Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.
Directory of Open Access Journals (Sweden)
Victoria Gonzalo
Full Text Available BACKGROUND: Colorectal cancer (CRC multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. METHODOLOGY/PRINCIPAL FINDINGS: We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2, RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008 and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047 as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006. Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17, SFRP1 (r = 0.83, 0.06, HPP1 (r = 0.64, p = 0.17, 3OST2 (r = 0.83, p = 0.06 and GATA4 (r = 0.6, p = 0.24. Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant
ABERRANT METHYLATION OF THE PROMOTER OF APC, CDH13 AND MGMT GENES IN COLORECTAL CANCER PATIENTS
Directory of Open Access Journals (Sweden)
O. I. Kit
2016-01-01
Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.
Taguchi, Y-h
2015-01-01
Transgenerational epigenetics (TGE) are currently considered important in disease, but the mechanisms involved are not yet fully understood. TGE abnormalities expected to cause disease are likely to be initiated during development and to be mediated by aberrant gene expression associated with aberrant promoter methylation that is heritable between generations. However, because methylation is removed and then re-established during development, it is not easy to identify promoter methylation abnormalities by comparing normal lineages with those expected to exhibit TGE abnormalities. This study applied the recently proposed principal component analysis (PCA)-based unsupervised feature extraction to previously reported and publically available gene expression/promoter methylation profiles of rat primordial germ cells, between E13 and E16 of the F3 generation vinclozolin lineage that are expected to exhibit TGE abnormalities, to identify multiple genes that exhibited aberrant gene expression/promoter methylation during development. The biological feasibility of the identified genes were tested via enrichment analyses of various biological concepts including pathway analysis, gene ontology terms and protein-protein interactions. All validations suggested superiority of the proposed method over three conventional and popular supervised methods that employed t test, limma and significance analysis of microarrays, respectively. The identified genes were globally related to tumors, the prostate, kidney, testis and the immune system and were previously reported to be related to various diseases caused by TGE. Among the genes reported by PCA-based unsupervised feature extraction, we propose that chemokine signaling pathways and leucine rich repeat proteins are key factors that initiate transgenerational epigenetic-mediated diseases, because multiple genes included in these two categories were identified in this study.
LENUS (Irish Health Repository)
Murphy, Therese M
2011-01-01
Aberrant DNA methylation has been implicated as a key survival mechanism in cancer, whereby promoter hypermethylation silences genes essential for many cellular processes including apoptosis. Limited data is available on the methylation profile of apoptotic genes in prostate cancer (CaP). The aim of this study was to profile methylation of apoptotic-related genes in CaP using denaturing high performance liquid chromatography (DHPLC).
Directory of Open Access Journals (Sweden)
Ramesh
2015-06-01
Full Text Available PURPOSE: The promoter hypermethylation patterns of Thrombospodin - 1 gene in 50 EOC patients were studied and the methylation pattern was correlated with various clinic pathological parameters. METHODS: The promoter hypermethylation pattern of the TSP - 1 gene was assessed using nested PCR and Methylation specific PCR. STATISTICAL ANALYSIS: All the available data was statistically analyzed using the Chi square test or Fisher Exact Test on the SPSS software version 22.0 and a value <0.0 5 was considered statistically significant. RESULTS: Forty of the fifty ovarian carcinoma samples reported positive for methylation corresponding to a methylation frequency of 80%. A methylation frequency of 89.2%, 83.3% and 42.8% was observed in malignant , Low malignant potential (borderline and benign sample cohorts. CONCLUSION: From the results drawn from this study, it clearly shows that the anti angiogenic protein TSP - 1 is extensively hypermethylated in ovarian carcinoma and that it accumulates over t he progression of the disease from benign to malignant. As previous reports suggest that there is no evidence of mutation of this gene, promoter hypermethylation may be a crucial factor for the down regulation of the gene. Further by clubbing together the promoter hypermethylation pattern of TSP - 1 gene with hypermethylation patterns of other TSG may provide a better insight into the application of using methylation profiles of TSG as a biomarker in the detection of ovarian carcinoma.
Directory of Open Access Journals (Sweden)
Guzmán Leda
2012-07-01
Full Text Available Abstract Background Chronic obstructive pulmonary disease (COPD is a disorder associated to cigarette smoke and lung cancer (LC. Since epigenetic changes in oncogenes and tumor suppressor genes (TSGs are clearly important in the development of LC. In this study, we hypothesize that tobacco smokers are susceptible for methylation in the promoter region of TSGs in airway epithelial cells when compared with non-smoker subjects. The purpose of this study was to investigate the usefulness of detection of genes promoter methylation in sputum specimens, as a complementary tool to identify LC biomarkers among smokers with early COPD. Methods We determined the amount of DNA in induced sputum from patients with COPD (n = 23, LC (n = 26, as well as in healthy subjects (CTR (n = 33, using a commercial kit for DNA purification, followed by absorbance measurement at 260 nm. The frequency of CDKN2A, CDH1 and MGMT promoter methylation in the same groups was determined by methylation-specific polymerase chain reaction (MSP. The Fisher’s exact test was employed to compare frequency of results between different groups. Results DNA concentration was 7.4 and 5.8 times higher in LC and COPD compared to the (CTR (p Conclusions We provide evidence that aberrant methylation of TSGs in samples of induced sputum is a useful tool for early diagnostic of lung diseases (LC and COPD in smoker subjects. Virtual slides The abstract MUST finish with the following text: Virtual Slides The virtual slide(s for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1127865005664160
Pancreatic cancer genomes reveal aberrations in axon guidance pathway genes.
Biankin, Andrew V; Waddell, Nicola; Kassahn, Karin S; Gingras, Marie-Claude; Muthuswamy, Lakshmi B; Johns, Amber L; Miller, David K; Wilson, Peter J; Patch, Ann-Marie; Wu, Jianmin; Chang, David K; Cowley, Mark J; Gardiner, Brooke B; Song, Sarah; Harliwong, Ivon; Idrisoglu, Senel; Nourse, Craig; Nourbakhsh, Ehsan; Manning, Suzanne; Wani, Shivangi; Gongora, Milena; Pajic, Marina; Scarlett, Christopher J; Gill, Anthony J; Pinho, Andreia V; Rooman, Ilse; Anderson, Matthew; Holmes, Oliver; Leonard, Conrad; Taylor, Darrin; Wood, Scott; Xu, Qinying; Nones, Katia; Fink, J Lynn; Christ, Angelika; Bruxner, Tim; Cloonan, Nicole; Kolle, Gabriel; Newell, Felicity; Pinese, Mark; Mead, R Scott; Humphris, Jeremy L; Kaplan, Warren; Jones, Marc D; Colvin, Emily K; Nagrial, Adnan M; Humphrey, Emily S; Chou, Angela; Chin, Venessa T; Chantrill, Lorraine A; Mawson, Amanda; Samra, Jaswinder S; Kench, James G; Lovell, Jessica A; Daly, Roger J; Merrett, Neil D; Toon, Christopher; Epari, Krishna; Nguyen, Nam Q; Barbour, Andrew; Zeps, Nikolajs; Kakkar, Nipun; Zhao, Fengmei; Wu, Yuan Qing; Wang, Min; Muzny, Donna M; Fisher, William E; Brunicardi, F Charles; Hodges, Sally E; Reid, Jeffrey G; Drummond, Jennifer; Chang, Kyle; Han, Yi; Lewis, Lora R; Dinh, Huyen; Buhay, Christian J; Beck, Timothy; Timms, Lee; Sam, Michelle; Begley, Kimberly; Brown, Andrew; Pai, Deepa; Panchal, Ami; Buchner, Nicholas; De Borja, Richard; Denroche, Robert E; Yung, Christina K; Serra, Stefano; Onetto, Nicole; Mukhopadhyay, Debabrata; Tsao, Ming-Sound; Shaw, Patricia A; Petersen, Gloria M; Gallinger, Steven; Hruban, Ralph H; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Schulick, Richard D; Wolfgang, Christopher L; Morgan, Richard A; Lawlor, Rita T; Capelli, Paola; Corbo, Vincenzo; Scardoni, Maria; Tortora, Giampaolo; Tempero, Margaret A; Mann, Karen M; Jenkins, Nancy A; Perez-Mancera, Pedro A; Adams, David J; Largaespada, David A; Wessels, Lodewyk F A; Rust, Alistair G; Stein, Lincoln D; Tuveson, David A; Copeland, Neal G; Musgrove, Elizabeth A; Scarpa, Aldo; Eshleman, James R; Hudson, Thomas J; Sutherland, Robert L; Wheeler, David A; Pearson, John V; McPherson, John D; Gibbs, Richard A; Grimmond, Sean M
2012-11-15
Pancreatic cancer is a highly lethal malignancy with few effective therapies. We performed exome sequencing and copy number analysis to define genomic aberrations in a prospectively accrued clinical cohort (n = 142) of early (stage I and II) sporadic pancreatic ductal adenocarcinoma. Detailed analysis of 99 informative tumours identified substantial heterogeneity with 2,016 non-silent mutations and 1,628 copy-number variations. We define 16 significantly mutated genes, reaffirming known mutations (KRAS, TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A and SF3B1), and uncover novel mutated genes including additional genes involved in chromatin modification (EPC1 and ARID2), DNA damage repair (ATM) and other mechanisms (ZIM2, MAP2K4, NALCN, SLC16A4 and MAGEA6). Integrative analysis with in vitro functional data and animal models provided supportive evidence for potential roles for these genetic aberrations in carcinogenesis. Pathway-based analysis of recurrently mutated genes recapitulated clustering in core signalling pathways in pancreatic ductal adenocarcinoma, and identified new mutated genes in each pathway. We also identified frequent and diverse somatic aberrations in genes described traditionally as embryonic regulators of axon guidance, particularly SLIT/ROBO signalling, which was also evident in murine Sleeping Beauty transposon-mediated somatic mutagenesis models of pancreatic cancer, providing further supportive evidence for the potential involvement of axon guidance genes in pancreatic carcinogenesis.
Aberrant Gene Expression in Acute Myeloid Leukaemia
DEFF Research Database (Denmark)
Bagger, Frederik Otzen
model to investigate the role of telomerase in AML, we were able to translate the observed effect into human AML patients and identify specific genes involved, which also predict survival patterns in AML patients. During these studies we have applied methods for investigating differentially expressed......-based gene-lookup webservices, called HemaExplorer and BloodSpot. These web-services support the aim of making data and analysis of haematopoietic cells from mouse and human accessible for researchers without bioinformatics expertise. Finally, in order to aid the analysis of the very limited number...
Directory of Open Access Journals (Sweden)
Yasuko eKikuchi
2013-12-01
Full Text Available Cancer arises through accumulation of epigenetic and genetic alteration. Aberrant promoter methylation is a common epigenetic mechanism of gene silencing in cancer cells. We here performed genome-wide analysis of DNA methylation of promoter regions by Infinium HumanMethylation27 BeadChip, using 14 clinical papillary thyroid cancer samples and 10 normal thyroid samples. Among the 14 papillary cancer cases, 11 showed frequent aberrant methylation, but the other three cases showed no aberrant methylation at all. Distribution of the hypermethylation among cancer samples was non-random, which implied existence of a subset of preferentially methylated papillary thyroid cancer. Among 25 frequently methylated genes, methylation status of six genes (HIST1H3J, POU4F2, SHOX2, PHKG2, TLX3, HOXA7 was validated quantitatively by pyrosequencing. Epigenetic silencing of these genes in methylated papillary thyroid cancer cell lines was confirmed by gene re-expression following treatment with 5-aza-2'-deoxycytidine and trichostatin A, and detected by real-time RT-PCR. Methylation of these six genes was validated by analysis of additional 20 papillary thyroid cancer and 10 normal samples. Among the 34 cancer samples in total, 26 cancer samples with preferential methylation were significantly associated with mutation of BRAF/RAS oncogene (P=0.04, Fisher’s exact test. Thus we identified new genes with frequent epigenetic hypermethylation in papillary thyroid cancer, two subsets of either preferentially methylated or hardly methylated papillary thyroid cancer, with a concomitant occurrence of oncogene mutation and gene methylation. These hypermethylated genes may constitute potential biomarkers for papillary thyroid cancer.
Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.
Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A
2004-09-01
Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.
Aberrant DNA methylation of cancer-related genes in giant breast fibroadenoma: a case report
Directory of Open Access Journals (Sweden)
Orozco Javier I
2011-10-01
Full Text Available Abstract Introduction Giant fibroadenoma is an uncommon variant of benign breast lesions. Aberrant methylation of CpG islands in promoter regions is known to be involved in the silencing of genes (for example, tumor-suppressor genes and appears to be an early event in the etiology of breast carcinogenesis. Only hypermethylation of p16INK4a has been reported in non-giant breast fibroadenoma. In this particular case, there are no previously published data on epigenetic alterations in giant fibroadenomas. Our previous results, based on the analysis of 49 cancer-related CpG islands have confirmed that the aberrant methylation is specific to malignant breast tumors and that it is completely absent in normal breast tissue and breast fibroadenomas. Case presentation A 13-year-old Hispanic girl was referred after she had noted a progressive development of a mass in her left breast. On physical examination, a 10 × 10 cm lump was detected and axillary lymph nodes were not enlarged. After surgical removal the lump was diagnosed as a giant fibroadenoma. Because of the high growth rate of this benign tumor, we decided to analyze the methylation status of 49 CpG islands related to cell growth control. We have identified the methylation of five cancer-related CpG islands in the giant fibroadenoma tissue: ESR1, MGMT, WT-1, BRCA2 and CD44. Conclusion In this case report we show for the first time the methylation analysis of a giant fibroadenoma. The detection of methylation of these five cancer-related regions indicates substantial epigenomic differences with non-giant fibroadenomas. Epigenetic alterations could explain the higher growth rate of this tumor. Our data contribute to the growing knowledge of aberrant methylation in breast diseases. In this particular case, there exist no previous data regarding the role of methylation in giant fibroadenomas, considered by definition as a benign breast lesion.
Directory of Open Access Journals (Sweden)
Qiang Sun
Full Text Available IgA nephropathy (IgAN is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26, other renal diseases (n = 11 and healthy children (n = 13. B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2'-deoxycytidine (AZA. The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113, but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001 or AZA (P<0.0001. Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001. The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001. After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001 with more markedly decreased Cosmc mRNA content (P<0.0001. After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001, while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001. The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated
Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome
Directory of Open Access Journals (Sweden)
Chih-Jie Shen
2014-01-01
Full Text Available Cloned animals usually exhibited many defects in physical characteristics or aberrant epigenetic reprogramming, especially in some important organ development. Osteoponin (OPN is an extracellular-matrix protein involved in heart and bone development and diseases. In this study, we investigated the correlation between OPN mRNA and its promoter methylation changes by the 5-aza-dc treatment in fibroblast cell and promoter assay. Aberrant methylation of porcine OPN was frequently found in different tissues of somatic nuclear transferred cloning pigs, and bisulfite sequence data suggested that the OPN promoter region −2615 to −2239 nucleotides (nt may be a crucial regulation DNA element. In pig ear fibroblast cell culture study, the demethylation of OPN promoter was found in dose-dependent response of 5-aza-dc treatment and followed the OPN mRNA reexpression. In cloned pig study, discrepant expression pattern was identified in several cloned pig tissues, especially in brain, heart, and ear. Promoter assay data revealed that four methylated CpG sites presenting in the −2615 to −2239 nt region cause significant downregulation of OPN promoter activity. These data suggested that methylation in the OPN promoter plays a crucial role in the regulation of OPN expression that we found in cloned pigs genome.
Grosso, Ana R; Leite, Ana P; Carvalho, Sílvia; Matos, Mafalda R; Martins, Filipa B; Vítor, Alexandra C; Desterro, Joana MP; Carmo-Fonseca, Maria; de Almeida, Sérgio F
2015-01-01
Aberrant expression of cancer genes and non-canonical RNA species is a hallmark of cancer. However, the mechanisms driving such atypical gene expression programs are incompletely understood. Here, our transcriptional profiling of a cohort of 50 primary clear cell renal cell carcinoma (ccRCC) samples from The Cancer Genome Atlas (TCGA) reveals that transcription read-through beyond the termination site is a source of transcriptome diversity in cancer cells. Amongst the genes most frequently mutated in ccRCC, we identified SETD2 inactivation as a potent enhancer of transcription read-through. We further show that invasion of neighbouring genes and generation of RNA chimeras are functional outcomes of transcription read-through. We identified the BCL2 oncogene as one of such invaded genes and detected a novel chimera, the CTSC-RAB38, in 20% of ccRCC samples. Collectively, our data highlight a novel link between transcription read-through and aberrant expression of oncogenes and chimeric transcripts that is prevalent in cancer. DOI: http://dx.doi.org/10.7554/eLife.09214.001 PMID:26575290
Directory of Open Access Journals (Sweden)
Shanker Kalyana-Sundaram
2012-08-01
Full Text Available Application of high-throughput transcriptome sequencing has spurred highly sensitive detection and discovery of gene fusions in cancer, but distinguishing potentially oncogenic fusions from random, “passenger” aberrations has proven challenging. Here we examine a distinctive group of gene fusions that involve genes present in the loci of chromosomal amplifications—a class of oncogenic aberrations that are widely prevalent in breast cancers. Integrative analysis of a panel of 14 breast cancer cell lines comparing gene fusions discovered by high-throughput transcriptome sequencing and genome-wide copy number aberrations assessed by array comparative genomic hybridization, led to the identification of 77 gene fusions, of which more than 60% were localized to amplicons including 17q12, 17q23, 20q13, chr8q, and others. Many of these fusions appeared to be recurrent or involved highly expressed oncogenic drivers, frequently fused with multiple different partners, but sometimes displaying loss of functional domains. As illustrative examples of the “amplicon-associated” gene fusions, we examined here a recurrent gene fusion involving the mediator of mammalian target of rapamycin signaling, RPS6KB1 kinase in BT-474, and the therapeutically important receptor tyrosine kinase EGFR in MDA-MB-468 breast cancer cell line. These gene fusions comprise a minor allelic fraction relative to the highly expressed full-length transcripts and encode chimera lacking the kinase domains, which do not impart dependence on the respective cells. Our study suggests that amplicon-associated gene fusions in breast cancer primarily represent a by-product of chromosomal amplifications, which constitutes a subset of passenger aberrations and should be factored accordingly during prioritization of gene fusion candidates.
Galamb, Orsolya; Kalmár, Alexandra; Péterfia, Bálint; Csabai, István; Bodor, András; Ribli, Dezső; Krenács, Tibor; Patai, Árpád V; Wichmann, Barnabás; Barták, Barbara Kinga; Tóth, Kinga; Valcz, Gábor; Spisák, Sándor; Tulassay, Zsolt; Molnár, Béla
2016-08-02
The WNT signaling pathway has an essential role in colorectal carcinogenesis and progression, which involves a cascade of genetic and epigenetic changes. We aimed to analyze DNA methylation affecting the WNT pathway genes in colorectal carcinogenesis in promoter and gene body regions using whole methylome analysis in 9 colorectal cancer, 15 adenoma, and 6 normal tumor adjacent tissue (NAT) samples by methyl capture sequencing. Functional methylation was confirmed on 5-aza-2'-deoxycytidine-treated colorectal cancer cell line datasets. In parallel with the DNA methylation analysis, mutations of WNT pathway genes (APC, β-catenin/CTNNB1) were analyzed by 454 sequencing on GS Junior platform. Most differentially methylated CpG sites were localized in gene body regions (95% of WNT pathway genes). In the promoter regions, 33 of the 160 analyzed WNT pathway genes were differentially methylated in colorectal cancer vs. normal, including hypermethylated AXIN2, CHP1, PRICKLE1, SFRP1, SFRP2, SOX17, and hypomethylated CACYBP, CTNNB1, MYC; 44 genes in adenoma vs. NAT; and 41 genes in colorectal cancer vs. adenoma comparisons. Hypermethylation of AXIN2, DKK1, VANGL1, and WNT5A gene promoters was higher, while those of SOX17, PRICKLE1, DAAM2, and MYC was lower in colon carcinoma compared to adenoma. Inverse correlation between expression and methylation was confirmed in 23 genes, including APC, CHP1, PRICKLE1, PSEN1, and SFRP1. Differential methylation affected both canonical and noncanonical WNT pathway genes in colorectal normal-adenoma-carcinoma sequence. Aberrant DNA methylation appears already in adenomas as an early event of colorectal carcinogenesis.
Aberrant Splicing of Estrogen Receptor, HER2, and CD44 Genes in Breast Cancer
Directory of Open Access Journals (Sweden)
Kazushi Inoue
2015-01-01
Full Text Available Breast cancer (BC is the most common cause of cancer-related death among women under the age of 50 years. Established biomarkers, such as hormone receptors (estrogen receptor [ER]/progesterone receptor and human epidermal growth factor receptor 2 (HER2, play significant roles in the selection of patients for endocrine and trastuzumab therapies. However, the initial treatment response is often followed by tumor relapse with intrinsic resistance to the first-line therapy, so it has been expected to identify novel molecular markers to improve the survival and quality of life of patients. Alternative splicing of pre-messenger RNAs is a ubiquitous and flexible mechanism for the control of gene expression in mammalian cells. It provides cells with the opportunity to create protein isoforms with different, even opposing, functions from a single genomic locus. Aberrant alternative splicing is very common in cancer where emerging tumor cells take advantage of this flexibility to produce proteins that promote cell growth and survival. While a number of splicing alterations have been reported in human cancers, we focus on aberrant splicing of ER , HER2 , and CD44 genes from the viewpoint of BC development. ERα36 , a splice variant from the ER1 locus, governs nongenomic membrane signaling pathways triggered by estrogen and confers 4-hydroxytamoxifen resistance in BC therapy. The alternative spliced isoform of HER2 lacking exon 20 (Δ16HER2 has been reported in human BC; this isoform is associated with transforming ability than the wild-type HER2 and recapitulates the phenotypes of endocrine therapy-resistant BC. Although both CD44 splice isoforms ( CD44s , CD44v play essential roles in BC development, CD44v is more associated with those with favorable prognosis, such as luminal A subtype, while CD44s is linked to those with poor prognosis, such as HER2 or basal cell subtypes that are often metastatic. Hence, the detection of splice variants from these loci
Aberrant activity of NKL homeobox gene NKX3-2 in a T-ALL subset
Meyer, Corinna; Kaufmann, Maren; Zaborski, Margarete; MacLeod, Roderick A. F.; Drexler, Hans G.
2018-01-01
T-cell acute lymphoblastic leukemia (T-ALL) is a hematopoietic malignancy originating from T-cell progenitors in which differentiation is blocked at early stages. Physiological expression of specific NKL homeobox genes obeys a hematopoietic NKL-code implicated in the process of lymphopoiesis while in differentiated T-cells these genes are silenced. We propose that this developmental expression pattern underlies the observation that NKL homeobox genes are the most ubiquitous group of transcription factors deregulated in T-ALL, including TLX1, TLX3, NKX2-5 and NKX3-1. Here, we describe a novel member of the NKL homeobox gene subclass, NKX3-2 (BAPX1), which is aberrantly activated in 18% of pediatric T-ALL patients analyzed while being normally expressed in developing spleen. Identification of NKX3-2 expression in T-ALL cell line CCRF-CEM qualified these cells to model its deregulation and function in a leukemic context. Genomic and chromosomal analyses demonstrated normal configuration of the NKX3-2 locus at chromosome 4p15, thus excluding cytogenetic dysregulation. Comparative expression profiling analysis of NKX3-2 patient data revealed deregulated activity of BMP- and MAPK-signalling. These candidate pathways were experimentally confirmed to mediate aberrant NKX3-2 expression. We also show that homeobox gene SIX6, plus MIR17HG and GATA3 are downstream targets of NKX3-2 and plausibly contribute to the pathogenesis of this malignancy by suppressing T-cell differentiation. Finally, NKL homeobox gene NKX2-5 was activated by NKX3-2 in CCRF-CEM and by FOXG1 in PEER, representing mutually inhibitory activators of this translocated oncogene. Together, our findings reveal a novel oncogenic NKL homeobox gene subclass member which is aberrantly expressed in a large subset of T-ALL patients and participates in a deregulated gene network likely to arise in developing spleen. PMID:29746601
International Nuclear Information System (INIS)
Perl, A.; Wang, N.; Williams, J.M.; Hunt, M.J.; Rosenfeld, S.I.; Condemi, J.J.; Packman, C.H.; Abraham, G.N.
1987-01-01
The status of the immunoglobulin (Ig) genes was investigated in patients with idiopathic nonmalignant monoclonal IgG cryoglobulinemia (NCG). In NCG, monoclonal antibodies are synthesized at an accelerated rate by nonmalignant B lymphocytes. In order to determine whether this high production rate is related to a clonal B cell expansion, the rearrangement of the Ig genes was investigated by Southern blot analysis of genomic, 32 P-labelled, DNA extracted from the peripheral blood lymphocytes of four NCG patients. In three of four (VI, BR, and CH) clonal expansion of B cells was detected using probes specific for the genes. BamHI digestion of DNA from VI and BR produced three rearranged fragments which cohybridized with two of the probes. This finding suggested the presence of additional nonsecretory B cell clones and/or disruption of the gene segments spanned by and detected with the probes. In addition, the possibility of aberrant gene rearrangements was supported by noting the alteration of the c-myc gene locus in genomic DNA from peripheral blood leukocytes of VI and CH. Northern blot analysis of RNA isolated from peripheral blood B cells of VI and CH demonstrated aberrant transcripts of the c-myc gene, showing an active role of the altered c-myc locus. Detection of c-myc rearrangement in NCG patients clearly shows that this event may not be a final step in malignant B cell transformation
Fukushima, Noriyoshi; Sato, Norihiro; Ueki, Takashi; Rosty, Christophe; Walter, Kimberly M.; Wilentz, Robb E.; Yeo, Charles J.; Hruban, Ralph H.; Goggins, Michael
2002-01-01
Pancreatic intraductal neoplasia (PanIN) is thought to be the precursor to infiltrating pancreatic ductal adenocarcinoma. We have previously shown that the preproenkephalin (ppENK) and p16 genes are aberrantly methylated in pancreatic adenocarcinoma. In this study we define the methylation status of the ppENK and p16 genes in various grades of PanINs. One hundred seventy-four samples (28 nonneoplastic pancreatic epithelia, 7 reactive epithelia, 29 PanIN-1A, 48 PanIN-1B, 27 PanIN-2, 14 PanIN-3...
York, Dan; Higgins, Robert J.; LeCouteur, Richard A.; Joshi, Nikhil; Bannasch, Danika
2016-01-01
Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy. PMID:27251041
Aberrant Promoter Hypermethylation of RASSF Family Members in Merkel Cell Carcinoma
Energy Technology Data Exchange (ETDEWEB)
Richter, Antje M.; Haag, Tanja; Walesch, Sara [Institute for Genetics, University of Giessen, Giessen D-35392 (Germany); Herrmann-Trost, Peter [Institute of Pathology, Halle D-06097 (Germany); Marsch, Wolfgang C. [Department of Dermatology, University of Halle, Halle D-06120 (Germany); Kutzner, Heinz [DermPath, Friedrichshafen D-88048 (Germany); Helmbold, Peter [Department of Dermatology, University of Heidelberg, Heidelberg D-69120 (Germany); Dammann, Reinhard H., E-mail: Reinhard.Dammann@gen.bio.uni-giessen.de [Institute for Genetics, University of Giessen, Giessen D-35392 (Germany)
2013-11-18
Merkel cell carcinoma (MCC) is one of the most aggressive cancers of the skin. RASSFs are a family of tumor suppressors that are frequently inactivated by promoter hypermethylation in various cancers. We studied CpG island promoter hypermethylation in MCC of RASSF2, RASSF5A, RASSF5C and RASSF10 by combined bisulfite restriction analysis (COBRA) in MCC samples and control tissue. We found RASSF2 to be methylated in three out of 43 (7%), RASSF5A in 17 out of 39 (44%, but also 43% in normal tissue), RASSF5C in two out of 26 (8%) and RASSF10 in 19 out of 84 (23%) of the cancer samples. No correlation between the methylation status of the analyzed RASSFs or between RASSF methylation and MCC characteristics (primary versus metastatic, Merkel cell polyoma virus infection, age, sex) was found. Our results show that RASSF2, RASSF5C and RASSF10 are aberrantly hypermethylated in MCC to a varying degree and this might contribute to Merkel cell carcinogenesis.
Aberrant Promoter Hypermethylation of RASSF Family Members in Merkel Cell Carcinoma
Richter, Antje M.; Haag, Tanja; Walesch, Sara; Herrmann-Trost, Peter; Marsch, Wolfgang C.; Kutzner, Heinz; Helmbold, Peter; Dammann, Reinhard H.
2013-01-01
Merkel cell carcinoma (MCC) is one of the most aggressive cancers of the skin. RASSFs are a family of tumor suppressors that are frequently inactivated by promoter hypermethylation in various cancers. We studied CpG island promoter hypermethylation in MCC of RASSF2, RASSF5A, RASSF5C and RASSF10 by combined bisulfite restriction analysis (COBRA) in MCC samples and control tissue. We found RASSF2 to be methylated in three out of 43 (7%), RASSF5A in 17 out of 39 (44%, but also 43% in normal tissue), RASSF5C in two out of 26 (8%) and RASSF10 in 19 out of 84 (23%) of the cancer samples. No correlation between the methylation status of the analyzed RASSFs or between RASSF methylation and MCC characteristics (primary versus metastatic, Merkel cell polyoma virus infection, age, sex) was found. Our results show that RASSF2, RASSF5C and RASSF10 are aberrantly hypermethylated in MCC to a varying degree and this might contribute to Merkel cell carcinogenesis. PMID:24252868
Aberrant Promoter Hypermethylation of RASSF Family Members in Merkel Cell Carcinoma
International Nuclear Information System (INIS)
Richter, Antje M.; Haag, Tanja; Walesch, Sara; Herrmann-Trost, Peter; Marsch, Wolfgang C.; Kutzner, Heinz; Helmbold, Peter; Dammann, Reinhard H.
2013-01-01
Merkel cell carcinoma (MCC) is one of the most aggressive cancers of the skin. RASSFs are a family of tumor suppressors that are frequently inactivated by promoter hypermethylation in various cancers. We studied CpG island promoter hypermethylation in MCC of RASSF2, RASSF5A, RASSF5C and RASSF10 by combined bisulfite restriction analysis (COBRA) in MCC samples and control tissue. We found RASSF2 to be methylated in three out of 43 (7%), RASSF5A in 17 out of 39 (44%, but also 43% in normal tissue), RASSF5C in two out of 26 (8%) and RASSF10 in 19 out of 84 (23%) of the cancer samples. No correlation between the methylation status of the analyzed RASSFs or between RASSF methylation and MCC characteristics (primary versus metastatic, Merkel cell polyoma virus infection, age, sex) was found. Our results show that RASSF2, RASSF5C and RASSF10 are aberrantly hypermethylated in MCC to a varying degree and this might contribute to Merkel cell carcinogenesis
Aberrant epigenetic changes and gene expression in cloned cattle dying around birth
Directory of Open Access Journals (Sweden)
Zhao Dingsheng
2008-02-01
Full Text Available Abstract Background Aberrant reprogramming of donor somatic cell nuclei may result in many severe problems in animal cloning. To assess the extent of abnormal epigenetic modifications and gene expression in clones, we simultaneously examined DNA methylation, histone H4 acetylation and expression of six genes (β-actin, VEGF, oct4, TERT, H19 and Igf2 and a repetitive sequence (art2 in five organs (heart, liver, spleen, lung and kidney from two cloned cattle groups that had died at different stages. In the ED group (early death, n = 3, the cloned cattle died in the perinatal period. The cattle in the LD group (late death, n = 3 died after the perinatal period. Normally reproduced cattle served as a control group (n = 3. Results Aberrant DNA methylation, histone H4 acetylation and gene expression were observed in both cloned groups. The ED group showed relatively fewer severe DNA methylation abnormalities (p Conclusion Deaths of clones may be ascribed to abnormal expression of a very limited number of genes.
Aberrant DNA methylation in 5'regions of DNA methyltransferase genes in aborted bovine clones
Institute of Scientific and Technical Information of China (English)
2008-01-01
High rate of abortion and developmental abnormalities is thought to be closely associated with inefficient epigenetic reprogramming of the transplanted nuclei during bovine cloning.It is known that one of the important mechanisms for epigenetic reprogramming is DNA methylation.DNA methylation is established and maintained by DNA methyltransferases(DNMTs),therefore,it is postulated that the inefficient epigenetic reprogramming of transplanted nuclei may be due to abnormal expression of DNMTs.Since DNA methylation can strongly inhibit gene expression,aberrant DNA methylation of DNMT genes may disturb gene expression.But presently,it is not clear whether the methylation abnormality of DNMT genes is related to developmental failure of somatic cell nuclear transfer embryos.In our study,we analyzed methylation patterns of the 5' regions of four DNMT genes including Dnmt3a,Dnmt3b,Dnmtl and Dnmt2 in four aborted bovine clones.Using bisulfite sequencing method,we found that 3 out of 4 aborted bovine clones(AF1,AF2 and AF3)showed either hypermethylation or hypomethylation in the 5' regions of Dnmt3a and Dnmt3b.indicating that Dnmt3a and Dnmt3b genes are not properly reprogrammed.However,the individual AF4 exhibited similar methylation level and pattern to age-matched in vitro fertilized (IVF)fetuses.Besides,we found that tle 5'regions of Dnmtl and Dnmt2 were nearly completely unmethylated in all normal adults.IVF fetuses,sperm and aborted clones.Together,our results suggest that the aberrant methylation of Dnmt3a and Dnmt3b 5' regions is probably associated with the high abortion of bovine clones.
Directory of Open Access Journals (Sweden)
Maria J Camões
Full Text Available FLI1 and ERG, the major ETS transcription factors involved in rearrangements in the Ewing's sarcoma family of tumors (ESFT and in prostate carcinomas (PCa, respectively, belong to the same subfamily, having 98% sequence identity in the DNA binding domain. We therefore decided to investigate whether the aberrant transcription factors in both malignancies have some common downstream targets. We crossed a publicly available list of all putative EWSR1-FLI1 target genes in ESFT with our microarray expression data on 24 PCa and 6 non-malignant prostate tissues (NPT and choose four genes among the top-most differentially expressed between PCa with (PCa ERG+ and without (PCa ETS- ETS fusion genes (HIST1H4L, KCNN2, ECRG4 and LDOC1, as well as four well-validated direct targets of the EWSR1-FLI1 chimeric protein in ESFT (NR0B1, CAV1, IGFBP3 and TGFBR2. Using quantitative expression analysis in 16 ESFT and seven alveolar rhabdomyosarcomas (ARMS, we were able to validate the four genes previously described as direct targets of the EWSR1-FLI1 oncoprotein, showing overexpression of CAV1 and NR0B1 and underexpression of IGFBP3 and TGFBR2 in ESFT as compared to ARMS. Although none of these four genes showed significant expression differences between PCa ERG+ and PCa ETS-, CAV1, IGFBP3 and TGFBR2 were less expressed in PCa in an independent series of 56 PCa and 15 NPT, as also observed for ECRG4 and LDOC1, suggesting a role in prostate carcinogenesis in general. On the other hand, we demonstrate for the first time that both HIST1H4L and KCNN2 are significantly overexpressed in PCa ERG+ and that ERG binds to the promoter of these genes. Conversely, KCNN2 was found underexpressed in ESFT relative to ARMS, suggesting that the EWSR1-ETS oncoprotein may have the opposite effect of ERG rearrangements in PCa. We conclude that aberrant ETS transcription factors modulate target genes differently in ESFT and PCa.
Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.
Directory of Open Access Journals (Sweden)
Patrick O McGowan
Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.
Directory of Open Access Journals (Sweden)
Xiaoqi Zhang
2018-06-01
Full Text Available Oral squamous cell carcinoma (OSCC is a malignant disease. Methylation plays a key role in the etiology and pathogenesis of OSCC. The goal of this study was to identify aberrantly methylated differentially expressed genes (DEGs in OSCCs, and to explore the underlying mechanisms of tumorigenesis by using integrated bioinformatic analysis. Gene expression profiles (GSE30784 and GSE38532 were analyzed using the R software to obtain aberrantly methylated DEGs. Functional enrichment analysis of screened genes was performed using the DAVID software. Protein–protein interaction (PPI networks were constructed using the STRING database. The cBioPortal software was used to exhibit the alterations of genes. Lastly, we validated the results with the Cancer Genome Atlas (TCGA data. Twenty-eight upregulated hypomethylated genes and 24 downregulated hypermethylated genes were identified. These genes were enriched in the biological process of regulation in immune response, and were mainly involved in the PI3K-AKT and EMT pathways. Additionally, three upregulated hypomethylated oncogenes and four downregulated hypermethylated tumor suppressor genes (TSGs were identified. In conclusion, our study indicated possible aberrantly methylated DEGs and pathways in OSCCs, which could improve the understanding of the underlying molecular mechanisms. Aberrantly methylated oncogenes and TSGs may also serve as biomarkers and therapeutic targets for the precise diagnosis and treatment of OSCCs in the future.
International Nuclear Information System (INIS)
Rice, K L; Lin, X; Wolniak, K; Ebert, B L; Berkofsky-Fessler, W; Buzzai, M; Sun, Y; Xi, C; Elkin, P; Levine, R; Golub, T; Gilliland, D G; Crispino, J D; Licht, J D; Zhang, W
2011-01-01
Polycythemia vera (PV), essential thrombocythemia and primary myelofibrosis, are myeloproliferative neoplasms (MPNs) with distinct clinical features and are associated with the JAK2V617F mutation. To identify genomic anomalies involved in the pathogenesis of these disorders, we profiled 87 MPN patients using Affymetrix 250K single-nucleotide polymorphism (SNP) arrays. Aberrations affecting chr9 were the most frequently observed and included 9pLOH (n=16), trisomy 9 (n=6) and amplifications of 9p13.3–23.3 (n=1), 9q33.1–34.13 (n=1) and 9q34.13 (n=6). Patients with trisomy 9 were associated with elevated JAK2V617F mutant allele burden, suggesting that gain of chr9 represents an alternative mechanism for increasing JAK2V617F dosage. Gene expression profiling of patients with and without chr9 abnormalities (+9, 9pLOH), identified genes potentially involved in disease pathogenesis including JAK2, STAT5B and MAPK14. We also observed recurrent gains of 1p36.31–36.33 (n=6), 17q21.2–q21.31 (n=5) and 17q25.1–25.3 (n=5) and deletions affecting 18p11.31–11.32 (n=8). Combined SNP and gene expression analysis identified aberrations affecting components of a non-canonical PRC2 complex (EZH1, SUZ12 and JARID2) and genes comprising a ‘HSC signature' (MLLT3, SMARCA2 and PBX1). We show that NFIB, which is amplified in 7/87 MPN patients and upregulated in PV CD34+ cells, protects cells from apoptosis induced by cytokine withdrawal
Directory of Open Access Journals (Sweden)
Sonaglio V
2013-06-01
Full Text Available Viviane Sonaglio,1 Ana C de Carvalho,2 Silvia R C Toledo,3,4 Carolina Salinas-Souza,3,4 André L Carvalho,5 Antonio S Petrilli,3 Beatriz de Camargo,6 André L Vettore21Pediatrics Department, A C Camargo Hospital, São Paulo, Brazil; 2Biological Science Department, Federal University of São Paulo, Diadema, Brazil; 3Department of Pediatrics, Pediatric Oncology Institute, GRAACC/Federal University of São Paulo, São Paulo, Brazil; 4Department of Morphology and Genetics, Federal University of São Paulo, São Paulo, Brazil; 5Department of Head and Neck Surgery, PIO XII Foundation, Barretos Cancer Hospital, Barretos, São Paulo, Brazil; 6Research Program Pediatric Oncology Program, CPNq, Instituto Nacional do Cancer, Rio de Janeiro, BrazilAbstract: Osteosarcoma (OS is the eighth most common form of childhood and adolescence cancer. Approximately 10%–20% of patients present metastatic disease at diagnosis and the 5-year overall survival remains around 70% for nonmetastatic patients and around 30% for metastatic patients. Metastatic disease at diagnosis and the necrosis grade induced by preoperative treatment are the only well-established prognostic factors for osteosarcoma. The DNA aberrant methylation is a frequent epigenetic alteration in humans and has been described as a molecular marker in different tumor types. This study evaluated the DNA aberrant methylation status of 18 genes in 34 OS samples without previous chemotherapy treatment and in four normal bone specimens and compared the methylation profile with clinicopathological characteristics of the patients. We were able to define a three-gene panel (AIM1, p14ARF, and ESR1 in which methylation was correlated with OS cases. The hypermethylation of p14ARF showed a significant association with the absence of metastases at diagnoses, while ESR1 hypermethylation was marginally associated with worse overall survival. This study demonstrated that aberrant promoter methylation is a common event
Directory of Open Access Journals (Sweden)
Tsuyoshi Yoshida
2010-07-01
Full Text Available Background: Colorectal cancer (CRC is one of the most frequently occurring cancers in Japan, and thus a wide range of methods have been deployed to study the molecular mechanisms of CRC. In this study, we performed a comprehensive analysis of CRC, incorporating copy number aberration (CRC and gene expression data. For the last four years, we have been collecting data from CRC cases and organizing the information as an “omics” study by integrating many kinds of analysis into a single comprehensive investigation. In our previous studies, we had experienced difficulty in finding genes related to CRC, as we observed higher noise levels in the expression data than in the data for other cancers. Because chromosomal aberrations are often observed in CRC, here, we have performed a combination of CNA analysis and expression analysis in order to identify some new genes responsible for CRC. This study was performed as part of the Clinical Omics Database Project at Tokyo Medical and Dental University. The purpose of this study was to investigate the mechanism of genetic instability in CRC by this combination of expression analysis and CNA, and to establish a new method for the diagnosis and treatment of CRC. Materials and methods: Comprehensive gene expression analysis was performed on 79 CRC cases using an Affymetrix Gene Chip, and comprehensive CNA analysis was performed using an Affymetrix DNA Sty array. To avoid the contamination of cancer tissue with normal cells, laser micro-dissection was performed before DNA/RNA extraction. Data analysis was performed using original software written in the R language. Result: We observed a high percentage of CNA in colorectal cancer, including copy number gains at 7, 8q, 13 and 20q, and copy number losses at 8p, 17p and 18. Gene expression analysis provided many candidates for CRC-related genes, but their association with CRC did not reach the level of statistical significance. The combination of CNA and gene
Directory of Open Access Journals (Sweden)
Erik Södersten
2014-09-01
Full Text Available Polycomb group (PcG proteins bind to and repress genes in embryonic stem cells through lineage commitment to the terminal differentiated state. PcG repressed genes are commonly characterized by the presence of the epigenetic histone mark H3K27me3, catalyzed by the Polycomb repressive complex 2. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation. The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP experiments showed that increased H3K27me3S28p was accompanied by reduced PcG binding to regulatory regions of genes. An analysis of the genome wide distribution of L-DOPA-induced H3K27me3S28 phosphorylation by ChIP sequencing (ChIP-seq in combination with expression analysis by RNA-sequencing (RNA-seq showed that the induction of H3K27me3S28p correlated with increased expression of a subset of PcG repressed genes. We found that induction of H3K27me3S28p persisted during chronic L-DOPA administration to parkisonian mice and correlated with aberrant gene expression. We propose that dopaminergic transmission can activate PcG repressed genes in the adult brain and thereby contribute to long-term maladaptive responses including the motor complications, or dyskinesia, caused by prolonged administration of L-DOPA in Parkinson's disease.
Wijnands, M.V.W.; Erk, van M.J.; Doornbos, R.P.; Krul, C.A.M.; Woutersen, R.A.
2004-01-01
The effects of different dietary compounds on the formation of aberrant crypt foci (ACF) and colorectal tumours and on the expression of a selection of genes were studied in rats. Azoxymethane-treated male F344 rats were fed either a control diet or a diet containing 10% wheat bran (WB), 0.2%
Aberrant neuronal activity-induced signaling and gene expression in a mouse model of RASopathy.
Directory of Open Access Journals (Sweden)
Franziska Altmüller
2017-03-01
Full Text Available Noonan syndrome (NS is characterized by reduced growth, craniofacial abnormalities, congenital heart defects, and variable cognitive deficits. NS belongs to the RASopathies, genetic conditions linked to mutations in components and regulators of the Ras signaling pathway. Approximately 50% of NS cases are caused by mutations in PTPN11. However, the molecular mechanisms underlying cognitive impairments in NS patients are still poorly understood. Here, we report the generation and characterization of a new conditional mouse strain that expresses the overactive Ptpn11D61Y allele only in the forebrain. Unlike mice with a global expression of this mutation, this strain is viable and without severe systemic phenotype, but shows lower exploratory activity and reduced memory specificity, which is in line with a causal role of disturbed neuronal Ptpn11 signaling in the development of NS-linked cognitive deficits. To explore the underlying mechanisms we investigated the neuronal activity-regulated Ras signaling in brains and neuronal cultures derived from this model. We observed an altered surface expression and trafficking of synaptic glutamate receptors, which are crucial for hippocampal neuronal plasticity. Furthermore, we show that the neuronal activity-induced ERK signaling, as well as the consecutive regulation of gene expression are strongly perturbed. Microarray-based hippocampal gene expression profiling revealed profound differences in the basal state and upon stimulation of neuronal activity. The neuronal activity-dependent gene regulation was strongly attenuated in Ptpn11D61Y neurons. In silico analysis of functional networks revealed changes in the cellular signaling beyond the dysregulation of Ras/MAPK signaling that is nearly exclusively discussed in the context of NS at present. Importantly, changes in PI3K/AKT/mTOR and JAK/STAT signaling were experimentally confirmed. In summary, this study uncovers aberrant neuronal activity
Aberrant DNA methylation of matrix remodeling and cell adhesion related genes in pterygium.
Directory of Open Access Journals (Sweden)
Andri K Riau
Full Text Available BACKGROUND: Pterygium is a common ocular surface disease characterized by abnormal epithelial and fibrovascular proliferation, invasion, and matrix remodeling. This lesion, which migrates from the periphery to the center of the cornea, impairs vision and causes considerable irritation. The mechanism of pterygium formation remains ambiguous, and current treatment is solely surgical excision, with a significant risk of recurrence after surgery. Here, we investigate the role of methylation in DNA sequences that regulate matrix remodeling and cell adhesion in pterygium formation. METHODOLOGY/PRINCIPAL FINDINGS: Pterygium and uninvolved conjunctiva samples were obtained from the same eye of patients undergoing surgery. The EpiTYPER Sequenom technology, based on differential base cleavage and bisulfite sequencing was used to evaluate the extent of methylation of 29 matrix and adhesion related genes. In pterygium, three CpG sites at -268, -32 and -29 bp upstream of transglutaminase 2 (TGM-2 transcription initiation were significantly hypermethylated (p<0.05, whereas hypomethylation was detected at CpGs +484 and +602 bp downstream of matrix metalloproteinase 2 (MMP-2 transcription start site, and -809, -762, -631 and -629 bp upstream of the CD24 transcription start site. RT-qPCR, western blot and immunofluorescent staining showed that transcript and protein expression were reduced for TGM-2 and increased for MMP-2 and CD24. Inhibition of methylation in cultured conjunctival epithelial cells increased these transcripts. CONCLUSIONS/SIGNIFICANCE: We found regions of aberrant DNA methylation which were consistent with alteration of TGM-2, MMP-2, and CD24 transcript and protein expression, and that inhibition of methylation in cultured cells can increase the expression of these genes. Since these genes were related to cell adhesion and matrix remodeling, dysregulation may lead to fibroblastic and neovascular changes and pterygium formation. These results
International Nuclear Information System (INIS)
Elisova, I.V.; Feoktistova, I.P.
1983-01-01
The culture of Chinese hamster cells (clone 431) has been used to study cysteamine action on mutagenous effect of X-rays, determined by the induction of resistance of gene mutations to 6-thioguanine and chromosomal abberations, as well as on the reproductive form of death of irradiated cells. Dose--- effect curves are obtained under conditions of irradiation with and without protector. The factor of dose alteration is 2.0 for chromosomal aberrations and cell survival, and 2.8 for gene mutations. It is sUpposed that cysteamine affects the general mechanisms, which take part in the realis zation of injuries that bring about gene mutations, chromosomal aberrations and cell lethality
Dietary fat and risk of colon and rectal cancer with aberrant MLH1 expression, APC or KRAS genes.
Weijenberg, Matty P; Lüchtenborg, Margreet; de Goeij, Anton F P M; Brink, Mirian; van Muijen, Goos N P; de Bruïne, Adriaan P; Goldbohm, R Alexandra; van den Brandt, Piet A
2007-10-01
To investigate baseline fat intake and the risk of colon and rectal tumors lacking MLH1 (mutL homolog 1, colon cancer, nonpolyposis type 2) repair gene expression and harboring mutations in the APC (adenomatous polyposis coli) tumor suppressor gene and in the KRAS (v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog) oncogene. After 7.3 years of follow-up of the Netherlands Cohort Study (n = 120,852), adjusted incidence rate ratios (RR) and 95% confidence intervals (CI) were computed, based on 401 colon and 130 rectal cancer patients. Total, saturated and monounsaturated fat were not associated with the risk of colon or rectal cancer, or different molecular subgroups. There was also no association between polyunsaturated fat and the risk of overall or subgroups of rectal cancer. Linoleic acid, the most abundant polyunsaturated fatty acid in the diet, was associated with increased risk of colon tumors with only a KRAS mutation and no additional truncating APC mutation or lack of MLH1 expression (RR = 1.41, 95% CI 1.18-1.69 for one standard deviation (i.e., 7.5 g/day) increase in intake, p-trend over the quartiles of intake colon tumors without any of the gene defects, or with tumors harboring aberrations in either MLH1 or APC. Linoleic acid intake is associated with colon tumors with an aberrant KRAS gene, but an intact APC gene and MLH1 expression, suggesting a unique etiology of tumors with specific genetic aberrations.
Directory of Open Access Journals (Sweden)
Shifeng Huang
Full Text Available Hepatitis C virus (HCV has been reported to regulate cellular microRNAs (miRNAs. The HCV core protein is considered to be a potential oncoprotein in HCV-related hepatocellular carcinoma (HCV-HCC, but HCV core-regulated miRNAs are largely unknown. Our preliminary experiments revealed significant down-regulation of microRNA-152 (miR-152 by HCV core protein in HepG2 cells. Through target gene prediction softwares, Wnt1 was predicted to be a potential target of miR-152. The present study was initiated to investigate whether miR-152 is aberrantly regulated by the HCV core protein, and involved in the regulation of the aberrant proliferation of HCV-HCC cells.MiR-152 levels were examined by stem-loop real-time RT-PCR (SLqRT-PCR. Cell proliferation was analyzed by MTT and colony formation assay. Cell cycle analysis was performed by flow cytometry. Luciferase reporter assay was conducted to confirm miRNA-target association. Wnt1 expression was determined by real-time qPCR and Western blotting.HCV core protein significantly suppressed miR-152 expression, and led to significant Wnt1 up-regulation with a concomitant aberrantly promoted proliferation. Moreover, we validated that miR-152 inhibition promoted, while miR-152 mimics inhibited cell proliferation. Using, qRT-PCR and western blot, Wnt1 was demonstrated to be regulated by miR-152. Luciferase activity assay showed that while miR-152 mimics significantly reduced the luciferase activity by 83.76% (P<0.0001, miR-152 inhibitor showed no effect on luciferase reporter. Most notably, salvage expression of miR-152 after Ad-HCV core infection for 24 h almost totally reversed the proliferation-promoting effect of the HCV core protein, and meanwhile, reduced the expression of both Wnt1 mRNA and protein to basal levels.These findings provide important evidence that the reduced miR-152 expression by HCV core protein can indirectly lose an inhibitory effect on Wnt1, which might, at least partially lead to cell
International Nuclear Information System (INIS)
Anjaria, K.B.; Shirsath, K.B.; Bhat, N.N.; Sreedevi, B.
2010-01-01
It has been reported that tumour-promoting agents potentiate a number of genetic events induced by initiating agents in vitro Iodoacetate (IA) is reported to be a tumour promoter of moderate potency and although to the best of our knowledge, tumour promoting ability of IA in animals has not been reported, a large number of studies have reported various types of effects of IA, which may result in tumour promotion. In this paper, the modifying effects of tumour promoter IA on radiation induced dicentrics in peripheral blood lymphocytes have been reported
Directory of Open Access Journals (Sweden)
Evert van den Broek
2017-07-01
Full Text Available Development of cancer is driven by somatic alterations, including numerical and structural chromosomal aberrations. Currently, several computational methods are available and are widely applied to detect numerical copy number aberrations (CNAs of chromosomal segments in tumor genomes. However, there is lack of computational methods that systematically detect structural chromosomal aberrations by virtue of the genomic location of CNA-associated chromosomal breaks and identify genes that appear non-randomly affected by chromosomal breakpoints across (large series of tumor samples. ‘GeneBreak’ is developed to systematically identify genes recurrently affected by the genomic location of chromosomal CNA-associated breaks by a genome-wide approach, which can be applied to DNA copy number data obtained by array-Comparative Genomic Hybridization (CGH or by (low-pass whole genome sequencing (WGS. First, ‘GeneBreak’ collects the genomic locations of chromosomal CNA-associated breaks that were previously pinpointed by the segmentation algorithm that was applied to obtain CNA profiles. Next, a tailored annotation approach for breakpoint-to-gene mapping is implemented. Finally, dedicated cohort-based statistics is incorporated with correction for covariates that influence the probability to be a breakpoint gene. In addition, multiple testing correction is integrated to reveal recurrent breakpoint events. This easy-to-use algorithm, ‘GeneBreak’, is implemented in R (www.cran.r-project.org and is available from Bioconductor (www.bioconductor.org/packages/release/bioc/html/GeneBreak.html.
Nagel, Stefan; Ehrentraut, Stefan; Tomasch, Jürgen; Quentmeier, Hilmar; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G.; MacLeod, Roderick A. F.
2013-01-01
Homeobox genes encode transcription factors ubiquitously involved in basic developmental processes, deregulation of which promotes cell transformation in multiple cancers including hematopoietic malignancies. In particular, NKL-family homeobox genes TLX1, TLX3 and NKX2-5 are ectopically activated by chromosomal rearrangements in T-cell neoplasias. Here, using transcriptional microarray profiling and RQ-PCR we identified ectopic expression of NKL-family member NKX2-1, in a diffuse large B-cell lymphoma (DLBCL) cell line SU-DHL-5. Moreover, in silico analysis demonstrated NKX2-1 overexpression in 5% of examined DLBCL patient samples. NKX2-1 is physiologically expressed in lung and thyroid tissues where it regulates differentiation. Chromosomal and genomic analyses excluded rearrangements at the NKX2-1 locus in SU-DHL-5, implying alternative activation. Comparative expression profiling implicated several candidate genes in NKX2-1 regulation, variously encoding transcription factors, chromatin modifiers and signaling components. Accordingly, siRNA-mediated knockdown and overexpression studies confirmed involvement of transcription factor HEY1, histone methyltransferase MLL and ubiquitinated histone H2B in NKX2-1 deregulation. Chromosomal aberrations targeting MLL at 11q23 and the histone gene cluster HIST1 at 6p22 which we observed in SU-DHL-5 may, therefore, represent fundamental mutations mediating an aberrant chromatin structure at NKX2-1. Taken together, we identified ectopic expression of NKX2-1 in DLBCL cells, representing the central player in an oncogenic regulative network compromising B-cell differentiation. Thus, our data extend the paradigm of NKL homeobox gene deregulation in lymphoid malignancies. PMID:23637834
Kurscheid, Sebastian; Bady, Pierre; Sciuscio, Davide; Samarzija, Ivana; Shay, Tal; Vassallo, Irene; Van Criekinge, Wim; Domany, Eytan; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika
2014-01-01
We previously reported a stem cell related HOX gene signature associated with resistance to chemo-radiotherapy (TMZ/RT- > TMZ) in glioblastoma. However, underlying mechanisms triggering overexpression remain mostly elusive. Interestingly, HOX genes are neither involved in the developing brain, nor expressed in normal brain, suggestive of an acquired gene expression signature during gliomagenesis. HOXA genes are located on CHR 7 that displays trisomy in most glioblastoma which strongly impacts gene expression on this chromosome, modulated by local regulatory elements. Furthermore we observed more pronounced DNA methylation across the HOXA locus as compared to non-tumoral brain (Human methylation 450K BeadChip Illumina; 59 glioblastoma, 5 non-tumoral brain sampes). CpG probes annotated for HOX-signature genes, contributing most to the variability, served as input into the analysis of DNA methylation and expression to identify key regulatory regions. The structural similarity of the observed correlation matrices between DNA methylation and gene expression in our cohort and an independent data-set from TCGA (106 glioblastoma) was remarkable (RV-coefficient, 0.84; p-value < 0.0001). We identified a CpG located in the promoter region of the HOXA10 locus exerting the strongest mean negative correlation between methylation and expression of the whole HOX-signature. Applying this analysis the same CpG emerged in the external set. We then determined the contribution of both, gene copy aberration (CNA) and methylation at the selected probe to explain expression of the HOX-signature using a linear model. Statistically significant results suggested an additive effect between gene dosage and methylation at the key CpG identified. Similarly, such an additive effect was also observed in the external data-set. Taken together, we hypothesize that overexpression of the stem-cell related HOX signature is triggered by gain of trisomy 7 and escape from compensatory DNA methylation at
Nagarajan, Raman P; Hogart, Amber R; Gwye, Ynnez; Martin, Michelle R; LaSalle, Janine M
2006-01-01
Mutations in MECP2, encoding methyl CpG binding protein 2 (MeCP2), cause most cases of Rett syndrome (RTT), an X-linked neurodevelopmental disorder. Both RTT and autism are "pervasive developmental disorders" and share a loss of social, cognitive and language skills and a gain in repetitive stereotyped behavior, following apparently normal perinatal development. Although MECP2 coding mutations are a rare cause of autism, MeCP2 expression defects were previously found in autism brain. To further study the role of MeCP2 in autism spectrum disorders (ASDs), we determined the frequency of MeCP2 expression defects in brain samples from autism and other ASDs. We also tested the hypotheses that MECP2 promoter mutations or aberrant promoter methylation correlate with reduced expression in cases of idiopathic autism. MeCP2 immunofluorescence in autism and other neurodevelopmental disorders was quantified by laser scanning cytometry and compared with control postmortem cerebral cortex samples on a large tissue microarray. A significant reduction in MeCP2 expression compared to age-matched controls was found in 11/14 autism (79%), 9/9 RTT (100%), 4/4 Angelman syndrome (100%), 3/4 Prader-Willi syndrome (75%), 3/5 Down syndrome (60%), and 2/2 attention deficit hyperactivity disorder (100%) frontal cortex samples. One autism female was heterozygous for a rare MECP2 promoter variant that correlated with reduced MeCP2 expression. A more frequent occurrence was significantly increased MECP2 promoter methylation in autism male frontal cortex compared to controls. Furthermore, percent promoter methylation of MECP2 significantly correlated with reduced MeCP2 protein expression. These results suggest that both genetic and epigenetic defects lead to reduced MeCP2 expression and may be important in the complex etiology of autism.
Duodenal ulcer promoting gene of Helicobacter pylori.
Lu, Hong; Hsu, Ping-I; Graham, David Y; Yamaoka, Yoshio
2005-04-01
Identification of a disease-specific H pylori virulence factors predictive of the outcome of infection remains unachieved. We used the polymerase chain reaction and Southern blot to compare the presence of 14 vir homologue genes with clinical presentation of H pylori infection, mucosal histology, and mucosal interleukin (IL)-8 levels. We examined 500 H pylori strains from East Asia and South America, including 120 with gastritis, 140 with duodenal ulcer (DU), 110 with gastric ulcer (GU), and 130 with gastric cancer. Only 1 gene that encompassed both jhp0917 and jhp0918 called dupA (duodenal ulcer promoting gene) was associated with a specific clinical outcome. dupA was present in 42% of DU vs. 21% of gastritis (adjusted odds ratio [OR] = 3.1, 95% confidence interval [CI]: 1.7-5.7). Its presence was also associated with more intense antral neutrophil infiltration and IL-8 levels and was a marker for protection against gastric atrophy, intestinal metaplasia, and gastric cancer (OR for gastric cancer = 0.42, 95% CI: 0.2-0.9 compared with gastritis). In vitro studies in gastric epithelial cells using dupA -deleted and -complemented mutants showed that the dupA plays roles in IL-8 production, in activation of transcription factors responsible for IL-8 promoter activity, and in increased survivability at low pH. dupA is a novel marker associated with an increased risk for DU and reduced risk for gastric atrophy and cancer. Its association with DU-promoting and -protective effects against atrophy/cancer was evident in both Asian and Western countries.
International Nuclear Information System (INIS)
Adler, Ilse-Dore; Carere, Angelo; Eichenlaub-Ritter, Ursula; Pacchierotti, Francesca
2007-01-01
Germ cell mutagenicity testing provides experimental data to quantify genetic risk for exposed human populations. The majority of tests are performed with exposure of males, and female data are relatively rare. The reason for this paucity lies in the differences between male and female germ cell biology. Male germ cells are produced throughout reproductive life and all developmental stages can be ascertained by appropriate breeding schemes. In contrast, the female germ cell pool is limited, meiosis begins during embryogenesis and oocytes are arrested over long periods of time until maturation processes start for small numbers of oocytes during the oestrus cycle in mature females. The literature data are reviewed to point out possible gender differences of germ cells to exogenous agents such as chemicals or ionizing radiation. From the limited information, it can be concluded that male germ cells are more sensitive than female germ cells to the induction of chromosomal aberrations and gene mutations. However, exceptions are described which shed doubt on the extrapolation of experimental data from male rodents to the genetic risk of the human population. Furthermore, the female genome may be more sensitive to mutation induction during peri-conceptional stages compared to the male genome of the zygote. With few exceptions, germ cell experiments have been carried out under high acute exposure to optimize the effects and to compensate for the limited sample size in animal experiments. Human exposure to environmental agents, on the other hand, is usually chronic and involves low doses. Under these conditions, gender differences may become apparent that have not been studied so far. Additionally, data are reviewed that suggest a false impression of safety when responses are negative under high acute exposure of male rodents while a mutational response is induced by low chronic exposure. The classical (morphological) germ cell mutation tests are not performed anymore
Tian, Ruiyuan; Chen, Xiuhua; Chang, Jianmei; Zhang, Na; Tan, Yanhong; Xu, Zhifang; Ren, Fanggang; Zhao, Junxia; Pan, Jie; Guo, Haixiu; Wang, Xiaojuan; Wang, Hongwei
2015-07-01
To identify the MPL L391-V392ins12 spliceosome and analyze its frequencies in patients with myeloproliferative neoplasms (MPN). MPL aberrant spliceosome was identified through reverse transcription polymerase chain reaction (RT-PCR)combined with cloning sequencing. The mutation of this spliceosome in 248 MPN patients and 200 normal people was determined by allele-specific polymerase chain reaction (AS-PCR). A novel aberrant spliceosome of MPL gene (MPL L391-V392ins12)was identified, i.e. 36 bp intron was retained between exon7 and exon8, and there were 12 amino acids (EGLKLLPADIPV)inserted. MPL L391-V392ins12 mutation was detected in 19 (7.66%)of the 248 patients with MPN, including 1 (1.92%) of 52 patients with PV, 14 (9.66%) of 145 with ET, and 4 (7.84%) of 51 with PMF. And the mutation was not detected in the group of 200 normal people. MPL L391-V392ins12 spliceosome is an aberrant spliceosome present in the MPN. It can be detected in PV, ET and PMF, and more frequently in ET and PMF. This mutation may play an important role in the process of MPN.
Directory of Open Access Journals (Sweden)
Pieter Rottiers
1999-12-01
Full Text Available In addition to eugenetic changes, cancerous cells exhibit extensive modifications in the expression levels of a variety of genes. The phenotypic switch observed after inoculation of T lymphoma cells into syngenic mice illustrates the active participation of tumoral environment in the induction of an aberrant gene expression pattern. To further substantiate this contribution, we performed polymerase chain reaction (PCR-based subtraction suppression hybridization (SSH to identify genes that are differentially expressed in tumor-derived EL4/13.3 cells compared to the same cells isolated from cultures. Besides a number of unknown genes, the subtracted library contained several known genes that have been reported to be expressed at increased levels in tumors and/or to contribute to carcinogenesis. Apart from clones representing translated transcripts, the subtracted library also contained a high number of clones representing B2 repeat elements, viz. short interspersed repetitive elements that are transcribed by RNA polymerase III. Northern blotting confirmed the induction of B2 transcripts in tumor tissue and also revealed induction of chimeric, B2 repeat-containing mRNA. The appearance of chimeric transcripts was accompanied by aberrant, shorter-than-full-length transcripts, specifically from upregulated genes. Accordingly, in addition to altered gene expression, tumoral environmental triggers constitute a potent mechanism to create an epigenetic diversity in cancers by inducing extensive transcript anomalies.
Zhao, Mengnan; Zhan, Cheng; Li, Ming; Yang, Xiaodong; Yang, Xinyu; Zhang, Yong; Lin, Miao; Xia, Yifeng; Feng, Mingxiang; Wang, Qun
2018-01-01
The aberrant status of target genes and their associations with clinicopathologic characteristics are still unclear in primary lung adenocarcinoma. The common mutations and translocations of nine target genes were evaluated in 1,247 specimens of surgically-resected primary lung adenocarcinoma. Immunohistochemistry was used to analyze the expressions of programmed death-1 (PD-1)/programmed death-ligand 1 (PD-L1) in 731 specimens. The frequency of the aberrations and their associations with clinicopathologic characteristics were analyzed. Overall, 952 (76.3%) of 1,247 patients harbored at least one target mutation or translocation: epidermal growth factor receptor ( EGFR ) (729, 58.5%), v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog ( KRAS ) (83, 6.7%), human epidermal growth factor receptor 2 ( HER2 ) (82, 6.6%), anaplastic lymphoma kinase ( ALK) (23, 1.8%), phosphoinositide-3-kinase catalytic alpha polypeptide ( PIK3CA ) (20, 1.6%), Ret proto-oncogene RET (15, 1.2%), ROS proto-oncogene 1 receptor tyrosine kinase ( ROS1 ) (12, 1.0%), B-raf proto-oncogene ( BRAF ) (9, 0.7%), neuroblastoma RAS viral (v-ras) oncogene homolog ( NRAS ) (3, 0.2%). Fourteen (1.9%) of 731 patients were PD-1 positive and 95 (13.0%) were PD-L1 positive in tumor cells. In men and smokers, there were more frequent KRAS mutations (both Ppatients, while HER2 (Ppatients with EGFR mutations (all Ppatients with primary lung adenocarcinoma harbored target gene aberrations. The frequency of each alteration differed in patients depending on clinicopathologic characteristics.
Isolating Barley ( Hordeum vulgare L.) B1 Hordein Gene Promoter ...
African Journals Online (AJOL)
Promoters play the most important role in determining the temporal and spatial expression pattern and transcript level of a gene. Some strong constitutive promoters, such as cauliflower mosaic virus 35s promoter, are widely used in plant genetic engineering research. However, the expression levels of the foreign genes in ...
Aberrant methylation of the M-type phospholipase A2 receptor gene in leukemic cells
International Nuclear Information System (INIS)
Menschikowski, Mario; Platzbecker, Uwe; Hagelgans, Albert; Vogel, Margot; Thiede, Christian; Schönefeldt, Claudia; Lehnert, Renate; Eisenhofer, Graeme; Siegert, Gabriele
2012-01-01
The M-type phospholipase A2 receptor (PLA2R1) plays a crucial role in several signaling pathways and may act as tumor-suppressor. This study examined the expression and methylation of the PLA2R1 gene in Jurkat and U937 leukemic cell lines and its methylation in patients with myelodysplastic syndrome (MDS) or acute leukemia. Sites of methylation of the PLA2R1 locus were identified by sequencing bisulfite-modified DNA fragments. Methylation specific-high resolution melting (MS-HRM) analysis was then carried out to quantify PLA2R1 methylation at 5-CpG sites identified with differences in methylation between healthy control subjects and leukemic patients using sequencing of bisulfite-modified genomic DNA. Expression of PLA2R1 was found to be completely down-regulated in Jurkat and U937 cells, accompanied by complete methylation of PLA2R1 promoter and down-stream regions; PLA2R1 was re-expressed after exposure of cells to 5-aza-2´-deoxycytidine. MS-HRM analysis of the PLA2R1 locus in patients with different types of leukemia indicated an average methylation of 28.9% ± 17.8%, compared to less than 9% in control subjects. In MDS patients the extent of PLA2R1 methylation significantly increased with disease risk. Furthermore, measurements of PLA2R1 methylation appeared useful for predicting responsiveness to the methyltransferase inhibitor, azacitidine, as a pre-emptive treatment to avoid hematological relapse in patients with high-risk MDS or acute myeloid leukemia. The study shows for the first time that PLA2R1 gene sequences are a target of hypermethylation in leukemia, which may have pathophysiological relevance for disease evolution in MDS and leukemogenesis
Directory of Open Access Journals (Sweden)
Lockwood William W
2010-05-01
Full Text Available Abstract Background Genomics has substantially changed our approach to cancer research. Gene expression profiling, for example, has been utilized to delineate subtypes of cancer, and facilitated derivation of predictive and prognostic signatures. The emergence of technologies for the high resolution and genome-wide description of genetic and epigenetic features has enabled the identification of a multitude of causal DNA events in tumors. This has afforded the potential for large scale integration of genome and transcriptome data generated from a variety of technology platforms to acquire a better understanding of cancer. Results Here we show how multi-dimensional genomics data analysis would enable the deciphering of mechanisms that disrupt regulatory/signaling cascades and downstream effects. Since not all gene expression changes observed in a tumor are causal to cancer development, we demonstrate an approach based on multiple concerted disruption (MCD analysis of genes that facilitates the rational deduction of aberrant genes and pathways, which otherwise would be overlooked in single genomic dimension investigations. Conclusions Notably, this is the first comprehensive study of breast cancer cells by parallel integrative genome wide analyses of DNA copy number, LOH, and DNA methylation status to interpret changes in gene expression pattern. Our findings demonstrate the power of a multi-dimensional approach to elucidate events which would escape conventional single dimensional analysis and as such, reduce the cohort sample size for cancer gene discovery.
Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors
Directory of Open Access Journals (Sweden)
Oliveira Jorge
2007-07-01
Full Text Available Abstract Background Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. Methods A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC, 13 papillary (pRCC, 10 chromophobe (chRCC, and 10 oncocytomas and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Results Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007, PTGS2 (p = 0.002, and RASSF1A (p = 0.0001. CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively, whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004. RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035. In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031 and nuclear grade (p = 0.022, respectively. Conclusion The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses.
Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors
International Nuclear Information System (INIS)
Costa, Vera L; Henrique, Rui; Ribeiro, Franclim R; Pinto, Mafalda; Oliveira, Jorge; Lobo, Francisco; Teixeira, Manuel R; Jerónimo, Carmen
2007-01-01
Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP) in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC), 13 papillary (pRCC), 10 chromophobe (chRCC), and 10 oncocytomas) and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007), PTGS2 (p = 0.002), and RASSF1A (p = 0.0001). CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively), whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004). RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035). In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031) and nuclear grade (p = 0.022), respectively. The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses
Seirin Lee, S.; Gaffney, E. A.
2010-01-01
domains in the presence of gene expression (Gaffney and Monk in Bull. Math. Biol. 68:99-130, 2006). Our results emphasise that gene expression dynamics induce unrealistic behaviour in Turing's model for multiple choices of kinetics and thus such aberrant
Czech Academy of Sciences Publication Activity Database
Šrám, Radim; Beskid, Olena; Binková, Blanka; Chvátalová, Irena; Lněničková, Zdena; Milcová, Alena; Solanský, I.; Tulupová, Elena; Bavorová, H.; Ocadlíková, D.; Farmer, P. B.
2007-01-01
Roč. 620, - (2007), s. 22-33 ISSN 0027-5107 R&D Projects: GA MŽP SI/340/2/00; GA MŽP SL/740/5/03; GA MŽP SL/5/160/05 Grant - others:EU(GB) 2000-00091 Institutional research plan: CEZ:AV0Z50390512 Source of funding: R - rámcový projekt EK Keywords : chromosomal aberrations * cytogenetic analysis * carcinogenic PAHs Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 4.159, year: 2007
Fu, Ssu-Ju; Jeng, Chung-Jiuan; Ma, Chia-Hao; Peng, Yi-Jheng; Lee, Chi-Ming; Fang, Ya-Ching; Lee, Yi-Ching; Tang, Sung-Chun; Hu, Meng-Chun; Tang, Chih-Yung
2017-03-01
Voltage-gated Ca V 2.1 channels comprise a pore-forming α 1A subunit with auxiliary α 2 δ and β subunits. Ca V 2.1 channels play an essential role in regulating synaptic signaling. Mutations in the human gene encoding the Ca V 2.1 subunit are associated with the cerebellar disease episodic ataxia type 2 (EA2). Several EA2-causing mutants exhibit impaired protein stability and exert dominant-negative suppression of Ca V 2.1 wild-type (WT) protein expression via aberrant proteasomal degradation. Here, we set out to delineate the protein degradation mechanism of human Ca V 2.1 subunit by identifying RNF138, an E3 ubiquitin ligase, as a novel Ca V 2.1-binding partner. In neurons, RNF138 and Ca V 2.1 coexist in the same protein complex and display notable subcellular colocalization at presynaptic and postsynaptic regions. Overexpression of RNF138 promotes polyubiquitination and accelerates protein turnover of Ca V 2.1. Disrupting endogenous RNF138 function with a mutant (RNF138-H36E) or shRNA infection significantly upregulates the Ca V 2.1 protein level and enhances Ca V 2.1 protein stability. Disrupting endogenous RNF138 function also effectively rescues the defective protein expression of EA2 mutants, as well as fully reversing EA2 mutant-induced excessive proteasomal degradation of Ca V 2.1 WT subunits. RNF138-H36E coexpression only partially restores the dominant-negative effect of EA2 mutants on Ca V 2.1 WT functional expression, which can be attributed to defective membrane trafficking of Ca V 2.1 WT in the presence of EA2 mutants. We propose that RNF138 plays a critical role in the homeostatic regulation of Ca V 2.1 protein level and functional expression and that RNF138 serves as the primary E3 ubiquitin ligase promoting EA2-associated aberrant degradation of human Ca V 2.1 subunits. SIGNIFICANCE STATEMENT Loss-of-function mutations in the human Ca V 2.1 subunit are linked to episodic ataxia type 2 (EA2), a dominantly inherited disease characterized by
Relationship between promoter methylation & tissue expression of MGMT gene in ovarian cancer
Directory of Open Access Journals (Sweden)
V Shilpa
2014-01-01
Full Text Available Background & objectives: Epigenetic alterations, in addition to multiple gene abnormalities, are involved in the genesis and progression of human cancers. Aberrant methylation of CpG islands within promoter regions is associated with transcriptional inactivation of various tumour suppressor genes. O 6 -methyguanine-DNA methyltransferase (MGMT is a DNA repair gene that removes mutagenic and cytotoxic adducts from the O 6 -position of guanine induced by alkylating agents. MGMT promoter hypermethylation and reduced expression has been found in some primary human carcinomas. We studied DNA methylation of CpG islands of the MGMT gene and its relation with MGMT protein expression in human epithelial ovarian carcinoma. Methods: A total of 88 epithelial ovarian cancer (EOC tissue samples, 14 low malignant potential (LMP tumours and 20 benign ovarian tissue samples were analysed for MGMT promoter methylation by nested methylation-specific polymerase chain reaction (MSP after bisulphite modification of DNA. A subset of 64 EOC samples, 10 LMP and benign tumours and five normal ovarian tissue samples were analysed for protein expression by immunohistochemistry. Results: The methylation frequencies of the MGMT gene promoter were found to be 29.5, 28.6 and 20 per cent for EOC samples, LMP tumours and benign cases, respectively. Positive protein expression was observed in 93.8 per cent of EOC and 100 per cent in LMP, benign tumours and normal ovarian tissue samples. Promoter hypermethylation with loss of protein expression was seen only in one case of EOC. Interpretation & conclusions: Our results suggest that MGMT promoter hypermethylation does not always reflect gene expression.
Insulators form gene loops by interacting with promoters in Drosophila.
Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2011-09-01
Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.
International Nuclear Information System (INIS)
Tsujiuchi, Toshifumi; Shimizu, Kyoko; Onishi, Mariko; Sugata, Eriko; Fujii, Hiromasa; Mori, Toshio; Honoki, Kanya; Fukushima, Nobuyuki
2006-01-01
Lysophosphatidic acid (LPA) is a bioactive phospholipid that stimulates cell proliferation, migration, and protects cells from apoptosis. It interacts with specific G protein-coupled transmembrane receptors. Recently, it has been reported that alterations of LPA receptor expression might be important in the malignant transformation of tumor cells. Therefore, to assess an involvement of DNA methylation in reduced expression of the LPA receptor-1 (lpa1) gene, we investigated the expression of the lpa1 gene and its DNA methylation patterns in rat tumor cell lines. Both rat brain-derived neuroblastoma B103 and liver-derived hepatoma RH7777 cells used in this study indicated no expression of lpa1. For the analysis of methylation status, bisulfite sequencing was performed with B103 and RH7777 cells, comparing with other lpa1 expressed cells and normal tissues of brain and liver. The lpa1 expressed cells and tissues were all unmethylated in this region of lpa1. In contrast, both B103 and RH7777 cells were highly methylated, correlating with reduced expression of the lpa1. Treatment with 5-aza 2'-deoxycytidine induced expression of lpa1 gene in B103 and RH7777 cells after 24 h. In RH7777 cells treated with 5-aza 2'-deoxycytidine, stress fiber formation was also observed in response to LPA in RH7777 cells, but not in untreated RH7777 cells. These results suggest that aberrant DNA methylation of the lpa1 gene may be involved in its reduced expression in rat tumor cells
Graham, Deborah S Cunninghame; Pinder, Christopher L; Tombleson, Philip; Behrens, Timothy W; Martín, Javier; Fairfax, Benjamin P; Knight, Julian C; Chen, Lingyan; Replogle, Joseph; Syvänen, Ann-Christine; Rönnblom, Lars; Graham, Robert R; Wither, Joan E; Rioux, John D; Alarcón-Riquelme, Marta E; Vyse, Timothy J
2015-01-01
Systemic lupus erythematosus (SLE; OMIM 152700) is a genetically complex autoimmune disease characterized by loss of immune tolerance to nuclear and cell surface antigens. Previous genome-wide association studies (GWAS) had modest sample sizes, reducing their scope and reliability. Our study comprised 7,219 cases and 15,991 controls of European ancestry: a new GWAS, meta-analysis with a published GWAS and a replication study. We have mapped 43 susceptibility loci, including 10 novel associations. Assisted by dense genome coverage, imputation provided evidence for missense variants underpinning associations in eight genes. Other likely causal genes were established by examining associated alleles for cis-acting eQTL effects in a range of ex vivo immune cells. We found an over-representation (n=16) of transcription factors among SLE susceptibility genes. This supports the view that aberrantly regulated gene expression networks in multiple cell types in both the innate and adaptive immune response contribute to the risk of developing SLE. PMID:26502338
Aberrations of ERBB2 and TOP2A Genes in Breast Cancer
DEFF Research Database (Denmark)
Nielsen, Kirsten Vang; Müller, Sven; Møller, Susanne
2009-01-01
genes and the other by having amplification of ERBB2 and deletion of TOP2A. The characteristics are compared to findings on paired ERBB2 and TOP2A data from 649 patients with invasive breast cancer from a previously published biomarker study. The physical localization of FISH signals in metaphase...... spreads from cell lines showed that simultaneous amplification is not a simple co-amplification of a whole amplicon containing both genes. Most gene signals are translocated to abnormal marker chromosomes. ERBB2 genes but not TOP2A genes are present in tandem amplicons, leading to a higher ERBB2 ratio....... This observation was confirmed by patient FISH data: among 276 (43% of all patients) abnormal tumors, 67% had different ERBB2 and TOP2A status. ERBB2 amplification with normal TOP2A status was found in 36% of the abnormal tumors (15% of all patients). Simultaneous amplification of both genes was found in 28...
Precise regulation of gene expression dynamics favors complex promoter architectures.
Directory of Open Access Journals (Sweden)
Dirk Müller
2009-01-01
Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.
Yang, Yinhui; Bai, Yang; He, Yundong; Zhao, Yu; Chen, Jiaxiang; Ma, Linlin; Pan, Yunqian; Hinten, Michael; Zhang, Jun; Karnes, R. Jeffrey; Kohli, Manish; Westendorf, Jennifer J.; Li, Benyi; Zhu, Runzhi; Huang, Haojie; Xu, Wanhai
2018-01-01
Purpose Intratumoral androgen synthesis (IAS) is a key mechanism promoting androgen receptor (AR)reactivation and anti-androgen resistance in castration-resistant prostate cancer (CRPC). However, signaling pathways driving aberrant IAS remain poorly understood. Experimental Design The effect of components of the AKT-RUNX2-osteocalcin (OCN)-GPRC6A-CREB signaling axis on expression of steroidogenesis genes CYP11A1 and CYP17A1 and testosterone level were examined in PTEN-null human PCa cell lines. Pten knockout mice were employed to examine the effect of Runx2 heterozygous deletion or abiraterone acetate (ABA), a prodrug of the CYP17A1 inhibitor abiraterone on Cyp11a1 and Cyp17a1 expression, testosterone level and tumor microenvironment (TME) remodeling in vivo. Results We uncovered that activation of the AKT-RUNX2-OCN-GPRC6A-CREB signaling axis induced expression of CYP11A1 and CYP17A1 and testosterone production in PTEN-null PCa cell lines in culture. Deletion of Runx2 in Pten homozygous knockout prostate tumors decreased Cyp11a1 and Cyp17a1 expression, testosterone level and tumor growth in castrated mice. ABA treatment also inhibited testosterone synthesis and alleviated Pten loss-induced tumorigenesis in vivo. Pten deletion induced TME remodeling, but Runx2 heterozygous deletion or ABA treatment reversed the effect of Pten loss by decreasing expression of the collagenase Mmp9. Conclusions Abnormal RUNX2 activation plays a pivotal role in PTEN loss-induced IAS and TME remodeling, suggesting that the identified signaling cascade represents a viable target for effective treatment of PTEN-null PCa including CRPC. PMID:29167276
Archaeal promoter architecture and mechanism of gene activation
DEFF Research Database (Denmark)
Peng, Nan; Ao, Xiang; Liang, Yun Xiang
2011-01-01
element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....
Integrating chromosomal aberrations and gene expression profiles to dissect rectal tumorigenesis
Directory of Open Access Journals (Sweden)
Eilers Paul HC
2008-10-01
Full Text Available Abstract Background Accurate staging of rectal tumors is essential for making the correct treatment choice. In a previous study, we found that loss of 17p, 18q and gain of 8q, 13q and 20q could distinguish adenoma from carcinoma tissue and that gain of 1q was related to lymph node metastasis. In order to find markers for tumor staging, we searched for candidate genes on these specific chromosomes. Methods We performed gene expression microarray analysis on 79 rectal tumors and integrated these data with genomic data from the same sample series. We performed supervised analysis to find candidate genes on affected chromosomes and validated the results with qRT-PCR and immunohistochemistry. Results Integration of gene expression and chromosomal instability data revealed similarity between these two data types. Supervised analysis identified up-regulation of EFNA1 in cases with 1q gain, and EFNA1 expression was correlated with the expression of a target gene (VEGF. The BOP1 gene, involved in ribosome biogenesis and related to chromosomal instability, was over-expressed in cases with 8q gain. SMAD2 was the most down-regulated gene on 18q, and on 20q, STMN3 and TGIF2 were highly up-regulated. Immunohistochemistry for SMAD4 correlated with SMAD2 gene expression and 18q loss. Conclusion On basis of integrative analysis this study identified one well known CRC gene (SMAD2 and several other genes (EFNA1, BOP1, TGIF2 and STMN3 that possibly could be used for rectal cancer characterization.
Synthetic promoter libraries- tuning of gene expression
DEFF Research Database (Denmark)
Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal
2006-01-01
knockout and strong overexpression. However, applications such as metabolic optimization and control analysis necessitate a continuous set of expression levels with only slight increments in strength to cover a specific window around the wildtype expression level of the studied gene; this requirement can......The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene...
Pluripotency Genes and Their Functions in the Normal and Aberrant Breast and Brain
Directory of Open Access Journals (Sweden)
Tracy Seymour
2015-11-01
Full Text Available Pluripotent stem cells (PSCs attracted considerable interest with the successful isolation of embryonic stem cells (ESCs from the inner cell mass of murine, primate and human embryos. Whilst it was initially thought that the only PSCs were ESCs, in more recent years cells with similar properties have been isolated from organs of the adult, including the breast and brain. Adult PSCs in these organs have been suggested to be remnants of embryonic development that facilitate normal tissue homeostasis during repair and regeneration. They share certain characteristics with ESCs, such as an inherent capacity to self-renew and differentiate into cells of the three germ layers, properties that are regulated by master pluripotency transcription factors (TFs OCT4 (octamer-binding transcription factor 4, SOX2 (sex determining region Y-box 2, and homeobox protein NANOG. Aberrant expression of these TFs can be oncogenic resulting in heterogeneous tumours fueled by cancer stem cells (CSC, which are resistant to conventional treatments and are associated with tumour recurrence post-treatment. Further to enriching our understanding of the role of pluripotency TFs in normal tissue function, research now aims to develop optimized isolation and propagation methods for normal adult PSCs and CSCs for the purposes of regenerative medicine, developmental biology, and disease modeling aimed at targeted personalised cancer therapies.
Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter
International Nuclear Information System (INIS)
Dávalos-Salas, Mercedes; Furlan-Magaril, Mayra; González-Buendía, Edgar; Valdes-Quezada, Christian; Ayala-Ortega, Erandi; Recillas-Targa, Félix
2011-01-01
Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing
International Nuclear Information System (INIS)
Ishii, Yutaka
1988-01-01
Chromosomal aberrations are classified into two types, chromosome-type and chromatid-type. Chromosom-type aberrations include terminal deletion, dicentric, ring and interstitial deletion, and chromatid-type aberrations include achromatic lesion, chromatid deletion, isochromatid deletion and chromatid exchange. Clastogens which induce chromosomal aberration are divided into ''S-dependent'' agents and ''S-independent''. It might mean whether they can induce double strand breaks independent of the S phase or not. Double strand breaks may be the ultimate lesions to induce chromosomal aberrations. Caffeine added even in the G 2 phase appeared to modify the frequency of chromatid aberrations induced by X-rays and mitomycin C. Those might suggest that the G 2 phase involves in the chromatid aberration formation. The double strand breaks might be repaired by ''G 2 repair system'', the error of which might yield breakage types of chromatid aberrations and the by-pass of which might yield chromatid exchanges. Chromosome-type aberrations might be formed in the G 1 phase. (author)
Hypomethylation and Aberrant Expression of the Glioma Pathogenesis-Related 1 Gene in Wilms Tumors
Directory of Open Access Journals (Sweden)
Laxmi Chilukamarri
2007-11-01
Full Text Available Wilms tumors (WTs have a complex etiology, displaying genetic and epigenetic changes, including loss of imprinting (LOI and tumor suppressor gene silencing. To identify new regions of epigenetic perturbation in WTs, we screened kidney and tumor DNA using CpG island (CGI tags associated with cancer-specific DNA methylation changes. One such tag corresponded to a paralog of the glioma pathogenesis-related 1/related to testis-specific, vespid, and pathogenesis proteins 1 (GLIPR1/RTVP-1 gene, previously reported to be a tumor-suppressor gene silenced by hypermethylation in prostate cancer. Here we report methylation analysis of the GLIPR1/RTVP-1 gene in WTs and normal fetal and pediatric kidneys. Hypomethylation of the GLIPR1/RTVP-1 5'-region in WTs relative to normal tissue is observed in 21/24 (87.5% of WTs analyzed. Quantitative analysis of GLIPR1/RTVP-1 expression in 24 WTs showed elevated transcript levels in 16/24 WTs (67%, with 12 WTs displaying in excess of 20-fold overexpression relative to fetal kidney (FK control samples. Immunohistochemical analysis of FK and WT corroborates the RNA expression data and reveals high GLIPR1/RTVP-1 in WT blastemal cells together with variable levels in stromal and epithelial components. Hypomethylation is also evident in the WT precursor lesions and nephrogenic rests (NRs, supporting a role for GLIPR1/RTVP-1 deregulation early in Wilms tumorigenesis. Our data show that, in addition to gene dosage changes arising from LOI and hypermethylation-induced gene silencing, gene activation resulting from hypomethylation is also prevalent in WTs.
Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data
DEFF Research Database (Denmark)
Kannan, Soumya; Sams, Thomas; Maury, Jérôme
2018-01-01
activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...
Niu, Jihong; Li, Henan; Zhang, Yao; Li, Jinlan; Xie, Min; Li, Lingdi; Qin, Xiaoying; Qin, Yazhen; Guo, Xiaohuan; Jiang, Qian; Liu, Yanrong; Chen, Shanshan; Huang, Xiaojun; Han, Wenling; Ruan, Guorui
2011-06-01
CMTM5 has been shown to exhibit tumor suppressor activities, however, its role in leukemia is unclear. Herein we firstly reported the expression and function of CMTM5 in myeloid leukemia. CMTM5 was down-regulated, or undetectable, in leukemia cell lines and bone marrow cells from leukemia patients with promoter methylation. Ectopic expression of CMTM5-v1 strongly inhibited the proliferation of K562 and MEG-01 cells. In addition, significant negative correlations were observed between CMTM5 and three leukemia-specific fusion genes (AML1-ETO, PML-RARα and BCR/ABL1). CMTM5 expression was up-regulated in patients who had undergone treatment. Therefore, CMTM5 may be involved in the pathomechanism of myeloid leukemias. Copyright © 2010 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Wilding, Craig S.; Relton, Caroline L.; Rees, Gwen S.; Tarone, Robert E.; Whitehouse, Caroline A.; Tawn, E. Janet
2005-01-01
Polymorphic variation in DNA repair genes was examined in a group of retired workers from the British Nuclear Fuels plc facility at Sellafield in relation to previously determined translocation frequencies in peripheral blood lymphocytes. Variation at seven polymorphisms in four genes involved in the base excision repair (XRCC1 R194W, R399Q and a [AC] n microsatellite in the 3' UTR) and double strand break repair (XRCC3 T241M and a [AC] n microsatellite in intron 3 of XRCC3, XRCC4 I134T, and a GACTAn microsatellite located 120kb 5' of XRCC5) pathways was determined for 291 retired radiation workers who had received cumulative occupational external radiation doses of between 0 and 1873mSv. When the interaction between radiation dose and each DNA repair gene polymorphism was examined in relation to translocation frequency there was no evidence for any of the polymorphisms studied influencing the response to occupational exposure. A positive interaction observed between genotype (individuals with at least one allele >=20 repeat units) at a microsatellite locus in the XRCC3 gene and smoking status should be interpreted cautiously because interactions were investigated for seven polymorphisms and two exposures. Nonetheless, further research is warranted to examine whether this DNA repair gene variant might be associated with a sub-optimal repair response to smoking-induced DNA damage and hence an increased frequency of translocations
Directory of Open Access Journals (Sweden)
Rosner William
2009-05-01
Full Text Available Abstract Background Human sex hormone-binding globulin (SHBG regulates free sex steroid concentrations in plasma and modulates rapid, membrane based steroid signaling. SHBG is encoded by an eight exon-long transcript whose expression is regulated by a downstream promoter (PL. The SHBG gene was previously shown to express a second major transcript of unknown function, derived from an upstream promoter (PT, and two minor transcripts. Results We report that transcriptional expression of the human SHBG gene is far more complex than previously described. PL and PT direct the expression of at least six independent transcripts each, resulting from alternative splicing of exons 4, 5, 6, and/or 7. We mapped two transcriptional start sites downstream of PL and PT, and present evidence for a third SHBG gene promoter (PN within the neighboring FXR2 gene; PN regulates the expression of at least seven independent SHBG gene transcripts, each possessing a novel, 164-nt first exon (1N. Transcriptional expression patterns were generated for human prostate, breast, testis, liver, and brain, and the LNCaP, MCF-7, and HepG2 cell lines. Each expresses the SHBG transcript, albeit in varying abundance. Alternative splicing was more pronounced in the cancer cell lines. PL- PT- and PN-derived transcripts were most abundant in liver, testis, and prostate, respectively. Initial findings reveal the existence of a smaller immunoreactive SHBG species in LNCaP, MCF-7, and HepG2 cells. Conclusion These results extend our understanding of human SHBG gene transcription, and raise new and important questions regarding the role of novel alternatively spliced transcripts, their function in hormonally responsive tissues including the breast and prostate, and the role that aberrant SHBG gene expression may play in cancer.
Directory of Open Access Journals (Sweden)
Chia-Hsin Chen
Full Text Available Human p29 is a putative component of spliceosomes, but its role in pre-mRNA is elusive. By siRNA knockdown and stable overexpression, we demonstrated that human p29 is involved in DNA damage response and Fanconi anemia pathway in cultured cells. In this study, we generated p29 knockout mice (mp29(GT/GT using the mp29 gene trap embryonic stem cells to study the role of mp29 in DNA damage response in vivo. Interruption of mp29 at both alleles resulted in embryonic lethality. Embryonic abnormality occurred as early as E6.5 in mp29(GT/GT mice accompanied with decreased mRNA levels of α-tubulin and Chk1. The reduction of α-tubulin and Chk1 mRNAs is likely due to an impaired post-transcriptional event. An aberrant G2/M checkpoint was found in mp29 gene trap embryos when exposed to aphidicolin and UV light. This embryonic lethality was rescued by crossing with mp29 transgenic mice. Additionally, the knockdown of zfp29 in zebrafish resulted in embryonic death at 72 hours of development postfertilization (hpf. A lower level of acetylated α-tubulin was also observed in zfp29 morphants. Together, these results illustrate an indispensable role of mp29 in DNA checkpoint response during embryonic development.
A novel aberrant splicing mutation of the PEX16 gene in two patients with Zellweger syndrome
Shimozawa, Nobuyuki; Nagase, Tomoko; Takemoto, Yasuhiko; Suzuki, Yasuyuki; Fujiki, Yukio; Wanders, Ronald J. A.; Kondo, Naomi
2002-01-01
Human Pex16p, a peroxisomal membrane protein composed of 336 amino acids, plays a central role in peroxisomal membrane biogenesis. A nonsense mutation (R176ter) in the PEX16 gene has been reported in the case of only one patient (D-01) belonging to complementation group D of the peroxisome
As we enter the era of precision medicine, characterization of cancer genomes will directly influence therapeutic decisions in the clinic. Here we describe a platform enabling functionalization of rare gene mutations through their high-throughput construction, molecular barcoding and delivery to cancer models for in vivo tumour driver screens. We apply these technologies to identify oncogenic drivers of pancreatic ductal adenocarcinoma (PDAC).
Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.
Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T
2018-03-16
Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.
DEFF Research Database (Denmark)
Jørgensen, Charlotte Lt; Ejlertsen, Bent; Bjerre, Karsten D
2013-01-01
according to gene status were investigated by subgroup analyses, and the Wald test was applied. All statistical tests were two-sided. Results FISH analysis for both RRM1 and RRM2B was successful in 251 patients. RRM1 and RRM2B aberrations (deletions and amplifications) were observed in 15.9% and 13...... was not different by gene status. No significant differences were detected in TTP or OS within subgroups according to gene status and chemotherapy regimen. Conclusions This study demonstrated the presence of RRM1 and RRM2B copy number changes in primary breast tumor specimens. Nevertheless, we found no support...... of the hypothesis that aberrations of RRM1 or RRM2B, neither individually nor in combination, are associated with an altered clinical outcome following chemotherapy with gemcitabine in combination with docetaxel compared to docetaxel alone in advanced breast cancer patients....
CpG promoter methylation of the ALKBH3 alkylation repair gene in breast cancer.
Stefansson, Olafur Andri; Hermanowicz, Stefan; van der Horst, Jasper; Hilmarsdottir, Holmfridur; Staszczak, Zuzanna; Jonasson, Jon Gunnlaugur; Tryggvadottir, Laufey; Gudjonsson, Thorkell; Sigurdsson, Stefan
2017-07-05
DNA repair of alkylation damage is defective in various cancers. This occurs through somatically acquired inactivation of the MGMT gene in various cancer types, including breast cancers. In addition to MGMT, the two E. coli AlkB homologs ALKBH2 and ALKBH3 have also been linked to direct reversal of alkylation damage. However, it is currently unknown whether ALKBH2 or ALKBH3 are found inactivated in cancer. Methylome datasets (GSE52865, GSE20713, GSE69914), available through Omnibus, were used to determine whether ALKBH2 or ALKBH3 are found inactivated by CpG promoter methylation. TCGA dataset enabled us to then assess the impact of CpG promoter methylation on mRNA expression for both ALKBH2 and ALKBH3. DNA methylation analysis for the ALKBH3 promoter region was carried out by pyrosequencing (PyroMark Q24) in 265 primary breast tumours and 30 proximal normal breast tissue samples along with 8 breast-derived cell lines. ALKBH3 mRNA and protein expression were analysed in cell lines using RT-PCR and Western blotting, respectively. DNA alkylation damage assay was carried out in cell lines based on immunofluorescence and confocal imaging. Data on clinical parameters and survival outcomes in patients were obtained and assessed in relation to ALKBH3 promoter methylation. The ALKBH3 gene, but not ALKBH2, undergoes CpG promoter methylation and transcriptional silencing in breast cancer. We developed a quantitative alkylation DNA damage assay based on immunofluorescence and confocal imaging revealing higher levels of alkylation damage in association with epigenetic inactivation of the ALKBH3 gene (P = 0.029). In our cohort of 265 primary breast cancer, we found 72 cases showing aberrantly high CpG promoter methylation over the ALKBH3 promoter (27%; 72 out of 265). We further show that increasingly higher degree of ALKBH3 promoter methylation is associated with reduced breast-cancer specific survival times in patients. In this analysis, ALKBH3 promoter methylation at >20
DEFF Research Database (Denmark)
Södersten, Erik; Feyder, Michael; Lerdrup, Mads
2014-01-01
. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation....... The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP) experiments showed that increased H3K27me3S28p...
Firefly luciferase gene contains a cryptic promoter
Czech Academy of Sciences Publication Activity Database
Vopálenský, V.; Mašek, T.; Horváth, Ondřej; Vicenová, B.; Mokrejš, M.; Pospíšek, M.
2008-01-01
Roč. 14, č. 9 (2008), s. 1720-1729 ISSN 1355-8382 Grant - others:GAČR(CZ) GA204/03/1487; GAČR(CZ) GA301/07/0607; Mšk(CZ) LC06066 Program:LC Institutional research plan: CEZ:AV0Z50520514 Keywords : luciferase * cryptic promoter * hepatitis C virus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.018, year: 2008
miRNA Gene Promoters Are Frequent Targets of Aberrant DNA Methylation in Human Breast Cancer
Czech Academy of Sciences Publication Activity Database
Vrba, Lukáš; Munoz-Rodriguez, J.L.; Stampfer, M.R.; Futscher, B. W.
2013-01-01
Roč. 8, č. 1 (2013), e54398 E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : Tumor-Suppressor * feedback loop * microRNAs Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013
Congenital analbuminemia caused by a novel aberrant splicing in the albumin gene.
Caridi, Gianluca; Dagnino, Monica; Erdeve, Omer; Di Duca, Marco; Yildiz, Duran; Alan, Serdar; Atasay, Begum; Arsan, Saadet; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo
2014-01-01
Congenital analbuminemia is a rare autosomal recessive disorder manifested by the presence of a very low amount of circulating serum albumin. It is an allelic heterogeneous defect, caused by variety of mutations within the albumin gene in homozygous or compound heterozygous state. Herein we report the clinical and molecular characterization of a new case of congenital analbuminemia diagnosed in a female newborn of consanguineous (first degree cousins) parents from Ankara, Turkey, who presented with a low albumin concentration (A transition at position c.1652+1, the first base of intron 12, which inactivates the strongly conserved GT dinucleotide at the 5' splice site consensus sequence of this intron. The splicing defect results in the complete skipping of the preceding exon (exon 12) and in a frame-shift within exon 13 with a premature stop codon after the translation of three mutant amino acid residues. Our results confirm the clinical diagnosis of congenital analbuminemia in the proband and the inheritance of the trait and contribute to shed light on the molecular genetics of analbuminemia.
Scarpa, Marco; Scarpa, Melania; Castagliuolo, Ignazio; Erroi, Francesca; Kotsafti, Andromachi; Basato, Silvia; Brun, Paola; D'Incà, Renata; Rugge, Massimo; Angriman, Imerio; Castoro, Carlo
2016-03-01
BACKGROUND PROMOTER: hypermethylation plays a major role in cancer through transcriptional silencing of critical genes. The aim of our study is to evaluate the methylation status of these genes in the colonic mucosa without dysplasia or adenocarcinoma at the different steps of sporadic and UC-related carcinogenesis and to investigate the possible role of genomic methylation as a marker of CRC. The expression of Dnmts 1 and 3A was significantly increased in UC-related carcinogenesis compared to non inflammatory colorectal carcinogenesis. In non-neoplastic colonic mucosa, the number of methylated genes resulted significantly higher in patients with CRC and in those with UC-related CRC compared to the HC and UC patients and patients with dysplastic lesion of the colon. The number of methylated genes in non-neoplastic colonic mucosa predicted the presence of CRC with good accuracy either in non inflammatory and inflammatory related CRC. Colonic mucosal samples were collected from healthy subjects (HC) (n = 30) and from patients with ulcerative colitis (UC) (n = 29), UC and dysplasia (n = 14), UC and cancer (n = 10), dysplastic adenoma (n = 14), and colon adenocarcinoma (n = 10). DNA methyltransferases-1, -3a, -3b, mRNA expression were quantified by real time qRT-PCR. The methylation status of CDH13, APC, MLH1, MGMT1 and RUNX3 gene promoters was assessed by methylation-specific PCR. Methylation status of APC, CDH13, MGMT, MLH1 and RUNX3 in the non-neoplastic mucosa may be used as a marker of CRC: these preliminary results could allow for the adjustment of a patient's surveillance interval and to select UC patients who should undergo intensive surveillance.
International Nuclear Information System (INIS)
Wang, Shumin; Ma, Ning; Murata, Mariko; Huang, Guangwu; Zhang, Zhe; Xiao, Xue; Zhou, Xiaoying; Huang, Tingting; Du, Chunping; Yu, Nana; Mo, Yingxi; Lin, Longde; Zhang, Jinyan
2010-01-01
Epigenetic silencing of tumor suppressor genes play important roles in NPC tumorgenesis. Tissue factor pathway inhibitor-2 (TFPI-2), is a protease inhibitor. Recently, TFPI-2 was suggested to be a tumor suppressor gene involved in tumorigenesis and metastasis in some cancers. In this study, we investigated whether TFPI-2 was inactivated epigenetically in nasopharyngeal carcinoma (NPC). Transcriptional expression levels of TFPI-2 was evaluated by RT-PCR. Methylation status were investigated by methylation specific PCR and bisulfate genomic sequencing. The role of TFPI-2 as a tumor suppressor gene in NPC was addressed by re-introducing TFPI-2 expression into the NPC cell line CNE2. TFPI-2 mRNA transcription was inactivated in NPC cell lines. TFPI-2 was aberrantly methylated in 66.7% (4/6) NPC cell lines and 88.6% (62/70) of NPC primary tumors, but not in normal nasopharyngeal epithelia. TFPI-2 expression could be restored in NPC cells after demethylation treatment. Ectopic expression of TFPI-2 in NPC cells induced apoptosis and inhibited cell proliferation, colony formation and cell migration. Epigenetic inactivation of TFPI-2 by promoter hypermethylation is a frequent and tumor specific event in NPC. TFPI-2 might be considering as a putative tumor suppressor gene in NPC
Ivanova, T I; Kondrashova, T V; Krikunova, L I; Smirnova, I A; Shentereva, N I; Sychenkova, N I; Rykova, E V; Zharikova, I A; Khorokhorina, V A; Riabchenko, N I; Zamulaeva, I A
2010-01-01
The association between polymorphisms in genes COMT, HFE that takes part in oxidative stress regulation, and chromosome aberration frequency in lymphocytes was assessed in 278 female residents of radiation polluted regions of Central Russia: Bryansk (322 kBk/m2) and Tula Districts (137Cs - 171 kBk/m2). The C187G, G845A genotyping of HFE and G1947A (H/L) of COMT was done by means of polymerase chain reaction-restriction fragment length polymorphism. Studied population was divided into 3 subgroups by level of chromosome aberrations per cell (0-2, 3-4, >5). There was shown statistically significant difference in distribution of COMTand HFE genotypes between the groups. The high frequency of chromosome aberrations (> or = 5%) was associated with homozygotes of the high activity COMT G/G and HFE CC. Heterozygotes for G1947A COMT and C187G HFE reveal negative association with the high frequency of chromosome aberrations and correspond to "resistance factors".
Directory of Open Access Journals (Sweden)
Steven D Sheridan
Full Text Available Fragile X syndrome (FXS is the most common inherited cause of intellectual disability. In addition to cognitive deficits, FXS patients exhibit hyperactivity, attention deficits, social difficulties, anxiety, and other autistic-like behaviors. FXS is caused by an expanded CGG trinucleotide repeat in the 5' untranslated region of the Fragile X Mental Retardation (FMR1 gene leading to epigenetic silencing and loss of expression of the Fragile X Mental Retardation protein (FMRP. Despite the known relationship between FMR1 CGG repeat expansion and FMR1 silencing, the epigenetic modifications observed at the FMR1 locus, and the consequences of the loss of FMRP on human neurodevelopment and neuronal function remain poorly understood. To address these limitations, we report on the generation of induced pluripotent stem cell (iPSC lines from multiple patients with FXS and the characterization of their differentiation into post-mitotic neurons and glia. We show that clones from reprogrammed FXS patient fibroblast lines exhibit variation with respect to the predominant CGG-repeat length in the FMR1 gene. In two cases, iPSC clones contained predominant CGG-repeat lengths shorter than measured in corresponding input population of fibroblasts. In another instance, reprogramming a mosaic patient having both normal and pre-mutation length CGG repeats resulted in genetically matched iPSC clonal lines differing in FMR1 promoter CpG methylation and FMRP expression. Using this panel of patient-specific, FXS iPSC models, we demonstrate aberrant neuronal differentiation from FXS iPSCs that is directly correlated with epigenetic modification of the FMR1 gene and a loss of FMRP expression. Overall, these findings provide evidence for a key role for FMRP early in human neurodevelopment prior to synaptogenesis and have implications for modeling of FXS using iPSC technology. By revealing disease-associated cellular phenotypes in human neurons, these iPSC models will aid
A novel BDNF gene promoter directs expression to skeletal muscle
Directory of Open Access Journals (Sweden)
Heinrich Gerhard
2003-06-01
Full Text Available Abstract Background Cell-specific expression of the gene that encodes brain-derived neurotrophic factor (BDNF is required for the normal development of peripheral sensory neurons and efficient synaptic transmission in the mature central and peripheral nervous system. The control of BDNF gene expression involves multiple tissue and cell-specific promoters that are differentially regulated. The molecular mechanisms that are responsible for tissue and cell-specific expression of these promoters are still incompletely understood. Results The cloning and analysis of three additional zebrafish (Danio rerio BDNF gene exons and two associated promoters, is reported. Among them are two exons that generate a novel tripartite mature transcript. The exons were located on the transcription unit, whose overall organization was determined by cloning, Southern blot hybridization and sequence analysis, and compared with the pufferfish (Fugu rubripes and mammalian BDNF loci, revealing a conserved but more compact organization. Structural and functional analysis of the exons, their adjacent promoters and 5' flanks, showed that they are expressed cell-specifically. The promoter associated with the 5' exon of the tripartite transcript is GC-rich, TATA-less and the 5' flank adjacent to it contains multiple Sp1, Mef2, and AP1 elements. A fusion gene containing the promoter and 1.5 KB of 5' flank is directed exclusively to skeletal muscle of transiently transfected embryos. The second promoter, whose associated 5' exon contains a 25-nucleotide segment of identity with a mammalian BDNF gene exon, was transiently expressed in yolk of the early embryo. RT-PCR analysis of total RNA from whole juvenile fish and adult female skeletal muscle revealed tissue-specific expression of the 5' exons but the novel exon could not be detected even after two rounds of nested PCR. Conclusion The zebrafish BDNF gene is as complex as the mammalian gene yet much more compact. Its exons are
Mechanosensitive promoter region in the human HB-GAM gene
DEFF Research Database (Denmark)
Liedert, Astrid; Kassem, Moustapha; Claes, Lutz
2009-01-01
Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...
DNA methylation of PTEN gene promoter region is not correlated ...
African Journals Online (AJOL)
Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...
Interleukin-10 gene promoter polymorphism as a potential host ...
African Journals Online (AJOL)
10) gene have been associated with altered levels of circulating IL-10, a Th2 cytokine that plays a key role in the pathogenesis of TB. We analyzed the frequencies of IL-10 promoter polymorphisms in 82 TB patients and 99 healthy Pakistani ...
Interleukin 10 gene promoter polymorphism and risk of diffuse large ...
African Journals Online (AJOL)
Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...
Directory of Open Access Journals (Sweden)
Yiwen Xiang
Full Text Available BACKGROUND: Lactic acid, a natural by-product of glycolysis, is produced at excess levels in response to impaired mitochondrial function, high-energy demand, and low oxygen availability. The enzyme involved in the production of β-amyloid peptide (Aβ of Alzheimer's disease, BACE1, functions optimally at lower pH, which led us to investigate a potential role of lactic acid in the processing of amyloid precursor protein (APP. METHODOLOGY/PRINCIPAL FINDINGS: Lactic acid increased levels of Aβ40 and 42, as measured by ELISA, in culture medium of human neuroblastoma cells (SH-SY5Y, whereas it decreased APP metabolites, such as sAPPα. In cell lysates, APP levels were increased and APP was found to interact with ER-chaperones in a perinuclear region, as determined by co-immunoprecipitation and fluorescence microscopy studies. Lactic acid had only a very modest effect on cellular pH, did increase the levels of ER chaperones Grp78 and Grp94 and led to APP aggregate formation reminiscent of aggresomes. CONCLUSIONS/SIGNIFICANCE: These findings suggest that sustained elevations in lactic acid levels could be a risk factor in amyloidogenesis related to Alzheimer's disease through enhanced APP interaction with ER chaperone proteins and aberrant APP processing leading to increased generation of amyloid peptides and APP aggregates.
Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters.
Mishra, Avinash; Tanna, Bhakti
2017-01-01
Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile , and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters ( NHX, SOS, HKT, VTPase ), ion channels (Cl - , Ca 2+ , aquaporins), antioxidant encoding genes ( APX, CAT, GST, BADH, SOD ) and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes). It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.
Halophytes: Potential Resources for Salt Stress Tolerance Genes and Promoters
Directory of Open Access Journals (Sweden)
Avinash Mishra
2017-05-01
Full Text Available Halophytes have demonstrated their capability to thrive under extremely saline conditions and thus considered as one of the best germplasm for saline agriculture. Salinity is a worldwide problem, and the salt-affected areas are increasing day-by-day because of scanty rainfall, poor irrigation system, salt ingression, water contamination, and other environmental factors. The salinity stress tolerance mechanism is a very complex phenomenon, and some pathways are coordinately linked for imparting salinity tolerance. Though a number of salt responsive genes have been reported from the halophytes, there is always a quest for promising stress-responsive genes that can modulate plant physiology according to the salt stress. Halophytes such as Aeluropus, Mesembryanthemum, Suaeda, Atriplex, Thellungiella, Cakile, and Salicornia serve as a potential candidate for the salt-responsive genes and promoters. Several known genes like antiporters (NHX, SOS, HKT, VTPase, ion channels (Cl−, Ca2+, aquaporins, antioxidant encoding genes (APX, CAT, GST, BADH, SOD and some novel genes such as USP, SDR1, SRP etc. were isolated from halophytes and explored for developing stress tolerance in the crop plants (glycophytes. It is evidenced that stress triggers salt sensors that lead to the activation of stress tolerance mechanisms which involve multiple signaling proteins, up- or down-regulation of several genes, and finally the distinctive or collective effects of stress-responsive genes. In this review, halophytes are discussed as an excellent platform for salt responsive genes which can be utilized for developing salinity tolerance in crop plants through genetic engineering.
Seirin Lee, S.
2010-03-23
Turing\\'s pattern formation mechanism exhibits sensitivity to the details of the initial conditions suggesting that, in isolation, it cannot robustly generate pattern within noisy biological environments. Nonetheless, secondary aspects of developmental self-organisation, such as a growing domain, have been shown to ameliorate this aberrant model behaviour. Furthermore, while in-situ hybridisation reveals the presence of gene expression in developmental processes, the influence of such dynamics on Turing\\'s model has received limited attention. Here, we novelly focus on the Gierer-Meinhardt reaction diffusion system considering delays due the time taken for gene expression, while incorporating a number of different domain growth profiles to further explore the influence and interplay of domain growth and gene expression on Turing\\'s mechanism. We find extensive pathological model behaviour, exhibiting one or more of the following: temporal oscillations with no spatial structure, a failure of the Turing instability and an extreme sensitivity to the initial conditions, the growth profile and the duration of gene expression. This deviant behaviour is even more severe than observed in previous studies of Schnakenberg kinetics on exponentially growing domains in the presence of gene expression (Gaffney and Monk in Bull. Math. Biol. 68:99-130, 2006). Our results emphasise that gene expression dynamics induce unrealistic behaviour in Turing\\'s model for multiple choices of kinetics and thus such aberrant modelling predictions are likely to be generic. They also highlight that domain growth can no longer ameliorate the excessive sensitivity of Turing\\'s mechanism in the presence of gene expression time delays. The above, extensive, pathologies suggest that, in the presence of gene expression, Turing\\'s mechanism would generally require a novel and extensive secondary mechanism to control reaction diffusion patterning. © 2010 Society for Mathematical Biology.
The human oxytocin gene promoter is regulated by estrogens.
Richard, S; Zingg, H H
1990-04-15
Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be
Directory of Open Access Journals (Sweden)
Mozhgan Rasti
2009-06-01
Full Text Available Background: Aberrant methylation of cytosine-guanine dinucleotideislands leads to inactivation of tumor suppressorgenes in breast cancer. Tumor suppressor genes are unmethylatedin normal tissue and often become hypermethylatedduring tumor formation, leading to gene silencing. We investigatedthe association between E-cadherin (CDH1 and estrogenreceptor-α (ESRα gene promoter methylation andmajor clinical and pathological features of breast cancer inIranian women.Methods: DNA was extracted from 67 primary breast tumorsand gene promoter methylation was analyzed by methylationspecificpolymerase chain reaction method.Results: Fifty percent of the samples showed aberrant methylationin at least one of the two tested loci. We detectedCDH1 hypermethylation in 41% of invasive tumors and receptor-α gene hypermethylation in 18% of invasive tumorsamples. We found no association between CDH1 and receptor-α gene hypermethylation (P=0.45. There was a correlationbetween hypermethylation of CDH1 locus and tumorsize ≥5 cm (P=0.019.Conclusion: Our data suggest that the malignant progressionof human ductal and lobular breast carcinoma in Iranianwomen involves a heterogeneous pattern of cytosine-guaninedinucleotide island hypermethylation of the CDH1 gene.
Promoter DNA hypermethylation and gene repression in undifferentiated Arabidopsis cells.
Directory of Open Access Journals (Sweden)
María Berdasco
Full Text Available Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells.
Pierre, Fabrice; Taché, Sylviane; Petit, Claude R; Van Der Meer, Roelof; Corpet, Denis E
2003-01-01
High intake of red meat, but not of white meat, is associated with an increased risk of colon cancer. However, red meat does not promote cancer in rodents. Haemin, added to low-calcium diets, increases colonic proliferation, and haemoglobin, added to high-fat diets, increases the colon tumour incidence in rats, an effect possibly due to peroxyl radicals. We thus speculated that haem might be the promoting agent in meat, and that prevention strategies could use calcium and antioxidants. These hypotheses were tested in rats at the aberrant crypt foci (ACF) stage at 100 days. F344 rats (n=124) were given an injection of azoxymethane and were then randomised to 11 groups fed with low-calcium (20μmol/g) AIN76-based diets, containing 5% safflower oil. Haemin (0.25, 0.5 and 1.5μmol/g) or haemoglobin (1.5 and 3 μmol haem/g) was added to five experimental diets, compared to a control diet without haem. Three other high-haemin diets (1.5μmol/g) were supplemented with calcium (250μmol/g), antioxidant butylated hydroxyanisole and rutin (0.05% each), and olive oil, which replaced safflower oil. Faecal water was assayed for lipid peroxidation by thiobarbituric acid reactive substances (TBARs) test, and for cytolytic activity. Haemin strikingly increased the ACF size, dose-dependently, from 2.6 to 11.4 crypts/ACF (all p<0.001). The high-haemin diet also increased the number of ACF per colon (p<0.001). Promotion was associated with increased faecal water TBARs and cytotoxicity. Calcium, olive oil, and antioxidants each inhibited the haemin-induced ACF promotion, and normalised the faecal TBARs and cytotoxicity. The haemoglobin diets increased the number of ACF and faecal TBARs, but not the ACF size or the faecal cytotoxicity. In conclusion, dietary haemin is the most potent known ACF promoter. Haemoglobin is also a potent promoter of colorectal carcinogenesis. The results suggest that myoglobin in red meat could promote colon cancer. Diets high in calcium, or in oxidation
DEFF Research Database (Denmark)
Thomassen, Mads; Tan, Qihua; Burton, Mark
2013-01-01
Background: Breast tumors have been described by molecular subtypes characterized by pervasively different gene expression profiles. The subtypes are associated with different clinical parameters and origin of precursor cells. However, the biological pathways and chromosomal aberrations that differ...... the subgroups impact metastasis. Results: We have scrutinized publicly available gene expression datasets and identified molecular subtypes in 1,394 breast tumors with outcome data. By analysis of chromosomal regions and pathways using “Gene set enrichment analysis” followed by a meta-analysis, we identified...... between the subgroups are less well characterized. The molecular subtypes are associated with different risk of metastatic recurrence of the disease. Nevertheless, the performance of these overall patterns to predict outcome is far from optimal, suggesting that biological mechanisms that extend beyond...
Yanagi, Tadahiro; Mizuochi, Tatsuki; Takaki, Yugo; Eda, Keisuke; Mitsuyama, Keiichi; Ishimura, Masataka; Takada, Hidetoshi; Shouval, Dror S; Griffith, Alexandra E; Snapper, Scott B; Yamashita, Yushiro; Yamamoto, Ken
2016-01-28
Although deleterious mutations in interleukin-10 and its receptor molecules cause severe infantile-onset inflammatory bowel disease, there are no reports of mutations affecting this signaling pathway in Japanese patients. Here we report a novel exonic mutation in the IL10RA gene that caused unique splicing aberrations in a Japanese patient with infantile-onset of inflammatory bowel disease in association with immune thrombocytopenic purpura and a transient clinical syndrome mimicking juvenile myelomonocytic leukemia. A Japanese boy, who was the first child of non-consanguineous healthy parents, developed bloody diarrhea, perianal fistula, and folliculitis in early infancy and was diagnosed with inflammatory bowel disease. He also developed immune thrombocytopenic purpura and transient features mimicking juvenile myelomonocytic leukemia. The patient failed to respond to various treatments, including elemental diet, salazosulfapyridine, metronidazole, corticosteroid, infliximab, and adalimumab. We identified a novel mutation (c.537G > A, p.T179T) in exon 4 of the IL10RA gene causing unique splicing aberrations and resulting in lack of signaling through the interleukin-10 receptor. At 21 months of age, the patient underwent allogeneic hematopoietic stem cell transplantation and achieved clinical remission. We describe a novel exonic mutation in the IL10RA gene resulting in infantile-onset inflammatory bowel disease. This mutation might also be involved in his early-onset hematologic disorders. Physicians should be familiar with the clinical phenotype of IL-10 signaling defects in order to enable prompt diagnosis at an early age and referral for allogeneic hematopoietic stem cell transplantation.
Genes that cooperate with tumor promoters in transformation
International Nuclear Information System (INIS)
Colburn, N.H.; Smith, B.M.
1988-01-01
Tumor-promoting phorbol esters, like growth factors, elicit pleiotropic responses involving biochemical pathways that lead to different biological responses. Genetic variant cell lines that are resistant to mitogenic, differentiation, or transformation responses to tumor promoters have been valuable tools for understanding the molecular bases of these responses. Studies using the mouse epidermal JB6 cell lines that are sensitive or resistant to tumor promoter-induced transformation have yielded new understanding of genetic and signal transduction events involved in neoplastic transformation. The isolation and characterization of cloned mouse promotion sensitivity genes pro-1 and pro-2 is reviewed. A new activity of pro-1 has been identified: when transfected into human cancer prone basal cell nevus syndrome fibroblasts but not normal fibroblasts mouse pro-1 confers lifespan extension of these cells. Recently, we have found tat a pro-1 homolog from a library of nasopharyngeal carcinoma, but not the homolog from a normal human library, is activated for transferring promotion sensitivity. The many genetic variants for responses to tumor promoters have also proved valuable for signal transduction studies. JPB P- cells fail to show the 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced syntheses of two proteins of 15 and 16 kD seen in P+ cells. P-, P+, and TPA transformed cells show a progressive decrease in both basal and TPA-inducible levels of a protein kinase C substrate of 80 kD. P- cells are relatively resistant both to anchorage-independent transformation and to a protein band shift induced by the calcium analog lanthanum. It appears that one or more calcium-binding proteins and one or more pro genes may be critical determinants of tumor promoter-induced neoplastic transformation
Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing
2011-12-01
Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and
Gene activation regresses atherosclerosis, promotes health, and enhances longevity
Directory of Open Access Journals (Sweden)
Luoma Pauli V
2010-07-01
Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.
Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters
2016-08-01
levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential
The altered promoter methylation of oxytocin receptor gene in autism.
Elagoz Yuksel, Mine; Yuceturk, Betul; Karatas, Omer Faruk; Ozen, Mustafa; Dogangun, Burak
Autism spectrum disorder (ASD) is one of the lifelong existing disorders. Abnormal methylation status of gene promoters of oxytonergic system has been implicated as among the etiologic factors of ASDs. We, therefore, investigated the methylation frequency of oxytocin receptor gene (OXTR) promoter from peripheral blood samples of children with autistic features. Our sample includes 66 children in total (22-94 months); 27 children with ASDs according to the DSM-IV-TR and the Childhood Autism Rating Scale (CARS) and 39 children who do not have any autistic like symptoms as the healthy control group. We investigated the DNA methylation status of OXTR promoter by methylation specific enzymatic digestion of genomic DNA and polymerase chain reaction. A significant relationship has been found between ASDs and healthy controls for the reduction of methylation frequency of the regions MT1 and MT3 of OXTR. We could not find any association in the methylation frequency of MT2 and MT4 regions of OXTR. Although our findings indicate high frequency of OXTR promoter hypomethylation in ASDs, there is need for independent replication of the results for a bigger sample set. We expect that future studies with the inclusion of larger, more homogeneous samples will attempt to disentangle the causes of ASDs.
Optical Aberrations and Wavefront
Directory of Open Access Journals (Sweden)
Nihat Polat
2014-08-01
Full Text Available The deviation of light to create normal retinal image in the optical system is called aberration. Aberrations are divided two subgroup: low-order aberrations (defocus: spherical and cylindrical refractive errors and high-order aberrations (coma, spherical, trefoil, tetrafoil, quadrifoil, pentafoil, secondary astigmatism. Aberrations increase with aging. Spherical aberrations are compensated by positive corneal and negative lenticular spherical aberrations in youth. Total aberrations are elevated by positive corneal and positive lenticular spherical aberrations in elderly. In this study, we aimed to analyze the basic terms regarding optic aberrations which have gained significance recently. (Turk J Ophthalmol 2014; 44: 306-11
BRAF mutation-specific promoter methylation of FOX genes in colorectal cancer
E.H.J. van Roon (Eddy); A. Boot (Arnoud); A.A. Dihal (Ashwin); R.F. Ernst (Robert); T. van Wezel (Tom); H. Morreau (Hans); J.M. Boer (Judith)
2013-01-01
textabstractBackground: Cancer-specific hypermethylation of (promoter) CpG islands is common during the tumorigenesis of colon cancer. Although associations between certain genetic aberrations, such as BRAF mutation and microsatellite instability, and the CpG island methylator phenotype (CIMP), have
Gao, S; Sun, F-K; Fan, Y-C; Shi, C-H; Zhang, Z-H; Wang, L-Y; Wang, K
2015-08-01
Glutathione-S-transferase P1 (GSTP1) methylation has been demonstrated to be associated with oxidative stress induced liver damage in acute-on-chronic hepatitis B liver failure (ACHBLF). To evaluate the methylation level of GSTP1 promoter in acute-on-chronic hepatitis B liver failure and determine its predictive value for prognosis. One hundred and five patients with acute-on-chronic hepatitis B liver failure, 86 with chronic hepatitis B (CHB) and 30 healthy controls (HC) were retrospectively enrolled. GSTP1 methylation level in peripheral mononuclear cells (PBMC) was detected by MethyLight. Clinical and laboratory parameters were obtained. GSTP1 methylation levels were significantly higher in patients with acute-on-chronic hepatitis B liver failure (median 16.84%, interquartile range 1.83-59.05%) than those with CHB (median 1.25%, interquartile range 0.48-2.47%; P chronic hepatitis B liver failure group, nonsurvivors showed significantly higher GSTP1 methylation levels (P chronic hepatitis B liver failure, GSTP1 methylation showed significantly better predictive value than MELD score [area under the receiver operating characteristic curve (AUC) 0.89 vs. 0.72, P chronic hepatitis B liver failure and shows high predictive value for short-term mortality. It might serve as a potential prognostic marker for acute-on-chronic hepatitis B liver failure. © 2015 John Wiley & Sons Ltd.
Zhu, Honglin; Mi, Wentao; Luo, Hui; Chen, Tao; Liu, Shengxi; Raman, Indu; Zuo, Xiaoxia; Li, Quan-Zhen
2016-07-13
CpG sites in the promotor region of the gene. Our study has demonstrated that significant number of differential genes in SLE were involved in IFN, TLR signaling pathways, and inflammatory cytokines. The enrichment of differential genes has been associated with aberrant DNA methylation, which may be relevant to the pathogenesis of SLE. Our observations have laid the groundwork for further diagnostic and mechanistic studies of SLE and LN.
Bettini, Sarah; Boutet-Robinet, Elisa; Cartier, Christel; Coméra, Christine; Gaultier, Eric; Dupuy, Jacques; Naud, Nathalie; Taché, Sylviane; Grysan, Patrick; Reguer, Solenn; Thieriet, Nathalie; Réfrégiers, Matthieu; Thiaudière, Dominique; Cravedi, Jean-Pierre; Carrière, Marie; Audinot, Jean-Nicolas; Pierre, Fabrice H; Guzylack-Piriou, Laurence; Houdeau, Eric
2017-01-20
Food-grade titanium dioxide (TiO 2 ) containing a nanoscale particle fraction (TiO 2 -NPs) is approved as a white pigment (E171 in Europe) in common foodstuffs, including confectionary. There are growing concerns that daily oral TiO 2 -NP intake is associated with an increased risk of chronic intestinal inflammation and carcinogenesis. In rats orally exposed for one week to E171 at human relevant levels, titanium was detected in the immune cells of Peyer's patches (PP) as observed with the TiO 2 -NP model NM-105. Dendritic cell frequency increased in PP regardless of the TiO 2 treatment, while regulatory T cells involved in dampening inflammatory responses decreased with E171 only, an effect still observed after 100 days of treatment. In all TiO 2 -treated rats, stimulation of immune cells isolated from PP showed a decrease in Thelper (Th)-1 IFN-γ secretion, while splenic Th1/Th17 inflammatory responses sharply increased. E171 or NM-105 for one week did not initiate intestinal inflammation, while a 100-day E171 treatment promoted colon microinflammation and initiated preneoplastic lesions while also fostering the growth of aberrant crypt foci in a chemically induced carcinogenesis model. These data should be considered for risk assessments of the susceptibility to Th17-driven autoimmune diseases and to colorectal cancer in humans exposed to TiO 2 from dietary sources.
[The Role of 5-Aza-CdR on Methylation of Promoter in RASSF1A Gene in Endometrial Carcinoma].
Huang, Li-ping; Chen, Chen; Wang, Xue-ping; Liu, Hui
2015-05-01
To explore the effect of demethylating drug 5-Aza-2'-deoxycytidine (5-Aza-CdR) on methtylation status of the Ras-association domain familylA gene (RASSF1A) in human endometrial carcinoma. Randomly'assign the human endometrial carcinoma cell line HEC-1-B into groups and use demethylating drug 5-Aza-CdR of different concentration to treat them. Then Methylation-specific polymerase chain reaction (MSP), real-time PCR, Western blot, TUNEL technology were used to analyze methylation status of RASSF1A promoter CpG islands, RASSF1A mRNA expression, RASSF1A protein expression and apoptosis of HEC-1-B cell. High DNA methylation in RASSF1A gene promoter region, low RASSF1A mRNA level and protein expression and out of control of human endometrial carcinoma cell HEC-1-B apoptosis were observed. 5-Aza-CdR of different concentration could reverse RASSF1A gene's methylation status, recover the expression of mRNA and protein, and control the growth of HEC-1-B by inducing apoptosis. Aberrant methylation of RASSF1A in endometrial cancer as a therapeutic target, demethylating agent 5-Aza-CdR could be an effective way of gene therapy.
Promoter Methylation Analysis of IDH Genes in Human Gliomas
International Nuclear Information System (INIS)
Flanagan, Simon; Lee, Maggie; Li, Cheryl C. Y.; Suter, Catherine M.; Buckland, Michael E.
2012-01-01
Mutations in isocitrate dehydrogenase (IDH)-1 or -2 are found in the majority of WHO grade II and III astrocytomas and oligodendrogliomas, and secondary glioblastomas. Almost all described mutations are heterozygous missense mutations affecting a conserved arginine residue in the substrate binding site of IDH1 (R132) or IDH2 (R172). But the exact mechanism of IDH mutations in neoplasia is not understood. It has been proposed that IDH mutations impart a “toxic gain-of-function” to the mutant protein, however a dominant-negative effect of mutant IDH has also been described, implying that IDH may function as a tumor suppressor gene. As most, if not all, tumor suppressor genes are inactivated by epigenetic silencing, in a wide variety of tumors, we asked if IDH1 or IDH2 carry the epigenetic signature of a tumor suppressor by assessing cytosine methylation at their promoters. Methylation was quantified in 68 human brain tumors, including both IDH-mutant and IDH wildtype, by bisulfite pyrosequencing. In all tumors examined, CpG methylation levels were less than 8%. Our data demonstrate that inactivation of IDH function through promoter hypermethylation is not common in human gliomas and other brain tumors. These findings do not support a tumor suppressor role for IDH genes in human gliomas.
Intrinsically bent DNA in replication origins and gene promoters.
Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A
2008-06-24
Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
International Nuclear Information System (INIS)
Liu Jie; Xie Yaxiong; Cooper, Ryan; Ducharme, Danica M.K.; Tennant, Raymond; Diwan, Bhalchandra A.; Waalkes, Michael P.
2007-01-01
Exposure to inorganic arsenic in utero in C3H mice produces hepatocellular carcinoma in male offspring when they reach adulthood. To help define the molecular events associated with the fetal onset of arsenic hepatocarcinogenesis, pregnant C3H mice were given drinking water containing 0 (control) or 85 ppm arsenic from day 8 to 18 of gestation. At the end of the arsenic exposure period, male fetal livers were removed and RNA isolated for microarray analysis using 22K oligo chips. Arsenic exposure in utero produced significant (p < 0.001) alterations in expression of 187 genes, with approximately 25% of aberrantly expressed genes related to either estrogen signaling or steroid metabolism. Real-time RT-PCR on selected genes confirmed these changes. Various genes controlled by estrogen, including X-inactive-specific transcript, anterior gradient-2, trefoil factor-1, CRP-ductin, ghrelin, and small proline-rich protein-2A, were dramatically over-expressed. Estrogen-regulated genes including cytokeratin 1-19 and Cyp2a4 were over-expressed, although Cyp3a25 was suppressed. Several genes involved with steroid metabolism also showed remarkable expression changes, including increased expression of 17β-hydroxysteroid dehydrogenase-7 (HSD17β7; involved in estradiol production) and decreased expression of HSD17β5 (involved in testosterone production). The expression of key genes important in methionine metabolism, such as methionine adenosyltransferase-1a, betaine-homocysteine methyltransferase and thioether S-methyltransferase, were suppressed. Thus, exposure of mouse fetus to inorganic arsenic during a critical period in development significantly alters the expression of various genes encoding estrogen signaling and steroid or methionine metabolism. These alterations could disrupt genetic programming at the very early life stage, which could impact tumor formation much later in adulthood
Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G
2018-02-01
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.
Almamun, Md; Kholod, Olha; Stuckel, Alexei J; Levinson, Benjamin T; Johnson, Nathan T; Arthur, Gerald L; Davis, J Wade; Taylor, Kristen H
2017-09-01
A complete understanding of the mechanisms involved in the development of pre-B ALL is lacking. In this study, we integrated DNA methylation data and gene expression data to elucidate the impact of aberrant intergenic DNA methylation on gene expression in pre-B ALL. We found a subset of differentially methylated intergenic loci that were associated with altered gene expression in pre-B ALL patients. Notably, 84% of these regions were also bound by transcription factors (TF) known to play roles in differentiation and B-cell development in a lymphoblastoid cell line. Further, an overall downregulation of eRNA transcripts was observed in pre-B ALL patients and these transcripts were associated with the downregulation of putative target genes involved in B-cell migration, proliferation, and apoptosis. The identification of novel putative regulatory regions highlights the significance of intergenic DNA sequences and may contribute to the identification of new therapeutic targets for the treatment of pre-B ALL.
Feng, Hongxiang; Zhang, Zhenrong; Qing, Xin; Wang, Xiaowei; Liang, Chaoyang; Liu, Deruo
2016-02-01
Aberrant promoter hypermethylations of tumor suppressor genes are promising markers for lung cancer diagnosis and prognosis. The purpose of this study was to determine methylation status at APC and RAR-β promoters in primary NSCLC, and whether they have any relationship with survival. APC and RAR-β promoter methylation status were determined in 41 NSCLC patients using methylation specific PCR. APC promoter methylation was detectable in 9 (22.0%) tumor samples and 6 (14.6%) corresponding non-tumor samples (P=0.391). RAR-β promoter methylation was detectable in 13 (31.7%) tumor samples and 4 (9.8%) corresponding non-tumor samples (P=0.049) in the NSCLC patients. APC promoter methylation was found to be associated with T stage (P=0.046) and nodal status (P=0.019) in non-tumor samples, and with smoking (P=0.004) in tumor samples. RAR-β promoter methylation was found associated with age (P=0.031) in non-tumor samples and with primary tumor site in tumor samples. Patients with APC promoter methylation in tumor samples showed significantly longer survival than patients without it (Log-rank P=0.014). In a multivariate analysis of prognostic factors, APC methylation in tumor samples was an independent prognostic factor (P=0.012), as were N1 positive lymph node number (P=0.025) and N2 positive lymph node number (P=0.06). Our study shows that RAR-β methylation detected in lung tissue may be used as a predictive marker for NSCLC diagnosis and that APC methylation in tumor sample may be a useful marker for superior survival in NSCLC patients. Copyright © 2015. Published by Elsevier Inc.
Genetic recombination is targeted towards gene promoter regions in dogs.
Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R
2013-01-01
The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.
Jardin, Fabrice; Picquenot, Jean-Michel; Parmentier, Françoise; Ruminy, Philippe; Cornic, Marie; Penther, Dominique; Bertrand, Philippe; Lanic, Hélène; Cassuto, Ophélie; Humbrecht, Catherine; Lemasle, Emilie; Wautier, Agathe; Bastard, Christian; Tilly, Hervé
2009-09-01
The t(11;14)(q13;q32) is the hallmark of mantle cell lymphoma (MCL). Additional genetic alterations occur in the majority of cases. This study aimed to design a polymerase chain reaction (PCR) assay to determine the incidence and relevance of recurrent gene copy number aberrations in this disease. Forty-two MCL cases with frozen- or paraffin-embedded (FFPE) tissues were selected. Three different quantitative Multiplex PCR of Short Fluorescent Fragments (QMPSF) assays were designed to simultaneously analyse eight genes (CDKN2A, RB1, ATM, CDK2, TP53, MYC, CDKN1B, MDM2), to analyse the 9p21 locus (CDKN2A/CDKN2B) and FFPE tissues. Gains of MYC, CDK2, CDKN1B, and MDM2 were observed in 10% of cases. Losses of RB1, CDKN2A, ATM or TP53 were observed in 38%, 31%, 24% and 10% of cases, respectively. Analysis of the 9p21 locus indicated that, in most cases, tumours displayed a complete inactivation of p14(ARF)/p15I(NK4B)/p16I(NK4A). CDKN2A and MYC aberrations were associated with a high MCL international prognostic index (MIPI). CDK2/MDM2 gains and CDKN2A/TP53 losses correlated with an unfavourable outcome. PCR experiments with frozen and FFPE-tissues indicated that our approach is valid in a routine diagnostic setting, providing a powerful tool that could be used for patient stratification in combination with MIPI in future clinical trials.
Dietary fat and risk of colon and rectal cancer with aberrant MLH1 expression, APC or KRAS genes.
Weijenberg, M.P.; Luchtenborg, M.; Goeij, A.F. de; Brink, M.; Muijen, G.N.P. van; Bruine, A.P. de; Goldbohm, R.A.; Brandt, P.A. van den
2007-01-01
OBJECTIVE: To investigate baseline fat intake and the risk of colon and rectal tumors lacking MLH1 (mutL homolog 1, colon cancer, nonpolyposis type 2) repair gene expression and harboring mutations in the APC (adenomatous polyposis coli) tumor suppressor gene and in the KRAS (v-Ki-ras2 Kirsten rat
Wise, Alexandria; Tenezaca, Luis; Fernandez, Robert W; Schatoff, Emma; Flores, Julian; Ueda, Atsushi; Zhong, Xiaotian; Wu, Chun-Fang; Simon, Anne F; Venkatesh, Tadmiri
2015-01-01
Autism spectrum disorder (ASD) is a neurodevelopmental disorder in humans characterized by complex behavioral deficits, including intellectual disability, impaired social interactions, and hyperactivity. ASD exhibits a strong genetic component with underlying multigene interactions. Candidate gene studies have shown that the neurobeachin (NBEA) gene is disrupted in human patients with idiopathic autism ( Castermans et al., 2003 ). The NBEA gene spans the common fragile site FRA 13A and encodes a signal scaffold protein ( Savelyeva et al., 2006 ). In mice, NBEA has been shown to be involved in the trafficking and function of a specific subset of synaptic vesicles. ( Medrihan et al., 2009 ; Savelyeva et al., 2006 ). Rugose (rg) is the Drosophila homolog of the mammalian and human NBEA. Our previous genetic and molecular analyses have shown that rg encodes an A kinase anchor protein (DAKAP 550), which interacts with components of the epidermal growth factor receptor or EGFR and Notch-mediated signaling pathways, facilitating cross talk between these and other pathways ( Shamloula et al., 2002 ). We now present functional data from studies on the larval neuromuscular junction that reveal abnormal synaptic architecture and physiology. In addition, adult rg loss-of-function mutants exhibit defective social interactions, impaired habituation, aberrant locomotion, and hyperactivity. These results demonstrate that Drosophila NBEA (rg) mutants exhibit phenotypic characteristics reminiscent of human ASD and thus could serve as a genetic model for studying ASDs.
Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina
Yurong, Chai; Yumin, Lu; Tianyun, Wang; Weihong, Hou; Lexun, Xue
2006-12-01
Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.
IL6 gene promoter polymorphisms and type 2 diabetes
DEFF Research Database (Denmark)
Huth, Cornelia; Heid, Iris M; Vollmert, Caren
2006-01-01
Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...
Genome-wide analysis of regions similar to promoters of histone genes
Chowdhary, Rajesh
2010-05-28
Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that
Cooperative binding of transcription factors promotes bimodal gene expression response.
Directory of Open Access Journals (Sweden)
Pablo S Gutierrez
Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.
Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk
Chornokur, G.; Lin, H.Y.; Tyrer, J.P.; Lawrenson, K.; Dennis, J.; Amankwah, E.K.; Qu, X.; Tsai, Y.Y.; Jim, H.S.; Chen, Z.; Chen, A.Y.; Permuth-Wey, J.; Aben, K.; Anton-Culver, H.; Antonenkova, N.; Bruinsma, F.; Bandera, E.V.; Bean, Y.T.; Beckmann, M.W.; Bisogna, M.; Bjorge, L.; Bogdanova, N.; Brinton, L.A.; Brooks-Wilson, A.; Bunker, C.H.; Butzow, R.; Campbell, I.G.; Carty, K.; Chang-Claude, J.; Cook, L.S.; Cramer, D.W; Cunningham, J.M.; Cybulski, C.; Dansonka-Mieszkowska, A.; Bois, A. du; Despierre, E.; Dicks, E.; Doherty, J.A.; Dork, T.; Durst, M.; Easton, D.F.; Eccles, D.M.; Edwards, R.P.; Ekici, A.B.; Fasching, P.A.; Fridley, B.L.; Gao, Y.T.; Gentry-Maharaj, A.; Giles, G.G.; Glasspool, R.; Goodman, M.T.; Gronwald, J.; Harrington, P.; Harter, P.; Hein, A.; Heitz, F.; Hildebrandt, M.A.T.; Hillemanns, P.; Hogdall, C.K.; Hogdall, E.; Hosono, S.; Jakubowska, A.; Jensen, A.; Ji, B.T.; Karlan, B.Y.; Kelemen, L.E.; Kellar, M.; Kiemeney, L.A.L.M.; Krakstad, C.; Kjaer, S.K.; Kupryjanczyk, J.; Lambrechts, D.; Lambrechts, S.; Le, N.D.; Lee, A.W.; Lele, S.; Leminen, A.; Lester, J.; Levine, D.A.; Liang, D.; Lim, B.K.; Lissowska, J.; Lu, K.; Lubinski, J.; Lundvall, L.; Massuger, L.F.A.G.; Matsuo, K.; McGuire, V.; McLaughlin, J.R.; McNeish, I.; Menon, U.; Milne, R.L.; Modugno, F.; Moysich, K.B.; Ness, R.B.; Nevanlinna, H.; Eilber, U.; Odunsi, K.; Olson, S.H.; Orlow, I., et al.
2015-01-01
BACKGROUND: Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As
Altered gene-expression profile in rat plasma and promoted body ...
African Journals Online (AJOL)
Altered gene-expression profile in rat plasma and promoted body and brain development ... The study was aimed to explore how the prenatal EE impacts affect the ... positively promote the body and nervous system development of offspring, ...
Directory of Open Access Journals (Sweden)
Ping Peng
Full Text Available To investigate the association of ABCG1, GALNT2 and HMGCR genes promoter DNA methylation with coronary heart disease (CHD and explore the interaction between their methylation status and the CHD patients' clinical characteristics in Han Chinese population.Methylation-specific polymerase chain reaction (MSP technology was used to examine the role of the aberrant gene promoter methylation in CHD in Han Chinese population. A total of 85 CHD patients and 54 participants without CHD confirmed by angiography were recruited. 82.8% of the participants with ABCG1 gene promoter hypermethylation have CHD, while only 17.4% of the participants without hypermethylation have it. The average age of the participants with GALNT2 gene promoter hypermethylation is 62.10 ± 8.21, while that of the participants without hypermethylation is 57.28 ± 9.87; in the former group, 75.4% of the participants have CHD, compared to only 50% in the latter group. As for the HMGCR gene, the average age of the participants with promoter hypermethylation is 63.24 ± 8.10 and that of the participants without hypermethylation is 57.79 ± 9.55; its promoter hypermethylation is likely to be related to smoking. Our results indicated a significant statistical association of promoter methylation of the ABCG1 gene with increased risk of CHD (OR = 19.966; 95% CI, 7.319-54.468; P*<0.001; P*: adjusted for age, gender, smoking, lipid level, hypertension, and diabetes. Similar results were obtained for that of the GALNT2 gene (OR = 2.978; 95% CI, 1.335-6.646; P* = 0.008, but not of HMGCR gene (OR = 1.388; 95% CI, 0.572-3.371; P* = 0.469.The present work provides evidence to support the association of promoter DNA methylation status with the risk profile of CHD. Our data indicates that promoter DNA hypermethylation of the ABCG1 and GALNT2 genes, but not the HMGCR gene, is associated with an increased risk of CHD. CHD, smoking and aging are likely to be the important factors influencing DNA
Development of chimeric gene promoters responsive to hypoxia and ionizing radiation
International Nuclear Information System (INIS)
Zheng Aiqing; Yu Jinming
2004-01-01
The authors describe two systems that make use of gene-directed enzyme prodrug therapy, regulated by radiation or hypoxic-responsive promoters. The use of treatment-, condition- or tumor-specific promoters to control gene-directed enzyme prodrug therapy is one such method for targeting gene expression to the tumor. The development of such strategies that achieve tumor targeted expression of genes via selective promoters will enable improved specificity and targeting thereby addressing one of the major limitations of cancer gene therapy
Directory of Open Access Journals (Sweden)
Georg Kern
Full Text Available Chronic nephrotoxicity of immunosuppressives is one of the main limiting factors in the long-term outcome of kidney transplants, leading to tissue fibrosis and ultimate organ failure. The cytokine TGF-β is considered a key factor in this process. In the human renal fibroblast cell line TK-173, the macrolide calcineurin inhibitor tacrolimus (FK-506 induced TGF-β-like effects, manifested by increased expression of NAD(PH-oxidase 4 (Nox4, transgelin, tropomyosin 1, and procollagen α1(V mRNA after three days. The macrolide mTOR inhibitor rapamycin had similar effects, while cyclosporine A did not induce fibrose-related genes. Concentration dependence curves were sigmoid, where mRNA expression was induced already at low nanomolar levels of tacrolimus, and reached saturation at 100-300 nM. The effects were independent of extracellular TGF-β as confirmed by the use of neutralizing antibodies, and thus most likely caused by aberrant TGF-β receptor signaling, where binding of tacrolimus to the regulatory FKBP12 protein results in a "leaky" TGF-β receptor. The myofibroblast marker α-smooth muscle actin was neither induced by tacrolimus nor by TGF-β1, indicating an incomplete activation of TK-173 fibroblasts under culture conditions. Tacrolimus- and TGF-β1-induced Nox4 protein upregulation was confirmed by Western blotting, and was accompanied by a rise in intracellular H2O2 concentration. Si-RNA mediated knock-down of Nox4 expression prevented up-regulation of procollagen α1(V mRNA in tacrolimus-treated cells, but induced procollagen α1(V expression in control cells. Nox4 knock-down had no significant effect on the other genes tested. TGF-β is a key molecule in fibrosis, and the constant activation of aberrant receptor signaling by tacrolimus might contribute to the long-term development of interstitial kidney fibrosis in immunosuppressed patients. Nox4 levels possibly play a regulatory role in these processes.
Viral promoters can initiate expression of toxin genes introduced into Escherichia coli
Directory of Open Access Journals (Sweden)
Jacob Daniela
2005-06-01
Full Text Available Abstract Background The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. Results We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. Conclusion According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms.
Directory of Open Access Journals (Sweden)
Mian-Yang Li
2015-01-01
Full Text Available Background: The diagnosis of myelodysplastic syndrome (MDS, especially hypoplastic MDS, and MDS with low blast counts or normal karyotype may be problematic. This study characterized ID4 gene methylation in patients with MDS and aplastic anemia (AA. Methods: The methylation status of ID4 was analyzed by bisulfite sequencing polymerase chain reaction (PCR and quantitative real-time methylation-specific PCR (MethyLight PCR in 100 patients with MDS and 31 patients with AA. Results: The MDS group had a higher ID4 gene methylation positivity rate (22.22% and higher methylation levels (0.21 [0-3.79] than the AA group (P < 0.05. Furthermore, there were significant differences between the hypoplastic MDS and AA groups, the MDS with low blast count and the AA groups, and the MDS with normal karyotype and the AA groups. The combination of genetic and epigenetic markers was used in much more patients with MDS (62.5% [35/56] than the use of genetic markers only (51.79% [29/56]. Conclusions: These results showed that the detection of ID4 methylation positivity rates and levels could be a useful biomarker for MDS diagnosis.
Breast tumor copy number aberration phenotypes and genomic instability
International Nuclear Information System (INIS)
Fridlyand, Jane; Jain, Ajay N; McLennan, Jane; Ziegler, John; Chin, Koei; Devries, Sandy; Feiler, Heidi; Gray, Joe W; Waldman, Frederic; Pinkel, Daniel; Albertson, Donna G; Snijders, Antoine M; Ylstra, Bauke; Li, Hua; Olshen, Adam; Segraves, Richard; Dairkee, Shanaz; Tokuyasu, Taku; Ljung, Britt Marie
2006-01-01
Genomic DNA copy number aberrations are frequent in solid tumors, although the underlying causes of chromosomal instability in tumors remain obscure. Genes likely to have genomic instability phenotypes when mutated (e.g. those involved in mitosis, replication, repair, and telomeres) are rarely mutated in chromosomally unstable sporadic tumors, even though such mutations are associated with some heritable cancer prone syndromes. We applied array comparative genomic hybridization (CGH) to the analysis of breast tumors. The variation in the levels of genomic instability amongst tumors prompted us to investigate whether alterations in processes/genes involved in maintenance and/or manipulation of the genome were associated with particular types of genomic instability. We discriminated three breast tumor subtypes based on genomic DNA copy number alterations. The subtypes varied with respect to level of genomic instability. We find that shorter telomeres and altered telomere related gene expression are associated with amplification, implicating telomere attrition as a promoter of this type of aberration in breast cancer. On the other hand, the numbers of chromosomal alterations, particularly low level changes, are associated with altered expression of genes in other functional classes (mitosis, cell cycle, DNA replication and repair). Further, although loss of function instability phenotypes have been demonstrated for many of the genes in model systems, we observed enhanced expression of most genes in tumors, indicating that over expression, rather than deficiency underlies instability. Many of the genes associated with higher frequency of copy number aberrations are direct targets of E2F, supporting the hypothesis that deregulation of the Rb pathway is a major contributor to chromosomal instability in breast tumors. These observations are consistent with failure to find mutations in sporadic tumors in genes that have roles in maintenance or manipulation of the genome
Pan, Jie-Xue; Tan, Ya-Jing; Wang, Fang-Fang; Hou, Ning-Ning; Xiang, Yu-Qian; Zhang, Jun-Yu; Liu, Ye; Qu, Fan; Meng, Qing; Xu, Jian; Sheng, Jian-Zhong; Huang, He-Feng
2018-01-01
Polycystic ovary syndrome (PCOS), whose etiology remains uncertain, is a highly heterogenous and genetically complex endocrine disorder. The aim of this study was to identify differentially expressed genes (DEGs) in granulosa cells (GCs) from PCOS patients and make epigenetic insights into the pathogenesis of PCOS. Included in this study were 110 women with PCOS and 119 women with normal ovulatory cycles undergoing in vitro fertilization acting as the control group. RNA-seq identified 92 DEGs unique to PCOS GCs in comparison with the control group. Bioinformatic analysis indicated that synthesis of lipids and steroids was activated in PCOS GCs. 5-Methylcytosine analysis demonstrated that there was an approximate 25% reduction in global DNA methylation of GCs in PCOS women (4.44 ± 0.65%) compared with the controls (6.07 ± 0.72%; P PCOS.
Directory of Open Access Journals (Sweden)
Kaisa Kyöstilä
2015-04-01
Full Text Available Inherited neurodegenerative disorders are debilitating diseases that occur across different species. We have performed clinical, pathological and genetic studies to characterize a novel canine neurodegenerative disease present in the Lagotto Romagnolo dog breed. Affected dogs suffer from progressive cerebellar ataxia, sometimes accompanied by episodic nystagmus and behavioral changes. Histological examination revealed unique pathological changes, including profound neuronal cytoplasmic vacuolization in the nervous system, as well as spheroid formation and cytoplasmic aggregation of vacuoles in secretory epithelial tissues and mesenchymal cells. Genetic analyses uncovered a missense change, c.1288G>A; p.A430T, in the autophagy-related ATG4D gene on canine chromosome 20 with a highly significant disease association (p = 3.8 x 10-136 in a cohort of more than 2300 Lagotto Romagnolo dogs. ATG4D encodes a poorly characterized cysteine protease belonging to the macroautophagy pathway. Accordingly, our histological analyses indicated altered autophagic flux in affected tissues. The knockdown of the zebrafish homologue atg4da resulted in a widespread developmental disturbance and neurodegeneration in the central nervous system. Our study describes a previously unknown canine neurological disease with particular pathological features and implicates the ATG4D protein as an important autophagy mediator in neuronal homeostasis. The canine phenotype serves as a model to delineate the disease-causing pathological mechanism(s and ATG4D function, and can also be used to explore treatment options. Furthermore, our results reveal a novel candidate gene for human neurodegeneration and enable the development of a genetic test for veterinary diagnostic and breeding purposes.
Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters
Directory of Open Access Journals (Sweden)
Gagniuc Paul
2012-09-01
Full Text Available Abstract Background The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? Results In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on
Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan
2015-10-01
The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.
HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study
Directory of Open Access Journals (Sweden)
Marla A. Endriga
2010-10-01
Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.
Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.
Directory of Open Access Journals (Sweden)
Jianqing Pan
Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.
Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters
Directory of Open Access Journals (Sweden)
Farré Domènec
2007-12-01
Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.
The progress of tumor gene-radiotherapy induced by Egr-1 promoter
International Nuclear Information System (INIS)
Guo Rui; Li Biao
2010-01-01
The promoter of early growth response gene-1 (Egr-1) is a cis-acting element of Egr-1, and its activity is regulated by inducers such as ionizing radiation, free radical. In designated gene-radiotherapy system, radiation combined with therapeutic gene (such as tumor necrosis factor-α gene, suicide gene) can spatially and temporally regulate therapeutic gene expression in the irradiated field, produced a marked effect, while little systemic toxicities were observed. The combination of radiotherapy and gene therapy is promising in tumor therapy. (authors)
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
International Nuclear Information System (INIS)
Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29
Pathophysiology of MDS: genomic aberrations.
Ichikawa, Motoshi
2016-01-01
Myelodysplastic syndromes (MDS) are characterized by clonal proliferation of hematopoietic stem/progenitor cells and their apoptosis, and show a propensity to progress to acute myelogenous leukemia (AML). Although MDS are recognized as neoplastic diseases caused by genomic aberrations of hematopoietic cells, the details of the genetic abnormalities underlying disease development have not as yet been fully elucidated due to difficulties in analyzing chromosomal abnormalities. Recent advances in comprehensive analyses of disease genomes including whole-genome sequencing technologies have revealed the genomic abnormalities in MDS. Surprisingly, gene mutations were found in approximately 80-90% of cases with MDS, and the novel mutations discovered with these technologies included previously unknown, MDS-specific, mutations such as those of the genes in the RNA-splicing machinery. It is anticipated that these recent studies will shed new light on the pathophysiology of MDS due to genomic aberrations.
Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene
International Nuclear Information System (INIS)
Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.
2010-01-01
Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.
Keller, Thomas E; Han, Priscilla; Yi, Soojin V
2016-04-01
Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf
Comparative analysis of ADS gene promoter in seven Artemisia ...
Indian Academy of Sciences (India)
2014-12-23
Dec 23, 2014 ... antimalarial drugs from plants that were used in traditional. Chinese medicine ...... ogy of eukaryotic promoter prediction-a review. Comput. Chem. ... Main J. J. 2006 Antiviral effect of artemisinin from Artemisia annua against a ...
A novel binary T-vector with the GFP reporter gene for promoter characterization.
Directory of Open Access Journals (Sweden)
Shu-Ye Jiang
Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.
CSIR Research Space (South Africa)
Crampton, Michael C
2010-07-01
Full Text Available This presentation focused on the transcriptional analysis of heterologous gene expression using the endogenous sD promoter from Bacillus halodurans. It concludes to a successful implementation of a high throughput mRNA sandwich hybridisation...
Fauteux, François; Strömvik, Martina V
2009-01-01
Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs
Directory of Open Access Journals (Sweden)
Fauteux François
2009-10-01
Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination
Watanabe, Yousuke; Abe, Hajime; Nakajima, Kota; Ideta-Otsuka, Maky; Igarashi, Katsuhide; Woo, Gye-Hyeong; Yoshida, Toshinori; Shibutani, Makoto
2018-05-01
Maternal hexachlorophene (HCP) exposure causes transient disruption of hippocampal neurogenesis in mouse offspring. We examined epigenetically hypermethylated and downregulated genes related to this HCP-induced disrupted neurogenesis. Mated female mice were dietary exposed to 0 or 100 ppm HCP from gestational day 6 to postnatal day (PND) 21 on weaning. The hippocampal dentate gyrus of male offspring was subjected to methyl-capture sequencing and real-time reverse transcription-polymerase chain reaction analyses on PND 21. Validation analyses on methylation identified three genes, Dlx4, Dmrt1, and Plcb4, showing promoter-region hypermethylation. Immunohistochemically, DLX4+, DMRT1+, and PLCB4+ cells in the dentate hilus co-expressed GAD67, a γ-aminobutyric acid (GABA)ergic neuron marker. HCP decreased all of three subpopulations as well as GAD67+ cells on PND 21. PLCB4+ cells also co-expressed the metabotropic glutamate receptor, GRM1. HCP also decreased transcript level of synaptic plasticity-related genes in the dentate gyrus and immunoreactive granule cells for synaptic plasticity-related ARC. On PND 77, all immunohistochemical cellular density changes were reversed, whereas the transcript expression of the synaptic plasticity-related genes fluctuated. Thus, HCP-exposed offspring transiently reduced the number of GABAergic interneurons. Among them, subpopulations expressing DLX4, DMRT1, or PLCB4 were transiently reduced in number through an epigenetic mechanism. Considering the role of the Dlx gene family in GABAergic interneuron migration and differentiation, the decreased number of DLX4+ cells may be responsible for reducing those GABAergic interneurons regulating neurogenesis. The effect on granule cell synaptic plasticity was sustained until the adult stage, and reduced GABAergic interneurons active in GRM1-PLCB4 signaling may be responsible for the suppression on weaning.
Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk
Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P.; Lawrenson, Kate; Dennis, Joe; Amankwah, Ernest K.; Qu, Xiaotao; Tsai, Ya-Yu; Jim, Heather S. L.; Chen, Zhihua; Chen, Ann Y.; Permuth-Wey, Jennifer; Aben, Katja KH.; Anton-Culver, Hoda; Antonenkova, Natalia
2015-01-01
Background\\ud \\ud Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contribu...
Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio
2014-11-07
Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and
International Nuclear Information System (INIS)
Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.
2017-01-01
Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Directory of Open Access Journals (Sweden)
Daniel Meier
Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation
International Nuclear Information System (INIS)
Anstett, A.
2005-09-01
Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)
Control of phenylalanine ammonia-lyase gene promoters from pea by UV radiation
International Nuclear Information System (INIS)
Pluskota, W.E.; Michalczyk, D.J.; Gorecki, R.J.
2005-01-01
The gene fusion system was used to study UV light-control of PS PAL1 and PS PAL2 genes encoding phenylalanine ammonia-lyase of pea. The induction of pea PAL promoters was analysed in transgenic tobacco plants. Binary plasmids (derivatives of pBI101.2 vector) containing 5' regulatory fragments of PS PAL1 and PS PAL2 linked to reporter genes (GUS, LUC) were constructed. The analyses were performed with the use of single constructs (containing one variant of PS PAL promoter and one reporter gene) and dual constructs (containing both PS PAL1 and PS PAL2 promoters connected with different reporter genes). The use of dual constructs enabled the evaluation of both PS PAL promoters activity in the same plant. The analyses of in vitro grown plants have shown that both PAL promoters are strongly induced in leaves subjected to UV radiation. In some cases, the UV-stimulated expression exceeded the exposed areas. This phenomenon was observed more often in the leaves of plants containing the PS PAL1::GUS than PS PAL2::GUS construct. Removal of boxes 2, 4, 5 from PS PAL1 promoter and deletion of its 5' end region (-339 to -1394) decreases the level of gene expression but does not eliminate its responsiveness to UV
International Nuclear Information System (INIS)
Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.
1988-01-01
Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene
Directory of Open Access Journals (Sweden)
Andrea Degl'Innocenti
Full Text Available In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice.Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice.Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J, and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections.In the mouse genome there are eight intact solitary genes: Olfr19 (M12, Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings
Engineered promoters enable constant gene expression at any copy number in bacteria.
Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A
2018-04-01
The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.
Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells
DEFF Research Database (Denmark)
Mortensen, O V; Thomassen, M; Larsen, M B
1999-01-01
were found to possess the additional 379 bp fragment. The integrity of the promoter was furthermore confirmed by genomic Southern blotting. The promoter activity was analyzed by reporter gene assays in neuronal and non-neuronal serotonergic cell lines. In immortalized serotonergic raphe neurons, RN46A...
Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.
2009-07-01
The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)
Geurts, J.; Joosten, L.A.B.; Takahashi, N.; Arntz, O.J.; Gluck, A.; Bennink, M.B.; Berg, W.B. van den; Loo, F.A.J. van de
2009-01-01
The promoter regions of genes that are differentially regulated in the synovial membrane during the course of rheumatoid arthritis (RA) represent attractive candidates for application in transcriptionally targeted gene therapy. In this study, we applied an unbiased computational approach to define
Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger
International Nuclear Information System (INIS)
Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.
2009-01-01
The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)
The promoter for a variant surface glycoprotein gene expression site in Trypanosoma brucei
Zomerdijk, J. C.; Ouellette, M.; ten Asbroek, A. L.; Kieft, R.; Bommer, A. M.; Clayton, C. E.; Borst, P.
1990-01-01
The variant-specific surface glycoprotein (VSG) gene 221 of Trypanosoma brucei is transcribed as part of a 60 kb expression site (ES). We have identified the promoter controlling this multigene transcription unit by the use of 221 chromosome-enriched DNA libraries and VSG gene 221 expression site
Comparative analysis of ADS gene promoter in seven Artemisia ...
Indian Academy of Sciences (India)
... were more in the high artemisinin producer species, A. annua, than the other species. We have reported that the light-responsive elements, W-box, CAAT-box, 5′-UTR py-rich stretch, TATA-box sequence and tandem repeat sequences have been identified as important factors in the increased expression of ADS gene.
A cII-dependent promoter is located within the Q gene of bacteriophage lambda.
Hoopes, B C; McClure, W R
1985-01-01
We have found a cII-dependent promoter, PaQ, within the Q gene of bacteriophage lambda. Transcription experiments and abortive initiation assays performed in vitro showed that the promoter strength and the cII affinity of PaQ were comparable to the other cII-dependent lambda promoters, PE and PI. The location and leftward direction of PaQ suggests a possible role in the delay of lambda late-gene expression by cII protein, a phenomenon that has been called cII-dependent inhibition. We have con...
Directory of Open Access Journals (Sweden)
Vingron Martin
2008-10-01
Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.
Tissue specific promoters improve the localization of radiation-inducible gene expression
International Nuclear Information System (INIS)
Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph
1996-01-01
Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene
Role of promoter element in c-mpl gene expression induced by TPO.
Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao
2013-01-01
Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.
The application of powerful promoters to enhance gene expression in industrial microorganisms.
Zhou, Shenghu; Du, Guocheng; Kang, Zhen; Li, Jianghua; Chen, Jian; Li, Huazhong; Zhou, Jingwen
2017-02-01
Production of useful chemicals by industrial microorganisms has been attracting more and more attention. Microorganisms screened from their natural environment usually suffer from low productivity, low stress resistance, and accumulation of by-products. In order to overcome these disadvantages, rational engineering of microorganisms to achieve specific industrial goals has become routine. Rapid development of metabolic engineering and synthetic biology strategies provide novel methods to improve the performance of industrial microorganisms. Rational regulation of gene expression by specific promoters is essential to engineer industrial microorganisms for high-efficiency production of target chemicals. Identification, modification, and application of suitable promoters could provide powerful switches at the transcriptional level for fine-tuning of a single gene or a group of genes, which are essential for the reconstruction of pathways. In this review, the characteristics of promoters from eukaryotic, prokaryotic, and archaea microorganisms are briefly introduced. Identification of promoters based on both traditional biochemical and systems biology routes are summarized. Besides rational modification, de novo design of promoters to achieve gradient, dynamic, and logic gate regulation are also introduced. Furthermore, flexible application of static and dynamic promoters for the rational engineering of industrial microorganisms is highlighted. From the perspective of powerful promoters in industrial microorganisms, this review will provide an extensive description of how to regulate gene expression in industrial microorganisms to achieve more useful goals.
Seifi Moroudi, Reihane; Masoudi, Ali Akbar; Vaez Torshizi, Rasoul; Zandi, Mohammad
2014-12-01
One of the important behaviors of dogs is trainability which is affected by learning and memory genes. These kinds of the genes have not yet been identified in dogs. In the current research, these genes were found in animal models by mining the biological data and scientific literatures. The proteins of these genes were obtained from the UniProt database in dogs and humans. Not all homologous proteins perform similar functions, thus comparison of these proteins was studied in terms of protein families, domains, biological processes, molecular functions, and cellular location of metabolic pathways in Interpro, KEGG, Quick Go and Psort databases. The results showed that some of these proteins have the same performance in the rat or mouse, dog, and human. It is anticipated that the protein of these genes may be effective in learning and memory in dogs. Then, the expression pattern of the recognized genes was investigated in the dog hippocampus using the existing information in the GEO profile. The results showed that BDNF, TAC1 and CCK genes are expressed in the dog hippocampus, therefore, these genes could be strong candidates associated with learning and memory in dogs. Subsequently, due to the importance of the promoter regions in gene function, this region was investigated in the above genes. Analysis of the promoter indicated that the HNF-4 site of BDNF gene and the transcription start site of CCK gene is exposed to methylation. Phylogenetic analysis of protein sequences of these genes showed high similarity in each of these three genes among the studied species. The dN/dS ratio for BDNF, TAC1 and CCK genes indicates a purifying selection during the evolution of the genes.
A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli
Directory of Open Access Journals (Sweden)
Li Mingji
2012-02-01
Full Text Available Abstract Background For metabolic engineering, many rate-limiting steps may exist in the pathways of accumulating the target metabolites. Increasing copy number of the desired genes in these pathways is a general method to solve the problem, for example, the employment of the multi-copy plasmid-based expression system. However, this method may bring genetic instability, structural instability and metabolic burden to the host, while integrating of the desired gene into the chromosome may cause inadequate transcription or expression. In this study, we developed a strategy for obtaining gene overexpression by engineering promoter clusters consisted of multiple core-tac-promoters (MCPtacs in tandem. Results Through a uniquely designed in vitro assembling process, a series of promoter clusters were constructed. The transcription strength of these promoter clusters showed a stepwise enhancement with the increase of tandem repeats number until it reached the critical value of five. Application of the MCPtacs promoter clusters in polyhydroxybutyrate (PHB production proved that it was efficient. Integration of the phaCAB genes with the 5CPtacs promoter cluster resulted in an engineered E.coli that can accumulate 23.7% PHB of the cell dry weight in batch cultivation. Conclusions The transcription strength of the MCPtacs promoter cluster can be greatly improved by increasing the tandem repeats number of the core-tac-promoter. By integrating the desired gene together with the MCPtacs promoter cluster into the chromosome of E. coli, we can achieve high and stale overexpression with only a small size. This strategy has an application potential in many fields and can be extended to other bacteria.
Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.
Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A
1993-12-01
Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.
Kikuchi, Ryoko; Tsuda, Hitoshi; Kanai, Yae; Kasamatsu, Takahiro; Sengoku, Kazuo; Hirohashi, Setsuo; Inazawa, Johji; Imoto, Issei
2007-08-01
Connective tissue growth factor (CTGF) is a secreted protein belonging to the CCN family, members of which are implicated in various biological processes. We identified a homozygous loss of CTGF (6q23.2) in the course of screening a panel of ovarian cancer cell lines for genomic copy number aberrations using in-house array-based comparative genomic hybridization. CTGF mRNA expression was observed in normal ovarian tissue and immortalized ovarian epithelial cells but was reduced in many ovarian cancer cell lines without its homozygous deletion (12 of 23 lines) and restored after treatment with 5-aza 2'-deoxycytidine. The methylation status around the CTGF CpG island correlated inversely with the expression, and a putative target region for methylation showed promoter activity. CTGF methylation was frequently observed in primary ovarian cancer tissues (39 of 66, 59%) and inversely correlated with CTGF mRNA expression. In an immunohistochemical analysis of primary ovarian cancers, CTGF protein expression was frequently reduced (84 of 103 cases, 82%). Ovarian cancer tended to lack CTGF expression more frequently in the earlier stages (stages I and II) than the advanced stages (stages III and IV). CTGF protein was also differentially expressed among histologic subtypes. Exogenous restoration of CTGF expression or treatment with recombinant CTGF inhibited the growth of ovarian cancer cells lacking its expression, whereas knockdown of endogenous CTGF accelerated growth of ovarian cancer cells with expression of this gene. These results suggest that epigenetic silencing by hypermethylation of the CTGF promoter leads to a loss of CTGF function, which may be a factor in the carcinogenesis of ovarian cancer in a stage-dependent and/or histologic subtype-dependent manner.
Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu
2015-04-01
The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.
Energy Technology Data Exchange (ETDEWEB)
Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR
2002-10-15
The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.
Energy Technology Data Exchange (ETDEWEB)
Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR
2003-03-04
The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...
Scassa, María E; Marazita, Mariela C; Ceruti, Julieta M; Carcagno, Abel L; Sirkin, Pablo F; González-Cid, Marcela; Pignataro, Omar P; Cánepa, Eduardo T
2007-05-01
Genome integrity and cell proliferation and survival are regulated by an intricate network of pathways that includes cell cycle checkpoints, DNA repair and recombination, and programmed cell death. It makes sense that there should be a coordinated regulation of these different processes, but the components of such mechanisms remain unknown. In this report, we demonstrate that p19INK4d expression enhances cell survival under genotoxic conditions. By using p19INK4d-overexpressing clones, we demonstrated that p19INK4d expression correlates with the cellular resistance to UV treatment with increased DNA repair activity against UV-induced lesions. On the contrary, cells transfected with p19INK4d antisense cDNA show reduced ability to repair DNA damage and increased sensitivity to genotoxic insult when compared with their p19INK4d-overexpressing counterparts. Consistent with these findings, our studies also show that p19INK4d-overexpressing cells present not only a minor accumulation of UV-induced chromosomal aberrations but a lower frequency of spontaneous chromosome abnormalities than p19INK4d-antisense cells. Lastly, we suggest that p19INK4d effects are dissociated from its role as CDK4/6 inhibitor. The results presented herein support a crucial role for p19INK4d in regulating genomic stability and overall cell viability under conditions of genotoxic stress. We propose that p19INK4d would belong to a protein network that would integrate DNA repair, apoptotic and checkpoint mechanisms in order to maintain the genomic integrity.
Low-Dose Radiation Induces Genes Promoting Cell Survival
International Nuclear Information System (INIS)
Liu, Shu-Zheng; Chen, Dong; Mu, Ying
1999-01-01
Apoptosis is an important process controlling homeostasis of the body. It is influenced by stimuli constantly arising from the external and internal environment of the organism. It is well known that radiation could induce apoptosis of cells in vitro and in vivo. However, the dose-effect relationship of apoptosis extending to the low-dose range has scarcely been studied. Here, the molecular basis of the phenomenon is explored by examining the changes in expression of some of the proapoptotic and antiapoptotic genes
Regional differences in gene expression and promoter usage in aged human brains
Pardo, Luba M.
2013-02-19
To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor
2013-07-01
The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.
Promoter Hypermethylation of the ATM Gene as a Novel Biomarker for Breast Cancer
Begam, Nasrin; Jamil, Kaiser; Raju, Suryanarayana G
2017-11-26
Background: Breast cancer may be induced by activation of protooncogenes to oncogenes and in many cases inactivation of tumor suppressor genes. Ataxia telangiectasia mutated (ATM) is an important tumor suppressor gene which plays central roles in the maintenance of genomic integrity by activating cell cycle checkpoints and promoting repair of double-strand breaks of DNA. In breast cancer, decrease ATM expression correlates with a poor outcome; however, the molecular mechanisms underlying downregulation are still unclear. Promoter hypermethylation may contribute in downregulation. Hence the present investigation was designed to evaluate promoter methylation and expression of the ATM gene in breast cancer cases, and to determine links with clinical and demographic manifestations, in a South Indian population. Methods: Tumor biopsy samples were collected from 50 pathologically confirmed sporadic breast cancer cases. DNA was isolated from tumor and adjacent non-tumorous regions, and sodium bisulfite conversion and methylation-specific PCR were performed using MS-PCR primers for the ATM promoter region. In addition, ATM mRNA expression was also analyzed for all samples using real-time PCR. Results: Fifty eight percent (58%) of cancer tissue samples showed promoter hypermethylation for the ATM gene, in contrast to only 4.44% of normal tissues (p= 0.0001). Furthermore, ATM promoter methylation was positively associated with age (p = 0.01), tumor size (p=0.045) and advanced stage of disease i.e. stages III and IV (p =0.019). An association between promoter hypermethylation and lower expression of ATM mRNA was also found (p=0.035). Conclusion: We report for the first time that promoter hypermethylation of ATM gene may be useful as a potential new biomarker for breast cancer, especially in the relatively young patients. Creative Commons Attribution License
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
International Nuclear Information System (INIS)
Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi
2014-01-01
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter
Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs
Energy Technology Data Exchange (ETDEWEB)
Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)
2014-07-18
Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter
Directory of Open Access Journals (Sweden)
Alexander Michael Bedford Johns
2016-10-01
Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.
Characterization of promoter sequence of toll-like receptor genes in Vechur cattle
Directory of Open Access Journals (Sweden)
R. Lakshmi
2016-06-01
Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.
Amirhaeri, S; Wohlrab, F; Wells, R D
1995-02-17
The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.
Sandoval, V.; Barton, K.; Longhurst, A.
2012-12-01
Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.
Directory of Open Access Journals (Sweden)
Ansaya Thonpho
Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.
Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L
1996-12-01
The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
NGX6 gene mediated by promoter methylation as a potential molecular marker in colorectal cancer
Directory of Open Access Journals (Sweden)
Shen Shourong
2010-04-01
Full Text Available Abstract Background Nasopharyngeal carcinoma associated gene 6 (NGX6 is down-regulated in most colon cancer cell lines and tumor tissues when compared with their normal tissue samples. As a novel suppress tumor gene, it could inhibit colon cancer cell growth and cell cycle progression. However, little is known about the transcriptional mechanisms controlling NGX6 gene expression. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumorigenesis of colorectal carcinoma (CRC. In this study, we explored the role of DNA methylation in regulation of NGX6 transcription. Methods In the present study, we cloned the NGX6 promoter with characteristics of a CpG island by luciferase reporter assay. Then, the CpG methylation status around the NGX6 promoter region in colon cancer cell lines and colorectal tumor tissues was examined by methylation-specific PCR and bisulfite DNA sequencing. Finally, 5-Aza-2'-deoxycytidine (5-Aza-dC treatment was used to confirm the correlation between NGX6 promoter methylation and its gene inactivation. Results The sequence spanning positions -157 to +276 was identified as the NGX6 promoter, in which no canonical TATA boxes were found, while two CAAT boxes and GC boxes were discovered. Methylation status was observed more frequently in 40 colorectal cancer samples than in 40 adjacent normal mucosa samples (18/40 versus 7/40; P Conclusions Down-regulation of NGX6 gene is related to the promoter methylation. DNA methylation of NGX6 promoter might be a potential molecular marker for diagnosis or prognosis, or serve as a therapeutic target.
Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.
He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y
2013-09-04
To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.
Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.
Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile
2017-01-01
Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.
Directory of Open Access Journals (Sweden)
Li Mei-zhi
2010-10-01
Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.
Light-regulated promoters for tunable, temporal, and affordable control of fungal gene expression.
Fuller, Kevin K; Dunlap, Jay C; Loros, Jennifer J
2018-05-01
Regulatable promoters are important genetic tools, particularly for assigning function to essential and redundant genes. They can also be used to control the expression of enzymes that influence metabolic flux or protein secretion, thereby optimizing product yield in bioindustry. This review will focus on regulatable systems for use in filamentous fungi, an important group of organisms whose members include key research models, devastating pathogens of plants and animals, and exploitable cell factories. Though we will begin by cataloging those promoters that are controlled by nutritional or chemical means, our primary focus will rest on those who can be controlled by a literal flip-of-the-switch: promoters of light-regulated genes. The vvd promoter of Neurospora will first serve as a paradigm for how light-driven systems can provide tight, robust, tunable, and temporal control of either autologous or heterologous fungal proteins. We will then discuss a theoretical approach to, and practical considerations for, the development of such promoters in other species. To this end, we have compiled genes from six previously published light-regulated transcriptomic studies to guide the search for suitable photoregulatable promoters in your fungus of interest.
Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng
2017-10-01
RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ede, Christopher; Chen, Ximin; Lin, Meng-Yin; Chen, Yvonne Y.
2016-01-01
Inducible transcription systems play a crucial role in a wide array of synthetic biology circuits. However, the majority of inducible promoters are constructed from a limited set of tried-and-true promoter parts, which are susceptible to common shortcomings such as high basal expression levels (i.e., leakiness). To expand the toolbox for regulated mammalian gene expression and facilitate the construction of mammalian genetic circuits with precise functionality, we quantitatively characterized a panel of eight core promoters, including sequences with mammalian, viral, and synthetic origins. We demonstrate that this selection of core promoters can provide a wide range of basal gene expression levels and achieve a gradient of fold-inductions spanning two orders of magnitude. Furthermore, commonly used parts such as minimal CMV and minimal SV40 promoters were shown to achieve robust gene expression upon induction, but also suffer from high levels of leakiness. In contrast, a synthetic promoter, YB_TATA, was shown to combine low basal expression with high transcription rate in the induced state to achieve significantly higher fold-induction ratios compared to all other promoters tested. These behaviors remain consistent when the promoters are coupled to different genetic outputs and different response elements, as well as across different host-cell types and DNA copy numbers. We apply this quantitative understanding of core promoter properties to the successful engineering of human T cells that respond to antigen stimulation via chimeric antigen receptor signaling specifically under hypoxic environments. Results presented in this study can facilitate the design and calibration of future mammalian synthetic biology systems capable of precisely programmed functionality. PMID:26883397
Esteller, M; Risques, R A; Toyota, M; Capella, G; Moreno, V; Peinado, M A; Baylin, S B; Herman, J G
2001-06-15
Defects in DNA repair may be responsible for the genesis of mutations in key genes in cancer cells. The tumor suppressor gene p53 is commonly mutated in human cancer by missense point mutations, most of them G:C to A:T transitions. A recognized cause for this type of change is spontaneous deamination of the methylcytosine. However, the persistence of a premutagenic O(6)-methylguanine can also be invoked. This last lesion is removed in the normal cell by the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT). In many tumor types, epigenetic silencing of MGMT by promoter hypermethylation has been demonstrated and linked to the appearance of G to A mutations in the K-ras oncogene in colorectal tumors. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of p53 mutations, we studied 314 colorectal tumors for MGMT promoter hypermethylation and p53 mutational spectrum. Inactivation of MGMT by aberrant methylation was associated with the appearance of G:C to A:T transition mutations at p53 (Fischer's exact test, two-tailed; P = 0.01). Overall, MGMT methylated tumors displayed p53 transition mutations in 43 of 126 (34%) cases, whereas MGMT unmethylated tumors only showed G:C to A:T changes in 37 of 188 (19%) tumors. A more striking association was found in G:C to A:T transitions in non-CpG dinucleotides; 71% (12 of 17) of the total non-CpG transition mutations in p53 were observed in MGMT aberrantly methylated tumors (Fischer's exact test, two-tailed; P = 0.008). Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to G:C to A:T transition mutations in p53.
International Nuclear Information System (INIS)
Bamodu, Oluwaseun Adebayo; Huang, Wen-Chien; Lee, Wei-Hwa; Wu, Alexander; Wang, Liang Shun; Hsiao, Michael; Yeh, Chi-Tai; Chao, Tsu-Yi
2016-01-01
Triple negative breast cancers (TNBC) possess cell dedifferentiation characteristics, carry out activities connate to those of cancer stem cells (CSCs) and are associated with increased metastasis, as well as, poor clinical prognosis. The regulatory mechanism of this highly malignant phenotype is still poorly characterized. Accruing evidence support the role of non-coding RNAs (ncRNAs) as potent regulators of CSC and metastatic gene expression, with their dysregulation implicated in tumorigenesis and disease progression. In this study, we investigated TNBC metastasis, metastasis-associated genes and potential inhibitory mechanisms using bioinformatics, tissue microarray analyses, immunoblotting, polymerase chain reaction, loss and gain of gene function assays and comparative analyses of data obtained. Compared with other breast cancer types, the highly metastatic MDA-MB-231 cells concurrently exhibited increased expression levels of Lysine-specific demethylase 5B protein (KDM5B) and long non-coding RNA (lncRNA), MALAT1, suggesting their functional association. KDM5B-silencing in the TNBC cells correlated with the upregulation of hsa-miR-448 and led to suppression of MALAT1 expression with decreased migration, invasion and clonogenic capacity in vitro, as well as, poor survival in vivo. This projects MALAT1 as a mediator of KDM5B oncogenic potential and highlights the critical role of this microRNA, lncRNA and histone demethylase in cancer cell motility and metastatic colonization. Increased expression of KDM5B correlating with disease progression and poor clinical outcome in breast cancer was reversed by hsa-miR-448. Our findings demonstrate the critical role of KDM5B and its negative regulator hsa-miR-448 in TNBC metastasis and progression. Hsa-miR-448 disrupting KDM5B-MALAT1 signalling axis and associated activities in TNBC cells, projects it as a putative therapeutic factor for selective eradication of TNBC cells
Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis
DEFF Research Database (Denmark)
Xu, Wenming; Zhang, Sizhong; Qiu, Weimin
2009-01-01
reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...
Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang
2017-12-19
WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.
Novel strong tissue specific promoter for gene expression in human germ cells
Directory of Open Access Journals (Sweden)
Kuzmin Denis
2010-08-01
Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.
Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; Brown, James B.; Lipovich, Leonard; Bajic, Vladimir B.
2014-01-01
raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted
Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z
2016-10-01
The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.
Identification of cis-acting regulatory elements in the human oxytocin gene promoter.
Richard, S; Zingg, H H
1991-12-01
The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT
Directory of Open Access Journals (Sweden)
Mei-Sheng Xiao
Full Text Available PURPOSE: Caspase 8 (CASP8 plays a critical role in the apoptotic pathway and aberrant regulation of this pathway causes many diseases including cancers. Genetic variants rs3834129 (CTTACT/- and rs3769821 (T/C in the promoter region of the CASP8 gene were documented to be associated with multiple solid cancers and non-Hodgkin's lymphoma (NHL, respectively, despite of some controversies. We aimed to discern potential association of these two variants and rs113686495 (CTGTCATT/-, as well as CASP8 mRNA and protein expression levels with colorectal cancer (CRC in Han Chinese. METHODS: We genotyped CASP8 genetic variants in 305 CRC patients and 342 healthy individuals from Kunming, Southwest China. Expression levels of CASP8 mRNA and protein were quantified in paired cancerous and paracancerous normal tissues by using real-time quantitative PCR and western blot, respectively. We compared the frequencies of alleles, genotypes, and haplotypes between the cases and controls. Correlation of CASP8 mRNA and protein expression levels in paired cancerous and paracancerous normal tissues from patients with different genotypes and clinical expression were also evaluated. RESULTS: There was no association of the CASP8 genetic variants with CRC in our case-control study. The CASP8 gene mRNA expression levels in cancerous and paracancerous normal tissues were similar and there was no significant difference between subjects with different genotypes and clinical features. However, we found that CASP8 protein level was significantly lower in cancerous tissues than in paired paracancerous normal tissues. CONCLUSIONS: Our results suggest that the three CASP8 genetic variants may not be associated with CRC risk in Han Chinese from southwest China. Aberrant CASP8 protein expression may play a role in the pathogenesis of CRC.
A study of the frequency of methylation of gene promoter regions in ...
Indian Academy of Sciences (India)
2013-04-02
Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.
Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.
2001-01-01
Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an
Aberrantly methylated DNA as a biomarker in breast cancer.
Kristiansen, Søren; Jørgensen, Lars M; Guldberg, Per; Sölétormos, György
2013-01-01
Aberrant DNA hypermethylation at gene promoters is a frequent event in human breast cancer. Recent genome-wide studies have identified hundreds of genes that exhibit differential methylation between breast cancer cells and normal breast tissue. Due to the tumor-specific nature of DNA hypermethylation events, their use as tumor biomarkers is usually not hampered by analytical signals from normal cells, which is a general problem for existing protein tumor markers used for clinical assessment of breast cancer. There is accumulating evidence that DNA-methylation changes in breast cancer patients occur early during tumorigenesis. This may open up for effective screening, and analysis of blood or nipple aspirate may later help in diagnosing breast cancer. As a more detailed molecular characterization of different types of breast cancer becomes available, the ability to divide patients into subgroups based on DNA biomarkers may improve prognosis. Serial monitoring of DNA-methylation markers in blood during treatment may be useful, particularly when the cancer burden is below the detection level for standard imaging techniques. Overall, aberrant DNA methylation has a great potential as a versatile biomarker tool for screening, diagnosis, prognosis and monitoring of breast cancer. Standardization of methods and biomarker panels will be required to fully exploit this clinical potential.
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter
Directory of Open Access Journals (Sweden)
Wolfgang Boecker
2004-04-01
Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.
Medicago truncatula SOC1 Genes Are Up-regulated by Environmental Cues That Promote Flowering
Directory of Open Access Journals (Sweden)
Jared B. Fudge
2018-04-01
Full Text Available Like Arabidopsis thaliana, the flowering of the legume Medicago truncatula is promoted by long day (LD photoperiod and vernalization. However, there are differences in the molecular mechanisms involved, with orthologs of two key Arabidopsis thaliana regulators, FLOWERING LOCUS C (FLC and CONSTANS (CO, being absent or not having a role in flowering time function in Medicago. In Arabidopsis, the MADS-box transcription factor gene, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (AtSOC1, plays a key role in integrating the photoperiodic and vernalization pathways. In this study, we set out to investigate whether the Medicago SOC1 genes play a role in regulating flowering time. Three Medicago SOC1 genes were identified and characterized (MtSOC1a–MtSOC1c. All three MtSOC1 genes, when heterologously expressed, were able to promote earlier flowering of the late-flowering Arabidopsis soc1-2 mutant. The three MtSOC1 genes have different patterns of expression. However, consistent with a potential role in flowering time regulation, all three MtSOC1 genes are expressed in the shoot apex and are up-regulated in the shoot apex of plants in response to LD photoperiods and vernalization. The up-regulation of MtSOC1 genes was reduced in Medicago fta1-1 mutants, indicating that they are downstream of MtFTa1. Insertion mutant alleles of Medicago soc1b do not flower late, suggestive of functional redundancy among Medicago SOC1 genes in promoting flowering.
Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C
2000-06-01
Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.
International Nuclear Information System (INIS)
Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng
2005-01-01
PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases
Directory of Open Access Journals (Sweden)
João Ramalho-Carvalho
2017-02-01
Full Text Available Abstract Background Numerous DNA-damaging cellular stresses, including oncogene activation and DNA-damage response (DDR, may lead to cellular senescence. Previous observations linked microRNA deregulation with altered senescent patterns, prompting us to investigate whether epigenetic repression of microRNAs expression might disrupt senescence in prostate cancer (PCa cells. Methods Differential methylation mapping in prostate tissues was carried using Infinium HumanMethylation450 BeadChip. After validation of methylation and expression analyses in a larger series of prostate tissues, the functional role of the cluster miR-130b~301b was explored using in vitro studies testing cell viability, apoptosis, invasion and DNA damage in prostate cancer cell lines. Western blot and RT-qPCR were performed to support those observations. Results We found that the miR-130b~301b cluster directs epigenetic activation of cell cycle inhibitors required for DDR activation, thus stimulating the senescence-associated secretory phenotype (SASP. Furthermore, overexpression of miR-130b~301b cluster markedly reduced the malignant phenotype of PCa cells. Conclusions Altogether, these data demonstrate that miR-130b~301b cluster overexpression might effectively induce PCa cell growth arrest through epigenetic regulation of proliferation-blocking genes and activation of cellular senescence.
Identification of distal silencing elements in the murine interferon-A11 gene promoter.
Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G
1996-08-01
The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.
Lack of death receptor 4 (DR4) expression through gene promoter methylation in gastric carcinoma.
Lee, Kyung Hwa; Lim, Sang Woo; Kim, Ho Gun; Kim, Dong Yi; Ryu, Seong Yeob; Joo, Jae Kyun; Kim, Jung Chul; Lee, Jae Hyuk
2009-07-01
To determine the underlying mechanism for the differential expression, the extent of promoter methylation in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-related genes acting downstream of TRAIL was examined in early and advanced gastric carcinomas. The extent of promoter methylation in the DR4, DR5, DcR1, DcR2, and CASP8 genes was quantified using bisulfite modification and methylation-specific polymerase chain reaction. The promoters for DcR1, DcR2, and CASP8 were largely unmethylated in early gastric carcinoma, advanced gastric carcinoma, and controls, with no significant difference among them. Protein levels of DR4, DcR1, and DcR2 as revealed by immunohistochemistry correlated with the extent of the respective promoter methylation (P < 0.05 in all cases). Hypomethylation, rather than hypermethylation, of the DR4 promoter was noted in invasive gastric malignancies, with statistical significance (P = 0.003). The promoter methylation status of TRAIL receptors in gastric carcinoma may have clinical implications for improving therapeutic strategies in patients with gastric carcinoma.
Wise, Alexandra; Tenezaca, Luis; Fernandez, Robert W.; Schatoff, Emma; Flores, Julian; Ueda, Atsushi; Zhong, Xiaotian; Wu, Chun-Fang; Simon, Anne F.; Venkatesh, Tadmiri
2015-01-01
Autism spectrum disorder (ASD) is a neurodevelopmental disorder in humans characterized by complex behavioral deficits, including intellectual disability, impaired social interactions and hyperactivity. ASD exhibits a strong genetic component with underlying multi-gene interactions. Candidate gene studies have shown that the neurobeachin gene is disrupted in human patients with idiopathic autism (Castermans et al., 2003). The gene for neurobeachin (NBEA) spans the common fragile site FRA 13A ...
A database of annotated promoters of genes associated with common respiratory and related diseases
Chowdhary, Rajesh; Tan, Sinlam; Pavesi, Giulio; Jin, Gg; Dong, Difeng; Mathur, Sameer K.; Burkart, Arthur; Narang, Vipin; Glurich, Ingrid E.; Raby, Benjamin A.; Weiss, Scott T.; Limsoon, Wong; Liu, Jun; Bajic, Vladimir B.
2012-01-01
Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.
A database of annotated promoters of genes associated with common respiratory and related diseases
Chowdhary, Rajesh
2012-07-01
Many genes have been implicated in the pathogenesis of common respiratory and related diseases (RRDs), yet the underlying mechanisms are largely unknown. Differential gene expression patterns in diseased and healthy individuals suggest that RRDs affect or are affected by modified transcription regulation programs. It is thus crucial to characterize implicated genes in terms of transcriptional regulation. For this purpose, we conducted a promoter analysis of genes associated with 11 common RRDs including allergic rhinitis, asthma, bronchiectasis, bronchiolitis, bronchitis, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, eczema, psoriasis, and urticaria, many of which are thought to be genetically related. The objective of the present study was to obtain deeper insight into the transcriptional regulation of these disease-associated genes by annotating their promoter regions with transcription factors (TFs) and TF binding sites (TFBSs). We discovered many TFs that are significantly enriched in the target disease groups including associations that have been documented in the literature. We also identified a number of putative TFs/TFBSs that appear to be novel. The results of our analysis are provided in an online database that is freely accessible to researchers at http://www.respiratorygenomics.com. Promoter-associated TFBS information and related genomic features, such as histone modification sites, microsatellites, CpG islands, and SNPs, are graphically summarized in the database. Users can compare and contrast underlying mechanisms of specific RRDs relative to candidate genes, TFs, gene ontology terms, micro-RNAs, and biological pathways for the conduct of metaanalyses. This database represents a novel, useful resource for RRD researchers. Copyright © 2012 by the American Thoracic Society.
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
Energy Technology Data Exchange (ETDEWEB)
Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)
2006-03-31
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.
Schmidt, S.M.; Houterman, P.M.; Schreiver, I.; Ma, L.; Amyotte, S.; Chellappan, B.; Boeren, S.; Takken, F.L.W.; Rep, M.
2013-01-01
Background The plant-pathogenic fungus Fusarium oxysporum f.sp.lycopersici (Fol) has accessory, lineage-specific (LS) chromosomes that can be transferred horizontally between strains. A single LS chromosome in the Fol4287 reference strain harbors all known Fol effector genes. Transfer of this
Transactivation of the proximal promoter of human oxytocin gene by TR4 orphan receptor
International Nuclear Information System (INIS)
Wang, C.-P.; Lee, Y.-F.; Chang, C.; Lee, H.-J.
2006-01-01
The human testicular receptor 4 (TR4) shares structural homology with members of the nuclear receptor superfamily. Some other members of this superfamily were able to regulate the transcriptional activity of the human oxytocin (OXT) promoter by binding to the first DR0 regulatory site. However, little investigation was conducted systematically in the study of the second dDR4 site of OXT proximal promoter, and the relationship between the first and the second sites of OXT promoter. Here, we demonstrated for the first time that TR4 could increase the proximal promoter activity of the human OXT gene via DR0, dDR4, and OXT (both DR0 and dDR4) elements, respectively. TR4 might induce OXT gene expression through the OXT element in a dose-dependent manner. However, there is no synergistic effect between DR0 and dDR4 elements during TR4 transactivation. Taken together, these results suggested that TR4 should be one of important regulators of OXT gene expression
Cloning and characterization of the human integrin β6 gene promoter.
Directory of Open Access Journals (Sweden)
Mingyan Xu
Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.
Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A
2010-01-01
Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.
International Nuclear Information System (INIS)
Kimball, R.F.
1987-01-01
An historical overview is given of the development of ideas about chromosomal and DNA repair as they relate to the induction of mutations, chromosomal aberrations, and sister-chromatid exchanges by radiations and chemicals. The genetic and molecular bases of the various repair pathways are reviewed whenever possible. Work on both prokaryotes and eukaryotes is included. Mention is made, when deemed appropriate, of major developments in other areas that served as essential background for the repair work, but no attempt is made to cover these background developments in any detail. Near the end, a brief review is given of factors affecting polymerase fidelity. The history is subdivided into approximately 10-year intervals. For the most part, references are to reviews and symposia in which the ideas of the time were brought together. The implications of these findings for some practical problems in genetic toxicology and for our understanding of the maintenance of the genome are discussed at the end. 147 refs
Energy Technology Data Exchange (ETDEWEB)
Kimball, R F
1987-07-01
An historical overview is given of the development of ideas about chromosomal and DNA repair as they relate to the induction of mutations, chromosomal aberrations, and sister-chromatid exchanges by radiations and chemicals. The genetic and molecular bases of the various repair pathways are reviewed whenever possible. Work on both prokaryotes and eukaryotes is included. Mention is made, when deemed appropriate, of major developments in other areas that served as essential background for the repair work, but no attempt is made to cover these background developments in any detail. Near the end, a brief review is given of factors affecting polymerase fidelity. The history is subdivided into approximately 10-year intervals. For the most part, references are to reviews and symposia in which the ideas of the time were brought together. The implications of these findings for some practical problems in genetic toxicology and for our understanding of the maintenance of the genome are discussed at the end. 147 refs.
Directory of Open Access Journals (Sweden)
Shan Xin
Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.
Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo
2017-10-01
PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.
Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer
International Nuclear Information System (INIS)
Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.
2003-01-01
Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement
Mutations and chromosomal aberrations
International Nuclear Information System (INIS)
Kihlman, B.A.
1977-01-01
The genetic changes of mutations and chromosomal aberrations are discussed. The consequences of both depend not only on the type of genetic change produced but also on the type of cell that is affected and on the development stage of the organism. (C.F.)
c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells
International Nuclear Information System (INIS)
Chen, Yinghua; Xu, Jinhua; Borowicz, Stanley; Collins, Cindy; Huo, Dezheng; Olopade, Olufunmilayo I
2011-01-01
The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c
Mechanism of selective recruitment of RNA polymerases II and III to snRNA gene promoters.
Dergai, Oleksandr; Cousin, Pascal; Gouge, Jerome; Satia, Karishma; Praz, Viviane; Kuhlman, Tracy; Lhôte, Philippe; Vannini, Alessandro; Hernandez, Nouria
2018-05-01
RNA polymerase II (Pol II) small nuclear RNA (snRNA) promoters and type 3 Pol III promoters have highly similar structures; both contain an interchangeable enhancer and "proximal sequence element" (PSE), which recruits the SNAP complex (SNAPc). The main distinguishing feature is the presence, in the type 3 promoters only, of a TATA box, which determines Pol III specificity. To understand the mechanism by which the absence or presence of a TATA box results in specific Pol recruitment, we examined how SNAPc and general transcription factors required for Pol II or Pol III transcription of SNAPc-dependent genes (i.e., TATA-box-binding protein [TBP], TFIIB, and TFIIA for Pol II transcription and TBP and BRF2 for Pol III transcription) assemble to ensure specific Pol recruitment. TFIIB and BRF2 could each, in a mutually exclusive fashion, be recruited to SNAPc. In contrast, TBP-TFIIB and TBP-BRF2 complexes were not recruited unless a TATA box was present, which allowed selective and efficient recruitment of the TBP-BRF2 complex. Thus, TBP both prevented BRF2 recruitment to Pol II promoters and enhanced BRF2 recruitment to Pol III promoters. On Pol II promoters, TBP recruitment was separate from TFIIB recruitment and enhanced by TFIIA. Our results provide a model for specific Pol recruitment at SNAPc-dependent promoters. © 2018 Dergai et al.; Published by Cold Spring Harbor Laboratory Press.
DEFF Research Database (Denmark)
Rohlin, A; Engwall, Y; Fritzell, K
2011-01-01
inactivation of promoter 1B is disease causing in FAP; (ii) expression of transcripts from promoter 1B is generated at considerable higher levels compared with 1A, demonstrating a hitherto unknown importance of 1B; (iii) adenoma formation in FAP, caused by impaired function of promoter 1B, does not require......Familial adenomatous polyposis (FAP) is caused by germline mutations in the adenomatous polyposis coli (APC) gene. Two promoters, 1A and 1B, have been recognized in APC, and 1B is thought to have a minor role in the regulation of the gene. We have identified a novel deletion encompassing half...... of this promoter in the largest family (Family 1) of the Swedish Polyposis Registry. The mutation leads to an imbalance in allele-specific expression of APC, and transcription from promoter 1B was highly impaired in both normal colorectal mucosa and blood from mutation carriers. To establish the significance...
hTERT promoter mediating gene therapy in laryngeal squamous carcinomas cells in vitro
International Nuclear Information System (INIS)
Liao Zhengkai; Zhou Yunfeng; Zhou Fuxiang; Luo Zhiguo; Xiong Jie; Bao Jie; Xie Conghua; Liu Shiquan
2007-01-01
Objective: To investigate the relationship among hTERT promoter activity, hTERT mRNA expression, and telomerase activity (TA) in laryngeal squamous carcinomas cell lines, and to evaluate the usefulness of hTERT promoter mediated gene therapy. Methods: After plasmids pGL3-hTERTp were transfected, hTEBT promoter activity, hTERT mRNA expression and TA were determined by luciferase assay, RT-PCR and TRAP-PCR-ELISA, respectively. Plasmid phTERTp-HRP was constructed and transfected, HRP expression was determined by RT-PCR and competent peroxidase activity was confirmed by enzyme activity assay. The cytotoxicity and radiosensitivity of phTERTp-HRP/IAA were determined by clonogenic assay. Results: The relative levels of hTERT promoter activity, hTERT mRNA expression and TA in Hep2R cells were 1.37-fold, 1.43-fold and 1.81-fold compared with Hep2R cells, hTERT promoter activity was closely associated with hTERT mRNA expression and TA levels (P SF 2 ) was 1.24 (Hep2R cells) and 1.20 (Hep 2cells), the parameter a of with or without IAA incubation were 0.090, 0.020 (Hep2R)and 0.099, 0.042 (Hep2). Conclusions: hTERT promoter is applicable in mediating gene therapy in different radiosensitive laryngeal squamous carcinomas cells. hTERTp-HRP/IAA gene therapy may be a promising supplementary method for radiotherapy of laryngeal squamous-cell carcinomas. (authors)
Directory of Open Access Journals (Sweden)
Lincoln Matthew R
2008-07-01
Full Text Available Abstract Background Multiple sclerosis (MS is a complex trait in which alleles at or near the class II loci HLA-DRB1 and HLA-DQB1 contribute significantly to genetic risk. The MHC class II transactivator (MHC2TA is the master controller of expression of class II genes, and methylation of the promoter of this gene has been previously been shown to alter its function. In this study we sought to assess whether or not methylation of the MHC2TA promoter pIV could contribute to MS disease aetiology. Methods In DNA from peripheral blood mononuclear cells from a sample of 50 monozygotic disease discordant MS twins the MHC2TA promoter IV was sequenced and analysed by methylation specific PCR. Results No methylation or sequence variation of the MHC2TA promoter pIV was found. Conclusion The results of this study cannot support the notion that methylation of the pIV promoter of MHC2TA contributes to MS disease risk, although tissue and timing specific epigenetic modifications cannot be ruled out.
Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo
2014-09-17
DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.
MGMT, GATA6, CD81, DR4, and CASP8 gene promoter methylation in glioblastoma
Directory of Open Access Journals (Sweden)
Skiriute Daina
2012-06-01
Full Text Available Abstract Background Methylation of promoter region is the major mechanism affecting gene expression in tumors. Recent methylome studies of brain tumors revealed a list of new epigenetically modified genes. Our aim was to study promoter methylation of newly identified epigenetically silenced genes together with already known epigenetic markers and evaluate its separate and concomitant role in glioblastoma genesis and patient outcome. Methods The methylation status of MGMT, CD81, GATA6, DR4, and CASP8 in 76 patients with primary glioblastomas was investigated. Methylation-specific PCR reaction was performed using bisulfite treated DNA. Evaluating glioblastoma patient survival time after operation, patient data and gene methylation effect on survival was estimated using survival analysis. Results The overwhelming majority (97.3% of tumors were methylated in at least one of five genes tested. In glioblastoma specimens gene methylation was observed as follows: MGMT in 51.3%, GATA6 in 68.4%, CD81 in 46.1%, DR4 in 41.3% and CASP8 in 56.8% of tumors. Methylation of MGMT was associated with younger patient age (p CASP8 with older (p MGMT methylation was significantly more frequent event in patient group who survived longer than 36 months after operation (p CASP8 was more frequent in patients who survived shorter than 36 months (p MGMT, GATA6 and CASP8 as independent predictors for glioblastoma patient outcome (p MGMT and GATA6 were independent predictors for patient survival in younger patients’ group, while there were no significant associations observed in older patients’ group when adjusted for therapy. Conclusions High methylation frequency of tested genes shows heterogeneity of glioblastoma epigenome and the importance of MGMT, GATA6 and CASP8 genes methylation in glioblastoma patient outcome.
Two distinct promoters drive transcription of the human D1A dopamine receptor gene.
Lee, S H; Minowa, M T; Mouradian, M M
1996-10-11
The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has
Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.
Steinacher, Arno; Bates, Declan G; Akman, Ozgur E; Soyer, Orkun S
2016-01-01
Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for
Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.
Directory of Open Access Journals (Sweden)
Arno Steinacher
Full Text Available Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest
Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun
2015-01-01
Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
CAGE-defined promoter regions of the genes implicated in Rett Syndrome
DEFF Research Database (Denmark)
Vitezic, Morana; Bertin, Nicolas; Andersson, Robin
2014-01-01
BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
Correlation between the methylation of APC gene promoter and colon cancer.
Li, Bing-Qiang; Liu, Peng-Peng; Zhang, Cai-Hua
2017-08-01
The present study was planned to explore the correlation between the methylation of APC (adenomatous polyposis coli) and colon carcinogenesis. Colon cancer tissues and tumor-adjacent normal tissues of 60 colon cancer patients (who received surgical operation in our hospital from January 2012 to December 2014) were collected. SW1116 cells in human colon cancer tissues were selected for culturing. 5-aza-2c-deoxycytidine (5-aza-dC) was utilized as an inhibitor of the methylation for APC gene. Methylation specific PCR (MSP) was utilized for detection of APC methylation in SW1116 cells. The MTT and Transwell assays were performed to detect the effect of the methylation of APC gene on the proliferation and invasive abilities of SW1116 cells. The correlation between the methylation of APC gene and pathological parameters of colon cancer patients was analyzed. MSP results revealed that 41 cases (68.33%) showed methylation of APC gene in colon cancer tissues. No methylation of APC gene was found in tumor-adjacent normal tissues. 5-aza-dC was able to inhibit the methylation of APC gene in SW1116 cells. APC gene methylation was correlated with tumor size, differentiation degree, lymph node metastasis and Dukes staging. In conclusion, the levels of the methylation of APC in colon cancer tissues and SW1116 cells are relatively high. The methylation of APC promoted the proliferation and invasion abilities of SW1116 cells. Furthermore, methylation is correlated with a variety of clinicopathological features of colon cancer patients.
Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes
DEFF Research Database (Denmark)
Lindvall, Therese; Karlsson, Jenny; Holmdahl, Rikard
2009-01-01
with Eae39 congenic- and sub-interval congenic mice, carrying RIIIS/J genes on the B10.RIII genetic background, revealed three loci within Eae39 that control disease and anti-collagen antibody titers. Two of the loci promoted disease and the third locus was protecting from collagen induced arthritis...... development. By further breeding of mice with small congenic fragments, we identified a 3.2 Megabasepair (Mbp) interval that regulates disease. CONCLUSIONS: Disease promoting- and protecting genes within the Eae39 locus on mouse chromosome 5, control susceptibility to collagen induced arthritis. A disease......-protecting locus in the telomeric part of Eae39 results in lower anti-collagen antibody responses. The study shows the importance of breeding sub-congenic mouse strains to reveal genetic effects on complex diseases....
Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter
International Nuclear Information System (INIS)
Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi
2006-01-01
The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid
International Nuclear Information System (INIS)
Zurita, Mercedes; Lara, Pedro C; Moral, Rosario del; Torres, Blanca; Linares-Fernández, José Luis; Arrabal, Sandra Ríos; Martínez-Galán, Joaquina; Oliver, Francisco Javier; Ruiz de Almodóvar, José Mariano
2010-01-01
Numerous hypermethylated genes have been reported in breast cancer, and the silencing of these genes plays an important role in carcinogenesis, tumor progression and diagnosis. These hypermethylated promoters are very rarely found in normal breast. It has been suggested that aberrant hypermethylation may be useful as a biomarker, with implications for breast cancer etiology, diagnosis, and management. The relationship between primary neoplasm and metastasis remains largely unknown. There has been no comprehensive comparative study on the clinical usefulness of tumor-associated methylated DNA biomarkers in primary breast carcinoma and metastatic breast carcinoma. The objective of the present study was to investigate the association between clinical extension of breast cancer and methylation status of Estrogen Receptor1 (ESR1) and Stratifin (14-3-3-σ) gene promoters in disease-free and metastatic breast cancer patients. We studied two cohorts of patients: 77 patients treated for breast cancer with no signs of disease, and 34 patients with metastatic breast cancer. DNA was obtained from serum samples, and promoter methylation status was determined by using DNA bisulfite modification and quantitative methylation-specific PCR. Serum levels of methylated gene promoter 14-3-3-σ significantly differed between Control and Metastatic Breast Cancer groups (P < 0.001), and between Disease-Free and Metastatic Breast Cancer groups (P < 0.001). The ratio of the 14-3-3-σ level before the first chemotherapy cycle to the level just before administration of the second chemotherapy cycle was defined as the Biomarker Response Ratio [BRR]. We calculated BRR values for the 'continuous decline' and 'rise-and-fall' groups. Subsequent ROC analysis showed a sensitivity of 75% (95% CI: 47.6 - 86.7) and a specificity of 66.7% (95% CI: 41.0 - 86.7) to discriminate between the groups for a cut-off level of BRR = 2.39. The area under the ROC curve (Z = 0.804 ± 0
DEFF Research Database (Denmark)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal
2013-01-01
, isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the "electron transport chain" and neuronal differentiation, emphasizing that "tissue important" genes are regulated at several...
Olayan, Rawan S.
2012-12-01
In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.
Olayan, Rawan S.
2012-01-01
In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.
Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A
2007-08-01
Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.
Panagopoulou, Maria; Lambropoulou, Maria; Balgkouranidou, Ioanna; Nena, Evangelia; Karaglani, Makrina; Nicolaidou, Christina; Asimaki, Anthi; Konstantinidis, Theocharis; Constantinidis, Theodoros C; Kolios, George; Kakolyris, Stylianos; Agorastos, Theodoros; Chatzaki, Ekaterini
2017-04-01
Cervical cancer is strongly related to certain high-risk types of human papilloma virus infection. Breast cancer metastasis suppressor 1 (BRMS1) is a tumor suppressor gene, its expression being regulated by DNA promoter methylation in several types of cancers. This study aims to evaluate the methylation status of BRMS1 promoter in relation to high-risk types of human papilloma virus infection and the development of pre-cancerous lesions and describe the pattern of BRMS1 protein expression in normal, high-risk types of human papilloma virus-infected pre-cancerous and malignant cervical epithelium. We compared the methylation status of BRMS1 in cervical smears of 64 women with no infection by high-risk types of human papilloma virus to 70 women with proven high-risk types of human papilloma virus infection, using real-time methylation-specific polymerase chain reaction. The expression of BRMS1 protein was described by immunohistochemistry in biopsies from cervical cancer, pre-cancerous lesions, and normal cervices. Methylation of BRMS1 promoter was detected in 37.5% of women with no high-risk types of human papilloma virus infection and was less frequent in smears with high-risk types of human papilloma virus (11.4%) and in women with pathological histology (cervical intraepithelial neoplasia) (11.9%). Methylation was detected also in HeLa cervical cancer cells. Immunohistochemistry revealed nuclear BRMS1 protein staining in normal high-risk types of human papilloma virus-free cervix, in cervical intraepithelial neoplasias, and in malignant tissues, where staining was occasionally also cytoplasmic. In cancer, expression was stronger in the more differentiated cancer blasts. In conclusion, BRMS1 promoter methylation and aberrant protein expression seem to be related to high-risk types of human papilloma virus-induced carcinogenesis in uterine cervix and is worthy of further investigation.
Sox2 Is an Androgen Receptor-Repressed Gene That Promotes Castration-Resistant Prostate Cancer
Kregel, Steven; Kiriluk, Kyle J.; Rosen, Alex M.; Cai, Yi; Reyes, Edwin E.; Otto, Kristen B.; Tom, Westin; Paner, Gladell P.; Szmulewitz, Russell Z.; Vander Griend, Donald J.
2013-01-01
Despite advances in detection and therapy, castration-resistant prostate cancer continues to be a major clinical problem. The aberrant activity of stem cell pathways, and their regulation by the Androgen Receptor (AR), has the potential to provide insight into novel mechanisms and pathways to prevent and treat advanced, castrate-resistant prostate cancers. To this end, we investigated the role of the embryonic stem cell regulator Sox2 [SRY (sex determining region Y)-box 2] in normal and malignant prostate epithelial cells. In the normal prostate, Sox2 is expressed in a portion of basal epithelial cells. Prostate tumors were either Sox2-positive or Sox2-negative, with the percentage of Sox2-positive tumors increasing with Gleason Score and metastases. In the castration-resistant prostate cancer cell line CWR-R1, endogenous expression of Sox2 was repressed by AR signaling, and AR chromatin-IP shows that AR binds the enhancer element within the Sox2 promoter. Likewise, in normal prostate epithelial cells and human embryonic stem cells, increased AR signaling also decreases Sox2 expression. Resistance to the anti-androgen MDV3100 results in a marked increase in Sox2 expression within three prostate cancer cell lines, and in the castration-sensitive LAPC-4 prostate cancer cell line ectopic expression of Sox2 was sufficient to promote castration-resistant tumor formation. Loss of Sox2 expression in the castration-resistant CWR-R1 prostate cancer cell line inhibited cell growth. Up-regulation of Sox2 was not associated with increased CD133 expression but was associated with increased FGF5 (Fibroblast Growth Factor 5) expression. These data propose a model of elevated Sox2 expression due to loss of AR-mediated repression during castration, and consequent castration-resistance via mechanisms not involving induction of canonical embryonic stem cell pathways. PMID:23326489
Transgelin gene is frequently downregulated by promoter DNA hypermethylation in breast cancer.
Sayar, Nilufer; Karahan, Gurbet; Konu, Ozlen; Bozkurt, Betul; Bozdogan, Onder; Yulug, Isik G
2015-01-01
CpG hypermethylation in gene promoters is a frequent mechanism of tumor suppressor gene silencing in various types of cancers. It usually occurs at early steps of cancer progression and can be detected easily, giving rise to development of promising biomarkers for both detection and progression of cancer, including breast cancer. 5-aza-2'-deoxycytidine (AZA) is a DNA demethylating and anti-cancer agent resulting in induction of genes suppressed via DNA hypermethylation. Using microarray expression profiling of AZA- or DMSO-treated breast cancer and non-tumorigenic breast (NTB) cells, we identified for the first time TAGLN gene as a target of DNA hypermethylation in breast cancer. TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells compared to NTB cells, and also in 13/21 (61.9 %) of breast tumors compared to matched normal tissues. Analyses of public microarray methylation data showed that TAGLN was also hypermethylated in 63.02 % of tumors compared to normal tissues; relapse-free survival of patients was worse with higher TAGLN methylation; and methylation levels could discriminate between tumors and healthy tissues with 83.14 % sensitivity and 100 % specificity. Additionally, qRT-PCR and immunohistochemistry experiments showed that TAGLN expression was significantly downregulated in two more independent sets of breast tumors compared to normal tissues and was lower in tumors with poor prognosis. Colony formation was increased in TAGLN silenced NTB cells, while decreased in overexpressing BC cells. TAGLN gene is frequently downregulated by DNA hypermethylation, and TAGLN promoter methylation profiles could serve as a future diagnostic biomarker, with possible clinical impact regarding the prognosis in breast cancer.
Association of Interleukin-10 gene promoter polymorphisms with obstructive sleep apnea.
Özdaş, Sibel; Özdaş, Talih; Acar, Mustafa; Erbek, Selim S; Köseoğlu, Sabri; Göktürk, Gökhan; Izbirak, Afife
2016-05-01
Interleukin-10 (IL) is an anti-inflammatory cytokine that regulates normal sleep patterns, and recent studies have reported that it is a potential useful biomarker to identify presence and severity of sleep apnea syndrome (OSAS). Promoter polymorphisms of IL-10 gene have been associated with altered expression levels, which contributes to OSAS. The aim of this study was to determine the prevalence of -1082 G/A, -819 C/T, and -592 C/A promoter polymorphisms of IL-10 gene in individuals with OSAS and controls. An open-label study was performed in the Otorhinolaryngology and Sleep Disorders Outpatient Clinics. One hundred four cases with OSAS were included as the study group, and 78 individuals without OSAS were included as the controls. DNAs were extracted from peripheral blood leukocytes, and the sites that encompassed those polymorphisms were identified by DNA sequencing analyses. Data were analyzed with SNPStats and multifactor dimensionality reduction (MDR) software. The prevalence of OSAS was higher in males in the study group when compared to controls (P = 0.0003). The IL-10-1082 G/A, -819 C/T, and -592 C/A SNPs, and their minor alleles were associated with a significantly increased risk for OSAS compared to the controls (P ˂ 0.05 for all). Furthermore, ATA haplotype frequency was significantly higher in the study group compared to the control group, but the GCC haplotype frequency was lower (P = 0.0001 and P = 0.0001). As indicated in MDR analysis, combinations of IL-10 gene were associated with OSAS in single-, double-, and triple-locus analyses. The prevalences of the IL-10 gene promoter polymorphisms were different in OSAS patients and the controls in Turkish population. IL-10 gene polymorphisms may lead to altered inflammatory cascade, which might contribute to OSAS. Further studies on larger cohorts are needed to validate our findings.
Promotion of growth by Coenzyme Q10 is linked to gene expression in C. elegans.
Fischer, Alexandra; Niklowitz, Petra; Menke, Thomas; Döring, Frank
2014-10-03
Coenzyme Q (CoQ, ubiquinone) is an essential component of the respiratory chain, a cofactor of pyrimidine biosynthesis and acts as an antioxidant in extra mitochondrial membranes. More recently CoQ has been identified as a modulator of apoptosis, inflammation and gene expression. CoQ deficient Caenorhabditis elegans clk-1 mutants show several phenotypes including a delayed postembryonic growth. Using wild type and two clk-1 mutants, here we established an experimental set-up to study the consequences of endogenous CoQ deficiency or exogenous CoQ supply on gene expression and growth. We found that a deficiency of endogenous CoQ synthesis down-regulates a cluster of genes that are important for growth (i.e., RNA polymerase II, eukaryotic initiation factor) and up-regulates oxidation reactions (i.e., cytochrome P450, superoxide dismutase) and protein interactions (i.e., F-Box proteins). Exogenous CoQ supply partially restores the expression of these genes as well as the growth retardation of CoQ deficient clk-1 mutants. On the other hand exogenous CoQ supply does not alter the expression of a further sub-set of genes. These genes are involved in metabolism (i.e., succinate dehydrogenase complex), cell signalling or synthesis of lectins. Thus, our work provides a comprehensive overview of genes which can be modulated in their expression by endogenous or exogenous CoQ. As growth retardation in CoQ deficiency is linked to the gene expression profile we suggest that CoQ promotes growth via gene expression. Copyright © 2014 Elsevier Inc. All rights reserved.
Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas
Directory of Open Access Journals (Sweden)
Marta Mellai
2013-01-01
Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.
Fu, Chunli; Xing, Yingqi; Song, Xiaonan
2011-04-01
To investigate the association of single nucleotide polymorphism in the matrix metalloproteinase-3 (MMP3) gene promoter with the susceptibility to the middle cerebral artery stenosis. A case-control study was performed by determining the genotype of MMP3 gene promoter region using polymerase chain reaction-restriction fragment length polymorphism in 119 patients with middle cerebral artery stenosis documented by transcranial Doppler compared to 92 control patients. The frequencies of 5A and 6A alleles in MMP3 promoter region were 16.0 and 84.0% respectively in case group compared to 15.8 and 84.2% in control group with no significant difference between the two groups (P > 0.05). No significant difference was also observed in the distribution of genotypes 5A/5A,5A/6A, and 6A/6A between middle cerebral artery stenosis and control groups. Compared to 5A/5A + 5A/6A genotypes,the 6A/6A genotype did not significantly modify the risk of developing the middle cerebral artery stenosis. The MMP3-1171 dupA promoter polymorphisms are not valuable markers of susceptibility of the middle cerebral artery stenosis in this sample of population studied.
Durr, Megan L.; Mydlarz, Wojciech K.; Shao, Chunbo; Zahurak, Marianna L.; Chuang, Alice Y.; Hoque, Mohammad O.; Westra, William H.; Liegeois, Nanette J.; Califano, Joseph A.; Sidransky, David; Ha, Patrick K.
2010-01-01
Background Methylation profiling of tumor suppressor gene (TSGs) promoters is quickly becoming a powerful diagnostic tool for the early detection, prognosis, and even prediction of clinical response to treatment. Few studies address this in salivary gland tumors (SGTs); hence the promoter methylation profile of various TSGs was quantitatively assessed in primary SGT tissue to determine if tumor-specific alterations could be detected. Methodology DNA isolated from 78 tumor and 17 normal parotid gland specimens was assayed for promoter methylation status of 19 TSGs by fluorescence-based, quantitative methylation-specific PCR (qMSP). The data were utilized in a binary fashion as well as quantitatively (using a methylation quotient) allowing for better profiling and interpretation of results. Principal Findings The average number of methylation events across the studied genes was highest in salivary duct carcinoma (SDC), with a methylation value of 9.6, compared to the normal 4.5 (ptrend for increasing methylation in APC, Mint 1, PGP9.5, RAR-β, and Timp3. Conclusions/Significance Screening promoter methylation profiles in SGTs showed considerable heterogeneity. The methylation status of certain markers was surprisingly high in even normal salivary tissue, confirming the need for such controls. Several TSGs were found to be associated with malignant SGTs, especially SDC. Further study is needed to evaluate the potential use of these associations in the detection, prognosis, and therapeutic outcome of these rare tumors. PMID:20520817
Directory of Open Access Journals (Sweden)
Rachel M. Woodfint
2017-01-01
Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.
Genomic organization and promoter cloning of the human X11α gene APBA1.
LENUS (Irish Health Repository)
Chai, Ka-Ho
2012-05-01
X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.
International Nuclear Information System (INIS)
Konstam, M.A.; Novelline, R.A.; Athanasoulis, C.A.
1979-01-01
In a patient undergoing selective hepatic arteriography for suspected liver trauma, a nonopacified area of the liver, initially thought to represent a hepatic hematoma, was later discovered to be due to the presence of an accessory right hepatic artery arising from the superior mesenteric artery. This case illustrates the need for a search for aberrant vasculature whenever a liver hematoma is suspected on the basis of a selective hepatic arteriogram. (orig.) [de
Over-expression of Gene FaASR Promotes Strawberry Fruit Coloring
Directory of Open Access Journals (Sweden)
Liu Zhongjie
2015-11-01
Full Text Available Fruit development and ripening is a complicate process. Although much progress has been made on the ripenig process, the molecular mechamism of fruit development is not yet clear. In this study, we used ‘Sweet Charlie’ strawberry as test materials, based on cloning the strawberries ASR homologous gene, we carried out the bioinformatics and temporal expression analysis of FaASR, by manipulating ASR gene expression level in strawberry fruit, we tested the changes of physiological indicators, including sugar, ABA, pigments content, and fruit firmness, as well as phenotypic changes. In addition, we measured the expression changes of some anthocyanin-related gene, such as CHS and UFGT, by which we revealed the regulation mechanisms of ASR gene over strawberry fruit ripening. Strawberry ASR contained a typical domain of ABA/WDS that was related to fruit ripening and stress-resistance, and ASR gene over-expression could promote strawberry fruit coloring, endogenous ABA and sucrose accumulation, fruit softening, and induced the transcription levels of anthocyanin-related genes CHS and UFGT. The present study will further reveal the molecular mechanisms of information transmission in fruit development, and will also play an important foundation for future molecular improvement of strawberries breeding.
Directory of Open Access Journals (Sweden)
Shane D. Sykes
2015-01-01
Full Text Available The intrauterine renin angiotensin system (RAS is implicated in placentation and labour onset. Here we investigate whether promoter methylation of RAS genes changes with gestation or labour and if it affects gene expression. Early gestation amnion and placenta were studied, as were term amnion, decidua, and placenta collected before labour (at elective caesarean section or after spontaneous labour and delivery. The expression and degree of methylation of the prorenin receptor (ATP6AP2, angiotensin converting enzyme (ACE, angiotensin II type 1 receptor (AGTR1, and two proteases that can activate prorenin (kallikrein, KLK1, and cathepsin D, CTSD were measured by qPCR and a DNA methylation array. There was no effect of gestation or labour on the methylation of RAS genes and CTSD. Amnion and decidua displayed strong correlations between the percent hypermethylation of RAS genes and CTSD, suggestive of global methylation. There were no correlations between the degree of methylation and mRNA abundance of any genes studied. KLK1 was the most methylated gene and the proportion of hypermethylated KLK1 alleles was lower in placenta than decidua. The presence of intermediate methylated alleles of KLK1 in early gestation placenta and in amnion after labour suggests that KLK1 methylation is uniquely dynamic in these tissues.
Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization
International Nuclear Information System (INIS)
Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.
1987-01-01
The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Optical traps with geometric aberrations
International Nuclear Information System (INIS)
Roichman, Yael; Waldron, Alex; Gardel, Emily; Grier, David G.
2006-01-01
We assess the influence of geometric aberrations on the in-plane performance of optical traps by studying the dynamics of trapped colloidal spheres in deliberately distorted holographic optical tweezers. The lateral stiffness of the traps turns out to be insensitive to moderate amounts of coma, astigmatism, and spherical aberration. Moreover holographic aberration correction enables us to compensate inherent shortcomings in the optical train, thereby adaptively improving its performance. We also demonstrate the effects of geometric aberrations on the intensity profiles of optical vortices, whose readily measured deformations suggest a method for rapidly estimating and correcting geometric aberrations in holographic trapping systems
Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes
Directory of Open Access Journals (Sweden)
Rowe J
2009-08-01
Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.
Energy Technology Data Exchange (ETDEWEB)
Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others
1994-09-01
The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.
Promoter characterization and genomic organization of the human X11β gene APBA2.
LENUS (Irish Health Repository)
Hao, Yan
2012-02-15
Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.
International Nuclear Information System (INIS)
Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent
2011-01-01
Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue
Directory of Open Access Journals (Sweden)
Lagerstedt Kristina
2011-06-01
Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.
Energy Technology Data Exchange (ETDEWEB)
Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)
2007-07-01
As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.
Directory of Open Access Journals (Sweden)
Xian-E Peng
Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.
Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin
2016-06-01
Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.
Directory of Open Access Journals (Sweden)
Tung Shu-Yun
2011-04-01
Full Text Available Abstract Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR. A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI genes (OnTI1, OnTI2 and OnTI3, which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Alam, Tanvir
2012-07-01
Distinguishing transcription regulatory patterns of different gene groups is a common problem in various bioinformatics studies. In this work we developed a methodology to deal with such a problem based on machine learning techniques. We applied our method to two biologically important problems related to detecting a difference in transcription regulation of: a/ protein-coding and long non-coding RNAs (lncRNAs) in human, as well as b/ a difference between primate-specific and non-primate-specific long non-coding RNAs. Our method is capable to classify RNAs using various regulatory features of genes that transcribe into these RNAs, such as nucleotide frequencies, transcription factor binding sites, de novo sequence motifs, CpG islands, repetitive elements, histone modification marks, and others. Ten-fold cross-validation tests suggest that our model can distinguish protein-coding and non-coding RNAs with accuracy above 80%. Twenty-fold cross-validation tests suggest that our model can distinguish primate-specific from non-primate-specific promoters of lncRNAs with accuracy above 80%. Consequently, we can hypothesize that transcription of the groups of genes mentioned above are regulated by different mechanisms. Feature selection techniques allowed us to reduce the number of features significantly while keeping the accuracy around 80%. Consequently, we can conclude that selected features play significant role in transcription regulation of coding and non-coding genes, as well as primate-specific and non-primate-specific lncRNA genes.
Aquilegia B gene homologs promote petaloidy of the sepals and maintenance of the C domain boundary
Directory of Open Access Journals (Sweden)
Bharti Sharma
2017-11-01
Full Text Available Abstract The model Aquilegia coerulea x “Origami” possesses several interesting floral features, including petaloid sepals that are morphologically distinct from the true petals and a broad domain containing many whorls of stamens. We undertook the current study in an effort to understand the former trait, but additionally uncovered data that inform on the latter. The Aquilegia B gene homolog AqPI is shown to contribute to the production of anthocyanin in the first whorl sepals, although it has no major role in their morphology. Surprisingly, knockdown of AqPI in Aquilegia coerulea x “Origami” also reveals a role for the B class genes in maintaining the expression of the C gene homolog AqAG1 in the outer whorls of stamens. These findings suggest that the transference of pollinator function to the first whorl sepals included a non-homeotic recruitment of the B class genes to promote aspects of petaloidy. They also confirm results in several other Ranunculales that have revealed an unexpected regulatory connection between the B and C class genes.
Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family
Directory of Open Access Journals (Sweden)
Jill Christine Preston
2013-04-01
Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Energy Technology Data Exchange (ETDEWEB)
Kuzmina, Nina S., E-mail: nin-kuzmin@youndex.ru; Lapteva, Nellya Sh.; Rubanovich, Alexander V.
2016-04-15
Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10{sup −7}). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10{sup −5}). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10{sup −7}). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging
International Nuclear Information System (INIS)
Kuzmina, Nina S.; Lapteva, Nellya Sh.; Rubanovich, Alexander V.
2016-01-01
Some human genes known to undergo age-related promoter hypermethylation. These epigenetic modifications are similar to those occurring in the course of certain diseases, e.g. some types of cancer, which in turn may also associate with age. Given external genotoxic factors may additionally contribute to hypermethylation, this study was designed to analyzes, using methylation-sensitive polymerase chain reaction (PCR), the CpG island hypermethylation in RASSF1A, CDKN2A (including p16/INK4A and p14/ARF) and GSTP1 promoters in peripheral blood leukocytes of individuals exposed to ionizing radiation long time ago. One hundred and twenty-four irradiated subjects (24–77 years old at sampling: 83 Chernobyl Nuclear Power Plant clean-up workers, 21 nuclear workers, 20 residents of territories with radioactive contamination) and 208 unirradiated volunteers (19–77 years old at sampling) were enrolled. In addition, 74 non-exposed offspring (2–51 years old at sampling) born to irradiated parents were examined. The frequency of individuals displaying promoter methylation of at least one gene in exposed group was significantly higher as compared to the control group (OR=5.44, 95% CI=2.62–11.76, p=3.9×10 −7 ). No significant difference was found between the frequency of subjects with the revealed promoter methylation in the group of offspring born to irradiated parents and in the control group. The increase in the number of methylated loci of RASSF1A and p14/ARF was associated with age (β=0.242; p=1.7×10 −5 ). In contrast, hypermethylation of p16/INK4A and GSTP1 genes correlated with the fact of radiation exposure only (β=0.290; p=1.7×10 −7 ). The latter finding demonstrates that methylation changes in blood leukocytes of healthy subjects exposed to radiation resemble those reported in human malignancies. Additional studies are required to identify the dose-response of epigenetic markers specifically associating with radiation-induced premature aging and/or with
Butler, Nathaniel M; Hannapel, David J
2012-12-01
Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.
Directory of Open Access Journals (Sweden)
Zhichun Zhang
Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.
Glucose metabolism in pigs expressing human genes under an insulin promoter.
Wijkstrom, Martin; Bottino, Rita; Iwase, Hayoto; Hara, Hidetaka; Ekser, Burcin; van der Windt, Dirk; Long, Cassandra; Toledo, Frederico G S; Phelps, Carol J; Trucco, Massimo; Cooper, David K C; Ayares, David
2015-01-01
Xenotransplantation of porcine islets can reverse diabetes in non-human primates. The remaining hurdles for clinical application include safe and effective T-cell-directed immunosuppression, but protection against the innate immune system and coagulation dysfunction may be more difficult to achieve. Islet-targeted genetic manipulation of islet-source pigs represents a powerful tool to protect against graft loss. However, whether these genetic alterations would impair islet function is unknown. On a background of α1,3-galactosyltransferase gene-knockout (GTKO)/human (h)CD46, additional genes (hCD39, human tissue factor pathway inhibitor, porcine CTLA4-Ig) were inserted in different combinations under an insulin promoter to promote expression in islets (confirmed by immunofluorescence). Seven pigs were tested for baseline and glucose/arginine-challenged levels of glucose, insulin, C-peptide, and glucagon. This preliminary study did not show definite evidence of β-cell deficiencies, even when three transgenes were expressed under the insulin promoter. Of seven animals, all were normoglycemic at fasting, and five of seven had normal glucose disposal rates after challenge. All animals exhibited insulin, C-peptide, and glucagon responses to both glucose and arginine challenge; however, significant interindividual variation was observed. Multiple islet-targeted transgenic expression was not associated with an overtly detrimental effect on islet function, suggesting that complex genetic constructs designed for islet protection warrants further testing in islet xenotransplantation models. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Ruixi Liu
2012-01-01
Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.
Directory of Open Access Journals (Sweden)
de Souza Emanuel M
2009-03-01
Full Text Available Abstract Background ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. Methods First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP. Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. Results The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM; tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC was 76.2% compared with 25.5% in invasive ductal carcinoma
International Nuclear Information System (INIS)
Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de
2009-01-01
ADAM33 protein is a member of the family of transmembrane glycoproteins composed of multidomains. ADAM family members have different activities, such as proteolysis and adhesion, making them good candidates to mediate the extracellular matrix remodelling and changes in cellular adhesion that characterise certain pathologies and cancer development. It was reported that one family member, ADAM23, is down-regulated by promoter hypermethylation. This seems to correlate with tumour progression and metastasis in breast cancer. In this study, we explored the involvement of ADAM33, another ADAM family member, in breast cancer. First, we analysed ADAM33 expression in breast tumour cell lines by RT-PCR and western blotting. We also used 5-aza-2'-deoxycytidine (5azadCR) treatment and DNA bisulphite sequencing to study the promoter methylation of ADAM33 in breast tumour cell lines. We evaluated ADAM33 methylation in primary tumour samples by methylation specific PCR (MSP). Finally, ADAM33 promoter hypermethylation was correlated with clinicopathological data using the chi-square test and Fisher's exact test. The expression analysis of ADAM33 in breast tumour cell lines by RT-PCR revealed gene silencing in 65% of tumour cell lines. The corresponding lack of ADAM33 protein was confirmed by western blotting. We also used 5-aza-2'-deoxycytidine (5-aza-dCR) demethylation and bisulphite sequencing methodologies to confirm that gene silencing is due to ADAM33 promoter hypermethylation. Using MSP, we detected ADAM33 promoter hypermethylation in 40% of primary breast tumour samples. The correlation between methylation pattern and patient's clinicopathological data was not significantly associated with histological grade; tumour stage (TNM); tumour size; ER, PR or ERBB2 status; lymph node status; metastasis or recurrence. Methylation frequency in invasive lobular carcinoma (ILC) was 76.2% compared with 25.5% in invasive ductal carcinoma (IDC), and this difference was
Cellular origin of prognostic chromosomal aberrations in AML patients
DEFF Research Database (Denmark)
Mora-Jensen, H.; Jendholm, J.; Rapin, N.
2015-01-01
chromosomal structural rearrangements and single nucleotide variants (SNVs). Conventional AML diagnostics and recent seminal next-generation sequencing (NGS) studies have identified more than 200 recurrent genetic aberrations presenting in various combinations in individual patients. Significantly, many...... of these aberrations occur in normal hematopoietic stem and progenitor cells (HSCs/HPCs) before definitive leukemic transformation through additional acquisition of a few (that is, mostly 1 or 2) leukemia-promoting driver aberrations. NGS studies on sorted bone marrow (BM) populations of AML patients with a normal...
The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.
Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta
2009-08-01
Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.
Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida
2015-09-29
Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B. No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.
Directory of Open Access Journals (Sweden)
Cynthia J Thomson
Full Text Available Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4 influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599 that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing sensation seeking between groups. There were no significant associations between genotype(s and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.
Thomson, Cynthia J; Rajala, Amelia K; Carlson, Scott R; Rupert, Jim L
2014-01-01
Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regions of the dopamine-4-receptor gene (DRD4) influenced sport-specific sensation seeking, we analyzed five polymorphisms (-1106T/C, -906T/C, -809G/A, -291C/T, 120-bp duplication) in the promoter region of the gene in a cohort of skiers and snowboarders (n = 599) that represented a broad range of sensation seeking behaviours. We grouped subjects by genotype at each of the five loci and compared impulsive sensation seeking and domain-specific (skiing) sensation seeking between groups. There were no significant associations between genotype(s) and general or domain-specific sensation seeking in the skiers and snowboarders, suggesting that while DRD4 has previously been implicated in sensation seeking, the promoter variants investigated in this study do not contribute to sensation seeking in this athlete population.
Directory of Open Access Journals (Sweden)
Yin Weilun
2010-01-01
Full Text Available Abstract Background CBL1 is a calcium sensor that regulates drought, cold and salt signals in Arabidopsis. Overexpression of CBL1 gene in Arabidopsis and in Ammopiptanthus mongolicus showed different tolerant activities. We are interested in understanding the molecular mechanism of the upstream region of the CBL1 gene of A. mongolicus (AmCBL1. We investigated and characterized the promoter of the AmCBL1 gene, for promoters play a very important role in regulating gene expression in eukaryotes. Results A 1683-bp 5' flanking region was isolated from A. mongolicus. The sequence was identified as AmCBL1 promoter. Analysis of the promoter sequence indicated a 690-bp intron and some basic cis-acting elements were related to various environmental stresses and plant hormones. To identify the functional region of the AmCBL1 promoter, five plant expression vectors fused with the GUS (β-glucuronidase gene, driven by series deleted fragments of AmCBL1 promoter at different lengths from -1659, -1414, -1048, -296 to -167 bp relative to the transcriptional start site were constructed and transformed into Nicotiana tabacum L. cv. 89. Functional properties of each promoter segment were examined by GUS staining and fluorescence quantitative analyses using at least three single-copy PCR-positive plants of transgenic tobacco, treated with various environmental stresses and plant hormones for different times. We demonstrated that the AmCBL1 promoter was a vascular-specific and multiple-stress-inducible promoter. Our results further imply that the promoter fragment B1S3 possessed sufficient essential cis-acting elements, accounting for vascular-specific and stress-induced expression patterns. It may also indicate that for response to some stresses certain cis-elements are required in tissues outside the region of the B1S3 construct. Conclusions To help resolve uncertainties about the upstream regulatory mechanism of the CBL1 gene in desert plants, we suggest that
Hasenkamp, Sandra; Telgmann, Ralph; Staessen, Jan A; Hagedorn, Claudia; Dördelmann, Corinna; Bek, Martin; Brand-Herrmann, Stefan-Martin; Brand, Eva
2008-10-01
The G protein-coupled receptor kinase 4 is involved in renal sodium handling and blood pressure regulation. Missense variants have already been tested functionally and are associated with hypertension, but no data on promoter analyses are yet available. We scanned 94 hypertensive white subjects for genetic variation and performed promoter reporter gene analyses in HEK293T, COS7, and SaOs-2 cells. Transient transfections with various full lengths and wild-type deletion constructs revealed that 1851 bp of the flanking region and 275 bp of the 5'-untranslated region were sufficient for transcriptional activities and composed a powerful cis-active element in the distal 293 bp. The -1702T and +2T alleles resulted in drastic general reductions of promoter function, whereas an activity increasing effect of +268C was cell type specific. Electrophoretic mobility-shift assay, supershift, and cotransfection analyses of transcription factor binding sites predicted in silico (Alibaba2.1/Transfac7) resulted in allele-specific binding patterns of nuclear proteins and identified the participation of CCAAT/enhancer-binding protein transcription factor family members. The G protein-coupled receptor kinase 4 core promoter resides in the first 1851 bp upstream of its transcription start site. The 4 identified genetic variants within this region exert allele-specific impact on both cell type- and stimulation-dependent transcription and may affect the expression balance of renal G protein-coupled receptor kinase 4.
CypA, a gene downstream of HIF-1α, promotes the development of PDAC.
Directory of Open Access Journals (Sweden)
Huan Zhang
Full Text Available Hypoxia-inducible factor-1α (HIF-1α is a highly important transcription factor involved in cell metabolism. HIF-1α promotes glycolysis and inhibits of mitochondrial respiration in pancreatic ductal adenocarcinoma (PDAC. In response to tumor hypoxia, cyclophilin A (CypA is over-expressed in various cancer types, and is associated with cell apoptosis, tumor invasion, metastasis, and chemoresistance in PDAC. In this study, we showed that both HIF-1α and CypA expression were significantly associated with lymph node metastasis and tumor stage. The expression of CypA was correlated with HIF-1α. Moreover, the mRNA and protein expression of CypA markedly decreased or increased following the suppression or over-expression of HIF-1α in vitro. Chromatin immunoprecipitation analysis showed that HIF-1α could directly bind to the hypoxia response element (HRE in the CypA promoter regions and regulated CypA expression. Consistent with other studies, HIF-1α and CypA promoted PDAC cell proliferation and invasion, and suppressed apoptosis in vitro. Furthermore, we proved the combination effect of 2-methoxyestradiol and cyclosporin A both in vitro and in vivo. These results suggested that,CypA, a gene downstream of HIF-1α, could promote the development of PDAC. Thus, CypA might serve as a potential therapeutic target for PDAC.
Promoter Methylation and mRNA Expression of Response Gene to Complement 32 in Breast Carcinoma
International Nuclear Information System (INIS)
Nasab, E. E.; Nasab, E. E.; Hashemi, M.; Rafighdoost, F.
2016-01-01
Response gene to complement 32 (RGC32), induced by activation of complements, has been characterized as a cell cycle regulator; however, its role in carcinogenesis is still controversial. In the present study we compared RGC32 promoter methylation patterns and mRNA expression in breast cancerous tissues and adjacent normal tissues. Materials and Methods. Sixty-three breast cancer tissues and 63 adjacent non neoplastic tissues were included in our study. Design. Nested methylation-specific polymerase chain reaction (Nested-MSP) and quantitative PCR (qPCR) were used to determine RGC32 promoter methylation status and its mRNA expression levels, respectively. Results. RGC32 methylation pattern was not different between breast cancerous tissue and adjacent non neoplastic tissue (OR=2.30, 95% CI=0.95-5.54). However, qPCR analysis displayed higher levels of RGC32 mRNA in breast cancerous tissues than in noncancerous tissues (1.073 versus 0.959; P=0.001), irrespective of the promoter methylation status. The expression levels and promoter methylation of RGC32 were not correlated with any of patients’ clinical characteristics (P>0.05).
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.
Tencomnao, T; Yu, R K; Kapitonov, D
2001-02-16
UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.
Methylated genes as new cancer biomarkers
DEFF Research Database (Denmark)
Brunner, Nils; Duffy, M.J; Napieralski, R.
2009-01-01
Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested that meas......Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested...... that measurement of the methylation status of the promoter regions of specific genes can aid early detection of cancer, determine prognosis and predict therapy responses. Promising DNA methylation biomarkers include the use of methylated GSTP1 for aiding the early diagnosis of prostate cancer, methylated PITX2...... for predicting outcome in lymph node-negative breast cancer patients and methylated MGMT in predicting benefit from alkylating agents in patients with glioblastomas. However, prior to clinical utilisation, these findings require validation in prospective clinical studies. Furthermore, assays for measuring gene...
Ottini, Laura; Rizzolo, Piera; Siniscalchi, Ester; Zijno, Andrea; Silvestri, Valentina; Crebelli, Riccardo; Marcon, Francesca
2015-02-01
The influence of DNA repair capacity, plasma nutrients and tobacco smoke exposure on DNA methylation was investigated in blood cells of twenty-one couples of monozygotic twins with discordant smoking habits. All study subjects had previously been characterized for mutagen sensitivity with challenge assays with ionizing radiation in peripheral blood lymphocytes. Plasma levels of folic acid, vitamin B12 and homocysteine were also available from a previous investigation. In this work DNA methylation in the promoter region of a panel of ten genes involved in cell cycle control, differentiation, apoptosis and DNA repair (p16, FHIT, RAR, CDH1, DAPK1, hTERT, RASSF1A, MGMT, BRCA1 and PALB2) was assessed in the same batches of cells isolated for previous studies, using the methylation-sensitive high-resolution melting technique. Fairly similar profiles of gene promoter methylation were observed within co-twins compared to unrelated subjects (p= 1.23 × 10(-7)), with no significant difference related to smoking habits (p = 0.23). In a regression analysis the methylation index of study subjects, used as synthetic descriptor of overall promoter methylation, displayed a significant inverse correlation with radiation-induced micronuclei (p = 0.021) and plasma folic acid level (p = 0.007) both in smokers and in non-smokers. The observed association between repair of radiation-induced DNA damage and promoter methylation suggests the involvement of the DNA repair machinery in DNA modification. Data also highlight the possible modulating effect of folate deficiency on DNA methylation and the strong influence of familiarity on the individual epigenetic profile. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Kiss Nimrod B
2012-09-01
Full Text Available Abstract Background In this study we aimed to quantify tumor suppressor gene (TSG promoter methylation densities levels in primary neuroblastoma tumors and cell lines. A subset of these TSGs is associated with a CpG island methylator phenotype (CIMP in other tumor types. Methods The study panel consisted of 38 primary tumors, 7 established cell lines and 4 healthy references. Promoter methylation was determined by bisulphate Pyrosequencing for 14 TSGs; and LINE-1 repeat element methylation was used as an indicator of global methylation levels. Results Overall mean TSG Z-scores were significantly increased in cases with adverse outcome, but were unrelated to global LINE-1 methylation. CIMP with hypermethylation of three or more gene promoters was observed in 6/38 tumors and 7/7 cell lines. Hypermethylation of one or more TSG (comprising TSGs BLU, CASP8, DCR2, CDH1, RASSF1A and RASSF2 was evident in 30/38 tumors. By contrast only very low levels of promoter methylation were recorded for APC, DAPK1, NORE1A, P14, P16, TP73, PTEN and RARB. Similar involvements of methylation instability were revealed between cell line models and neuroblastoma tumors. Separate analysis of two proposed CASP8 regulatory regions revealed frequent and significant involvement of CpG sites between exon 4 and 5, but modest involvement of the exon 1 region. Conclusions/significance The results highlight the involvement of TSG methylation instability in neuroblastoma tumors and cell lines using quantitative methods, support the use of DNA methylation analyses as a prognostic tool for this tumor type, and underscore the relevance of developing demethylating therapies for its treatment.
Camerino, Giulia Maria; Cannone, Maria; Giustino, Arcangela; Massari, Ada Maria; Capogrosso, Roberta Francesca; Cozzoli, Anna; De Luca, Annamaria
2014-11-01
Weakness and fatigability are typical features of Duchenne muscular dystrophy patients and are aggravated in dystrophic mdx mice by chronic treadmill exercise. Mechanical activity modulates gene expression and muscle plasticity. Here, we investigated the outcome of 4 (T4, 8 weeks of age) and 12 (T12, 16 weeks of age) weeks of either exercise or cage-based activity on a large set of genes in the gastrocnemius muscle of mdx and wild-type (WT) mice using quantitative real-time PCR. Basal expression of the exercise-sensitive genes peroxisome-proliferator receptor γ coactivator 1α (Pgc-1α) and Sirtuin1 (Sirt1) was higher in mdx versus WT mice at both ages. Exercise increased Pgc-1α expression in WT mice; Pgc-1α was downregulated by T12 exercise in mdx muscles, along with Sirt1, Pparγ and the autophagy marker Bnip3. Sixteen weeks old mdx mice showed a basal overexpression of the slow Mhc1 isoform and Serca2; T12 exercise fully contrasted this basal adaptation as well as the high expression of follistatin and myogenin. Conversely, T12 exercise was ineffective in WT mice. Damage-related genes such as gp91-phox (NADPH-oxidase2), Tgfβ, Tnfα and c-Src tyrosine kinase were overexpressed in mdx muscles and not affected by exercise. Likewise, the anti-inflammatory adiponectin was lower in T12-exercised mdx muscles. Chronic exercise with minor adaptive effects in WT muscles leads to maladaptation in mdx muscles with a disequilibrium between protective and damaging signals. Increased understanding of the pathways involved in the altered mechanical-metabolic coupling may help guide appropriate physical therapies while better addressing pharmacological interventions in translational research. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
van Doorn, Remco; Dijkman, Remco; Vermeer, Maarten H; Out-Luiting, Jacoba J; van der Raaij-Helmer, Elisabeth M H; Willemze, Rein; Tensen, Cornelis P
2004-08-15
Sézary syndrome (Sz) is a malignancy of CD4+ memory skin-homing T cells and presents with erythroderma, lymphadenopathy, and peripheral blood involvement. To gain more insight into the molecular features of Sz, oligonucleotide array analysis was performed comparing gene expression patterns of CD4+ T cells from peripheral blood of patients with Sz with those of patients with erythroderma secondary to dermatitis and healthy controls. Using unsupervised hierarchical clustering gene, expression patterns of T cells from patients with Sz were classified separately from those of benign T cells. One hundred twenty-three genes were identified as significantly differentially expressed and had an average fold change exceeding 2. T cells from patients with Sz demonstrated decreased expression of the following hematopoietic malignancy-linked tumor suppressor genes: TGF-beta receptor II, Mxi1, Riz1, CREB-binding protein, BCL11a, STAT4, and Forkhead Box O1A. Moreover, the tyrosine kinase receptor EphA4 and the potentially oncogenic transcription factor Twist were highly and selectively expressed in T cells of patients with Sz. High expression of EphA4 and Twist was also observed in lesional skin biopsy specimens of a subset of patients with cutaneous T cell lymphomas related to Sz, whereas their expression was nearly undetectable in benign T cells or in skin lesions of patients with inflammatory dermatoses. Detection of EphA4 and Twist may be used in the molecular diagnosis of Sz and related cutaneous T-cell lymphomas. Furthermore, the membrane-bound EphA4 receptor may serve as a target for directed therapeutic intervention.
[Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].
Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W
2016-11-23
Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.
Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T
2011-01-01
Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.
International Nuclear Information System (INIS)
Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi
2011-01-01
Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.
Aberrant alternative splicing is another hallmark of cancer.
Ladomery, Michael
2013-01-01
The vast majority of human genes are alternatively spliced. Not surprisingly, aberrant alternative splicing is increasingly linked to cancer. Splice isoforms often encode proteins that have distinct and even antagonistic properties. The abnormal expression of splice factors and splice factor kinases in cancer changes the alternative splicing of critically important pre-mRNAs. Aberrant alternative splicing should be added to the growing list of cancer hallmarks.
Aberrant Alternative Splicing Is Another Hallmark of Cancer
Ladomery, Michael
2013-01-01
The vast majority of human genes are alternatively spliced. Not surprisingly, aberrant alternative splicing is increasingly linked to cancer. Splice isoforms often encode proteins that have distinct and even antagonistic properties. The abnormal expression of splice factors and splice factor kinases in cancer changes the alternative splicing of critically important pre-mRNAs. Aberrant alternative splicing should be added to the growing list of cancer hallmarks.
Shepard, Jaclyn A.; Stevans, Alyson C.; Holland, Samantha; Wang, Christine E.; Shikanov, Ariella; Shea, Lonnie D.
2012-01-01
Hydrogels capable of gene delivery provide a combinatorial approach for nerve regeneration, with the hydrogel supporting neurite outgrowth and gene delivery inducing the expression of inductive factors. This report investigates the design of hydrogels that balance the requirements for supporting neurite growth with those requirements for promoting gene delivery. Enzymatically-degradable PEG hydrogels encapsulating dorsal root ganglia explants, fibroblasts, and lipoplexes encoding nerve growth factor were gelled within channels that can physically guide neurite outgrowth. Transfection of fibroblasts increased with increasing concentration of Arg-Gly-Asp (RGD) cell adhesion sites and decreasing PEG content. The neurite length increased with increasing RGD concentration within 10% PEG hydrogels, yet was maximal within 7.5% PEG hydrogels at intermediate RGD levels. Delivering lipoplexes within the gel produced longer neurites than culture in NGF-supplemented media or co-culture with cells exposed to DNA prior to encapsulation. Hydrogels designed to support neurite outgrowth and deliver gene therapy vectors locally may ultimately be employed to address multiple barriers that limit regeneration. PMID:22038654
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene
International Nuclear Information System (INIS)
Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters
Liang, Jianhua; Yang, Lixia; Chen, Xiong; Li, Ling; Guo, Dongliang; Li, Haihang; Zhang, Biyu
2009-09-01
We cloned the promoter of the 9-cis-epoxycarotenoid dioxygenase gene from Arachis hypogaea L. beta-Glucuronidase (GUS) histochemical staining and GUS activity assay indicated that the activity of the promoter was exhibited predominantly in the leaves and enhanced by water and NaCl stresses, and by application of abscisic acid (ABA) and salicylic acid (SA) in transgenic Arabidopsis. Moreover, two novel ABRE-like (abscisic acid response element) elements were identified in the promoter region.
Methylated genes as new cancer biomarkers.
LENUS (Irish Health Repository)
Duffy, M J
2012-02-01
Aberrant hypermethylation of promoter regions in specific genes is a key event in the formation and progression of cancer. In at least some situations, these aberrant alterations occur early in the formation of malignancy and appear to be tumour specific. Multiple reports have suggested that measurement of the methylation status of the promoter regions of specific genes can aid early detection of cancer, determine prognosis and predict therapy responses. Promising DNA methylation biomarkers include the use of methylated GSTP1 for aiding the early diagnosis of prostate cancer, methylated PITX2 for predicting outcome in lymph node-negative breast cancer patients and methylated MGMT in predicting benefit from alkylating agents in patients with glioblastomas. However, prior to clinical utilisation, these findings require validation in prospective clinical studies. Furthermore, assays for measuring gene methylation need to be standardised, simplified and evaluated in external quality assurance programmes. It is concluded that methylated genes have the potential to provide a new generation of cancer biomarkers.
Mengesha, Asferd; Dubois, Ludwig; Lambin, Philippe; Landuyt, Willy; Chiu, Roland K; Wouters, Bradly G; Theys, Jan
To increase the potential of attenuated Salmonella as gene delivery vectors for cancer treatment, we developed a hypoxia-inducible promoter system to limit gene expression specifically to the tumor. This approach is envisaged to not only increase tumor specificity, but also to target those cells
Chang, Ji Suk; Jun, Hee-Jin; Park, Minsung
2016-10-01
The transcriptional coactivator PGC-1α plays a central role in hepatic gluconeogenesis. We previously reported that alternative splicing of the PGC-1α gene produces an additional transcript encoding the truncated protein NT-PGC-1α NT-PGC-1α is co-expressed with PGC-1α and highly induced by fasting in the liver. NT-PGC-1α regulates tissue-specific metabolism, but its role in the liver has not been investigated. Thus, the objective of this study was to determine the role of hepatic NT-PGC-1α in the regulation of gluconeogenesis. Adenovirus-mediated expression of NT-PGC-1α in primary hepatocytes strongly stimulated the expression of key gluconeogenic enzyme genes (PEPCK and G6Pase), leading to increased glucose production. To further understand NT-PGC-1α function in hepatic gluconeogenesis in vivo, we took advantage of a previously reported FL-PGC-1α -/- mouse line that lacks full-length PGC-1α (FL-PGC-1α) but retains a slightly shorter and functionally equivalent form of NT-PGC-1α (NT-PGC-1α 254 ). In FL-PGC-1α -/- mice, NT-PGC-1α 254 was induced by fasting in the liver and recruited to the promoters of PEPCK and G6Pase genes. The enrichment of NT-PGC-1α 254 at the promoters was closely associated with fasting-induced increase in PEPCK and G6Pase gene expression and efficient production of glucose from pyruvate during a pyruvate tolerance test in FL-PGC-1α -/- mice. Moreover, FL-PGC-1α -/- primary hepatocytes showed a significant increase in gluconeogenic gene expression and glucose production after treatment with dexamethasone and forskolin, suggesting that NT-PGC-1α 254 is sufficient to stimulate the gluconeogenic program in the absence of FL-PGC-1α Collectively, our findings highlight the role of hepatic NT-PGC-1α in stimulating gluconeogenic gene expression and glucose production. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.
Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad
2018-02-01
The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.
Yin, W J; Zhu, X; Yang, H Y; Sun, W Y; Wu, M J
2018-01-08
bcl-2 gene translocation and ICN were found in 30 patients. Four ICNs of C-MYC gene were found in 28 patients. Elevated protein in cerebrospinal fluid (CSF) was found in 13 patients. LDH increased in 10 cases. Follow-up period was 2-90 months with the average survival time of (23.0±3.7) months and two-year survival rate of 39.0%. Univariate survival analysis showed that overexpression of bcl-2 protein (≥70%) and MYC protein (≥40%), bcl-2 gene abnormality (including copy number increase and translocation), C-MYC gene copy number increased were adverse factors for survival. C-MYC/ bcl-2 gene double hit was seen in 2 cases. Bivariate survival analysis found that of bcl-2/MYC protein double expression and bcl-2 and C-MYC genes double aberration were significantly associated with adverse outcomes. Cox multivariate risk regression analysis found that gender, cerebrospinal fluid protein increasing, and ICN of C-MYC gene were independent poor prognostic factors. DH-MTX based comprehensive chemotherapy was associated with better prognosis. Conclusions: Double hit at genomic level (copy number variations and gene rearrangements) and double protein expression of bcl-2 and C-MYC in PCNS-DLBCL are significantly associated with an adverse outcome. DH-MTX based comprehensive treatment may prolong the patient survival.
ΔNp73 enhances promoter activity of TGF-β induced genes.
Directory of Open Access Journals (Sweden)
Maarten Niemantsverdriet
Full Text Available The p53 homolog p73 is frequently overexpressed in cancers. Especially the transactivation domain truncated isoform ΔNp73 has oncogenic properties and its upregulation is associated with poor patient survival. It has been shown that ΔNp73 has an inhibitory effect on the transactivation capacity of p53 and other p73 isoforms. Here, we confirm this finding but surprisingly find that ΔNp73 may also stimulate the expression of TGF-β signaling targets. Promoter-reporter analysis indicated that the presence of Smad Binding Elements (SBE in the promoter is sufficient for stimulation of gene expression by ΔNp73. TGF-β signaling was less efficient in ΔNp73 downregulated cells, whereas tetracycline induced ΔNp73 increased expression of endogenous TGF-β regulated genes PAI-1 and Col1a1. Pull-down assays with SBE DNA suggest that ΔNp73 enhances smad3/4 binding to SBEs, thereby stimulating TGF-β signaling. Chromatin immunoprecipitation assays confirmed a direct interaction between ΔNp73 and SBE. Given the role of TGF-β signaling in carcinogenesis, tumor invasion and metastasis via targets like PAI-1 and Col1a1, our data suggest a model on how this effect of ΔNp73 could be a contributing factor in cancer progression.
Chen, Zongjing; Yang, Yunxiu; Liu, Biao; Wang, Benquan; Sun, Meng; Zhang, Ling; Chen, Bicheng; You, Heyi; Zhou, Mengtao
2015-01-01
Histone deacetylase inhibitors represent a promising class of potential anticancer agents for the treatment of human malignancies. In this study, the effects of trichostatin A (TSA) on apoptosis, metastasis-associated gene expression, and activation of the Notch pathway in human pancreatic cancer cell lines were investigated. After treatment with TSA, cell viability and apoptosis were evaluated using the MTT [3-(4,5-dimethylthia-zol-2-yl)-2,5-diphenyltetrazolium bromide] assay, Hoechst 33258 staining, and flow cytometry. Moreover, RT-PCR and western blot analyses were performed to measure the expression levels of apoptosis-associated genes (Bcl-2, Bax, and caspase-3), metastasis-associated genes (E-cadherin, vimentin, and matrix metalloproteinases), and Notch pathway activation (Notch intracellular domain, NICD). The levels of matrix metalloproteinase 2 and NICD were also semi-quantified by immunoassay. Following treatment with TSA for 24 h, PANC-1, SW1990, and MIATACA-2 cells exhibited cell death. The MTT assay revealed that TSA significantly decreased cell viability in a dose-dependent manner in PANC-1 cells. The Hoechst 33258 staining and flow cytometry results evidenced a significant increase in PANC-1 cell apoptosis following TSA treatment. The expression levels of Bax and caspase-3 were increased significantly, whereas Bcl-2 was down-regulated after TSA treatment. In the PANC-1 cells that survived after TSA treatment, the expression levels of vimentin, E-cadherin, and MMP genes were altered by the promotion of potential metastasis and increased expression of NICD. TSA can induce apoptosis of pancreatic cancer cells. In addition, the up-regulation of metastasis-related genes and the activation of the Notch pathway in the survived PANC-1 cells may be associated with a too-low level of TSA or resistance to TSA.
The Helicobacter pylori duodenal ulcer promoting gene, dupA in China
Directory of Open Access Journals (Sweden)
Liu Wenzhong
2008-10-01
Full Text Available Abstract Background The prevalence of H. pylori is as high as 60–70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. Methods H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU, gastric ulcer (GU, or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1β polymorphism was investigated using restriction fragment length polymorphism. Results Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360 and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058. The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1β polymorphisms. Conclusion In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.
The Helicobacter pylori duodenal ulcer promoting gene, dupA in China.
Zhang, Zhiyu; Zheng, Qing; Chen, Xiaoyu; Xiao, Shudong; Liu, Wenzhong; Lu, Hong
2008-10-25
The prevalence of H. pylori is as high as 60-70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA) gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU), gastric ulcer (GU), or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1beta polymorphism was investigated using restriction fragment length polymorphism. Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360) and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058). The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1beta polymorphisms. In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.
Directory of Open Access Journals (Sweden)
Wei Yin
Full Text Available Hypodontia, hypohidrosis, sparse hair and characteristic faces are the main characters of X-linked hypohidrotic ectodermal dysplasia (XLHED which is caused by genetic ectodysplasin A (EDA deficiency. Heterozygous female carriers tend to have mild to moderate XLHED phenotype, even though 30% of them present no obvious symptom.A large Chinese XLHED family was reported and the entire coding region and exon-intron boundaries of EDA gene were sequenced. To elucidate the mechanism for carriers' tempered phenotype, we analyzed the methylation level on four sites of the promoter of EDA by the pyrosequencing system.A known frameshift mutation (c.573-574 insT was found in this pedigree. Combined with the pedigrees we reported before, 120 samples comprised of 23 carrier females from 11 families and 97 healthy females were analyzed for the methylation state of EDA promoter. Within 95% confidence interval (CI, 18 (78.26% carriers were hypermethylated at these 4 sites.Chinese XLHED carriers often have a hypermethylated EDA promoter.
Zhang, Changsong; Ling, Yang; Zhang, Chenghui; Xu, Yun; Gao, Lu; Li, Rong; Zhu, Jing; Fan, Lieying; Wei, Lixin
2012-01-01
Background: To evaluate the promoter methylation status of RECK gene and mRNA expression in patients with hepatocellular carcinoma (HCC). Methods: We analyzed RECK methylation by MSP, and RECK mRNA by real-time PCR in 74 HCC. The liver cell lines (7721, Chang and Hep-G2) were treated with 5-Aza-CdR and TSA. Results: RECK mRNA were lower in HCC tissues (Mean -∆Ct = -3.29) than that in Non-Hcc tissues (Mean -∆Ct = -2.42). Expression of RECK was elevated in only 24 (32.43%) of the 74 HCC patients but decreased (-∆∆Ct=0.5) (Mean -∆∆Ct = -1.75) than those with demethylation (∆MI<0.5) (Mean -∆∆Ct = 0.05), and there is a decreased tendency for RECK mRNA in HCC patients with promoter hypermethylation (p = 0.002). There was a significantly correlation found between RECK mRNA and poor survival after surgery. After treated by 5-Aza-CdR and TSA, we found that RECK mRNA induced different changes in 7721, Chang and Hep-G2 cells. And RECK demethylation also induced by epigenetic inhibitors. Conclusion: The results suggested that the hypermethylation may lead to promoter silencing of RECK mRNA and associated with poor survival in HCC. PMID:22419890
International Nuclear Information System (INIS)
Simbaqueba, Jaime; Cotes, Alba Marina; Barrero, Luz Stella
2011-01-01
Induced systemic resistance (ISR) is a mechanism by which plants enhance defenses against any stress condition. ISR and growth promotion are enhanced when tomato (Solanum lycopersicum) is inoculated with several strains of Trichoderma ssp. this study aims to genetically map tomato candidate genes involved in ISR and growth promotion induced by the Colombian native isolate Trichoderma koningiopsis th003. Forty-nine candidate genes previously identified on tomato plants treated with th003 and T. hamatum T382 strains were evaluated for polymorphisms and 16 of them were integrated on the highly saturated genetic linkage map named TOMATO EXPEN 2000. The location of six unigenes was similar to the location of resistance gene analogs (RGAS), defense related ests and resistance QTLs previously reported, suggesting new possible candidates for these quantitative trait loci (QTL) regions. The candidate gene-markers may be used for future ISR or growth promotion assisted selection in tomato.
Wiśniewska, A; Dąbrowska-Bronk, J; Szafrański, K; Fudali, S; Święcicka, M; Czarny, M; Wilkowska, A; Morgiewicz, K; Matusiak, J; Sobczak, M; Filipecki, M
2013-06-01
The potato cyst nematode (Globodera rostochiensis) induces feeding sites (syncytia) in tomato and potato roots. In a previous study, 135 tomato genes up-regulated during G. rostochiensis migration and syncytium development were identified. Five genes (CYP97A29, DFR, FLS, NIK and PMEI) were chosen for further study to examine their roles in plant-nematode interactions. The promoters of these genes were isolated and potential cis regulatory elements in their sequences were characterized using bioinformatics tools. Promoter fusions with the β-glucuronidase gene were constructed and introduced into tomato and potato genomes via transformation with Agrobacterium rhizogenes to produce hairy roots. The analysed promoters displayed different activity patterns in nematode-infected and uninfected transgenic hairy roots.
Santovito, Alfredo; Cervella, Piero; Delpero, Massimiliano
2016-05-01
The increased exposure to environmental pollutants has led to the awareness of the necessity for constant monitoring of human populations, especially those living in urban areas. This study evaluated the background levels of genomic damage in a sample of healthy subjects living in the urban area of Turin (Italy). The association between DNA damage with age, sex and GSTs polymorphisms was assessed. One hundred and one individuals were randomly sampled. Sister Chromatid Exchanges (SCEs) and Chromosomal Aberrations (CAs) assays, as well as genotyping of GSTT1 and GSTM1 genes, were performed. Mean values of SCEs and CAs were 5.137 ± 0.166 and 0.018 ± 0.002, respectively. Results showed age and gender associated with higher frequencies of these two cytogenetic markers. The eldest subjects (51-65 years) showed significantly higher levels of genomic damage than younger individuals. GSTs polymorphisms did not appear to significantly influence the frequencies of either markers. The CAs background frequency observed in this study is one of the highest reported among European populations. Turin is one of the most polluted cities in Europe in terms of air fine PM10 and ozone and the clastogenic potential of these pollutants may explain the high frequencies of chromosomal rearrangements reported here.
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Light response and potential interacting proteins of a grape flavonoid 3'-hydroxylase gene promoter.
Sun, Run-Ze; Pan, Qiu-Hong; Duan, Chang-Qing; Wang, Jun
2015-12-01
Flavonoid 3'-hydroxylase (F3'H), a member of cytochrome P450 protein family, introduces B-ring hydroxyl group in the 3' position of the flavonoid. In this study, the cDNA sequence of a F3'H gene (VviF3'H), which contains an open reading frame of 1530 bp encoding a polypeptide of 509 amino acids, was cloned and characterized from Vitis vinifera L. cv. Cabernet Sauvignon. VviF3'H showed high homology to known F3'H genes, especially F3'Hs from the V. vinifera reference genome (Pinot Noir) and lotus. Expression profiling analysis using real-time PCR revealed that VviF3'H was ubiquitously expressed in all tested tissues including berries, leaves, flowers, roots, stems and tendrils, suggesting its important physiological role in plant growth and development. Moreover, the transcript level of VviF3'H gene in grape berries was relatively higher at early developmental stages and gradually decreased during véraison, and then increased in the mature phase. In addition, the promoter of VviF3'H was isolated by using TAIL-PCR. Yeast one-hybrid screening of the Cabernet Sauvignon cDNA library and subsequent in vivo/vitro validations revealed the interaction between VviF3'H promoter and several transcription factors, including members of HD-Zip, NAC, MYB and EIN families. A transcriptional regulation mechanism of VviF3'H expression is proposed for the first time. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Xiu-Yun Li
2018-05-01
Full Text Available As a major family of plant-specific transcription factors, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL genes play vital regulatory roles in plant growth, development and stress responses. In this study, 18 SPL genes were identified and cloned from Betula luminifera. Two zinc finger-like structures and a nuclear location signal (NLS segments were existed in the SBP domains of all BlSPLs. Phylogenetic analysis showed that these genes were clustered into nine groups (group I-IX. The intron/exon structure and motif composition were highly conserved within the same group. 12 of the 18 BlSPLs were experimentally verified as the targets of miR156, and two cleavage sites were detected in these miR156-targeted BlSPL genes. Many putative cis-elements, associated with light, stresses and phytohormones response, were identified in the promoter regions of BlSPLs, suggesting that BlSPL genes are probably involved in important physiological processes and developmental events. Tissue-specific expression analysis showed that miR156-targeted BlSPLs exhibited a more differential expression pattern, while most miR156-nontargeted BlSPLs tended to be constitutively expressed, suggesting the distinct roles of miR156-targeted and nontargeted BlSPLs in development and growth of B. luminifera. Further expression analysis revealed that miR156-targeted BlSPLs were dramatically up-regulated with age, whereas mature BlmiR156 level was apparently declined with age, indicating that miR156/SPL module plays important roles in vegetative phase change of B. luminifera. Moreover, yeast two-hybrid assay indicated that several miR156-targeted and nontargeted BlSPLs could interact with two DELLA proteins (BlRGA and BlRGL, which suggests that certain BlSPLs take part in the GA regulated processes through protein interaction with DELLA proteins. All these results provide an important basis for further exploring the biological functions of BlSPLs in B. luminifera.
Aberration studies and computer algebra
International Nuclear Information System (INIS)
Hawkes, P.W.
1981-01-01
The labour of calculating expressions for aberration coefficients is considerably lightened if a computer algebra language is used to perform the various substitutions and expansions involved. After a brief discussion of matrix representations of aberration coefficients, a particular language, which has shown itself to be well adapted to particle optics, is described and applied to the study of high frequency cavity lenses. (orig.)
USP7 Attenuates Hepatic Gluconeogenesis Through Modulation of FoxO1 Gene Promoter Occupancy
Hall, Jessica A.; Tabata, Mitsuhisa; Rodgers, Joseph T.
2014-01-01
Hepatic forkhead protein FoxO1 is a key component of systemic glucose homeostasis via its ability to regulate the transcription of rate-limiting enzymes in gluconeogenesis. Important in the regulation of FoxO1 transcriptional activity are the modifying/demodifying enzymes that lead to posttranslational modification. Here, we demonstrate the functional interaction and regulation of FoxO1 by herpesvirus-associated ubiquitin-specific protease 7 (USP7; also known as herpesvirus-associated ubiquitin-specific protease, HAUSP), a deubiquitinating enzyme. We show that USP7-mediated mono-deubiquitination of FoxO1 results in suppression of FoxO1 transcriptional activity through decreased FoxO1 occupancy on the promoters of gluconeogenic genes. Knockdown of USP7 in primary hepatocytes leads to increased expression of FoxO1-target gluconeogenic genes and elevated glucose production. Consistent with this, USP7 gain-of-function suppresses the fasting/cAMP-induced activation of gluconeogenic genes in hepatocyte cells and in mouse liver, resulting in decreased hepatic glucose production. Notably, we show that the effects of USP7 on hepatic glucose metabolism depend on FoxO1. Together, these results place FoxO1 under the intimate regulation of deubiquitination and glucose metabolic control with important implication in diseases such as diabetes. PMID:24694308
International Nuclear Information System (INIS)
Jaeaeskelaeinen, T.; Huhtakangas, J.; Maeenpaeae, P.H.
2005-01-01
The negative regulation of the human parathyroid hormone (PTH) gene by biologically active vitamin D 3 (1,25-dihydroxyvitamin D 3 ; 1,25(OH) 2 D 3 ) was studied in rat pituitary GH4C1 cells, which express factors needed for the negative regulation. We report here that NF-Y binds to sequences downstream of the site previously reported to bind the vitamin D receptor (VDR). Additional binding sites for NF-Y reside in the near vicinity and were shown to be important for full activity of the PTH gene promoter. VDR and NF-Y were shown to exhibit mutually exclusive binding to the VDRE region. According to our results, sequestration of binding partners for NF-Y by VDR also affects transcription through a NF-Y consensus binding element in GH4C1 but not in ROS17/2.8 cells. These results indicate that 1,25(OH) 2 D 3 may affect transcription of the human PTH gene both by competitive binding of VDR and NF-Y, and by modulating transcriptional activity of NF-Y
Luisier, Raphaëlle; Unterberger, Elif B.; Goodman, Jay I.; Schwarz, Michael; Moggs, Jonathan; Terranova, Rémi; van Nimwegen, Erik
2014-01-01
Gene regulatory interactions underlying the early stages of non-genotoxic carcinogenesis are poorly understood. Here, we have identified key candidate regulators of phenobarbital (PB)-mediated mouse liver tumorigenesis, a well-characterized model of non-genotoxic carcinogenesis, by applying a new computational modeling approach to a comprehensive collection of in vivo gene expression studies. We have combined our previously developed motif activity response analysis (MARA), which models gene expression patterns in terms of computationally predicted transcription factor binding sites with singular value decomposition (SVD) of the inferred motif activities, to disentangle the roles that different transcriptional regulators play in specific biological pathways of tumor promotion. Furthermore, transgenic mouse models enabled us to identify which of these regulatory activities was downstream of constitutive androstane receptor and β-catenin signaling, both crucial components of PB-mediated liver tumorigenesis. We propose novel roles for E2F and ZFP161 in PB-mediated hepatocyte proliferation and suggest that PB-mediated suppression of ESR1 activity contributes to the development of a tumor-prone environment. Our study shows that combining MARA with SVD allows for automated identification of independent transcription regulatory programs within a complex in vivo tissue environment and provides novel mechanistic insights into PB-mediated hepatocarcinogenesis. PMID:24464994
O'Riordan, N; O'Callaghan, J; Buttò, L F; Kilcoyne, M; Joshi, L; Hickey, R M
2018-05-23
Bovine milk glycomacropeptide (GMP) is derived from κ-casein, with exclusively o-linked glycosylation. Glycomacropeptide promoted the growth of Bifidobacterium longum ssp. infantis in a concentration-dependent manner, and this activity was lost following periodate treatment of the GMP (GMP-P), which disables biological recognition of the conjugated oligosaccharides. Transcriptional analysis of B. longum ssp. infantis following exposure to GMP revealed a substantial response to GMP relative to bacteria treated with GMP-P, with a greater number of differentially expressed transcripts and larger fold changes versus the control. Therefore, stimulation of B. longum ssp. infantis growth by GMP is intrinsically linked to the peptide's O-linked glycosylation. The pool of differentially expressed transcripts included 2 glycoside hydrolase (family 25) genes, which were substantially upregulated following exposure to GMP, but not GMP-P. These GH25 genes were present in duplicated genomic islands that also contained genes encoding fibronectin type III binding domain proteins and numerous phage-related proteins, all of which were also upregulated. Homologs of this genomic arrangement were present in other Bifidobacterium species, which suggest it may be a conserved domain for the utilization of glycosylated peptides. This study provides insights into the molecular basis for the prebiotic effect of bovine milk GMP on B. longum ssp. infantis. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy
Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.
2016-01-01
Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199
Deletion of the Imprinted Gene Grb10 Promotes Hematopoietic Stem Cell Self-Renewal and Regeneration.
Yan, Xiao; Himburg, Heather A; Pohl, Katherine; Quarmyne, Mamle; Tran, Evelyn; Zhang, Yurun; Fang, Tiancheng; Kan, Jenny; Chao, Nelson J; Zhao, Liman; Doan, Phuong L; Chute, John P
2016-11-01
Imprinted genes are differentially expressed by adult stem cells, but their functions in regulating adult stem cell fate are incompletely understood. Here we show that growth factor receptor-bound protein 10 (Grb10), an imprinted gene, regulates hematopoietic stem cell (HSC) self-renewal and regeneration. Deletion of the maternal allele of Grb10 in mice (Grb10 m/+ mice) substantially increased HSC long-term repopulating capacity, as compared to that of Grb10 +/+ mice. After total body irradiation (TBI), Grb10 m/+ mice demonstrated accelerated HSC regeneration and hematopoietic reconstitution, as compared to Grb10 +/+ mice. Grb10-deficient HSCs displayed increased proliferation after competitive transplantation or TBI, commensurate with upregulation of CDK4 and Cyclin E. Furthermore, the enhanced HSC regeneration observed in Grb10-deficient mice was dependent on activation of the Akt/mTORC1 pathway. This study reveals a function for the imprinted gene Grb10 in regulating HSC self-renewal and regeneration and suggests that the inhibition of Grb10 can promote hematopoietic regeneration in vivo. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Camera processing with chromatic aberration.
Korneliussen, Jan Tore; Hirakawa, Keigo
2014-10-01
Since the refractive index of materials commonly used for lens depends on the wavelengths of light, practical camera optics fail to converge light to a single point on an image plane. Known as chromatic aberration, this phenomenon distorts image details by introducing magnification error, defocus blur, and color fringes. Though achromatic and apochromatic lens designs reduce chromatic aberration to a degree, they are complex and expensive and they do not offer a perfect correction. In this paper, we propose a new postcapture processing scheme designed to overcome these problems computationally. Specifically, the proposed solution is comprised of chromatic aberration-tolerant demosaicking algorithm and post-demosaicking chromatic aberration correction. Experiments with simulated and real sensor data verify that the chromatic aberration is effectively corrected.
Alam, Tanvir
2014-10-02
Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.
Shakespear, Melanie R.; Hohenhaus, Daniel M.; Kelly, Greg M.; Kamal, Nabilah A.; Gupta, Praveer; Labzin, Larisa I.; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A.; Reid, Robert C.; Irvine, Katharine M.; Fairlie, David P.; Sweet, Matthew J.
2013-01-01
Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target. PMID:23853092
Shakespear, Melanie R; Hohenhaus, Daniel M; Kelly, Greg M; Kamal, Nabilah A; Gupta, Praveer; Labzin, Larisa I; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A; Reid, Robert C; Irvine, Katharine M; Fairlie, David P; Sweet, Matthew J
2013-08-30
Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target.
Association between promoter polymorphisms of OPN gene and cancer risk: a meta-analysis
Directory of Open Access Journals (Sweden)
Liu JW
2015-12-01
Full Text Available Jingwei Liu,1–2 Caiyun He,1–2 Quan Yuan,1–2 Zhenning Wang,1–2 Chengzhong Xing,1–2 Yuan Yuan1–2 1Tumor Etiology and Screening Department of Cancer Institute and General Surgery, The First Affiliated Hospital of China Medical University, 2Key Laboratory of Cancer Etiology and Prevention, China Medical University, Liaoning Provincial Education Department, Shenyang, People’s Republic of China Background: Results of the association between polymorphisms of osteopontin (OPN gene promoter region and risk of cancer were inconclusive. The aim of this meta-analysis was to elucidate whether OPN promoter polymorphisms were associated with cancer risk.Methods: Electronic databases including PubMed, Web of Science, and Chinese National Knowledge Infrastructure were systematically searched. Odd ratios (ORs and their 95% confidential interval (CI were used to assess the strength of association between OPN promoter polymorphisms and cancer risks.Results: Nine studies were finally included in this meta-analysis. For OPN rs17524488 polymorphism, carriers of GG or -/G genotype were significantly associated with increased cancer risk compared with wild-type -/- carriers, respectively (GG vs -/-: OR =1.40, 95% CI =1.03–1.91, P=0.033; -/G vs -/-: OR =1.22, 95% CI =1.07–1.40, P=0.002. Additionally, G allele was significantly associated with increased cancer risk compared with (- allele (OR =1.21, 95% CI =1.04–1.40, P=0.016. However, no significant association was observed of OPN rs11730582 polymorphism and cancer risk (CC vs TT: OR =0.98, 95% CI =0.49–1.97, P=0.964; CT vs TT: OR =0.88, 95% CI =0.54–1.43, P=0.610.Conclusion: Carriers of GG or -/G genotype of OPN promoter rs17524488 (-156-/G polymorphism might be associated with increased risk of cancer compared with wild-type -/- carriers, respectively. However, no significant association was observed between OPN promoter rs11730582 (-443C/T polymorphism and risk of cancer. Keywords: OPN
Promoter demethylation of Keap1 gene in human diabetic cataractous lenses
Energy Technology Data Exchange (ETDEWEB)
Palsamy, Periyasamy [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Ayaki, Masahiko [Shizuoka National Hospital, Saitama (Japan); Elanchezhian, Rajan [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States); Shinohara, Toshimichi, E-mail: tshinohara@unmc.edu [Department of Ophthalmology and Visual Sciences, University of Nebraska Medical Center, Omaha, NE (United States)
2012-07-06
Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which
Promoter demethylation of Keap1 gene in human diabetic cataractous lenses
International Nuclear Information System (INIS)
Palsamy, Periyasamy; Ayaki, Masahiko; Elanchezhian, Rajan; Shinohara, Toshimichi
2012-01-01
Highlights: ► We found significant Keap1 promoter demethylation in diabetic cataractous lenses. ► Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. ► Elevated levels of Keap1 are known to decrease the levels of Nrf2. ► Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is known that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2′deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
Patel, B; Kang, Y; Cui, K; Litt, M; Riberio, M S J; Deng, C; Salz, T; Casada, S; Fu, X; Qiu, Y; Zhao, K; Huang, S
2014-02-01
Long-range chromatin interactions control metazoan gene transcription. However, the involvement of intra- and interchromosomal interactions in development and oncogenesis remains unclear. TAL1/SCL is a critical transcription factor required for the development of all hematopoietic lineages; yet, aberrant TAL1 transcription often occurs in T-cell acute lymphoblastic leukemia (T-ALL). Here, we report that oncogenic TAL1 expression is regulated by different intra- and interchromosomal loops in normal hematopoietic and leukemic cells, respectively. These intra- and interchromosomal loops alter the cell-type-specific enhancers that interact with the TAL1 promoter. We show that human SET1 (hSET1)-mediated H3K4 methylations promote a long-range chromatin loop, which brings the +51 enhancer in close proximity to TAL1 promoter 1 in erythroid cells. The CCCTC-binding factor (CTCF) facilitates this long-range enhancer/promoter interaction of the TAL1 locus in erythroid cells while blocking the same enhancer/promoter interaction of the TAL1 locus in human T-cell leukemia. In human T-ALL, a T-cell-specific transcription factor c-Maf-mediated interchromosomal interaction brings the TAL1 promoter into close proximity with a T-cell-specific regulatory element located on chromosome 16, activating aberrant TAL1 oncogene expression. Thus, our study reveals a novel molecular mechanism involving changes in three-dimensional chromatin interactions that activate the TAL1 oncogene in human T-cell leukemia.
Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce
2014-08-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul
2014-04-01
Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. © 2013 Scandinavian Plant Physiology Society.
Energy Technology Data Exchange (ETDEWEB)
Matsui, Keiji; Oda, Kasumi; Mizuta, Shumpei; Ishino, Ruri; Urahama, Norinaga; Hasegawa, Natsumi [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Roeder, Robert G. [Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Ito, Mitsuhiro, E-mail: itomi@med.kobe-u.ac.jp [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Department of Family and Community Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 654-0142 (Japan); Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan)
2013-10-11
Highlights: •MED1 is a bona fide T3-dependent coactivator on TSHB promoter. •Mice with LxxLL-mutant MED1 have attenuated TSHβ mRNA and thyroid hormone levels. •MED1 activates TSHB promoter T3-dependently in cultured cells. •T3-dependent MED1 action is enhanced when SRC1/SRC2 or HDAC2 is downregulated. •MED1 is also a T3-independent GATA2/Pit1 coactivator on TSHB promoter. -- Abstract: The MED1 subunit of the Mediator transcriptional coregulator complex is a nuclear receptor-specific coactivator. A negative feedback mechanism of thyroid-stimulating hormone (TSH, or thyrotropin) expression in the thyrotroph in the presence of triiodothyronine (T3) is employed by liganded thyroid hormone receptor β (TRβ) on the TSHβ gene promoter, where conventional histone-modifying coactivators act as corepressors. We now provide evidence that MED1 is a ligand-dependent positive cofactor on this promoter. TSHβ gene transcription was attenuated in MED1 mutant mice in which the nuclear receptor-binding ability of MED1 was specifically disrupted. MED1 stimulated GATA2- and Pit1-mediated TSHβ gene promoter activity in a ligand-independent manner in cultured cells. MED1 also stimulated transcription from the TSHβ gene promoter in a T3-dependent manner. The transcription was further enhanced when the T3-dependent corepressors SRC1, SRC2, and HDAC2 were downregulated. Hence, MED1 is a T3-dependent and -independent coactivator on the TSHβ gene promoter.
International Nuclear Information System (INIS)
Depto, A.S.; Stenberg, R.M.
1989-01-01
To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection of the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene
Esteller, M; Toyota, M; Sanchez-Cespedes, M; Capella, G; Peinado, M A; Watkins, D N; Issa, J P; Sidransky, D; Baylin, S B; Herman, J G
2000-05-01
O6-methylguanine DNA methyltransferase (MGMT) is a DNA repair protein that removes mutagenic and cytotoxic adducts from the O6 position of guanine. O6-methylguanine mispairs with thymine during replication, and if the adduct is not removed, this results in conversion from a guanine-cytosine pair to an adenine-thymine pair. In vitro assays show that MGMT expression avoids G to A mutations and MGMT transgenic mice are protected against G to A transitions at ras genes. We have recently demonstrated that the MGMT gene is silenced by promoter methylation in many human tumors, including colorectal carcinomas. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of K-ras mutations, we studied 244 colorectal tumor samples for MGMT promoter hypermethylation and K-ras mutational status. Our results show a clear association between the inactivation of MGMT by promoter hypermethylation and the appearance of G to A mutations at K-ras: 71% (36 of 51) of the tumors displaying this particular type of mutation had abnormal MGMT methylation, whereas only 32% (12 of 37) of those with other K-ras mutations not involving G to A transitions and 35% (55 of 156) of the tumors without K-ras mutations demonstrated MGMT methylation (P = 0.002). In addition, MGMT loss associated with hypermethylation was observed in the small adenomas, including those that do not yet contain K-ras mutations. Hypermethylation of other genes such as p16INK4a and p14ARF was not associated with either MGMT hypermethylation or K-ras mutation. Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to a particular genetic change in human cancer, specifically G to A transitions in the K-ras oncogene.
Zarandi, Ashkan; Irani, Shiva; Savabkar, Sanaz; Chaleshi, Vahid; Ghavideldarestani, Maryam; Mirfakhraie, Reza; Khodadoostan, Mahsa; Nazemalhosseini-Mojarad, Ehsan; Asadzadeh Aghdaei, Hamid
2017-01-01
The aim of this study was to evaluate the methylation status of the promoter region of MLH1 gene in colorectal cancer (CRC) and its precursor lesions as well as elucidate its association with various clinicopathological characteristics among Iranian population. Epigenetic silencing of mismatch repair genes, such as MLH1 , by methylation of CpG islands of their promoter region has been proved to be an important mechanism in colorectal carcinogenesis. Fifty colorectal cancer and polyp tissue samples including 13 Primary colorectal tumor and 37 Adenoma polyp samples were enrolled in this study. Methylation-specific polymerase chain reaction (MSP) was performed to find the frequency of MLH1 Promoter Methylation. Promoter methylation of MLH1 gene was detected in 5 out of 13 tumor tissues and 4 out of 37 adenoma polyp. The frequency of MLH1 methylation in tumor samples was significantly higher compared to that in polyp tissues (P= 0.026). No significant association was observed between MLH1 promoter methylation and clinicopathological characteristics of the patients. The frequency of MLH1 promoter methylation in CRC and colon polyp was 18%. Our findings indicated that methylation of MLH1 promoter region alone cannot be considered as a biomarker for early detection of CRC.
Stolzenburg, Sabine
2014-01-01
Cancer development is not only the result of genetic mutations but also stems from modifications in the epigenetic code leading to an aberrant expression of genes relevant for cancer. The most studied epigenetic mark is DNA methylation of cytosines in the promoters of genes, which is associated with
Expression of Nanog gene promotes NIH3T3 cell proliferation
International Nuclear Information System (INIS)
Zhang Jingyu; Wang Xia; Chen Bing; Suo Guangli; Zhao Yanhong; Duan Ziyuan; Dai Jianwu
2005-01-01
Cells are the functional elements in tissue engineering and regenerative medicine. A large number of cells are usually needed for these purposes. However, there are numbers of limitations for in vitro cell proliferation. Nanog is an important self-renewal determinant in embryonic stem cells. However, it remains unknown whether Nanog will influence the cell cycle and cell proliferation of mature cells. In this study, we expressed Nanog in NIH3T3 cells and showed that expression of Nanog in NIH3T3 promoted cells to enter into S phase and enhanced cell proliferation. This suggests that Nanog gene might function in a similar fashion in mature cells as in ES cells. In addition, it may provide an approach for in vitro cell expansion
DEFF Research Database (Denmark)
Gojkovic, Zoran; Knecht, Wolfgang; Warneboldt, J.
2004-01-01
The ability to propagate under anaerobic conditions is an essential and unique trait of brewer's or baker's yeast (Saccharomyces cervisiae). To understand the evolution of facultative anaerobiosis we studied the dependence of de novo pyrimidine biosynthesis, more precisely the fourth enzymic...... activity catalysed by dihydroorotate dehydrogenase (DHODase), on the enzymes of the respiratory chain in several yeast species. While the majority of yeasts possess a mitochondrial DHODase, Saccharomyces cerevisiae has a cytoplasmatic enzyme, whose activity is independent of the presence of oxygen. From....... We show that these two S. kluyveri enzymes, and their coding genes, differ in their dependence on the presence of oxygen. Only the cytoplasmic DHODase promotes growth in the absence of oxygen. Apparently a Saccharomyces yeast progenitor which had a eukaryotic-like mitochondrial DHODase acquired...
DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy
Directory of Open Access Journals (Sweden)
Deming Li
2014-06-01
Full Text Available Epidermal growth factor (EGF, a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration.
Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals
Directory of Open Access Journals (Sweden)
Yasuhito Ohsaka
2010-01-01
Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.
Dragon (repulsive guidance molecule b, RGMb) is a novel gene that promotes colorectal cancer growth.
Shi, Ying; Chen, Guo-Bin; Huang, Xiao-Xiao; Xiao, Chuan-Xing; Wang, Huan-Huan; Li, Ye-Sen; Zhang, Jin-Fang; Li, Shao; Xia, Yin; Ren, Jian-Lin; Guleng, Bayasi
2015-08-21
Colorectal cancer (CRC) is one of the most commonly diagnosed cancers and a major cause of cancer death. However, the molecular mechanisms underlying CRC initiation, growth and metastasis are poorly understood. Dragon (RGMb), a member of the repulsive guidance molecule (RGM) family, has been recently identified as a co-receptor for bone morphogenetic protein (BMP) signaling, but the role of Dragon in CRC development is undefined. Here, we show that Dragon expression was increased in colon cancer tissues compared to control tissues in CAC mouse model and in human patients. Dragon promoted proliferation of CT26.WT and CMT93 colon cancer cells and accelerated tumor growth in the xenograft mouse model. Dragon's action on colon cancer development was mediated via the BMP4-Smad1/5/8 and Erk1/2 pathways. Therefore, our results have revealed that Dragon is a novel gene that promotes CRC growth through the BMP pathway. Dragon may be exploited as a potential therapeutic target for CRC treatment.
PROMOTER POLYMORPHISM OF IL-1β GENE IN PATIENTS WITH A HISTORY OF ACUTE MYOCARDIAL INFARCTION
Directory of Open Access Journals (Sweden)
A. V. Shevchenko
2010-01-01
Full Text Available We have performed analysis of associations between IL-1β gene promoter polymorphism (-511C/T and -31 T/C variants, and conventional cardiovascular risk factors in the patients living in the West Siberia who had previously a history of myocardial infarction (MI. We are shown a strong linkage disequilibrium between IL-1β -31C/T (rs1143627, and IL-1β-511T/C (rs16944. Significant differences in frequency distributions of some compound genotypes were observed between healthy and patients with a history of MI. E.g., frequency of IL-1β-31CC/-511CT genotype was detected in 5.5 % of healthy population, while being absent among MI patients. A frequency of IL-1β (-31/-511 CC/CT genotype showed significant differences between MI patients under 55 years, as compared to healthy persons. Hence, the analyzed IL-1β promoter polymorphisms may be considered as an additional constitutional factor predisposing for vascular alterations.
Cloning and functional analysis of promoters of three GnRH genes in a cichlid
International Nuclear Information System (INIS)
Kitahashi, Takashi; Sato, Hideki; Sakuma, Yasuo; Parhar, Ishwar S.
2005-01-01
Mechanisms regulating gonadotropin-releasing hormone (GnRH) types, a key molecule for reproductive physiology, remain unclear. In the present study, we cloned the promoters of GnRH1, GnRH2, and GnRH3 genes in the tilapia, Oreochromis niloticus; and found putative binding sites for glucocorticoid receptors, Sp1, C/EBP, GATA, and Oct-1, but not for androgen receptors in all three GnRH promoters using computer analysis. The presence of binding sites for progesterone receptors in GnRH1, estrogen receptors in GnRH1 and GnRH2, and thyroid hormone receptors in GnRH1 and GnRH3 suggests direct action of steroid hormones on GnRH types. Our observation of SOX and LINE-like sequences exclusively in GnRH1, COUP in GnRH2, and retinoid X receptors in GnRH3 suggests their role in sexual differentiation, midbrain segmentation, and visual cue integration, respectively. Thus, the characteristic binding sites for nuclear receptors and transcription factors support the notion that each GnRH type is regulated differently and has distinct physiological roles
Chromosome aberration assays in barley (Hordeum vulgare)
Energy Technology Data Exchange (ETDEWEB)
Constantin, M J [Univ. of Tennessee, Knoxville; Nilan, R A
1982-01-01
Barley is an exceellent organism for studies of induced chromosome aberrations because of its few (2n = 2x = 14) relatively large chromosomes. Root-tip and shoot-tip cells have been used extensively for the study of ionizing radiation-induced chromosome aberrations. The general procedures are well known, the technology is simple and easy to learn, and the assays are relatively quick and inexpensive. Both root tips and shoot tips can be used for the study of chemical mutagens as well as ionizing radiations. Pollen mother cells are well suited for studying the effects of mutagens on meiotic chromosomes. The literature review for the Gene-Tox Program reported on 61 chemicals tested for their effects on barley chromosomes. Of these, 90% were reported to be either positive or positive dose-related, while 7% were negative and 3% were questionable. Barley assays based on chromosomal aberrations are useful to detect the clastogenic potency of chemicals under laboratory conditions. Indications are that the data from barley can be used to corroborate data obtained from other organisms. Among the classes of chemicals assayed were: alcohols and phenols; alkaloids; epoxides; alkyl sulfates; amides and sulfonamides; aromatic amines; aryl halides; aziridines; alkenes; carbamates; hydroazides; nitroaromatics; nitrosamides; nitrosources; phenothiazines; and polycyclic aromatic hydrocarbons.
Stanniocalcin-2 is a HIF-1 target gene that promotes cell proliferation in hypoxia
Energy Technology Data Exchange (ETDEWEB)
Law, Alice Y.S. [Department of Biology, Hong Kong Baptist University, Kowloon Tong (Hong Kong); Wong, Chris K.C., E-mail: ckcwong@hkbu.edu.hk [Department of Biology, Hong Kong Baptist University, Kowloon Tong (Hong Kong)
2010-02-01
Stanniocalcin-2 (STC2), the paralog of STC1, has been suggested as a novel target of oxidative stress response to protect cells from apoptosis. The expression of STC2 has been reported to be highly correlated with human cancer development. In this study, we reported that STC2 is a HIF-1 target gene and is involved in the regulation of cell proliferation. STC2 was shown to be up-regulated in different breast and ovarian cancer cells, following exposure to hypoxia. Using ovarian cancer cells (SKOV3), the underlying mechanism of HIF-1 mediated STC2 gene transactivation was characterized. Hypoxia-induced STC2 expression was found to be HIF-1{alpha} dependent and required the recruitment of p300 and HDAC7. Using STC2 promoter deletion constructs and site-directed mutagenesis, two authentic consensus HIF-1 binding sites were identified. Under hypoxic condition, the silencing of STC2 reduced while the overexpression of STC2 increased the levels of phosphorylated retinoblastoma and cyclin D in both SKOV3 and MCF7 cells. The change in cell cycle proteins correlated with the data of the serial cell counts. The results indicated that cell proliferation was reduced in STC2-silenced cells but was increased in STC2-overexpressing hypoxic cells. Solid tumor progression is usually associated with hypoxia. The identification and functional analysis of STC2 up-regulation by hypoxia, a feature of the tumor microenvironment, sheds light on a possible role for STC2 in tumors.
Sabaawy, H E; Zhang, F; Nguyen, X; ElHosseiny, A; Nasjletti, A; Schwartzman, M; Dennery, P; Kappas, A; Abraham, N G
2001-08-01
Heme oxygenase (HO) catalyzes the conversion of heme to biliverdin, with release of free iron and carbon monoxide. Both heme and carbon monoxide have been implicated in the regulation of vascular tone. A retroviral vector containing human HO-1 cDNA (LSN-HHO-1) was constructed and subjected to purification and concentration of the viral particles to achieve 5x10(9) to 1x10(10) colony-forming units per milliliter. The ability of concentrated infectious viral particles to express human HO-1 (HHO-1) in vivo was tested. A single intracardiac injection of the concentrated infectious viral particles (expressing HHO-1) to 5-day-old spontaneously hypertensive rats resulted in functional expression of the HHO-1 gene and attenuation of the development of hypertension. Rats expressing HHO-1 showed a significant decrease in urinary excretion of a vasoconstrictor arachidonic acid metabolite and a reduction in myogenic responses to increased intraluminal pressure in isolated arterioles. Unexpectedly, HHO-1 chimeric rats showed a simultaneous significant proportionate increase in somatic growth. Thus, delivery of HHO-1 gene by retroviral vector attenuates the development of hypertension and promotes body growth in spontaneously hypertensive rats.
Bhatlekar, Seema; Viswanathan, Vignesh; Fields, Jeremy Z; Boman, Bruce M
2018-02-01
Because HOX genes encode master regulatory transcription factors that regulate stem cells (SCs) during development and aberrant expression of HOX genes occurs in various cancers, our goal was to determine if dysregulation of HOX genes is involved in the SC origin of colorectal cancer (CRC). We previously reported that HOXA4 and HOXD10 are expressed in the colonic SC niche and are overexpressed in CRC. HOX gene expression was studied in SCs from human colon tissue and CRC cells (CSCs) using qPCR and immunostaining. siRNA-mediated knockdown of HOX expression was used to evaluate the role of HOX genes in modulating cancer SC (CSC) phenotype at the level of proliferation, SC marker expression, and sphere formation. All-trans-retinoic-acid (ATRA), a differentiation-inducing agent was evaluated for its effects on HOX expression and CSC growth. We found that HOXA4 and HOXA9 are up-regulated in CRC SCs. siRNA knockdown of HOXA4 and HOXA9 reduced: (i) proliferation and sphere-formation and (ii) gene expression of known SC markers (ALDH1, CD166, LGR5). These results indicate that proliferation and self-renewal ability of CRC SCs are reduced in HOXA4 and HOXA9 knockdown cells. ATRA decreased HOXA4, HOXA9, and HOXD10 expression in parallel with reduction in ALDH1 expression, self-renewal, and proliferation. Overall, our findings indicate that overexpression of HOXA4 and HOXA9 contributes to self-renewal and overpopulation of SCs in CRC. Strategies designed to modulate HOX expression may provide ways to target malignant SCs and to develop more effective therapies for CRC. © 2017 Wiley Periodicals, Inc.
Obinata, Daisuke; Takada, Shogo; Takayama, Ken-ichi; Urano, Tomohiko; Ito, Akiko; Ashikari, Daisaku; Fujiwara, Kyoko; Yamada, Yuta; Murata, Taro; Kumagai, Jinpei; Fujimura, Tetsuya; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Homma, Yukio; Takahashi, Satoru; Inoue, Satoshi
2016-04-01
The androgen receptor (AR) plays a key role in the development of prostate cancer. AR signalling mediates the expression of androgen-responsive genes, which are involved in prostate cancer development and progression. Our previous chromatin immunoprecipitation study showed that the region of abhydrolase domain containing 2 (ABHD2) includes a functional androgen receptor binding site. In this study, we demonstrated that ABHD2 is a novel androgen-responsive gene that is overexpressed in human prostate cancer tissues. The expression levels of ABHD2 in androgen-sensitive cells were evaluated by quantitative reverse transcription polymerase chain reaction and western-blot analyses. LNCaP and VCaP cells with ABHD2 overexpression or short interfering RNA (siRNA) knockdown were used for functional analyses. ABHD2 expression was examined in clinical samples of prostate cancer by immunohistochemistry. We showed that ABHD2 expression is increased by androgen in LNCaP and VCaP cells. This androgen-induced ABHD2 expression was diminished by bicalutamide. While stable expression of ABHD2 affected the enhancement of LNCaP cell proliferation and migration, siRNA-mediated ABHD2 knockdown suppressed cell proliferation and migration. In addition, the siRNA treatment significantly repressed the tumour growth derived from LNCaP cells in athymic mice. Immunohistochemical analysis of ABHD2 expression in tumour specimens showed a positive correlation of ABHD2 immunoreactivity with high Gleason score and pathological N stage. Moreover, patients with high immunoreactivity of ABHD2 showed low cancer-specific survival rates and a resistance to docetaxel-based chemotherapy. ABHD2 is a novel androgen-regulated gene that can promote prostate cancer growth and resistance to chemotherapy, and is a novel target for diagnosis and treatment of prostate cancer. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Ma, Jing; Chen, Xi; Liu, Yanan; Xie, Qunhui; Sun, Yawen; Chen, Jingshan; Leng, Ling; Yan, Huan; Zhao, Bin; Tang, Naijun
2015-01-01
Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8–14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly with hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. - Highlights: • Ancestral TCDD exposure induces epigenetic transgenerational inheritance. • Ancestral TCDD exposure affects methylation status in ICR and DMR2 region of Igf2. • DNMTs play a role in TCDD induced epigenetic transgenerational changes of Igf2.
Induction of interferon-stimulated genes by IRF3 promotes replication of Toxoplasma gondii.
Majumdar, Tanmay; Chattopadhyay, Saurabh; Ozhegov, Evgeny; Dhar, Jayeeta; Goswami, Ramansu; Sen, Ganes C; Barik, Sailen
2015-03-01
Innate immunity is the first line of defense against microbial insult. The transcription factor, IRF3, is needed by mammalian cells to mount innate immune responses against many microbes, especially viruses. IRF3 remains inactive in the cytoplasm of uninfected cells; upon virus infection, it gets phosphorylated and then translocates to the nucleus, where it binds to the promoters of antiviral genes and induces their expression. Such genes include type I interferons (IFNs) as well as Interferon Stimulated Genes (ISGs). IRF3-/- cells support enhanced replication of many viruses and therefore, the corresponding mice are highly susceptible to viral pathogenesis. Here, we provide evidence for an unexpected pro-microbial role of IRF3: the replication of the protozoan parasite, Toxoplasma gondii, was significantly impaired in IRF3-/- cells. In exploring whether the transcriptional activity of IRF3 was important for its pro-parasitic function, we found that ISGs induced by parasite-activated IRF3 were indeed essential, whereas type I interferons were not important. To delineate the signaling pathway that activates IRF3 in response to parasite infection, we used genetically modified human and mouse cells. The pro-parasitic signaling pathway, which we termed PISA (Parasite-IRF3 Signaling Activation), activated IRF3 without any involvement of the Toll-like receptor or RIG-I-like receptor pathways, thereby ruling out a role of parasite-derived RNA species in activating PISA. Instead, PISA needed the presence of cGAS, STING, TBK1 and IRF3, indicating the necessity of DNA-triggered signaling. To evaluate the physiological significance of our in vitro findings, IRF3-/- mice were challenged with parasite infection and their morbidity and mortality were measured. Unlike WT mice, the IRF3-/- mice did not support replication of the parasite and were resistant to pathogenesis caused by it. Our results revealed a new paradigm in which the antiviral host factor, IRF3, plays a cell
Mutational analysis of the promoter and the coding region of the 5-HT1A gene
Energy Technology Data Exchange (ETDEWEB)
Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others
1994-09-01
Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.
Energy Technology Data Exchange (ETDEWEB)
Ma, Jing; Chen, Xi; Liu, Yanan [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China); Xie, Qunhui [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Sun, Yawen; Chen, Jingshan; Leng, Ling; Yan, Huan [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China); Zhao, Bin, E-mail: binzhao@rcees.ac.cn [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Tang, Naijun, E-mail: tangnaijun@tijmu.edu.cn [Department of Occupational and Environmental Health, School of Public Health, Tianjin Medical University, Tianjin 300070 (China)
2015-12-01
Ancestral TCDD exposure could induce epigenetic transgenerational phenotypes, which may be mediated in part by imprinted gene inheritance. The aim of our study was to evaluate the transgenerational effects of ancestral TCDD exposure on the imprinted gene insulin-like growth factor-2 (Igf2) in rat somatic tissue. TCDD was administered daily by oral gavage to groups of F0 pregnant SD rats at dose levels of 0 (control), 200 or 800 ng/kg bw during gestation day 8–14. Animal transgenerational model of ancestral exposure to TCDD was carefully built, avoiding sibling inbreeding. Hepatic Igf2 expression of the TCDD male progeny was decreased concomitantly with hepatic damage and increased activities of serum hepatic enzymes both in the F1 and F3 generation. Imprinted Control Region (ICR) of Igf2 manifested a hypermethylated pattern, whereas methylation status in the Differentially Methylated Region 2 (DMR2) showed a hypomethylated manner in the F1 generation. These epigenetic alterations in these two regions maintained similar trends in the F3 generation. Meanwhile, the expressions of DNA methyltransferases (DNMT1, DNMT3A and DNMT3B) changed in a non-monotonic manner both in the F1 and F3 generation. This study provides evidence that ancestral TCDD exposure may promote epigenetic transgenerational alterations of imprinted gene Igf2 in adult somatic tissue. - Highlights: • Ancestral TCDD exposure induces epigenetic transgenerational inheritance. • Ancestral TCDD exposure affects methylation status in ICR and DMR2 region of Igf2. • DNMTs play a role in TCDD induced epigenetic transgenerational changes of Igf2.
Lintas, Carla; Sacco, Roberto; Persico, Antonio M
2016-01-01
Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.
The Relationship between FHIT Gene Promoter Methylation and Lung Cancer Risk: a Meta-analysis
Directory of Open Access Journals (Sweden)
Yichang SUN
2014-03-01
Full Text Available Background and objective Tumor-suppressor gene promoter DNA methylation in tumor cells is associated with its reduced expression. FHIT (fragile histindine triad was one of the important tumor suppressor genes which was found hypermethylated in the promoter region in most of tumors. The aim of this study is to evaluate the relationship between FIHT gene promother methylation and lung cancer risk by meta-analysis. Methods By searching Pubmed, CNKI and Wanfang, the open published articles related to FHIT gene promoter methylation and lung carcinoma risk were collected. The odds ratio (OR and range of FHIT gene of cancer tissue of lung cancer patients compared with normal lung tissue, plasma and the bronchial lavage fluid were pooled by statistical software Stata 11.0. Results Eleven studies were finally included in this meta-analysis. The median methylation rate were Pmedian=40.0% (0-68.3%, Pmedian=8.7% (0-35.0%, Pmedian=33.3% (17.1%-38.3% and Pmedian=35.9% (31.1%-50.8% in cancer tissue, NLT, BALF and plasm respectively. The pooled results showed the methylation rate in tumor tissue was much higer than that of NLT OR=5.82 (95%CI: 3.74-9.06, P0.05 and plasma OR=1.41 (95%CI: 0.90-2.20, P>0.05. Conclusion Hypermethylation of FHIT gene promoter region was found more frequent in cancer tissue than that of NLT which may demonstrated association between lung cancer risk and FHIT gene promoter methylation.
DNA Repair Defects and Chromosomal Aberrations
Hada, Megumi; George, K. A.; Huff, J. L.; Pluth, J. M.; Cucinotta, F. A.
2009-01-01
Yields of chromosome aberrations were assessed in cells deficient in DNA doublestrand break (DSB) repair, after exposure to acute or to low-dose-rate (0.018 Gy/hr) gamma rays or acute high LET iron nuclei. We studied several cell lines including fibroblasts deficient in ATM (ataxia telangiectasia mutated; product of the gene that is mutated in ataxia telangiectasia patients) or NBS (nibrin; product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase (DNA-PK) activity. Chromosomes were analyzed using the fluorescence in situ hybridization (FISH) chromosome painting method in cells at the first division post irradiation, and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma irradiation induced greater yields of both simple and complex exchanges in the DSB repair-defective cells than in the normal cells. The quadratic dose-response terms for both simple and complex chromosome exchanges were significantly higher for the ATM- and NBS-deficient lines than for normal fibroblasts. However, in the NBS cells the linear dose-response term was significantly higher only for simple exchanges. The large increases in the quadratic dose-response terms in these repair-defective cell lines points the importance of the functions of ATM and NBS in chromatin modifications to facilitate correct DSB repair and minimize the formation of aberrations. The differences found between ATM- and NBS-deficient cells at low doses suggest that important questions should with regard to applying observations of radiation sensitivity at high dose to low-dose exposures. For aberrations induced by iron nuclei, regression models preferred purely linear dose responses for simple exchanges and quadratic dose responses for complex exchanges. Relative biological effectiveness (RBE) factors of all of
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2006-01-01
In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)
Generation and evaluation of an IPTG-regulated version of Vav-gene promoter for mouse transgenesis.
Directory of Open Access Journals (Sweden)
Francesca Grespi
2011-03-01
Full Text Available Different bacteria-derived systems for regulatable gene expression have been developed for the use in mammalian cells and some were also successfully adopted for in vivo use in vertebrate model organisms. However, certain limitations apply to most of these systems, including leakiness of transgene expression, inefficient transgene silencing or activation, as well as limited tissue accessibility of transgene-inducers or their unfavourable pharmacokinetics. In this study, we evaluated the suitability of the lac-operon/lac-repressor (lacO/lacI system for the regulation of the well-established Vav-gene promoter that allows inducible transgene expression in different haematopoietic lineages in mice. Using the fluorescence marker protein Venus as a reporter, we observed that the lacO/lacI system could be amended to modulate transgene-expression in haematopoietic cells. However, reporter expression was not uniform and the lacO elements introduced into the Vav-gene promoter only conferred limited repression and reversion of lacI-mediated gene silencing after administration of IPTG. Although further optimization of the system is required, the lacO-modified version of the Vav-gene promoter may be adopted as a tool where low basal gene-expression and limited transient induction of protein expression are desired, e.g. for the activation of oncogenes or transgenes that act in a dominant-negative manner.
Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C
2016-02-01
Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.
Ferreira, Joshua P.; Peacock, Ryan W. S.; Lawhorn, Ingrid E. B.; Wang, Clifford L.
2011-01-01
The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evalua...
Ansari, Suraiya A.; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z.; Rode, Kara A.; Barber, Wesley T.; Ellis, Laura C.; LaPorta, Erika; Orzechowski, Amanda M.; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H.
2014-01-01
Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. PMID:24727477
International Nuclear Information System (INIS)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn
2013-01-01
Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i
Expression of P. falciparum var Genes Involves Exchange of the Histone Variant H2A.Z at the Promoter
Petter, Michaela; Lee, Chin Chin; Byrne, Timothy J.; Boysen, Katja E.; Volz, Jennifer; Ralph, Stuart A.; Cowman, Alan F.; Brown, Graham V.; Duffy, Michael F.
2011-01-01
Plasmodium falciparum employs antigenic variation to evade the human immune response by switching the expression of different variant surface antigens encoded by the var gene family. Epigenetic mechanisms including histone modifications and sub-nuclear compartmentalization contribute to transcriptional regulation in the malaria parasite, in particular to control antigenic variation. Another mechanism of epigenetic control is the exchange of canonical histones with alternative variants to generate functionally specialized chromatin domains. Here we demonstrate that the alternative histone PfH2A.Z is associated with the epigenetic regulation of var genes. In many eukaryotic organisms the histone variant H2A.Z mediates an open chromatin structure at promoters and facilitates diverse levels of regulation, including transcriptional activation. Throughout the asexual, intraerythrocytic lifecycle of P. falciparum we found that the P. falciparum ortholog of H2A.Z (PfH2A.Z) colocalizes with histone modifications that are characteristic of transcriptionally-permissive euchromatin, but not with markers of heterochromatin. Consistent with this finding, antibodies to PfH2A.Z co-precipitate the permissive modification H3K4me3. By chromatin-immunoprecipitation we show that PfH2A.Z is enriched in nucleosomes around the transcription start site (TSS) in both transcriptionally active and silent stage-specific genes. In var genes, however, PfH2A.Z is enriched at the TSS only during active transcription in ring stage parasites. Thus, in contrast to other genes, temporal var gene regulation involves histone variant exchange at promoter nucleosomes. Sir2 histone deacetylases are important for var gene silencing and their yeast ortholog antagonises H2A.Z function in subtelomeric yeast genes. In immature P. falciparum parasites lacking Sir2A or Sir2B high var transcription levels correlate with enrichment of PfH2A.Z at the TSS. As Sir2A knock out parasites mature the var genes are
DEFF Research Database (Denmark)
Metz, B A; Welters, P; Hoffmann, H J
1988-01-01
The primary structure of a leghemoglobin (lb) gene from the stem-nodulated, tropical legume Sesbania rostrata and two lb gene promoter regions was analysed. The S. rostrata lb gene structure and Lb amino acid composition were found to be highly conserved with previously described lb genes and Lb ...
Zhou, Mingxue; Ma, Chao; Liu, Weihong; Liu, Hongxu; Wang, Ning; Kang, Qunfu; Li, Ping
2015-09-01
Renalase is a protein that can regulate sympathetic nerve activity by metabolizing catecholamines, while redundant catecholamines are thought to contribute to atherosclerosis (As). Catecholamine release can be facilitated by angiotensin (Ang) II by binding to Ang II type 1 (AT1) receptors. Valsartan, a special AT1 antagonist, can dilate blood vessels and reduce blood pressure, but it remained unclear whether valsartan can promote the stability of atherosclerotic plaque by affecting renalase. This study examined the tissue distribution of renalase in ApoE(-/-) mice fed with a high-fat diet and the effect of valsartan on expression of renalase. ApoE(-/-) mice were fed with a high-fat diet for 13 or 26 weeks. As a control, 10 C57BL mice were fed with a standard chow diet. After 13 weeks on the high-fat diet, the ApoE(-/-) mice were randomized (10 mice/group) and treated with valsartan, simvastatin, or distilled water (control group) for an additional 13 weeks accompanied by a high-fat diet. Knockout of ApoE caused a dramatic increase in expression of renalase in mice adipose tissue. With the disturbance of lipid metabolism induced by a high-fat diet, renalase expression decreased in the liver. Renalase can be expressed in smooth muscle cells and M2 macrophages in atherosclerotic plaque, and its expression gradually decreases in the fibrous cap during the transition from stable to vulnerable atherosclerotic plaque. Valsartan, an AT1 receptor antagonist, promotes the stabilization of atherosclerotic plaque by increasing the levels of renalase in serum and the expression of renalase in the fibrous cap of atherosclerotic plaque. It also reduces triglyceride levels in serum and increases the expression of renalase in the liver. Renalase may be a potential-related gene of lipid metabolism and As, and it may be the possible molecular target of valsartan to help stabilize atherosclerotic plaque. © The Author(s) 2015.
International Nuclear Information System (INIS)
Tong, Joanna H; Lo, Kwok W; To, Ka F; Ng, David C; Chau, Shuk L; So, Ken K; Leung, Patrick P; Lee, Tin L; Lung, Raymond W; Chan, Michael W; Chan, Anthony W
2010-01-01
Human Disabled-2 (DAB2), is a multi-function signalling molecule that it is frequently down-regulated in human cancers. We aimed to investigate the possible tumour suppressor effect of DAB2 in nasopharyngeal carcinoma (NPC). We studied the expression of DAB2 in NPC cell lines, xenografts and primary tumour samples. The status of promoter methylation was assessed by methylation specific PCR and bisulfite sequencing. The functional role of DAB2 in NPC was investigated by re-introducing DAB2 expression into NPC cell line C666-1. Decrease or absent of DAB2 transcript was observed in NPC cell lines and xenografts. Loss of DAB2 protein expression was seen in 72% (33/46) of primary NPC as demonstrated by immunohistochemistry. Aberrant DAB2 promoter methylation was detected in 65.2% (30/46) of primary NPC samples by methylation specific PCR. Treatment of the DAB2 negative NPC cell line C666-1 with 5-aza-2'-deoxycytidine resulted in restoration of DAB2 expression in a dose-dependent manner. Overexpression of DAB2 in NPC cell line C666-1 resulted in reduced growth rate and 35% reduction in anchorage-dependent colony formation, and inhibition of serum-induced c-Fos expression compared to vector-transfected controls. Over expression of DAB2 resulted in alterations of multiple pathways as demonstrated by expression profiling and functional network analysis, which confirmed the role of DAB2 as an adaptor molecule involved in multiple receptor-mediated signalling pathways. We report the frequent down regulation of DAB2 in NPC and the promoter hypermethylation contributes to the loss of expression of DAB2. This is the first study demonstrating frequent DAB2 promoter hypermethylation in human cancer. Our functional studies support the putative tumour suppressor effect of DAB2 in NPC cells
Mengin-Lecreulx, Dominique; Ayala, Juan; Bouhss, Ahmed; van Heijenoort, Jean; Parquet, Claudine; Hara, Hiroshi
1998-01-01
Recently, a promoter for the essential gene ftsI, which encodes penicillin-binding protein 3 of Escherichia coli, was precisely localized 1.9 kb upstream from this gene, at the beginning of the mra cluster of cell division and cell envelope biosynthesis genes (H. Hara, S. Yasuda, K. Horiuchi, and J. T. Park, J. Bacteriol. 179:5802–5811, 1997). Disruption of this promoter (Pmra) on the chromosome and its replacement by the lac promoter (Pmra::Plac) led to isopropyl-β-d-thiogalactopyranoside (IPTG)-dependent cells that lysed in the absence of inducer, a defect which was complemented only when the whole region from Pmra to ftsW, the fifth gene downstream from ftsI, was provided in trans on a plasmid. In the present work, the levels of various proteins involved in peptidoglycan synthesis and cell division were precisely determined in cells in which Pmra::Plac promoter expression was repressed or fully induced. It was confirmed that the Pmra promoter is required for expression of the first nine genes of the mra cluster: mraZ (orfC), mraW (orfB), ftsL (mraR), ftsI, murE, murF, mraY, murD, and ftsW. Interestingly, three- to sixfold-decreased levels of MurG and MurC enzymes were observed in uninduced Pmra::Plac cells. This was correlated with an accumulation of the nucleotide precursors UDP–N-acetylglucosamine and UDP–N-acetylmuramic acid, substrates of these enzymes, and with a depletion of the pool of UDP–N-acetylmuramyl pentapeptide, resulting in decreased cell wall peptidoglycan synthesis. Moreover, the expression of ftsZ, the penultimate gene from this cluster, was significantly reduced when Pmra expression was repressed. It was concluded that the transcription of the genes located downstream from ftsW in the mra cluster, from murG to ftsZ, is also mainly (but not exclusively) dependent on the Pmra promoter. PMID:9721276
Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2005-01-01
In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)
Cell cycle regulation of the cyclin A gene promoter is mediated by a variant E2F site
DEFF Research Database (Denmark)
Schulze, A; Zerfass, K; Spitkovsky, D
1995-01-01
Cyclin A is involved in the control of S phase and mitosis in mammalian cells. Expression of the cyclin A gene in nontransformed cells is characterized by repression of its promoter during the G1 phase of the cell cycle and its induction at S-phase entry. We show that this mode of regulation...
Guerrero-Preston, Rafael; Michailidi, Christina; Marchionni, Luigi; Pickering, Curtis R.; Frederick, Mitchell J.; Myers, Jeffrey N.; Yegnasubramanian, Srinivasan; Hadar, Tal; Noordhuis, Maartje G.; Zizkova, Veronika; Fertig, Elana; Agrawal, Nishant; Westra, William; Koch, Wayne; Califano, Joseph; Velculescu, Victor E.; Sidransky, David
Tumor suppressor genes (TSGs) are commonly inactivated by somatic mutation and/or promoter methylation; yet, recent high-throughput genomic studies have not identified key TSGs inactivated by both mechanisms. We pursued an integrated molecular analysis based on methylation binding domain sequencing
Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.
2009-01-01
The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…
Directory of Open Access Journals (Sweden)
Marwa H. Saied
2018-04-01
Full Text Available Background: DNA methylation is the commonest known epigenetic change that results in silencing of tumor suppressor genes. Promoter methylation of tumor suppressor genes has the potential for early detection of breast cancer. Aim: Aim is to examine the potential usefulness of blood based methylation specific polymerase chain reaction (MSP of methylated DKK3 and RASSF1A genes in early detection of breast cancer. Method: Methylation status of DKK3 and RASSF1 was investigated in forty breast cancer patients, twenty fibroadenoma patients and twenty healthy ladies as control group using MSP. Results: Methylation of DKK3 promoter was found in 22.5% of breast cancer patients, while DKK3 methylation was absent in both fibroadenoma patients and control group. Similarly, methylation of RASSF1 promoter was found in 17.5% of breast cancer patients and in none of fibroadenoma and control group. Conclusion: Promoter methylation of DKK3 and RASSF1 was found in breast cancer patients while absent in control group suggesting that tumorspecific methylation of the two genes (DKK3 and RASSF1A might be a valuable biomarker for the early detection of breast cancer. Keywords: DNA methylation, Breast cancer, DKK3, RASSF1
Fagoe, N D; Eggers, R; Verhaagen, J; Mason, M R J
Adeno-associated viral (AAV) vectors based on serotype 5 are an efficient means to target dorsal root ganglia (DRG) to study gene function in the primary sensory neurons of the peripheral nervous system. In this study, we have developed a compact AAV dual promoter vector composed of the
DEFF Research Database (Denmark)
Knudsen, Jan Dines; Johanson, Ted; Eliasson Lantz, Anna
2015-01-01
A control point for keeping redox homeostasis in Saccharomyces cerevisiae during fermentative growth is the dynamic regulation of transcription for the glycerol-3-phosphate dehydrogenase 2 (GPD2) gene. In this study, the possibility to steer the activity of the GPD2 promoter was investigated by p...
Borghi, Monica; Xie, De Yu
2016-01-01
Main conclusion: Arabidopsis promoters of genesBANYULSandFRUITFULLare transcribed in Camelina. They triggered the transcription oflimonene synthaseand induced higher limonene production in seeds and fruits thanCaMV 35Spromoter.Camelina sativa (Camelina) is an oilseed crop of relevance for the
Directory of Open Access Journals (Sweden)
Margarita Pesmatzoglou
2012-01-01
Full Text Available Primary immune thrombocytopenia (ITP is one of the most common blood diseases as well as the commonest acquired bleeding disorder in childhood. Although the etiology of ITP is unclear, in the pathogenesis of the disease, both environmental and genetic factors including polymorphisms of TNF-a, IL-10, and IL-4 genes have been suggested to be involved. In this study, we investigated the rs2424913 single-nucleotide polymorphism (SNP (C46359T in DNA methyltransferase 3B (DNMT3B gene promoter and the VNTR polymorphism of IL-1 receptor antagonist (IL-1 Ra intron-2 in 32 children (17 boys with the diagnosis of ITP and 64 healthy individuals. No significant differences were found in the genotype distribution of DNMT3B polymorphism between the children with ITP and the control group, whereas the frequency of allele T appeared significantly increased in children with ITP (P = 0.03, OR = 2, 95% CI: 1.06–3.94. In case of IL-1 Ra polymorphism, children with ITP had a significantly higher frequency of genotype I/II, compared to control group (P = 0.043, OR = 2.60, 95% CI: 1.02–6.50. Moreover, genotype I/I as well as allele I was overrepresented in the control group, suggesting that allele I may have a decreased risk for development of ITP. Our findings suggest that rs2424913 DNMT3B SNP as well as IL-1 Ra VNTR polymorphism may contribute to the susceptibility to ITP.
Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V
2012-11-01
Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.
Calonge, María Julia; Seoane, Joan; Massagué, Joan
2004-05-28
A critical component of the epidermal basement membrane, collagen type VII, is produced by keratinocytes and fibroblasts, and its production is stimulated by the cytokine transforming growth factor-beta (TGF-beta). The gene, COL7A1, is activated by TGF-beta via Smad transcription factors in cooperation with AP1. Here we report a previously unsuspected level of complexity in this regulatory process. We provide evidence that TGF-beta may activate the COL7A1 promoter by two distinct inputs operating through a common region of the promoter. One input is provided by TGF-beta-induced Smad complexes via two Smad binding elements that function redundantly depending on the cell type. The second input is provided by relieving the COL7A1 promoter from chicken ovalbumin upstream promoter transcription factor (COUP-TF)-mediated transcriptional repression. We identified COUP-TFI and -TFII as factors that bind to the TGF-beta-responsive region of the COL7A1 promoter in an expression library screening. COUP-TFs bind to a site between the two Smad binding elements independently of Smad or AP1 and repress the basal and TGF-beta-stimulated activities of this promoter. We provide evidence that endogenous COUP-TF activity represses the COL7A1 promoter. Furthermore, we show that TGF-beta addition causes a rapid and profound down-regulation of COUP-TF expression in keratinocytes and fibroblasts. The results suggest that TGF-beta signaling may exert tight control over COL7A1 by offsetting the balance between opposing Smad and COUP-TFs.
International Nuclear Information System (INIS)
Thangapazham, Rajesh; Saenz, Francisco; Katta, Shilpa; Mohamed, Ahmed A; Tan, Shyh-Han; Petrovics, Gyorgy; Srivastava, Shiv; Dobi, Albert
2014-01-01
In normal prostate epithelium the TMPRSS2 gene encoding a type II serine protease is directly regulated by male hormones through the androgen receptor. In prostate cancer ERG protooncogene frequently gains hormonal control by seizing gene regulatory elements of TMPRSS2 through genomic fusion events. Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. Comparative genomic analyses of the TMPRSS2 promoter upstream sequences and pathway analyses were performed by the Genomatix Software. NKX3.1 and ERG genes expressions were evaluated by immunoblot or by quantitative Real-Time PCR (qRT-PCR) assays in response to siRNA knockdown or heterologous expression. QRT-PCR assay was used for monitoring the gene expression levels of NKX3.1-regulated genes. Transcriptional regulatory function of NKX3.1 was assessed by luciferase assay. Recruitment of NKX3.1 to its cognate elements was monitored by Chromatin Immunoprecipitation assay. Comparative analysis of the TMPRSS2 promoter upstream sequences among different species revealed the conservation of binding sites for the androgen inducible NKX3.1 tumor suppressor. Defects of NKX3.1, such as, allelic loss, haploinsufficiency, attenuated expression or decreased protein stability represent established pathways in prostate tumorigenesis. We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. These observations imply that the frequently noted loss-of-function of NKX3.1 cooperates with the activation of TMPRSS2-ERG fusions in prostate tumorigenesis
Directory of Open Access Journals (Sweden)
Tatsuya eKon
2014-11-01
Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.
Chromosomal aberrations in tire plant workers and interaction with
Czech Academy of Sciences Publication Activity Database
Musak, L.; Souček, P.; Vodičková, Ludmila; Naccarati, Alessio; Halasová, E.; Poláková, Veronika; Slyšková, Jana; Susová, S.; Buchancová, J.; Šmerhovský, Z.; Sediková, J.; Klimentová, G.; Osina, O.; Hemminki, K.; Vodička, Pavel
2008-01-01
Roč. 641, 1-2 (2008), s. 36-42 ISSN 0027-5107 R&D Projects: GA MZd NR8563 Institutional research plan: CEZ:AV0Z50390512 Keywords : Chromosomal aberrations * Genetic polymorphisms * DNA repair genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.198, year: 2008
Directory of Open Access Journals (Sweden)
Rafael Estrada-Avilés
Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.
Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng
2017-01-01
Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.
Directory of Open Access Journals (Sweden)
Kosuke Fujita
2017-06-01
Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.
Directory of Open Access Journals (Sweden)
O'Brien Susan
2010-11-01
Full Text Available Abstract Background Myelodysplastic syndrome (MDS may be induced by certain mutagenic environmental or chemotherapeutic toxins; however, the role of susceptibility genes remains unclear. The G/G genotype of the single-nucleotide polymorphism (SNP rs1617640 in the erythropoietin (EPO promoter has been shown to be associated with decreased EPO expression. We examined the association of rs1617640 genotype with MDS. Methods We genotyped the EPO rS1617640 SNP in 189 patients with MDS, 257 with acute myeloid leukemia (AML, 106 with acute lymphoblastic leukemia, 97 with chronic lymphocytic leukemia, 353 with chronic myeloid leukemia, and 95 healthy controls. Results The G/G genotype was significantly more common in MDS patients (47/187; 25.1% than in controls (6/95; 6.3% or in patients with other leukemias (101/813; 12.4% (all P P = 0.03. Time to neutrophils recovery after therapy was significantly longer in MDS patients with the G/G genotype (P = 0.02. Conclusions These findings suggest a strong association between the rs1617640 G/G genotype and MDS. Further studies are warranted to investigate the utility of screening for this marker in individuals exposed to environmental toxins or chemotherapy.
Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K
Energy Technology Data Exchange (ETDEWEB)
Ferrari, S; Drusiani, E; Battini, R; Fregni, M
1988-01-11
Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.
Promoter Methylation and BDNF and DAT1 Gene Expression Profiles in Patients with Drug Addiction.
Kordi-Tamandani, Dor Mohammad; Tajoddini, Shahrad; Salimi, Farzaneh
2015-01-01
Drug addiction is a brain disorder that has negative consequences for individuals and society. Addictions are chronic relapsing diseases of the brain that are caused by direct drug-induced effects and persevering neuroadaptations at the epigenetic, neuropeptide and neurotransmitter levels. Because the dopaminergic system has a significant role in drug abuse, the purpose of this study was to analyze the methylation and expression profile of brain-derived neurotrophic factor (BDNF) and dopamine transporter (DAT1) genes in individuals with drug addiction. BDNF and DAT1 promoter methylation were investigated with a methylation-specific polymerase chain reaction (PCR) technique in blood samples from 75 individuals with drug addiction and 65 healthy controls. The expression levels of BDNF and DAT1 were assessed in 12 mRNA samples from the blood of patients and compared to the samples of healthy controls (n = 12) with real-time quantitative reverse transcription PCR. No significant differences were found in the methylation of BDNF and DAT1 between patients and controls, but the relative levels of expression of BDNF and DAT1 mRNA differed significantly in the patients compared to controls (p drug addiction.
Jönsson, Erik G; Cichon, Sven; Gustavsson, J Petter; Grünhage, Frank; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Farde, Lars; Propping, Peter; Nöthen, Markus M
2003-04-01
Personality traits have shown considerable heritable components. Striatal dopamine D(2) receptor density, as determined by positron-emission tomography, has been associated with detached personality, as assessed by the Karolinska Scales of Personality. A putative functional promoter polymorphism in the dopamine D(2) receptor gene (DRD2), -141C ins/del, has been associated with dopamine D(2) receptor density. In this study healthy subjects (n = 235) who filled in at least one of several personality questionnaires (Karolinska Scales of Personality, Swedish Universities Scales of Personality, Health-relevant Five-factor Personality Inventory, and Temperament and Character Inventory) were analyzed with regard to the DRD2 -141C ins/del variant. There was an association (p =.001) between the DRD2 -141C ins/del variant and Karolinska Scales of Personality Detachment scale, indicating higher scores in subjects with the -141C del variant. There were also associations between the DRD2 -141C ins/del variant and a number of Karolinska Scales of Personality and Swedish Universities Scales of Personality Neuroticism-related scales, but of these only Swedish Universities Scales of Personality Lack of Assertiveness scale (p =.001) survived correction for multiple testing. These results add further support for the involvement of dopamine D(2) receptor in certain personality traits. The results should be treated with caution until replicated.
Directory of Open Access Journals (Sweden)
Zhaorui Lian
2003-05-01
Full Text Available Hepatitis B x antigen (HBxAg is a trans-activating protein that may be involved in hepatocarcinogenesis, although few natural effectors of HBxAg that participate in this process have been identified. To identify additional effectors, whole cell RNA isolated from HBxAg-positive and HBxAg-negative HepG2 cells were compared by polymerase chain reaction select cDNA subtraction, and one clone, upregulated gene, clone 11 (URG11, was chosen for further characterization. Elevated levels of URG11 mRNA and protein were observed in HBxAg-positive compared to HBxAg-negative HepG2 cells. Costaining was observed in infected liver (P<.01. URG11 stimulated cell growth in culture (P<.01, anchorage-independent growth in soft agar (P<.001, and accelerated tumor formation (P<.01, and yielded larger tumors (P<.02 in SCID mice injected subcutaneously with HepG2 cells. These data suggest that URG11 is a natural effector of HBxAg that may promote the development of hepatocellular carcinoma.
Mono-(2-Ethylhexyl Phthalate Promotes Pro-Labor Gene Expression in the Human Placenta.
Directory of Open Access Journals (Sweden)
Ximi K Wang
Full Text Available Women exposed to phthalates during pregnancy are at increased risk for delivering preterm, but the mechanism behind this relationship is unknown. Placental corticotropin-releasing hormone (CRH and cyclooxygenase-2 (COX-2 are key mediators of parturition and are regulated by the non-canonical NF-kB (RelB/p52 signaling pathway. In this study, we demonstrate that one of the major phthalate metabolites, mono-(2-ethylhexyl-phthalate (MEHP, increased CRH and COX-2 mRNA and protein abundance in a dose-dependent manner in primary cultures of cytotrophoblast. This was coupled with an increase in nuclear import of RelB/p52 and its association with the CRH and COX-2 promoters. Silencing of NF-kB inducing kinase, a central signaling component of the non-canonical NF-kB pathway, blocked MEHP-induced upregulation of CRH and COX-2. These results suggest a potential mechanism mediated by RelB/p52 by which phthalates could prematurely induce pro-labor gene activity and lead to preterm birth.
Feng, Feiyue; Qiu, Bin; Zang, Ruochuan; Song, Peng; Gao, Shugeng
2017-04-25
Natural antisense transcripts (NATs) as one of the most diverse classes of long noncoding RNAs (lncRNAs), have been demonstrated involved in fundamental biological processes in human. Here, we reported that human prohibitin gene pseudogene 1 (PHBP1) was upregulated in ESCC, and increased PHBP1 expression in ESCC was associated with clinical advanced stage. Functional experiments showed that PHBP1 knockdown inhibited ESCC cells proliferation, colony formation and xenograft tumor growth in vitro and in vivo by causing cell-cycle arrest at the G1-G0 phase. Mechanisms analysis revealed that PHBP1 transcript as an antisense transcript of PHB is partially complementary to PHB mRNA and formed an RNA-RNA hybrid with PHB, consequently inducing an increase of PHB expression at both the mRNA and protein levels. Furthermore, PHBP1 expression is strongly correlated with PHB expression in ESCC tissues. Collectively, this study elucidates an important role of PHBP1 in promoting ESCC partly via increasing PHB expression.
Energy Technology Data Exchange (ETDEWEB)
Xu, Yu, E-mail: xuyu1001@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liu, Zhengchun, E-mail: l135027@126.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Kong, Haiyan, E-mail: suppleant@163.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Sun, Wenjie, E-mail: wendy11240325@163.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liao, Zhengkai, E-mail: fastbeta@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Zhou, Fuxiang, E-mail: happyzhoufx@sina.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Xie, Conghua, E-mail: chxie_65@hotmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); and others
2011-09-09
Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.
International Nuclear Information System (INIS)
Xu, Yu; Liu, Zhengchun; Kong, Haiyan; Sun, Wenjie; Liao, Zhengkai; Zhou, Fuxiang; Xie, Conghua
2011-01-01
Highlights: → A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. → The promoter was characterized with radiation-inducibility and tumor-specificity. → Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. → Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.
International Nuclear Information System (INIS)
Yuan, Yang; Wang, Weixing; Li, Huizhong; Yu, Yongwei; Tao, Jin; Huang, Shengdong; Zeng, Zhiyong
2015-01-01
Previous study showed that mitochondrial ND6 (mitND6) gene missense mutation resulted in NADH dehydrogenase deficiency and was associated with tumor metastasis in several mouse tumor cell lines. In the present study, we investigated the possible role of mitND6 gene nonsense and missense mutations in the metastasis of human lung adenocarcinoma. The presence of mitND6 gene mutations was screened by DNA sequencing of tumor tissues from 87 primary lung adenocarcinoma patients and the correlation of the mutations with the clinical features was analyzed. In addition, we constructed cytoplasmic hybrid cells with denucleared primary lung adenocarcinoma cell as the mitochondria donor and mitochondria depleted lung adenocarcinoma A549 cell as the nuclear donor. Using these cells, we studied the effects of mitND6 gene nonsense and missense mutations on cell migration and invasion through wounding healing and matrigel-coated transwell assay. The effects of mitND6 gene mutations on NADH dehydrogenase activity and ROS production were analyzed by spectrophotometry and flow cytometry. mitND6 gene nonsense and missense mutations were detected in 11 of 87 lung adenocarcinoma specimens and was correlated with the clinical features including age, pathological grade, tumor stage, lymph node metastasis and survival rate. Moreover, A549 cell containing mitND6 gene nonsense and missense mutation exhibited significantly lower activity of NADH dehydrogenase, higher level of ROS, higher capacity of cell migration and invasion, and higher pAKT and pERK1/ERK2 expression level than cells with the wild type mitND6 gene. In addition, NADH dehydrogenase inhibitor rotenone was found to significantly promote the migration and invasion of A549 cells. Our data suggest that mitND6 gene nonsense and missense mutation might promote cell migration and invasion in lung adenocarcinoma, probably by NADH dehydrogenase deficiency induced over-production of ROS
Directory of Open Access Journals (Sweden)
Rupal Sinha
Full Text Available Colorectal cancer (CRC development involves underlying modifications at genetic/epigenetic level. This study evaluated the role of Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation together/independently in sporadic CRC in Indian population and correlation with clinicopathological variables of the disease.One hundred and twenty four consecutive surgically resected tissues (62 tumor and equal number of normal adjacent controls of primary sporadic CRC were included and patient details including demographic characteristics, lifestyle/food or drinking habits, clinical and histopathological profiles were recorded. Polymerase chain reaction - Restriction fragment length polymorphism and direct sequencing for Kras gene mutation and Methylation Specific-PCR for RASSF1A, FHIT and MGMT genes was performed.Kras gene mutation at codon 12 & 13 and methylated RASSF1A, FHIT and MGMT gene was observed in 47%, 19%, 47%, 37% and 47% cases, respectively. Alcohol intake and smoking were significantly associated with presence of Kras mutation (codon 12 and MGMT methylation (p-value <0.049. Tumor stage and metastasis correlated with presence of mutant Kras codon 12 (p-values 0.018, 0.044 and methylated RASSF1A (p-values 0.034, 0.044, FHIT (p-values 0.001, 0.047 and MGMT (p-values 0.018, 0.044 genes. Combinatorial effect of gene mutation/methylation was also observed (p-value <0.025. Overall, tumor stage 3, moderately differentiated tumors, presence of lymphatic invasion and absence of metastasis was more frequently observed in tumors with mutated Kras and/or methylated RASSF1A, FHIT and MGMT genes.Synergistic interrelationship between these genes in sporadic CRC may be used as diagnostic/prognostic markers in assessing the overall pathological status of CRC.
Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui
2017-07-01
Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.
Aberrant T Cell Signaling and Subsets in Systemic Lupus Erythematosus
Directory of Open Access Journals (Sweden)
Takayuki Katsuyama
2018-05-01
Full Text Available Systemic lupus erythematosus (SLE is a chronic multi-organ debilitating autoimmune disease, which mainly afflicts women in the reproductive years. A complex interaction of genetics, environmental factors and hormones result in the breakdown of immune tolerance to “self” leading to damage and destruction of multiple organs, such as the skin, joints, kidneys, heart and brain. Both innate and adaptive immune systems are critically involved in the misguided immune response against self-antigens. Dendritic cells, neutrophils, and innate lymphoid cells are important in initiating antigen presentation and propagating inflammation at lymphoid and peripheral tissue sites. Autoantibodies produced by B lymphocytes and immune complex deposition in vital organs contribute to tissue damage. T lymphocytes are increasingly being recognized as key contributors to disease pathogenesis. CD4 T follicular helper cells enable autoantibody production, inflammatory Th17 subsets promote inflammation, while defects in regulatory T cells lead to unchecked immune responses. A better understanding of the molecular defects including signaling events and gene regulation underlying the dysfunctional T cells in SLE is necessary to pave the path for better management, therapy, and perhaps prevention of this complex disease. In this review, we focus on the aberrations in T cell signaling in SLE and highlight therapeutic advances in this field.
Aberrant T Cell Signaling and Subsets in Systemic Lupus Erythematosus
Katsuyama, Takayuki; Tsokos, George C.; Moulton, Vaishali R.
2018-01-01
Systemic lupus erythematosus (SLE) is a chronic multi-organ debilitating autoimmune disease, which mainly afflicts women in the reproductive years. A complex interaction of genetics, environmental factors and hormones result in the breakdown of immune tolerance to “self” leading to damage and destruction of multiple organs, such as the skin, joints, kidneys, heart and brain. Both innate and adaptive immune systems are critically involved in the misguided immune response against self-antigens. Dendritic cells, neutrophils, and innate lymphoid cells are important in initiating antigen presentation and propagating inflammation at lymphoid and peripheral tissue sites. Autoantibodies produced by B lymphocytes and immune complex deposition in vital organs contribute to tissue damage. T lymphocytes are increasingly being recognized as key contributors to disease pathogenesis. CD4 T follicular helper cells enable autoantibody production, inflammatory Th17 subsets promote inflammation, while defects in regulatory T cells lead to unchecked immune responses. A better understanding of the molecular defects including signaling events and gene regulation underlying the dysfunctional T cells in SLE is necessary to pave the path for better management, therapy, and perhaps prevention of this complex disease. In this review, we focus on the aberrations in T cell signaling in SLE and highlight therapeutic advances in this field. PMID:29868033
Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.
Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T
2017-08-01
X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.
Love, Dona C; Ghosh, Salil; Mondoux, Michelle A; Fukushige, Tetsunari; Wang, Peng; Wilson, Mark A; Iser, Wendy B; Wolkow, Catherine A; Krause, Michael W; Hanover, John A
2010-04-20
Nutrient-driven O-GlcNAcylation of key components of the transcription machinery may epigenetically modulate gene expression in metazoans. The global effects of GlcNAcylation on transcription can be addressed directly in C. elegans because knockouts of the O-GlcNAc cycling enzymes are viable and fertile. Using anti-O-GlcNAc ChIP-on-chip whole-genome tiling arrays on wild-type and mutant strains, we detected over 800 promoters where O-GlcNAc cycling occurs, including microRNA loci and multigene operons. Intriguingly, O-GlcNAc-marked promoters are biased toward genes associated with PIP3 signaling, hexosamine biosynthesis, and lipid/carbohydrate metabolism. These marked genes are linked to insulin-like signaling, metabolism, aging, stress, and pathogen-response pathways in C. elegans. Whole-genome transcriptional profiling of the O-GlcNAc cycling mutants confirmed dramatic deregulation of genes in these key pathways. As predicted, the O-GlcNAc cycling mutants show altered lifespan and UV stress susceptibility phenotypes. We propose that O-GlcNAc cycling at promoters participates in a molecular program impacting nutrient-responsive pathways in C. elegans, including stress, pathogen response, and adult lifespan. The observed impact of O-GlcNAc cycling on both signaling and transcription in C. elegans has important implications for human diseases of aging, including diabetes and neurodegeneration.
Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou
2014-08-01
30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.
Chopra, A; Gupta, I D; Verma, A; Chakravarty, A K; Vohra, V
2015-01-01
Lactoferrin (Lf) gene promoter was screened for the presence of single nucleotide polymphism in indigenous and crossbred cattle from North India and to evaluate its association with Mastitis. Study revealed the presence of genetic variation in regulatory region of bovine Lactoferrin gene using PCR-RFLP technique. Three genotypes namely GG, GH and HH were identified. A single nucleotide change, from guanine to adenine at 25th position was found to be significantly associated (pmastitis in indigenous Sahiwal and crossbred Karan Fries cattle maintained at organised herd of National Dairy Research Institute, Karnal. A non-significant association was observed between subclinical mastitis, somatic cell score (SCS), and GG genotype in Karan Fries cattle, however, a lower SCS was observed in animals having GG genotype. Overall a lower incidence of clinical mastitis was recorded in those animals having GG genotype of Lf in Sahiwal and Karan Fries (KF) cattle. The SNP identified in the promoter region may effect expression lactoferrin protein, which may lead to different levels of antibacterial and anti-inflammatory activity of Lf gene. Results from this study indicated the probable role played by Lactoferrin promoter to serve as candidate gene for mastitis susceptibility among indigenous and crossbred milch cattle.
Low-energy foil aberration corrector
International Nuclear Information System (INIS)
Aken, R.H. van; Hagen, C.W.; Barth, J.E.; Kruit, P.
2002-01-01
A spherical and chromatic aberration corrector for electron microscopes is proposed, consisting of a thin foil sandwiched between two apertures. The electrons are retarded at the foil to almost zero energy, so that they can travel ballistically through the foil. It is shown that such a low-voltage corrector has a negative spherical aberration for not too large distances between aperture and foil, as well as a negative chromatic aberration. For various distances the third- and fifth-order spherical aberration coefficients and the first- and second-order chromatic aberration coefficients are calculated using ray tracing. Provided that the foils have sufficient electron transmission the corrector is able to correct the third-order spherical aberration and the first-order chromatic aberration of a typical low-voltage scanning electron microscope. Preliminary results show that the fifth-order spherical aberration and the second-order chromatic aberration can be kept sufficiently low
Directory of Open Access Journals (Sweden)
Sakaki Yoshiyuki
2004-02-01
Full Text Available Abstract Background Gene expression is regulated mainly by transcription factors (TFs that interact with regulatory cis-elements on DNA sequences. To identify functional regulatory elements, computer searching can predict TF binding sites (TFBS using position weight matrices (PWMs that represent positional base frequencies of collected experimentally determined TFBS. A disadvantage of this approach is the large output of results for genomic DNA. One strategy to identify genuine TFBS is to utilize local concentrations of predicted TFBS. It is unclear whether there is a general tendency for TFBS to cluster at promoter regions, although this is the case for certain TFBS. Also unclear is the identification of TFs that have TFBS concentrated in promoters and to what level this occurs. This study hopes to answer some of these questions. Results We developed the cluster score measure to evaluate the correlation between predicted TFBS clusters and promoter sequences for each PWM. Non-promoter sequences were used as a control. Using the cluster score, we identified a PWM group called PWM-PCP, in which TFBS clusters positively correlate with promoters, and another PWM group called PWM-NCP, in which TFBS clusters negatively correlate with promoters. The PWM-PCP group comprises 47% of the 199 vertebrate PWMs, while the PWM-NCP group occupied 11 percent. After reducing the effect of CpG islands (CGI against the clusters using partial correlation coefficients among three properties (promoter, CGI and predicted TFBS cluster, we identified two PWM groups including those strongly correlated with CGI and those not correlated with CGI. Conclusion Not all PWMs predict TFBS correlated with human promoter sequences. Two main PWM groups were identified: (1 those that show TFBS clustered in promoters associated with CGI, and (2 those that show TFBS clustered in promoters independent of CGI. Assessment of PWM matches will allow more positive interpretation of TFBS in
Chao, Chun-Nun; Lin, Mien-Chun; Fang, Chiung-Yao; Chen, Pei-Lain; Chang, Deching; Shen, Cheng-Huang; Wang, Meilin
2016-01-01
Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B) has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV) infection. Therefore, we designed that the JCPyV virus-like particle (VLP) packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk) for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp) or thymidine kinase gene (pSPB-tk) under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV) were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549) and large cell carcinoma (H460) cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV), a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.
Directory of Open Access Journals (Sweden)
Chun-Nun Chao
Full Text Available Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV infection. Therefore, we designed that the JCPyV virus-like particle (VLP packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp or thymidine kinase gene (pSPB-tk under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549 and large cell carcinoma (H460 cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV, a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.
Lin, Min; Dan, Hanhong; Li, Yijing
2004-02-01
Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.
Arroyo-Jousse, Viviana; Garcia-Diaz, Diego F; Codner, Ethel; Pérez-Bravo, Francisco
2016-12-01
TNF-α is a pro-inflammatory cytokine that is involved in type 1 diabetes (T1D) pathogenesis. The TNFa gene is subject of epigenetic regulation in which folate and homocysteine are important molecules because they participate in the methionine cycle where the most important methyl group donor (S-adenosylmethionine) is formed. We investigated whether TNFa gene promoter methylation status in T1D patients was related to blood folate, homocysteine and TNF-α in a transversal case-control study. We studied T1D patients (n 25, mean=13·7 years) and healthy control subjects (n 25, mean=31·1 years), without T1D and/or other autoimmune diseases or direct family history of these diseases. A blood sample was obtained for determination of serum folate, plasma homocysteine and TNF-α concentrations. Whole blood was used for the extraction of DNA to determine the percentage of methylation by real-time PCR and melting-curve analysis. Results are expressed as means and standard deviations for parametric variables and as median (interquartile range) for non-parametric variables. T1D patients showed a higher TNFa gene promoter methylation (39·2 (sd 19·5) %) when compared with control subjects (25·4 (sd 13·7) %) (P=0·008). TNFa gene promoter methylation was positively associated only with homocysteine levels in T1D patients (r 0·55, P=0·007), but not in control subjects (r -0·122, P=0·872). To our knowledge, this is the first work that reports the methylation status of the TNFa gene promoter and its relationship with homocysteine metabolism in Chilean T1D patients without disease complications.
Directory of Open Access Journals (Sweden)
Wu MH
2016-03-01
Full Text Available Minhua Wu,1,2,* Xiaoxia Ye,2,* Xubin Deng,3,* Yanxia Wu,4 Xiaofang Li,4 Lin Zhang11Department of Histology and Embryology, Southern Medical University, Guangzhou, 2Department of Histology and Embryology, Guangdong Medical University, Zhanjiang, 3Affiliated Cancer Hospital of Guangzhou Medical University, Cancer Center of Guangzhou Medical University, Guangzhou, 4Pathological Diagnosis and Research Center, Affiliated Hospital of Guangdong Medical University, Zhanjiang, People’s Republic of China*These authors contributed equally to this workAims: Metastasis-associated gene 2 (MTA2 is reported to play an important role in tumor progression, but little is known about the role of MTA2 in nasopharyngeal carcinoma (NPC. The aim of the study was to explore the expression and function of MTA2 in NPC.Methods: Expression of MTA2 in NPC tissues and cell lines was detected by immunohistochemistry and Western blotting. Relationship between MTA2 expression and clinicopathological features was analyzed. Stable MTA2-overexpressing and MTA2-siliencing NPC cells were established by transfection with plasmids encoding MTA2 cDNA and lentivirus-mediated short hairpin RNA, respectively. Cell viability was determined by Cell Counting Kit-8 and colony formation assay. Cell migration ability was evaluated by wound healing and transwell invasion assay. The impact of MTA2 knockdown on growth and metastasis of CNE2 cells in vivo was determined by nude mouse xenograft models. Expression of several Akt pathway proteins was detected by Western blotting.Results: MTA2 was upregulated in NPC tissues and three NPC cell lines detected (CNE1, CNE2, and HNE1. MTA2 expression was related to clinical stage and lymph node metastasis of patients with NPC. MTA2 upregulation promoted proliferation and invasion of CNE1 cells, while MTA2 depletion had opposite effects on CNE2 cells. Moreover, MTA2 depletion suppressed growth and metastasis of CNE2 cells in vivo. MTA2 overexpression
Screening for aberrant behavior in the nuclear industry
International Nuclear Information System (INIS)
Borofsky, G.L.
1987-01-01
This paper attempts to promote a fuller understanding of how psychological assessment procedures can be used to reduce the threat from aberrant behavior in the nuclear industry. It begins with a discussion of the scientifically based methods that are used by ps