolysis. Formalin was used in 1 experiment, which negatively affected AA digestibility and likely limited the complete release of AA during acid hydrolysis. The mean AA digestibility was 87.8 and 81.6% for non-formalin-treated bacteria and protozoa, respectively. Preservation of microbe samples in formalin likely decreased recovery of several individual AA. Results from the multiple time point hydrolysis indicated that Ile, Val, and Met hydrolyzed at a slower rate compared with other essential AA. Singe time point hydrolysis was found to be nonequivalent to multiple time point hydrolysis when considering biologically important changes in estimated microbial AA profiles. Several AA, including Met, Ile, and Val, were underpredicted using AA determination after a single 24-h hydrolysis. Models for predicting postruminal supply of AA might need to consider potential bias present in postruminal AA flow literature when AA determinations are performed after single time point hydrolysis and when using formalin as a preservative for microbial samples. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Effect of heating on the stability of amyloid A (AA) fibrils and the intra- and cross-species transmission of AA amyloidosis.

    Science.gov (United States)

    Ogawa, Saki; Murakami, Tomoaki; Inoshima, Yasuo; Ishiguro, Naotaka

    2015-01-01

    Amyloid A (AA) amyloidosis is a protein misfolding disease characterized by extracellular deposition of AA fibrils. AA fibrils are found in several tissues from food animals with AA amyloidosis. For hygienic purposes, heating is widely used to inactivate microbes in food, but it is uncertain whether heating is sufficient to inactivate AA fibrils and prevent intra- or cross-species transmission. We examined the effect of heating (at 60 °C or 100 °C) and autoclaving (at 121 °C or 135 °C) on murine and bovine AA fibrils using Western blot analysis, transmission electron microscopy (TEM), and mouse model transmission experiments. TEM revealed that a mixture of AA fibrils and amorphous aggregates appeared after heating at 100 °C, whereas autoclaving at 135 °C produced large amorphous aggregates. AA fibrils retained antigen specificity in Western blot analysis when heated at 100 °C or autoclaved at 121 °C, but not when autoclaved at 135 °C. Transmissible pathogenicity of murine and bovine AA fibrils subjected to heating (at 60 °C or 100 °C) was significantly stimulated and resulted in amyloid deposition in mice. Autoclaving of murine AA fibrils at 121 °C or 135 °C significantly decreased amyloid deposition. Moreover, amyloid deposition in mice injected with murine AA fibrils was more severe than that in mice injected with bovine AA fibrils. Bovine AA fibrils autoclaved at 121 °C or 135 °C did not induce amyloid deposition in mice. These results suggest that AA fibrils are relatively heat stable and that similar to prions, autoclaving at 135 °C is required to destroy the pathogenicity of AA fibrils. These findings may contribute to the prevention of AA fibril transmission through food materials to different animals and especially to humans.

  14. Outcomes From AAS Hack Day at the 227th AAS Meeting

    Science.gov (United States)

    Kohler, Susanna

    2016-01-01

    Editors Note:This is a final post from the 227th AAS Meeting in Kissimmee, FL. This special summary of AAS Hack Day, a meeting of AAS members to collaboratively work on various small projects, was written by Meredith Rawls (@Merrdiff) and was originally posted on astrobites.com.As the 227thAmerican Astronomical Society meeting drew to a close (see highlights from Day 1, Day 2, Day 3, and Day 4), a group of at least 50 attendees spent Day 4working on small projects fondly called hacks. Thanks to sponsorship from LSST and Northrup Grumman, the industrious hackers werewell-caffeinated and fed so we could devote time and energy toworking in groups on one-day projects.TheHack Day beganat 10am with pitches. Anybody with a project idea was welcome to briefly speak and try to convince others to work with them. Only someideas panned out, but the enthusiasm was palpable. Its not every day you get a full room of astronomers and affiliates eager to spend hours working on fun and useful projects to benefit the community.#hackAAS is getting underway! #aas227 pic.twitter.com/yX7jlOnSCK James R A Davenport (@jradavenport) January 8, 2016Here is a rundown of what we accomplished. Pretty impressive for a single day! Many thanks to fellow astrobiter Erika Nesvold (now at Carnegie DTM; @erikanesvold) whose hack was live-documenting all the other hacks. Her tweets as @astrobites appeared with the #hackaas hashtag, and her notes made this recap post infinitely easier to write.Interested in joining the fun? Sign up for Hack Day at the 2017 JanuaryAAS meeting (its free with meeting registration), and consider applying for the .Astronomy conference this summer.Towards Optimal Session Scheduling:Adrian Price-Whelan (Columbia), David Hogg (NYU), and Scott Idem (AAS) began writing a program to take all submitted abstracts to a conference like AAS and sort them using keywords to avoid scheduling similar talks in parallel sessions. Its impossible to make everyone happy, but minimizing conflicts

  15. High-energy radiation processing, a smart approach to obtain PVP-graft-AA nanogels

    International Nuclear Information System (INIS)

    Grimaldi, N.; Sabatino, M.A.; Przybytniak, G.; Kaluska, I.; Bondì, M.L.; Bulone, D.; Alessi, S.; Spadaro, G.; Dispenza, C.

    2014-01-01

    Poly(N-vinylpyrrolidone)-grafted-acrylic acid biocompatible nanogels (NGs) were prepared using an exiting industrial-type electron accelerator and setups, starting from semi-dilute aqueous solutions of a commercial PVP and the acrylic acid monomer. As a result, NGs with tunable size and structure can be obtained quantitatively. Sterility was also imparted at the integrated dose absorbed. The chemical structure of the NGs produced was confirmed through Fourier Transformer Infrared Spectroscopy (FT-IR). The molecular and physico-chemical properties of NGs, such as the hydrodynamic dimensions and surface charge densities, for various polymer and monomer concentrations in the irradiated solutions, are discussed here. - Highlights: • Aqueous solutions of PVP and AA were irradiated by industrial electron accelerator. • NGs with different physico-chemical and molecular properties can be obtained. • Carboxyl-functionalized NGs produced are promising building blocks for bio-devices

  16. Interaction of Lysinibacillus sphaericus Cry48Aa/Cry49Aa toxin with midgut brush-border membrane fractions from Culex quinquefasciatus larvae.

    Science.gov (United States)

    Guo, Q-Y; Hu, X-M; Cai, Q-X; Yan, J-P; Yuan, Z-M

    2016-04-01

    The Cry48Aa/Cry49Aa mosquitocidal toxin from Lysinibacillus sphaericus was uniquely composed of a three-domain (Cry) toxin and binary (Bin) toxin-like protein, with high toxicity against Culex spp. However, its mode of action against the target mosquitoes is still unknown. In this study, Cry48Aa, Cry49Aa and its N- and C-terminal truncated proteins were expressed and purified, and the binding affinities of the purified proteins with midgut brush-border membrane fractions (BBMFs) from Culex quin-quefasciatus larvae were performed. The results showed that both Cry48Aa and Cry49Aa have specific and high binding affinity to BBMFs, with dissociation constants of 9.5 ± 1.8 and 25.4 ± 3.8 nM, respectively. Competition assays demonstrated that Cry49Aa C-terminal derivatives were able to bind to the BBMFs, whereas Far-Western dot blot analysis revealed that its N-terminal constructs interacted with Cry48Aa. Nevertheless, larvicidal activity was almost lost when Cry49Aa truncated proteins, either individually or in pairs, combined with Cry48Aa. It is concluded that Cry49Aa is responsible for receptor binding and interaction with Cry48Aa and plays an important role in the mechanism of action of these two-component toxins. © 2016 The Royal Entomological Society.

  17. Protein Restriction with Amino Acid-Balanced Diets Shrinks Circulating Pool Size of Amino Acid by Decreasing Expression of Specific Transporters in the Small Intestine.

    Directory of Open Access Journals (Sweden)

    Kai Qiu

    Full Text Available Dietary protein restriction is not only beneficial to health and longevity in humans, but also protects against air pollution and minimizes feeding cost in livestock production. However, its impact on amino acid (AA absorption and metabolism is not quite understood. Therefore, the study aimed to explore the effect of protein restriction on nitrogen balance, circulating AA pool size, and AA absorption using a pig model. In Exp.1, 72 gilts weighting 29.9 ± 1.5 kg were allocated to 1 of the 3 diets containing 14, 16, or 18% CP for a 28-d trial. Growth (n = 24, nitrogen balance (n = 6, and the expression of small intestinal AA and peptide transporters (n = 6 were evaluated. In Exp.2, 12 barrows weighting 22.7 ± 1.3 kg were surgically fitted with catheters in the portal and jejunal veins as well as the carotid artery and assigned to a diet containing 14 or 18% CP. A series of blood samples were collected before and after feeding for determining the pool size of circulating AA and AA absorption in the portal vein, respectively. Protein restriction did not sacrifice body weight gain and protein retention, since nitrogen digestibility was increased as dietary protein content reduced. However, the pool size of circulating AA except for lysine and threonine, and most AA flux through the portal vein were reduced in pigs fed the low protein diet. Meanwhile, the expression of peptide transporter 1 (PepT-1 was stimulated, but the expression of the neutral and cationic AA transporter systems was depressed. These results evidenced that protein restriction with essential AA-balanced diets, decreased AA absorption and reduced circulating AA pool size. Increased expression of small intestinal peptide transporter PepT-1 could not compensate for the depressed expression of jejunal AA transporters for AA absorption.

  18. Laboratory study on the behaviour of spent AA household alkaline batteries in incineration.

    Science.gov (United States)

    Almeida, Manuel F; Xará, Susana M; Delgado, Julanda; Costa, Carlos A

    2009-01-01

    The quantitative evaluation of emissions from incineration is essential when Life Cycle Assessment (LCA) studies consider this process as an end-of-life solution for some wastes. Thus, the objective of this work is to quantify the main gaseous emissions produced when spent AA alkaline batteries are incinerated. With this aim, batteries were kept for 1h at 1273K in a refractory steel tube hold in a horizontal electric furnace with temperature control. At one end of the refractory steel tube, a constant air flow input assures the presence of oxygen in the atmosphere and guides the gaseous emissions to a filter system followed by a set of two bubbler flasks having an aqueous solution of 10% (v/v) nitric acid. After each set of experiments, sulphur, chlorides and metals (As, Cd, Co, Cr, Cu, Fe, Hg, Mn, Ni, Pb, Sb, Tl and Zn) were analyzed in both the solutions obtained from the steel tube washing and from the bubblers. Sulphur, chlorides and metals were quantified, respectively, using barium sulfate gravimetry, the Volhard method and atomic absorption spectrometry (AAS). The emissions of zinc, the most emitted metal, represent about 6.5% of the zinc content in the batteries. Emissions of manganese (whose oxide is the main component of the cathode) and iron (from the cathode collector) are negligible when compared with their amount in AA alkaline batteries. Mercury is the metal with higher volatility in the composition of the batteries and was collected even in the second bubbler flask. The amount of chlorides collected corresponds to about 36% of the chlorine in the battery sleeve that is made from PVC. A considerable part of the HCl formed in PVC plastic sleeve incineration is neutralized with KOH, zinc and manganese oxides and, thus, it is not totally released in the gas. Some of the emissions are predictable through a thermodynamic data analysis at temperatures in the range of 1200-1300K taking into account the composition of the batteries. This analysis was done

  19. DNA Adducts Formed by Aristolochic Acid Are Unique Biomarkers of Exposure and Explain the Initiation Phase of Upper Urothelial Cancer.

    Science.gov (United States)

    Stiborová, Marie; Arlt, Volker M; Schmeiser, Heinz H

    2017-10-14

    Aristolochic acid (AA) is a plant alkaloid that causes aristolochic acid nephropathy (AAN) and Balkan endemic nephropathy (BEN), unique renal diseases frequently associated with upper urothelial cancer (UUC). This review summarizes the significance of AA-derived DNA adducts in the aetiology of UUC leading to specific A:T to T:A transversion mutations (mutational signature) in AAN/BEN-associated tumours, which are otherwise rare in individuals with UCC not exposed to AA. Therefore, such DNA damage produced by AA-DNA adducts is one rare example of the direct association of exposure and cancer development (UUC) in humans, confirming that the covalent binding of carcinogens to DNA is causally related to tumourigenesis. Although aristolochic acid I (AAI), the major component of the natural plant extract AA, might directly cause interstitial nephropathy, enzymatic activation of AAI to reactive intermediates capable of binding to DNA is a necessary step leading to the formation of AA-DNA adducts and subsequently AA-induced malignant transformation. Therefore, AA-DNA adducts can not only be utilized as biomarkers for the assessment of AA exposure and markers of AA-induced UUC, but also be used for the mechanistic evaluation of its enzymatic activation and detoxification. Differences in AA metabolism might be one of the reasons for an individual's susceptibility in the multi-step process of AA carcinogenesis and studying associations between activities and/or polymorphisms of the enzymes metabolising AA is an important determinant to identify individuals having a high risk of developing AA-mediated UUC.

  20. A human dietary arachidonic acid supplementation study conducted in a metabolic research unit: rationale and design.

    Science.gov (United States)

    Nelson, G J; Kelley, D S; Emken, E A; Phinney, S D; Kyle, D; Ferretti, A

    1997-04-01

    While there are many reports of studies that fed arachidonic acid (AA) to animals, there are very few reports of AA feeding to humans under controlled conditions. This 130-d study was conceived as a controlled, symmetrical crossover design with healthy, adult male volunteers. They lived in the metabolic research unit (MRU) of the Western Human Nutrition Research (WHNRC) for the entire study. All food was prepared by the WHNRC kitchen. The basal (low-AA) diet consisted of natural foods (30 en% fat, 15 en% protein, and 55 en% carbohydrate), containing 210 mg/d of AA, and met the recommended daily allowance for all nutrients. The high-AA (intervention) diet was similar except that 1.5 g/d of AA in the form of a triglyceride containing 50% AA replaced an equal amount of high-oleic safflower oil in the basal diet. The subjects (ages 20 to 39) were within -10 to +20% of ideal body weight, nonsmoking, and not allowed alcohol in the MRU. Their exercise level was constant, and their body weights were maintained within 2% of entry level. Subjects were initially fed the low-AA diet for 15 d. On day 16, half of the subjects (group A) wee placed on the high-AA diet, and the other group (B) remained on the low-AA diets. On day 65, the two groups switched diets. On day 115, group B returned to the low-AA diet. This design, assuming no carryover effect, allowed us to merge the data from the two groups, with the data comparison days being 65 (low-AA) and 115 (high-AA) for group B and 130 (low-AA) and 65 (high-AA) for group A. The main indices studied were the fatty acid composition of the plasma, red blood cells, platelets, and adipose tissue; in vitro platelet aggregation, bleeding times, clotting factors; immune response as measured by delayed hypersensitivity skin tests, cellular proliferation of peripheral blood mononuclear cells in response to various mitogens and antigens, natural killer cell activity, and response to measles/mumps/rubella and influenza vaccines; the

  1. Characterization of chiral amino acids from different milk origins using ultra-performance liquid chromatography coupled to ion-mobility mass spectrometry

    Science.gov (United States)

    Tian, He; Zheng, Nan; Li, Songli; Zhang, Yangdong; Zhao, Shengguo; Wen, Fang; Wang, Jiaqi

    2017-04-01

    Milk contains free amino acids (AAs) that play essential roles in maintaining the growth and health of infants, and D-AA isomers are increasingly being recognized as important signalling molecules. However, there are no studies of the different characteristics of chiral AA (C-AA) from different milk origins. Here, UPLC coupled to ion-mobility high-resolution MS (IM-HRMS) was employed to characterize 18 pairs of C-AAs in human, cow, yak, buffalo, goat, and camel milk. The results proved that milk origins can be differentiated based on the D- to L- AA ratio-based projection scores by principal component analysis. The present study gives a deeper understanding of the D- to L- AA ratio underlying the biological functions of different animal milks, and provide a new strategy for the study of AA metabolic pathways.

  2. Selective determination of 3, 4-dihydroxyphenylacetic acid in the ...

    Indian Academy of Sciences (India)

    We report here the highly sensitive and selective electrochemical determination of 3,4-dihydroxyphenylacetic acid (DOPAC), one of the dopamine metabolites in the presence of important interferents ascorbic acid (AA) and uric acid (UA) using an ultrathin electropolymerized film of 5-amino-1,3,4-thiadiazole-2-thiol (p-ATT) ...

  3. Arachidonic and eicosapentaenoic acid metabolism in bovine neutrophils and platelets: effect of calcium ionophore

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, S.M.; Laegreid, W.W.; Heidel, J.R.; Straub, K.M.; Liggitt, H.D.; Silflow, R.M.; Breeze, R.G.; Leid, R.W.

    1987-09-01

    Substitution of dietary fatty acids has potential for altering the inflammatory response. The purpose of the present study was to define the metabolites of arachidonic acid (AA) and eicosapentaenoic acid (EPA) secreted by bovine peripheral blood neutrophils and platelets. High performance liquid chromatography was used to characterize cyclooxygenase and lipoxygenase metabolites secreted in response to the calcium ionophore A23187. Cells were prelabelled with /sup 3/H-AA or /sup 3/H-EPA prior to challenge with the calcium ionophore. Bovine neutrophils secreted leukotriene B4 (LTB4) and 5-hydroxyeicosatetraenoic acid (5-HETE) as the major metabolites of AA, as well as the corresponding leukotriene B5 (LTB5) and 5-hydroxyeicosapentaenoic acid (5-HEPE) metabolites of EPA. Peptidoleukotrienes derived from /sup 3/H-AA or /sup 3/H-EPA were not detected under these conditions. The major tritiated metabolites secreted from bovine platelets were: thromboxane A2, measured as the stable metabolite thromboxane B2 (TXB2); hydroxyheptadecatrienoic acid (HHT) and 12-HETE derived from /sup 3/H-AA; and the omega-3 analogs TXB3 and 12-HEPE, derived from /sup 3/H-EPA. Preferred substrate specificities existed amongst the AA- and EPA-derived metabolites for the intermediary enzymes involved in the arachidonic acid cascade. These findings support the hypothesis that substitution of membrane-bound AA by EPA has potential for modulation of the host inflammatory response following cellular phospholipid mobilization.

  4. Dietary supplementation of branched-chain amino acids increases muscle net amino acid fluxes through elevating their substrate availability and intramuscular catabolism in young pigs.

    Science.gov (United States)

    Zheng, Liufeng; Zuo, Fangrui; Zhao, Shengjun; He, Pingli; Wei, Hongkui; Xiang, Quanhang; Pang, Jiaman; Peng, Jian

    2017-04-01

    Branched-chain amino acids (BCAA) have been clearly demonstrated to have anabolic effects on muscle protein synthesis. However, little is known about their roles in the regulation of net AA fluxes across skeletal muscle in vivo. This study was aimed to investigate the effect and related mechanisms of dietary supplementation of BCAA on muscle net amino acid (AA) fluxes using the hindlimb flux model. In all fourteen 4-week-old barrows were fed reduced-protein diets with or without supplemental BCAA for 28 d. Pigs were implanted with carotid arterial, femoral arterial and venous catheters, and fed once hourly with intraarterial infusion of p-amino hippurate. Arterial and venous plasma and muscle samples were obtained for the measurement of AA, branched-chain α-keto acids (BCKA) and 3-methylhistidine (3-MH). Metabolomes of venous plasma were determined by HPLC-quadrupole time-of-flight-MS. BCAA-supplemented group showed elevated muscle net fluxes of total essential AA, non-essential AA and AA. As for individual AA, muscle net fluxes of each BCAA and their metabolites (alanine, glutamate and glutamine), along with those of histidine, methionine and several functional non-essential AA (glycine, proline and serine), were increased by BCAA supplementation. The elevated muscle net AA fluxes were associated with the increase in arterial and intramuscular concentrations of BCAA and venous metabolites including BCKA and free fatty acids, and were also related to the decrease in the intramuscular concentration of 3-MH. Correlation analysis indicated that muscle net AA fluxes are highly and positively correlated with arterial BCAA concentrations and muscle net BCKA production. In conclusion, supplementing BCAA to reduced-protein diet increases the arterial concentrations and intramuscular catabolism of BCAA, both of which would contribute to an increase of muscle net AA fluxes in young pigs.

  5. Yield and flow properties of aluminum alloy AA 8001

    International Nuclear Information System (INIS)

    Lyons, J.S.; Johnson, H.W.; Han, E.G.

    1995-01-01

    Aluminum alloy AA 8001 is being used at the Westinghouse Savannah River Company (WSRC) for nuclear reactor fuel and target components. The objective of this research was to determine parameters for predictive models of the compressive flow properties of AA 8001. Seventy-five true strain-rate, hot compression tests were performed. New, quantitative information about the yield and flow behavior of aluminum alloy AA 8001 was determined. Parameters were determined to use in a hyperbolic sine constitutive law so that the yield stress, the peak stress, and the peak strain can be predicted from the temperature-compensated strain-rate, Z. It was found that the onset of strain softening was more strongly dependent on Z than the onset of yielding was

  6. Functional amino acids in fish nutrition, health and welfare.

    Science.gov (United States)

    Andersen, Synne M; Waagbø, Rune; Espe, Marit

    2016-01-01

    Protein is the most expensive part of fish diets and supplies amino acids (AA) for energy, growth, protein synthesis and as substrates for key metabolic pathways. Functional AA is a term used to describe AA that are involved in cellular processes apart from protein synthesis. A deficiency, or imbalance, in functional AA may impair body metabolism and homeostasis. Recent years have seen an increased interest in AA to increase disease resistance, immune response, reproduction, behavior and more. This has led to a boost of commercially available functional fish feeds that aim to optimize fish performance and quality of the product. This review aim to collect recent findings of functional AA and of how they may improve fish health and welfare. It will focus on functional properties of some of the most studied AA, namely arginine, glutamine, glutamate, tryptophan, sulfur amino acids (methionine, cysteine and taurine), histidine and branched chain amino acids. Where information is not available in fish, we will point towards functions known in animals and humans, with possible translational functions to fish.

  7. Exposure of Atlantic salmon parr (Salmo salar) to a combination of resin acids and a water soluble fraction of diesel fuel oil: A model to investigate the chemical causes of pigmented salmon syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Croce, B. [Scottish Office Agriculture, Environment, and Fisheries Dept., Aberdeen (United Kingdom). Marine Lab.]|[Scottish Environmental Protection Agency, Aberdeen (United Kingdom). North East River Purification Board; Stagg, R.M. [Scottish Office Agriculture, Environment, and Fisheries Dept., Aberdeen (United Kingdom). Marine Lab.

    1997-09-01

    Pigmented salmon syndrome is a pollutant-induced hemolytic anemia and hyperbilirubinemia. As part of an investigation of this condition, S2 Atlantic salmon parr (Salmo salar) were exposed to a diesel fuel oil, water soluble fraction (WSF) in combination with a mixture of three resin acids (isopimaric, dehydroabietic, and abietic acids) in a continuous-flow freshwater system. The total nominal concentrations of resin acids in the exposure tanks were 10, 50, and 100 {micro}g/L; the diesel WSF was generated in situ and provided a mean hydrocarbon concentration of 2.0 {+-} 0.1 mg/L (n = 12) during the 9-d exposure period. Exposure to the diesel WSF alone depressed liver bilirubin UDP-glucuronosyl transferase (UDPGT) activity and induced phenol UDPGT activity. Exposure to the diesel WSF in the absence or presence of resin acids induced liver cytochrome P4501A and increased the concentrations in the plasma of the enzymes lactate dehydrogenase, alkaline phosphatase, and glutamic oxaloacetic transaminase. The combined exposure to diesel WSF with either 50 or 100 {micro}g/L total resin acid caused significant elevations in the concentrations of bilirubin in the plasma and many of these fish had yellow pigmentation on the ventral surface and around the gill arches. The results demonstrate that exposure to combinations of two groups of contaminants can result in the manifestation of toxic effects not apparent from exposure to either of these chemicals in isolation.

  8. Fatigue behaviour of GMAW welded aluminium alloy AA7020

    OpenAIRE

    Bloem, Carlos; Salvador Moya, Mª Dolores; Amigó, Vicente; Vicente-Escuder, Ángel

    2009-01-01

    [EN] The aim of this investigation is to evaluate the influence on fatigue behaviour of the finishing of the bulge in a welded aluminium zinc magnesium alloy AA7020. It was determined that total or partial elimination of the bulge has very little influence on its behaviour, giving a very similar result on both cases, where one is better than the other by only 3%. Bloem, C.; Salvador Moya, MD.; Amigó, V.; Vicente-Escuder, Á. (2009). Fatigue behaviour of GMAW welded aluminium alloy AA7020. W...

  9. Experimental transmission of AA amyloidosis by injecting the AA amyloid protein into interleukin-1 receptor antagonist knockout (IL-1raKO) mice.

    Science.gov (United States)

    Watanabe, K; Uchida, K; Chambers, J K; Tei, M; Shoji, A; Ushio, N; Nakayama, H

    2015-05-01

    The incidence of AA amyloidosis is high in humans with rheumatoid arthritis and several animal species, including cats and cattle with prolonged inflammation. AA amyloidosis can be experimentally induced in mice using severe inflammatory stimuli and a coinjection of AA amyloid; however, difficulties have been associated with transmitting AA amyloidosis to a different animal species, and this has been attributed to the "species barrier." The interleukin-1 receptor antagonist knockout (IL-1raKO) mouse, a rodent model of human rheumatoid arthritis, has been used in the transmission of AA amyloid. When IL-1raKO and BALB/c mice were intraperitoneally injected with mouse AA amyloid together with a subcutaneous pretreatment of 2% AgNO3, all mice from both strains that were injected with crude or purified murine AA amyloid developed AA amyloidosis. However, the amyloid index, which was determined by the intensity of AA amyloid deposition, was significantly higher in IL-1raKO mice than in BALB/c mice. When IL-1raKO and BALB/c mice were injected with crude or purified bovine AA amyloid together with the pretreatment, 83% (5/6 cases) and 38% (3/8 cases) of IL-1raKO mice and 17% (1/6 cases) and 0% (0/6 cases) of BALB/c mice, respectively, developed AA amyloidosis. Similarly, when IL-1raKO and BALB/c mice were injected with crude or purified feline AA amyloid, 33% (2/6 cases) and 88% (7/8 cases) of IL-1raKO mice and 0% (0/6 cases) and 29% (2/6 cases) of BALB/c mice, respectively, developed AA amyloidosis. These results indicated that IL-1raKO mice are a useful animal model for investigating AA amyloidogenesis. © The Author(s) 2014.

  10. Definition of apparent, true, and standardized ileal digestibility of amino acids in pigs

    NARCIS (Netherlands)

    Stein, H.H.; Fuller, M.F.; Moughan, P.J.; Seve, B.; Mosenthin, R.; Jansman, A.J.M.; Fernandez, J.A.; Lange, de C.F.M.

    2007-01-01

    Measures of ileal digestibility (ID) are used routinely as estimates of amino acid (AA) bio-availability in pig feed ingredients. Values for ID may be expressed as apparent (AID), standardized (SID), or true (TID). Values for AID are calculated by deducting the total ileal outflow of AA (the sum of

  11. What shapes amino acid and sugar composition in Mediterranean floral nectars?

    NARCIS (Netherlands)

    Petanidou, T.; Van Laere, A.; Ellis, W.; Smets, E.

    2006-01-01

    We studied the amino acid (AA) composition of the floral nectars of 73 plant species occurring in a phryganic (East Mediterranean garrigue) community and investigated whether AA and sugar composition is shaped by evolutionary (plant phylogeny), ecological (flowering time as a direct effect of summer

  12. Amino acids, independent of insulin, attenuate skeletal muscle autophagy in neonatal pigs during endotoxemia

    Science.gov (United States)

    Sepsis induces loss of skeletal muscle mass by activating the ubiquitin proteasome (UPS) and autophagy systems. Although muscle protein synthesis in healthy neonatal piglets is responsive to amino acids (AA) stimulation, it is not known if AA can prevent the activation of muscle protein degradation ...

  13. Development of a screening method for co-amorphous formulations of drugs and amino acids

    DEFF Research Database (Denmark)

    Kasten, Georgia; Grohganz, Holger; Rades, Thomas

    2016-01-01

    Using amino acids (AA) as low molecular weight excipients in the preparation of co-amorphous blends with the aim to stabilize the drug in the amorphous form have been discussed in a range of studies. However, there is currently no theoretical consensus behind which AA would be a suitable co...

  14. Contribution of Fermentation Yeast to Final Amino Acid Profile in DDGS

    Science.gov (United States)

    One major factor affecting DDGS quality and market values is amino acid (AA) composition. DDGS proteins come from corn and yeast. Yet, the effect of fermentation yeast on DDGS protein quantity and quality (AA profile) has not been well documented. Based on literature review, there are at least 4 met...

  15. Modulation of arachidonic and linoleic acid metabolites in myeloperoxidase deficient mice during acute inflammation

    Science.gov (United States)

    Kubala, Lukas; Schmelzer, Kara R.; Klinke, Anna; Kolarova, Hana; Baldus, Stephan; Hammock, Bruce D.; Eiserich, Jason P.

    2010-01-01

    Acute inflammation is a common feature of many life-threatening pathologies, including septic shock. One hallmark of acute inflammation is the peroxidation of polyunsaturated fatty acids forming bioactive products, which regulate inflammation. Myeloperoxidase (MPO) is an abundant phagocyte-derived hemoprotein released during phagocyte activation. Here, we investigated the role of MPO in modulating biologically active arachidonic acid (AA) and linoleic acid (LA) metabolites during acute inflammation. Wild-type and MPO-knockout (KO) mice were exposed to intraperitoneally injected endotoxin for 24 h, and plasma LA and AA oxidation products were comprehensively analyzed using a liquid chromatography-mass spectrometry method. Compared to wild-type mice, MPO-KO mice had significantly lower plasma levels of LA epoxides and corresponding LA- and AA-derived fatty acid diols. AA and LA hydroxy intermediates (hydroxyeicosatetraenoic and hydroxyoctadecadienoic acids) were also significantly lower in MPO-KO mice. Conversely, MPO-deficient mice had significantly higher plasma levels of cysteinyl-leukotrienes with well-known pro-inflammatory properties. In vitro experiments revealed significantly lower amounts of AA and LA epoxides, LA- and AA-derived fatty acid diols, and AA and LA hydroxy intermediates in stimulated polymorphonuclear neutrophils isolated from MPO-KO mice. Our results demonstrate that MPO modulates the balance of pro- and anti-inflammatory lipid mediators during acute inflammation. In this way, may control acute inflammatory diseases. PMID:20156554

  16. Modulation of arachidonic and linoleic acid metabolites in myeloperoxidase-deficient mice during acute inflammation.

    Science.gov (United States)

    Kubala, Lukas; Schmelzer, Kara R; Klinke, Anna; Kolarova, Hana; Baldus, Stephan; Hammock, Bruce D; Eiserich, Jason P

    2010-05-15

    Acute inflammation is a common feature of many life-threatening pathologies, including septic shock. One hallmark of acute inflammation is the peroxidation of polyunsaturated fatty acids forming bioactive products that regulate inflammation. Myeloperoxidase (MPO) is an abundant phagocyte-derived hemoprotein released during phagocyte activation. Here, we investigated the role of MPO in modulating biologically active arachidonic acid (AA) and linoleic acid (LA) metabolites during acute inflammation. Wild-type and MPO-knockout (KO) mice were exposed to intraperitoneally injected endotoxin for 24 h, and plasma LA and AA oxidation products were comprehensively analyzed using a liquid chromatography-mass spectrometry method. Compared to wild-type mice, MPO-KO mice had significantly lower plasma levels of LA epoxides and corresponding LA- and AA-derived fatty acid diols. AA and LA hydroxy intermediates (hydroxyeicosatetraenoic and hydroxyoctadecadienoic acids) were also significantly lower in MPO-KO mice. Conversely, MPO-deficient mice had significantly higher plasma levels of cysteinyl-leukotrienes with well-known proinflammatory properties. In vitro experiments revealed significantly lower amounts of AA and LA epoxides, LA- and AA-derived fatty acid diols, and AA and LA hydroxy intermediates in stimulated polymorphonuclear neutrophils isolated from MPO-KO mice. Our results demonstrate that MPO modulates the balance of pro- and anti-inflammatory lipid mediators during acute inflammation and, in this way, may control acute inflammatory diseases. Copyright 2010 Elsevier Inc. All rights reserved.

  17. Lithium and the other mood stabilizers effective in bipolar disorder target the rat brain arachidonic acid cascade.

    Science.gov (United States)

    Rapoport, Stanley I

    2014-06-18

    This Review evaluates the arachidonic acid (AA, 20:4n-6) cascade hypothesis for the actions of lithium and other FDA-approved mood stabilizers in bipolar disorder (BD). The hypothesis is based on evidence in unanesthetized rats that chronically administered lithium, carbamazepine, valproate, or lamotrigine each downregulated brain AA metabolism, and it is consistent with reported upregulated AA cascade markers in post-mortem BD brain. In the rats, each mood stabilizer reduced AA turnover in brain phospholipids, cyclooxygenase-2 expression, and prostaglandin E2 concentration. Lithium and carbamazepine also reduced expression of cytosolic phospholipase A2 (cPLA2) IVA, which releases AA from membrane phospholipids, whereas valproate uncompetitively inhibited in vitro acyl-CoA synthetase-4, which recycles AA into phospholipid. Topiramate and gabapentin, proven ineffective in BD, changed rat brain AA metabolism minimally. On the other hand, the atypical antipsychotics olanzapine and clozapine, which show efficacy in BD, decreased rat brain AA metabolism by reducing plasma AA availability. Each of the four approved mood stabilizers also dampened brain AA signaling during glutamatergic NMDA and dopaminergic D2 receptor activation, while lithium enhanced the signal during cholinergic muscarinic receptor activation. In BD patients, such signaling effects might normalize the neurotransmission imbalance proposed to cause disease symptoms. Additionally, the antidepressants fluoxetine and imipramine, which tend to switch BD depression to mania, each increased AA turnover and cPLA2 IVA expression in rat brain, suggesting that brain AA metabolism is higher in BD mania than depression. The AA hypothesis for mood stabilizer action is consistent with reports that low-dose aspirin reduced morbidity in patients taking lithium, and that high n-3 and/or low n-6 polyunsaturated fatty acid diets, which in rats reduce brain AA metabolism, were effective in BD and migraine patients.

  18. Biotribological properties of UHMWPE grafted with AA under lubrication as artificial joint.

    Science.gov (United States)

    Deng, Yaling; Xiong, Dangsheng; Wang, Kun

    2013-09-01

    Osteolysis caused by wear particles from polyethylene in the artificial hip joints is a serious issue. In order to endow the low friction and wear of the bearing surface of ultra-high molecular weight polyethylene (UHMWPE) artificial joint for a longer term, hydrophilic acrylic acid (AA) was grafted on UHMWPE powders with the method of ultraviolet irradiation and then the modified powders were hot pressed. The tribological properties of modified UHMWPE sliding against CoCrMo metallic plate on reciprocating tribometer under calf serum, saline and distilled water lubrication during a long-term friction were investigated. The measurement of Fourier-transform infrared spectroscopy indicates that AA is successfully grafted on the surface of UHMWPE powders by photo-induced graft polymerization. Contact angles of UHMWPE are decreased from 83° to 35° by grafting and the surface wettability is effectively improved. The tensile strength of modified sample decreases. The friction coefficient and wear rate of UHMWPE-g-PAA under calf serum, saline and distilled water lubrication are lower than that of untreated UHMWPE. With the increase of grafting ratio, the wear rate of UHMWPE-g-PAA decreases firstly and then increases. The modified UHMWPE with grafting ratio of 3.5 % has the lowest wear rate, which is just quarter of the untreated UHMWPE. The hydrated PAA polymer brushes enclosed in the UHMWPE bulk material provide continuous lubrication during long term sliding.

  19. Ascorbic Acid and the Brain: Rationale for the Use against Cognitive Decline

    Directory of Open Access Journals (Sweden)

    Fiona E. Harrison

    2014-04-01

    Full Text Available This review is focused upon the role of ascorbic acid (AA, vitamin C in the promotion of healthy brain aging. Particular attention is attributed to the biochemistry and neuronal metabolism interface, transport across tissues, animal models that are useful for this area of research, and the human studies that implicate AA in the continuum between normal cognitive aging and age-related cognitive decline up to Alzheimer’s disease. Vascular risk factors and comorbidity relationships with cognitive decline and AA are discussed to facilitate strategies for advancing AA research in the area of brain health and neurodegeneration.

  20. Ascorbic Acid and the Brain: Rationale for the Use against Cognitive Decline

    Science.gov (United States)

    Harrison, Fiona E.; Bowman, Gene L.; Polidori, Maria Cristina

    2014-01-01

    This review is focused upon the role of ascorbic acid (AA, vitamin C) in the promotion of healthy brain aging. Particular attention is attributed to the biochemistry and neuronal metabolism interface, transport across tissues, animal models that are useful for this area of research, and the human studies that implicate AA in the continuum between normal cognitive aging and age-related cognitive decline up to Alzheimer’s disease. Vascular risk factors and comorbidity relationships with cognitive decline and AA are discussed to facilitate strategies for advancing AA research in the area of brain health and neurodegeneration. PMID:24763117

  1. [Exploring the Correlation between Pi and Shen from the Excretion of AA-I and Expressions of Or- ganic Anion Transporting Polypeptide 2al and 2 b1 in Pi Deficiency Model Rats].

    Science.gov (United States)

    Xiang, Ting; Ren, Bin; Yang, Zhang-bin; Sun, Bao-guo; Chen, Ze-xiong; Chen, Yan; Zhang, Shi-jun

    2015-10-01

    To explore the correlation between Pi and Shen by observing the relationship between the metabolism of aristolochic acid (AA) and mRNA and protein expression levels of organic anion transporting polypeptide (oatp) superfamily member 2a1 and 2 b1 (oatp2al and oatp2bl) in renal, small intestinal, and large intestinal tissues of Pi deficiency syndrome (PDS) model rats. Totally 46 Sprague-Dawley (SD) rats were randomly divided into four groups, i.e., the blank group (n = 12), the PDS group (n = 22), the AA-I group (n = 6), and the PDS AA-I group (n = 6). PDS model was established by subcutaneously injecting Reserpine at the daily dose of 5 mg/kg for 16 successive days. Carotid intubation was performed in 6 rats selected from the blank group and the PDS group. Pharmacokinetics of AA-I were detected at 5, 15, 30, 45, and 60 min after gastrogavage of AA-I. AA-I concentrations in renal, small intestinal, and large intestinal tissues of 10 rats selected from the PDS group were determined. Normal saline was administered to 6 rats selected from the PDS group and the blank group by gastrogavage. Renal, small intestinal, and large intestinal tissues were collected in the AA-I group and the PDS AA-I group at 60 min after gastrogavage of AA-I. mRNA and protein expression levels of oatp2a1 and oatp2b1 in each tissue were detected using real-time polymerase chain reaction (RT- PCR) and Western blot. Compared with the blank group, plasma concentrations of in vivo AA-I were obviously higher in the PDS group at 15, 30, 45, and 60 min after gastrogavage of AA-I with statistical difference (P AA-I were obviously decreased at 60 min after gastrogavage of AA-I; AA-I concentrations in renal and large intestinal tissues were elevated; AA-I concentrations in small intestinal tissues were obviously reduced in the PDS group. There was no statistical difference in mRNA expression levels of oatp2a1 and oatp2b1 in the aforesaid three tissues of rats between the blank group and the PDS group

  2. Contribution to comprehensive study of aluminium alloy Aa 5083 ...

    African Journals Online (AJOL)

    Corrosion induced by elemental mercury in aqueous media of industrial Aluminium alloys AA5083 used in heat exchanger industries of natural gas liquefaction has been studied by linear sweep voltammétry on rotating amalgamated disk electrode. Corrosion process depends on: • Chemical processes of amalgamation of ...

  3. Churg-Strauss syndrome associated with AA amyloidosis: a case ...

    African Journals Online (AJOL)

    Churg Strauss syndrome is a rare systemic and pulmonary vasculitis exceptionally associated with AA amyloidosis. We report the case of a 65-year old woman with past medical history of asthma. She developed polyarthralgia, headache and purpura. A laboratory workout found hypereosinophilia (1150/μL), positive ...

  4. Backend solutions for AA in the MUSE network supporting FMC

    NARCIS (Netherlands)

    Neerbos, A.N.R. van; Prins, M.; Melander, B.; Pimilla Larrucea, I.; Thakur, M.J.; Fredricx, F.

    2007-01-01

    The European MUSE project investigated fixed-mobile convergence from the perspective of an unbundled fixed network. A major part of the work consisted of finding solutions for the authentication and authorisation of users who roam from their home network to a visited network. This paper shows how AA

  5. Three body abrasion of laser surface alloyed aluminium AA1200

    CSIR Research Space (South Africa)

    Mabhali, Luyolo AB

    2012-06-01

    Full Text Available Laser surface alloying of aluminium AA1200 was performed with a 4 kW Nd:YAG laser to improve the abrasion wear resistance. Aluminium surfaces reinforced with metal matrix composites and intermetallic phases were achieved. The phases present depended...

  6. Recovery and recrystallization in the superplastic deformation of AA5182

    NARCIS (Netherlands)

    Chen, Z.; Kazantzis, A. V.; De Hosson, J. Th. M.

    The coarse-grained Al alloy AA5182 exhibits poor superplasticity with a maximum elongation to failure not exceeding 220% at 450 degrees C and at 10(-2) s(-1). The low values of the strain rate sensitivity indicate that the dislocation velocity is quite high and necking is developed quite soon during

  7. Impact toughness of laser alloyed aluminium AA1200 alloys

    CSIR Research Space (South Africa)

    Mabhali, Luyolo AB

    2013-08-01

    Full Text Available Laser surface alloying of aluminium AA1200 was performed with a 4kW Nd:YAG laser and impact resistance of the alloys was investigated. The alloying powders were a mixture of Ni, Ti and SiC in different proportions. Surfaces reinforced...

  8. Pollution assessment and heavy metal determination by AAS in ...

    African Journals Online (AJOL)

    Foisal

    below detective level. This study points out the health risk status of waste water for residents and aquatic living being, an ultimate concern for their survival in the region. Key words: Waste water, pollution assessment, physico-chemical parameters, atomic absorption spectrophotometer (AAS), heavy metal contamination.

  9. Making ET AAS Determination Less Dependent on Vapourization ...

    African Journals Online (AJOL)

    NICO

    The quantification of the analytes in ET AAS is normally attained by the measurement and integration of transient absorbance. High degree of atomization and constant vapour transportation rate for the analyte atoms in the absorption volume are considered to be crucial to grant correctness of the measurements. However ...

  10. Regulatory signals for intestinal amino acid transporters and peptidases

    International Nuclear Information System (INIS)

    Ferraris, R.P.; Kwan, W.W.; Diamond, J.

    1988-01-01

    Dietary protein ultimately regulates many processes involved in protein digestion, but it is often unclear whether proteins themselves, peptides, or amino acids (AAs) are the proximate regulatory signal. Hence the authors compared several processes involved in protein digestion in mice adapted to one of three rations, identical except for containing 54% of either casein, a partial hydrolysate of casein, or a free AA mixture simulating a complete hydrolysate of casein. The authors measured brush-border uptakes of seven AAs that variously serve as substrates for four AA transporters, and brush-border and cytosolic activities of four peptidases. The three rations yielded essentially the same AA uptake rates. Peptidase activities tended to be lower on the AA ration than on the protein ration. In other studies, all three rations yielded the same rates of brush-border peptide uptake; protein is only modestly more effective than AAs at inducing synthesis of pancreatic proteases; and, depending on the animal species, protein is either much less or much more effective than AAs at stimulating release of cholecystokinin and hence of pancreatic enzymes. Thus the regulators of each process involved in protein digestion are not necessarily that process's substrate

  11. ESR study of ascorbic acid irradiated with gamma-ray

    International Nuclear Information System (INIS)

    Tuner, H.; Korkmaz, M.

    2007-01-01

    The interest in application of high-energy ionizing radiation for sterilization of pharmaceutical products and foodstuffs has led a number of workers to investigate the radiation sensitivity of vitamins. Aside from its use as a vitamin, ascorbic acid (AA) or some derivatives are employed as antioxidants in foodstuffs. The effects of ionizing radiation on AA in simple solutions and in mixture of naturally occurring compounds have been extensively reported in the literature. However, the effects of ionizing radiation on solid AA were reported in few works which described rather dosimetric features of AA. No reports, except one, are available describing the characteristic features of the radiolytic intermediates produced after irradiation of polycrystalline AA. Irradiation studies performed on single crystal of AA has led us to reinvestigate our previous work on the radiolytic intermediates produced in irradiated polycrystalline AA. Three radical species, rather than two, having different characteristics were decided contributing to the formation of experimental electron spin resonance (ESR) spectrum of γ-irradiated polycrystalline AA. Spectral parameters of these species were calculated after exhaustive spectrum simulation calculations based on data derived from experimental microwave saturation and dose-response studies. (author)

  12. Modularity of Conifer Diterpene Resin Acid Biosynthesis: P450 Enzymes of Different CYP720B Clades Use Alternative Substrates and Converge on the Same Products.

    Science.gov (United States)

    Geisler, Katrin; Jensen, Niels Berg; Yuen, Macaire M S; Madilao, Lina; Bohlmann, Jörg

    2016-05-01

    Cytochrome P450 enzymes of the CYP720B subfamily play a central role in the biosynthesis of diterpene resin acids (DRAs), which are a major component of the conifer oleoresin defense system. CYP720Bs exist in families of up to a dozen different members in conifer genomes and fall into four different clades (I-IV). Only two CYP720B members, loblolly pine (Pinus taeda) PtCYP720B1 and Sitka spruce (Picea sitchensis) PsCYP720B4, have been characterized previously. Both are multisubstrate and multifunctional clade III enzymes, which catalyze consecutive three-step oxidations in the conversion of diterpene olefins to DRAs. These reactions resemble the sequential diterpene oxidations affording ent-kaurenoic acid from ent-kaurene in gibberellin biosynthesis. Here, we functionally characterized the CYP720B clade I enzymes CYP720B2 and CYP720B12 in three different conifer species, Sitka spruce, lodgepole pine (Pinus contorta), and jack pine (Pinus banksiana), and compared their activities with those of the clade III enzymes CYP720B1 and CYP720B4 of the same species. Unlike the clade III enzymes, clade I enzymes were ultimately found not to be active with diterpene olefins but converted the recently discovered, unstable diterpene synthase product 13-hydroxy-8(14)-abietene. Through alternative routes, CYP720B enzymes of both clades produce some of the same profiles of conifer oleoresin DRAs (abietic acid, neoabietic acid, levopimaric acid, and palustric acid), while clade III enzymes also function in the formation of pimaric acid, isopimaric acid, and sandaracopimaric acid. These results highlight the modularity of the specialized (i.e. secondary) diterpene metabolism, which produces conifer defense metabolites through variable combinations of different diterpene synthase and CYP720B enzymes. © 2016 American Society of Plant Biologists. All Rights Reserved.

  13. Expression of apical Na(+)-L-glutamine co-transport activity, B(0)-system neutral amino acid co-transporter (B(0)AT1) and angiotensin-converting enzyme 2 along the jejunal crypt-villus axis in young pigs fed a liquid formula

    Science.gov (United States)

    Gut apical amino acid (AA) transport activity is high at birth and during suckling, thus being essential to maintain luminal nutrient-dependent mucosal growth through providing AA as essential metabolic fuel, substrates and nutrient stimuli for cellular growth. Because system-B(0) Na(+)-neutral AA c...

  14. Ingredient classification according to the digestible amino acid profile: an exploratory analysis

    Directory of Open Access Journals (Sweden)

    DE Faria Filho

    2005-09-01

    Full Text Available This study aimed: 1 to classify ingredients according to the digestible amino acid (AA profile; 2 to determine ingredients with AA profile closer to the ideal for broiler chickens; and 3 to compare digestible AA profiles from simulated diets with the ideal protein profile. The digestible AA levels of 30 ingredients were compiled from the literature and presented as percentages of lysine according to the ideal protein concept. Cluster and principal component analyses (exploratory analyses were used to compose and describe groups of ingredients according to AA profiles. Four ingredient groups were identified by cluster analysis, and the classification of the ingredients within each of these groups was obtained from a principal component analysis, showing 11 classes of ingredients with similar digestible AA profiles. The ingredients with AA profiles closer to the ideal protein were meat and bone meal 45, fish meal 60 and wheat germ meal, all of them constituting Class 1; the ingredients from the other classes gradually diverged from the ideal protein. Soybean meal, which is the main protein source for poultry, showed good AA balance since it was included in Class 3. On the contrary, corn, which is the main energy source in poultry diets, was classified in Class 8. Dietary AA profiles were improved when corn and/or soybean meal were partially or totally replaced in the simulations by ingredients with better AA balance.

  15. A Status Report on the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Fienberg, Richard Tresch; Fraknoi, Andrew; Gurton, Suzanne; Hurst, Anna; Schatz, Dennis L.

    2014-06-01

    The American Astronomical Society, in partnership with the Astronomical Society of the Pacific (ASP), has launched a series of professional-development workshops and a community of practice designed to improve early-career astronomers’ ability to communicate effectively with students and the public. Called AAS Astronomy Ambassadors, the program provides training and mentoring for young astronomers, from advanced undergraduates to beginning faculty; it also provides them access to resources and a network of contacts within the astronomy education and public outreach (EPO) community. Ambassadors are provided with a library of outreach activities and resource materials suitable for a range of venues and audiences. For much of this library we are using resources developed by organizations such as the ASP, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. After a period of evaluation and revision, the program’s “Menu of Outreach Opportunities for Science Education” (MOOSE) is now posted on the AAS website at http://aas.org/outreach/moose-menu-outreach-opportunities-science-education.The first two Astronomy Ambassadors workshops were held at AAS meetings in January 2013 and January 2014; each served 30 young astronomers chosen from about twice that many applicants. Web-based follow-up activities are being provided through a website at the ASP designed to keep cohorts of educators trained in their programs in touch with one another. The AAS is exploring ways to fund additional workshops at future winter meetings; suggestions are most welcome. Meanwhile, the Astronomy Ambassadors trained to date have logged more than 150 outreach events, reaching many thousands of children and adults across the U.S. and Canada.

  16. Arachidonic acid supplementation enhances in vitro skeletal muscle cell growth via a COX-2-dependent pathway.

    Science.gov (United States)

    Markworth, James F; Cameron-Smith, David

    2013-01-01

    Arachidonic acid (AA) is the metabolic precursor to a diverse range of downstream bioactive lipid mediators. A positive or negative influence of individual eicosanoid species [e.g., prostaglandins (PGs), leukotrienes, and hydroxyeicosatetraenoic acids] has been implicated in skeletal muscle cell growth and development. The collective role of AA-derived metabolites in physiological states of skeletal muscle growth/atrophy remains unclear. The present study aimed to determine the direct effect of free AA supplementation and subsequent eicosanoid biosynthesis on skeletal myocyte growth in vitro. C2C12 (mouse) skeletal myocytes induced to differentiate with supplemental AA exhibited dose-dependent increases in the size, myonuclear content, and protein accretion of developing myotubes, independent of changes in cell density or the rate/extent of myogenic differentiation. Nonselective (indomethacin) or cyclooxygenase 2 (COX-2)-selective (NS-398) nonsteroidal anti-inflammatory drugs blunted basal myogenesis, an effect that was amplified in the presence of supplemental free AA substrate. The stimulatory effects of AA persisted in preexisting myotubes via a COX-2-dependent (NS-389-sensitive) pathway, specifically implying dependency on downstream PG biosynthesis. AA-stimulated growth was associated with markedly increased secretion of PGF(2α) and PGE(2); however, incubation of myocytes with PG-rich conditioned medium failed to mimic the effects of direct AA supplementation. In vitro AA supplementation stimulates PG release and skeletal muscle cell hypertrophy via a COX-2-dependent pathway.

  17. Active biopolymer film based on carboxymethyl cellulose and ascorbic acid for food preservation

    Science.gov (United States)

    Halim, Al Luqman Abdul; Kamari, Azlan

    2017-05-01

    In the present study, an active biopolymer film based on carboxymethyl cellulose (CMC) and ascorbic acid (AA) was synthesised at an incorporation rate of 15% (w/w). Several analytical instruments such as Fourier Transform Infrared Spectrometer (FTIR), Thermogravimetry Analyser (TGA), UV-Visible Spectrophotometer (UV-Vis), Scanning Electron Microscope (SEM) and Universal Testing Machine were used to characterise the physical and chemical properties of CMC-AA film. The addition of AA significantly reduced elongation at break (322%) and tensile strength (10 MPa) of CMC-AA film. However, CMC-AA film shows a better antimicrobial property against two bacteria, namely Escherichia coli (E. coli) and Staphylococcus aureus (S. aureus) as compared to CMC film. The CMC-AA film was able to preserve cherry tomato with low weight loss and browning index. Overall, results from this study highlight the feasibility of CSAA film for food preservation.

  18. Effects of dimethylaminoethanol and compound amino acid on D-galactose induced skin aging model of rat.

    Science.gov (United States)

    Liu, Su; Chen, Zhenyu; Cai, Xia; Sun, Ying; Zhao, Cailing; Liu, Fangjun; Liu, Dalie

    2014-01-01

    A lasting dream of human beings is to reverse or postpone aging. In this study, dimethylaminoethanol (DMAE) and compound amino acid (AA) in Mesotherapy were investigated for their potential antiaging effects on D-galactose induced aging skin. At 18 days after D-gal induction, each rat was treated with intradermal microinjection of saline, AA, 0.1% DMAE, 0.2% DMAE, 0.1% DMAE + AA, or 0.2% DMAE + AA, respectively. At 42 days after treatment, the skin wound was harvested and assayed. Measurement of epidermal and dermal thickness in 0.1% DMAE + AA and 0.2% DMAE + AA groups appeared significantly thicker than aging control rats. No differences were found in tissue water content among groups. Hydroxyproline in 0.1% DMAE + AA, 0.2% DMAE + AA, and sham control groups was much higher than all other groups. Collagen type I, type III, and MMP-1 expression was highly upregulated in both 0.1% DMAE + AA and 0.2% DMAE + AA groups compared with aging control. In contrast, TIMP-1 expression levels of various aging groups were significantly reduced when compared to sham control. Coinjection of DMAE and AA into target tissue has marked antiaging effects on D-galactose induced skin aging model of rat.

  19. Effects of Dimethylaminoethanol and Compound Amino Acid on D-Galactose Induced Skin Aging Model of Rat

    Directory of Open Access Journals (Sweden)

    Su Liu

    2014-01-01

    Full Text Available A lasting dream of human beings is to reverse or postpone aging. In this study, dimethylaminoethanol (DMAE and compound amino acid (AA in Mesotherapy were investigated for their potential antiaging effects on D-galactose induced aging skin. At 18 days after D-gal induction, each rat was treated with intradermal microinjection of saline, AA, 0.1% DMAE, 0.2% DMAE, 0.1% DMAE + AA, or 0.2% DMAE + AA, respectively. At 42 days after treatment, the skin wound was harvested and assayed. Measurement of epidermal and dermal thickness in 0.1% DMAE + AA and 0.2% DMAE + AA groups appeared significantly thicker than aging control rats. No differences were found in tissue water content among groups. Hydroxyproline in 0.1% DMAE + AA, 0.2% DMAE + AA, and sham control groups was much higher than all other groups. Collagen type I, type III, and MMP-1 expression was highly upregulated in both 0.1% DMAE + AA and 0.2% DMAE + AA groups compared with aging control. In contrast, TIMP-1 expression levels of various aging groups were significantly reduced when compared to sham control. Coinjection of DMAE and AA into target tissue has marked antiaging effects on D-galactose induced skin aging model of rat.

  20. Ascorbic acid is a dose-dependent inhibitor of adipocyte differentiation, probably by reducing cAMP pool.

    Science.gov (United States)

    Rahman, Fryad; Al Frouh, Fadi; Bordignon, Benoit; Fraterno, Marc; Landrier, Jean-François; Peiretti, Franck; Fontes, Michel

    2014-01-01

    Ascorbic acid (AA) is the active component of vitamin C and antioxidant activity was long considered to be the primary molecular mechanism underlying the physiological actions of AA. We recently demonstrated that AA is a competitive inhibitor of adenylate cyclase, acting as a global regulator of intracellular cyclic adenosine monophosphate (cAMP) levels. Our study, therefore, aimed to determine new targets of AA that would account for its potential effect on signal transduction, particularly during cell differentiation. We demonstrated that AA is an inhibitor of pre-adipocyte cell line differentiation, with a dose-dependent effect. Additionally, we describe the impact of AA on the expression of genes involved in adipogenesis and/or the adipocyte phenotype. Moreover, our data suggest that treatment with AA partially reverses lipid accumulation in mature adipocytes. These properties likely reflect the function of AA as a global regulator of the cAMP pool, since an analog of AA without any antioxidant properties elicited the same effect. Additionally, we demonstrated that AA inhibits adipogenesis in OP9 mesenchymal cell line and drives the differentiation of this line toward osteogenesis. Finally, our data suggest that the intracellular transporter SVCT2 is involved in these processes and may act as a receptor for AA.

  1. Rapid quantification of underivatized amino acids in plasma by hydrophilic interaction liquid chromatography (HILIC) coupled with tandem mass-spectrometry.

    Science.gov (United States)

    Prinsen, Hubertus C M T; Schiebergen-Bronkhorst, B G M; Roeleveld, M W; Jans, J J M; de Sain-van der Velden, M G M; Visser, G; van Hasselt, P M; Verhoeven-Duif, N M

    2016-09-01

    Amino acidopathies are a class of inborn errors of metabolism (IEM) that can be diagnosed by analysis of amino acids (AA) in plasma. Current strategies for AA analysis include cation exchange HPLC with post-column ninhydrin derivatization, GC-MS, and LC-MS/MS-related methods. Major drawbacks of the current methods are time-consuming procedures, derivative problems, problems with retention, and MS-sensitivity. The use of hydrophilic interaction liquid chromatography (HILIC) columns is an ideal separation mode for hydrophilic compounds like AA. Here we report a HILIC-method for analysis of 36 underivatized AA in plasma to detect defects in AA metabolism that overcomes the major drawbacks of other methods. A rapid, sensitive, and specific method was developed for the analysis of AA in plasma without derivatization using HILIC coupled with tandem mass-spectrometry (Xevo TQ, Waters). Excellent separation of 36 AA (24 quantitative/12 qualitative) in plasma was achieved on an Acquity BEH Amide column (2.1×100 mm, 1.7 μm) in a single MS run of 18 min. Plasma of patients with a known IEM in AA metabolism was analyzed and all patients were correctly identified. The reported method analyzes 36 AA in plasma within 18 min and provides baseline separation of isomeric AA such as leucine and isoleucine. No separation was obtained for isoleucine and allo-isoleucine. The method is applicable to study defects in AA metabolism in plasma.

  2. Microstructure and Mechanical Properties of Accumulative Roll-Bonded AA1050A/AA5005 Laminated Metal Composites

    Directory of Open Access Journals (Sweden)

    Frank Kümmel

    2016-03-01

    Full Text Available Laminated metal composites (LMCs with alternating layers of commercial pure aluminum AA1050A and aluminum alloy AA5005 were produced by accumulative roll-bonding (ARB. In order to vary the layer thickness and the number of layer interfaces, different numbers of ARB cycles (4, 8, 10, 12, 14 and 16 were performed. The microstructure and mechanical properties were characterized in detail. Up to 8 ARB cycles, the ultrafine-grained (UFG microstructure of the layers in the LMC evolves almost equally to those in AA1050A and AA5005 mono-material sheets. However, the grain size in the composites tends to have smaller values. Nevertheless, the local mechanical properties of the individual layers in the LMCs are very similar to those of the mono-material sheets, and the macroscopic static mechanical properties of the LMCs can be calculated as the mean value of the mono-material sheets applying a linear rule of mixture. In contrast, for more than 12 ARB cycles, a homogenous microstructure was obtained where the individual layers within the composite cannot be visually separated any longer; thus, the hardness is at one constant and a high level across the whole sheet thickness. This results also in a significant higher strength in tensile testing. It was revealed that, with decreasing layer thickness, the layer interfaces become more and more dominating.

  3. Dynamic Response and Microstructure Evolution of AA2219-T4 and AA2219-T6 Aluminum Alloys

    Science.gov (United States)

    Olasumboye, A.; Owolabi, G.; Odeshi, A.; Zeytinci, A.; Yilmaz, N.

    2018-02-01

    In this study, the dynamic deformation behavior of AA2219 aluminum alloy was investigated in two different temper conditions: T4 and T6, with a view to determining the effect of heat treatment on the microstructure and flow behavior of the material under high strain rates. Split Hopkinson pressure bar experiment was used in determining the dynamic response of the alloy while a digital image correlation system was employed in visualizing and tracking the surface deformation of the specimens. Optical microscopy and scanning electron microscopy were used to assess the microstructure of the material after following standard metallographic specimen preparation techniques. The results obtained showed heterogeneous deformation of the alloy in the two temper conditions. It was observed that the dynamic mechanical behavior of each sample preparation was dependent on its strength properties due to aging type, which in turn controls the metamorphosis of the strengthening precipitates and the initial microstructure. At the maximum strain rate of 3500 s-1, transformed bands leading to crack nucleation was observed in the AA2219-T4 aluminum alloy while AA2219-T6 had fractured at the same strain rate. The modes of crack formation and growth in the two alloys were found to be similar: nucleation, growth and coalescence of voids. However, shear band bifurcation phenomenon was observed only in the AA2219-T6 alloy.

  4. Delineation of the functional properties and the mechanism of action of AA29504, an allosteric agonist and positive allosteric modulator of GABAAreceptors.

    Science.gov (United States)

    Olander, Emma Rie; Madjroh, Nawid; Bunch, Lennart; Söderhielm, Pella Cecilia; Jensen, Anders A

    2018-04-01

    The retigabine analog 2-amino-4-[(2,4,6-trimethylbenzylamino)-phenyl]-carbamic acid ethyl ester (AA29504) is a positive allosteric modulator (PAM) of γ-aminobutyric acid A receptors (GABA A Rs), and the modulator has been used in ex vivo/in vivo studies to probe the physiological roles of native δ-containing GABA A Rs. In this study, the functional properties and mode of action of AA29504 were investigated at human GABA A Rs expressed in Xenopus oocytes by two-electrode voltage clamp electrophysiology. AA29504 was found to be an allosteric GABA A R agonist displaying low intrinsic activities at 3-30 μM. AA29504 was essentially equipotent as a PAM at the 13 GABA A R subtypes tested (EC 50 : 0.45-5.2 μM), however GABA EC 5 -evoked currents through αβδ subtypes were modulated to substantially higher levels than those through αβγ 2S subtypes (relative to GABA I max ). While the δ/γ 2S -difference clearly was key for this differential GABA efficacy modulation, studies of the AA29504-mediated modulation of different α 4,5,6 -containing αβ, αβγ 2S and αβδ GABA A Rs revealed the α-subunit identity to be another important determinant. Based on its functional properties at numerous mutant GABA A Rs and on in silico analysis of its low-energy conformations, AA29504 is proposed to act through an allosteric site in the transmembrane β (+) /α (-) interface in the GABA A R also targeted by etomidate and several other modulators. In contrast to these modulators, however, AA29504 did not display substantial β 2 /β 3 -over-β 1 GABA A R preference, which challenges the notion of ligands targeting this site always possessing this subtype-selectivity profile. Hence, the detailed pharmacological profiling of AA29504 both highlights the complexity of allosteric GABA A R modulation and provides valuable information about this modulator as a pharmacological tool. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Diagnostic performance of amyloid A protein quantification in fat tissue of patients with clinical AA amyloidosis

    NARCIS (Netherlands)

    Hazenberg, Bouke P. C.; Bijzet, Johannes; Limburg, Pieter C.; Skinner, Martha; Hawkins, Philip N.; Butrimiene, Irena; Livneh, Avi; Lesnyak, Olga; Nasonov, Evgeney L.; Filipowicz-Sosnowska, Anna; Guel, Ahmet; Merlini, Giampaolo; Wiland, Piotr; Oezdogan, Huri; Gorevic, Peter D.; Ben Maiz, Hedi; Benson, Merrill D.; Direskeneli, Haner; Kaarela, Kalevi; Garceau, Denis; Hauck, Wendy; van Rijswijk, Martin

    Objective. Amyloid A protein quantification in fat tissue is a new immunochemical method for detecting AA amyloidosis, a rare but serious disease. The objective was to assess diagnostic performance in clinical AA amyloidosis. Methods. Abdominal subcutaneous fat tissue of patients with AA amyloidosis

  6. Displaying Now-Understanding: The Finnish Change-of-State Token "aa"

    Science.gov (United States)

    Koivisto, Aino

    2015-01-01

    This article discusses the use of the Finnish change-of-state token "aa" that has previously not been identified. The central claim is that even though "aa" indicates a cognitive shift experienced by the speaker, it does not function as a receipt of new information. Instead, the token "aa" indicates that the speaker…

  7. An Analysis of the Rise and Fall of the AA-MAS Policy

    Science.gov (United States)

    Lazarus, Sheryl S.; Thurlow, Martha L.; Ysseldyke, James E.; Edwards, Lynn M.

    2015-01-01

    In 2005, to address concerns about students who might fall in the "gap" between the regular assessment and the alternate assessment based on alternate achievement standards (AA-AAS), the U.S. Department of Education announced that states could develop alternate assessments based on modified achievement standards (AA-MAS). This article…

  8. Arsenic trioxide preferentially induces nonapoptotic cell deaths as well as actin cytoskeleton rearrangement in the CHO AA8 cell line

    Directory of Open Access Journals (Sweden)

    Magdalena Izdebska

    2014-12-01

    Full Text Available Introduction: The therapeutic effect of arsenic trioxide (ATO, As2O3 has been investigated for many years. However, the precise molecular mechanisms underlying the antitumor activity of ATO are still not fully understood, but seem to depend on cell types, dosage, and duration of exposure. The purpose of this study was to assess the actin cytoskeleton rearrangement during the cell death process induced by arsenic trioxide in the CHO AA8 cells. A better understanding the mechanisms of ATO-action is likely to lead to more rational use of this drug either as monotherapies or in combination with other anticancer agents.Material and methods: The effect of ATO on actin cytoskeleton was studied in Chinese Hamster Ovary AA8 cell line. Actin was visualized by fluorescence microscopy and phalloidin conjugated to Alexa Fluor® 488. Morphological and ultrastructural alterations in the CHO AA8 cells were evaluated by using light and electron microscope, respectively. For quantitative measurement of cell death, Annexin V-Alexa Fluor® 488 and Propidium Iodide assay was performed. The vital staining of CHO AA8 cells with acridine orange was applied to detect the development of acidic vesicular organelles (AVOs.Results: The performed experiments revealed a dose-dependent decrease in the cell survival. The morphological and ultrastructural features acquired by the cells after ATO-treatment were considered as typical for autophagy and mitotic cell death. As was shown by acridine orange staining, arsenic trioxide treatment increased red fluorescence signals in dose-dependent manner, indicating the development of AVOs, a hallmark of autophagy. Low level of apoptosis was induced in the ATO-treated CHO AA8 cells. Furthermore, the rearrangement of actin filaments associated with cell death process was also detected.Conclusions: The obtained results suggest that arsenic trioxide preferentially induces nonapoptotic cell deaths, autophagy and mitotic cell death, in p53

  9. Functional amino acids in nutrition and health.

    Science.gov (United States)

    Wu, Guoyao

    2013-09-01

    The recent years have witnessed growing interest in biochemistry, physiology and nutrition of amino acids (AA) in growth, health and disease of humans and other animals. This results from the discoveries of AA in cell signaling involving protein kinases, G protein-coupled receptors, and gaseous molecules (i.e., NO, CO and H2S). In addition, nutritional studies have shown that dietary supplementation with several AA (e.g., arginine, glutamine, glutamate, leucine, and proline) modulates gene expression, enhances growth of the small intestine and skeletal muscle, or reduces excessive body fat. These seminal findings led to the new concept of functional AA, which are defined as those AA that participate in and regulate key metabolic pathways to improve health, survival, growth, development, lactation, and reproduction of the organisms. Functional AA hold great promise in prevention and treatment of metabolic diseases (e.g., obesity, diabetes, and cardiovascular disorders), intrauterine growth restriction, infertility, intestinal and neurological dysfunction, and infectious disease (including viral infections).

  10. Proton conduction in adipic acid/benzimidazole hybrid electrolytes

    Science.gov (United States)

    Karadedeli, B.; Bozkurt, A.; Baykal, A.

    2005-07-01

    Anhydrous proton conducting organic electrolytes were prepared by doping of adipic acid (AA) with benzimidazole (BnIm) at various stoichiometric ratios to form BnIm xAA ( x is the mol ratio of BnIm to -COOH unit). The AA-BnIm interactions were investigated with Fourier transform infrared spectroscopy (FT-IR) and X-ray diffraction (XRD). Thermal properties were characterized by means of thermogravimetry analysis (TG) and differential scanning calorimetry (DSC). The proton conductivity of these materials was studied by dielectric spectroscopy. The blends exhibit a maximum proton conductivity of 4×10 -3 S/cm at 130 °C.

  11. Proton conduction in adipic acid/benzimidazole hybrid electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Karadedeli, B. [Department of Chemistry, Fatih University, 34500 Buyukcekmece-Istanbul (Turkey); Bozkurt, A. [Department of Chemistry, Fatih University, 34500 Buyukcekmece-Istanbul (Turkey)]. E-mail: bozkurt@fatih.edu.tr; Baykal, A. [Department of Chemistry, Fatih University, 34500 Buyukcekmece-Istanbul (Turkey)

    2005-07-15

    Anhydrous proton conducting organic electrolytes were prepared by doping of adipic acid (AA) with benzimidazole (BnIm) at various stoichiometric ratios to form BnIm {sub x} AA (x is the mol ratio of BnIm to -COOH unit). The AA-BnIm interactions were investigated with Fourier transform infrared spectroscopy (FT-IR) and X-ray diffraction (XRD). Thermal properties were characterized by means of thermogravimetry analysis (TG) and differential scanning calorimetry (DSC). The proton conductivity of these materials was studied by dielectric spectroscopy. The blends exhibit a maximum proton conductivity of 4x10{sup -3} S/cm at 130 deg C.

  12. ?Suspects? in Etiology of Endemic Nephropathy: Aristolochic Acid versus Mycotoxins

    OpenAIRE

    Pepeljnjak, Stjepan; Klari?, Maja ?egvi?

    2010-01-01

    Despite many hypotheses that have been challenged, the etiology of endemic nephropathy (EN) is still unknown. At present, the implications of aristolochic acid (AA) and mycotoxins (ochratoxin A—OTA and citrinin—CIT) are under debate. AA-theory is based on renal pathohistological similarities between Chinese herbs nephropathy (CHN) and EN, findings of AA-DNA adducts in EN and in patients with urinary tract tumors (UTT), as well as the domination of A:T→T:A transversions in the p53 mutational s...

  13. Steam based conversion coating on AA6060 alloy: Effect of sodium silicate chemistry and corrosion performance

    DEFF Research Database (Denmark)

    Din, Rameez Ud; Bordo, Kirill; Tabrizian, Naja

    2017-01-01

    Surface treatment of aluminium alloy AA6060 using an industrially applicable pilot steam jet system with and without silicate chemistry has been investigated. Treatment using steam alone and steam with silicate, resulted in an oxide layer formation with thickness ∼425 nm and ∼160 nm, respectively....... Moreover, the use of sodium silicate resulted in the formation of distinct microstructure and incorporation of silicate into the oxide film. These oxide films reduced the anodic activity 4 times, while the corrosion protection by silicate containing oxide was the function of its concentration. Further......, in acid salt spray and filiform corrosion tests, oxide layer containing silicate exhibited two times higher corrosion resistance....

  14. Allosteric interactions and proton conducting pathways in proton pumping aa(3) oxidases: heme a as a key coupling element.

    Science.gov (United States)

    Capitanio, Nazzareno; Palese, Luigi Leonardo; Capitanio, Giuseppe; Martino, Pietro Luca; Richter, Oliver-Matthias H; Ludwig, Bernd; Papa, Sergio

    2012-04-01

    In this paper allosteric interactions in protonmotive heme aa(3) terminal oxidases of the respiratory chain are dealt with. The different lines of evidence supporting the key role of H(+)/e(-) coupling (redox Bohr effect) at the low spin heme a in the proton pump of the bovine oxidase are summarized. Results are presented showing that the I-R54M mutation in P. denitrificans aa(3) oxidase, which decreases by more than 200mV the E(m) of heme a, inhibits proton pumping. Mutational amino acid replacement in proton channels, at the negative (N) side of membrane-inserted prokaryotic aa(3) oxidases, as well as Zn(2+) binding at this site in the bovine oxidase, uncouples proton pumping. This effect appears to result from alteration of the structural/functional device, closer to the positive, opposite (P) surface, which separates pumped protons from those consumed in the reduction of O(2) to 2 H(2)O. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Determination of ascorbic acid, dopamine, and uric acid by a novel electrochemical sensor based on pristine graphene

    International Nuclear Information System (INIS)

    Qi, Shaopeng; Zhao, Bo; Tang, Heqing; Jiang, Xiaoqing

    2015-01-01

    In this article, a novel electrochemical sensor based on pristine graphene (PG) is successfully constructed to detect ascorbic acid (AA), dopamine (DA), and uric acid (UA). The PG is obtained by liquid-phase exfoliation of graphite and characterized by transmission electron microscopy and X-ray photoelectron spectroscopy. The sensor based on PG prepared by this method to realize simultaneous determination of AA, DA, and UA is firstly reported. The linear detection ranges for AA, DA, and UA are 9.00–2314 μM, 5.00–710 μM, and 6.00–1330 μM, respectively, with detection limits of 6.45, 2.00, and 4.82 μM. This PG based sensor exhibits excellent performance for detection of AA, DA, and UA, which is much better than those electrochemical sensors based on chemical converted graphene

  16. Amino Acid Medical Foods Provide a High Dietary Acid Load and Increase Urinary Excretion of Renal Net Acid, Calcium, and Magnesium Compared with Glycomacropeptide Medical Foods in Phenylketonuria

    OpenAIRE

    Stroup, Bridget M.; Sawin, Emily A.; Murali, Sangita G.; Binkley, Neil; Hansen, Karen E.; Ney, Denise M.

    2017-01-01

    Background. Skeletal fragility is a complication of phenylketonuria (PKU). A diet containing amino acids compared with glycomacropeptide reduces bone size and strength in mice. Objective. We tested the hypothesis that amino acid medical foods (AA-MF) provide a high dietary acid load, subsequently increasing urinary excretion of renal net acid, calcium, and magnesium, compared to glycomacropeptide medical foods (GMP-MF). Design. In a crossover design, 8 participants with PKU (16?35?y) provided...

  17. Position 228 in Paenibacillus macerans cyclodextrin glycosyltransferase is critical for 2-O-d-glucopyranosyl-l-ascorbic acid synthesis.

    Science.gov (United States)

    Chen, Sheng; Xiong, Yanjun; Su, Lingqia; Wang, Lei; Wu, Jing

    2017-04-10

    The markedly stable l-ascorbic acid (L-AA) derivative 2-O-d-glucopyranosyl-l-ascorbic acid (AA-2G) has been widely used in the fields of food, medicine, cosmetics, and husbandry. Cyclodextrin glycosyltransferase (CGTase) is considered suitable for the large-scale production of AA-2G. In this work, Paenibacillus macerans CGTase was used to produce AA-2G and the production was 13.5g/l. An amino-acid sequence alignment of α-, β-, and α⁄β-CGTase indicated that the Phe at position 228 of P. macerans CGTase was different from the amino acids at this position in other CGTases (Met, Val, or Ile). In addition, the CGTases from Anaerobranca gottschalkii and Bacillus circulans 251, which have Val and Met at position 228, were shown to produce 28.9 and 35.7g/l AA-2G, respectively, which verified the importance of this position for AA-2G synthesis. Subsequently, P. macerans CGTase mutants F228M and F228V were constructed and shown to produce 24.8g/l and 24.0g/l AA-2G, respectively, which are 84% and 78% higher than that of wild-type P. macerans CGTase, respectively. Kinetic analysis of AA-2G synthesis showed that affinities of the two mutants for L-AA and the catalytic efficiencies increased. Meanwhile, the mutants had lower cyclization activity but higher disproportionation activities, which is beneficial for AA-2G synthesis. All these results indicated that amino acid at position 228 of P. macerans CGTase is crucial to AA-2G synthesis. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Mitigation of membrane biofouling by d-amino acids: Effect of bacterial cell-wall property and d-amino acid type.

    Science.gov (United States)

    Wang, Si-Yu; Sun, Xue-Fei; Gao, Wen-Jing; Wang, Yi-Fu; Jiang, Bei-Bei; Afzal, Muhammad Zaheer; Song, Chao; Wang, Shu-Guang

    2018-04-01

    Development of novel approaches for biofouling mitigation is of crucial importance for membrane-based technologies. d-amino acids (d-AAs) have been proposed as a potential strategy to mitigate biofouling. However, the effect of bacterial cell-wall properties and d-AAs type on biofouling mitigation remains unclear. This study assesses the effect of d-AAs type on membrane biofouling control, towards Gram positive (G+) and Gram negative (G-) bacteria. Three kinds of d-AAs were found to inhibit both G+ and G- bacterial attachment in short-term attachment and dead-end filtration experiments. The existence of d-AAs reduces extracellular polysaccharides and proteins on the membrane, which may decrease membrane biofouling. Cross-flow filtration tests further indicated that d-AAs could effectively reduce membrane biofouling. The permeate flux recovery post chemical cleaning, improved for both P. aeruginosa and B. subtilis treated with d-AAs. The results obtained from this study enable better understanding of the role of d-AAs species on bacterial adhesion and biofilm formation. This may provide a new way to regulate biofilm formation by manipulating the species of d-AAs membrane systems. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Insight on the impacts of free amino acids and their metabolites on the immune system from a perspective of inborn errors of amino acid metabolism.

    Science.gov (United States)

    Pakula, Malgorzata M; Maier, Thorsten J; Vorup-Jensen, Thomas

    2017-06-01

    Amino acids (AAs) support a broad range of functions in living organisms, including several that affect the immune system. The functions of the immune system are affected when free AAs are depleted or in excess because of external factors, such as starvation, or because of genetic factors, such as inborn errors of metabolism. Areas covered: In this review, we discuss the current insights into how free AAs affect immune responses. When possible, we make comparisons to known disease states resulting from inborn errors of metabolism, in which changed levels of AAs or AA metabolites provide insight into the impact of AAs on the human immune system in vivo. We also explore the literature describing how changes in AA levels might provide pharmaceutical targets for safe immunomodulatory treatment. Expert opinion: The impact of free AAs on the immune system is a neglected topic in most immunology textbooks. That neglect is undeserved, because free AAs have both direct and indirect effects on the immune system. Consistent choices of pre-clinical models and better strategies for creating formulations are required to gain clinical impact.

  20. New biosourced AA and AB monomers from 1,4:3,6-dianhydrohexitols, Isosorbide, Isomannide, and Isoidide.

    Science.gov (United States)

    Saadaoui, Asma; Medimagh, Raouf; Marque, Sylvain; Prim, Damien; Chatti, Saber; Casabianca, Herve; Said Zina, Mongia

    2017-01-01

    In the present work, we propose the synthesis of a new family of sugar derived 1,4:3,6-dianhydrohexitol based AA/AB-type monomers. Unprecedented diacids based on Isomannide and Isoidide were elaborated with high yields and showed interestingly high melting point ranges (240-375 °C). Optimization of reaction conditions (temperature, time of reaction, and reactant ratios) has been investigated to synthesize the key intermediate of a set of AB monomers with acid, ester, and acid chloride functionalities. Isosorbide based ether benzoic acid AB monomer was polymerized and characterized by NMR and DSC techniques. The results show a semicrystalline behavior of the obtained polymer thanks to the controlled stereoregular arrangement of the AB starting monomer.

  1. Rapid microwave-assisted acid extraction of southern pine waste wood to remove metals from chromated copper arsenate (CCA) treatment

    Science.gov (United States)

    Chung-Yun Hse; Todd F. Shupe; Bin Yu

    2013-01-01

    Recovery of metals from chromated copper arsenate (CCA)-treated southern pine wood particles was investigated by extraction in a microwave reactor with binary combinations of acetic acid (AA), oxalic acid (OxA), and phosphoric acid (PhA). Use of OxA was not successful, as insoluble copper oxalate complexes impeded copper removal. The combination of OxA and AA also had...

  2. Arachidonic acid: an evolutionarily conserved signaling molecule modulates plant stress signaling networks.

    Science.gov (United States)

    Savchenko, Tatyana; Walley, Justin W; Chehab, E Wassim; Xiao, Yanmei; Kaspi, Roy; Pye, Matthew F; Mohamed, Maged E; Lazarus, Colin M; Bostock, Richard M; Dehesh, Katayoon

    2010-10-01

    Fatty acid structure affects cellular activities through changes in membrane lipid composition and the generation of a diversity of bioactive derivatives. Eicosapolyenoic acids are released into plants upon infection by oomycete pathogens, suggesting they may elicit plant defenses. We exploited transgenic Arabidopsis thaliana plants (designated EP) producing eicosadienoic, eicosatrienoic, and arachidonic acid (AA), aimed at mimicking pathogen release of these compounds. We also examined their effect on biotic stress resistance by challenging EP plants with fungal, oomycete, and bacterial pathogens and an insect pest. EP plants exhibited enhanced resistance to all biotic challenges, except they were more susceptible to bacteria than the wild type. Levels of jasmonic acid (JA) were elevated and levels of salicylic acid (SA) were reduced in EP plants. Altered expression of JA and SA pathway genes in EP plants shows that eicosapolyenoic acids effectively modulate stress-responsive transcriptional networks. Exogenous application of various fatty acids to wild-type and JA-deficient mutants confirmed AA as the signaling molecule. Moreover, AA treatment elicited heightened expression of general stress-responsive genes. Importantly, tomato (Solanum lycopersicum) leaves treated with AA exhibited reduced susceptibility to Botrytis cinerea infection, confirming AA signaling in other plants. These studies support the role of AA, an ancient metazoan signaling molecule, in eliciting plant stress and defense signaling networks.

  3. Screening of Catalyst and Important Variable for The Esterification of Acrylic Acid with 2 Ethylhexanol

    Science.gov (United States)

    Ahmad, M. A. A.; Chin, S. Y.

    2017-06-01

    The global demand of 2-ethylhexyl acrylate (2EHA) market has witnessed a significant growth in the past few years and this growth is anticipated to increase in the coming years. 2EHA is one of the basic organic building blocks that mainly used in the production of coatings, adhesives, superabsorbents, thickeners and plastic additives. Homogenous acid-catalysed esterification of acrylic acid (AA) with 2-ethylhexanol (2EH) is commonly used for the production of 2EHA. The homogeneous catalysts such as sulfuric and para-toluene sulfonic acid have resulted the costly and complicated downstream process that generates acidic, corrosive and non-environmental friendly waste. Therefore, it is importance to develop a cheaper process that employing heterogeneous catalysts and alternative raw material from wastewater containing acrylic acid. In this research, the study for the esterification of AA with 2EH catalysed by ion-exchange resin was conducted. The best sulfonic acid functional cation-exchange resin among SK104, SK1B, PK208, PK216, PK228, RCP145, and RCP160 was screened. PK208 outperformed the other resins and it was used subsequently in the parametric studies. The effect of important parameters (initial concentration of acrylic acid (AA), temperature, molar ratio of reactant (AA and 2EH), catalyst loading, and polymerisation inhibitor loading) was studied using 2 factorial design to determine the significant parameters to the esterification. It was found that the initial concentration of AA and temperature were most significantly affecting the esterification of AA with 2EH.

  4. Effect of glycine supplementation in low protein diets with amino acids from soy protein isolate or free amino acids on broiler growth and nitrogen utilisation.

    Science.gov (United States)

    Siegert, W; Wild, K J; Schollenberger, M; Helmbrecht, A; Rodehutscord, M

    2016-06-01

    Here, it was investigated whether substitution of amino acids (AA) from soy protein isolate with free AA in low crude protein diets influences the growth performance and N utilisation in broilers, and whether interactions with dietary glycine equivalent (Glyequi) concentration exist. Birds were distributed in two 2 × 2 factorial arrangements of 48 floor pens containing 10 birds each, plus 48 metabolism cages containing two birds each. Experimental feed was provided for ad libitum consumption from d 7 to 22. Diets contained either a soy protein isolate at 79 g/kg or a mix of free AA, which supplied the same amount of 18 proteinogenic AA. A mix of free glycine and l-serine was used to obtain low and high (12.0 and 20.5 g/kg dry matter) levels of dietary Glyequi. Substitution of soy protein isolate with free AA reduced the average daily gain and feed efficiency, mainly due to reduced feed intake. Efficiency of N accretion was not influenced by the AA source or Glyequi concentration on d 21, possibly due to the lower AA digestibility of soy protein isolate and higher urinary excretion of nitrogenous substances in the treatments with the AA mix. The average daily weight gain of the treatments with high Glyequi concentration was higher for both AA sources. This increase was due to higher average daily feed intake by broilers in the treatments with soy protein isolate and due to the increased feed efficiency in the treatments with the AA mix. Broilers exhibited different growth responses to dietary Glyequi between the AA sources; however, these responses could not be attributed to the different utilisation of Glyequi for uric acid synthesis.

  5. Norepinephrine-modified glassy carbon electrode for the simultaneous determination of ascorbic acid and uric acid

    International Nuclear Information System (INIS)

    Zare, H.R.; Memarzadeh, F.; Ardakani, M. Mazloum; Namazian, M.; Golabi, S.M.

    2005-01-01

    The oxidation of norepinephrine (NE) on a preactivated glassy carbon electrode leads to the formation of a deposited layer of about 4.2 x 10 -10 mol cm -2 at the surface of the electrode. The electron transfer rate constant, k s , and charge transfer coefficient, α, for electron transfer between the electrode and immobilized NE film were calculated as 44 s -1 and 0.46, respectively. The NE-modified glassy carbon electrode exhibited good electrocatalytic properties towards ascorbic acid (AA) oxidation in phosphate buffer (pH 7.0) with an overpotential of about 475 mV lower than that of the bare electrode. The electrocatalytic response was evaluated by cyclic voltammetry, chronoamperometry, amperometry and rotating disk voltammetry. The overall number of electrons involved in the catalytic oxidation of AA and the number of electrons involved in the rate-determining step are 2 and 1, respectively. The rate constant for the catalytic oxidation of AA was evaluated by RDE voltammetry and an average value of k h was found to be 8.42 x 10 3 M -1 s -1 . Amperometric determination of AA in stirred solution exhibits a linear range of 2.0-1300.0 μM (correlation coefficient 0.9999) and a detection limit of 0.076 μM. The precision of amperometry was found to be 1.9% for replicate determination of a 49.0 μM solution of AA (n = 6). In differential pulse voltammetric measurements, the NE-modified glassy carbon electrode can separate the AA and uric acid (UA) signals. Ascorbic acid oxidizes at more negative potential than UA. Also, the simultaneous determination of UA and AA is achieved at the NE-modified electrode

  6. Plasma Free Fatty Acids in Hyperemesis Gravidarum Pregnancy

    Science.gov (United States)

    Ulubay, Mustafa; Ozturk, Mustafa; Ozturk, Ozlem; Keskin, Ugur; Fidan, Ulas; Sertoglu, Erdim; Aydin, Hakan; Yilmaz, Ali; Cemal Yenen, Mufit

    2017-01-01

    Abstract We evaluated the free fatty acids differences in plasma between hyperemesis gravidarum(HG) and healthy pregnant in first trimester pregnancy. Objective We aimed to compare the plasma levels of DHA, AA and EPA, between HG patients and healthy pregnant women Design Fifty-two pregnants were involved in the study. Twenty-six pregnants of them were HG as study group, and twenty-six pregnants were enrolled as healthy pregnant women at the similar gestational age. The saturated fatty acids C14, C15, C16, C18, C20, C22, and C24; the omega-3 fatty acids eicosapentaenoic acid, (EPA) and docosahexaenoic acid, (DHA); the omega-6 fatty acids linoleic acid, arachidonic acid (AA), and homo-gamma-linolenic acid; and the omega-9 fatty acids oleic acid, erucic acid, and nervonic acid were analysed by gas chromatography. Results Statistically differences was not seen between the groups with maternal age, gestational age, or plasma levels of EPA, DHA, and AA. Statistically significant difference was seen between the groups with plasma levels of C20 and C22(pHyperemesis gravidarum. PMID:28730165

  7. Plasma Free Fatty Acids in Hyperemesis Gravidarum Pregnancy.

    Science.gov (United States)

    Ulubay, Mustafa; Ozturk, Mustafa; Ozturk, Ozlem; Keskin, Ugur; Fidan, Ulas; Sertoglu, Erdim; Aydin, Hakan; Yilmaz, Ali; Cemal Yenen, Mufit

    2017-01-01

    We evaluated the free fatty acids differences in plasma between hyperemesis gravidarum(HG) and healthy pregnant in first trimester pregnancy. We aimed to compare the plasma levels of DHA, AA and EPA, between HG patients and healthy pregnant women. Fifty-two pregnants were involved in the study. Twenty-six pregnants of them were HG as study group, and twenty-six pregnants were enrolled as healthy pregnant women at the similar gestational age. The saturated fatty acids C14, C15, C16, C18, C20, C22, and C24; the omega-3 fatty acids eicosapentaenoic acid, (EPA) and docosahexaenoic acid, (DHA); the omega-6 fatty acids linoleic acid, arachidonic acid (AA), and homo-gamma-linolenic acid; and the omega-9 fatty acids oleic acid, erucic acid, and nervonic acid were analysed by gas chromatography. Statistically differences was not seen between the groups with maternal age, gestational age, or plasma levels of EPA, DHA, and AA. Statistically significant difference was seen between the groups with plasma levels of C20 and C22(p Hyperemesis gravidarum.

  8. Plasma Ascorbic Acid Concentration and some Haematological ...

    African Journals Online (AJOL)

    Aim: To determine the plasma ascorbic acid concentration, haematocrit, reticulocyte count and blood cell morphology in homozygous sickle cell disease in Enugu metropolis. Materals and Methods: Forty known sickle cell anaemia patients (HbSS) and ten non-sicklers (HbAA) were used as tests and controls respectively.

  9. Natural Aging Behaviour Of AA6111 Aluminium | Quainoo | Ghana ...

    African Journals Online (AJOL)

    Natural aging is observed to affect the kinetic reaction of AA6111. Dans la campagne continue pour la réduction en poids dans le nouveau modèle d\\' automobile, les séries 6000 d\\' aluminium en alliage ont émergé comme le matériau de feuille de carrosserie la plus prometteuse endurcirable avec l\\'âge dans l\\'industrie de ...

  10. Evolutionary status of AA Doradus: still an enigma?

    International Nuclear Information System (INIS)

    Sarna, M.J.

    1985-01-01

    The evolutionary scenarios for AA Dor are reconsidered using new contraction times for degenerate red dwarfs. It is found that both types of models considered by Paczynski (1980) with the primary being either an hydrogen shell burning helium white dwarf or a double shell burning carbon-oxygen white dwarf are consistent with the available data. The second model requires a very narrow range of the initial parameters of the binary system. 26 refs. (author)

  11. Mexican obsidian samples analysed by PIXE and AAS

    Energy Technology Data Exchange (ETDEWEB)

    Tenorio, D.; Jimenez-Reyes, M. [Inst. Nacional de Investigaciones Nucleares, Mexico (Mexico); Lagarde, G.

    1997-12-31

    Proton induced X-ray emission analysis results are reported for obsidian artifacts from different sites of the State of Mexico: Teotenango, Calixtlahuaca, La Marqueza, Malinalco and Tonatico. Twenty elements were analysed by PIXE and some of them were verified by AAS. The results show that the samples came from three different sources: Teotenango and Calixtlahuaca samples from the first, La Marqueza and Malinalco samples from the second and Tonatico samples from the third. (author)

  12. Wooden models of an AA quadrupole between bending magnets

    CERN Multimedia

    CERN PhotoLab

    1978-01-01

    At two points in the AA lattice, a quadrupole (QDN, defocusing, narrow) was tightly wedged between two bending magnets (BST, short, wide). This picture of wooden models lets one imagine the strong interaction between their magnetic fields. There was no way one could calculate with the necessary accuracy the magnetic effects and their consequences for the machine optics. The necessary corrections were made after measurements with a circulating beam, in a tedious iterative procedure, with corrrection coils and shims.

  13. Ascorbic acid from lime juice does not improve the iron status of iron-deficient women in rural Mexico.

    Science.gov (United States)

    Garcia, Olga P; Diaz, Margarita; Rosado, Jorge L; Allen, Lindsay H

    2003-08-01

    Although ascorbic acid (AA) increases dietary iron bioavailability, there has been no food-based community trial of its efficacy in improving iron status. The objective was to assess the efficacy of 25 mg AA as agua de limón (limeade), consumed with each of 2 daily meals, in improving the iron status of iron-deficient women. Two rural Mexican populations were randomly assigned to an AA or a placebo group, each with 18 iron-deficient women. The AA group was given 500 mL limeade containing 25 mg AA twice a day, 6 d/wk, for 8 mo. The placebo group was given a lime-flavored beverage free of AA or citric acid. Beverages were consumed within 30 min of 2 main daily meals. Data were collected on morbidity (3 times/wk), dietary intake (on 6 d), socioeconomic status, parasites (twice), medical history, and response to treatment. Blood samples at 0, 2, 4, 6, and 8 mo were analyzed for hemoglobin, plasma AA, plasma ferritin, transferrin receptors, and C-reactive protein. AA intake was significantly (P < 0.0001) higher in the AA group, but nonheme iron, heme iron, and phytic acid intakes did not differ significantly. Plasma AA was significantly (P < 0.01) higher in the AA group at 2, 4, 6, and 8 mo. There were no final differences between groups in hemoglobin, plasma ferritin, or transferrin receptor concentrations or in the ratio of transferrin receptors to plasma ferritin after control for initial concentrations. Increasing dietary AA by 25 mg at each of 2 meals/d did not improve iron status in iron-deficient women consuming diets high in phytate and nonheme iron.

  14. New perspectives on contributing factors to the monthly behavior of the aa geomagnetic index

    Science.gov (United States)

    Mendoza, Blanca; Pazos, Marni; González, Luis Xavier

    2016-12-01

    We studied the Aa geomagnetic index ( aa index daily average) behavior on a monthly timescale using data from 1868 to 2015 for cycles 11-24. We identified solar- and lunar-associated periodicities in the Aa time series and found statistically significant Aa minima values a few days before the full Moon and high Aa values during the new Moon. When considering all the cycles, it was clear that the deepest Aa minima occurred during the Aa descending activity phase. However, when the cycles were separated according to the direction of the interplanetary magnetic field (IMF), the Aa minima came from the contribution of cycles with the IMF pointing toward the Sun (Type 1). Furthermore, during the descending phase of cycles with the IMF pointing away from the Sun (Type 2), the smallest Aa index values were found along with smaller changes compared to Type 1 cases. This behavior implies that during Type 1 cycles there are larger Aa perturbations than during Type 2 cycles. It is very likely that the mechanisms responsible for the Aa monthly behavior are a combination of solar and lunar effects that depend on several factors: (a) the Moon phases (new and full Moon), (b) the phase of the solar cycle (ascending or descending), and (c) the direction of the interplanetary magnetic field (away or toward the Sun).

  15. Amino Acid Medical Foods Provide a High Dietary Acid Load and Increase Urinary Excretion of Renal Net Acid, Calcium, and Magnesium Compared with Glycomacropeptide Medical Foods in Phenylketonuria

    Directory of Open Access Journals (Sweden)

    Bridget M. Stroup

    2017-01-01

    Full Text Available Background. Skeletal fragility is a complication of phenylketonuria (PKU. A diet containing amino acids compared with glycomacropeptide reduces bone size and strength in mice. Objective. We tested the hypothesis that amino acid medical foods (AA-MF provide a high dietary acid load, subsequently increasing urinary excretion of renal net acid, calcium, and magnesium, compared to glycomacropeptide medical foods (GMP-MF. Design. In a crossover design, 8 participants with PKU (16–35 y provided food records and 24-hr urine samples after consuming a low-Phe diet in combination with AA-MF and GMP-MF for 1–3 wks. We calculated potential renal acid load (PRAL of AA-MF and GMP-MF and determined bone mineral density (BMD measurements using dual X-ray absorptiometry. Results. AA-MF provided 1.5–2.5-fold higher PRAL and resulted in 3-fold greater renal net acid excretion compared to GMP-MF (p=0.002. Dietary protein, calcium, and magnesium intake were similar. GMP-MF significantly reduced urinary excretion of calcium by 40% (p=0.012 and magnesium by 30% (p=0.029. Two participants had low BMD-for-age and trabecular bone scores, indicating microarchitectural degradation. Urinary calcium with AA-MF negatively correlated with L1–L4 BMD. Conclusion. Compared to GMP-MF, AA-MF increase dietary acid load, subsequently increasing urinary calcium and magnesium excretion, and likely contributing to skeletal fragility in PKU. The trial was registered at clinicaltrials.gov as NCT01428258.

  16. Corrosion of AA2024-T3 Part III: Propagation

    International Nuclear Information System (INIS)

    Glenn, A.M.; Muster, T.H.; Luo, C.; Zhou, X.; Thompson, G.E.; Boag, A.; Hughes, A.E.

    2011-01-01

    Research highlights: → Corrosion of AA2024 in 0.1 M NaCl was examined for immersion times up to 120 min. → Rings of corrosion product with H 2 evolution developed after 5 min immersion. → Intergranular attack penetrated up to 60 μm below the rings within 120 min. → After 240 min mixed intergranular attack and grain etchout were observed. - Abstract: Optical and electron microscopies and EBSD were used to study the early stages of corrosion propagation during stable pit formation on AA2024-T3. Polished AA2024-T3 developed large scale rings of corrosion product, typically a few hundred microns in diameter, within 2 h of exposure to 0.1 M NaCl at room temperature. These features were sectioned using diamond ultramicrotomy and substantial subsurface attack, in the form of intergranular corrosion was observed beneath these sites with virtually no grain etchout. A model is proposed for the mechanism of stable pit progression which involves extensive grain boundary attack, followed by grain etchout leading to open pit formation.

  17. Renal Involvement in AA Amyloidosis: Clinical Outcomes and Survival

    Directory of Open Access Journals (Sweden)

    Murvet Yilmaz

    2013-03-01

    Full Text Available Background: The natural history of AA amyloidosis is typically progressive, leading to multiple organ failure and death. We analyzed the etiology as well as clinical and laboratory features of patients with biopsy-proven AA amyloidosis and evaluated the ultimate outcome. Methods: Seventy-three patients (24 female; mean age 41.85±15.89 years were analyzed retrospectively. Demographic, clinical and laboratory features were studied and the outcome was assessed. Results: Familial Mediterranean Fever and tuberculosis were the most frequent causes of amyloidosis. Mean serum creatinine and proteinuria at diagnosis were 4.65±4.89 mg/dl and 8.04±6.09 g/day, respectively; and stage I, II, III, IV and V renal disease were present in 19.2%, 13.7%, 16.4%, 11%, and 39.7% of the patients, respectively. ESRD developed in 16 patients during the follow-up period. All of the ESRD patients started a dialysis programme. Thirty patients (41% died during the follow-up period; median patient survival was 35.9±6.12 months. Old age, tuberculosis etiology, advanced renal disease and low serum albumin levels were associated with a worse prognosis. Serum albumin was a predictor of mortality in logistic regression analysis. Conclusion: The ultimate outcome of the patients with AA amyloidosis is poor, possibly due to the late referral to the nephrology clinics. Early referral may be helpful to improve prognosis.

  18. Characterizing the Constitutive Properties of AA7075 for Hot Forming

    Science.gov (United States)

    Omer, K.; Kim, S.; Butcher, C.; Worswick, M.

    2017-09-01

    The work presented herein investigates the constitutive properties of AA7075 as it undergoes a hot stamping/die quenching process. Tensile specimens were solutionized inside a heated furnace set to 470°C. Once solutionized, the samples were quenched to an intermediate temperature using a vortex air chiller at a minimum rate of 52°C/s. Tensile tests were conducted at steady state temperatures of 470, 400, 300, 200, 115 and 25°C. This solutionizing and subsequent quenching process replicated the temperature cycle and quench rates representative of a die quenching operation. The results of the tensile test were analyzed with digital imaging correlation using an area reduction approach. The area reduction approach approximated the cross-sectional area of the tensile specimen as it necked. The approach allowed for the true stress-strain response to be calculated well past the initial necking point. The resulting true stress-strain curves showed that the AA7075 samples experienced almost no hardening at 470°C. As steady state temperature decreased, the rate of hardening as well as overall material strength increased. The true stress strain curves were fit to a modified version of the extended Voce constitutive model. The resulting fits can be used in a finite element model to predict the behaviour of an AA7075 blank during a die quenching operation.

  19. Long-term biases in geomagnetic K and aa indices

    Science.gov (United States)

    Love, J.J.

    2011-01-01

    Analysis is made of the geomagnetic-activity aa index and its source K-index data from groups of ground-based observatories in Britain, and Australia, 1868.0-2009.0, solar cycles 11-23. The K data show persistent biases, especially for high (low) K-activity levels at British (Australian) observatories. From examination of multiple subsets of the K data we infer that the biases are not predominantly the result of changes in observatory location, localized induced magnetotelluric currents, changes in magnetometer technology, or the modernization of K-value estimation methods. Instead, the biases appear to be artifacts of the latitude-dependent scaling used to assign K values to particular local levels of geomagnetic activity. The biases are not effectively removed by weighting factors used to estimate aa. We show that long-term averages of the aa index, such as annual averages, are dominated by medium-level geomagnetic activity levels having K values of 3 and 4. ?? 2011 Author(s).

  20. Effects of Friction Stir Welding Speed on AA2195 alloy

    Directory of Open Access Journals (Sweden)

    Lee Ho-Sung

    2016-01-01

    Full Text Available The application of friction stir welding (FSW to aerospace has grown rapidly due to the high efficiency and environmental friendly nature of the process. FSW is achieved by plastic flow of frictionally heated material in solid state and offers many advantages of avoiding hot cracking and limiting component distortion. Recently low density, high modulus and high strength AA2195 are used as substitute for conventional aluminum alloys since the weight saving is critical in aerospace applications. One of the problems for this alloy is weld metal porosity formation leading to hot cracking. Combination of FSW and AA2195 provides synergy effect to improve mechanical properties and weight saving of aerospace structure such as cryogenic fuel tanks for launch systems. The objective of this paper is to investigate the effect of friction stir welding speed on mechanical and microstructural properties of AA2195. The friction stir welded materials were joined with four different tool rotation speeds (350~800 rpm and five welding speeds (120~360 mm/min, which are the two prime welding parameters in this process.

  1. Cell volume regulation in hemoglobin CC and AA erythrocytes

    International Nuclear Information System (INIS)

    Berkowitz, L.R.; Orringer, E.P.

    1987-01-01

    Swelling hemoglobin CC erythrocytes stimulates a ouabain-insensitive K flux that restores original cell volume. Studies were performed with the K analog, 86 Rb. This volume regulatory pathway was characterized for its anion dependence, sensitivity to loop diuretics, and requirement for Na. The swelling-induced K flux was eliminated if intracellular chloride was replaced by nitrate and both swelling-activated K influx and efflux were partially inhibited by 1 mM furosemide or bumetanide. K influx in swollen hemoglobin CC cells was not diminished when Na in the incubation medium was replaced with choline, indicating Na independence of the swelling-induced flux. Identical experiments with hemoglobin AA cells also demonstrated a swelling-induced increase in K flux, but the magnitude and duration of this increase were considerably less than that seen with hemoglobin CC cells. The increased K flux in hemoglobin AA cells was likewise sensitive to anion replacement and to loop diuretics and did not require the presence of Na. These data indicate that a volume-activated K pathway with similar transport characteristics exists in both hemoglobin CC and AA red cells

  2. Lipoxygenase- and cyclooxygenase-reaction products and incorporation into glycerolipids or radiolabeled arachidonic acid in the bovine retina

    International Nuclear Information System (INIS)

    Birkle, D.L.; Bazan, N.G.

    1984-01-01

    The metabolism of radiolabeled arachidonic acid (AA) by the intact bovine retina in vitro has been studied. Synthesis of prostaglandins (PGs) and hydroxyeicosatetraenoic acids (HETEs), and incorporation of AA into glycerolipids has been measured by reverse-phase and straight-phase high performance liquid chromatography with flow scintillation detection, and by thin-layer chromatography. AA was actively acylated into glycerolipids, particularly triglycerides, phosphatidylcholine and phosphatidylinositol. AA was also converted to the major PGs, PGF2 alpha, PGE2, PGD2, 6-keto-PGF1 alpha and TXB2, and to the lipoxygenase reaction products, 12-HETE, 5-HETE, and other monohydroxy isomers. Approximately 6% of the radiolabeled AA was converted to eicosanoids. The synthesis of HETEs was inhibited in a concentration-dependent manner (IC50 . 8.3 nM) by nordihydroguaiaretic acid (NDGA). PG synthesis was inhibited by aspirin (10 microM), indomethacin (1 microM) and NDGA (IC50 . 380 nM). Metabolism of AA via lipoxygenase, cyclooxygenase and activation-acylation was inhibited by boiling retinal tissue prior to incubation. These studies demonstrate an active system for the uptake and utilization of AA in the bovine retina, and provide the first evidence of lipoxygenase-mediated metabolism of AA, resulting in the synthesis of mono-hydroxyeicosatetraenoic acids, in the retina

  3. APPLICATION OF ASCORBIC ACID 2-PHOSPHATE AS A NEW ...

    African Journals Online (AJOL)

    An electrochemical assay of the enzyme alkaline phosphatase (ALP) using ascorbic acid 2-phosphate (AAP) as a new voltammetric substrate has been described in this paper. In the alkaline buffer solution the ALP enzymatic hydrolysis product of AAP was ascorbic acid (AA), which was an electro-active substance and had ...

  4. The Utilization of Nitrogen Gas as a Carrier Gas in the Determination of Hg Ions Using Cold Vapor-Atomic Absorption Spectrophotometer (CV-AAS)

    OpenAIRE

    Panggabean, Aman Sentosa; Pasaribu, Subur P; Kristiana, Farida

    2018-01-01

    The research about utilization of nitrogen gas as a carrier gas in the determination of Hg ions by using Cold Vapor-Atomic Absorption Spectrophotometer (CV-AAS) method has been conducted. To optimize the measurement results, several parameters that affect hydride generator have been studied. Some specified important parameters are SnCl2 concentration as reductant, acid concentration, and the analytical performance such as repeatability and reproducibility (% RSD), linearity (r), limits of det...

  5. Effect of gaussian beam on microstructural and mechanical properties of dissimilarlaser welding ofAA5083 and AA6061 alloys

    Science.gov (United States)

    Srinivas, B.; Cheepu, Muralimohan; Sivaprasad, K.; Muthupandi, V.

    2018-03-01

    The present study focuses on a sheet thickness of 4 mm using different laser power and welding rate by the laser beam welding (LBW) at a beam size180 μm. The observations on the weldments are showing that thermal conductivity of the materials plays a major role on microstructural changes. The as-welded mechanical properties were studied by correlation with its microstructures. Due to the steeper temperature gradient during the laser beam welding AA6061 was showing the greater variation compares with AA5083 side in the micro hardness studies.Also, the tensile strength of 241 MPa has been reported as highest with the welds made of laser powerat 3.5 kW and welding rate at 3.5 mmin-1.

  6. Prediction of shear and tensile strength of the diffusion bonded AA5083 and AA7075 aluminium alloy using ANN

    International Nuclear Information System (INIS)

    Sagai Francis Britto, A.; Raj, R. Edwin; Mabel, M. Carolin

    2017-01-01

    Diffusion bonding is a pressure welding technique to establish bonds by inter diffusion of atoms. Bonding characteristics were generated by varying the significant process conditions such as the bonding temperature, the pressing load and the duration of pressure while bonding the aluminium alloys AA5083 and AA7075. Deriving analytical correlation with the process variables to weld strength is quite involved due to the non-linear dependency of the process variables with the mechanical strength of the joints. An arbitrary function approximation mechanism, the artificial neural network (ANN) is therefore employed to develop the models for predicting the mechanical properties of the bonded joints. Back propagation technique, which alters the network weights to minimize the mean square error was used to develop the ANN models. The models were tested, validated and found to be satisfactory with good prediction accuracy.

  7. Eicosapentaenoic and dihomo gamma linolenic acid metabolism by cultured rat mesangial cells

    Energy Technology Data Exchange (ETDEWEB)

    Scharschmidt, L.A.; Gibbons, N.B.; Neuwirth, R.

    1989-01-01

    To better understand the effects of dietary fatty acid manipulations on glomerular function, we compared mesangial incorporation, release, and metabolism of arachidonic (AA), eicosapentaenoic (EPA), and dihomo gamma linolenic (DHG) acids. We found marked differences in mesangial handling of these fatty acids. AA was incorporated into lipids of mesangial cells much more rapidly than EPA or DHG. Ionophore-induced stimulation of fatty acid release from mesangial cells prelabeled with (/sup 14/C)AA, (/sup 14/C)EPA, or (/sup 14/C)DHG caused a release of labeled AA greater than DHG much less than EPA, respectively. Preloading mesangial cells with DHG or EPA for 24 h reduced subsequent basal, ionophore-, and hormone-stimulated prostaglandin E2 (PGE2) synthesis. Finally, unlike AA, neither EPA nor DHG was converted to a significant extent by mesangial cyclooxygenase or lipoxygenase. Thus the mesangial metabolism of DHG and EPA differs both quantitatively and qualitatively from that of AA. Furthermore, EPA and DHG inhibit metabolism of AA at the level of mesangial cyclooxygenase.

  8. The influence of Copolimers Acrylic Acid onto Poli(Etilene Terephthalate)woven fabric

    International Nuclear Information System (INIS)

    Srie-Sunaryati

    2000-01-01

    To improve suitability of wearing poli etilene terephthalate (PET) wovenfabric, it need to enhance the ability in absorbing of water vapour. For theabove reason acrylic acid (AA) has been grafted onto PET wovenfabric(PET-g-AA). Fourier Transform Infrared (FT-IR) data show that poly(acrylic acid) have grafted onto PET woven fabric. Thermal propertiesobtained from DSC (Differential Scanning Calorimeter) measurements of PET-g-AA show that the grafting does not affect bulk properties of PET. Thedecrease of the tensile strength had occurred to PET-g-MMA, however it ratherinfluenced by the reaction time than the initial concentration of acrylicacid. (author)

  9. Influence of tryptophan loading on urinary excretion of anthranilic acid and 3-hydroxyanthranilic acid by men and women as determined by alkali flame ionization gas chromatography

    NARCIS (Netherlands)

    Poll, J.M. van der; Vink, M.; Schrijver, J.; Odink, J.

    1986-01-01

    A gas chromatographic method with alkali flame ionization detection is described for the determination of urinary total (free and conjugated) anthranilic acid (AA) and 3-hydroxyanthranilic acid (HAA) as their pentafluorobenzyl esters. Prior to analysis, urine was hydrolysed using hydrochloric acid

  10. Effect of the ratio between essential and nonessential amino acids in the diet on utilization of nitrogen and amino acids by growing pigs

    NARCIS (Netherlands)

    Lenis, N.P.; Diepen, van H.T.M.; Bikker, P.; Jongbloed, A.W.; Meulen, van der J.

    1999-01-01

    In 36 growing pigs (30 to 60 kg), N balance and amino acid (AA) composition of weight gain were measured to evaluate the interactive effect of the ratio between N from essential amino acids (EAA(N)) to nonessential amino acids (NEAA(N)) and total N level (T(N)) in the diet on N retention and

  11. Kinetics of Oxidation of Some Amino Acids by N-Chlorosaccharin in Aqueous Acetic Acid Medium

    Directory of Open Access Journals (Sweden)

    N. A. Mohamed Farook

    2004-01-01

    Full Text Available The kinetics of oxidation of some amino acids namely, glycine, alanine, aspartic acid, arginine, and histidine, (AA by N-chlorosaccharin (NCSA in aqueous acetic acid medium in the presence of perchloric acid have been investigated. The observed rate of oxidation is first order in [AA], [NCSA] and of inverse fractional order in [H+]. The main product of the oxidation is the corresponding aldehyde. The ionic strength on the reaction rate has no significant effect. The effect of changing the dielectric constant of the medium on the rate indicates the reaction to be of dipole-dipole type. Hypochlorous acid has been postulated as the reactive oxidizing species. The reaction constants involved in the mechanism are derived. The activation parameters are computed with respect to slow step of the mechanism.

  12. Reduction of nitrobenzene with alkaline ascorbic acid: Kinetics and pathways

    International Nuclear Information System (INIS)

    Liang, Chenju; Lin, Ya-Ting; Shiu, Jia-Wei

    2016-01-01

    Highlights: • Alkaline ascorbic acid (a.k.a. vitamin C) is capable of reductively degrading NB. • The pH above the pK a2 of ascorbic acid increases reductive electron transfer to NB. • The rate equation for the reactions between NB and AA is determined. • NSB, AZOXY, and AZO are identified as intermediates and aniline as a final product. • Alkaline pH is essential for AA remediation of NB contaminated soils. - Abstract: Alkaline ascorbic acid (AA) exhibits the potential to reductively degrade nitrobenzene (NB), which is the simplest of the nitroaromatic compounds. The nitro group (NO 2 − ) of NB has a +III oxidation state of the N atom and tends to gain electrons. The effect of alkaline pH ranging from 9 to 13 was initially assessed and the results demonstrated that the solution pH, when approaching or above the pK a2 of AA (11.79), would increase reductive electron transfer to NB. The rate equation for the reactions between NB and AA at pH 12 can be described as r = ((0.89 ± 0.11) × 10 −4 mM 1−(a + b) h −1 ) × [NB] a = 1.35 ± 0.10 [AA] b = 0.89 ± 0.01 . The GC/MS analytical method identified nitrosobenzene, azoxybenzene, and azobenzene as NB reduction intermediates, and aniline (AN) as a final product. These experimental results indicate that the alkaline AA reduction of NB to AN mainly proceeds via the direct route, consisting of a series of two-electron or four-electron transfers, and the condensation reaction plays a minor route. Preliminary evaluation of the remediation of spiked NB contaminated soils revealed that maintenance of alkaline pH and a higher water to soil ratio are essential for a successful alkaline AA application.

  13. The role of amino acids in hydroxyapatite mineralization

    Science.gov (United States)

    2016-01-01

    Polar and charged amino acids (AAs) are heavily expressed in non-collagenous proteins (NCPs), and are involved in hydroxyapatite (HA) mineralization in bone. Here, we review what is known on the effect of single AAs on HA precipitation. Negatively charged AAs, such as aspartic acid, glutamic acid (Glu) and phosphoserine are largely expressed in NCPs and play a critical role in controlling HA nucleation and growth. Positively charged ones such as arginine (Arg) or lysine (Lys) are heavily involved in HA nucleation within extracellular matrix proteins such as collagen. Glu, Arg and Lys intake can also increase bone mineral density by stimulating growth hormone production. In vitro studies suggest that the role of AAs in controlling HA precipitation is affected by their mobility. While dissolved AAs are able to inhibit HA precipitation and growth by chelating Ca2+ and PO43− ions or binding to nuclei of calcium phosphate and preventing their further growth, AAs bound to surfaces can promote HA precipitation by attracting Ca2+ and PO43− ions and increasing the local supersaturation. Overall, the effect of AAs on HA precipitation is worth being investigated more, especially under conditions closer to the physiological ones, where the presence of other factors such as collagen, mineralization inhibitors, and cells heavily influences HA precipitation. A deeper understanding of the role of AAs in HA mineralization will increase our fundamental knowledge related to bone formation, and could lead to new therapies to improve bone regeneration in damaged tissues or cure pathological diseases caused by excessive mineralization in tissues such as cartilage, blood vessels and cardiac valves. PMID:27707904

  14. [A review for recent advances in AA amyloid research and therapeutic approach to AA amyloidosis complicating rheumatoid arthritis].

    Science.gov (United States)

    Tamura, Hiroaki; Hasegawa, Kiminori

    2009-02-01

    AA amyloidosis is a life threatening clinical complication of chronic inflammatory diseases such as rheumatoid arthritis. It has been demonstrated biochemically that amyloidosis resulted from abnormal folding of proteins, which are deposited as insoluble fibrils in extracellular tissue, leading to the disruption of their normal function. In this regard, amyloidosis has been recognized as a conformation disorder. Interestingly, genetic polymorphisms of amyloid precursor protein (SAA) have been reported to associate with increased risk for AA amyloidosis. Also recent biochemical research revealed that SAA is synthesized under the influence of the proinflammatory cytokines, such as IL-6, TNF-alpha, IL-1. Additionally, it was suggested that amyloid deposits in extracellular tissue could reflect to the serum level of SAA in the reversible fashion, leading to the hypothesis that the control of the SAA synthesis could be beneficial to the treatment of amyloidosis. In this context, anti-cytokine therapies may be most effective. Especially the inhibition of IL-6 is critical to suppression of SAA production, so treatment with a humanized monoclonal antibody against human IL-6 receptor may not only ameliorate RA disease activity but also pave the way for the treatment of AA amyloidosis.

  15. Overexpression of a Novel NAC Domain-Containing Transcription Factor Gene (AaNAC1) Enhances the Content of Artemisinin and Increases Tolerance to Drought and Botrytis cinerea in Artemisia annua.

    Science.gov (United States)

    Lv, Zongyou; Wang, Shu; Zhang, Fangyuan; Chen, Lingxian; Hao, Xiaolong; Pan, Qifang; Fu, Xueqing; Li, Ling; Sun, Xiaofen; Tang, Kexuan

    2016-09-01

    The NAC (NAM, ATAF and CUC) superfamily is one of the largest plant-specific transcription factor families. NAC transcription factors always play important roles in response to various abiotic stresses. A NAC transcription factor gene AaNAC1 containing a complete open reading frame (ORF) of 864 bp was cloned from Artemisia annua. The expression of AaNAC1 could be induced by dehydration, cold, salicylic acid (SA) and methyl jasmonate (MJ), suggesting that it might be a key regulator of stress signaling pathways in A. annua. AaNAC1 was shown to be localized to the nuclei by transforming tobacco leaf epidermal cells. When AaNAC1 was overexpressed in A. annua, the content of artemisinin and dihydroartemisinic acid was increased by 79% and 150%, respectively. The expression levels of artemisinin biosynthetic pathway genes, i.e. amorpha-4,11-diene synthase (ADS), artemisinic aldehyde Δ11(13) reductase (DBR2) and aldehyde dehydrogenase 1 (ALDH1), were increased. Dual luciferase (dual-LUC) assays showed that AaNAC1 could activate the transcription of ADS in vivo. The transgenic A. annua exhibited increased tolerance to drought and resistance to Botrytis cinerea. When AaNAC1 was overexpressed in Arabidopsis, the transgenic Arabidopsis were markedly more tolerant to drought. The transgenic Arabidopsis showed increased resistance to B. cinerea. These results indicate that AaNAC1 can potentially be used in transgenic breeding for improving the content of artemisinin and drought tolerance in A. annua. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  16. FADS genotypes and desaturase activity estimated by the ratio of arachidonic acid to linoleic acid are associated with inflammation and coronary artery disease.

    Science.gov (United States)

    Martinelli, Nicola; Girelli, Domenico; Malerba, Giovanni; Guarini, Patrizia; Illig, Thomas; Trabetti, Elisabetta; Sandri, Marco; Friso, Simonetta; Pizzolo, Francesca; Schaeffer, Linda; Heinrich, Joachim; Pignatti, Pier Franco; Corrocher, Roberto; Olivieri, Oliviero

    2008-10-01

    The delta-5 and delta-6 desaturases, encoded by FADS1 and FADS2 genes, are key enzymes in polyunsaturated fatty acid (PUFA) metabolism that catalyze the conversion of linoleic acid (LA) into arachidonic acid (AA) and that of alpha-linolenic acid (ALA) into eicosapentaenoic acid (EPA). Single-nucleotide polymorphisms (SNPs) in FADS1 and FADS2 have been associated with different concentrations of AA and LA, and those associations have possible functional consequences for desaturase activity. We aimed to evaluate the possible association among FADS genotypes, desaturase activity, inflammation, and coronary artery disease (CAD). Thirteen FADS SNPs and the ratio of AA to LA (AA/LA) on red blood cell (RBC) membranes, a marker of desaturase activity, were evaluated in 876 subjects with (n = 610) or without (n = 266) angiographically documented CAD. Both AA/LA and the ratio of EPA to ALA (EPA/ALA) were higher in patients with CAD than in those without CAD, but, in a multiple logistic regression model, only a higher AA/LA resulted an independent risk factor for CAD (odds ratio: 2.55; 95% CI: 1.61, 4.05 for higher compared with lower ratio tertile; P for trend FADS haplotypes, including the alleles associated with a higher ratio. In populations following a Western diet, subjects carrying FADS haplotypes that are associated with higher desaturase activity may be prone to a proinflammatory response favoring atherosclerotic vascular damage.

  17. Amino Acids Attenuate Insulin Action on Gluconeogenesis and Promote Fatty Acid Biosynthesis via mTORC1 Signaling Pathway in trout Hepatocytes

    Directory of Open Access Journals (Sweden)

    Weiwei Dai

    2015-06-01

    Full Text Available Background/Aims: Carnivores exhibit poor utilization of dietary carbohydrates and glucose intolerant phenotypes, yet it remains unclear what are the causal factors and underlying mechanisms. We aimed to evaluate excessive amino acids (AAs-induced effects on insulin signaling, fatty acid biosynthesis and glucose metabolism in rainbow trout and determine the potential involvement of mTORC1 and p38 MAPK pathway. Methods: We stimulated trout primary hepatocytes with different AA levels and employed acute administration of rapamycin to inhibit mTORC1 activation. Results: Increased AA levels enhanced the phosphorylation of ribosomal protein S6 kinase (S6K1, S6, and insulin receptor substrate 1 (IRS-1 on Ser302 but suppressed Akt and p38 phosphorylation; up-regulated the expression of genes related to gluconeogenesis and fatty acid biosynthesis. mTORC1 inhibition not only inhibited the phosphorylation of mTORC1 downstream targets, but also blunted IRS-1 Ser302 phosphorylation and restored excessive AAs-suppressed Akt phosphorylation. Rapamycin also inhibited fatty acid biosynthetic and gluconeogenic gene expression. Conclusion: High levels of AAs up-regulate hepatic fatty acid biosynthetic gene expression through an mTORC1-dependent manner, while attenuate insulin-mediated repression of gluconeogenesis through elevating IRS-1 Ser302 phosphorylation, which in turn impairs Akt activation and thereby weakening insulin action. We propose that p38 MAPK probably also involves in these AAs-induced metabolic changes.

  18. Superiorly Plasticized PVC/PBSA Blends through Crotonic and Acrylic Acid Functionalization of PVC

    Directory of Open Access Journals (Sweden)

    Arturo Salazar Avalos

    2017-03-01

    Full Text Available Superior plasticization efficiency was achieved by a grafting from functionalization of the PVC backbone. This was deduced to a synergistic effect of internal plasticization and improved intermolecular interactions between PVC and an oligomeric poly(butylene succinate-co-adipate (PBSA plasticizer. A mild grafting process for functionalization of the PVC chain by crotonic acid (CA or acrylic acid (AA was used. The formation of PVC-g-CA and PVC-g-AA was confirmed by FTIR and 1H NMR. Grafting with the seemingly similar monomers, CA and AA, resulted in different macromolecular structures. AA is easily homopolymerized and long hydrophilic poly(acrylic acid grafts are formed resulting in branched materials. Crotonic acid does not easily homopolymerize; instead, single crotonic acid units are located along the PVC chain, leading to basically linear PVC chains with pendant crotonic acid groups. The elongation of PVC-g-CA and PVC-g-AA in comparison to pure PVC were greatly increased from 6% to 128% and 167%, respectively, by the grafting reactions. Blending 20% (w/w PBSA with PVC, PVC-AA or PVC-CA further increased the elongation at break to 150%, 240% and 320%, respectively, clearly showing a significant synergistic effect in the blends with functionalized PVC. This is a clearly promising milestone towards environmentally friendly flexible PVC materials.

  19. Uptake and conversion of D-amino acids in Arabidopsis thaliana.

    Science.gov (United States)

    Gördes, Dirk; Kolukisaoglu, Üner; Thurow, Kerstin

    2011-02-01

    The D-enantiomers of proteinogenic amino acids fulfill essential functions in bacteria, fungi and animals. Just in the plant kingdom, the metabolism and role of D-amino acids (D-AAs) still remains unclear, although plants have to cope with significant amounts of these compounds from microbial decay in the rhizosphere. To fill this gap of knowledge, we tested the inhibitory effects of D-AAs on plant growth and established a method to quantitate 16 out of 19 proteinogenic amino acids and their D-enantiomers in plant tissue extracts. Therefore, the amino acids in the extracts were derivatized with Marfey's reagent and separated by HPLC-MS. We used two ecotypes (Col-0 and C24) and a mutant (lht1) of the model plant Arabidopsis thaliana to determine the influence and fate of exogenously applied D-AAs. All of them were found in high concentrations in the plant extracts after application, even in lht1, which points to additional transporters facilitating the import of D-AAs. The addition of particular amino acids (D-Trp, D-Phe, D-Met and D-His) led to the accumulation of the corresponding L-amino acid. In almost all cases, the application of a D-AA resulted in the accumulation of D-Ala and D-Glu. The presented results indicate that soil borne D-AAs can actively be taken up and metabolized via central metabolic routes.

  20. Stability of chitosan nanoparticles for L-ascorbic acid during heat treatment in aqueous solution.

    Science.gov (United States)

    Jang, Keum-Il; Lee, Hyeon Gyu

    2008-03-26

    This study investigated the stability and characteristics of L-ascorbic acid (AA)-loaded chitosan (CS) nanoparticles during heat processing in aqueous solutions. AA-loaded CS nanoparticles were prepared by ionic gelation of CS with tripolyphosphate (TPP) anions. The smallest CS nanoparticles (170 nm) were obtained with a CS concentration of 1.5 mg/mL and a TPP concentration of 0.6 mg/mL. As the concentration of AA increased from 0.1 to 0.3 mg/mL, the particle size increased, while the zeta potential decreased, and the encapsulation efficiency of AA remained within a fixed range (10-12%). During heat processing at various temperatures, the size and zeta potential of the particles decreased rapidly in the first 5 min and then slowly fell to the regular range. At the beginning of the release profiles, the burst release-related stability of the surface increased with the temperature. Then, the release of the internal AA was constantly higher with a longer release time. Consequently, it was confirmed that the stability of AA-loaded CS nanoparticles was affected by temperature but that the internal stability was greater than the surface stability. These results demonstrate the stability of CS nanoparticles for AA during heat processing and suggest the possible use of AA-loaded CS nanoparticles to enhance antioxidant effects because of the continuous release of AA from CS nanoparticles in food processing.

  1. Recent Advances in Understanding Amino Acid Sensing Mechanisms that Regulate mTORC1

    Directory of Open Access Journals (Sweden)

    Liufeng Zheng

    2016-09-01

    Full Text Available The mammalian target of rapamycin (mTOR is the central regulator of mammalian cell growth, and is essential for the formation of two structurally and functionally distinct complexes: mTORC1 and mTORC2. mTORC1 can sense multiple cues such as nutrients, energy status, growth factors and hormones to control cell growth and proliferation, angiogenesis, autophagy, and metabolism. As one of the key environmental stimuli, amino acids (AAs, especially leucine, glutamine and arginine, play a crucial role in mTORC1 activation, but where and how AAs are sensed and signal to mTORC1 are not fully understood. Classically, AAs activate mTORC1 by Rag GTPases which recruit mTORC1 to lysosomes, where AA signaling initiates. Plasma membrane transceptor L amino acid transporter 1 (LAT1-4F2hc has dual transporter-receptor function that can sense extracellular AA availability upstream of mTORC1. The lysosomal AA sensors (PAT1 and SLC38A9 and cytoplasmic AA sensors (LRS, Sestrin2 and CASTOR1 also participate in regulating mTORC1 activation. Importantly, AAs can be sensed by plasma membrane receptors, like G protein-coupled receptor (GPCR T1R1/T1R3, and regulate mTORC1 without being transported into the cells. Furthermore, AA-dependent mTORC1 activation also initiates within Golgi, which is regulated by Golgi-localized AA transporter PAT4. This review provides an overview of the research progress of the AA sensing mechanisms that regulate mTORC1 activity.

  2. Media optimization of Parietochloris incisa for arachidonic acid accumulation in an outdoor vertical tubular photobioreactor.

    Science.gov (United States)

    Tababa, Hazel Guevarra; Hirabayashi, Seishiro; Inubushi, Kazuyuki

    2012-08-01

    The green alga Parietochloris incisa contains a significant amount of the nutritionally valuable polyunsaturated fatty acid and arachidonic acid (AA) and is being considered for mass cultivation for commercial AA production. This study was primarily aimed to define a practical medium formulation that can be used in commercial mass cultivation that will contribute to a substantial increase in the AA productivity of P. incisa with concomitant reduction of nutritional cost. The effect of nutrient limitation on growth and AA content of this microalga was explored in a batch culture in outdoor conditions using a vertical tubular photobioreactor. The study was conducted in two parts: the first was primarily focused on the effect of different nitrogen concentration on growth and AA content and the second part compares nitrogen deprivation, combination of nitrogen and phosphorus deprivation, and combined overall nutrient limitations at different levels of deprivation under low and high population densities. Since complete nitrogen deprivation hampers lipid and AA accumulation of P. incisa, thus, a critical value of nitrogen supply that will activate AA accumulation must be elucidated under specific growth conditions. Under the present experimental conditions, 0.5 g(-1) sodium nitrate obtained a higher AA productivity and volumetric yield relative to the nitrogen-deprived culture corresponding to 36.32 mg L(-1) day(-1) and 523.19 mg L(-1). The combined nitrogen and phosphorus limitation seemed to enhance AA productivity better than nitrogen deprivation alone. The effect of overall nutrient limitation indicates that acute nutrient deficiency can trigger rapid lipid and AA syntheses. The effect of light as a consequence of culture cell density was also discussed. This study therefore shows that the nutrient cost can be greatly reduced by adjusting the nutrient levels and culture density to induce AA accumulation in P. incisa.

  3. Acanthoic acid protectsagainst ethanol-induced liver injury: Possible role of AMPK activation and IRAK4 inhibition.

    Science.gov (United States)

    Yao, You-Li; Han, Xin; Song, Jian; Zhang, Jing; Li, Ya-Mei; Lian, Li-Hua; Wu, Yan-Ling; Nan, Ji-Xing

    2017-11-05

    The aim of this study was to investigate the effects of acanthoic acid (AA) on the regulation of inflammatory response, lipid accumulation, and fibrosis via AMPK- IRAK4 signaling against chronic alcohol consumption in mice. Ethanol-induced liver injury was induced in male mice by Lieber-DeCarli diet for 28d. And mice in AA groups were gavaged with AA (20 or 40mg/kg) for 28d. AA treatment significantly decreased serum AST and TG, hepatic TG levels, serum ethanol and LPS levels compared with chronic ethanol administration. AA ameliorated histological changes, lipid droplets, hepatic fibrosis, and inflammation induced by ethanol. AA significantly increased the expressions of p-LKB1, p-AMPK, and SIRT1 caused by chronic ethanol administration, and attenuated the increasing protein expressions of IRAK1 and IRAK4.siRNA against AMPKα1 blocked AMPKα1 and increased IRAK4 protein expressions, compared with control-siRNA-transfected group, while AA treatment significantly decreased IRAK4 expressions compared with AMPKα1-siRNA-transfected group. AMPK-siRNA also blocked the decreased effect of AA on inflammatory factors. AA decreased over-expression of IRAK4 and inflammation under ethanol plus LPS challenge. AA recruited LKB1-AMPK phosphorylation and activated SIRT1 to regulate alcoholic liver injury, especially, inhibited IRAK1/4 signaling pathway to regulate lipid metabolism, hepatic fibrosis and inflammation caused by alcohol consumption. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Extract of a spice--omum (Trachyspermum ammi)-shows antiaggregatory effects and alters arachidonic acid metabolism in human platelets.

    Science.gov (United States)

    Srivastava, K C

    1988-07-01

    An ethereal extract of omum (Trachyspermum ammi; Hindustani: ajwan)--a frequently consumed spice--was found to inhibit platelet aggregation induced by arachidonic acid (AA), epinephrine and collagen; in this respect it was most effective against AA-induced aggregation. Inhibition of aggregation by omum could be explained by its effect on platelet thromboxane production as suggested by the following experimental observation. (i) Omum reduced TxB2 formation in intact platelet preparations from added arachidonate, and (ii) it reduced the formation of TxB2 from AA-labelled platelets after stimulation with Ca2+-ionophore A23187 by a direct action on cyclooxygenase as it did not affect the release of AA from labelled platelets. An increased formation of lipoxygenase-derived products from exogenous AA in omum-treated platelets was apparently due to redirection of AA from cyclooxygenase to the lipoxygenase pathway.

  5. L-ascorbic acid losses in Kenyan vegetables during cooking as determined by high performance liquid chromatography

    Directory of Open Access Journals (Sweden)

    N.M.N. Wekesa

    2001-06-01

    Full Text Available The loss of L-ascorbic acid (L-AA in 14 different cooked local vegetables found in Nairobi markets was determined by high performance liquid chromatography. The effect of quantity of water on the loss of L-AA during cooking was studied with cowpea leaves. It was found that more L-AA was lost when larger amount of water was used than when smaller amount was used. The effect of the sharpness of the knife on the loss of L-AA was studied with spinach. It was found that more loss of L-AA occurred when a blunt (edge thickness 0.08 cm knife was used for cutting the vegetables than when a sharp knife (edge thickness 0.04 cm was used during cooking. L-AA was also determined when vegetables were cooked in different size pieces (surface are >1 cm2

  6. Elimination of ascorbic acid after high-dose infusion in prostate cancer patients

    DEFF Research Database (Denmark)

    Nielsen, Torben Kjær; Højgaard, Martin; Andersen, Jon Thor Trærup

    2015-01-01

    Treatment with high-dose intravenous (IV) ascorbic acid (AA) is used in complementary and alternative medicine for various conditions including cancer. Cytotoxicity to cancer cell lines has been observed with millimolar concentrations of AA. Little is known about the pharmacokinetics of high dose...... infusion stop in prostate cancer patients with normal kidney function. We propose a regimen with a bolus loading followed by a maintenance infusion based on the calculated clearance.......Treatment with high-dose intravenous (IV) ascorbic acid (AA) is used in complementary and alternative medicine for various conditions including cancer. Cytotoxicity to cancer cell lines has been observed with millimolar concentrations of AA. Little is known about the pharmacokinetics of high dose...... IV AA. The purpose of the present study was to assess the basic kinetic variables in human beings over a relevant AA dosing interval for proper design of future clinical trials. Ten patients with metastatic prostate cancer were treated for four weeks with fixed AA doses of 5, 30 and 60 g. AA...

  7. Ascorbic acid promotes a TGFβ1-induced myofibroblast phenotype switch.

    Science.gov (United States)

    Piersma, Bram; Wouters, Olaf Y; de Rond, Saskia; Boersema, Miriam; Gjaltema, Rutger A F; Bank, Ruud A

    2017-09-01

    l-Ascorbic acid (AA), generally known as vitamin C, is a crucial cofactor for a variety of enzymes, including prolyl-3-hydroxylase (P3H), prolyl-4-hydroxylase (P4H), and lysyl hydroxylase (LH)-mediated collagen maturation. Here, we investigated whether AA has additional functions in the regulation of the myofibroblast phenotype, besides its function in collagen biosynthesis. We found that AA positively influences TGF β 1-induced expression of COL1A1 , ACTA2 , and COL4A1 Moreover, we demonstrated that AA promotes α SMA stress fiber formation as well as the synthesis and deposition of collagens type I and IV Additionally, AA amplified the contractile phenotype of the myofibroblasts, as seen by increased contraction of a 3D collagen lattice. Moreover, AA increased the expression of several TGF β 1-induced genes, including DDR1 and CCN2 Finally, we demonstrated that the mechanism of AA action seems independent of Smad2/3 signaling. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  8. [AA amyloidosis: a little-known complication of chronic leg ulcer].

    Science.gov (United States)

    Waton, J; Fays-Michel, S; Chandeclerc, M L; Corby, S; Cuny, J F; Barbaud, A; Schmutz, J-L

    2008-02-01

    AA amyloidosis, secondary to inflammatory chronic diseases like rheumatoid arthritis, is often complicated by renal failure. Chronic inflammatory dermatoses constitute rare causes of AA amyloidosis. We describe two cases of AA amyloidosis discovered after renal failure in patients presenting leg ulcers for several years. AL amyloidosis was suspected in both cases because of a history of monoclonal gammopathy in one patient and of plasmocytoma in the other. The diagnosis of AA amyloidosis was confirmed on renal histology through the detection of AA antibodies in amyloid deposits. No extrarenal amyloidosis was seen in either patient and there were no inflammatory diseases other than chronic leg ulcers. AA amyloidosis is caused by serum amyloid protein A (SAA), a reactive inflammatory protein. AA amyloidosis is thus caused by chronic inflammatory diseases, but only rarely by cutaneous inflammatory diseases. To our knowledge, the literature contains only seven other published cases of AA amyloidosis secondary to chronic leg ulcers. A review of the literature does not indicate whether cure of ulcers has any effect on the accompanying renal failure. We imagine that AA amyloidosis secondary to leg ulcer is in fact under-diagnosed. However, since the first specific treatment for AA amyloidosis is currently being evaluated by the Food and Drug Administration, it is essential that this serious complication of chronic leg ulcers be widely recognised.

  9. Role and mechanism of AT1-AA in the pathogenesis of HELLP syndrome.

    Science.gov (United States)

    Bu, Shurui; Wang, Yuxian; Sun, Shuqing; Zheng, Yanqian; Jin, Zhu; Zhi, Jianming

    2018-01-10

    HELLP syndrome remains a leading cause of maternal and neonatal mortality and morbidity worldwide, which symptoms include hemolysis, elevated liver enzymes and low platelet count. The objective of this study was to determine whether HELLP is associated with AT1-AA. The positive rate and titer of AT1-AA in plasma from pregnant women were determined, and the correlation of AT1-AA titer with the grade of HELLP was analyzed. A HELLP rat model established by intravenous injection of AT1-AA. Our experimental results show the AT1-AA titer and positive rate were significantly higher in HELLP group, and AT1-AA titer were positively correlated with the level of TNF-α and ET-1 in plasma and the grade of HELLP syndrome. The results of animal experiments showed that the typical features of HELLP in the pregnant rats after AT1-AA injection. The levels of TNF-α and ET-1 in plasma and liver tissue were significantly increased in AT1-AA-treated rats compared with control rats. The HELLP syndrome induced by AT1-AA was attenuated markedly after administration of losartan. These data support the hypothesis that one the potential pathway that AT1-AA induce damage to capillary endothelial cells and liver during pregnancy is through activation of TNF-α and ET-1.

  10. Adverse effects of doping with anabolic androgenic steroids (AAS) in competitive athletics, recreational sports and bodybuilding.

    Science.gov (United States)

    Vorona, Elena; Nieschlag, Eberhard

    2018-02-19

    Despite the fact that sports organizations and legislators have introduced various mechanisms to discourage athletes from using performance and appearance enhancing substances a high percentage of athletes admits to their unabated application. In competitive athletics, bodybuilding and in recreational sports anabolic androgenic steroids (AAS) continue to be the substances most abused. This review summarizes the side effects of AAS abuse on organs and system functions in both sexes. High doses of AAS cause a significant increase of erythrocytes und haemoglobin concentration, which may lead to thromboembolism, intracardiac thrombosis and stroke. Long-term AAS abusers have a higher incidence of arrhythmias, atherosclerosis, concentric left-ventricular myocardial hypertrophy with impaired diastolic function and also sudden cardiac death. Changes of liver function and structure, up to hepatocellular carcinoma, have been described, mainly in cases of chronic misuse of 17α-alkylated AAS. Sleeplessness, increased irritability, depressive mood status are often observed in AAS abuse. In former AAS abusers depression, anxiety and melancholy may persist for many years. Due to negative feedback in the regulation of the hypothalamic-pituitary-gonadal axis AAS can cause reversible suppression of spermatogenesis up to azoospermia. In women the changes most often caused by AAS abuse are hirsutism, irreversible deepening of voice, dysmenorrhoea, secondary amenorrhoea with anovulation and infertility. AAS abuse notwithstanding, under clinical conditions testosterone remains the most important hormone for substitution therapy of male hypogonadism.

  11. Simultaneous determination of ascorbic acid, dopamine and uric acid based on tryptophan functionalized graphene

    Energy Technology Data Exchange (ETDEWEB)

    Lian, Qianwen; He, Zhifang; He, Qian; Luo, Ai; Yan, Kaiwang; Zhang, Dongxia [Key Laboratory of Bioelectrochemistry and Environmental Analysis of Gansu Province, College of Geography and Environment Science, Northwest Normal University, Lanzhou, 730070 (China); Lu, Xiaoquan, E-mail: Luxq@nwnu.edu.cn [Key Laboratory of Bioelectrochemistry and Environmental Analysis of Gansu Province, College of Chemistry and Chemical Engineering, Northwest Normal University, Lanzhou, 730070 (China); Zhou, Xibin, E-mail: zhouxb@nwnu.edu.cn [Key Laboratory of Bioelectrochemistry and Environmental Analysis of Gansu Province, College of Geography and Environment Science, Northwest Normal University, Lanzhou, 730070 (China)

    2014-05-01

    Highlights: • Trp-GR was synthesized by utilizing a facile ultrasonic method. • The material as prepared had well dispersivity in water and better conductivity than pure GR. • Trp-GR/GCE showed excellent potential for the determination of AA, DA and UA. • The proposed method was applied for the analysis of AA, DA and UA in real samples. - Abstract: A new type of tryptophan-functionalized graphene nanocomposite (Trp-GR) was synthesized by utilizing a facile ultrasonic method via π–π conjugate action between graphene (GR) and tryptophan (Trp) molecule. The material as prepared had well dispersivity in water and better conductivity than pure GR. The surface morphology of Trp-GR was characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM) and Raman spectroscopy. The electrochemical behaviors of ascorbic acid (AA), dopamine (DA), and uric acid (UA) were investigated by cyclic voltammetry (CV) on the surface of Trp-GR. The separation of the oxidation peak potentials for AA–DA, DA–UA and UA–AA was about 182 mV, 125 mV and 307 mV, which allowed simultaneously determining AA, DA, and UA. Differential pulse voltammetery (DPV) was used for the determination of AA, DA, and UA in their mixture. Under optimum conditions, the linear response ranges for the determination of AA, DA, and UA were 0.2–12.9 mM, 0.5–110 μM, and 10–1000 μM, with the detection limits (S/N = 3) of 10.09 μM, 0.29 μM and 1.24 μM, respectively. Furthermore, the modified electrode was investigated for real sample analysis.

  12. Combining eicosapentaenoic acid, decosahexaenoic acid and arachidonic acid, using a fully crossed design, affect gene expression and eicosanoid secretion in salmon head kidney cells in vitro.

    Science.gov (United States)

    Holen, Elisabeth; He, Juyun; Espe, Marit; Chen, Liqiou; Araujo, Pedro

    2015-08-01

    Future feed for farmed fish are based on untraditional feed ingredients, which will change nutrient profiles compared to traditional feed based on marine ingredients. To understand the impact of oils from different sources on fish health, n-6 and n-3 polyunsaturated fatty acids (PUFAs) were added to salmon head kidney cells, in a fully crossed design, to monitor their individual and combined effects on gene expression. Exposing salmon head kidney cells to single fatty acids, arachidonic acid (AA) or decosahexaenoic acid (DHA), resulted in down-regulation of cell signaling pathway genes and specific fatty acid metabolism genes as well as reduced prostaglandin E2 (PGE2) secretion. Eicosapentaenoic acid (EPA) had no impact on gene transcription in this study, but reduced the cell secretion of PGE2. The combined effect of AA + EPA resulted in up-regulation of eicosanoid pathway genes and the pro-inflammatory cytokine, tumor necrosis factor alpha (TNF-α), Bclx (an inducer of apoptosis) and fatty acid translocase (CD36) as well as increased cell secretion of PGE2 into the media. Adding single fatty acids to salmon head kidney cells decreased inflammation markers in this model. The combination AA + EPA acted differently than the rest of the fatty acid combinations by increasing the inflammation markers in these cells. The concentration of fatty acid used in this experiment did not induce any lipid peroxidation responses. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Potentiation of TRPV3 Channel Function by Unsaturated Fatty Acids

    Science.gov (United States)

    HU, HONG-ZHEN; XIAO, RUI; WANG, CHUNBO; GAO, NA; COLTON, CRAIG K.; WOOD, JACKIE D.; ZHU, MICHAEL X.

    2015-01-01

    Transient receptor potential vanilloid (TRPV) channels are polymodal detectors of multiple environmental factors, including temperature, pH, and pressure. Inflammatory mediators enhance TRPV function through multiple signaling pathways. The lipoxygenase and epoxygenase products of arachidonic acid (AA) metabolism have been shown to directly activate TRPV1 and TRPV4, respectively. TRPV3 is a thermosensitive channel with an intermediate temperature threshold of 31–39°C. We have previously shown that TRPV3 is activated by 2-aminoethoxydiphenyl borate (2APB). Here we show that AA and other unsaturated fatty acids directly potentiate 2APB-induced responses of TRPV3 expressed in HEK293 cells, Xenopus oocytes, and mouse keratinocytes. The AA-induced potentiation is observed in intracellular Ca2+ measurement, whole-cell and two-electrode voltage clamp studies, as well as single channel recordings of excised inside-out and outside-out patches. The fatty acid-induced potentiation is not blocked by inhibitors of protein kinase C and thus differs from that induced by the kinase. The potentiation does not require AA metabolism but is rather mimicked by non-metabolizable analogs of AA. These results suggest a novel mechanism regulating the TRPV3 response to inflammation, which differs from TRPV1 and TRPV4, and involves a direct action of free fatty acids on the channel. PMID:16557504

  14. Introducing the AAS Working Group on Astroinformatics and Astrostatistics

    Science.gov (United States)

    Ivezic, Zeljko

    2014-01-01

    In response to two White Papers submitted to the Astro2010 Decadal Survey (1,2), a new AAS Working Group on Astroinformatics and Astrostatistics (WGAA) has been approved by the AAS Council at the 220th Meeting, June 2012, in Anchorage. The motivation for this WG is the growing importance of the interface between astronomy and various branches of applied mathematics, computer science and the emerging field of data science. With the new data-intensive projects envisioned for the coming decade, the need for advice derived from the focused attention of a group of AAS members who work in these areas is bound to increase. The Working Group is charged with spreading awareness of rapidly advancing computational techniques, sophsticated statistical methods, and highly capble software to further the goals of astronomical and astrophysical research. The three main strategic goals adopted by the WGAA Steering Committee for the next few years are to: (i) develop, organize and maintain methodological resources (such as software tools, papers, books, and lectures); (ii) enhance human resources (such as foster the creation of career paths, establish a Speakers' Bureau, establish and maintain an archived discussion forum, enable periodic news distribution); and (iii) organize topical meetings. The WGAA Steering Committee at this time includes twelve members: Kirk Borne, George Djorgovski, Eric Feigelson, Eric Ford, Alyssa Goodman, Joe Hilbe, Zeljko Ivezic (chair), Ashish Mahabal, Aneta Siemiginowska, Alex Szalay, Rick White, and Padma Yanamandra-Fisher. I will summarize our accomplishments since July 2012. (1) Astroinformatics: A 21st Century Approach to Astronomy (Borne & 90 coauthors), (2) The Astronomical Information Sciences: A Keystone for 21st-Century Astronomy (Loredo & 72 coauthors)

  15. Effect of precipitates on mechanical properties of AA2195

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jae-Hee [Launcher Structure and Materials Team, Korea Aerospace Research Institute, Daejeon (Korea, Republic of); Jeun, Jeong-Hoon [Department of Materials Science and Engineering, Seoul National University, Seoul (Korea, Republic of); Chun, Hyun-Jin [Southeast University, Nanjing (China); Lee, Ye Rim [Department of Aerospace System Engineering, University of Science & Technology, Daejeon (Korea, Republic of); Yoo, Joon-Tae [Launcher Structure and Materials Team, Korea Aerospace Research Institute, Daejeon (Korea, Republic of); Yoon, Jong-Hoon [Launcher Structure and Materials Team, Korea Aerospace Research Institute, Daejeon (Korea, Republic of); Department of Aerospace System Engineering, University of Science & Technology, Daejeon (Korea, Republic of); Lee, Ho-Sung, E-mail: hslee@kari.re.kr [Launcher Structure and Materials Team, Korea Aerospace Research Institute, Daejeon (Korea, Republic of); Department of Aerospace System Engineering, University of Science & Technology, Daejeon (Korea, Republic of)

    2016-06-05

    Addition of 1–4 wt.% lithium into a conventional Al–Cu–Mg alloy allows lower density and higher mechanical properties, which are attractive for aerospace applications. In this study, fundamental investigations including phase and microstructure evolution, resulting in strengthening, of the AA2195 are conducted to observe a possibility of production with commercial level. Precipitation sequence and kinetics during post-annealing were evaluated with variations of temperature and holding time. Microstructures revealed formation and evolution in representative precipitates including θ (Al{sub 2}Cu), ß′ (Al{sub 3}Zr), and T (Al{sub x}Li{sub y}Cu) series. Aluminum alloys have low hardness, modulus, and strength before aging, but precipitates such as θ′ (Al{sub 2}Cu), ß′ (Al{sub 3}Zr), and T{sub 1} (Al{sub 2}LiCu) show enhanced mechanical properties of AA2195 tempered because of their interaction with dislocation. However, longer holding time and higher annealing temperature result in significant decreases in mechanical properties due to the presence of incoherent precipitates (θ phase) and coarsening of the precipitates via grain-boundary diffusion. In the current study, the tensile strength of 560 MPa was obtained with post-heat treatment without work hardening. This value has never been achieved in other studies. The maximum strength was reported as 500 MPa without a work hardening process. - Highlights: • A relationship between microstructure and mechanical properties to post annealing AA2195. • A formation and dissolution of the precipitates were observed for various treatment. • An optimum post-annealing condition was obtained.

  16. Neonatal fatty acid status and cardiometabolic health at 9years.

    Science.gov (United States)

    Seggers, Jorien; Kikkert, Hedwig K; de Jong, Corina; Decsi, Tamas; Boehm, Gunther; Hadders-Algra, Mijna

    2016-09-01

    Long chain polyunsaturated fatty acid (LCPUFA) status is associated with risk of cardiovascular diseases in adulthood. We previously demonstrated no effect of LCPUFA supplementation after birth on BP and anthropometrics. Little is known about the association between fatty acid status at birth and cardiometabolic health at older ages. To evaluate associations between docosahexaenoic acid (DHA) and arachidonic acid (AA) levels in the umbilical cord and blood pressure (BP) and anthropometrics at 9years. Observational follow-up study. Multivariable analyses were carried out to adjust for potential confounders. 229 children who took part in a randomized controlled trial (RCT) on the effects of LCPUFA formula supplementation. BP was chosen as primary outcome; heart rate and anthropometrics as secondary outcomes. AA levels in the wall of the umbilical vein and artery were negatively associated with diastolic BP (B: vein -0.831, 95% CI: -1.578; -0.083, p=0.030; artery: -0.605, 95% CI: -1.200; -0.010, p=0.046). AA was not associated with systolic BP; DHA not with diastolic nor systolic BP. The AA:DHA ratio in the umbilical vein was negatively associated with diastolic BP (B: -1.738, 95% CI: -3.141; -0.335, p=0.015). Heart rate and anthropometrics were not associated with neonatal LCPUFA status. Higher AA levels and a higher AA:DHA ratio at birth are associated with lower diastolic BP at age 9. This suggests that the effect of LCPUFAs at early age is different from that in adults, where DHA is regarded anti-adipogenic and AA as adipogenic. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. Raloxifene and hormone replacement therapy increase arachidonic acid and docosahexaenoic levels in postmenopausal women

    NARCIS (Netherlands)

    Giltay, E.J.; Duschek, E.J.J.; Katan, M.B.; Neele, S.J.; Netelenbos, J.C.; Zock, P.L.

    2004-01-01

    Estrogens may affect the essential n-6 and n-3 fatty acids arachidonic acid (AA; C20:4n-6) and docosahexaenoic acid (DHA; C22:6n-3). Therefore, we investigated the long-term effects of hormone replacement therapy and raloxifene, a selective estrogen-receptor modulator, in two randomized,

  18. Whole body and egg amino acid composition of Nile perch, Lates ...

    African Journals Online (AJOL)

    Windows User

    0.05) between the amino acids (AA) composition in the eggs and tissue and amongst the four class sizes of juveniles was observed. Estimates of the amino acid dietary requirements revealed that Nile perch has high arginine, leucine, threonine, valine and isoleucine dietary requirements. Key words: Nile perch, amino acids ...

  19. Role of cellular antioxidants (glutathione and ascorbic acid) in the growth and development of wild carrot suspension cultures

    International Nuclear Information System (INIS)

    Earnshaw, B.A.

    1986-01-01

    Determinations of endogenous glutathione (GSH), glutathione disulfide (GSSG), ascorbic acid (AA) and dehydroascorbic acid (DHA) in proliferating and developing wild carrot cultures showed that lower levels of GSH and AA were associated with developing cultures. The GSSG and DHA levels did not account for the changes in the levels of antioxidants between proliferating and developing cultures. Studies were designed to test an observed auxin (2,4-Dichlorophenoxyacetic acid, 2,4-D)-antioxidant association. Two fractions (embryo and less developed) were obtained by screening developed cultures which were previously grown in the presence of 14 C-2, 4-D. The embryo fraction had a lower concentration of 14 C than the less developed fraction, supporting the association, since the two fractions showed this relationship with respect to GSH and AA concentrations. Determinations of GSH and AA levels of cells grown in various concentrations of 2,4-D showed the association, decreases in the 2,4-D concentration correlated with decreases in the GSH and AA concentrations. The existence of a respiratory pathway involving GSSG reductase, DHA reductase, and AA oxidase was investigated to test whether inhibition of AA oxidase by 2,4-D could explain the auxin-antioxidant association; however, AA oxidase activity was not detected

  20. Recent advanced applications of AAS and ICP-MS in the semiconductor industry

    Energy Technology Data Exchange (ETDEWEB)

    Shabani, Mohammad B.; Shiina, Y.; Kirscht, F.G.; Shimanuki, Y

    2003-09-15

    We report on instrumentation-related challenges of applying graphite furnace atomic absorption spectroscopy (GF-AAS) and inductively coupled plasma mass spectrometry (ICP-MS). We show that a significant amount of polyatomic species derived from silicon sample solution in the plasma, such as SiO, SiOH, SiOH{sub 2}{center_dot}SiOH{sub 3}, SiO{sub 2}, SiO{sub 2}H, SiO{sub 2}H{sub 2} and SiO{sub 2}H{sub 3}, can hamper the detection limits of many elements of interest. This paper describes a method for eliminating these polyatomic ions. We discuss the advantages and disadvantages of vapor phase decomposition method (VPD), drop etching method (DE) and drop sandwich-etching method (DSE) for the recovery of metal impurities from a silicon wafer surface. We report the application of the DSE method for the evaluation of near-surface metal impurities, used for gettering studies. We describe the direct acid bulk decomposition (DABD) and the room temperature acid vapor phase decomposition method (RT-AVPD) for the determination of metal impurities in bulk silicon. Finally, we report concentration of trace metal contamination in several chemical reagent solutions.

  1. Inside Hall 193 for the Antiproton Accumulator (AA) ring

    CERN Multimedia

    1979-01-01

    Installation work is in full swing. A model quadrupole on the left shows where the magnet ring will be. The cables wound on drums are part of the pulse-forming network for the injection kicker. See Annual Report 1979 p. 103, Fig. 9 and photo 7911303. For photos of the AA in different phases of completion (between 1979 and 1982) see: 7911303, 7911597X, 8004261, 8004608X, 8005563X, 8005565X, 8006716X, 8006722X, 8010939X, 8010941X, 8202324, 8202658X, 8203628X .

  2. The effect of atmospheric corona treatment on AA1050 aluminium

    DEFF Research Database (Denmark)

    Jariyaboon, Manthana; Møller, Per; Dunin-Borkowski, Rafal E.

    2010-01-01

    The effect of atmospheric corona discharge on AM 050 aluminium surface was investigated using electrochemical polarization, SEM-EDX, FIB-SEM. and XPS. The corona treatment was performed with varying time (1, 5, and 15 min) in atmospheric air. A 200 nm oxide layer was generated on AA1050 after...... the 15 min air corona treatment. A significant reduction in anodic and cathodic reactivities was observed starting from 1 min exposure, which further decreased with prolonged exposure (15 min) and after delayed testing (after 30 days). The reduction in surface reactivity is due to the formation...

  3. Functionalized-graphene modified graphite electrode for the selective determination of dopamine in presence of uric acid and ascorbic acid.

    Science.gov (United States)

    Mallesha, Malledevaru; Manjunatha, Revanasiddappa; Nethravathi, C; Suresh, Gurukar Shivappa; Rajamathi, Michael; Melo, Jose Savio; Venkatesha, Thimmappa Venkatarangaiah

    2011-06-01

    Graphene is chemically synthesized by solvothermal reduction of colloidal dispersions of graphite oxide. Graphite electrode is modified with functionalized-graphene for electrochemical applications. Electrochemical characterization of functionalized-graphene modified graphite electrode (FGGE) is carried out by cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The behavior of FGGE towards ascorbic acid (AA), dopamine (DA) and uric acid (UA) has been investigated by CV, differential pulse voltammetry (DPV) and chronoamperommetry (CA). The FGGE showed excellent catalytic activity towards electrochemical oxidation of AA, DA and UA compared to that of the bare graphite electrode. The electrochemical oxidation signals of AA, DA and UA are well separated into three distinct peaks with peak potential separation of 193mv, 172mv and 264mV between AA-DA, DA-UA and AA-UA respectively in CV studies and the corresponding peak potential separations in DPV mode are 204mv, 141mv and 345mv. The FGGE is successfully used for the simultaneous detection of AA, DA and UA in their ternary mixture and DA in serum and pharmaceutical samples. The excellent electrocatalytic behavior of FGGE may lead to new applications in electrochemical analysis. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Inorganic arsenic –spe hg–aas method for rice tested in-house and collaboratively

    DEFF Research Database (Denmark)

    Rasmussen, Rie Romme; Qian, Yiting; Sloth, Jens Jørgen

    2013-01-01

    As) and the methylated species monomethylarsonic acid (MA) and dimethylarsinic acid (DMA). Dietary intake of iAs is of special concern due to its carcinogenicity to humans, whereas DMA and MA are considered of less toxicological importance. Rice grains and rice-based products are staple foods in many countries...... and is one of the major contributors to the iAs exposure in many countries. The work presented here describes the development, validation and application of a simple and inexpensive method for inorganic arsenic (iAs) determination in rice samples. The separation of iAs from organoarsenic compounds (MA...... reference samples. The limit of detection was 0.02 mg/kg, and repeatability and intra-laboratory reproducibility were less than 6 and 9 %, respectively. The SPE HG-AAS method produced similar results compared to parallel high-performance liquid chromatography coupled to inductively coupled plasma mass...

  5. Microstructural characterization of fly ash particulate reinforced AA6063 aluminium alloy for aerospace applications

    Science.gov (United States)

    Razzaq, A. M.; Majid, D. L. Abang Abdul; Ishak, M. R.; Uday, M. B.

    2017-12-01

    Aluminium-fly ash (FA) particulate reinforced composites (AA6063-FA) have been used in automotive and aerospace industries because of their low density and good mechanical properties. Three different weight fraction of FA: 2%, 4% and 6% are added to AA6063 alloy using compocasting method. The effect of FA particulates on microstructure, density and compression strength of AA6063- FA composites are investigated. Field Emission Scanning Electron Microscope (FESEM) micrographs reveal that the FA particulates are uniformly distributed in AA6063 alloy. The results also show that density, compression strength and microstructure of the AA6063-FA composites are significantly influenced by the FA amount. The increase in the weight fraction of FA will improve the microstructure and enhance the compression strength. The density of AA6063-FA composites decreases as the incorporation of FA increases.

  6. Bacillus thuringiensis Cry1Aa toxin-binding region of Bombyx mori aminopeptidase N.

    Science.gov (United States)

    Yaoi, K; Nakanishi, K; Kadotani, T; Imamura, M; Koizumi, N; Iwahana, H; Sato, R

    1999-12-17

    The Bacillus thuringiensis Cry1Aa toxin-binding region of Bombyx mori aminopeptidase N (APN) was analyzed, to better understand the molecular mechanism of susceptibility to the toxin and the development of resistance in insects. APN was digested with lysylendopeptidase and the ability of the resulting fragments to bind to Cry1Aa and 1Ac toxins was examined. The binding abilities of the two toxins to these fragments were different. The Cry1Aa toxin bound to the fragment containing 40-Asp to 313-Lys, suggesting that the Cry1Aa toxin-binding site is located in the region between 40-Asp and 313-Lys, while Cry1Ac toxin bound exclusively to mature APN. Next, recombinant APN of various lengths was expressed in Escherichia coli cells and its ability to bind to Cry1Aa toxin was examined. The results localized the Cry1Aa toxin binding to the region between 135-Ile and 198-Pro.

  7. Mass Spectrometric and Spectrofluorometric Studies of the Interaction of Aristolochic Acids with Proteins

    Science.gov (United States)

    Li, Weiwei; Hu, Qin; Chan, Wan

    2015-10-01

    Aristolochic acid (AA) is a potent carcinogen and nephrotoxin and is associated with the development of “Chinese herb nephropathy” and Balkan endemic nephropathy. Despite decades of research, the specific mechanism of the observed nephrotoxicity has remained elusive and the potential effects on proteins due to the observed toxicity of AA are not well-understood. To better understand the pharmacotoxicological features of AA, we investigated the non-covalent interactions of AA with proteins. The protein-binding properties of AA with bovine serum albumin (BSA) and lysozyme were characterized using spectrofluorometric and mass spectrometric (MS) techniques. Moreover, the protein-AA complexes were clearly identified by high-resolution MS analyses. To the best of our knowledge, this is the first direct evidence of non-covalently bound protein-AA complexes. An analysis of the spectrofluorometric data by a modified Stern-Volmer plot model also revealed that both aristolochic acid I (AAI) and aristolochic acid II (AAII) were bound to BSA and lysozyme in 1:1 stoichiometries. A significantly stronger protein binding property was observed in AAII than in AAI as evidenced by the spectrofluorometric and MS analyses, which may explain the observed higher mutagenicity of AAII.

  8. Expedited Phonon Transfer in Interfacially Constrained Polymer Chain along Self-Organized Amino Acid Crystals.

    Science.gov (United States)

    Mu, Liwen; Li, Yifan; Mehra, Nitin; Ji, Tuo; Zhu, Jiahua

    2017-04-05

    In this work, poly(vinyl alcohol) (PVA)/amino acid (AA) composites were prepared by a self-organized crystallization process. Five different AAs (cysteine, aspartic acid, glutamic acid, ornithine, and lysine) were selected based on their similar functional groups but different molecular structures. The different PVA-AA interactions in the five PVA/AA composites lead to two crystal patterns, i.e., continuous network (cysteine and lysine) and discrete particles (glutamic acid, ornithine, and aspartic acid). Scanning thermal microscopy is then applied to map the distribution of thermal conduction in these composites. It is found that the interface surrounding the crystals plays a dominating role in phonon transport where the polymer chains are greatly restrained by the interfacial confinement effect. Continuous crystal network builds up a continuous interface that facilitates phonon transfer while phonon scattering occurs in discrete crystalline structures. Significantly improved thermal conductivity of ∼0.7 W/m·K is observed in PVA/cysteine composite with AA loading of 8.4 wt %, which corresponds to a 170% enhancement as compared to pure PVA. The strong PVA-AA molecular interaction and self-organized crystal structure are considered the major reasons for the unique interface property and superior thermal conductivity.

  9. Comparison of calculated and experimentally determined SID of CP and AA in complex diets differing in AA contents for grower finisher pigs.

    Science.gov (United States)

    Büsing, K; Berk, A; Müller, S; Kieckhäven, S; Krüger, K; Zeyner, A

    2017-10-01

    In practice, the content of standardized ileal digestible AA in complex feeds for pigs is calculated on the basis of tabulated values for individual feedstuffs. It comes into question, however, whether this truly reflects an accurate content based upon the estimate made for the individual feedstuffs. The objective of this study was to compare standardized ileal digestibility (SID) of crude protein (CP) and selected AA in complex feeds for grower and finisher pigs either calculated or experimentally determined. Six diets with increasing AA levels were prepared for grower (BW from 30 to 70 kg) and finisher (BW from 70 to 120 kg) feed. Crystalline L-lys, DL-met and L-thr were added to both diets, L-trp and L-val only to the grower feed. SID of both CP and AA was calculated from feed tables and experimentally determined in six adult minipigs (MINILEWE) with ileorectal anastomosis. With increasing AA levels, experimentally determined SID of supplemented AA increased (p AA via tabulated values for individual feedstuffs, however, seems to be acceptable for practical use. Journal of Animal Physiology and Animal Nutrition © 2017 Blackwell Verlag GmbH.

  10. Compound-specific amino acid δ15N patterns in marine algae: Tracer potential for cyanobacterial vs. eukaryotic organic nitrogen sources in the ocean

    Science.gov (United States)

    McCarthy, Matthew D.; Lehman, Jennifer; Kudela, Raphael

    2013-02-01

    Stable nitrogen isotopic analysis of individual amino acids (δ15N-AA) has unique potential to elucidate the complexities of food webs, track heterotrophic transformations, and understand diagenesis of organic nitrogen (ON). While δ15N-AA patterns of autotrophs have been shown to be generally similar, prior work has also suggested that differences may exist between cyanobacteria and eukaryotic algae. However, δ15N-AA patterns in differing oceanic algal groups have never been closely examined. The overarching goals of this study were first to establish a more quantitative understanding of algal δ15N-AA patterns, and second to examine whether δ15N-AA patterns have potential as a new tracer for distinguishing prokaryotic vs. eukaryotic N sources. We measured δ15N-AA from prokaryotic and eukaryotic phytoplankton cultures and used a complementary set of statistical approaches (simple normalization, regression-derived fractionation factors, and multivariate analyses) to test for variations. A generally similar δ15N-AA pattern was confirmed for all algae, however significant AA-specific variation was also consistently identified between the two groups. The relative δ15N fractionation of Glx (glutamine + glutamic acid combined) vs. total proteinaceous N appeared substantially different, which we hypothesize could be related to differing enzymatic forms. In addition, the several other AA (most notably glycine and leucine) appeared to have strong biomarker potential. Finally, we observed that overall patterns of δ15N values in algae correspond well with the Trophic vs. Source-AA division now commonly used to describe variable AA δ15N changes with trophic transfer, suggesting a common mechanistic basis. Overall, these results show that autotrophic δ15N-AA patterns can differ between major algal evolutionary groupings for many AA. The statistically significant multivariate results represent a first approach for testing ideas about relative eukaryotic vs. prokaryotic

  11. Effects of fluticasone propionate inhalation on levels of arachidonic acid metabolites in patients with chronic obstructive pulmonary disease

    Directory of Open Access Journals (Sweden)

    Gert T. Verhoeven

    2001-01-01

    Full Text Available Background: In smoking COPD patients the bronchoalveolar lavage (BAL fluid contains high numbers of inflammatory cells. These cells might produce arachidonic acid (AA metabolites, which contribute to inflammation and an increased bronchomotor tone.

  12. Global trophic position comparison of two dominant mesopelagic fish families (Myctophidae, Stomiidae) using amino acid nitrogen isotopicanalyses

    Science.gov (United States)

    We examined the biogeochemical and ecological mechanisms responsible for variability in bulk tissue and amino acid (AA) stable nitrogen isotope compositions in two groups of important mesopelagic fish families, Myctophidae (lanternfishes) and Stomiidae (dragonfishes), from five d...

  13. Experimental transmission of systemic AA amyloidosis in autoimmune disease and type 2 diabetes mellitus model mice

    Science.gov (United States)

    Maeda, Mayuko; Murakami, Tomoaki; Muhammad, Naeem; Inoshima, Yasuo; Ishiguro, Naotaka

    2016-01-01

    AA amyloidosis is a protein misfolding disease characterized by extracellular deposition of amyloid A (AA) fibrils. AA amyloidosis has been identified in food animals, and it has been postulated that AA amyloidosis may be transmissible to different animal species. Since the precursor protein of AA fibrils is serum amyloid A (SAA), which is an inflammatory acute phase protein, AA amyloidosis is considered to be associated with inflammatory diseases such as rheumatoid arthritis. Chronic diseases such as autoimmune disease and type 2 diabetes mellitus could be potential factors for AA amyloidosis. In this study, to examine the relationship between the induction of AA amyloidosis and chromic abnormalities such as autoimmune disease or type 2 diabetes mellitus, amyloid fibrils from mice, cattle, or chickens were experimentally injected into disease model mice. Wild-type mice were used as controls. The concentrations of SAA, IL-6, and IL-10 in autoimmune disease model mice were higher than those of control mice. However, induction of AA amyloidosis in autoimmune disease and type 2 diabetes mellitus model mice was lower than that in control mice, and the amount of amyloid deposits in the spleens of both mouse models was lower than that of control mice according to Congo red staining and immunohistochemistry. These results suggest that factors other than SAA levels, such as an inflammatory or anti-inflammatory environment in the immune response, may be involved in amyloid deposition. PMID:27321428

  14. Prevalence, Attitude, Knowledge, and Practice of Anabolic Androgenic Steroid (AAS) Use Among Gym Participants.

    Science.gov (United States)

    Althobiti, Sami D; Alqurashi, Nassar M; Alotaibi, Abdulmajeed S; Alharthi, Turki F; Alswat, Khaled A

    2018-03-01

    Anabolic steroids (AS) are synthetic testosterone derivatives that last longer than physiological androgens in the body. Anabolic-androgenic steroid (AAS) abuse is spreading among athletes. The aim of this study is to assess the knowledge, attitudes, and practices of gym participants in Saudi Arabia. A cross-sectional survey was carried out among gym users from February 2017 to May 2017. The questionnaire included information on demographics related to the use of AAS and lifestyle habits. Any willing male gym participant could be included. A total of 4860 male gym participants with a mean age of 28.6 ± 6.2 years were included. A majority were single, with a bachelor's degree or higher. Moreover, 9.8% of the participants used AAS, of which 76.7% reported improved fitness. Friends were the main source of AAS-related information, but only 38.0% of AAS users sought medical consults. The oral route was most common, and testosterone enanthate was the AAS most used. Also, 9.8% of gym participants used AAS and were more likely to be involved in risky habits, such as smoking and growth hormone abuse. They were less aware of potential complications of AAS, with gym trainers being the predominant source of AAS substances.

  15. Lu AA21004, a novel multimodal antidepressantwith activity exerted through serotonergic targets

    DEFF Research Database (Denmark)

    Mork, A.; Pehrson, A.; Montezinho, L. C. P.

    2012-01-01

    of contextual memory in rats were studied in the fear conditioning paradigm, and episodic memory was evaluated in the novel object recognition test. Results: Administration of Lu AA21004 (0.1-10 mg/kg, sc) demonstrated that the compound dose-dependently occupied the studied targets. Moreover, Lu AA21004...... increased extracellular levels of 5-HT, NA, DA, ACh and Hist in the brain. Lu AA21004 counteracted the immobility of FSL rats in the forced swim test and enhanced memory of the rats in the cognition models. Conclusions: Lu AA21004 in vivo engages relevant targets and affects several neurotransmitter systems...

  16. Spontaneous, Experimentally Induced, and Transmissible AA Amyloidosis in Japanese Quail ( Coturnix japonica).

    Science.gov (United States)

    Nakayama, Yumi; Kamiie, Junichi; Watanabe, Gen; Suzuki, Kazuhiko; Murakami, Tomoaki

    2017-11-01

    The authors describe a spontaneous case of amyloid A (AA) amyloidosis in an adult female Japanese quail ( Coturnix japonica). The bird developed AA amyloidosis secondary to chronic peritonitis caused by a Gram-negative bacillus infection. Mild amyloid deposition was also identified in the intestinal tract of apparently healthy adult individuals, suggesting that quail may develop intestinal amyloidosis with age. Based on these observations, it was hypothesized that quail can develop AA amyloidosis following inflammatory stimulation with lipopolysaccharide (LPS). Therefore, adult quail were repeatedly injected with LPS and the development of AA amyloidosis was confirmed. The amyloid deposition in this model increased when quail amyloid was intravenously injected as an amyloid-enhancing factor. The experiments were repeated with young quail, but amyloid deposits were not observed following LPS injections. However, AA amyloidosis did develop when quail amyloid was injected in addition to LPS. These results indicated that adult quail develop AA amyloidosis after inflammatory stimulation with LPS. Furthermore, quail AA amyloidosis was shown to have transmissibility regardless of age. Interestingly, the authors found that administration of chicken amyloid fibrils also induced AA amyloidosis in young quail. This is the first report of cross-species transmission of avian AA amyloidosis.

  17. Experimental transmission of systemic AA amyloidosis in autoimmune disease and type 2 diabetes mellitus model mice.

    Science.gov (United States)

    Maeda, Mayuko; Murakami, Tomoaki; Muhammad, Naeem; Inoshima, Yasuo; Ishiguro, Naotaka

    2016-11-01

    AA amyloidosis is a protein misfolding disease characterized by extracellular deposition of amyloid A (AA) fibrils. AA amyloidosis has been identified in food animals, and it has been postulated that AA amyloidosis may be transmissible to different animal species. Since the precursor protein of AA fibrils is serum amyloid A (SAA), which is an inflammatory acute phase protein, AA amyloidosis is considered to be associated with inflammatory diseases such as rheumatoid arthritis. Chronic diseases such as autoimmune disease and type 2 diabetes mellitus could be potential factors for AA amyloidosis. In this study, to examine the relationship between the induction of AA amyloidosis and chromic abnormalities such as autoimmune disease or type 2 diabetes mellitus, amyloid fibrils from mice, cattle, or chickens were experimentally injected into disease model mice. Wild-type mice were used as controls. The concentrations of SAA, IL-6, and IL-10 in autoimmune disease model mice were higher than those of control mice. However, induction of AA amyloidosis in autoimmune disease and type 2 diabetes mellitus model mice was lower than that in control mice, and the amount of amyloid deposits in the spleens of both mouse models was lower than that of control mice according to Congo red staining and immunohistochemistry. These results suggest that factors other than SAA levels, such as an inflammatory or anti-inflammatory environment in the immune response, may be involved in amyloid deposition.

  18. Introduction of poly[(2-acryloyloxyethyl trimethyl ammonium chloride)-co-(acrylic acid)] branches onto starch for cotton warp sizing.

    Science.gov (United States)

    Shen, Shiqi; Zhu, Zhifeng; Liu, Fengdan

    2016-03-15

    An attempt has been made to reveal the effect of amphoteric poly(2-acryloyloxyethyl trimethyl ammonium chloride-co-acrylic acid) [P(ATAC-co-AA)] branches grafted onto the backbones of starch upon the adhesion-to-cotton, film properties, and desizability of maize starch for cotton warp sizing. Starch-g-poly[(2-acryloyloxyethyl trimethyl ammonium chloride)-co-(acrylic acid) [S-g-P(ATAC-co-AA)] was prepared by the graft copolymerization of 2-acryloyloxyethyl trimethyl ammonium chloride (ATAC) and acrylic acid (AA) with acid-converted starch (ACS) in aqueous medium using Fe(2+)-H2O2 initiator. The adhesion was evaluated in term of bonding strength according to the FZ/T 15001-2008 whereas the film properties considered included tensile strength, work and percentage elongation at break. The evaluation was undertaken through the comparison of S-g-P(ATAC-co-AA) with ACS, starch-g-poly(acrylic acid), and starch-g-poly(2-acryloyloxyethyl trimethyl ammonium chloride). It was found that the amphoteric branch was able to significantly improve the adhesion and mitigate the brittleness of starch film. Zeta potential of cooked S-g-P(ATAC-co-AA) paste, depending on the mole ratio of ATAC to AA units on P(ATAC-co-AA) branches, had substantial effect on the adhesion and desizability. Increasing the mole ratio raised the potential, which favored the adhesion but disfavored the removal of S-g-P(ATAC-co-AA) from sized cotton warps. Electroneutral S-g-P(ATAC-co-AA) was superior to negatively grafted starch in adhesion and to positively grafted starch in desizability. Generally, it showed better sizing property than ACS, starch-g-poly(acrylic acid), and starch-g-poly(2-acryloyloxyethyl trimethyl ammonium chloride), and had potential in the application of cotton warp sizing. Copyright © 2015. Published by Elsevier Ltd.

  19. AAS, growth hormone, and insulin abuse: psychological and neuroendocrine effects

    Directory of Open Access Journals (Sweden)

    Michael R Graham

    2008-06-01

    Full Text Available Michael R Graham1, Peter Evans2, Bruce Davies1, Julien S Baker11Health and Exercise Science Research Unit, Faculty of Health Sport and Science, University of Glamorgan, Pontypridd, Wales, United Kingdom; 2Royal Gwent Hospital, Newport, Gwent, United KingdomAbstract: The nontherapeutic use of prescription medicines by individuals involved in sport is increasing. Anabolic-androgenic steroids (AAS are the most widely abused drug. Much of our knowledge of the psychological and physiological effects of human growth hormone (hGH and insulin has been learned from deficiency states. As a consequence of the Internet revolution, previously unobtainable and expensive designer drugs, particularly recombinant human growth hormone (rhGH and insulin, have become freely available at ridiculously discounted prices from countries such as China and are being abused. These drugs have various physiological and psychological effects and medical personnel must become aware that such prescription medicine abuse appears to be used not only for performance and cosmetic reasons, but as a consequence of psychological pre-morbidity.Keywords: AAS, cosmesis, growth hormone, insulin, performance, strength

  20. AAS Publishing News: Preparing Your Manuscript Just Got Easier

    Science.gov (United States)

    Kohler, Susanna

    2016-03-01

    Watermarking using the command watermark{DRAFT, v2}.Are you an astronomer considering submitting a paper to an AAS journal (i.e., AJ, ApJ, ApJ Letters, or ApJ Supplements)? If so, this post is for you! Read on to find out about the exciting new things you can do with the AASs newest LaTeX class file, available for download now.Why the Update?AAS publishing has maintained a consistent class file for LaTeX manuscript preparation for the past decade. But academic publishing is changing rapidly in todays era of electronic journals! Since its journals went fully electronic, the AAS has been continuously adding new publishing capabilities based on the recommendations of the Journals Task Force and the needs and requests of AAS authors. The AASs manuscript preparation tools are now being updated accordingly.Whats New in AASTex 6.0?There are many exciting new features and capabilities in AASTex 6.0. Here are just a few:Tracking options for author revisions include added{text}, deleted{text}, replaced{old}{new}, and explain{text}.Based on emulateapjDo you use the popular class file emulateapj to prepare your manuscripts? AASTex 6.0 is based on emulateapj, rather than on the older AASTex 5.2 (though 5.2 is still supported). This means that it is easy to produce a double-columned, single-spaced, and astro-ph-ready manuscript. Since two thirds of the AAS journals authors use emulateapj, this transition was designed to make manuscript preparation and sharing an easier and more seamless process.Tools for collaborationsDo you work in a large collaboration? AASTex now includes new tools to make preparing a manuscript within a collaboration easier. Drafts can now be watermarked to differentiate between versions. New markup for large author lists streamlines the display so that readers can access article information immediately, yet they can still access the full author list and affiliations at the end of the paper. And author revision markup allows members of a collaboration to

  1. Springback analysis on AA 6061 aluminum alloy sheets

    Science.gov (United States)

    Ramulu, Perumalla Janaki; Rao, P. Srinivasa; Yimer, Wassihun

    2016-10-01

    In automotive industry, sheet metal forming process play a key role with respect to economy and weight reduction ratio. In sheet metal forming, one of the operations is bending operation in which sheet will not go under sever deformation. The end components are made by applying the continuous load on the sheet in the bending process. In bending process, elastic limits of materials are exceeded, but flow limit thereof cannot be exceeded. Therefore, the material still keeps a portion of its original flexibility character. When the load is released, the material on forcing compress side tries to enlarge, whereas the material on tensile side tries to shrink. As a result, the material tries to spring back and the bended material by flexing slightly tries to open. Springback varies according to thickness of the material, material and process parameters, type of material, period when punch load stays on the material, dimensions of die, force applied, and bending radius. In order to make bending at a desired angle, springback amounts should be avoided. In the present work, experimentation on AA 6061 alloy sheet springback analysis has done with seven different rolling directions. Results are noted with respect to load, displacement, and die angle on the springback effect. It observed that springback affect is existed notably in the AA 6061 alloys with respect to die angle.

  2. Amino acid profiles of rumen undegradable protein: a comparison between forages including cereal straws and alfalfa and their respective total mixed rations.

    Science.gov (United States)

    Wang, B; Jiang, L S; Liu, J X

    2017-10-06

    Optimizing the amino acid (AA) profile of rumen undegradable protein (RUP) can positively affect the amount of milk protein. This study was conducted to improve knowledge regarding the AA profile of rumen undegradable protein from corn stover, rice straw and alfalfa hay as well as the total mixed ratio diets (TMR) based on one of them as forage source [forage-to-concentrate ratio of 45:55 (30% of corn stover (CS), 30% of rice straw (RS), 23% of alfalfa hay (AH) and dry matter basis)]. The other ingredients in the three TMR diets were similar. The RUP of all the forages and diets was estimated by incubation for 16 hr in the rumen of three ruminally cannulated lactating cows. All residues were corrected for microbial colonization, which was necessary in determining the AA composition of RUP from feed samples using in situ method. Compared with their original AA composition, the AA pattern of forages and forage-based diets changed drastically after rumen exposure. In addition, the extent of ruminal degradation of analysed AA was not constant among the forages. The greatest individual AA degradability of alfalfa hay and corn stover was Pro, but was His of rice straw. A remarkable difference was observed between microbial attachment corrected and uncorrected AA profiles of RUP, except for alfalfa hay and His in the three forages and TMR diets. The ruminal AA degradability of cereal straws was altered compared with alfalfa hay but not for the TMR diets. In summary, the AA composition of forages and TMR-based diets changed significantly after ruminal exposure, indicating that the original AA profiles of the feed cannot represent its AA composition of RUP. The AA profile of RUP and ruminal AA degradability for corn stover and rice straw contributed to missing information in the field. © 2017 Blackwell Verlag GmbH.

  3. [A novel gene (Aa-accA ) encoding acetyl-CoA carboxyltransferase alpha-subunit of Alkalimonas amylolytica N10 enhances salt and alkali tolerance of Escherichia coli and tobacco BY-2 cells].

    Science.gov (United States)

    Xian, Mingjie; Zhai, Lei; Zhong, Naiqin; Ma, Yiwei; Xue, Yanfen; Ma, Yanhe

    2013-08-04

    Acetyl-CoA carboxylase (ACC) catalyzes the first step of fatty acid synthesis. In most bacteria, ACC is composed of four subunits encoded by accA, accB, accC, and accD. Of them, accA encodes acetyl-CoA carboxyltransferase alpha-subunit. Our prior work on proteomics of Alkalimonas amylolytica N10 showed that the expression of the Aa-accA has a remarkable response to salt and alkali stress. This research aimed to find out the Aa-accA gene contributing to salt and alkali tolerance. The Aa-accA was amplified by PCR from A. amylolytica N10 and expressed in E. coli K12 host. The effects of Aa-accA expression on the growth of transgenic strains were examined under different NaCl concentration and pH conditions. Transgenic tobacco BY-2 cells harboring Aa-accA were also generated via Agrobacterium-mediated transformation. The viability of BY-2 cells was determined with FDA staining method after salt and alkali shock. The Aa-accA gene product has 318 amino acids and is homologous to the carboxyl transferase domain of acyl-CoA carboxylases. It showed 76% identity with AccA (acetyl-CoA carboxylase carboxyltransferase subunit alpha) from E. coli. Compared to the wild-type strains, transgenic E. coli K12 strain containing Aa-accA showed remarkable growth superiority when grown in increased NaCl concentrations and pH levels. The final cell density of the transgenic strains was 2.6 and 3.5 times higher than that of the control type when they were cultivated in LB medium containing 6% (W/V) NaCl and at pH 9, respectively. Complementary expression of Aa-accA in an accA-depletion E. coli can recover the tolerance of K12 delta accA to salt and alkali stresses to some extent. Similar to the transgenic E. coli, transgenic tobacco BY-2 cells showed higher percentages of viability compared to the wild BY-2 cells under the salt or alkali stress condition. We found that Aa-accA from A. amylolytica N10 overexpression enhances the tolerance of both transgenic E. coli and tobacco BY-2 cells to

  4. Effect of plant proteins and crystalline amino acid supplementation on postprandial plasma amino acid profiles and metabolic response in rainbow trout (Oncorhynchus mykiss)

    DEFF Research Database (Denmark)

    Rolland, Marine; Larsen, Bodil Katrine; Holm, Jørgen

    2015-01-01

    .75 % of their body mass with a diet based on either (1) fish meal (FM), (2) pea protein concentrate (PPC), or (3) pea protein concentrate supplemented with histidine, lysine, methionine and threonine (PPC+) to mimic FM AA profile. The specific dynamic action and nitrogen quotient (NQ) were calculated for 48 h......The use of aquafeeds formulated with plant protein sources supplemented with crystalline amino acids (CAAs) is believed to influence amino acid (AA) uptake patterns and AA metabolic fate. Oxygen consumption and ammonia excretion rates were measured in rainbow trout (468.5 +/- A 86.5 g) force fed 0...... of the postprandial period. In parallel, plasma AA concentrations were measured in blood samples withdrawn from the caudal vein before and then 2, 4, 6, 8, 12, 20, 32 and 48 h after feed administration. The unbalanced diet PPC had a significantly higher NQ compared to FM (0.29 +/- A 0.09 and 0.18 +/- A 0...

  5. Effect of Chlorine Dioxide and Ascorbic Acid on Enzymatic Browning and Shelf Life of Fresh-Cut Red Delicious and Granny Smith Apples

    NARCIS (Netherlands)

    Remorini, Damiano; Landi, Marco; Tardelli, Francesca; Lugani, Arianna; Massai, Rossano; Graziani, Giulia; Fogliano, Vincenzo; Guidi, Lucia

    2015-01-01

    In this work, we tested the hypothesis that ascorbic acid (AA) reduces browning of fresh-cut apples (Red Delicious, RD, and Granny Smith, GS), and we investigated the impact of AA on phenylpropanoid metabolism of RD and GS. Apple slices were dipped in a solution of 100mg/L of chlorine dioxide

  6. Adsorption of humic acid on acid-activated Greek bentonite.

    Science.gov (United States)

    Doulia, Danae; Leodopoulos, Ch; Gimouhopoulos, K; Rigas, F

    2009-12-15

    The adsorption of humic acid on bentonite from Milos Island (Greece) acid-treated with dilute H(2)SO(4) solutions over a concentration range between 0.25 and 13M has been studied. Bentonite activated with 3M sulfuric acid (AAS) showed a higher efficiency in removing humic acid from aqueous solutions and was selected for further investigation. The specific surface area of acid-activated bentonite was estimated using the methylene blue adsorption method. The morphology of untreated, activated, and HA-sorbed bentonite was studied under scanning electron microscope (SEM). The effects of contact time, adsorbate concentration, adsorbent dose, and temperature on the adsorption of humic acid onto bentonite activated with 3M H(2)SO(4) were studied using a batch adsorption technique. Acidic pH and high ionic strength proved to be favorable for the adsorption efficiency. Pseudo-first-order, pseudo-second-order, and intraparticle diffusion models were used to describe the kinetic data and the rate constants were evaluated. The experimental isotherm data were analyzed using Langmuir, Freundlich, and Temkin equations and the isotherm constants were determined. Thermodynamic parameters (DeltaH(o), DeltaS(o), and DeltaG(o)) of adsorption of humic acid onto acid-activated bentonite with 3M sulfuric acid were also evaluated.

  7. [Development of ICP-OES, ICP-MS and GF-AAS Methods for Simultaneous Quantification of Lead, Total Arsenic and Cadmium in Soft Drinks].

    Science.gov (United States)

    Kataoka, Yohei; Watanabe, Takahiro; Hayashi, Tomoko; Teshima, Reiko; Matsuda, Rieko

    2015-01-01

    In this study, we developed methods to quantify lead, total arsenic and cadmium contained in various kinds of soft drinks, and we evaluated their performance. The samples were digested by common methods to prepare solutions for measurement by ICP-OES, ICP-MS and graphite furnace atomic absorption spectrometry (GF-AAS). After digestion, internal standard was added to the digestion solutions for measurements by ICP-OES and ICP-MS. For measurement by GF-AAS, additional purification of the digestion solution was conducted by back-extraction of the three metals into nitric acid solution after extraction into an organic solvent with ammonium pyrrolidine dithiocarbamate. Performance of the developed methods were evaluated for eight kinds of soft drinks.

  8. Amino Acid Specific Stable Nitrogen Isotope Values in Avian Tissues: Insights from Captive American Kestrels and Wild Herring Gulls.

    Science.gov (United States)

    Hebert, C E; Popp, B N; Fernie, K J; Ka'apu-Lyons, C; Rattner, B A; Wallsgrove, N

    2016-12-06

    Through laboratory and field studies, the utility of amino acid compound-specific nitrogen isotope analysis (AA-CSIA) in avian studies is investigated. Captive American kestrels (Falco sparverius) were fed an isotopically characterized diet and patterns in δ 15 N values of amino acids (AAs) were compared to those in their tissues (muscle and red blood cells) and food. Based upon nitrogen isotope discrimination between diet and kestrel tissues, AAs could mostly be categorized as source AAs (retaining baseline δ 15 N values) and trophic AAs (showing 15 N enrichment). Trophic discrimination factors based upon the source (phenylalanine, Phe) and trophic (glutamic acid, Glu) AAs were 4.1 (muscle) and 5.4 (red blood cells), lower than those reported for metazoan invertebrates. In a field study involving omnivorous herring gulls (Larus argentatus smithsonianus), egg AA isotopic patterns largely retained those observed in the laying female's tissues (muscle, red blood cells, and liver). Realistic estimates of gull trophic position were obtained using bird Glu and Phe δ 15 N values combined with β values (difference in Glu and Phe δ 15 N in primary producers) for aquatic and terrestrial food webs. Egg fatty acids were used to weight β values for proportions of aquatic and terrestrial food in gull diets. This novel approach can be applied to generalist species that feed across ecosystem boundaries.

  9. Fluorescing fatty acids in rat fatty liver models.

    Science.gov (United States)

    Croce, Anna C; Ferrigno, Andrea; Di Pasqua, Laura G; Berardo, Clarissa; Mannucci, Barbara; Bottiroli, Giovanni; Vairetti, Mariapia

    2017-06-01

    The autofluorescence (AF) of NAD(P)H and flavins has been at the basis of many in-situ studies of liver energy metabolism and functionality. Conversely, few data have been so far reported on fluorescing lipids. In this work we investigated the AF of liver lipid extracts from two fatty liver models, Wistar rats fed with MCD diet for 12 days (Wi-MCD), and obese (fa/fa) Zucker rats. Among the most abundant fatty acids in the lipid extracts, indicated by mass spectrometry, arachidonic acid (AA) exhibited higher quantum yield than the other fluorescing fatty acids (FLFA), and red shifted AF spectrum. This allowed to estimate the AA contribution to the overall emission of lipid extracts by curve fitting analysis. AA prevailed in obese Zucker livers, accounting for the different AF spectral profiles between the two models. AF and mass spectrometry indicated also a different balance between the fluorescing fraction and the overall amount of AA in the two models. The ability of AF to detect directly AA and FLFA was demonstrated, suggesting its supportive role as tool in wide-ranging applications, from the control of animal origin food, to experimental investigations on liver fat accumulation, lipotoxicity and disease progression, with potential translation to the clinics. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Ameliorative effects of riboflavin on acetic acid-induced colonic injury in rats.

    Science.gov (United States)

    Karakoyun, Berna; Ertaş, Büşra; Yüksel, Meral; Akakın, Dilek; Çevik, Özge; Şener, Göksel

    2017-11-22

    Riboflavin (RF) has been found to be a promising antioxidant and/or anti-inflammatory agent in several studies. However, the effect of RF against acetic acid (AA)-induced colonic injury is currently unknown. This study aimed to investigate the potential antioxidant and protective effects of RF in a rat model of ulcerative colitis. Starting immediately after the colitis induction (AA+RF group) or 1 week before the colitis induction (RF+AA+RF group), the rats were treated with RF (25 mg/kg per day; p.o.) for 3 days. The control and AA groups received saline (1 mL; p.o.) whereas AA+SS group (positive control) received sulfasalazine (100 mg/kg per day; p.o.) for 3 days. Colonic samples were taken for the biochemical and histological assessments on the third day. High damage scores, elevated tissue wet weight index (WI), tissue myeloperoxidase (MPO) activity, 8-hydroxy-2'-deoxyguanosine levels and chemiluminescence values, and a pronounced decrease in antioxidant glutathione (GSH) levels of the AA group were all reversed by RF pretreatment (RF+AA+RF group) and SS treatment (AA+SS group) (P < .05-.001). Tissue WI, MPO activity and GSH levels were not statistically changed in the AA+RF group. Western blot analysis revealed that the decreased protein expressions of tissue collagen (COL) 1A1, COL3A1 and transforming growth factor-β1 in the AA group were elevated in all the treatment groups (P < .05-.001). In conclusion, RF exerts both the antioxidant and anti-inflammatory effects against AA-induced colonic inflammation by suppressing neutrophil accumulation, inhibiting reactive oxidant generation, preserving endogenous glutathione, improving oxidative DNA damage and regulating inflammatory mediators, suggesting a future potential role in the treatment and prevention of ulcerative colitis. © 2017 John Wiley & Sons Australia, Ltd.

  11. Biogeochemistry of Dimethylsulfide, Dimethylsulfoniopropionate, and Acrylic Acid in the Changjiang Estuary and the East China Sea

    Science.gov (United States)

    Wu, Xi; Li, Pei-Feng; Liu, Chun-Ying; Zhang, Hong-Hai; Yang, Gui-Peng; Zhang, Sheng-Hui; Zhu, Mao-Xu

    2017-12-01

    The distributions of dimethylsulfide (DMS), dimethylsulfoniopropionate (DMSP), and acrylic acid (AA) were investigated in the Changjiang Estuary during winter (dry season) and summer (wet season) 2014 and in the East China Sea (ECS) during summer 2015. The rates of dissolved DMSP (DMSPd) degradation with DMS and AA production, DMS degradation, and AA degradation in the ECS were also studied. Significant seasonal variations in DMS(P) and AA concentrations were observed in the Changjiang Estuary with higher values during the wet season than during the dry season. The maximum ratio of AA/chlorophyll a (Chl a) occurred at the mouth of the Changjiang Estuary due to the combined effects of production from DMSP and terrestrial inputs from the Changjiang Estuary. The distributions of DMS(P) and AA in the ECS were dramatically influenced by the Kuroshio Current and the upwelling caused by the Taiwan Warm Current. The ratios of DMS(P)/Chl a and AA/Chl a exhibited similar patterns in the surface seawater of the ECS, which indicated that phytoplankton species and biomass might play important roles in controlling the distributions of DMS(P) and AA. In vertical profiles, high values of AA emerged in the upper water column and bottom seawater of the Changjiang Estuary. Meanwhile, the maxima of DMS(P) and AA generally appeared in the surface or euphotic layer, whereas their minima arose in the bottom seawater of the ECS. The degradation rates of DMSPd, DMS, and AA in the inshore waters were higher than those in the open sea.

  12. Electronically Stabilized Copoly(Styrene-Acrylic Acid Submicrocapsules Prepared by Miniemulsion Copolymerization

    Directory of Open Access Journals (Sweden)

    Minkwan Kim

    2017-07-01

    Full Text Available This work reports the preparation and characterization of poly(styrene-acrylic acid (St/AA submicrocapsules by using the miniemulsion copolymerization method. AA was introduced to miniemulsion polymerization of St to increase the zeta potential and the resulting electrostatic stability of St/AA submicrocapsules. Phytoncide oil was adopted as the core model material. Miniemulsion copolymerization of St and AA was conducted at a fixed monomer concentration (0.172 mol with a varying monomer feed ratio [AA]/[St] (0.2, 0.25, 0.33, 0.5, and 1.0. Concentrations of initiator (azobisisobutyronitrile; 1.0 × 10−3, 2.0 × 10−3, 3.0 × 10−3, and 4.0 × 10−3 mol/mol of monomer and surfactant (sodium dodecyl sulfate; 0.6 × 10−3, 1.0 × 10−3, and 1.4 × 10−3 mol were also controlled to optimize the miniemulsion copolymerization of St and AA. Dynamic light scattering and microscopic analyses confirmed the optimum condition of miniemulsion copolymerization of St and AA. Long-term colloidal stability of aqueous St/AA submicrocapsule suspension was evaluated by using TurbiscanTM Lab. In this work, the optimum condition for miniemulsion copolymerization of St and AA was determined ([AA]/[St] = 0.33; [SDS] = 1.0 × 10−3 mol; [AIBN] = 2.0 × 10−3 mol/mol of monomer. St/AA submicrocapsules prepared at the optimum condition (392.6 nm and −55.2 mV of mean particle size and zeta potential, respectively showed almost no variations in backscattering intensity (stable colloids without aggregation.

  13. UTILIZATION OF AMINO ACIDS OF BROKEN RICE IN GROWING PIGS

    Directory of Open Access Journals (Sweden)

    Matej Brestenský

    2014-02-01

    Full Text Available The six cannulated gilts (initial body weight 35.8 ± 0.5 kg fitted with a T-cannula in terminal ileum, were used to determine the apparent (AID and standardized (SID ileal digestibility of nitrogen (N and amino acids (AA in broken rice. Animals were fed twice daily in a two equal doses at a daily rate of 80 g.kg - 0.75. Water was offered ad libitum. The tested feed was the sole source of protein in the diet. The N-free diet was used to determine the ileal endogenous flow of AA and N. Chromium oxide (Cr2O3 was added to the diets as an indigestible marker in an amount of 0.3 % per kg of diet. After a 14 d postoperative period a 6 d adaptation period followed during which the animals were fed with an experimental diet. On d 7 ileal digesta was collected continuously for 24 h. The AID and SID of AA and N were calculated using analytically determined values of N, Cr2O3 and AA. The SID of AA was in a range from 81.6 % (tyrosine to 112.6 % (proline (P 0.05, respectively. There were no differences between standardized ileal digestibility of essential amino acids (94.3 % and nonessential amino acids (95.3 %. Regarding the ileal digestibility of AA, broken rice, a by-product from the food industry, is an appropriate source of digestible AA for growing pigs.

  14. Effect of pin tool design on the material flow of dissimilar AA7075-AA6061 friction stir welds

    Science.gov (United States)

    Hasan, Mohammed M.; Ishak, M.; Rejab, M. R. M.

    2017-10-01

    Tool design is the most influential aspect in the friction stir welding (FSW) technology. Influence of pin tool geometry on material flow pattern are studied in this work during the FSW of dissimilar AA7075 and AA6061 aluminium alloys. Three truncated pin tool profiles (threaded, threaded with single flat, and unthreaded with single flat) were used to prepare the weldments. The workpieces were joined using a custom-made clamping system under 1100 rpm of spindle speed, 300 mm/min of traverse rate and 3° of tilt angle. The metallographic analysis showed that defect-free welds can be produced using the three pin tools with significant changes in the mixing stir zone structure. The results declared that the introducing of the flat on the cone of the probe deviates the pattern of the onion rings without changing the chemical composition of the created layers. This in turn improves the hardness distribution and tensile strength of the welded joint. It was also noted that both heat affected zone (HAZ) and thermal-mechanical affected zone (TMAZ) are similar in composition to their corresponding base materials (BM).

  15. Depletion of spleen macrophages delays AA amyloid development: a study performed in the rapid mouse model of AA amyloidosis.

    Directory of Open Access Journals (Sweden)

    Katarzyna Lundmark

    Full Text Available AA amyloidosis is a systemic disease that develops secondary to chronic inflammatory diseases Macrophages are often found in the vicinity of amyloid deposits and considered to play a role in both formation and degradation of amyloid fibrils. In spleen reside at least three types of macrophages, red pulp macrophages (RPM, marginal zone macrophages (MZM, metallophilic marginal zone macrophages (MMZM. MMZM and MZM are located in the marginal zone and express a unique collection of scavenger receptors that are involved in the uptake of blood-born particles. The murine AA amyloid model that resembles the human form of the disease has been used to study amyloid effects on different macrophage populations. Amyloid was induced by intravenous injection of amyloid enhancing factor and subcutaneous injections of silver nitrate and macrophages were identified with specific antibodies. We show that MZMs are highly sensitive to amyloid and decrease in number progressively with increasing amyloid load. Total area of MMZMs is unaffected by amyloid but cells are activated and migrate into the white pulp. In a group of mice spleen macrophages were depleted by an intravenous injection of clodronate filled liposomes. Subsequent injections of AEF and silver nitrate showed a sustained amyloid development. RPMs that constitute the majority of macrophages in spleen, appear insensitive to amyloid and do not participate in amyloid formation.

  16. Determination of uric acid in the presence of ascorbic acid with hexacyanoferrate lanthanum film modified electrode

    International Nuclear Information System (INIS)

    Wang Guangfeng; Meng Jian; Liu Hongying; Jiao Shoufeng; Zhang Wei; Chen Daolei; Fang Bin

    2008-01-01

    A glassy carbon electrode modified with LaHCF was constructed and was characterized by cyclic voltammetry (CV) and electrochemical impedance spectrum (EIS). The resulting LaHCF modified glassy carbon electrode had a good catalytic character on uric acid (UA) and was used to detect uric acid and ascorbic acid (AA) simultaneously. This modified electrode exhibits potent and persistent electron-mediating behavior followed by well-separated oxidation peaks towards UA and AA with activation overpotential. For UA and AA in mixture, one can well separate from the other with a potential large enough to allow the determination of one in presence of the other. The DPV peak currents obtained increased linearly on the UA in the range of 2.0 x 10 -7 to 1.0 x 10 -4 mol/L with the detection limit (signal-to-noise ratio was 3) for UA 1.0 x 10 -7 mol/L. The proposed method showed excellent selectivity and stability, and the determination of UA and AA simultaneously in urine was satisfactory

  17. The impact of FADS genetic variants on ω6 polyunsaturated fatty acid metabolism in African Americans

    Directory of Open Access Journals (Sweden)

    Rudock Megan E

    2011-05-01

    Full Text Available Abstract Background Arachidonic acid (AA is a long-chain omega-6 polyunsaturated fatty acid (PUFA synthesized from the precursor dihomo-gamma-linolenic acid (DGLA that plays a vital role in immunity and inflammation. Variants in the Fatty Acid Desaturase (FADS family of genes on chromosome 11q have been shown to play a role in PUFA metabolism in populations of European and Asian ancestry; no work has been done in populations of African ancestry to date. Results In this study, we report that African Americans have significantly higher circulating levels of plasma AA (p = 1.35 × 10-48 and lower DGLA levels (p = 9.80 × 10-11 than European Americans. Tests for association in N = 329 individuals across 80 nucleotide polymorphisms (SNPs in the Fatty Acid Desaturase (FADS locus revealed significant association with AA, DGLA and the AA/DGLA ratio, a measure of enzymatic efficiency, in both racial groups (peak signal p = 2.85 × 10-16 in African Americans, 2.68 × 10-23 in European Americans. Ancestry-related differences were observed at an upstream marker previously associated with AA levels (rs174537, wherein, 79-82% of African Americans carry two copies of the G allele compared to only 42-45% of European Americans. Importantly, the allelic effect of the G allele, which is associated with enhanced conversion of DGLA to AA, on enzymatic efficiency was similar in both groups. Conclusions We conclude that the impact of FADS genetic variants on PUFA metabolism, specifically AA levels, is likely more pronounced in African Americans due to the larger proportion of individuals carrying the genotype associated with increased FADS1 enzymatic conversion of DGLA to AA.

  18. Overexpression of the protein phosphatase 2A regulatory subunit a gene ZmPP2AA1 improves low phosphate tolerance by remodeling the root system architecture of maize.

    Directory of Open Access Journals (Sweden)

    Jiemin Wang

    Full Text Available Phosphate (Pi limitation is a constraint for plant growth and development in many natural and agricultural ecosystems. In this study, a gene encoding Zea mays L. protein phosphatase 2A regulatory subunit A, designated ZmPP2AA1, was induced in roots by low Pi availability. The function of the ZmPP2AA1 gene in maize was analyzed using overexpression and RNA interference. ZmPP2AA1 modulated root gravitropism, negatively regulated primary root (PR growth, and stimulated the development of lateral roots (LRs. A detailed characterization of the root system architecture (RSA in response to different Pi concentrations with or without indole-3-acetic acid and 1-N-naphthylphthalamic acid revealed that auxin was involved in the RSA response to low Pi availability. Overexpression of ZmPP2AA1 enhanced tolerance to Pi starvation in transgenic maize in hydroponic and soil pot experiments. An increased dry weight (DW, root-to-shoot ratio, and total P content and concentration, along with a delayed and reduced accumulation of anthocyanin in overexpressing transgenic maize plants coincided with their highly branched root system and increased Pi uptake capability under low Pi conditions. Inflorescence development of the ZmPP2AA1 overexpressing line was less affected by low Pi stress, resulting in higher grain yield per plant under Pi deprivation. These data reveal the biological function of ZmPP2AA1, provide insights into a linkage between auxin and low Pi responses, and drive new strategies for the efficient utilization of Pi by maize.

  19. Cereal grain, rachis and pulse seed amino acid δ15N values as indicators of plant nitrogen metabolism.

    Science.gov (United States)

    Styring, Amy K; Fraser, Rebecca A; Bogaard, Amy; Evershed, Richard P

    2014-01-01

    Natural abundance δ(15)N values of plant tissue amino acids (AAs) reflect the cycling of N into and within plants, providing an opportunity to better understand environmental and anthropogenic effects on plant metabolism. In this study, the AA δ(15)N values of barley (Hordeum vulgare) and bread wheat (Triticum aestivum) grains and rachis and broad bean (Vicia faba) and pea (Pisum sativum) seeds, grown at the experimental farm stations of Rothamsted, UK and Bad Lauchstädt, Germany, were determined by GC-C-IRMS. It was found that the δ(15)N values of cereal grain and rachis AAs could be largely attributed to metabolic pathways involved in their biosynthesis and catabolism. The relative (15)N-enrichment of phenylalanine can be attributed to its involvement in the phenylpropanoid pathway and glutamate has a δ(15)N value which is an average of the other AAs due to its central role in AA-N cycling. The relative AA δ(15)N values of broad bean and pea seeds were very different from one another, providing evidence for differences in the metabolic routing of AAs to the developing seeds in these leguminous plants. This study has shown that AA δ(15)N values relate to known AA biosynthetic pathways in plants and thus have the potential to aid understanding of how various external factors, such as source of assimilated N, influence metabolic cycling of N within plants. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Essential fatty acids and lipid mediators. Endocannabinoids

    Directory of Open Access Journals (Sweden)

    G. Caramia

    2012-03-01

    Full Text Available In 1929 Burr and Burr discovered the essential fatty acids omega-6 and omega-3. Since then, researchers have shown a growing interest in polyunsaturated fatty acids (PUFA as precursors of “lipid mediator” molecules, often with opposing effects, prostaglandins, prostacyclins, thromboxanes, leukotrienes, lipossines, resolvines, protectines, maresins that regulate immunity, platelet aggregation, inflammation, etc. They showed that the balance between omega-3 and omega-6 acids has a profound influence on all the body’s inflammatory responses and a raised level of PUFA omega-3 in tissue correlate with a reduced incidence of degenerative cardiovascular disease, some mental illnesses such as depression, and neuro-degenerative diseases such as Alzheimer’s. The CYP-catalyzed epoxidation and hydroxylation of arachidonic acid (AA were established recently as the so-called third branch of AGE cascade. Cytochrome P450 (CYP epoxygenases convert AA to four epoxyeicosatrienoic acid (EET regioisomers, that produce vascular relaxation anti-inflammatory effects on blood vessels and in the kidney, promote angiogenesis, and protect ischemic myocardium and brain. Eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA are accessible to CYP enzymes in the same way as AA. Metabolites derived from EPA include epoxyeicosatetraenoic acids (EETR and hydroxyeicosapentaenoic acids (19- and 20-HEPE, whereas DHA include epoxydocosapentaenoic acids (EDPs hydroxydocosahexaenoic acids (21- and 22-HDoHE. For many of the CYP isoforms, the n-3 PUFAs are the preferred substrates and the available data suggest that some of the vasculo- and cardioprotective effects attributed to dietary n-3 PUFAs may be mediated by CYP-dependent metabolites of EPA and DHA. From AA derives also endocannabinoids like anandamide (N-arachidonoylethanolamine and 2-arachidonoylglycerol, capable of mimicking the pharmacological actions of the active principle of Cannabis sativa preparations such as

  1. Intracellular ascorbic acid inhibits transport of glucose by neurons, but not by astrocytes.

    Science.gov (United States)

    Castro, Maite A; Pozo, Miguel; Cortés, Christian; García, María de Los Angeles; Concha, Ilona I; Nualart, Francisco

    2007-08-01

    It has been demonstrated that glutamatergic activity induces ascorbic acid (AA) depletion in astrocytes. Additionally, different data indicate that AA may inhibit glucose accumulation in primary cultures of rat hippocampal neurons. Thus, our hypothesis postulates that AA released from the astrocytes during glutamatergic synaptic activity may inhibit glucose uptake by neurons. We observed that cultured neurons express the sodium-vitamin C cotransporter 2 and the facilitative glucose transporters (GLUT) 1 and 3, however, in hippocampal brain slices GLUT3 was the main transporter detected. Functional activity of GLUTs was confirmed by means of kinetic analysis using 2-deoxy-d-glucose. Therefore, we showed that AA, once accumulated inside the cell, inhibits glucose transport in both cortical and hippocampal neurons in culture. Additionally, we showed that astrocytes are not affected by AA. Using hippocampal slices, we observed that upon blockade of monocarboxylate utilization by alpha-cyano-4-hydroxycinnamate and after glucose deprivation, glucose could rescue neuronal response to electrical stimulation only if AA uptake is prevented. Finally, using a transwell system of separated neuronal and astrocytic cultures, we observed that glutamate can reduce glucose transport in neurons only in presence of AA-loaded astrocytes, suggesting the essential role of astrocyte-released AA in this effect.

  2. Safety assessment of azelaic acid and its derivatives entrapped in nanovesicles.

    Science.gov (United States)

    Panyosak, A; Manosroi, J; Rojanasakul, Y; Manosroi, A

    2009-06-01

    The aim of this study was to determine the safety of azelaic acid (AA) and its derivatives in nanovesicles for pharmaceutical and cosmetic uses. The hydrophilic property of AA was modified by complexing AA with hydroxypropyl-beta-cyclodextrin (AACD). The lipophilic property of AA was improved to diethyl azelate (DA) by esterification with Fischer reaction. AA, AACD and DA were entrapped in liposomes and niosomes with the compositions of L-alpha-dipalmitoyl phosphatidylcholine/cholesterol = 7:3 and Tween 61/cholesterol = 1:1, respectively, by chloroform film method with sonication. The size of the vesicles ranged from 50 to 200 nm, indicating nanosize characteristics. The cytotoxicity of AA, AACD and DA entrapped nanovesicular formulations on mouse epidermal cell lines (JB6, normal cell lines) by the sulforhodamine B assay was modest when compared with cisplatin. Blank liposomes and niosomes gave no growth inhibitory effect. The irritation of AA, AACD and DA entrapped and not entrapped in nanovesicles on rabbit skin was examined according to the Environmental Protection Agency health effect test guidelines. The results showed no signs of erythema or edema within 72 h. AA and its derivatives were safe for topical use when entrapped in nanovesicles because of no toxicity to normal cell lines and no allergy on rabbit skin.

  3. Combination of azelaic acid 5% and erythromycin 2% in the treatment of acne vulgaris.

    Science.gov (United States)

    Pazoki-Toroudi, Hamidreza; Nassiri-Kashani, Mansour; Tabatabaie, Hossein; Ajami, Marjan; Habibey, Rouhollah; Shizarpour, Mohammad; Babakoohi, Shahab; Rahshenas, Makan; Firooz, Alireza

    2010-05-01

    Acne vulgaris is a common problem, particularly among adolescents, which is usually resistant to monotherapy. We evaluated the efficacy and safety of a combination of azelaic acid (AA) 5% and erythromycin 2% gel (AzE) compared with AA 20% or erythromycin 2% gels in facial acne vulgaris. We conducted a 12-week, multicenter, randomized double-blind study on 147 patients with mild-to-moderate acne vulgaris. Four treatment group were determined (placebo, erythromycin, AA and AzE) and followed in 4-week intervals for 12 weeks, except the placebo group which was changed to routine treatment after 4 weeks. The combination of AA 5% and erythromycin 2% gel significantly reduced the number of papules, pustules and comedones compared with placebo (p < 0.001), erythromycin 2% (p < 0.01) or AA 20% (p < 0.05). The incidence of adverse effects observed in patients treated with AzE (27%) was less than that with erythromycin 2% (54%) and AA 20% (45%). The combination of AA 5% and erythromycin 2% produced more potent therapeutic effects in comparison with erythromycin 2% or AA 20% alone, and with fewer side effects.

  4. Acetic acid in aged vinegar affects molecular targets for thrombus disease management.

    Science.gov (United States)

    Jing, Li; Yanyan, Zhang; Junfeng, Fan

    2015-08-01

    To elucidate the mechanism underlying the action of dietary vinegar on antithrombotic activity, acetic acid, the main acidic component of dietary vinegar, was used to determine antiplatelet and fibrinolytic activity. The results revealed that acetic acid significantly inhibits adenosine diphosphate (ADP)-, collagen-, thrombin-, and arachidonic acid (AA)-induced platelet aggregation. Acetic acid (2.00 mM) reduced AA-induced platelet aggregation to approximately 36.82 ± 1.31%, and vinegar (0.12 mL L(-1)) reduced the platelet aggregation induced by AA to 30.25 ± 1.34%. Further studies revealed that acetic acid exerts its effects by inhibiting cyclooxygenase-1 and the formation of thromboxane-A2. Organic acids including acetic acid, formic acid, lactic acid, citric acid, and malic acid also showed fibrinolytic activity; specifically, the fibrinolytic activity of acetic acid amounted to 1.866 IU urokinase per mL. Acetic acid exerted its fibrinolytic activity by activating plasminogen during fibrin crossing, thus leading to crosslinked fibrin degradation by the activated plasmin. These results suggest that organic acids in dietary vinegar play important roles in the prevention and cure of cardiovascular diseases.

  5. Amino acid metabolism during total parenteral nutrition in healthy volunteers: evaluation of a new amino acid solution.

    Science.gov (United States)

    Berard, M P; Hankard, R; Cynober, L

    2001-10-01

    The aim of this study was to determine the metabolism and the tolerance of a new amino acid (AA) solution administered under conditions mimicking cyclical parenteral nutrition (PN) in humans. Eight healthy volunteers received peripheral PN for 10 h providing 10.5 mg N x kg(-1) x h(-1) and 2.0 kcal x kg(-1) x h(-1) (glucose-to-lipids ratio: 70/30%). For adaptation, a non-protein energy intake was increased progressively for 90 min; thereafter, AA infusion was started and maintained at a constant rate for 10 h. Plasma and urine concentrations of all the AAs were measured before, during and after the PN. For each given AA, the relation between plasma variations at the steady-state and infusion rate, plasma clearance (Cl), renal clearance (Clr), re-absorption rate (Reab) and, retention rate (Reten) were determined. The nitrogen balance (DeltaN) was calculated during the PN period. The results are presented as means+/-sem. All plasma AA concentrations decreased during the starting period of non-protein energy intake. The plasma AA concentrations reached a steady-state within 3 h upon AA infusion, except for glycine and lysine (6 h). At the steady state, the plasma concentrations of the infused AAs were closely correlated to their infusion rate (y= -18.3+1.5x, r(2)=0.92). The plasma glutamine concentration was maintained during the PN, which indicates that the solution might stimulate the de novo synthesis of this AA. When the PN was stopped, plasma levels of the AAs decreased, most of them returning to their basal levels, or significantly below for lysine (Por= 99%, Reten >or=99% and for non-essential AAs: Cl or= 98% except glycine (95+/-1), aspartate (94+/-2) and histidine (94+/-1), Reten >or=97% except histidine (94+/-1), glycine (95+/-3). These results indicate that in healthy subjects, the amounts of AAs provided by the new solution were well balanced for an intravenous administration, and so were well utilized without excessive urinary excretion. The present study

  6. Meta-analysis of amino acid stable nitrogen isotope ratios for estimating trophic position in marine organisms.

    Science.gov (United States)

    Nielsen, Jens M; Popp, Brian N; Winder, Monika

    2015-07-01

    Estimating trophic structures is a common approach used to retrieve information regarding energy pathways, predation, and competition in complex ecosystems. The application of amino acid (AA) compound-specific nitrogen (N) isotope analysis (CSIA) is a relatively new method used to estimate trophic position (TP) and feeding relationships in diverse organisms. Here, we conducted the first meta-analysis of δ(15)N AA values from measurements of 359 marine species covering four trophic levels, and compared TP estimates from AA-CSIA to literature values derived from food items, gut or stomach content analysis. We tested whether the AA trophic enrichment factor (TEF), or the (15)N enrichment among different individual AAs is constant across trophic levels and whether inclusion of δ(15)N values from multiple AAs improves TP estimation. For the TEF of glutamic acid relative to phenylalanine (Phe) we found an average value of 6.6‰ across all taxa, which is significantly lower than the commonly applied 7.6‰. We found that organism feeding ecology influences TEF values of several trophic AAs relative to Phe, with significantly higher TEF values for herbivores compared to omnivores and carnivores, while TEF values were also significantly lower for animals excreting urea compared to ammonium. Based on the comparison of multiple model structures using the metadata of δ(15)N AA values we show that increasing the number of AAs in principle improves precision in TP estimation. This meta-analysis clarifies the advantages and limitations of using individual δ(15)N AA values as tools in trophic ecology and provides a guideline for the future application of AA-CSIA to food web studies.

  7. Gleaning unexpected fruits from hard-won synthetases: probing principles of permissivity in non-canonical amino acid-tRNA synthetases.

    Science.gov (United States)

    Cooley, Richard B; Karplus, P Andrew; Mehl, Ryan A

    2014-08-18

    The site-specific incorporation of non-canonical amino acids (ncAAs) into proteins is an important tool for understanding biological function. Traditionally, each new ncAA targeted for incorporation requires a resource-consuming process of generating new ncAA aminoacyl tRNA synthetase/tRNACUA pairs. However, the discovery that some tRNA synthetases are "permissive", in that they can incorporate multiple ncAAs, means that it is no longer always necessary to develop a new synthetase for each newly desired ncAA. Developing a better understanding of what factors make ncAA synthetases more permissive would increase the utility of this new approach. Here, we characterized two synthetases selected for the same ncAA that have markedly different "permissivity profiles." Remarkably, the more permissive synthetase incorporated an ncAA for which we had not been able to generate a synthetase through de novo selection methods. Crystal structures revealed that the two synthetases recognize their parent ncAA through a conserved core of interactions, with the more permissive synthetase displaying a greater degree of flexibility in its interaction geometries. We also observed that intraprotein interactions not directly involved in ncAA binding can play a crucial role in synthetase permissivity and suggest that optimization of such interactions might provide an avenue to engineering synthetases with enhanced permissivity. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. The effects of centrally injected arachidonic acid on respiratory system: Involvement of cyclooxygenase to thromboxane signaling pathway.

    Science.gov (United States)

    Erkan, Leman Gizem; Guvenc, Gokcen; Altinbas, Burcin; Niaz, Nasir; Yalcin, Murat

    2016-05-01

    Arachidonic acid (AA) is a polyunsaturated fatty acid that is present in the phospholipids of the cell membranes of the body and is abundant in the brain. Exogenously administered AA has been shown to affect brain metabolism and to exhibit cardiovascular and neuroendocrine actions. However, little is known regarding its respiratory actions and/or central mechanism of its respiratory effects. Therefore, the present study was designed to investigate the possible effects of centrally injected AA on respiratory system and the mediation of the central cyclooxygenase (COX) to thromboxane A2 (TXA2) signaling pathway on AA-induced respiratory effects in anaesthetized rats. Intracerebroventricular (i.c.v.) administration of AA induced dose- and time-dependent increase in tidal volume, respiratory rates and respiratory minute ventilation and also caused an increase in partial oxygen pressure (pO2) and decrease in partial carbon dioxide pressure (pCO2) in male anaesthetized Spraque Dawley rats. I.c.v. pretreatment with ibuprofen, a non-selective COX inhibitor, completely blocked the hyperventilation and blood gases changes induced by AA. In addition, central pretreatment with different doses of furegrelate, a TXA2 synthesis inhibitor, also partially prevented AA-evoked hyperventilation and blood gases effects. These data explicitly show that centrally administered AA induces hyperventilation with increasing pO2 and decreasing pCO2 levels which are mediated by the activation of central COX to TXA2 signaling pathway. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

    International Nuclear Information System (INIS)

    Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

    1986-01-01

    Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells

  10. Reframing Spirituality: AA, the 12 Steps, and the Mental Health Counselor.

    Science.gov (United States)

    Hanna, Fred J.

    1992-01-01

    Surveys literature and explores ways to understand spirituality in Alcoholics Anonymous (AA). Topics explored range from Jungian and Jamesian psychology, to Stoicism, the work of Bateson, and transpersonal psychology and therapy. Speculates that difficulty some mental health counselors have in accepting AA as therapy could be a result of…

  11. The Hidden Cost of Untreated Paragangliomas of the Head and Neck: Systemic Reactive (AA Amyloidosis

    Directory of Open Access Journals (Sweden)

    Erkan Dervisoglu

    2015-01-01

    Full Text Available We report a case of a 51-year-old man who was diagnosed with systemic reactive (AA amyloidosis in association with untreated glomus jugulare and glomus caroticum tumors. He refused radiotherapy and renal replacement therapy. Paragangliomas, although rare, should be considered one of the tumors that can result in AA amyloidosis.

  12. Is the presence of AA amyloidosis associated with impaired coronary flow reserve?

    Science.gov (United States)

    Bulut, Mustafa; Keles, Nursen; Caliskan, Zuhal; Kostek, Osman; Aksu, Feyza; Ozdil, Kamil; Akcakoyun, Mustafa; Demircioglu, Kenan; Yilmaz, Yusuf; Kanbay, Mehmet; Caliskan, Mustafa

    2016-08-01

    Systemic amyloid A protein (AA) amyloidosis may occur as a complication of many chronic inflammatory disorders. Patients receiving inadequate anti-inflammatory and immunosuppressive therapies have an increased risk of developing systemic AA amyloidosis. Inflammation plays a role in all stages and the thrombotic complications of atherosclerosis. In the absence of epicardial coronary stenosis, coronary flow reserve (CFR) reflects coronary microvascular dysfunction. In the present study, we hypothesized that amyloid advanced subclinical inflammation in chronic inflammatory diseases (CID) patients may further affect coronary microcirculation. Thirty-two patients with biopsy-diagnosed renal AA, 73 patients with non-amyloid CID, and a group of healthy volunteers were included in the study. The measurements of coronary flow velocity were performed by a single investigator with expertise in transthoracic Doppler harmonic echocardiography (TTDE). The AA amyloidosis subgroup had significantly lower CFR values than other non-amyloid CID patients and the control individuals (1.8 (1.5-2.1) vs. 2.1 (2.0-2.4) and 3.0 (2.8-3.2), p AA amyloidosis and elevated hs - CRP independently predict impairment of the CFR (p AA amyloidosis is related to decreased CFR values and the presence of AA amyloidosis and elevated hs - CRP independently predict impairment of the CFR. Therefore, patients with AA amyloidosis may have an increased risk of developing coronary artery diseases. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. A morphological study of filiform corrosive attack on cerated AA2024-T351 aluminium alloy

    NARCIS (Netherlands)

    Hughes, A.E.; Mol, J.M.C.; Hinton, B.R.W.; Zwaag, S. van der

    2005-01-01

    SEM and EDS studies were carried out to characterise filiform attack on a cerated AA2024- T351 aluminium alloy with a polyurethane topcoat. The filiforms developed on AA2024-T351 were sectioned, stripped of corrosion product and etched to reveal the grain structure. Examination of sections through

  14. Chang'aa Drinking in Kibera Slum: The Harmful Effects of ...

    African Journals Online (AJOL)

    Chang'aa Drinking in Kibera Slum: The Harmful Effects of Contemporary Changes in the Production and Consumption of Traditional Spirits. ... African Journal of Drug and Alcohol Studies ... This article examines the harmful effects of drinking chang'aa, an illegal spirit produced locally, in Kibera slum in Nairobi, Kenya.

  15. Co-deposition of basement membrane components during the induction of murine splenic AA amyloid

    DEFF Research Database (Denmark)

    Lyon, A W; Narindrasorasak, S; Young, I D

    1991-01-01

    Past studies have demonstrated that during murine AA amyloid induction there is co-deposition of the AA amyloid peptide and the basement membrane form of heparan sulfate proteoglycan. The synthesis and accumulation of heparan sulfate proteoglycan does not usually occur in the absence of other bas...

  16. Recovery and recrystallization in the superplastic deformation of AA5182

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Z.; Kazantzis, A.V.; De Hosson, J.T.M. [Department of Applied Physics, Netherlands Institute for Materials Research, University of Groningen (Netherlands)

    2008-04-15

    The coarse-grained Al alloy AA5182 exhibits poor superplasticity with a maximum elongation to failure not exceeding 220 % at 450 C and at 10{sup -2} s{sup -1}. The low values of the strain rate sensitivity indicate that the dislocation velocity is quite high and necking is developed quite soon during extension. The size (often exceeding 1 {mu}m) and the distribution of the precipitates render them incapable of pinning the subgrain boundaries efficiently. As a result recovery and reconstruction by grain refinement occurs only within the necking region where the applied stress is concentrated. A fabrication method which will be able to introduce a large number of submicron sized precipitates will most likely result in sufficient pinning of the subgrain boundaries. This will promote recovery and reconstruction to take place more uniformly in the material rendering it appreciably superplastic. (Abstract Copyright [2008], Wiley Periodicals, Inc.)

  17. The roles of the AAS Journals' Data Editors

    Science.gov (United States)

    Muench, August; NASA/SAO ADS, CERN/Zenodo.org, Harvard/CfA Wolbach Library

    2018-01-01

    I will summarize the community services provided by the AAS Journals' Data Editors to support authors’ when citing and preserving the software and data used in the published literature. In addition I will describe the life of a piece of code as it passes through the current workflows for software citation in astronomy. Using this “lifecycle” I will detail the ongoing work funded by a grant from the Alfred P. Sloan Foundation to the American Astronomical Society to improve the citation of software in the literature. The funded development team and advisory boards, made up of non-profit publishers, literature indexers, and preservation archives, is implementing the Force11 Software citation principles for astronomy Journals. The outcome of this work will be new workflows for authors and developers that fit in their current practices while enabling versioned citation of software and granular credit for its creators.

  18. AA, radiation shielding curtain along the target area

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    At the far left is the beam tube for the high-intensity proton beam from the 26 GeV PS. The tube ends in a thin window and the proton beam continues in air through a hole in the shielding blocks (see also 8010308), behind which the target (see 7905091, 7905094)was located. After the target followed the magnetic horn, focusing the antiprotons, and the first part of the injection line with a proton dump. The antiprotons, deflected by a magnet, left the target area through another shielding wall, to make their way to the AA ring. Laterally, this sequence of components was shielded with movable, suspended, concrete blocks: the "curtain". Balasz Szeless, who had constructed it, is standing at its side.

  19. Ultrasonic inspection of AA6013 laser welded joints

    Directory of Open Access Journals (Sweden)

    Adriano Passini

    2011-09-01

    Full Text Available Interest in laser beam welding for aerospace applications is continuously growing, mainly for aluminum alloys. The joints quality is usually assessed by non-destructive inspection (NDI. In this work, bead on plate laser welds on 1.6 mm thick AA6013 alloy sheets, using a 2 kW Yb-fiber laser were obtained and inspected by pulse/echo ultrasonic phased-array technique. Good and poor quality welds were inspected in order to verify the limits of inspection, comparing also to X-ray radiography and metallographic inspections. The results showed that ultrasonic phased array technique was able to identify the presence of grouped porosity, through the attenuation of the amplitude of the echo signal. This attenuation is attributed to the scattering of the waves caused by micro pores, with individual size below the resolution limit of the equipment, but when grouped, can cause a perceptive effect on the reflection spectra.

  20. Newer trace elements measured by RNAA and AAS

    International Nuclear Information System (INIS)

    Gharib, A.G.

    2004-01-01

    Very recently, quite attention has been made on a few more trace elements in foodstuff as essential for animal and human health in certain ranges of concentration or intake. These traces are: aluminum, nickel, vanadium and tin. Al and Ni have been measured by atomic absorption spectroscopy (AAS), and the two latter ones measured by radiochemical neutron activation analysis (RNAA) in few references laboratories. Here, scandium was also analysed by instrumental neutron activation analysis (INAA). These measurements were made for the most of the Iranian diets and other participant countries' diets under the framework of a co-ordinated research project (CRP) of the IAEA during the period 1986-1994, but practically it took more years. Here in this work the daily dietary intakes of above mentioned trace elements are given and discussed while the results of 20 other nutritionally important trace elements appeared somewhere else. (author)

  1. Antinociceptive Activities and the Mechanisms of Anti-Inflammation of Asiatic Acid in Mice

    Directory of Open Access Journals (Sweden)

    Shyh-Shyun Huang

    2011-01-01

    Full Text Available Asiatic acid (AA, a pentacyclic triterpene compound in the medicinal plant Centella asiatica, was evaluated for antinociceptive and anti-inflammatory effects. Treatment of male ICR mice with AA significantly inhibited the numbers of acetic acid-induced writhing responses and the formalin-induced pain in the late phase. In the anti-inflammatory test, AA decreased the paw edema at the 4th and 5th h after λ-carrageenan (Carr administration and increased the activities of catalase (CAT, superoxide dismutase (SOD, and glutathione peroxidase (GPx in the liver tissue. AA decreased the nitric oxide (NO, tumor necrosis factor-α (TNF-α, and interleukin-1β (IL-1β levels on serum level at the 5th h after Carr injection. Western blotting revealed that AA decreased Carr-induced inducible nitric oxide synthase (iNOS, cyclooxygenase (COX-2, and nuclear factor-κB (NF-κB expressions at the 5th h in the edema paw. An intraperitoneal (i.p. injection treatment with AA also diminished neutrophil infiltration into sites of inflammation as did indomethacin (Indo. The anti-inflammatory mechanisms of AA might be related to the decrease in the level of MDA, iNOS, COX-2, and NF-κB in the edema paw via increasing the activities of CAT, SOD, and GPx in the liver.

  2. Commensal bacteria and essential amino acids control food choice behavior and reproduction.

    Science.gov (United States)

    Leitão-Gonçalves, Ricardo; Carvalho-Santos, Zita; Francisco, Ana Patrícia; Fioreze, Gabriela Tondolo; Anjos, Margarida; Baltazar, Célia; Elias, Ana Paula; Itskov, Pavel M; Piper, Matthew D W; Ribeiro, Carlos

    2017-04-01

    Choosing the right nutrients to consume is essential to health and wellbeing across species. However, the factors that influence these decisions are poorly understood. This is particularly true for dietary proteins, which are important determinants of lifespan and reproduction. We show that in Drosophila melanogaster, essential amino acids (eAAs) and the concerted action of the commensal bacteria Acetobacter pomorum and Lactobacilli are critical modulators of food choice. Using a chemically defined diet, we show that the absence of any single eAA from the diet is sufficient to elicit specific appetites for amino acid (AA)-rich food. Furthermore, commensal bacteria buffer the animal from the lack of dietary eAAs: both increased yeast appetite and decreased reproduction induced by eAA deprivation are rescued by the presence of commensals. Surprisingly, these effects do not seem to be due to changes in AA titers, suggesting that gut bacteria act through a different mechanism to change behavior and reproduction. Thus, eAAs and commensal bacteria are potent modulators of feeding decisions and reproductive output. This demonstrates how the interaction of specific nutrients with the microbiome can shape behavioral decisions and life history traits.

  3. An Update on the AAS Astronomy Ambassadors Program

    Science.gov (United States)

    Fienberg, Richard T.; Gurton, S.; Fraknoi, A.; Prather, E. E.; Hurst, A.; Schatz, D. L.

    2013-06-01

    The American Astronomical Society, partnering with organizations active in science education and public outreach (EPO), has launched a series of professional-development workshops and a community of practice designed to help improve early-career astronomers’ ability to effectively communicate with students and the public. Called Astronomy Ambassadors, the program provides mentoring and training experiences for young astronomers, from advanced undergraduates to beginning faculty; it also provides access to resources and a network of contacts within the astronomy EPO community. By learning how to implement effective education and outreach strategies, Astronomy Ambassadors become better teachers, better presenters at meetings, and better representatives of our science to the public and to government. And because young astronomers are a more diverse group than those who currently do the majority of outreach, they help the astronomical community present a more multicultural and gender-balanced face to the public, enabling members of underserved groups to see themselves as scientists. Ambassadors are provided with a large library of outreach activities and materials that are suitable for a range of venues and audiences and that will grow with time. For much of this library we are using resources developed by organizations such as the Astronomical Society of the Pacific, the Pacific Science Center, and the Center for Astronomy Education for other outreach programs, though some resources have been created by one of us (AF) specifically for this program. The first Astronomy Ambassadors workshop was held at the 221st meeting of the AAS in January 2013 and served 30 young astronomers chosen from more than 75 applicants. Incorporating feedback from workshop participants and lessons learned from the reports they’ve submitted after conducting their own outreach events, we are now planning the second annual workshop to be held 4-5 January 2014 at the 223rd AAS meeting in

  4. Effect of laser-arc hybrid welding on fracture and corrosion behaviour of AA6061-T6 alloy

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Daquan, E-mail: zhdq@sh163.net [Department of Environmental Engineering, Shanghai University of Electric Power, Shanghai 200090 (China); Jin Xin; Gao Lixin [Department of Environmental Engineering, Shanghai University of Electric Power, Shanghai 200090 (China); Joo, Hyung Goun [Stress Analysis and Failure Design Laboratory, School of Mechanical Engineering, Yonsei University, Seoul 120-749 (Korea, Republic of); Lee, Kang Yong, E-mail: KYL2813@yonsei.ac.kr [Stress Analysis and Failure Design Laboratory, School of Mechanical Engineering, Yonsei University, Seoul 120-749 (Korea, Republic of)

    2011-03-15

    Research highlights: {yields} A dendritic cellular structure was formed in the weld fusion zone (WFZ) and caused alloying element segregation. {yields} The precipitation of intermetallic phases and the formation of galvanic corrosion couplings contribute to the improving pitting susceptibility in the WFZ. {yields} The intergranular corrosion nucleates on pit walls and spreads from them. - Abstract: The welding condition of the hybrid laser-gas metal arc (GMA) welding for AA6061-T6 alloy was optimized by tensile test. Formability performance was checked by the bend test. Fractographic analysis indicates a large number of fine ductile type voids in the fracture surface. The microstructure measurements exhibit a dendritic cellular structure in the weld fusion zone (WFZ) and a partially melted zone adjacent to the fusion boundaries. The corrosion behaviour of the weldment and the base alloy were investigated by weight-loss test in nitric acid solution. The WFZ suffers more severe pitting than the rest regions in the weldment. It shows that corrosion cracking is owing to the precipitation of intermetallic phases and the formation of galvanic corrosion couplings in the weldment of AA6061-T6 alloy.

  5. Shear Resistance Properties of Modified Nano-SiO2/AA/AM Copolymer Oil Displacement Agent

    Directory of Open Access Journals (Sweden)

    Nanjun Lai

    2016-12-01

    Full Text Available To address the problem regarding poor shear resistance of commonly employed polymers for oil displacement, modified nano-SiO2/AA/AM copolymer (HPMNS oil displacement agents were synthesized using acrylic acid (AA, acrylamide (AM, and modified nano-SiO2 of different modification degrees as raw materials. HPMNS was characterized by means of infrared spectroscopy (IR, nuclear magnetic resonance (1H-NMR, 13C-NMR, dynamic/static light scattering, and scanning electron microscope. A comparative study of the shear resistance properties for partially hydrolyzed polyacrylamide (HPAM and HPMNS was conducted. Compared to HPAM, the introduced hyperbranched structure endowed HPMNS with good shear resistance, which was quantified from the viscosity retention ratio of the polymer solutions. From the perspective of rheological property, HPMNS also showed great shear stability after shearing by a Mixing Speed Governor and porous media shear model. Furthermore, with a higher degree of modification, HPMNS-2 had better shear stability in terms of viscosity and rheological property than HPMNS-1. The phenomena were due to its lower hydrodynamic radius, weight-average molecular weight, and better flexibility of its molecular chains. In addition, upon the indoor displacement test, the resistance factor and residual resistance factor values of HPMNS-2 were higher than those of HPAM. This behavior is beneficial for increasing oil recovery.

  6. Changing epidemiology of AA amyloidosis: clinical observations over 25 years at a single national referral centre.

    Science.gov (United States)

    Lane, Thirusha; Pinney, Jennifer H; Gilbertson, Janet A; Hutt, David F; Rowczenio, Dorota M; Mahmood, Shameem; Sachchithanantham, Sajitha; Fontana, Marianna; Youngstein, Taryn; Quarta, Candida C; Wechalekar, Ashutosh D; Gillmore, Julian D; Hawkins, Philip N; Lachmann, Helen J

    2017-09-01

    Systemic AA amyloidosis is a serious complication of chronic inflammation; however, there are relatively few published data on its incidence. We investigated the changing epidemiology of AA amyloidosis over a 25-year period at a single national referral centre. We conducted a retrospective study of all patients diagnosed with AA amyloidosis who had attended the centre between 1990 and 2014 inclusive. Six hundred and twenty-five patients were studied in three cohorts: C1: 1990-1997; C2: 1998-2006; C3: 2007-2014. Mean age at presentation increased from 46 in C1 to 56 in C3 (p AA amyloidosis over a quarter of a century, reflecting advances in therapeutics and overall management of complex chronic disease in an ageing population. AA amyloidosis of uncertain aetiology presents an emerging major problem. Newer techniques such as next-generation sequencing may aid diagnosis and effective treatment, thereby improving overall survival.

  7. Dabigatran and rivaroxaban do not affect AA- and ADP-induced platelet aggregation in patients receiving concomitant platelet inhibitors.

    Science.gov (United States)

    Olivier, Christoph B; Weik, Patrick; Meyer, Melanie; Weber, Susanne; Diehl, Philipp; Bode, Christoph; Moser, Martin; Zhou, Qian

    2016-08-01

    Dabigatran and rivaroxaban are novel, vitamin K-independent oral anticoagulants (NOACs) and act via antagonism of the coagulation factor (F) IIa (dabigatran) or FXa (rivaroxaban), respectively. Compared to vitamin-K-antagonists, NOACs have shown non-inferiority of risk and benefit in patients with non valvular atrial fibrillation (AF). In clinical practice there is increasing use of NOACs combined with platelet inhibitors in patients with AF and coronary artery disease. However, whether NOACs affect the function of platelet inhibitors remains incompletely known. This observational study aimed to assess the platelet function in patients receiving dabigatran or rivaroxaban and concomitant platelet inhibitors. A single centre observational study was performed analysing the platelet aggregation of patients treated with dabigatran or rivaroxaban with or without concomitant platelet inhibitors. Measurements before the initiation of NOAC therapy served as the respective control group. Platelet aggregation was measured by multiple electrode aggregometry and was induced with adenosine diphosphate (ADP, 6.5 µM) and arachidonic acid (AA, 0.5 mM), respectively. In order to evaluate whether NOACs interact with platelet inhibition by ASA or the P2Y12-antagonist clopidogrel, 87 patients were grouped according to their concomitant antiplatelet medication. Comparing the ADP- and AA-induced platelet aggregation in patients without concomitant platelet inhibitors (n = 45) no significant differences under therapy with dabigatran (d) or rivaroxaban (r) compared to the control group (c) were observed. In patients taking clopidogrel as a concomitant platelet inhibitor (n = 21), neither dabigatran nor rivaroxaban affected the ADP-induced platelet aggregation (c 20 ± 11, d 21 ± 14, r 18 ± 8 AU*min, p = 0.200). Patients receiving dabigatran or rivaroxaban in combination with ASA (n = 42; 21 ASA only, 21 ASA + clopidogrel) showed no significant differences of the AA

  8. Inhibition of carbon steel corrosion by 11-aminoundecanoic acid

    Directory of Open Access Journals (Sweden)

    Saad Ghareba

    2015-12-01

    Full Text Available The current study reports results on the investigation of the possibility of using 11-aminoundecanoic acid (AA as an inhibitor of general corrosion of carbon steel (CS in HCl under a range of experimental conditions: inhibitor concentration, exposure time, electrolyte temperature and pH and CS surface roughness. It was found that AA acts as a mixed-type inhibitor, yielding maximum inhibition efficiency of 97 %. The adsorption of AA onto the CS surface was described by the Langmuir adsorption isotherm. The corresponding apparent Gibbs free energy of AA adsorption on CS at 295 K was calculated to be −30.2 kJ mol–1. The adsorption process was found to be driven by a positive change in entropy of the system. PM-IRRAS measurements revealed that the adsorbed AA layer is amorphous, which can be attributed to the repulsion between the neighboring positively charged amine groups and a high heterogeneity of the CS surface. It was also found that the AA provides very good corrosion protection of CS of various surface roughness, and over a prolonged time.

  9. Arachidonic acid metabolism in silica-stimulated bovine alveolar macrophages

    International Nuclear Information System (INIS)

    Englen, M.D.

    1989-01-01

    The in vitro production of arachidonic acid (AA) metabolites in adherent bovine alveolar macrophages (BAM) incubated with silica was investigated. BAM were pre-labelled with 3 H-AA, and lipid metabolites released into the culture medium were analyzed by high performance liquid chromatography (HPLC). Lactate dehydrogenase (LDH) release was simultaneously assayed to provide an indication of cell injury. Increasing doses of silica selectively stimulated the 5-lipoxygenase pathway of AA metabolism, while cyclooxygenase metabolite output was suppressed. LDH release increased in a linear, dose-dependent fashion over the range of silica doses used. Moreover, within 15 min following addition of a high silica dose, a shift to the production of 5-lipoxygenase metabolites occurred, accompanied by a reduction in cyclooxygenase products. This rapid alteration in AA metabolism preceded cell injury. To examine the relationship between cytotoxicity and AA metabolite release by BAM exposed to silicas with different cytotoxic and fibrogenic activities, BAM were exposed to different doses of DQ-12, Minusil-5, and Sigma silicas, and carbonyl iron beads. The median effective dose (ED 50 ) of each particulate to stimulate the release of AA metabolites and LDH was calculated. The ED 50 values for DQ-12, Minusil-5, and Sigma silica showed that the relative cytotoxicities of the different silicas for BAM corresponded to the relative potencies of the silicas to elicit 5-lipoxygenase metabolites from BAM. These results indicate that the cytotoxic, and presumed fibrogenic potential, of a silica is correlated with the potency to stimulate the release of leukotrienes from AM

  10. A study of new and more sustainable catalytic routes for the synthesis of adipic acid

    OpenAIRE

    Rozhko, Elena

    2014-01-01

    The aim of my PhD research project was to investigate new and more sustainable routes, compared to those currently used, for the production of adipic acid (AA). AA is a very important chemical intermediate. The main use of AA is the production of Nylon-6,6 fibers, resins, polyesters, plasticizers. My project was divided into two parts: 1. The two-step oxidation of cyclohexene, where the latter is first oxidized into trans-1,2-cyclohexanediol (CHD) with aqueous hydrogen peroxide, and the...

  11. Long-term prognosis of AL and AA renal amyloidosis: a Japanese single-center experience.

    Science.gov (United States)

    Ozawa, Masatoyo; Komatsuda, Atsushi; Ohtani, Hiroshi; Nara, Mizuho; Sato, Ryuta; Togashi, Masaru; Takahashi, Naoto; Wakui, Hideki

    2017-04-01

    Few studies have been conducted on the long-term prognosis of patients with amyloid light chain (AL) and amyloid A (AA) renal amyloidosis in the same cohort. We retrospectively examined 68 patients with biopsy-proven renal amyloidosis (38 AL and 30 AA). Clinicopathological findings at the diagnosis and follow-up data were evaluated in each patient. We analyzed the relationship between clinicopathological parameters and survival data. Significant differences were observed in several clinicopathological features, such as proteinuria levels, between the AL and AA groups. Among all patients, 84.2 % of the AL group and 93.3 % of the AA group received treatments for the underlying diseases of amyloidosis. During the follow-up period (median 18 months in AL and 61 months in AA), 36.8 % of the AL group and 36.7 % of the AA group developed end-stage renal failure requiring dialysis, while 71.1 % of the AL group and 56.7 % of the AA group died. Patient and renal survivals were significantly longer in the AA group than in the AL group. eGFR of >60 mL/min/1.73 m 2 at biopsy and an early histological stage of glomerular amyloid deposition were identified as low-risk factors. A multivariate analysis showed that cardiac amyloidosis and steroid therapy significantly influenced patient and renal survivals. Our results showed that heart involvement was the major predictor of poor outcomes in renal amyloidosis, and that the prognosis of AA renal amyloidosis was markedly better than that in previously reported cohorts. Therapeutic advances in inflammatory diseases are expected to improve the prognosis of AA amyloidosis.

  12. Orally Administrated Ascorbic Acid Suppresses Neuronal Damage and Modifies Expression of SVCT2 and GLUT1 in the Brain of Diabetic Rats with Cerebral Ischemia-Reperfusion

    Directory of Open Access Journals (Sweden)

    Naohiro Iwata

    2014-04-01

    Full Text Available Diabetes mellitus is known to exacerbate cerebral ischemic injury. In the present study, we investigated antiapoptotic and anti-inflammatory effects of oral supplementation of ascorbic acid (AA on cerebral injury caused by middle cerebral artery occlusion and reperfusion (MCAO/Re in rats with streptozotocin-induced diabetes. We also evaluated the effects of AA on expression of sodium-dependent vitamin C transporter 2 (SVCT2 and glucose transporter 1 (GLUT1 after MCAO/Re in the brain. The diabetic state markedly aggravated MCAO/Re-induced cerebral damage, as assessed by infarct volume and edema. Pretreatment with AA (100 mg/kg, p.o. for two weeks significantly suppressed the exacerbation of damage in the brain of diabetic rats. AA also suppressed the production of superoxide radical, activation of caspase-3, and expression of proinflammatory cytokines (tumor necrosis factor-α and interleukin-1β in the ischemic penumbra. Immunohistochemical staining revealed that expression of SVCT2 was upregulated primarily in neurons and capillary endothelial cells after MCAO/Re in the nondiabetic cortex, accompanied by an increase in total AA (AA + dehydroascorbic acid in the tissue, and that these responses were suppressed in the diabetic rats. AA supplementation to the diabetic rats restored these responses to the levels of the nondiabetic rats. Furthermore, AA markedly upregulated the basal expression of GLUT1 in endothelial cells of nondiabetic and diabetic cortex, which did not affect total AA levels in the cortex. These results suggest that daily intake of AA attenuates the exacerbation of cerebral ischemic injury in a diabetic state, which may be attributed to anti-apoptotic and anti-inflammatory effects via the improvement of augmented oxidative stress in the brain. AA supplementation may protect endothelial function against the exacerbated ischemic oxidative injury in the diabetic state and improve AA transport through SVCT2 in the cortex.

  13. Compound-specific amino acid δ15 N values in archaeological shell: Assessing diagenetic integrity and potential for isotopic baseline reconstruction.

    Science.gov (United States)

    Misarti, Nicole; Gier, Elizabeth; Finney, Bruce; Barnes, Kelli; McCarthy, Matthew

    2017-11-30

    Reconstructing stable isotope (SI) ratios at the base of paleo-food webs is often challenging. For coastal systems, the SI ratios of organic matter in archeological shell represents a possible solution, providing a direct record of primary consumer SI ratios in the littoral zone. However, shell is often porous, with organic compounds susceptible to diagenetic alteration or contamination. If molecular isotopic information is well preserved, compound-specific amino acid isotope analysis (CSI-AA) has the potential to provide direct proxies for baseline SI ratios, bypassing many contamination issues, and to allow assessment of the diagenetic state. We collected shell from both archeological middens and nearby littoral zones in coastal Alaska, and used a simple organic extraction approach based on decalcification with sequential weak HCl additions to liberate organic material. We measured CSI-AA patterns, molar AA distributions, and the CSI-AA degradation parameter (ΣV), in the context of bulk SI ratios in fossil shell, modern shell, and soft tissue from five common taxa (urchin, limpet, mussel, periwinkle, chiton). CSI-AA patterns in both soft tissue and shell were consistent with primary consumers, and were indistinguishable in most modern and fossil shell pairs, showing that amino acid δ 15 N values can be well preserved in archeological shell. AA molar distributions were also similar, although most fossil shell was enriched in Asx and Gly. Comparison between CSI-AA results from modern specimens confirmed that the source AA group (tracking isotopic baselines) are transferred without substantial modification into the shell record. In contrast, the Trophic AA group had elevated δ 15 N values in shell versus soft tissue for all taxa examined, suggesting that a correction factor will be required for any CSI-AA proxies using these AAs. Overall, this new data indicates that the CSI-AA analysis of fossil shell represents a promising new approach to determining isotopic

  14. The determination of arsenic, selenium, antimony, and tin in complex environmental samples by hydride generation AAS

    International Nuclear Information System (INIS)

    Johnson, D.; Beach, C.

    1990-01-01

    Hydride generation techniques are used routinely for the determination of As, Se, Sb and Sn in water samples. Advantages include high sensitivity, simplicity, and relative freedom from interferences. Continuous-flow designs greatly reduce analysis time as well as improve precision and allow for automation. However the accurate analysis of more complex environmental samples such as industrial sludges, soil samples, river sediments, and fly ash remains difficult. Numerous contributing factors influence the accuracy of the hydride technique. Sample digestion methods and sample preparation procedures are of critical importance. The digestion must adequately solubilize the elements of interest without loss by volatilization. Sample preparation procedures that guarantee the proper analyte oxidation state and eliminate the nitric acid and inter-element interferences are needed. In this study, difficult environmental samples were analyzed for As, Se, Sb, and Sn by continuous flow hydride generation. Sample preparation methods were optimized to eliminate interferences. The results of spike recovery studies will be presented. Data from the analysis of the same samples by graphite furnace AAS will be presented for comparison of accuracy, precision, and analysis time

  15. Helical 1:1 α/Sulfono-γ-AA Heterogeneous Peptides with Antibacterial Activity

    Energy Technology Data Exchange (ETDEWEB)

    She, Fengyu; Nimmagadda, Alekhya; Teng, Peng; Su, Ma; Zuo, Xiaobing; Cai, Jianfeng

    2016-05-09

    As one of the greatest threats facing in 21st century, antibiotic resistance is now a major public health concern. Host-defense peptides (HDPs) offer an alternative approach to combat emerging multidrug-resistant bacteria. It is known that helical HDPs such as magainin 2 and its analogs adopt cationic amphipathic conformations upon interaction with bacterial membranes, leading to membrane disruption and subsequent bacterial cell death. We have previously shown that amphipathic sulfono-γ-AApeptides could mimic magainin 2 and exhibit bactericidal activity. In this article, we demonstrate for the first time that amphipathic helical 1:1 α/sulfono-γ-AA heterogeneous peptides, in which regular amino acids and sulfono-γ-AApeptide building blocks are alternatively present in a 1:1 pattern, display potent antibacterial activity against both Gram-positive and Gram-negative bacterial pathogens. Small Angle X-ray Scattering (SAXS) suggests that the lead sequences adopt defined helical structures. The subsequent studies including 2 fluorescence microscopy and time-kill experiments indicate that these hybrid peptides exert antimicrobial activity by mimicking the mechanism of HDPs. Our findings may lead to the development of HDP-mimicking antimicrobial peptidomimetics that combat drug-resistant bacterial pathogens. In addition, our results also demonstrate the effective design of a new class of helical foldamer, which could be employed to interrogate other important biological targets such as protein-protein interactions in the future.

  16. Removal of some most hazardous cationic dyes using novel poly (NIPAAm/AA/N-allylisatin nanohydrogel

    Directory of Open Access Journals (Sweden)

    Viran P. Mahida

    2016-05-01

    Full Text Available Synthesis of nanoparticles by microemulsion method is an interesting research area of current years. By accepting this opinion, N-isopropylacrylamide was polymerized with different amounts of acrylic acid (AA and N-allylisatin using aerosol (AOT as a surfactant, ethylene glycol dimethacrylate (EGDMA as a cross linker and 2,2′-azobisisobuteronitrile (AIBN as a surface active initiator. The chemical structure of nanohydrogel was characterized by FT-IR, DSC and TGA analysis. SEM photographs demonstrate the surface morphology of nanohydrogel before and after the dye adsorption. TEM micrographs confirm the particle size distribution in the range between 5 and 10 nm. Specific surface area and pore volume of the synthesized nanohydrogel were determined by BET and BJH analysis. The nanohydrogels were used in experiments on swelling behavior and adsorption of some water-soluble cationic dyes such as Methylene Blue (BB-9, Auramine O (BY-2 and Chrysoidine G (BO-2. Furthermore, the Langmuir and Freundlich adsorption isotherm models were applied which showed a favorable adsorption. From the results, removal of dyes within the nanohydrogel increased in the following order: BB-9 > BY-2 > BO-2.

  17. Effect of temperature on the anodizing process of aluminum alloy AA 5052

    Science.gov (United States)

    Theohari, S.; Kontogeorgou, Ch.

    2013-11-01

    The effect of temperature (10-40 °C) during the anodizing process of AA 5052 for 40 min in 175 g/L sulfuric acid solution at constant voltage (15 V) was studied in comparison with pure aluminum. The incorporated magnesium species in the barrier layer result in the further increase of the minimum current density passed during anodizing, as the temperature increases, by about 42% up to 30 °C and then by 12% up to 40 °C. Then during the anodizing process for 40 min a blocking effect on oxide film growth was gradually observed as the temperature increased until 30 °C. The results of EDAX analysis on thick films reveal that the mean amount of the magnesium species inside the film is about 50-70% less than that in the bulk alloy, while it is higher at certain locations adjacent to the film surface at 30 °C. The increase of anodizing temperature does not influence the porosity of thin films (formed for short times) on pure aluminum, while it reduces it on the alloy. At 40 °C the above mentioned blocking effects disappear. It means that the presence of magnesium species causes an impediment to the effect of temperature on iss, on the film thickness and on the porosity of thin films, only under conditions where film growth takes place without significant loss of the anodizing charge to side reactions.

  18. Titanium conversion coatings on the aluminum foil AA 8021 used for lithium-ion battery package

    Science.gov (United States)

    Xia, Xu-Feng; Gu, Ying-Ying; Xu, Shi-Ai

    2017-10-01

    In this study, an environment-friendly titanium (Ti) conversion coating was successfully deposited on the aluminum foil AA 8021 in the solution containing hexafluorotitanic acid (H2TiF6), and its morphology, composition, growth process, hydrophilicity and corrosion resistance were characterized by scanning electron microscopy (SEM), atomic force microscopy (AFM), energy dispersive spectroscopy (EDS), X-ray photoelectric spectroscopy (XPS), contact-angle measurements (CAM) and salt spray exposure. The peeling strength between the Ti treated Al foil and the modified polypropylene (PP) film (PP grafted with maleic anhydride, PP-g-MAH) (Al/PP-g-MAH) was measured by T-peeling test. The results show that the Ti conversion coating is a multi-component coating composed primarily of metal oxides (TiO2 and Al2O3) and metal fluoride (AlF3). Ti treated Al foil shows better corrosion resistance than untreated and alkali-cleaned Al foils. The peeling strength of PP-g-MAH film with Ti treated Al foils is approximately 30 times higher than that with untreated Al foils. Thus, Ti treatment is a promising approach to improve the corrosion resistance and peeling strength of aluminum/polymer composite film (Al/P) used in the lithium-ion battery package.

  19. Characterization of AA7050 aluminium alloy processed by ECAP; Caracterizacao da liga de aluminio AA7050 processada por ECAP

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, K.R.; Guido, V. [Universidade do Vale do Paraiba (UNIVAP), Sao Jose dos Campos, SP (Brazil). Inst. de Pesquisa e Desenvolvimento; Travessa, D.N. [Empresa Brasileira de Aeronautica (EMBRAER), Sao Jose dos Campos, SP (Brazil); Jorge Junior, A.M. [Universidade Federal de Sao Carlos (DEMa/UFSCar), SP (Brazil). Dept. de Engenharia de Materiais

    2010-07-01

    The commercial AA7050 aluminium alloy in the solution heat treated condition (W) was processed by ECAP through route A. Two pressing temperatures (room and 150 deg C and velocities (5 and 30mm/min) were used, as well as different number of passes. The effect of such variables on the microstructure evolution was evaluated using optical and transmission electron microscopy with EDX microanalysis, and xray diffraction. It was found that the microstructure has been refined by ECAP, as a result of subgrains formed within deformation bands. ECAP at 150 deg C resulted in intense precipitation of plate like {eta} phase, which evolves to equiaxial morphology as the number of passes increases. (author)

  20. Improvement of 2-O-α-D-Glucopyranosyl-L-Ascorbic Acid ...

    African Journals Online (AJOL)

    Purpose: To improve 2-O-α-D-glucopyranosyl-L-ascorbic acid (AA-2G) production using ultrasonic radiation (UR) treatment. Methods: The production of AA-2G using UR or ultrasonic radiation with shaking (URS) at 150 rpm, at varying power (100 − 500 W), temperature (30 – 65 °C), pH 4.0 −9.0, and time (2−24 h) was ...

  1. A new model to study the role of arachidonic acid in colon cancer pathophysiology

    OpenAIRE

    Fan, Yang-Yi; Callaway, Evelyn; Monk, Jennifer M.; Goldsby, Jennifer S.; Yang, Peiying; Vincent, Logan; Chapkin, Robert S.

    2016-01-01

    A significant increase in cyclooxygenase 2 (COX2) gene expression has been shown to promote cylcooxygenase-dependent colon cancer development. Controversy associated with the role of COX2 inhibitors indicates that additional work is needed to elucidate the effects of arachidonic acid (AA) derived (cyclooxygenase and lipoxygenase) eicosanoids in cancer initiation, progression and metastasis. We have recently developed a novel Fads1 knockout mouse model, which allows for the investigation of AA...

  2. 76 FR 6794 - 30-Day Submission Period for Requests for ONC-Approved Accreditor (ONC-AA) Status

    Science.gov (United States)

    2011-02-08

    ... HUMAN SERVICES 30-Day Submission Period for Requests for ONC-Approved Accreditor (ONC-AA) Status AGENCY... ONC-Approved Accreditor (ONC-AA) status. Authority: 42 U.S.C. 300jj-11. DATES: The 30-day submission... a notice in the Federal Register to announce the 30-day period during which requests for ONC-AA...

  3. Amino acid fortified diets for weanling pigs replacing fish meal and whey protein concentrate: Effects on growth, immune status, and gut health.

    Science.gov (United States)

    Zhao, Yan; Weaver, Alexandra C; Fellner, Vivek; Payne, Robert L; Kim, Sung Woo

    2014-01-01

    Limited availability of fish meal and whey protein concentrate increases overall feed costs. Availability of increased number of supplemental amino acids including Lys, Met, Thr, Trp, Val, and Ile allows replacing expensive protein supplements to reduce feed costs. This study was to evaluate the effect of replacing fish meal and/or whey protein concentrate in nursery diets with 6 supplemental amino acids on growth performance and gut health of post-weaning pigs. Treatments were 1) FM-WPC: diet with fish meal (FM) and whey protein concentrate (WPC); 2) FM-AA: diet with FM and crystalline amino acids (L-Lys, L-Thr, L-Trp, DL-Met, L-Val, and L-Ile); 3) WPC-AA: diet with WPC and crystalline amino acid; and 4) AA: diet with crystalline amino acid. Pigs in FM-AA, WPC-AA, and AA had greater (P replace fish meal and/or whey protein concentrate without adverse effects on growth performance, immune status, and gut health of pigs at d 21 to 49 of age. Positive response with the use of 6 supplemental amino acids in growth during the first week of post-weaning may due to increased plasma insulin potentially improving uptake of nutrients for protein synthesis and energy utilization. The replacement of fish meal and/or whey protein concentrate with 6 supplemental amino acids could decrease the crude protein level in nursery diets, and potentially lead to substantial cost savings in expensive nursery diets.

  4. Synthesis of organic/inorganic hybrid gel with acid activated clay after γ-ray radiation.

    Science.gov (United States)

    Kim, Donghyun; Lee, Hoik; Sohn, Daewon

    2014-08-01

    A hybrid gel was prepared from acid activated clay (AA clay) and acrylic acid by gamma ray irradiation. Irradiated inorganic particles which have peroxide groups act as initiator because it generates oxide radicals by increasing temperature. Inorganic nanoparticles which are rigid part in hybrid gel also contribute to increase the mechanical property as a crosslinker. We prepared two hybrid gels to compare the effect of acid activated treatment of clay; one is synthesized with raw clay particles and another is synthesized with AA clay particles. The composition and structure of AA clay particles and raw clay particles were confirmed by X-ray diffraction (XRD), X-ray fluorescence instrument and surface area analyzer. And chemical and physical property of hybrid gel with different ratios of acrylic acid and clay particle was tested by Raman spectroscope and universal testing machine (UTM). The synthesized hydrogel with 76% gel contents can elongated approximately 1000% of its original size.

  5. Analysing the influence of FSP process parameters on IGC susceptibility of AA5083 using Sugeno – Fuzzy model

    Science.gov (United States)

    Jayakarthick, C.; Povendhan, A. P.; Vaira Vignesh, R.; Padmanaban, R.

    2018-02-01

    Aluminium alloy AA5083 was friction stir processed to improve the intergranular corrosion (IGC) resistance. FSP trials were performed by varying the process parameters as per Taguchi’s L18 orthogonal array. IGC resistance of the friction stir processed specimens were found by immersing them in concentrated nitric acid and measuring the mass loss per unit area. Results indicate that dispersion and partial dissolution of secondary phase increased IGC resistance of the friction stir processed specimens. A Sugeno fuzzy model was developed to study the effect of FSP process parameters on the IGC susceptibility of friction stir processed specimens. Tool Rotation Speed, Tool Traverse Speed and Shoulder Diameter have a significant effect on the IGC susceptibility of the friction stir processed specimens.

  6. Potential mechanisms explaining why hydrolyzed casein-based diets outclass single amino acid-based diets in the prevention of autoimmune diabetes in diabetes-prone BB rats

    NARCIS (Netherlands)

    Visser, J. T. J.; Bos, N. A.; Harthoorn, L. F.; Stellaard, F.; Beijer-Liefers, S.; Rozing, J.; van Tol, E. A. F.

    Background It remains controversial whether avoidance of dietary diabetogenic triggers, such as cow's milk proteins, can prevent type 1 diabetes in genetically susceptible individuals. Here, different extensive casein hydrolysates (HC) and single amino acid (AA) formulations were tested for their

  7. Supplementation of DHA but not DHA with arachidonic acid during pregnancy and lactation influences general movement quality in 12-week-old term infants

    NARCIS (Netherlands)

    van Goor, Saskia A.; Dijck-Brouwer, D. A. Janneke; Doornbos, Bennard; Erwich, Jan Jaap H. M.; Schaafsma, Anne; Muskiet, Frits A. J.; Hadders-Algra, Mijna

    2010-01-01

    DHA and arachidonic acid (AA) are important for neurodevelopment. A traditional neonatal neurological examination and the evaluation of general movement quality are sensitive techniques for assessing neurodevelopment in young infants. Mildly abnormal general movement,,; at 3 months have been

  8. Time-dependent changes in the plasma amino acid concentration in diabetes mellitus.

    Science.gov (United States)

    Mochida, Taiga; Tanaka, Takayuki; Shiraki, Yasuko; Tajiri, Hiroko; Matsumoto, Shirou; Shimbo, Kazutaka; Ando, Toshihiko; Nakamura, Kimitoshi; Okamoto, Masahiro; Endo, Fumio

    2011-08-01

    We investigated longitudinal change in the amino acid (AA) profile in type 1 diabetes mellitus (DM) using AKITA mice, which develop DM as a result of insulin deficiency. The plasma concentrations of valine, leucine, isoleucine, as well as the total branched chain amino acids, alanine, citrulline and proline, were significantly higher in the diabetic mice. We show that the degree and timing of the changes were different among the plasma amino acid concentrations (pAAs) during the development of type 1 DM. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Arachidonic and oleic acid exert distinct effects on the DNA methylome

    DEFF Research Database (Denmark)

    Silva-Martínez, Guillermo A.; Rodríguez-Ríos, Dalia; Alvarado-Caudillo, Yolanda

    2016-01-01

    ABSTRACT: Abnormal fatty acid metabolism and availability are landmarks of metabolic diseases, which in turn are associated with aberrant DNA methylation profiles. To understand the role of fatty acids in disease epigenetics, we sought DNA methylation profiles specifically induced by arachidonic....... The divergent response to AA and OA was prominent within the gene body of target genes, where it correlated positively with transcription. AA-induced DNA methylation profiles were similar to the corresponding profiles described for palmitic acid, atherosclerosis, diabetes, obesity, and autism, but relatively...

  10. Seasonal profiles of leaf ascorbic acid content and redox state in ozone-sensitive wildflowers

    International Nuclear Information System (INIS)

    Burkey, Kent O.; Neufeld, Howard S.; Souza, Lara; Chappelka, Arthur H.; Davison, Alan W.

    2006-01-01

    Cutleaf coneflower (Rudbeckia laciniata L.), crown-beard (Verbesina occidentalis Walt.), and tall milkweed (Asclepias exaltata L.) are wildflower species native to Great Smoky Mountains National Park (U.S.A.). Natural populations of each species were analyzed for leaf ascorbic acid (AA) and dehydroascorbic acid (DHA) to assess the role of ascorbate in protecting the plants from ozone stress. Tall milkweed contained greater quantities of AA (7-10 μmol g -1 fresh weight) than crown-beard (2-4 μmol g -1 fresh weight) or cutleaf coneflower (0.5-2 μmol g -1 fresh weight). DHA was elevated in crown-beard and cutleaf coneflower relative to tall milkweed suggesting a diminished capacity for converting DHA into AA. Tall milkweed accumulated AA in the leaf apoplast (30-100 nmol g -1 fresh weight) with individuals expressing ozone foliar injury symptoms late in the season having less apoplast AA. In contrast, AA was not present in the leaf apoplast of either crown-beard or cutleaf coneflower. Unidentified antioxidant compounds were present in the leaf apoplast of all three species. Overall, distinct differences in antioxidant metabolism were found in the wildflower species that corresponded with differences in ozone sensitivity. - Wildflower species exhibit differences in ascorbic acid content and redox status that affect ozone sensitivity

  11. Seasonal profiles of leaf ascorbic acid content and redox state in ozone-sensitive wildflowers

    Energy Technology Data Exchange (ETDEWEB)

    Burkey, Kent O. [Plant Science Research Unit, USDA-ARS and North Carolina State University, 3127 Ligon Street, Raleigh, NC 27607 (United States)]. E-mail: koburkey@unity.ncsu.edu; Neufeld, Howard S. [Appalachian State University, Boone, NC (United States); Souza, Lara [Department of Ecology and Evolutionary Biology, University of Tennessee, Knoxville, TN (United States); Chappelka, Arthur H. [Auburn University, Auburn, AL (United States); Davison, Alan W. [University of Newcastle, Newcastle, England (United Kingdom)

    2006-10-15

    Cutleaf coneflower (Rudbeckia laciniata L.), crown-beard (Verbesina occidentalis Walt.), and tall milkweed (Asclepias exaltata L.) are wildflower species native to Great Smoky Mountains National Park (U.S.A.). Natural populations of each species were analyzed for leaf ascorbic acid (AA) and dehydroascorbic acid (DHA) to assess the role of ascorbate in protecting the plants from ozone stress. Tall milkweed contained greater quantities of AA (7-10 {mu}mol g{sup -1} fresh weight) than crown-beard (2-4 {mu}mol g{sup -1} fresh weight) or cutleaf coneflower (0.5-2 {mu}mol g{sup -1} fresh weight). DHA was elevated in crown-beard and cutleaf coneflower relative to tall milkweed suggesting a diminished capacity for converting DHA into AA. Tall milkweed accumulated AA in the leaf apoplast (30-100 nmol g{sup -1} fresh weight) with individuals expressing ozone foliar injury symptoms late in the season having less apoplast AA. In contrast, AA was not present in the leaf apoplast of either crown-beard or cutleaf coneflower. Unidentified antioxidant compounds were present in the leaf apoplast of all three species. Overall, distinct differences in antioxidant metabolism were found in the wildflower species that corresponded with differences in ozone sensitivity. - Wildflower species exhibit differences in ascorbic acid content and redox status that affect ozone sensitivity.

  12. Digestible indispensable amino acid score (DIAAS) and protein digestibility corrected amino acid score (PDCAAS) in oat protein concentrate measured in 20- to 30-kilogram pigs.

    Science.gov (United States)

    Abelilla, Jerubella J; Liu, Yanhong; Stein, Hans H

    2018-01-01

    Oat protein concentrate is often used in human food, but the quality of this protein has not been characterized. Therefore, the objectives of this experiment were to determine the standardized ileal digestibility (SID) of crude protein (CP) and amino acids (AA) in oat protein concentrate and to determine differences in protein quality estimates between the protein digestibility-corrected AA score (PDCAAS) and the digestible indispensable AA score (DIAAS) when using growing pigs for both measurements. For infants, the most limiting AA in oat protein concentrate was the aromatic AA (Phe + Tyr), for which the DIAAS value was 41 and the PDCAAS was 43. For children (6 months to 3 years) and children older than 3 years, the most limiting AA in oat protein concentrate was Lys, for which the DIAAS was 56 and 67 and the PDCAAS was 58 and 69, respectively. The DIAAS value for oat protein concentrate was close to the calculated value for PDCAAS, but below the recommended intake for protein. Therefore, to satisfy the daily human AA requirement, oat protein needs to be complemented by other proteins of higher quality and specifically with greater lysine concentrations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  13. Two-shell structured PMAA@CeO2nanocontainers loaded with 2-mercaptobenzothiazole for corrosion protection of damaged epoxy coated AA 2024-T3.

    Science.gov (United States)

    Balaskas, A C; Hashimoto, T; Curioni, M; Thompson, G E

    2017-05-04

    In this work, novel two-shell structured inhibitor-loaded poly(methacrylic acid)@cerium oxide (PMAA@CeO 2 ) nanocontainers were synthesised and characterized. The purpose of the nanocontainers is to increase the corrosion protection provided by an epoxy coating applied to an aerospace alloy (AA 2024-T3). The (PMAA@CeO 2 ) nanocontainers with diameters of 550 nm were synthesised by a four-step process with the method of distillation precipitation polymerization for the synthesis of the inner PMAA layer, and the sol-gel method for the development of the outer CeO 2 layer. The loaded nanocontainers were characterized by scanning and transmission electron microscopies. The corrosion protection properties of the epoxy coated AA 2024-T3 with 2-mercaptobenzothiazole (2-MBT) loaded PMAA@CeO 2 nanocontainers were evaluated with and without artificial scribes by electrochemical impedance spectroscopy (EIS). The results indicated that the epoxy coating containing the 2-MBT-loaded nanocontainers provided enhanced protection of the AA 2024-T3 substrate.

  14. Fatty acid composition of the postmortem prefrontal cortex of adolescent male and female suicide victims.

    Science.gov (United States)

    McNamara, Robert K; Jandacek, Ronald; Rider, Therese; Tso, Patrick; Dwivedi, Yogesh; Roberts, Rosalinda C; Conley, Robert R; Pandey, Ghanshyam N

    2009-01-01

    Prior epidemiological, prospective intervention, and peripheral and central fatty acid composition studies suggest that omega-3 fatty acid deficiency may be associated with the pathoaetiology of depression and suicide. In the present study, we determined the fatty acid composition of the postmortem prefrontal cortex (PFC) of adolescent male and female suicide victims and age-matched controls. Fatty acid composition (wt% total fatty acids) and concentrations (micromol/g) were determined in the postmortem PFC (Brodmann area 10) of male and female adolescent (aged 13-20 years) suicide victims (n=20) and age-matched controls (n=20) by gas chromatography. None of the major polyunsaturated fatty acids including the principle brain omega-3 fatty acid, docosahexaenoic acid (DHA), monounsaturated fatty acids, or saturated fatty acids differed significantly between adolescent suicide victims and controls before or after segregation by gender. The arachidonic acid (AA, 20:4n-6): DHA ratio and adrenic acid (22:4n-6) composition were negatively correlated with age at death in controls but not in suicides, and males exhibited a greater AA:DHA ratio irrespective of cause-of-death. These results demonstrate that adolescent male and female suicide victims do not exhibit DHA deficits in the postmortem PFC relative to age-matched controls, and suggest that suicide victims do not exhibit the normal age-related decrease in adrenic acid composition and the AA:DHA ratio.

  15. A comparison of Aggregatibacter actinomycetemcomitans (Aa virulence traits in a rat model for periodontal disease.

    Directory of Open Access Journals (Sweden)

    Helen Schreiner

    Full Text Available Our aim was to explore the effects of Cytolethal Distending toxin (Cdt in a well established rat model of periodontal disease where leukotoxin (LtxA was thought to have no known effect. In vitro studies, were used to assess CdtB activity using Aa Leukotoxin as a negative control. These studies showed that both CdtB and LtxA (unexpectedly exerted significant effects on CD4(+ T cells. As a result we decided to compare the effects of these two prominent Aa virulence factors on bone loss using our rat model of Aa-induced periodontitis. In this model, Aa strains, mutant in cdtB and ltxA, were compared to their parent non-mutant strains and evaluated for colonization, antibody response to Aa, bone loss and disease. We found that bone loss/disease caused by the ltxA mutant strain, in which cdtB was expressed, was significantly less (p<0.05 than that due to the wild type strain. On the other hand, the disease caused by cdtB mutant strain, in which ltxA was expressed, was not significantly different from the wild type strain. This data indicates that Aa LtxA exerts a greater effect on bone loss than Cdt in this rat model of periodontal disease and supports the utility of this model to dissect specific virulence factors as they relate to immunopathology in studies of Aa-induced disease.

  16. Large magnetoresistance in (AA')2FeReO6 double perovskites

    International Nuclear Information System (INIS)

    Teresa, J.M. de; Serrate, D.; Blasco, J.; Ibarra, M.R.; Morellon, L.

    2005-01-01

    We review the main structural, magnetic and magnetotransport properties of the intriguing (AA') 2 FeReO 6 magnetic double perovskites. As the average cation size decreases, the crystallographic structure at room temperature evolves from cubic [(AA') 2 =Ba 2 , Ba 1.5 Sr 0.5 , BaSr, Ba 0.5 Sr 1.5 ] to tetragonal [(AA') 2 =Sr 2 ] and monoclinic [(AA') 2 =Ca 0.5 Sr 1.5 , CaSr, Ca 1.5 Sr 0.5 , Ca 2 ]. The Curie temperature increases anomalously from ∼303K for Ba 2 to ∼522K for Ca 2 in sharp contrast with the observed behaviour in the isostructural compounds (AA') 2 FeMoO 6 . Other anomalous features in the (AA') 2 FeReO 6 series are: the large magnetic anisotropy, the large magnetoelastic coupling and the semiconducting behaviour of the monoclinic compounds. The monoclinic compounds undergo a structural/magnetic transition at T S below 125K. Three different magnetoresistance mechanisms have been identified: the intergrain negative magnetoresistance effect, which is present across the whole series of compounds, and in the case of the monoclinic compounds below T S a negative magnetoresistance effect associated to the melting of the low-temperature phase and a positive magnetoresistance effect only present in (AA') 2 =Ca 2 below T∼50K

  17. Enantioseparation of 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate tagged amino acids and other zwitterionic compounds on cinchona-based chiral stationary phases.

    Science.gov (United States)

    Hellinger, Roland; Horak, Jeannie; Lindner, Wolfgang

    2013-10-01

    The fluorescent tag 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate (AQC; AccQ Fluor reagent kit from Waters) is a commercial N-terminal label for proteinogenic amino acids (AAs), designed for reversed-phase separation and quantification of the AA racemates. The applicability of AQC-tagged AAs and AA-type zwitterionic compounds was tested for enantiomer separation on the tert-butyl carbamate modified quinine and quinidine based chiral stationary phases, QN-AX and QD-AX employing polar-organic elution conditions. The investigated test analytes included the enantiomers of the positional isomers of isoleucine (Ile), threonine, homoserine, and 4-hydroxyproline. Furthermore, β-AAs, cyclic, and heterocyclic AAs including trans-2-amino-cyclohexane carboxylic acid and trans-2-aminocyclohexyl sulfonic acid, phenylalanine derivatives substituted with halides with increasing electronegativity and 3,4-dihydroxyphenylalanine, cysteine-related derivatives including homocysteic acid, methionine sulfone, cysteine-S-acetic acid, and cysteine-S-acetamide as well as a small range of aminophosphonic acids were enantioseparated. A mechanistic interaction study of AQC-AAs in comparison with fluoresceine isothiocyanate-labeled AAs was performed. The chiral and chemoselective recognition processes involved in enantiomer separation and retention was systematically discussed. Special emphasis was set on the influential factors exhibited by the chemistry, branching position, and spatial properties of the investigated zwitterionic analytes. The general interest to separate and distinguish between different types of branched-chained AAs and metabolic side products thereof lies in the toxicity of some of these compounds, which makes for instance allo-Ile an attractive candidate in disease-related biomarker research.

  18. application of ascorbic acid 2-phosphate as a new voltammetric

    African Journals Online (AJOL)

    a

    ALP activity. The hydrolysis product, ascorbic acid (AA) is electroactive and could be detected by differential pulse voltammetry (DPV) at +380 mV, which could be used for the determination of ALP concentration. ..... The results show that AAP can be used as the suitable substrate for the routine ALP assay with satisfactory ...

  19. Response of Adult Cockerels to Different Sources of Ascorbic acid ...

    African Journals Online (AJOL)

    A study was conducted to determine the response of Adult cockerels to three sources of ascorbic acid (AA). The sources of ascorbate (vitamin C) tested were industrial, medical and from natural (baobab pulp) in a completely randomized design. Weekly feed intake, feed:gain and weight gain were affected (P<0.05) by the ...

  20. ASCORBIC ACID IS DECREASED IN INDUCED SPUTUM OF MILD ASTHMATICS

    Science.gov (United States)

    Asthma is primarily an airways inflammatory disease, and the bronchial airways have been shown to be particularly susceptible to oxidant-induced tissue damage. The antioxidant ascorbic acid (AA) plays an essential role in defending against oxidant attack in the airways. Decreased...

  1. Determination of basal ileal endogenous losses and standardized ileal digestibility of amino acids in barley fed to growing pigs

    DEFF Research Database (Denmark)

    Spindler, Hanna Katharina; Mosenthin, Rainer; Rosenfelder, Pia

    2016-01-01

    digestible content (cAID) and total crude protein (CP) and AA can be considered as alternative approach to obtain more accurate values for IAAend and SID of AA in cereal grains.MethodsEight hulled barley genotypes were used, with barley being the only source of CP and AA in the assay diets. The diets......BackgroundBasal ileal endogenous amino acid (AA) losses (IAAend) and standardized ileal digestibility (SID) values of cereal grains, such as barley, are apparently underestimated when determined according to the nitrogen (N)-free method. Regression analysis between the dietary apparent ileal...... to tabulated values. Moreover, these SID values were greater than those reported in literature, based on correction of apparent ileal digestibility (AID) of CP and AA for their IAAend values. Summarized, the results of the present regression analysis indicate greater IAAend in barley-based diets compared...

  2. Properties of collagen gels cross-linked by N-hydroxysuccinimide activated adipic acid deriviate.

    Science.gov (United States)

    Duan, Lian; Liu, Wentao; Tian, Zhenhua; Li, Conghu; Li, Guoying

    2014-08-01

    In order to improve the properties of collagen gel, N-hydroxysuccinimide activated adipic acid derivative (NHS-AA) was introduced into the formation of collagen fibrils. NHS-AA with different [NHS-AA]/[NH2] ratios (0.1-1.5, calculated by [ester group] of NHS-AA and [NH2] of lysine and hydroxylysine residues of collagen) was added after, simultaneously with or before the formation of collagen fibrils (abbreviated CAF, CSF and CBF, respectively) to obtain different collagen gels. With the same dose of NHS-AA, the cross-linking degree for CAF was lower than those for CSF and CBF. The formation of collagen fibrils was restrained by NHS-AA for CSF and CBF while that for CAF was unaffected. When the dose of NHS-AA increased from 0.1 to 1.5, the water contents of CSF and CBF increased while that of CAF had no obvious change. With lower dose of NHS-AA (0.1), CAF possessed higher value of G' (87.3Pa) and the best thermal stability (47.6°C). As the ratio of [NHS-AA]/[NH2] increased to 1.5, CSF had the maximum value of G' (288.8Pa) and CAF had the best thermal stability (52.9°C). These results showed collagen gels with different properties could be prepared by adding NHS-AA with different adding sequence and dose. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Ozone tolerance in snap bean is associated with elevated ascorbic acid in the leaf apoplast

    Energy Technology Data Exchange (ETDEWEB)

    Burkey, K.O. [North Carolina State Univ., United States Dept. of Agriculture-Agricultural Research Service, and Dept. of Crop Science, Raleigh, NC (United States); Eason, G. [North Carolina, State Univ., United States Dept. of Plant Pathology, Raleigh, NC (United States)

    2002-03-01

    Ascorbic acid (AA) in the leaf apoplast has the potential to limit ozone injury by participating in reactions that detoxify ozone and reactive oxygen intermediates and thus prevent plasma membrane damage. Genotypes of snap bean (Phaseolus vulgaris L) were compared in controlled environments and in open-top field chambers to assess the relationship between extracellular AA content and ozone tolerance. Vacuum infiltration methods were employed to separate leaf AA into extracellular and intracellular fractions. For plants grown in controlled environments at low ozone concentration (4 nmol mol{sup -1} ozone), leaf apoplast AA was significantly higher in tolerant genotypes (300-400 nmol g{sup -1} FW) compared with sensitive genotypes (approximately 50 nmol g{sup -1} FW), evidence that ozone tolerance is associated with elevated extracellular AA. For the open top chamber study, plants were grown in pots under charcoal-filtered air (CF) conditions and then either maintained under CF conditions (29 nmol mol{sup -1} ozone) or exposed to elevated ozone (67 nmol mol{sup -1} ozone). Following an 8-day treatment period, leaf apoplast AA was in the range of 100-190 nmol g{sup -1} FW for all genotypes, but no relationship was observed between apoplast AA content and ozone tolerance. The contrasting results in the two studies demonstrated a potential limitation in the interpretation of extracellular AA data. Apoplast AA levels presumably reflect the steady-state condition between supply from the cytoplasm and utilization within the cell wall. The capacity to detoxify ozone in the extracellular space may be underestimated under elevated ozone conditions where the dynamics of AA supply and utilization are not adequately represented by a steady-state measurement. (au)

  4. Deciphering the specific high-affinity binding of cucurbit[7]uril to amino acids in water.

    Science.gov (United States)

    Lee, Jong Wha; Lee, Hyun Hee L; Ko, Young Ho; Kim, Kimoon; Kim, Hugh I

    2015-04-02

    This work presents a systematic study on the host-guest interactions between the macrocyclic host molecule cucurbit[7]uril (CB[7]) and amino acids (AAs) including three basic AAs (Lys, Arg, and His) and three aromatic AAs (Phe, Tyr, and Trp) to elucidate the origin of the high selectivity of CB[7] toward AA residues in proteins. Complex formation between CB[7] and each AA was examined in solution (by isothermal titration calorimetry and NMR) as well as in the gas phase (by ion mobility mass spectrometry and collision-induced dissociation), and the results were further combined with computational investigations. Generally, the aromatic AAs show higher binding affinities than the basic AAs in buffer solutions with various pH values. On the contrary, the gas-phase stabilities of the basic AA complex ions are higher than those of the aromatic AA complex ions, suggesting that the direct ion-dipole interactions between the charged side chains of the basic AAs and the polar carbonyl groups of CB[7] predominate in the absence of water. The ion-dipole interactions are less significant in water, since the original interactions of the guests with water are lost upon complex formation. In contrast, the transfer of the hydrophobic groups from the bulk into the hydrophobic CB[7] cavity suffers less from the desolvation penalty, resulting in higher binding affinities in water. Therefore, initial guest solvation is another key factor which should be considered when designing high-affinity host-guest systems, in addition to the contribution from the release of high-energy water molecules from the CB[7] cavity (J. Am. Chem. Soc. 2012, 134, 15318-15323).

  5. Structural Analysis of Metabolites of Asiatic Acid and Its Analogue Madecassic Acid in Zebrafish Using LC/IT-MSn

    Directory of Open Access Journals (Sweden)

    Binbin Xia

    2015-02-01

    Full Text Available Although zebrafish has become a significant animal model for drug discovery and screening, drug metabolism in zebrafish remains largely unknown. Asiatic acid (AA and madecassic acid (MA, two natural pentacyclic triterpenoids mainly obtained from Centella asiatica (L. Urban, have been found to possess many pharmacological effects. This study is to probe the metabolic capability of zebrafish via investigation of the drug metabolism of AA and MA in zebrafish, using a sensitive LC/IT-MSn method. In addition, the main fragmentation pathways of AA and MA were reported for the first time. Nineteen metabolites of AA and MA were firstly identified after zebrafish was exposed to the drug, which all were the phase I metabolites and mainly formed from hydroxylation, dehydrogenation, hydroxylation and dehydrogenation, dihydroxylation and dehydrogenation, and dehydroxylation reaction. The results indicated that zebrafish possessed strong metabolic capacity, and the metabolites of AA and MA were formed via similar metabolic pathways and well matched with the known metabolic rules in vivo and in vitro, which supports the widely use of this system in drug metabolism research. This investigation would also contribute to the novel information on the structural elucidation, in vivo metabolites and metabolic mechanism of pentacyclic triterpenoids.

  6. The molecular mechanism of leptin secretion and expression induced by aristolochic acid in kidney fibroblast.

    Directory of Open Access Journals (Sweden)

    Tsung-Chieh Lin

    Full Text Available BACKGROUND: Leptin is a peptide hormone playing pivotal role in regulating food intake and energy expenditure. Growing evidence has suggested the pro-inflammatory and fibrogenic properties of leptin. In addition, patients with renal fibrosis have higher level of plasma leptin, which was due to the increased leptin production. Aristolochic acid (AA is a botanical toxin characterized to associate with the development of renal fibrosis including tubulointerstitial fibrosis. However, whether leptin is upregulated to participate in AA-induced kidney fibrosis remain completely unknown. METHODOLOGY/PRINCIPAL FINDINGS: In this study, leptin expression was increased by sublethal dose of AA in kidney fibroblast NRK49f determined by enzyme-linked immunosorbent assay and Western blot. Data from real-time reverse transcriptase-polymerase chain reaction revealed that leptin was upregulated by AA at transcriptional level. DNA binding activity of CCAAT enhancer binding protein α (C/EBP α, one of the transcription factors for leptin gene, was enhanced in DNA affinity precipitation assay and chromatin immunoprecipitation experiments. Knockdown of C/EBP α expression by small interfering RNA markedly reduced AA-induced leptin expression. Moreover, AA promoted Akt interaction with p-PDK1, and increased phosphorylated activation of Akt. Akt knockdown, and inhibition of Akt signaling by LY294002 and mTOR inhibitor rapamycin reduced leptin expression. Furthermore, treatment of LY294002 or rapamycin significantly suppressed AA-induced C/EBP α DNA-binding activity. These results suggest that Akt and C/EBP α activation were involved in AA-regulated leptin expression. CONCLUSIONS/SIGNIFICANCE: Our findings demonstrate the first that AA could induce secretion and expression of fibrogenic leptin in kidney fibroblasts, which reveal potential involvement of leptin in the progression of kidney fibrosis in aristolochic acid nephropathy.

  7. Molecular evidence for an involvement of organic anion transporters (OATs) in aristolochic acid nephropathy

    International Nuclear Information System (INIS)

    Bakhiya, Nadiya; Arlt, Volker M.; Bahn, Andrew; Burckhardt, Gerhard; Phillips, David H.; Glatt, Hansruedi

    2009-01-01

    Aristolochic acid (AA), present in Aristolochia species, is the major causative agent in the development of severe renal failure and urothelial cancers in patients with AA nephropathy. It may also be a cause of Balkan endemic nephropathy. Epithelial cells of the proximal tubule are the primary cellular target of AA. To study whether organic anion transporters (OATs) expressed in proximal tubule cells are involved in uptake of AA, we used human epithelial kidney (HEK293) cells stably expressing human (h) OAT1, OAT3 or OAT4. AA potently inhibited the uptake of characteristic substrates, p-aminohippurate for hOAT1 and estrone sulfate for hOAT3 and hOAT4. Aristolochic acid I (AAI), the more cytotoxic and genotoxic AA congener, exhibited high affinity for hOAT1 (K i = 0.6 μM) as well as hOAT3 (K i = 0.5 μM), and lower affinity for hOAT4 (K i = 20.6 μM). Subsequently, AAI-DNA adduct formation (investigated by 32 P-postlabelling) was used as a measure of AAI uptake. Significantly higher levels of adducts occurred in hOAT-expressing cells than in control cells: this effect was abolished in the presence of the OAT inhibitor probenecid. In Xenopus laevis oocytes hOAT-mediated efflux of p-aminohippurate was trans-stimulated by extracellular AA, providing further molecular evidence for AA translocation by hOATs. Our study indicates that OATs can mediate the uptake of AA into proximal tubule cells and thereby participate in kidney cell damage by this toxin.

  8. Changes in depression mediate the effects of AA attendance on alcohol use outcomes.

    Science.gov (United States)

    Wilcox, Claire E; Tonigan, J Scott

    2018-01-01

    Depression may contribute to increased drinking in individuals with alcohol use disorder. Although Alcoholics Anonymous (AA) attendance predicts drinking reductions, there is conflicting information regarding the intermediary role played by reductions in depression. We explored whether AA attendance reduces depressive symptoms, the degree to which improvement in depression results in reductions in drinking, and in which subgroups these effects occur. 253 early AA affiliates (63% male) were recruited and assessed at baseline 3, 6, 9, 12, 18, and 24 months. Depression was measured using the Beck Depression Inventory (BDI) and was administered at baseline 3, 6, 12, 18, and 24 months. AA attendance and alcohol use outcomes were obtained with the Form 90. Mediation analyses were performed at early (3, 6, and 9 months) and late (12, 18, and 24 months) follow-up to investigate the degree to which reductions in depression mediated the effect of AA attendance on drinking, controlling for concurrent drinking. In addition, a series of moderated mediation analyses were performed using baseline depression severity as a moderator. At early follow-up, reductions in depression (6 months) mediated the effects of AA attendance (3 months) on later drinking (drinks per drinking day) (9 months) (b = -0.02, boot CI [-0.055, -0.0004]), controlling for drinking at 6 months. Baseline depression severity did not moderate the degree to which BDI mediated the effects of AA attendance on alcohol use (ps > .05). These findings provide further evidence that depression reduction is a mechanism by which AA attendance leads to reductions in alcohol use. Improving depression may help reduce alcohol use in individuals with AUD, and AA attendance may be an effective way to achieve that goal.

  9. Formability and failure mechanisms of AA2024 under hot forming conditions

    Energy Technology Data Exchange (ETDEWEB)

    Wang, L. [Department of Mechanical Engineering, Imperial College London, SW7 2AZ (United Kingdom); Strangwood, M. [School of Metallurgy and Materials, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Balint, D. [Department of Mechanical Engineering, Imperial College London, SW7 2AZ (United Kingdom); Lin, J., E-mail: jianguo.lin@imperial.ac.uk [Department of Mechanical Engineering, Imperial College London, SW7 2AZ (United Kingdom); Dean, T.A. [School of Mechanical Engineering, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom)

    2011-03-15

    Research highlights: {yields} Forming AA2024 sheet at its solution heat treatment (SHT) temperature is studied. {yields} Formability is shown to be extremely low for AA2024 at the SHT temperature. {yields} The cause of low SHT temperature formability of AA2024 is found by experiment. {yields} An attainable high formability window (temperature and speed) is found for AA2024. {yields} AA2024 formability may be dramatically increased by elevated temperature stamping. - Abstract: Aluminium alloy 2024 (AA2024) is extensively used as a structural material in the aircraft industry because of its good combination of strength and fatigue resistance. However, complex shaped components, particularly those made from sheet, are extremely difficult to form by traditional cold forming due to its low ductility at room temperature. A possible solution of this problem is to form sheet workpieces at elevated temperature. The aim of the work described in this paper is to determine the relationship between formability and temperature for AA2024 by conducting a series of tensile tests at elevated temperatures ranging from 350 to 493 deg. C. Ductility of AA2024 was found to increase gradually with increasing temperature up to 450 deg. C, followed by a sharp decrease with further increase in temperature. So-called cup tests confirmed that the formability of AA2024 is very high at a temperature of about 450 deg. C. Fracture surfaces and longitudinal sections of formed samples were examined by scanning electron microscope. It was found that fracture occurred in three different modes depending upon the temperature, and the sharp decrease in ductility when the temperature exceeds 450 deg. C was caused by softening of grain boundaries by solute enrichment (at higher heating rates liquation may be involved) and softening of the matrix around inclusion particles.

  10. Bacillus thuringiensis Cyt2Aa2 toxin disrupts cell membranes by forming large protein aggregates.

    Science.gov (United States)

    Tharad, Sudarat; Toca-Herrera, José L; Promdonkoy, Boonhiang; Krittanai, Chartchai

    2016-10-01

    Bacillus thuringiensis (Bt) Cyt2Aa2 showed toxicity against Dipteran insect larvae and in vitro lysis activity on several cells. It has potential applications in the biological control of insect larvae. Although pore-forming and/or detergent-like mechanisms were proposed, the mechanism underlying cytolytic activity remains unclear. Analysis of the haemolytic activity of Cyt2Aa2 with osmotic stabilizers revealed partial toxin inhibition, suggesting a distinctive mechanism from the putative pore formation model. Membrane permeability was studied using fluorescent dye entrapped in large unilamellar vesicles (LUVs) at various protein/lipid molar ratios. Binding of Cyt2Aa2 monomer to the lipid membrane did not disturb membrane integrity until the critical protein/lipid molar ratio was reached, when Cyt2Aa2 complexes and cytolytic activity were detected. The complexes are large aggregates that appeared as a ladder when separated by agarose gel electrophoresis. Interaction of Cyt2Aa2 with Aedes albopictus cells was investigated by confocal microscopy and total internal reflection fluorescent microscopy (TIRF). The results showed that Cyt2Aa2 binds on the cell membrane at an early stage without cell membrane disruption. Protein aggregation on the cell membrane was detected later which coincided with cell swelling. Cyt2Aa2 aggregations on supported lipid bilayers (SLBs) were visualized by AFM. The AFM topographic images revealed Cyt2Aa2 aggregates on the lipid bilayer at low protein concentration and subsequently disrupts the lipid bilayer by forming a lesion as the protein concentration increased. These results supported the mechanism whereby Cyt2Aa2 binds and aggregates on the lipid membrane leading to the formation of non-specific hole and disruption of the cell membrane. © 2016 The Author(s).

  11. Baseline Susceptibility of Field Populations of Helicoverpa armigera to Bacillus thuringiensis Vip3Aa Toxin and Lack of Cross-Resistance between Vip3Aa and Cry Toxins

    Directory of Open Access Journals (Sweden)

    Yiyun Wei

    2017-04-01

    Full Text Available The cotton bollworm Helicoverpa armigera (Hübner is one of the most damaging cotton pests worldwide. In China, control of this pest has been dependent on transgenic cotton producing a single Bacillus thuringiensis (Bt protein Cry1Ac since 1997. A small, but significant, increase in H. armigera resistance to Cry1Ac was detected in field populations from Northern China. Since Vip3Aa has a different structure and mode of action than Cry proteins, Bt cotton pyramids containing Vip3Aa are considered as ideal successors of Cry1Ac cotton in China. In this study, baseline susceptibility of H. armigera to Vip3Aa was evaluated in geographic field populations collected in 2014 from major cotton-producing areas of China. The LC50 values of 12 field populations ranged from 0.053 to 1.311 μg/cm2, representing a 25-fold range of natural variation among populations. It is also demonstrated that four laboratory strains of H. armigera with high levels of resistance to Cry1Ac or Cry2Ab have no cross-resistance to Vip3Aa protein. The baseline susceptibility data established here will serve as a comparative reference for detection of field-evolved resistance to Vip3Aa in H. armigera after future deployment of Bt cotton pyramids in China.

  12. Relative turnover of [3H]arachidonic acid and [14C]eicosapentaenoic acid in stimulated human platelets

    International Nuclear Information System (INIS)

    Weaver, B.J.; Holub, B.J.

    1986-01-01

    The relative release of arachidonic acid (AA) versus eicosapentaenoic acid (EPA) from platelet phospholipids may be important in accounting for the potential of dietary fish oil containing EPA to alter platelet reactivity. Human platelets enriched in EPA and prelabelled with [ 3 H]AA and [ 14 C]EPA were used to examine the relative losses of these fatty acids from platelet phospholipids upon stimulation. Washed dual-labelled platelets were incubated with and without thrombin in the presence of BW755C and in the presence and absence of trifluoperazine. The platelet lipids were extracted and the individual phospholipids as well as diacylglycerol (DG), phosphatidic acid (PA), etc. were separated by thin-layer chromatography and the radioactivity in each fraction determined. The [ 3 H]AA/[ 14 C]EPA dpm ratio for the loss in radioactivity from PC upon thrombin stimulation was similar to that for the PC in resting platelets. This suggests no marked selectivity in the degradation of AA versus EPA species of PC during platelet activation. The [ 3 H]/[ 14 C] ratios for the increased radioactivity in DG and PA upon thrombin stimulation were slightly higher than the ratio in PI from resting platelets suggesting only a minor preference for 1-acyl 2-arachidonoyl PI over 1-acyl 2-eicosapentaenoyl PI in the pathway from PI to DG to PA

  13. Relative turnover of (/sup 3/H)arachidonic acid and (/sup 14/C)eicosapentaenoic acid in stimulated human platelets

    Energy Technology Data Exchange (ETDEWEB)

    Weaver, B.J.; Holub, B.J.

    1986-03-05

    The relative release of arachidonic acid (AA) versus eicosapentaenoic acid (EPA) from platelet phospholipids may be important in accounting for the potential of dietary fish oil containing EPA to alter platelet reactivity. Human platelets enriched in EPA and prelabelled with (/sup 3/H)AA and (/sup 14/C)EPA were used to examine the relative losses of these fatty acids from platelet phospholipids upon stimulation. Washed dual-labelled platelets were incubated with and without thrombin in the presence of BW755C and in the presence and absence of trifluoperazine. The platelet lipids were extracted and the individual phospholipids as well as diacylglycerol (DG), phosphatidic acid (PA), etc. were separated by thin-layer chromatography and the radioactivity in each fraction determined. The (/sup 3/H)AA/(/sup 14/C)EPA dpm ratio for the loss in radioactivity from PC upon thrombin stimulation was similar to that for the PC in resting platelets. This suggests no marked selectivity in the degradation of AA versus EPA species of PC during platelet activation. The (/sup 3/H)/(/sup 14/C) ratios for the increased radioactivity in DG and PA upon thrombin stimulation were slightly higher than the ratio in PI from resting platelets suggesting only a minor preference for 1-acyl 2-arachidonoyl PI over 1-acyl 2-eicosapentaenoyl PI in the pathway from PI to DG to PA.

  14. The use of anarcadic acid solution as cleaning agent prior to adhesive restorations

    OpenAIRE

    Cristina Maria Fernandes Queiroz

    2015-01-01

    The aim of this in vitro study was to evaluate the performance of anacardic acid as a cavity-cleaning agent in adhesive restorations. Three cleaning agents were used: distilled water (DW), chlorhexidine digluconate solution at 2% (CHX) and anacardic acid (AA). Each cleaning agent was used in two strategies adhesive: after acid etching with phosphoric acid with etch&rinse adhesive or prior to the primer application in self-etch adhesive. Scanning electron microscopy (SEM) analysis was performe...

  15. Arachidonic acid triggers [Ca2+]i increases in rat round spermatids by a likely GPR activation, ERK signalling and ER/acidic compartments Ca2+ release.

    Science.gov (United States)

    Paillamanque, Joaquin; Sanchez-Tusie, Ana; Carmona, Emerson M; Treviño, Claudia L; Sandoval, Carolina; Nualart, Francisco; Osses, Nelson; Reyes, Juan G

    2017-01-01

    Arachidonic acid (AA), a compound secreted by Sertoli cells (SC) in a FSH-dependent manner, is able to induce the release of Ca2+ from internal stores in round spermatids and pachytene spermatocytes. In this study, the possible site(s) of action of AA in round spermatids, the signalling pathways associated and the intracellular Ca2+ stores targeted by AA-induced signalling were pharmacologically characterized by measuring intracellular Ca2+ using fluorescent Ca2+ probes. Our results suggest that AA acts by interacting with a fatty acid G protein coupled receptor, initiating a G protein signalling cascade that may involve PLA2 and ERK activation, which in turn opens intracellular ryanodine-sensitive channels as well as NAADP-sensitive channels in acidic intracellular Ca2+ stores. The results presented here also suggest that AMPK and PKA modulate this AA-induced Ca2+ release from intracellular Ca2+ stores in round spermatids. We propose that unsaturated free fatty acid lipid signalling in the seminiferous tubule is a novel regulatory component of rat spermatogenesis.

  16. Association between AA-NAT gene polymorphism and reproductive performance in sheep

    OpenAIRE

    Ding-ping,Bai; Cheng-jiang,Yu; Yu-lin,Chen

    2012-01-01

    Arylalkylamine N-acetyltransferase (AA-NAT) is critical enzyme in Melatonin (MLT) biosynthesis for MLT regulating the animal seasonal breeding. In this study, DNA sequencing methods were applied to detect the polymorphisms of the AA-NAT gene in 179 Chinese sheep belonging to two non-seasonal reproduction breeds and two seasonal reproduction breeds. One mutation at exon 3 (NM_001009461:c.486A > G) was firstly described at the sheep AA-NAT locus. Hence, we described the SmaI PCR-RFLP m...

  17. Controlled release of bioactive PDGF-AA from a hydrogel/nanoparticle composite.

    Science.gov (United States)

    Elliott Donaghue, Irja; Shoichet, Molly S

    2015-10-01

    Polymer excipients, such as low molar mass poly(ethylene glycol) (PEG), have shown contradictory effects on protein stability when co-encapsulated in polymeric nanoparticles. To gain further insight into these effects, platelet-derived growth factor (PDGF-AA) was encapsulated in polymeric nanoparticles with vs. without PEG. PDGF-AA is a particularly compelling protein, as it has been demonstrated to promote cell survival and induce the oligodendrocyte differentiation of neural stem/progenitor cells (NSPCs) both in vitro and in vivo. Here we show, for the first time, the controlled release of bioactive PDGF-AA from an injectable nanoparticle/hydrogel drug delivery system (DDS). PDGF-AA was encapsulated, with high efficiency, in poly(lactide-co-glycolide) nanoparticles, and its release from the drug delivery system was followed over 21 d. Interestingly, the co-encapsulation of low molecular weight poly(ethylene glycol) increased the PDGF-AA loading but, unexpectedly, accelerated the aggregation of PDGF-AA, resulting in reduced activity and detection by enzyme-linked immunosorbent assay (ELISA). In the absence of PEG, released PDGF-AA remained bioactive as demonstrated with NSPC oligodendrocyte differentiation, similar to positive controls, and significantly different from untreated controls. This work presents a novel delivery method for differentiation factors, such as PDGF-AA, and provides insights into the contradictory effects reported in the literature of excipients, such as PEG, on the loading and release of proteins from polymeric nanoparticles. Previously, the polymer poly(ethylene glycol) (PEG) has been used in many biomaterials applications, from surface coatings to the encapsulation of proteins. In this work, we demonstrate that, unexpectedly, low molecular weight PEG has a deleterious effect on the release of the encapsulated protein platelet-derived growth factor AA (PDGF-AA). We also demonstrate release of bioactive PDGF-AA (in the absence of PEG

  18. Renal AA amyloidosis in a patient with hereditary complete complement C4 deficiency

    Directory of Open Access Journals (Sweden)

    Imed Helal

    2011-01-01

    Full Text Available Hereditary complete C4 deficiency has until now been reported in 30 cases only. A disturbed clearance of immune- complexes probably predisposes these individuals to systemic lupus erythematosus, other immune- complex diseases and recurrent microbial infections. We present here a 20- year- old female with hereditary complete C4 deficiency. Renal biopsy demonstrated renal AA amyloidosis. This unique case further substantiates that deficiency of classical pathway components predisposes to the development of recurrent microbial infections and that the patients may develop AA amyloidosis. Furthermore, in clinical practice, the nephrotic syndrome occurring in a patient with hereditary complete complement C4 deficiency should lead to the suspicion of renal AA amyloidosis.

  19. Investigation of acetic acid-catalyzed hydrothermal pretreatment on corn stover

    DEFF Research Database (Denmark)

    Xu, Jian; Thomsen, Mette Hedegaard; Thomsen, Anne Belinda

    2010-01-01

    Acetic acid (AA)-catalyzed liquid hot water (LHW) pretreatments on raw corn stover (RCS) were carried out at 195 °C at 15 min with the acetic acid concentrations between 0 and 400 g/kg RCS. After pretreatment, the liquor fractions and water-insoluble solids (WIS) were collected separately and tes...

  20. Amino acid absorption in the large intestine of humans and porcine models

    NARCIS (Netherlands)

    Wielen, van der Nikkie; Moughan, Paul J.; Mensink, Marco

    2017-01-01

    Dietary protein quality has been recognized as a critical issue by international authorities because it can affect important functions of the body. To predict protein quality, the FAO introduced the Digestible Indispensable Amino Acid Score. This score depends on ileal amino acid (AA) digestibility;