WorldWideScience

Sample records for aberrant 5s rdna

  1. Physical mapping of 18S-25S rDNA and 5S rDNA in Lupinus via fluorescent in situ hybridization.

    Science.gov (United States)

    Naganowska, Barbara; Zielińska, Anna

    2002-01-01

    Double-target fluorescent in situ hybridization (FISH) was used to determine the genomic distribution of ribosomal RNA genes in five Lupinus species: L. cosentinii (2n=32), L. pilosus (2n=42), L. angustifolius (2n=40), L. luteus (2n=52) and L. mutabilis (2n=48). 18S-25S rDNA and 5S rDNA were used as probes. Some interspecific variation was observed in the number and size of the 18S-25S rDNA loci. All the studied species had one chromosome pair carrying 5S rDNA.

  2. Discrimination of Shark species by simple PCR of 5S rDNA repeats

    Directory of Open Access Journals (Sweden)

    Danillo Pinhal

    2008-01-01

    Full Text Available Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat units amplification, in order to contribute conservation management of these animals. The generated agarose electrophoresis band patterns allowed to unequivocally distinguish eight shark species. The data showed for the first time that a simple PCR is able to discriminate elasmobranch species. The described 5S rDNA PCR approach generated species-specific genetic markers that should find broad application in fishery management and trade of sharks and their subproducts.

  3. Chromosomal localization of rDNA genes and genomic organization of 5S rDNA in Oreochromis mossambicus, O. urolepis hornorum and their hybrid

    Indian Academy of Sciences (India)

    Hua Ping Zhu; Mai Xin Lu; Feng Ying Gao; Zhang Han Huang; Li Ping Yang; Jain Fang Gui

    2010-08-01

    In this study, classical and molecular cytogenetic analyses were performed in tilapia fishes, Oreochromis mossambicus (XX/XY sex determination system), O. urolepis hornorum (WZ/ZZ sex determination system) and their hybrid by crossing O. mossambicus female × O. u. hornorum male. An identical karyotype (($2n = 44$, NF (total number of chromosomal arms) = 50) was obtained from three examined tilapia samples. Genomic organization analysis of 5S rDNA revealed two different types of 5S rDNA sequences, 5S type I and 5S type II. Moreover, fluorescence in situ hybridization (FISH) with 5S rDNA probes showed six positive fluorescence signals on six chromosomes of all the analysed metaphases from the three tilapia samples. Subsequently, 45S rDNA probes were also prepared, and six positive fluorescence signals were observed on three chromosome pairs in all analysed metaphases of the three tilapia samples. The correlation between 45 rDNA localization and nucleolar organizer regions (NORs) was confirmed by silver nitrate staining in tilapia fishes. Further, different chromosomal localizations of 5S rDNA and 45S rDNA were verified by two different colour FISH probes. Briefly, the current data provide an insights for hybridization projects and breeding improvement of tilapias.

  4. 5S rDNA characterization in twelve Sciaenidae fish species (Teleostei, Perciformes: depicting gene diversity and molecular markers

    Directory of Open Access Journals (Sweden)

    Fernanda A. Alves-Costa

    2008-01-01

    Full Text Available In order to extend the genetic data on the Sciaenidae fish family, the present study had the purpose to characterize PCR-generated 5S rDNA repeats of twelve species of this group through PAGE (Polyacrylamide Gel Electrophoresis analysis. The results showed the occurrence of at least two different 5S rDNA size classes in all the species. Moreover, 5S rDNA repeats of one of the studied species - Isopisthus parvipinnis - were cloned and subjected to nucleotide sequencing and Southern blot membrane hybridization analyses, which permitted to confirm the existence of two major 5S rDNA classes. Phylogenetic analysis based on the nucleotide sequences of different 5S rDNA repeats of I. parvipinnis lead to their separation into two major clusters. These results may reflect the high dynamism that rules the evolution rate of 5S rDNA repeats. The obtained data suggest that 5S rDNA can be useful in genetic analyses to identify species-specific markers and determine relationships among species of the Sciaenidae group.

  5. Phylogenetic relationships among diploid Aegilops species inferred from 5S rDNA units.

    Science.gov (United States)

    Baum, B R; Edwards, T; Johnson, D A

    2009-10-01

    Relationships among the currently recognized 11 diploid species within the genus Aegilops have been investigated. Sequence similarity analysis, based upon 363 sequenced 5S rDNA clones from 44 accessions plus 15 sequences retrieved from GenBank, depicted two unit classes labeled the long AE1 and short AE1. Several different analytical methods were applied to infer relationships within haplomes, between haplomes and among the species, including maximum parsimony and maximum likelihood analyses of consensus sequences, "total evidence" phylogeny analysis and "matrix representation with parsimony" analysis. None were able to depict suites of markers or unit classes that could discern among the seven haplomes as is observed among established haplomes in other genera within the tribe Triticeae; however, most species could be separated when displayed on gene trees. These results suggest that the haplomes currently recognized are so refined that they may be relegated as sub-haplomes or haplome variants. Amblyopyrum shares the same 5S rDNA unit classes with the diploid Aegilops species suggesting that it belongs within the latter. Comparisons of the Aegilops sequences with those of Triticum showed that the long AE1 unit class of Ae. tauschii shared the clade with the equivalent long D1 unit class, i.e., the putative D haplome donor, but the short AE1 unit class did not. The long AE1 unit class but not the short, of Ae. speltoides and Ae. searsii both share the clade with the previously identified long {S1 and long G1 unit classes meaning that both Aegilops species can be equally considered putative B haplome donors to tetraploid Triticum species. The semiconserved nature of the nontranscribed spacer in Aegilops and in Triticeae in general is discussed in view that it may have originated by processes of incomplete gene conversion or biased gene conversion or birth-and-death evolution.

  6. Linked 5S and 45S rDNA sites are highly conserved through the subfamily Aurantioideae (Rutaceae).

    Science.gov (United States)

    Barros E Silva, A E; Dos Santos Soares Filho, W; Guerra, M

    2013-01-01

    Sites of 5S and 45S rDNA are more commonly located on different chromosomes of most angiosperms. Previous investigations have shown that in the subfamily Aurantioideae these sites may appear closely linked (adjacent sites), as in Poncirustrifoliata, or completely isolated, as in some species of Citrus. In the present work, the distribution of rDNA sites was investigated in representatives of 9 genera of Aurantioideae by FISH and CMA banding, aiming to understand the evolution of adjacent sites in the subfamily. A total of 57 rDNA sites were observed, 40 of them being adjacent to each other. All adjacent sites displayed the 45S rDNA array more terminally located. Assuming that the linked 5S-45S rDNA arrangement was the ancestral condition in Aurantioideae, the isolated rDNA sites observed in Clausena excavata,Bergera koenigii, and Fortunella obovata, as well as the complete linkage loss in Citrus maxima and C. medica indicates that unlinked sites arose independently several times in the evolution of the group. The linkage loss may be due to independent dispersion of one or both rDNA sequence families followed by deletion of the corresponding array in the adjacent site. The possible mechanisms behind these events and their occurrence in other groups are discussed.

  7. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    Science.gov (United States)

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-12-18

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes.

  8. Comparative Studies of 5S rDNA Profiles and Cyt b Sequences in two Onychostoma Species (Cyprinidae

    Directory of Open Access Journals (Sweden)

    Chiao-Chuan Han

    2015-12-01

    Full Text Available Onychostoma barbatulum and O. alticorpus, two primarily freshwater cyprinid fish, have similar morphological characters and partially overlapping ecological habitats. In order to explore the genetic differences between these two species, chromosomal characteristics and genetic variations were examined by fluorescence in situ hybridization (FISH of 5S rDNA and cytochrome (Cyt b gene analysis. Ten specimens of O. barbatulum and O. alticorpus were collected from the Nanzihsian Stream in southern Taiwan. FISH revealed that the 5S rDNA loci of O. barbatulum and O. alticorpus were found at a pericentromeric and subtelomeric position, respectively, in a pair of submetacentric chromosomes. Cyt b genes were amplified and sequenced from five individuals of each species. Intraspecific genetic distances ranged from 0.001–0.004 in O. barbatulum and from 0.001–0.006 in O. alticorpus. Genetic distances between these two species ranged from 0.132–0.142. The phylogenetic tree showed these two species are not sister species. In conclusion, FISH cytogenetic information and Cyt b gene analyses indicated that these two species have significantly different genetic characteristics; nevertheless, their morphological similarities may be due to environmental adaptation.

  9. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    Science.gov (United States)

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome.

  10. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    Directory of Open Access Journals (Sweden)

    Weiguo He

    Full Text Available Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100 × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48 were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC and only class IV from their male parent (TC. Triploid hybrids inherited class II and class III from their female parent (RCC and class IV from their male parent (TC. Tetraploid hybrids gained class II and class III from their female parent (RCC, and generated a new 5S rDNA sequence (designated class I-N. The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  11. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    Science.gov (United States)

    He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  12. Distribution of 5S and 45S rDNA sites in plants with holokinetic chromosomes and the "chromosome field" hypothesis.

    Science.gov (United States)

    Sousa, A; Barros e Silva, A E; Cuadrado, A; Loarce, Y; Alves, M V; Guerra, M

    2011-08-01

    Secondary constrictions or 45S rDNA sites are commonly reported to be located mainly in the terminal regions of the chromosomes. This distribution has been assumed to be related to the existence of a "chromosome field" lying between the centromere and the telomere, an area in which certain cytogenetic events may predominantly occur. If this hypothesis is true this distribution should not be observed in holokinetic chromosomes, as they do not have a localized centromere. In order to evaluate this hypothesis, a comparative study was made of the distributions of 5S and 45S rDNA sites using fluorescence in situ hybridization in representatives of the genera Eleocharis, Diplacrum, Fimbristylis, Kyllinga and Rhynchospora, all of which belong to the family Cyperaceae. The numbers of sites per diploid chromosome complement varied from 2 to ∼10 for 5S rDNA, and from 2 to ∼45 for 45S rDNA. All of the 11 species analyzed had terminally located 45S rDNA sites on the chromosomes whereas the 5S rDNA sites also generally had terminal distributions, except for the Rhynchospora species, where their position was almost always interstitial. These results, together with other previously published data, suggest that the variation in the number and position of the rDNA sites in species with holokinetic chromosomes is non-random and similar to that reported for species with monocentric chromosomes. Therefore, the predominant terminal position of the 45S rDNA sites does not appear to be influenced by the centromere-telomere polarization as suggested by the "chromosome field" hypothesis. Additionally, the hybridization of 5S and 45S rDNA sites provides interesting markers to distinguish several chromosomes on the rather symmetrical karyotypes of Cyperaceae.

  13. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    Directory of Open Access Journals (Sweden)

    Araki Carlos S

    2011-05-01

    Full Text Available Abstract Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution.

  14. Identification of goose (Anser anser) and mule duck (Anasplatyrhynchos x Cairina moschata) foie gras by multiplex polymerase chain reaction amplification of the 5S RDNA gene.

    Science.gov (United States)

    Rodríguez, M A; García, T; González, I; Asensio, L; Fernández, A; Lobo, E; Hernández, P E; Martín, R

    2001-06-01

    Polymerase chain reaction (PCR) amplification of the nuclear 5S rDNA gene has been used for the identification of goose and mule duck foie gras. Two species-specific reverse primers were designed and used in a multiplex reaction, together with a forward universal primer, to amplify specific fragments of the 5S rDNA in each species. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose and mule duck foie gras samples. This genetic marker can be useful for detecting fraudulent substitution of the duck liver for the more expensive goose liver.

  15. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    Science.gov (United States)

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-11-25

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition.

  16. Co-located 18S/5S rDNA arrays: an ancient and unusual chromosomal trait in Julidini species (Labridae, Perciformes)

    Science.gov (United States)

    Amorim, Karlla Danielle Jorge; Cioffi, Marcelo de Bello; Bertollo, Luiz Antonio Carlos; Soares, Rodrigo Xavier; de Souza, Allyson Santos; da Costa, Gideão Wagner Werneck Felix; Molina, Wagner Franco

    2016-01-01

    Abstract Wrasses (Labridae) are extremely diversified marine fishes, whose species exhibit complex interactions with the reef environment. They are widely distributed in the Indian, Pacific and Atlantic oceans. Their species have displayed a number of karyotypic divergent processes, including chromosomal regions with complex structural organization. Current cytogenetic information for this family is phylogenetically and geographically limited and mainly based on conventional cytogenetic techniques. Here, the distribution patterns of heterochromatin, GC-specific chromosome regions and Ag-NORs, and the organization of 18S and 5S rDNA sites of the Atlantic species Thalassoma noronhanum (Boulenger, 1890), Halichoeres poeyi (Steindachner, 1867), Halichoeres radiatus (Linnaeus, 1758), Halichoeres brasiliensis (Bloch, 1791) and Halichoeres penrosei Starks, 1913, belonging to the tribe Julidini were analyzed. All the species exhibited 2n=48 chromosomes with variation in the number of chromosome arms among genera. Thalassoma noronhanum has 2m+46a, while species of the genus Halichoeres Rüppell, 1835 share karyotypes with 48 acrocentric chromosomes. The Halichoeres species exhibit differences in the heterochromatin distribution patterns and in the number and distribution of 18S and 5S rDNA sites. The occurrence of 18S/5S rDNA syntenic arrangements in all the species indicates a functionally stable and adaptive genomic organization. The phylogenetic sharing of this rDNA organization highlights a marked and unusual chromosomal singularity inside the family Labridae. PMID:28123678

  17. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Science.gov (United States)

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  18. Population distribution of 45S and 5S rDNA in golden mahseer, Tor putitora: population-specific FISH marker

    Indian Academy of Sciences (India)

    Mamta Singh; Ravindra Kumar; N. S. Nagpure; Basdeo Kushwaha; Indra Mani; U. K. Chauhan; W. S. Lakra

    2009-12-01

    Chromosomal locations of major 45S and minor 5S ribosomal DNAs (rDNAs) and organization of 5S rRNA genes were analysed in five different populations of golden mahseers (Tor putitora) using fluorescence in situ hybridization (FISH) and Southern blot hybridization. All five populations of T. putitora ($2n = 100$) showed a similar type of macro-karyotype composed of 12 metacentric, 22 submetacentric, 14 subtelocentric and 52 telocentric chromosomes. Analysis of active nucleolar organizer regions (NORs) by silver staining did not show any differences in number and chromosomal position in different populations. But FISH data showed significant difference between the populations, four of the five populations showed six 18S (three pairs) and two 5S (one pair) signals with positional polymorphism, while one population showed eight 18S and four 5S signals, respectively. Southern blot data confirms that 5S rDNA clusters present on two different chromosome pairs in Kosi river population contain non-transcribed spacers (NTS) of same length. In the present study, simultaneous localization of 45S and 5S rDNA by in situ hybridization helped us to develop the discrete population-specific markers in different geographically isolated populations of T. putitora.

  19. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

    Science.gov (United States)

    Cruz, V P; Oliveira, C; Foresti, F

    2015-01-01

    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.

  20. Chromosomal localization of 5S rDNA in Chinese shrimp (Fenneropenaeus chinensis):a chromosome-specific marker for chromosome identification

    Institute of Scientific and Technical Information of China (English)

    郇聘; 张晓军; 李富花; 赵翠; 张成松; 相建海

    2010-01-01

    Chinese shrimp(Fenneropenaeus chinensis)is an economically important aquaculture species in China.However,cytogenetic and genomic data is limited in the organism partly because the chromosomes are difficult to isolate and analyze.In this study,fluorescence in-situ hybridization(FISH) was used to identify the chromosomes of F.chinensis.The 5S ribosomal RNA gene(rDNA)of F. chinensis was isolated,cloned and then used as a hybridization probe.The results show that the 5S rDNA was located on one pair of homologo...

  1. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

    Science.gov (United States)

    Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  2. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae: Evolutionary Tendencies in the Genus

    Directory of Open Access Journals (Sweden)

    Vanessa Bueno

    2014-01-01

    Full Text Available Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  3. The 5S rDNA high dynamism in Diplodus sargus is a transposon-mediated mechanism. Comparison with other multigene families and Sparidae species.

    Science.gov (United States)

    Merlo, Manuel A; Cross, Ismael; Manchado, Manuel; Cárdenas, Salvador; Rebordinos, Laureana

    2013-03-01

    There has been considerable discussion in recent years on the evolution of the tandemly repeated multigene families, since some organisms show a concerted model whereas others show a birth-and-death model. This controversial subject extends to several species of fish. In this study, three species of the Sparidae family (Pagrus pagrus, P. auriga and Diplodus sargus) and an interspecific hybrid (P. pagrus (♀) × P. auriga (♂)) have been studied at both molecular and cytogenetic level, taking three different multigene families (5S rDNA, 45S rDNA and U2 snDNA). Results obtained with the 5S rDNA in P. pagrus and P. auriga are characterized by a considerable degree of conservation at the two levels; however, an extraordinary variation was observed in D. sargus at the two levels, which has never been found in other fishes studied to date. As a consequence of this, the evolutionary model of the multigene families is discussed considering the results obtained and others from the bibliography. The result obtained in the hybrid allowed the recombination frequency in each multigene family to be estimated.

  4. 砂梨45 S rDNA和5 S rDNA的染色体定位研究%Physical Mapping of the 45 S rDNA and 5 S rDNA to Pear Metaphase Chromosome

    Institute of Scientific and Technical Information of China (English)

    杨光绪; 刁英

    2007-01-01

    45 S rDNA和5 S rDNA是砂梨中与核糖体RNA合成有关的2个功能片段.通过双色FISH(fluorescence in situ hybridization)确定了45 S rDNA序列和5 S rDNA在砂梨中期染色体上的分布,其中45 S rDNA位于砂梨的第4号,第11号和第15号染色体的短臂末端.5 S rDNA序列位于第12号染色体上着丝粒附近,而在第6和第13号染色体上则分布在长臂上.

  5. Molecular Cytogenetic Analysis of Cucumis Wild Species Distributed in Southern Africa: Physical Mapping of 5S and 45S rDNA with DAPI.

    Science.gov (United States)

    Yagi, Kouhei; Pawełkowicz, Magdalena; Osipowski, Paweł; Siedlecka, Ewa; Przybecki, Zbigniew; Tagashira, Norikazu; Hoshi, Yoshikazu; Malepszy, Stefan; Pląder, Wojciech

    2015-01-01

    Wild Cucumis species have been divided into Australian/Asian and African groups using morphological and phylogenetic characteristics, and new species have been described recently. No molecular cytogenetic information is available for most of these species. The crossability between 5 southern African Cucumis species (C. africanus, C. anguria, C. myriocarpus, C. zeyheri, and C. heptadactylus) has been reported; however, the evolutionary relationship among them is still unclear. Here, a molecular cytogenetic analysis using FISH with 5S and 45 S ribosomal DNA (rDNA) was used to investigate these Cucumis species based on sets of rDNA-bearing chromosomes (rch) types I, II and III. The molecular cytogenetic and phylogenetic results suggested that at least 2 steps of chromosomal rearrangements may have occurred during the evolution of tetraploid C. heptadactylus. In step 1, an additional 45 S rDNA site was observed in the chromosome (type III). In particular, C. myriocarpus had a variety of rch sets. Our results suggest that chromosomal rearrangements may have occurred in the 45 S rDNA sites. We propose that polyploid evolution occurred in step 2. This study provides insights into the chromosomal characteristics of African Cucumis species and contributes to the understanding of chromosomal evolution in this genus.

  6. An uncommon co-localization of rDNA 5S with major rDNA clusters in Callichthyidae (Siluriformes): a report case in Corydoras carlae Nijssen & Isbrücker, 1983

    Science.gov (United States)

    da Rocha, Rafael Henrique; Baumgärtner, Lucas; Paiz, Leonardo Marcel; Margarido, Vladimir Pavan; Fernandes, Carlos Alexandre; Gubiani, Éder André

    2016-01-01

    Abstract Corydoras Lacepède, 1803 is the most specious genus of Corydoradinae subfamily and many of its species are still unknown in relation to molecular cytogenetic markers. However, the diploid number and karyotypic formula were recorded for many species of this group. In current study, we provided the first cytogenetic information of Corydoras carlae Nijssen & Isbrücker, 1983, an endemic fish species from Iguassu River basin, Paraná State, Brazil. The individuals were collected in Florido River, a tributary of Iguassu River and analysed with respect to diploid number, heterochromatin distribution pattern, Ag-NORs and mapping of 5S and 18S ribosomal genes. The karyotype of this species comprises 46 chromosomes arranged in 22m+22sm+2st. The heterochromatin is distributed in centromeric and pericentromeric positions in most of the chromosomes, and also associated with NORs. The Ag-NORs were detected in the terminal position on the long arm of the metacentric pair 6. The double-FISH technique showed that 5S rDNA and 18S rDNA were co-localized in the terminal portion on the long arm of the metacentric pair 6. This condition of co-localization of ribosomal genes in Corydoras carlae seems to represent a marker for this species. PMID:28123681

  7. Obtaining 5S rDNA molecular markers for native and invasive Cichla populations (Perciformes – Cichlidae, in Brazil - DOI: 10.4025/actascibiolsci.v30i1.1467 Obtaining 5S rDNA molecular markers for native and invasive Cichla populations (Perciformes – Cichlidae, in Brazil - DOI: 10.4025/actascibiolsci.v30i1.1467

    Directory of Open Access Journals (Sweden)

    Sônia Maria Alves Pinto Prioli

    2008-03-01

    Full Text Available O gene DNAr 5S é informativo e possui altas taxas de conservação ao longo do genoma dos eucariotos, possuindo características únicas que são hereditárias. Estudos moleculares do gene DNAr 5S vem sendo realizados com diversos grupos, inclusive em algumas espécies de peixes, com o intuito de solucionar problemas de relações filogenéticas, padrão de ancestralidade e diversidade genética, entre grupos de populações naturais. Espécies do gênero Cichla, introduzidas na bacia do alto rio Paraná, apresentam polimorfismos genéticos, detectados por análise de RAPD e SPAR. Essas espécies estão intercruzando-se e formando híbridos viáveis, com maior variabilidade genética. O objetivo desse trabalho foi padronizar a metodologia de amplificação de regiões não-transcritas da família multigênica rDNA 5S de Cichla e obter marcadores específicos para as espécies parentais que pudessem, também, ser identificados nos híbridos. Foram analisados 65 espécimes de Cichla, das bacias do alto rio Paraná e Amazônica. Apesar de não se obter marcadores moleculares que pudessem ser úteis à identificação de híbridos, foram obtidos marcadores moleculares genéticos DNAr 5S espécie-específicos para Cichla temensis, que podem ser utilizados para identificação de exemplares dessa espécie e, também, marcadores populacionais, que podem ser úteis para estudos de variabilidade genética populacionalThe 5S rDNA gene is informative and has high conservation rates along the eukaryotic genome, having unique hereditary characteristics. Molecular studies with the 5S rDNA gene have been carried out with several groups, including some species of fish, aiming at solving phylogenetic relationship problems, ancestral patterns and genetic diversity among groups in natural populations. Species of the Cichla genus, introduced in the Upper Paraná River basin, present some genetic polymorphisms detected by RAPD and SPAR analyses. These species have

  8. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product.

  9. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Directory of Open Access Journals (Sweden)

    Garcia Sònia

    2012-06-01

    Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.

  10. Molecular cytogenetics studies in Reichardia tingetana: Physical mapping of heterochromatin, telomere repeats, and 5S and 45S rDNA by 4',6-diamidino-2-phenylindole and fluorescence in situ hybridization

    Institute of Scientific and Technical Information of China (English)

    Magdy Hussein ABD EL-TWAB

    2012-01-01

    Molecular cytogenetics studies of A-T-rich regions,telomeres,and 5S and 45S rDNA sites on the chromosomes of Reichardia tingetana Roth (2n =16; diploid) were done using 4',6-diamidino-2-phenylindole (DAPI) and fluorescence in situ hybridization (FISH).The species were collected from three geographically isolated populations at Borg El Arab (salt marsh habitat),and Rashed and Shosha (sandy clay habitats) in Egypt.The three populations showed the chromosome number of all plants are diploid except for two tetraploid samples from Shosha.Plants from both Rashed and Shosha showed similarity in the distribution of six DAPI bands on six chromosomes,whereas those of Borg El Arab showed a distribution of 16 bands on 14 chromosomes.The FISH signals of the telomeres,and 5S and 45S rDNA,were at the telomeres of all chromosomes,two interstitial,and four terminal,respectively.The combination of DAPI and FISH showed colocalization of the DAPI bands with two 5S and two 45S rDNA loci.The increased number of DAPI bands in the cytotypes from the salt marsh habitat could indicate natural genetic adaptation through increasing the heterochromatin of A-T-rich regions.

  11. Chromosomal mapping of repetitive DNAs in Gobionellus oceanicus and G. stomatus (Gobiidae; Perciformes): A shared XX/XY system and an unusual distribution of 5S rDNA sites on the Y chromosome.

    Science.gov (United States)

    Lima-Filho, Paulo A; Amorim, Karlla D J; Cioffi, Marcelo B; Bertollo, Luiz A C; Molina, Wagner F

    2014-01-01

    With nearly 2,000 species, Gobiidae is the most specious family of the vertebrates. This high level of speciation is accompanied by conspicuous karyotypic modifications, where the role of repetitive sequences remains largely unknown. This study analyzed the karyotype of 2 species of the genus Gobionellus and mapped 18S and 5S ribosomal RNA genes and (CA)15 microsatellite sequences onto their chromosomes. G. oceanicus (2n = 56; ♂ 12 metacentrics (m) + 4 submetacentrics (sm) + 1 subtelocentric (st) + 39 acrocentrics (a); ♀ 12m + 4sm + 2st + 38a) and G. stomatus (2n = 56; ♂ 20m + 14sm + 1st + 21a; ♀ 20m + 14sm + 2st + 20a) possess the highest diploid chromosome number among the Gobiidae and have different karyotypes. Both species share an XX/XY sex chromosome system with a large subtelocentric X and a small acrocentric Y chromosome which is rich in (CA)15 sequences and bears 5S rRNA sites. Although coding and noncoding repetitive DNA sequences may be involved in the genesis or differentiation of the sex chromosomes, the exclusive presence of 5S rDNA sites on the Y, but not on the X chromosome of both species, represents a novelty in fishes. In summary, the karyotypic differences, as well as new data on the sex chromosome systems in these 2 Gobiidae species, confirm the high chromosomal dynamism observed in this family.

  12. Cotranscription and processing of 23S, 4.5S and 5S rRNA in chloroplasts from Zea mays.

    OpenAIRE

    Strittmatter, G; Kössel, H.

    1984-01-01

    The termini of rRNA processing intermediates and of mature rRNA species encoded by the 3' terminal region of 23S rDNA, by 4.5S rDNA, by the 5' terminal region of 5S rDNA and by the 23S/4.5S/5S intergenic regions from Zea mays chloroplast DNA were determined by using total RNA isolated from maize chloroplasts and 32P-labelled rDNA restriction fragments of these regions for nuclease S1 and primer extension mapping. Several processing sites detectable by both 3' and 5' terminally labelled probes...

  13. rDNA Loci Evolution in the Genus Glechoma (Lamiaceae)

    Science.gov (United States)

    Jang, Tae-Soo; McCann, Jamie; Parker, John S.; Takayama, Koji; Hong, Suk-Pyo; Schneeweiss, Gerald M.

    2016-01-01

    Glechoma L. (Lamiaceae) is distributed in eastern Asia and Europe. Understanding chromosome evolution in Glechoma has been strongly hampered by its small chromosomes, constant karyotype and polyploidy. Here phylogenetic patterns and chromosomal variation in Glechoma species are considered, using genome sizes, chromosome mapping of 5S and 35S rDNAs by fluorescence in situ hybridisation (FISH), and phylogenetic analyses of internal transcribed spacers (nrITS) of 35S rDNA and 5S rDNA NTS sequences. Species and populations of Glechoma are tetraploid (2n = 36) with base chromosome number of x = 9. Four chromosomes carry pericentric 5S rDNA sites in their short arms in all the species. Two to four of these chromosomes also carry 35S rDNA in subterminal regions of the same arms. Two to four other chromosomes have 35S rDNA sites, all located subterminally within short arms; one individual possessed additional weak pericentric 35S rDNA signals on three other chromosomes. Five types of rDNA locus distribution have been defined on the basis of 35S rDNA variation, but none is species-specific, and most species have more than one type. Glechoma hederacea has four types. Genome size in Glechoma ranges from 0.80 to 0.94 pg (1C), with low levels of intrapopulational variation in all species. Phylogenetic analyses of ITS and NTS sequences distinguish three main clades coinciding with geographical distribution: European (G. hederacea–G. hirsuta), Chinese and Korean (G. longituba), and Japanese (G. grandis). The paper presents the first comparative cytogenetic analyses of Glechoma species including karyotype structure, rDNA location and number, and genome size interpreted in a phylogenetic context. The observed variation suggests that the genus is still in genomic flux. Genome size, but not rDNA loci number and distribution, provides a character for species delimitation which allows better inferences of interspecific relationships to be made, in the absence of well

  14. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    Science.gov (United States)

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes.

  15. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Science.gov (United States)

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  16. Novel variants of the 5S rRNA genes in Eruca sativa.

    Science.gov (United States)

    Singh, K; Bhatia, S; Lakshmikumaran, M

    1994-02-01

    The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. 5S ribosomal RNA genes in six species of Mediterranean grey mullets: genomic organization and phylogenetic inference.

    Science.gov (United States)

    Gornung, Ekaterina; Colangelo, Paolo; Annesi, Flavia

    2007-09-01

    This paper describes a study of the 5S ribosomal RNA genes (5S rDNA) in a group of 6 species belonging to 4 genera of Mugilidae. In these 6 species, the relatively short 5S rDNA repeat units, generated by PCR and ranging in size from 219 to 257 bp, show a high level of intragenomic homogeneity of both coding and spacer regions (NTS-I). Phylogenetic reconstructions based on this data set highlight the greater phylogenetic and genetic diversity of Mugil cephalus and Oedalechilus labeo compared with the genera Liza and Chelon. Comparative sequence analysis revealed significant conservation of the short 5S rDNA repeat units across Chelon and Liza. Moreover, a second size class of 5S rDNA repeat units, ranging from roughly 800 to 1100 bp, was produced in the Liza and Chelon samples. Only short 5S rDNA repeat units were found in M. cephalus and O. labeo. The sequences of the long 5S rDNA repeat units, obtained in Chelon labrosus and Liza ramada, differ owing to the presence of 2 large insertion/deletions (indels) in the spacers (NTS-II) and show considerable sequence identity with NTS-I spacers. Interspecific sequence variation of NTS-II spacers, excluding the indels, is low. Southern-blot hybridization patterns suggest an intermixed arrangement of short and long repeat units within a single chromosome locus.

  18. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells.

    Science.gov (United States)

    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena

    2012-06-01

    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment.

  19. Optical Aberrations and Wavefront

    Directory of Open Access Journals (Sweden)

    Nihat Polat

    2014-08-01

    Full Text Available The deviation of light to create normal retinal image in the optical system is called aberration. Aberrations are divided two subgroup: low-order aberrations (defocus: spherical and cylindrical refractive errors and high-order aberrations (coma, spherical, trefoil, tetrafoil, quadrifoil, pentafoil, secondary astigmatism. Aberrations increase with aging. Spherical aberrations are compensated by positive corneal and negative lenticular spherical aberrations in youth. Total aberrations are elevated by positive corneal and positive lenticular spherical aberrations in elderly. In this study, we aimed to analyze the basic terms regarding optic aberrations which have gained significance recently. (Turk J Ophthalmol 2014; 44: 306-11

  20. 5S IN QUALITY MANAGEMENT

    Directory of Open Access Journals (Sweden)

    BOCA GRATIELA DANA

    2015-07-01

    Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.

  1. Multicolor FISH analysis of rDNA and telomere on spinach

    Institute of Scientific and Technical Information of China (English)

    Tianying LAN; Bo LIU; Fengping DONG; Ruiyang CHEN; Xiulan LI; Chengbin CHEN

    2008-01-01

    In this study,multicolor fluorescence in situ hybridization (FISH) analysis on metaphase chromosomes of spinach with biotin-labeled 25S rDNA,DIG-labeled telomere sequences and biotin-labeled and DIG-labeled 5S rDNA was performed.There were six 25S rDNA loci located on the satellites of the third,the fifth and the sixth chromosomes,and four 5S rDNA loci located on the long arms of the third and the fifth chromosomes.The telomere loci were located on the end of the sixth chromosome and also on both the end and centromeric regions of other chromosomes.This study is an important complement to both traditional karyotype analysis and FISH karyotype analysis in spinach.

  2. Karyotyping of Brassica oleracea L.based on rDNA and Cot-1 DNA fluorescence in situ hybridization

    Institute of Scientific and Technical Information of China (English)

    WANG Taixia; WU Chunhong; HUANG Jinyong; WEI Wenhui

    2007-01-01

    To explore an effective and reliable karyotyping method in Brassica crop plants,Cot-1 DNA was isolated from Brassica oleracea genome,labeled as probe with Biotin-Nick Translation Mix kit,in situ hybridized to mitotic spreads,and where specific fluorescent bands showed on each chromosome pair.25S and 5S rDNA were labeled as probes with DIG-Nick Translation Mix kit and Biotin-Nick Translation Mix kit,respectively,in situ hybridized to mitotic preparations,where 25S rDNA could be detected on two chromosome pairs and 5S rDNA on only one.Cot-1 DNA contains rDNA and chromosome sites identity between Cot-1 DNA and 25S rDNA was determined by dual-colour fluorescence in situ hybridization.All these showed that the karyotyping technique based on a combination of rDNA and Cot-1 DNA chromosome landmarks is superior to all but one.A more exact karyotype ofB.oleracea has been analyzed based on a combination of rDNA sites,Cot-1 DNA fluorescent bands,chromosome lengths and arm ratios.

  3. Chicago aberration correction work.

    Science.gov (United States)

    Beck, V D

    2012-12-01

    The author describes from his personal involvement the many improvements to electron microscopy Albert Crewe and his group brought by minimizing the effects of aberrations. The Butler gun was developed to minimize aperture aberrations in a field emission electron gun. In the 1960s, Crewe anticipated using a spherical aberration corrector based on Scherzer's design. Since the tolerances could not be met mechanically, a method of moving the center of the octopoles electrically was developed by adding lower order multipole fields. Because the corrector was located about 15 cm ahead of the objective lens, combination aberrations would arise with the objective lens. This fifth order aberration would then limit the aperture of the microscope. The transformation of the off axis aberration coefficients of a round lens was developed and a means to cancel anisotropic coma was developed. A new method of generating negative spherical aberration was invented using the combination aberrations of hexapoles. Extensions of this technique to higher order aberrations were developed. An electrostatic electron mirror was invented, which allows the cancellation of primary spherical aberration and first order chromatic aberration. A reduction of chromatic aberration by two orders of magnitude was demonstrated using such a system.

  4. Chicago aberration correction work

    Energy Technology Data Exchange (ETDEWEB)

    Beck, V.D., E-mail: vnlbeck@earthlink.net [1 Hobby Drive, Ridgefield, CT 06877-01922 (United States)

    2012-12-15

    The author describes from his personal involvement the many improvements to electron microscopy Albert Crewe and his group brought by minimizing the effects of aberrations. The Butler gun was developed to minimize aperture aberrations in a field emission electron gun. In the 1960s, Crewe anticipated using a spherical aberration corrector based on Scherzer's design. Since the tolerances could not be met mechanically, a method of moving the center of the octopoles electrically was developed by adding lower order multipole fields. Because the corrector was located about 15 cm ahead of the objective lens, combination aberrations would arise with the objective lens. This fifth order aberration would then limit the aperture of the microscope. The transformation of the off axis aberration coefficients of a round lens was developed and a means to cancel anisotropic coma was developed. A new method of generating negative spherical aberration was invented using the combination aberrations of hexapoles. Extensions of this technique to higher order aberrations were developed. An electrostatic electron mirror was invented, which allows the cancellation of primary spherical aberration and first order chromatic aberration. A reduction of chromatic aberration by two orders of magnitude was demonstrated using such a system. -- Highlights: Black-Right-Pointing-Pointer Crewe and his group made significant advances in aberration correction and reduction. Black-Right-Pointing-Pointer A deeper understanding of the quadrupole octopole corrector was developed. Black-Right-Pointing-Pointer A scheme to correct spherical aberration using hexapoles was developed. Black-Right-Pointing-Pointer Chromatic aberration was corrected using a uniform field mirror.

  5. Molecular cytogenetic analysis of the Appenine endemic cyprinid fish Squalius lucumonis and three other Italian leuciscines using chromosome banding and FISH with rDNA probes.

    Science.gov (United States)

    Rossi, Anna Rita; Milana, Valentina; Hett, Anne Kathrin; Tancioni, Lorenzo

    2012-12-01

    Karyotype and other chromosomal characteristics of the Appenine endemic cyprinid fish, Toscana stream chub Squalius lucumonis, were analysed using conventional banding and FISH with 45S and 5S rDNA probes. The diploid chromosome number (2n = 50) and karyotype characteristics including pericentromeric heterochromatic blocks and GC-rich CMA(3)-positive sites corresponding to both positive Ag-NORs and 45S rDNA loci on the short arms of a single medium-sized submetacentric chromosome pair were consistent with those found in most European leuciscine cyprinids. On other hand, 5S rDNA FISH in the Toscana stream chub and three other Italian leuciscines, S. squalus, Rutilus rubilio and Telestes muticellus, revealed a species-specific hybridization pattern, i.e. signals on four (S. lucumonis), three (S. squalus and R. rubilio) and two (T. muticellus) chromosome pairs. Whereas all the species shared the 5S rDNA loci on the largest subtelocentric chromosome pair, a "leuciscine" cytotaxonomic marker, S. lucumonis showed both classes of rDNA loci tandem aligned on the short arms of chromosome pair No. 12. The present findings suggest that the observed high variability of 5S rDNA loci provides a powerful tool for investigation of karyotype differentiation in karyologically conservative leuciscine fishes.

  6. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).

    Science.gov (United States)

    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S

    2013-06-01

    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  7. Aberration Corrected Emittance Exchange

    CERN Document Server

    Nanni, Emilio A

    2015-01-01

    Full exploitation of emittance exchange (EEX) requires aberration-free performance of a complex imaging system including active radio-frequency (RF) elements which can add temporal distortions. We investigate the performance of an EEX line where the exchange occurs between two dimensions with normalized emittances which differ by orders of magnitude. The transverse emittance is exchanged into the longitudinal dimension using a double dog-leg emittance exchange setup with a 5 cell RF deflector cavity. Aberration correction is performed on the four most dominant aberrations. These include temporal aberrations that are corrected with higher order magnetic optical elements located where longitudinal and transverse emittance are coupled. We demonstrate aberration-free performance of emittances differing by 4 orders of magnitude, i.e. an initial transverse emittance of $\\epsilon_x=1$ pm-rad is exchanged with a longitudinal emittance of $\\epsilon_z=10$ nm-rad.

  8. Sequence Analysis of the 5S rRNA Gene Repeat Units in 5 Durum Wheat Species from Xinjiang of China%新疆硬粒小麦5个品种5S rRNA基因重复单元间序列分析

    Institute of Scientific and Technical Information of China (English)

    米日古丽·马木提; 布热比艳木·吾布力卡斯木; 吾买尔江·库尔班; 帕夏伊木·艾麦提; 赵奇

    2015-01-01

    本研究参照GenBank禾本科以及前期新疆7个小麦种5S rDNA NTS序列,通过PCR技术扩增获得新疆5个硬粒小麦品种5S rDNA NTS序列,并通过与5S rRNA序列比对,得到5S rDNA NTS序列结构和边界范围。结果显示:5个硬粒小麦品种均存在两种类型5S rDNA NTS序列且相似程度不同,长NTS序列保守性较高,短NTS片段相对较低;短NTS序列存在两处序列缺失现象,两种类型NTS序列存在不同位置和程度的变异位点和变异频率。利用MEG4.0软件,采用邻接法构建了分子进化树并计算获得了品种间遗传距离。对来自不同品种克隆单元基的序列进行比对,得知对于几个组直向是存在的。直系群体的5S rDNA序列有益于硬粒小麦进一步的系统发育分析。%According to GenBank in barley grasses 5S rDNA sequences and previously published 5S rDNA NTS sequences of seven Xinjiang wheat species, 5S rDNA sequences of five durum wheat varieties from Xinjiang were obtained by Polymerase Chain Reaction, the 5S rDNA structure and NTS boundaries were obtained by further alignments with barley grasses 5S rRNA sequence. Sequence analysis revealed that two types of 5S rDNA NTS sequences were presented in five wheat varieties and the nontranscribed spacer of long repeat classes was less variable than that of short repeat classes. Deletion was presented in two parts of 5S rDNA nontranscribed spacer (NTS) length of short repeat class. The different degrees of variable sites and mutation frequency exists in two types of 5S rDNA NTS sequences. Molecular phylogenetic tree was constructed and genetic distance between varieties was calculated by using the MEGA4.0 software and the neighbor-joining method. Sequence comparisons of individual clones (units) isolated from different species have allowed us to confirm that orthology exists for several groups. This demonstration of orthologous groups suggests that the 5S rDNA sequence may be useful for

  9. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Directory of Open Access Journals (Sweden)

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  10. [Characterization of 5S rRNA gene sequence and secondary structure in gymnosperms].

    Science.gov (United States)

    Liu, Zhan-Lin; Zhang, Da-Ming; Wang, Xiao-Ru

    2003-01-01

    In higher plants the primary and the secondary structures of 5S ribosomal RNA gene are considered highly conservative. Little is known about the 5S rRNA gene structure, organization and variation in gyimnosperms. In this study we analyzed sequence and structure variation of 5S rRNA gene in Pinus through cloning and sequencing multiple copies of 5S rDNA repeats from individual trees of five pines, P. bungeana, P. tabulaeformis, P. yunnanensis, P. massoniana and P. densata. Pinus bungeana is from the subgenus Strobus while the other four are from the subgenus Pinus (diploxylon pines). Our results revealed variations in both primary and secondary structure among copies of 5S rDNA within individual genomes and between species. 5S rRNA gene in Pinus is 120 bp long in most of the 122 clones we sequenced except for one or two deletions in three clones. Among these clones 50 unique sequences were identified and they were shared by different pine species. Our sequences were compared to 13 sequences each representing a different gymnosperm species, and to six sequences representing both angiosperm monocots and dicots. Average sequence similarity was 97.1% among Pinus species and 94.3% between Pinus and other gymnosperms. Between gymnosperms and angiosperms the sequence similarity decreased to 88.1%. Similar to other molecular data, significant sequence divergence was found between the two Pinus subgenera. The 5S gene tree (neighbor-joining tree) grouped the four diploxylon pines together and separated them distinctly from P. bungeana. Comparison of sequence divergence within individuals and between species suggested that concerted evolution has been very weak especially after the divergence of the four diploxylon pines. The phylogenetic information contained in the 5S rRNA gene is limited due to its shorter length and the difficulties in identifying orthologous and paralogous copies of rDNA multigene family further complicate its phylogenetic application. Pinus densata is a

  11. 5S tuotannonkehityksen työkaluna

    OpenAIRE

    Hautala, Teemu

    2015-01-01

    Tässä opinnäytetyössä on tutkittu lean-filosofiaan kuuluvan 5S-ohjelman käyttöönottoa mäntätoimisia painevaraajia valmistavassa yrityksessä. Konkreettisia työkaluja kehittämisen tukena käyttävä lean-filosofia on kerännyt menestystä yrityksissä ympäri maailmaa. 5S-ohjelman tarkoitus kehittää työpaikkaa viiden vaiheen avulla visuaalisemmaksi, tehokkaammaksi, turvallisemmaksi ja viihtyisämmäksi. Nimi 5S tulee japanin kielen sanoista seiri (erottele), seiton (järjestele), seiso (puhdista), seiket...

  12. Divergence between C. melo and African Cucumis Species Identified by Chromosome Painting and rDNA Distribution Pattern.

    Science.gov (United States)

    Li, Kunpeng; Wang, Huaisong; Wang, Jiming; Sun, Jianying; Li, Zongyun; Han, Yonghua

    2016-01-01

    The 5S and 45S rDNA sites are useful chromosome landmarks and can provide valuable information about karyotype evolution and species interrelationships. In this study, we employed fluorescence in situ hybridization (FISH) to determine the number and chromosomal location of 5S and 45S rDNA loci in 8 diploid Cucumis species. Two oligonucleotide painting probes specific for the rDNA-bearing chromosomes in C. melo were hybridized to other Cucumis species in order to investigate the homeologies among the rDNA-carrying chromosomes in Cucumis species. The analyzed diploid species showed 3 types of rDNA distribution patterns, which provided clear cytogenetic evidence on the divergence between C. melo and wild diploid African Cucumis species. The present results not only show species interrelationships in the genus Cucumis, but the rDNA FISH patterns can also be used as cytological markers for the discrimination of closely related species. The data will be helpful for breeders to choose the most suitable species from various wild species for improvement of cultivated melon.

  13. Molecular Cytogenetics in Digenean Parasites: Linked and Unlinked Major and 5S rDNAs, B Chromosomes and Karyotype Diversification.

    Science.gov (United States)

    García-Souto, Daniel; Pasantes, Juan J

    2015-01-01

    Digenetic trematodes are the largest group of internal metazoan parasites, but their chromosomes are poorly studied. Although chromosome numbers and/or karyotypes are known for about 300 of the 18,000 described species, molecular cytogenetic knowledge is mostly limited to the mapping of telomeric sequences and/or of major rDNA clusters in 9 species. In this work we mapped major and 5S rDNA clusters and telomeric sequences in chromosomes of Bucephalus minimus, B. australis, Prosorhynchoides carvajali (Bucephaloidea), Monascus filiformis (Gymnophalloidea), Parorchis acanthus (Echinostomatoidea), Cryptocotyle lingua (Opisthorchioidea), Cercaria longicaudata, Monorchis parvus (Monorchioidea), Diphterostomum brusinae, and Bacciger bacciger (Microphalloidea). Whilst single major and minor rDNA clusters were mapped to different chromosome pairs in B. minimus and P. acanthus, overlapping signals were detected on a single chromosome pair in the remaining taxa. FISH experiments using major rDNA and telomeric probes clearly demonstrated the presence of highly stretched NORs in most of the digenean taxa analyzed. B chromosomes were detected in the B. bacciger samples hosted by Ruditapes decussatus. Although the cercariae specimens obtained from Donax trunculus, Tellina tenuis, and R. decussatus were in agreement with B. bacciger, their karyotypes showed striking morphological differences in agreement with the proposed assignation of these cercariae to different species of the genus Bacciger. Results are discussed in comparison with previous data on digenean chromosomes.

  14. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

    Science.gov (United States)

    Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

    2017-01-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

  15. Two 5S genes are expressed in chicken somatic cells.

    OpenAIRE

    Lazar, E; Haendler, B.; Jacob, M

    1983-01-01

    Two 5S RNA species were detected in chicken cells. 5S I RNA has the nucleotide sequence of chicken 5S RNA previously published by Brownlee et al. (1) and 5S II RNA differs from it by 10 mutations. The secondary structure of both species is compatible with that proposed for other eukaryotic 5S RNAs. 5S II RNA represents 50-60% of 5S I RNA. Both species were found in total chicken liver and brain and were present in polysomes in the same relative proportions. Only one 5S RNA species could be de...

  16. Evolutionary dynamics of rDNA genes on chromosomes of the Eucinostomus fishes: cytotaxonomic and karyoevolutive implications.

    Science.gov (United States)

    Calado, L L; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Jacobina, U P; Molina, W F

    2014-11-27

    Several chromosomal features of Gerreidae fish have been found to be conserved. In this group, it is unclear whether the high degree of chromosomal stasis is maintained when analyzing more dynamic regions of chromosomes, such as rDNA sites that generally show a higher level of variability. Thus, cytogenetic analyses were performed on 3 Atlantic species of the genus Eucinostomus using conventional banding (C-banding, Ag-NOR), AT- and GC-specific fluorochromes, and fluorescence in situ hybridization mapping of telomeric sequences and 5S and 18S rDNA sites. The results showed that although the karyotypical macrostructure of these species is similar (2n = 48 chromosomes, simple Ag-NORs seemingly located on homeologous chromosomes and centromeric heterochromatin pattern), there are differences in the positions of rDNA subunits 5S and 18S. Thus, the ribosomal sites have demonstrated to be effective cytotaxonomic markers in Eucinostomus, presenting a different evolutionary dynamics in relation to other chromosomal regions and allowing access to important evolutionary changes in this group.

  17. Cerastoderma glaucum 5S ribosomal DNA: characterization of the repeat unit, divergence with respect to Cerastoderma edule, and PCR-RFLPs for the identification of both cockles.

    Science.gov (United States)

    Freire, Ruth; Insua, Ana; Méndez, Josefina

    2005-06-01

    The 5S rDNA repeat unit of the cockle Cerastoderma glaucum from the Mediterranean and Baltic coasts was PCR amplified and sequenced. The length of the units was 539-568 bp, of which 120 bp were assigned to the 5S rRNA gene and 419-448 bp to the spacer region, and the G/C content was 46%-49%, 54%, and 44%-47%, respectively. Two types of units (A and B), differing in the spacer, were distinguished based on the percentage of differences and clustering in phylogenetic trees. A PCR assay with specific primers for each unit type indicated that the occurrence of both units is not restricted to the sequenced individuals. The 5S rDNA units of C. glaucum were compared with new and previously reported sequences of Cerastoderma edule. The degree of variation observed in C. edule was lower than that in C. glaucum and evidence for the existence of units A and B in C. edule was not found. The two cockles have the same coding region but displayed numerous fixed differences in the spacer region and group separately in the phylogenetic trees. Digestion of the 5S rDNA PCR product with the restriction enzymes HaeIII and EcoRV revealed two RFLPs useful for cockle identification.

  18. The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

    OpenAIRE

    1986-01-01

    We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

  19. Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).

    Science.gov (United States)

    Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata

    2015-08-01

    Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

  20. Characterization of ribosomal DNA (rDNA in Drosophila arizonae

    Directory of Open Access Journals (Sweden)

    Francisco Javier Tovar

    2000-06-01

    Full Text Available Ribosomal DNA (rDNA is a multigenic family composed of one or more clusters of repeating units (RU. Each unit consists of highly conserved sequences codifying 18S, 5.8S and 28S rRNA genes intercalated with poorly conserved regulatory sequences between species. In this work, we analyzed the rDNA of Drosophila arizonae, a member of the mulleri complex (Repleta group. Using genomic restriction patterns, cloning and mapping of some representative rDNA fragments, we were able to construct a representative restriction map. RU in this species are 13.5-14 kb long, restriction sites are completely conserved compared with other drosophilids and the rDNA has an R1 retrotransposable element in some RU. We were unable to detect R2 elements in this species.O DNA ribossômico (rDNA é uma família multigênica composta de um ou mais aglomerados de unidades de repetição (RU. Cada unidade consiste de seqüências altamente conservadas que codificam os rRNAs 18S, 5.8S e 28S, intercaladas com seqüências regulatórias pouco conservadas entre as espécies. Neste trabalho analisamos o rDNA de Drosophila arizonae, um membro do complexo mulleri (grupo Repleta. Usando padrões de restrição genômicos, clonagem e mapeamento de alguns fragmentos de rDNA representativos, estabelecemos um mapa de restrição do rDNA representativo desta espécie. Neste drosofilídeo, a RU tem um tamanho médio de 13.5-14 kb e os sítios de restrição estão completamente conservados com relação a outras drosófilas. Além disto, este rDNA possui um elemento transponível tipo R1 presente em algumas unidades. Neste trabalho não tivemos evidências da presença de elementos R2 no rDNA desta espécie.

  1. Aberration Correction in Electron Microscopy

    CERN Document Server

    Rose, Harald H

    2005-01-01

    The resolution of conventional electron microscopes is limited by spherical and chromatic aberrations. Both defects are unavoidable in the case of static rotationally symmetric electromagnetic fields (Scherzer theorem). Multipole correctors and electron mirrros have been designed and built, which compensate for these aberrations. The principles of correction will be demonstrated for the tetrode mirror, the quadrupole-octopole corrector and the hexapole corrector. Electron mirrors require a magnetic beam separator free of second-order aberrations. The multipole correctors are highly symmetric telescopic systems compensating for the defects of the objective lens. The hexapole corrector has the most simple structure yet eliminates only the spherical aberration, whereas the mirror and the quadrupole-octopole corrector are able to correct for both aberrations. Chromatic correction is achieved in the latter corrector by cossed electric and magnetic quadrupoles acting as first-order Wien filters. Micrographs obtaine...

  2. Camera processing with chromatic aberration.

    Science.gov (United States)

    Korneliussen, Jan Tore; Hirakawa, Keigo

    2014-10-01

    Since the refractive index of materials commonly used for lens depends on the wavelengths of light, practical camera optics fail to converge light to a single point on an image plane. Known as chromatic aberration, this phenomenon distorts image details by introducing magnification error, defocus blur, and color fringes. Though achromatic and apochromatic lens designs reduce chromatic aberration to a degree, they are complex and expensive and they do not offer a perfect correction. In this paper, we propose a new postcapture processing scheme designed to overcome these problems computationally. Specifically, the proposed solution is comprised of chromatic aberration-tolerant demosaicking algorithm and post-demosaicking chromatic aberration correction. Experiments with simulated and real sensor data verify that the chromatic aberration is effectively corrected.

  3. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    Science.gov (United States)

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

    2012-01-01

    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  4. Phase aberration effects in elastography.

    Science.gov (United States)

    Varghese, T; Bilgen, M; Ophir, J

    2001-06-01

    In sonography, phase aberration plays a role in the corruption of sonograms. Phase aberration does not have a significant impact on elastography, if statistically similar phase errors are present in both the pre- and postcompression signals. However, if the phase errors are present in only one of the pre- or postcompression signal pairs, the precision of the strain estimation process will be reduced. In some cases, increased phase errors may occur only in the postcompression signal due to changes in the tissue structure with the applied compression. Phase-aberration effects increase with applied strain and may be viewed as an image quality derating factor, much like frequency-dependent attenuation or undesired lateral tissue motion. In this paper, we present a theoretical and simulation study of the effects of phase aberration on the elastographic strain-estimation process, using the strain filter approach.

  5. Regulation of rDNA stability by sumoylation

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2009-01-01

    , the eukaryotic cell has evolved mechanisms to favor equal sister chromatid exchange (SCE) and suppress unequal SCE, single-strand annealing and break-induced replication. In the budding yeast Saccharomyces cerevisiae, the tight regulation of homologous recombination at the rDNA locus is dependent on the Smc5-Smc...

  6. PROBLEMS OF IMPLEMENTATION 5S PRACTICES IN AN INDUSTRIAL COMPANY

    Directory of Open Access Journals (Sweden)

    Beata GALA

    2013-10-01

    Full Text Available 5S is a one of the tools of Lean Management enabling to organize workplace in an effective way. It could be implemented in all the spheres of the company. The article provides the theoretic description of Lean Management and 5S and also shows a case study based on gained experience. The author also describe the problems occured during the implementation of the 5S.

  7. Elimination of 5S DNA unit classes in newly formed allopolyploids of the genera Aegilops and Triticum.

    Science.gov (United States)

    Baum, B R; Feldman, M

    2010-06-01

    Two classes of 5S DNA units, namely the short (containing units of 410 bp) and the long (containing units of 500 bp), are recognized in species of the wheat (the genera Aegilops and Triticum) group. While every diploid species of this group contains 2 unit classes, the short and the long, every allopolyploid species contains a smaller number of unit classes than the sum of the unit classes of its parental species. The aim of this study was to determine whether the reduction in these unit classes is due to the process of allopolyploidization, that is, interspecific or intergeneric hybridization followed by chromosome doubling, and whether it occurs during or soon after the formation of the allopolyploids. To study this, the number and types of unit classes were determined in several newly formed allotetraploids, allohexaploids, and an allooctoploid of Aegilops and Triticum. It was found that elimination of unit classes of 5S DNA occurred soon (in the first 3 generations) after the formation of the allopolyploids. This elimination was reproducible, that is, the same unit classes were eliminated in natural and synthetic allopolyploids having the same genomic combinations. No further elimination occurred in the unit classes of the 5S DNA during the life of the allopolyploid. The genetic and evolutionary significance of this elimination as well as the difference in response to allopolyploidization of 5S DNA and rDNA are discussed.

  8. Cytogenetic characterization by in situ hybridization techniques and molecular analysis of 5S rRNA genes of the European hazelnut (Corylus avellana).

    Science.gov (United States)

    Falistocco, E; Marconi, G

    2013-03-01

    The European hazelnut (Corylus avellana L.) is widespread in Europe, where it has been cultivated for centuries. Despite progress in genetics, most of the cytogenetic aspects of this species have been overlooked. The aim of this study was to fill in this gap and obtain basic information on the chromosome structure of this species. Karyomorphological analysis confirmed the chromosome number 2n = 22 and showed that, despite their apparent uniformity, the chromosomes could be separated into three groups of different size: large (L), medium (M), and small (S). As a first step towards the physical mapping of the hazelnut chromosomes, we applied FISH to localize the position of rRNA genes (rDNA). The sites of 45S and 5S rDNA enabled us to identify two chromosome pairs belonging, respectively, to the L and S groups. The self-GISH procedure revealed that repetitive DNA is concentrated in the pericentromeric regions of the chromosomes, as with other species with rather small genomes. The analysis of 5S rDNA repeats offered additional information on the hazelnut genome by obtaining the whole sequence of the transcribed region so far unpublished. The overall results constitute a substantial advance in hazelnut cytogenetics. Further investigation of other species of Corylus could be an effective approach to understanding the phylogenesis of the genus and resolving taxonomic problems.

  9. Proteolytic footprinting of transcription factor TFIIIA reveals different tightly binding sites for 5S RNA and 5S DNA.

    OpenAIRE

    Bogenhagen, D F

    1993-01-01

    Transcription factor IIIA (TFIIIA) employs an array of nine N-terminal zinc fingers to bind specifically to both 5S RNA and 5S DNA. The binding of TFIIIA to 5S RNA and 5S DNA was studied by using a protease footprinting technique. Brief treatment of free or bound TFIIA with trypsin or chymotrypsin generated fragments which were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Fragments retaining the N terminus of TFIIA were identified by immunoblotting with an antibody ...

  10. Organization and Variation Analysis of 5S rDNA in Different Ploidy-level Hybrids of Red Crucian Carp × Topmouth Culter

    OpenAIRE

    Weiguo He; Qinbo Qin; Shaojun Liu; Tangluo Li; Jing Wang; Jun Xiao; Lihua Xie; Chun Zhang; Yun Liu

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets...

  11. Randomly detected genetically modified (GM maize (Zea mays L. near a transport route revealed a fragile 45S rDNA phenotype.

    Directory of Open Access Journals (Sweden)

    Nomar Espinosa Waminal

    Full Text Available Monitoring of genetically modified (GM crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a "beads-on-a-string" fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed.

  12. Karyotype analysis of Panax ginseng C.A.Meyer, 1843 (Araliaceae) based on rDNA loci and DAPI band distribution.

    Science.gov (United States)

    Waminal, Nomar Espinosa; Park, Hye Mi; Ryu, Kwang Bok; Kim, Joo Hyung; Yang, Tae-Jin; Kim, Hyun Hee

    2012-01-01

    Ginseng has long been considered a valuable plant owing to its medicinal properties; however, genomic information based on chromosome characterization and physical mapping of cytogenetic markers has been very limited. Dual-color FISH karyotype and DAPI banding analyses of Panax ginseng C. A. Meyer, 1843 were conducted using 5S and 45S rDNA probes. The somatic chromosome complement was 2n=48 with lengths from 3.3 μm to 6.3 μm. The karyotype was composed of 12 metacentric, 9 submetacentric, and 3 subtelocentric pairs. The 5S rDNA probe localized to the intercalary region of the short arm of pair 11, while the 45S rDNA was located at the secondary constriction of the subtelocentric satellited chromosome 14. DAPI bands were clearly observed for most chromosomes, with various signal intensities and chromosomal distributions that consequently improved chromosome identification. As a result, all 24 chromosomes could be distinguished and numbers were assigned to each chromosome for the first time. The results presented here will be useful for the on-going ginseng genome sequencing and further molecular-cytogenetic studies and breeding programs of ginseng.

  13. Karyotype analysis of Panax ginseng C.A.Meyer, 1843 (Araliaceae based on rDNA loci and DAPI band distribution

    Directory of Open Access Journals (Sweden)

    Nomar Waminal

    2012-12-01

    Full Text Available Ginseng has long been considered a valuable plant owing to its medicinal properties; however, genomic information based on chromosome characterization and physical mapping of cytogenetic markers has been very limited. Dual-color FISH karyotype and DAPI banding analyses of Panax ginseng C. A. Meyer, 1843 were conducted using 5S and 45S rDNA probes. The somatic chromosome complement was 2n=48 with lengths from 3.3 µm to 6.3 µm. The karyotype was composed of 12 metacentric, 9 submetacentric, and 3 subtelocentric pairs. The 5S rDNA probe localized to the intercalary region of the short arm of pair 11, while the 45S rDNA was located at the secondary constriction of the subtelocentric satellited chromosome 14. DAPI bands were clearly observed for most chromosomes, with various signal intensities and chromosomal distributions that consequently improved chromosome identification. As a result, all 24 chromosomes could be distinguished and numbers were assigned to each chromosome for the first time. The results presented here will be useful for the on-going ginseng genome sequencing and further molecular-cytogenetic studies and breeding programs of ginseng.

  14. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants.

    Science.gov (United States)

    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A

    2016-01-01

    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes.

  15. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants

    Science.gov (United States)

    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A.

    2016-01-01

    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes. PMID:27622766

  16. Using geometric algebra to study optical aberrations

    Energy Technology Data Exchange (ETDEWEB)

    Hanlon, J.; Ziock, H.

    1997-05-01

    This paper uses Geometric Algebra (GA) to study vector aberrations in optical systems with square and round pupils. GA is a new way to produce the classical optical aberration spot diagrams on the Gaussian image plane and surfaces near the Gaussian image plane. Spot diagrams of the third, fifth and seventh order aberrations for square and round pupils are developed to illustrate the theory.

  17. High-Resolution Infrared Spectroscopy of Carbon-Sulfur Chains: II. C_5S and SC_5S

    Science.gov (United States)

    Thorwirth, Sven; Salomon, Thomas; Dudek, John B.

    2016-06-01

    Unbiased high-resolution infrared survey scans of the ablation products from carbon-sulfur targets in the 2100 to 2150 cm-1 regime reveal two bands previously not observed in the gas phase. On the basis of comparison against laboratory matrix-isolation work and new high-level quantum-chemical calculations these bands are attributed to the linear C_5S and SC_5S clusters. While polar C_5S was studied earlier using Fourier-transform microwave techniques, the present work marks the first gas-phase spectroscopic detection of SC_5S. H. Wang, J. Szczepanski, P. Brucat, and M. Vala 2005, Int. J. Quant. Chem. 102, 795 Y. Kasai, K. Obi, Y. Ohshima, Y. Hirahara, Y. Endo, K. Kawaguchi, and A. Murakami 1993, ApJ 410, L45 V. D. Gordon, M. C. McCarthy, A. J. Apponi, and P. Thaddeus 2001, ApJS 134, 311

  18. Phase Aberrations in Diffraction Microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Marchesini, S; Chapman, H N; Barty, A; Howells, M R; Spence, J H; Cui, C; Weierstall, U; Minor, A M

    2005-09-29

    In coherent X-ray diffraction microscopy the diffraction pattern generated by a sample illuminated with coherent x-rays is recorded, and a computer algorithm recovers the unmeasured phases to synthesize an image. By avoiding the use of a lens the resolution is limited, in principle, only by the largest scattering angles recorded. However, the imaging task is shifted from the experiment to the computer, and the algorithm's ability to recover meaningful images in the presence of noise and limited prior knowledge may produce aberrations in the reconstructed image. We analyze the low order aberrations produced by our phase retrieval algorithms. We present two methods to improve the accuracy and stability of reconstructions.

  19. Review on Implementation of 5S in Various Organization

    Directory of Open Access Journals (Sweden)

    Vipulkumar C. Patel

    2014-04-01

    Full Text Available This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ efficiency, safety, security, quality and reduction of the industry pollution, proceedings according to decisions. The 5S methodology permits to analyze the processes running on the workplace and establishment of 5Ssustaining well organized, clean, high effective and high quality workplace. Research clearly show, that very essential is training of workers about the 5S rules. Essential thing is to divide activities on some main steps and to maintain the continuous improvement. This method can be used in all companies. Its result is the effective organization of the workplace.

  20. Correlations between corneal and total wavefront aberrations

    Science.gov (United States)

    Mrochen, Michael; Jankov, Mirko; Bueeler, Michael; Seiler, Theo

    2002-06-01

    Purpose: Corneal topography data expressed as corneal aberrations are frequently used to report corneal laser surgery results. However, the optical image quality at the retina depends on all optical elements of the eye such as the human lens. Thus, the aim of this study was to investigate the correlations between the corneal and total wavefront aberrations and to discuss the importance of corneal aberrations for representing corneal laser surgery results. Methods: Thirty three eyes of 22 myopic subjects were measured with a corneal topography system and a Tschernig-type wavefront analyzer after the pupils were dilated to at least 6 mm in diameter. All measurements were centered with respect to the line of sight. Corneal and total wavefront aberrations were calculated up to the 6th Zernike order in the same reference plane. Results: Statistically significant correlations (p corneal and total wavefront aberrations were found for the astigmatism (C3,C5) and all 3rd Zernike order coefficients such as coma (C7,C8). No statistically significant correlations were found for all 4th to 6th order Zernike coefficients except for the 5th order horizontal coma C18 (p equals 0.003). On average, all Zernike coefficients for the corneal aberrations were found to be larger compared to Zernike coefficients for the total wavefront aberrations. Conclusions: Corneal aberrations are only of limited use for representing the optical quality of the human eye after corneal laser surgery. This is due to the lack of correlation between corneal and total wavefront aberrations in most of the higher order aberrations. Besides this, the data present in this study yield towards an aberration balancing between corneal aberrations and the optical elements within the eye that reduces the aberration from the cornea by a certain degree. Consequently, ideal customized ablations have to take both, corneal and total wavefront aberrations, into consideration.

  1. rDNA mapping, heterochromatin characterization and AT/GC content of Agapanthus africanus (L. Hoffmanns (Agapanthaceae

    Directory of Open Access Journals (Sweden)

    ARYANE C. REIS

    2016-01-01

    Full Text Available ABSTRACT Agapanthus (Agapanthaceae has 10 species described. However, most taxonomists differ respect to this number because the great phenotypic plasticity of the species. The cytogenetic has been an important tool to aid the plant taxon identification, and to date, all taxa of Agapanthus L'Héritier studied cytologically, presented 2n = 30. Although the species possess large chromosomes, the group is karyologically little explored. This work aimed to increase the cytogenetic knowledge of Agapanthus africanus (L. Hoffmanns by utilization of chromosome banding techniques with DAPI / CMA3 and Fluorescent in situ Hybridization (FISH. In addition, flow cytometry was used for determination of DNA content and the percentage of AT / GC nitrogenous bases. Plants studied showed 2n = 30 chromosomes, ranging from 4.34 - 8.55 µm, with the karyotype formulae (KF = 10m + 5sm. Through FISH, one 45S rDNA signal was observed proximally to centromere of the chromosome 7, while for 5S rDNA sites we observed one signal proximally to centromere of chromosome 9. The 2C DNA content estimated for the species was 2C = 24.4 with 59% of AT and 41% of GC. Our data allowed important upgrade for biology and cytotaxonomy of Agapanthus africanus (L. Hoffmanns.

  2. 新疆春小麦4个地方品种5S rRNA基因变异分析%The 5S rRNA Gene Sequence Variation of Four Local Variety in Xinjiang Spring Wheat

    Institute of Scientific and Technical Information of China (English)

    布热比艳木·吾布力卡斯木; 吾甫尔·米吉提; 米日古丽·马木提; 维尼拉·吾甫尔; 祖路皮亚·载买尔

    2015-01-01

    5S rDNA (即5S rRNA基因)是由120 bp的编码区和非转录间隔区(nontranscribed spacers, NTS)组成的串联重复序列,及其NTS区碱基序列和长度在不同的种间甚至在种内都有差异,从而形成种内和种间特有的不同重复单元类型,不同单元类型各自代表不同的基因组型,因此5S rDNA多基因家族是研究物种基因组结构的有效工具。本研究以生长在不同地区的四个新疆春小麦地方品种(黑芒麦)作为供试材料,通过TA克隆法获得了128个5S rRNA基因重复单元,每个品种都有长度为326~422 bp之间的短5S rDNA片段和长度为481~491 bp之间的长5S rDNA片段。通过多次序列比对,Blast比对,聚类分析等方法将所有序列分为不同的5S rDNA单元类型。在ZM5291和ZM52300中发现了Short A2、Short D1、Short G1、Long A1、Long D1和Long{S1等6种不同的单元类型,而在ZM5306和ZM5343中只发现了Short A2、Short D1、Short G1和Long{S1等4种不同的单元类型,丢失了Long A1和Long D1。依据5S rDNA各单元类型在山羊草属和小麦属二倍体物种及其异源多倍体物种中的分布情况确定这四个春小麦地方品种的基因组型为AABBDD,确实是普通小麦。本研究首次在普通小麦中发现了六种不同的5S rDNA单元类型,6种单元类型在这4个地方品种中的分布情况表明ZM5291和ZM53005S rDNA序列的一致进化程度比ZM5306和ZM5343弱,推测生长在不同地区的黑芒麦多倍体物种形成的时代不一样,并ZM5291和ZM5300比ZM5306和ZM5343可能具有来自各基因组祖先的丰富基因资源。本研究结果为鉴别新疆春小麦种质资源的基因组类型以及亲本选配和育种工作提供新的依据。%5S rDNA is organized into arrays of tandem repeats consisting of a 120 bp coding region , and a non-transcribed spacer (NTS) which varies considerably in length and pattern, giving rise to different classes of repeat units in inter

  3. Analyzing Digital Library Initiatives: 5S Theory Perspective

    Science.gov (United States)

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  4. TEXTILE INDUSTRY APPLICATION OF THE 5S METHOD

    Directory of Open Access Journals (Sweden)

    Raluca BRAD

    2015-05-01

    Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.

  5. Patterns of rDNA and telomeric sequences diversification: contribution to repetitive DNA organization in Phyllostomidae bats.

    Science.gov (United States)

    Calixto, Merilane da Silva; de Andrade, Izaquiel Santos; Cabral-de-Mello, Diogo Cavalcanti; Santos, Neide; Martins, Cesar; Loreto, Vilma; de Souza, Maria José

    2014-02-01

    Chromosomal organization and the evolution of genome architecture can be investigated by physical mapping of the genes for 45S and 5S ribosomal DNAs (rDNAs) and by the analysis of telomeric sequences. We studied 12 species of bats belonging to four subfamilies of the family Phyllostomidae in order to correlate patterns of distribution of heterochromatin and the multigene families for rDNA. The number of clusters for 45S gene ranged from one to three pairs, with exclusively location in autosomes, except for Carollia perspicillata that had in X chromosome. The 5S gene all the species studied had only one site located on an autosomal pair. In no species the 45S and 5S genes collocated. The fluorescence in situ hybridization (FISH) probe for telomeric sequences revealed fluorescence on all telomeres in all species, except in Carollia perspicillata. Non-telomeric sites in the pericentromeric region of the chromosomes were observed in most species, ranged from one to 12 pairs. Most interstitial telomeric sequences were coincident with heterochromatic regions. The results obtained in the present work indicate that different evolutionary mechanisms are acting in Phyllostomidae genome architecture, as well as the occurrence of Robertsonian fusion during the chromosomal evolution of bats without a loss of telomeric sequences. These data contribute to understanding the organization of multigene families and telomeric sequences on bat genome as well as the chromosomal evolutionary history of Phyllostomidae bats.

  6. Chromosome aberrations induced by zebularine in triticale.

    Science.gov (United States)

    Ma, Xuhui; Wang, Qing; Wang, Yanzhi; Ma, Jieyun; Wu, Nan; Ni, Shuang; Luo, Tengxiao; Zhuang, Lifang; Chu, Chenggen; Cho, Seong-Woo; Tsujimoto, Hisashi; Qi, Zengjun

    2016-07-01

    Chromosome engineering is an important approach for generating wheat germplasm. Efficient development of chromosome aberrations will facilitate the introgression and application of alien genes in wheat. In this study, zebularine, a DNA methylation transferase inhibitor, was successfully used to induce chromosome aberrations in the octoploid triticale cultivar Jinghui#1. Dry seeds were soaked in zebularine solutions (250, 500, and 750 μmol/L) for 24 h, and the 500 μmol/L treatment was tested in three additional treatment times, i.e., 12, 36, and 48 h. All treatments induced aberrations involving wheat and rye chromosomes. Of the 920 cells observed in 67 M1 plants, 340 (37.0%) carried 817 aberrations with an average of 0.89 aberrations per cell (range: 0-12). The aberrations included probable deletions, telosomes and acentric fragments (49.0%), large segmental translocations (28.9%), small segmental translocations (17.1%), intercalary translocations (2.6%), long chromosomes that could carry more than one centromere (2.0%), and ring chromosomes (0.5%). Of 510 M2 plants analyzed, 110 (21.6%) were found to carry stable aberrations. Such aberrations included 79 with varied rye chromosome numbers, 7 with wheat and rye chromosome translocations, 15 with possible rye telosomes/deletions, and 9 with complex aberrations involving variation in rye chromosome number and wheat-rye translocations. These indicated that aberrations induced by zebularine can be steadily transmitted, suggesting that zebularine is a new efficient agent for chromosome manipulation.

  7. Atom lens without chromatic aberrations

    CERN Document Server

    Efremov, Maxim A; Schleich, Wolfgang P

    2012-01-01

    We propose a lens for atoms with reduced chromatic aberrations and calculate its focal length and spot size. In our scheme a two-level atom interacts with a near-resonant standing light wave formed by two running waves of slightly different wave vectors, and a far-detuned running wave propagating perpendicular to the standing wave. We show that within the Raman-Nath approximation and for an adiabatically slow atom-light interaction, the phase acquired by the atom is independent of the incident atomic velocity.

  8. Sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2, and 28S rDNA) of Demodex and phylogenetic analysis of Acari based on 18S and 28S rDNA.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping; Hu, Li; Xu, Yang; Wang, Zheng-Hang; Liu, Wen-Yan

    2012-11-01

    Due to the difficulty of DNA extraction for Demodex, few studies dealt with the identification and the phyletic evolution of Demodex at molecular level. In this study, we amplified, sequenced, and analyzed a complete (Demodex folliculorum) and an almost complete (D12 missing) (Demodex brevis) ribosomal DNA (rDNA) sequence and also analyzed the primary sequences of divergent domains in small-subunit ribosomal RNA (rRNA) of 51 species and in large-subunit rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea, and Ixodoidea). The results revealed that 18S rDNA sequence was relatively conserved in rDNA-coding regions and was not evolving as rapidly as 28S rDNA sequence. The evolutionary rates of transcribed spacer regions were much higher than those of the coding regions. The maximum parsimony trees of 18S and 28S rDNA appeared to be almost identical, consistent with their morphological classification. Based on the fact that the resolution capability of sequence length and the divergence of the 13 segments (D1-D6, D7a, D7b, and D8-D12) of 28S rDNA were stronger than that of the nine variable regions (V1-V9) of 18S rDNA, we were able to identify Demodex (Cheyletoidea) by the indels occurring in D2, D6, and D8.

  9. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    Science.gov (United States)

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  10. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    Science.gov (United States)

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-11-14

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera.

  11. Chromatic aberration measurement for transmission interferometric testing.

    Science.gov (United States)

    Seong, Kibyung; Greivenkamp, John E

    2008-12-10

    A method of chromatic aberration measurement is described based on the transmitted wavefront of an optical element obtained from a Mach-Zehnder interferometer. The chromatic aberration is derived from transmitted wavefronts measured at five different wavelengths. Reverse ray tracing is used to remove induced aberrations associated with the interferometer from the measurement. In the interferometer, the wavefront transmitted through the sample is tested against a plano reference, allowing for the absolute determination of the wavefront radius of curvature. The chromatic aberrations of a singlet and a doublet have been measured.

  12. Aberrations of Gradient-Index Lenses.

    Science.gov (United States)

    Matthews, A. L.

    Available from UMI in association with The British Library. In this thesis, the primary aberrations of lenses with a radial focussing gradient-of-index are analysed. Such a lens has a refractive index profile which decreases continuously and radially outward from the optical axis, so that the surfaces of constant refractive index are circular cylinders which are coaxial with the optical axis. Current applications of these lenses include photocopiers, medical endoscopes, telecommunications systems and compact disc systems. Closed formulae for the primary wavefront aberrations for a gradient-index lens with curved or plane entry and exit faces are obtained from the differential equations of such a lens to assess the primary transverse ray aberrations that it introduces. Identical expressions are then obtained by using the difference in optical path length produced between two rays by the lens. This duplication of the derivations of the primary wavefront aberrations acts as a confirmation of the validity of the expressions. One advantage of these equations is that the contributions due to the primary spherical aberration, coma, astigmatism, field curvature and distortion can be assessed individually. A Fortran 77 program has been written to calculate each of these individual contributions, the total primary wavefront aberrations and the primary transverse ray aberrations. Further confirmation of the validity of the expressions is obtained by using this program to show that the coma and distortion were both zero for fully symmetric systems working at unit magnification. The program is then used to assess the primary wavefront aberrations for a gradient-index lens which is currently of interest to the telecommunications industry. These results are compared with values obtained using a finite ray-tracing program for the total wavefront aberrations. This shows that the primary wavefront aberrations are the completely dominant contribution to the total wavefront

  13. Chromosomal locations of four minor rDNA loci and a marker microsatellite sequence in barley

    DEFF Research Database (Denmark)

    Pedersen, C.; Linde-Laursen, I.

    1994-01-01

    is located about 54% out on the short arm of chromosome 4 and it has not previously been reported in barley. We have designated the new locus Nor-I6. rDNA loci on homoeologous group 4 chromosomes have not yet been reported in other Triticeae species. The origin of these 4 minor rDNA loci is discussed...

  14. Aberration coefficients of curved holographic optical elements

    Science.gov (United States)

    Verboven, P. E.; Lagasse, P. E.

    1986-11-01

    A general formula is derived that gives all aberration terms of holographic optical elements on substrates of any shape. The spherical substrate shape and the planar substrate shape are treated as important special cases. A numerical example illustrates the need of including higher-order aberrations.

  15. Psychometric Characteristics of the Aberrant Behavior Checklist.

    Science.gov (United States)

    Aman, Michael G.; And Others

    1985-01-01

    Information is presented on the psychometric characteristics of the Aberrant Behavior Checklist, a measure of psychotropic drug effects. Internal consistency and test-retest reliability of the checklist appeared very good. Interrater reliability was generally in the moderate range. In general, validity was established for most Aberrant Behavior…

  16. 5S applied to the corporative network of data

    OpenAIRE

    Izekson Jose da Silva

    2002-01-01

    Resumo: Na busca de maior velocidade e agilidade nas organizações, para enfrentar com êxito o mercado cada vez mais competitivo, é acentuada a demanda por tecnologia de informação em rede corporativa de dados, como também de metodologias de tratamento de informações que proporcionem melhor desempenho dos recursos de informática utilizados, através de uma utilização disciplinada dos mesmos. Neste sentido, com base na experiência bem sucedida de aplicação do 5S em uma empresa de grande porte e ...

  17. Karyotype characterization of Crotalaria juncea (L. by chromosome banding and physical mapping of 18S-5.8S-26S and 5S rRNA gene sites

    Directory of Open Access Journals (Sweden)

    Mateus Mondin

    2007-01-01

    Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.

  18. Higher-Order Aberrations in Myopic Eyes

    Directory of Open Access Journals (Sweden)

    Farid Karimian

    2010-01-01

    Full Text Available Purpose: To evaluate the correlation between refractive error and higher-order aberrations (HOAs in patients with myopic astigmatism. Methods: HOAs were measured using the Zywave II aberrometer over a 6 mm pupil. Correlations between HOAs and myopia, astigmatism, and age were analyzed. Results: One hundred and twenty-six eyes of 63 subjects with mean age of 26.4±5.9 years were studied. Mean spherical equivalent refractive error and refractive astigmatism were -4.94±1.63 D and 0.96±1.06 D, respectively. The most common higher-order aberration was primary horizontal trefoil with mean value of 0.069±0.152 μm followed by spherical aberration (-0.064±0.130 μm and primary vertical coma (-0.038±0.148 μm. As the order of aberration increased from third to fifth, its contribution to total HOA decreased: 53.9% for third order, 31.9% for fourth order, and 14.2% for fifth order aberrations. Significant correlations were observed between spherical equivalent refractive error and primary horizontal coma (R=0.231, P=0.022, and root mean square (RMS of spherical aberration (R=0.213, P=0.031; between astigmatism and RMS of total HOA (R=0.251, P=0.032, RMS of fourth order aberration (R=0.35, P<0.001, and primary horizontal coma (R=0.314, P=0.004. Spherical aberration (R=0.214, P=0.034 and secondary vertical coma (R=0.203, P=0.031 significantly increased with age. Conclusion: Primary horizontal trefoil, spherical aberration and primary vertical coma are the predominant higher-order aberrations in eyes with myopic astigmatism.

  19. Photocurrent analysis of AgIn$_5$S$_8$ crystal

    Indian Academy of Sciences (India)

    MAHMUT BUCURGAT; SELAHATTIN OZDEMIR; TEZER FIRAT

    2016-10-01

    The photocurrent (PC) spectrum of AgIn$_5$S$_8$ crystal consists of a single peak, which provides to determine the bandgap energy by applying the Moss rule. The temperature dependence of the bandgap energy was alsocalculated. The PC dramatically increased by pre-illumination with light having wavelength corresponding to the bandgap of AgIn$_5$S$_8$. The temperature-dependent PC of the sample was measured at different temperatures from80 to 300 K and the PC spectrum consisted a single broad peak. Thermal quenching of the PC was observed to start at $\\sim$105 K and the PC completely quenched at $\\sim$180 K. The quenching mechanism was discussed in terms of the two-centre model. The height of the PC peak rised linearly with applied voltage up to 5.0 V under constant intensity of light. Similarly, the dark current–voltage characteristics consisted of a single region dominating an ohmicbehaviour, and no space charge limited region was apparent at various temperatures up to 20 V.

  20. Karyotyping and in situ chromosomal localization of rDNA sites in black cumin Bunium persicum (Boiss B. Fedtsch,1915 (Apiaceae

    Directory of Open Access Journals (Sweden)

    R. K. Chahota

    2011-11-01

    Full Text Available The fluorescent in situ hybridization (FISH technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes. The bicolour FISH technique involving 18S-5.8S-26S and 5S ribosomal RNA genes as probes was used to assign physical localization and measurement of rDNA sites on homologous pairs of chromosomes. The two 18S-5.8S-26S rRNA gene sites were at the terminal regions of the short arms of the chromosomes 1 and 2 involving NOR region of chromosome 1. The 5S rDNA sites were found on subtelomeric region of the long arm of the chromosome number 5 and at interstitial regions of the short arm of chromosome 7. Based on direct visual analysis of chromosome length, morphology and position of FISH signals, a pioneer attempt has been made to construct metaphase karyotype in B. persicum, an endangered medicinal plant of North Western Himalayas.

  1. Analysis of the Aberration in Directly-writing Atom Lithography

    Institute of Scientific and Technical Information of China (English)

    LI Chuanwen; CAI Weiquan; WANG Yuzhu

    2000-01-01

    After deriving the approximation solution which describes the motion of neutral atoms in an optical standing wave field with large detuning, the spherical aberration and the chromatic aberration are analyzed and possible methods to reduce these aberrations are discussed.

  2. Image-based EUVL aberration metrology

    Science.gov (United States)

    Fenger, Germain Louis

    A significant factor in the degradation of nanolithographic image fidelity is optical wavefront aberration. As resolution of nanolithography systems increases, effects of wavefront aberrations on aerial image become more influential. The tolerance of such aberrations is governed by the requirements of features that are being imaged, often requiring lenses that can be corrected with a high degree of accuracy and precision. Resolution of lithographic systems is driven by scaling wavelength down and numerical aperture (NA) up. However, aberrations are also affected from the changes in wavelength and NA. Reduction in wavelength or increase in NA result in greater impact of aberrations, where the latter shows a quadratic dependence. Current demands in semiconductor manufacturing are constantly pushing lithographic systems to operate at the diffraction limit; hence, prompting a need to reduce all degrading effects on image properties to achieve maximum performance. Therefore, the need for highly accurate in-situ aberration measurement and correction is paramount. In this work, an approach has been developed in which several targets including phase wheel, phase disk, phase edges, and binary structures are used to generate optical images to detect and monitor aberrations in extreme ultraviolet (EUV) lithographic systems. The benefit of using printed patterns as opposed to other techniques is that the lithography system is tested under standard operating conditions. Mathematical models in conjunction with iterative lithographic simulations are used to determine pupil phase wavefront errors and describe them as combinations of Zernike polynomials.

  3. Chromosome aberration assays in Allium

    Energy Technology Data Exchange (ETDEWEB)

    Grant, W.F.

    1982-01-01

    The common onion (Allium cepa) is an excellent plant for the assay of chromosome aberrations after chemical treatment. Other species of Allium (A. cepa var. proliferum, A. carinatum, A. fistulosum and A. sativum) have also been used but to a much lesser extent. Protocols have been given for using root tips from either bulbs or seeds of Allium cepa to study the cytological end-points, such as chromosome breaks and exchanges, which follow the testing of chemicals in somatic cells. It is considered that both mitotic and meiotic end-points should be used to a greater extent in assaying the cytogenetic effects of a chemical. From a literature survey, 148 chemicals are tabulated that have been assayed in 164 Allium tests for their clastogenic effect. Of the 164 assays which have been carried out, 75 are reported as giving a positive reaction, 49 positive and with a dose response, 1 positive and temperature-related, 9 borderline positive, and 30 negative; 76% of the chemicals gave a definite positive response. It is proposed that the Allium test be included among those tests routinely used for assessing chromosomal damage induced by chemicals.

  4. On aberration in gravitational lensing

    CERN Document Server

    Sereno, M

    2008-01-01

    It is known that a relative translational motion between the deflector and the observer affects gravitational lensing. In this paper, a lens equation is obtained to describe such effects on actual lensing observables. Results can be easily interpreted in terms of aberration of light-rays. Both radial and transverse motions with relativistic velocities are considered. The lens equation is derived by first considering geodesic motion of photons in the rest-frame Schwarzschild spacetime of the lens, and, then, light-ray detection in the moving observer's frame. Due to the transverse motion images are displaced and distorted in the observer's celestial sphere, whereas the radial velocity along the line of sight causes an effective re-scaling of the lens mass. The Einstein ring is distorted to an ellipse whereas the caustics in the source plane are still point-like. Either for null transverse motion or up to linear order in velocities, the critical curve is still a circle with its radius corrected by a factor (1+z...

  5. Inheritance of the group I rDNA intron in Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1992-01-01

    . In an analysis of vegetatively growing cells containing intron+ and intron- rDNA, initially in the same macronucleus, we similarly find no evidence of intron homing. During the course of this work, we observed to our surprise that progeny clones from some crosses contained three types of rDNA. One possible...... explanation is that T. pigmentosa has two rdn loci in contrast to the single locus found in T. thermophila. Some of the progeny clones from the genetic analysis were expanded for several hundred generations, and allelic assortment of the rDNA was demonstrated by subcloning analysis....

  6. Catadioptric aberration correction in cathode lens microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Tromp, R.M. [IBM T.J. Watson Research Center, PO Box 218, Yorktown Heights, NY 10598 (United States); Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Niels Bohrweg 2, 2333 CA Leiden (Netherlands)

    2015-04-15

    In this paper I briefly review the use of electrostatic electron mirrors to correct the aberrations of the cathode lens objective lens in low energy electron microscope (LEEM) and photo electron emission microscope (PEEM) instruments. These catadioptric systems, combining electrostatic lens elements with a reflecting mirror, offer a compact solution, allowing simultaneous and independent correction of both spherical and chromatic aberrations. A comparison with catadioptric systems in light optics informs our understanding of the working principles behind aberration correction with electron mirrors, and may point the way to further improvements in the latter. With additional developments in detector technology, 1 nm spatial resolution in LEEM appears to be within reach. - Highlights: • The use of electron mirrors for aberration correction in LEEM/PEEM is reviewed. • A comparison is made with similar systems in light optics. • Conditions for 1 nm spatial resolution are discussed.

  7. Flow cytometric detection of aberrant chromosomes

    Energy Technology Data Exchange (ETDEWEB)

    Gray, J.W.; Lucas, J.; Yu, L.C.; Langlois, R.

    1983-05-11

    This report describes the quantification of chromosomal aberrations by flow cytometry. Both homogeneously and heterogeneously occurring chromosome aberrations were studied. Homogeneously occurring aberrations were noted in chromosomes isolated from human colon carcinoma (LoVo) cells, stained with Hoechst 33258 and chromomycin A3 and analyzed using dual beam flow cytometry. The resulting bivariate flow karyotype showed a homogeneously occurring marker chromosome of intermediate size. Heterogeneously occurring aberrations were quantified by slit-scan flow cytometry in chromosomes isolated from control and irradiated Chinese hamster cells and stained with propidium iodide. Heterogeneously occurring dicentric chromosomes were detected by their shapes (two centrometers). The frequencies of such chromosomes estimated by slit-scan flow cytometry correlated well with the frequencies determined by visual microscopy.

  8. Sensing Phase Aberrations behind Lyot Coronagraphs

    Science.gov (United States)

    Sivaramakrishnan, Anand; Soummer, Rémi; Pueyo, Laurent; Wallace, J. Kent; Shao, Michael

    2008-11-01

    Direct detection of young extrasolar planets orbiting nearby stars can be accomplished from the ground with extreme adaptive optics and coronagraphy in the near-infrared, as long as this combination can provide an image with a dynamic range of 107 after the data are processed. Slowly varying speckles due to residual phase aberrations that are not measured by the primary wave-front sensor are the primary obstacle to achieving such a dynamic range. In particular, non-common optical path aberrations occurring between the wave-front sensor and the coronagraphic occulting spot degrade performance the most. We analyze the passage of both low and high spatial frequency phase ripples, as well as low-order Zernike aberrations, through an apodized pupil Lyot coronagraph in order to demonstrate the way coronagraphic filtering affects various aberrations. We derive the coronagraphically induced cutoff frequency of the filtering and estimate coronagraphic contrast losses due to low-order Zernike aberrations: tilt, astigmatism, defocus, coma, and spherical aberration. Such slowly varying path errors can be measured behind a coronagraph and corrected by a slowly updated optical path delay precompensation or offset asserted on the wave front by the adaptive optics (AO) system. We suggest ways of measuring and correcting all but the lowest spatial frequency aberrations using Lyot plane wave-front data, in spite of the complex interaction between the coronagraph and those mid-spatial frequency aberrations that cause image plane speckles near the coronagraphic focal plane mask occulter's edge. This investigation provides guidance for next-generation coronagraphic instruments currently under construction.

  9. Individual eye model based on wavefront aberration

    Science.gov (United States)

    Guo, Huanqing; Wang, Zhaoqi; Zhao, Qiuling; Quan, Wei; Wang, Yan

    2005-03-01

    Based on the widely used Gullstrand-Le Grand eye model, the individual human eye model has been established here, which has individual corneal data, anterior chamber depth and the eyeball depth. Furthermore, the foremost thing is that the wavefront aberration calculated from the individual eye model is equal to the eye's wavefront aberration measured with the Hartmann-shack wavefront sensor. There are four main steps to build the model. Firstly, the corneal topography instrument was used to measure the corneal surfaces and depth. And in order to input cornea into the optical model, high-order aspheric surface-Zernike Fringe Sag surface was chosen to fit the corneal surfaces. Secondly, the Hartmann-shack wavefront sensor, which can offer the Zernike polynomials to describe the wavefront aberration, was built to measure the wavefront aberration of the eye. Thirdly, the eye's axial lengths among every part were measured with A-ultrasonic technology. Then the data were input into the optical design software-ZEMAX and the crystalline lens's shapes were optimized with the aberration as the merit function. The individual eye model, which has the same wavefront aberrations with the real eye, is established.

  10. Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.

    Science.gov (United States)

    Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua

    2004-01-01

    In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae.

  11. Pulse compressor with aberration correction

    Energy Technology Data Exchange (ETDEWEB)

    Mankos, Marian [Electron Optica, Inc., Palo Alto, CA (United States)

    2015-11-30

    In this SBIR project, Electron Optica, Inc. (EOI) is developing an electron mirror-based pulse compressor attachment to new and retrofitted dynamic transmission electron microscopes (DTEMs) and ultrafast electron diffraction (UED) cameras for improving the temporal resolution of these instruments from the characteristic range of a few picoseconds to a few nanoseconds and beyond, into the sub-100 femtosecond range. The improvement will enable electron microscopes and diffraction cameras to better resolve the dynamics of reactions in the areas of solid state physics, chemistry, and biology. EOI’s pulse compressor technology utilizes the combination of electron mirror optics and a magnetic beam separator to compress the electron pulse. The design exploits the symmetry inherent in reversing the electron trajectory in the mirror in order to compress the temporally broadened beam. This system also simultaneously corrects the chromatic and spherical aberration of the objective lens for improved spatial resolution. This correction will be found valuable as the source size is reduced with laser-triggered point source emitters. With such emitters, it might be possible to significantly reduce the illuminated area and carry out ultrafast diffraction experiments from small regions of the sample, e.g. from individual grains or nanoparticles. During phase I, EOI drafted a set of candidate pulse compressor architectures and evaluated the trade-offs between temporal resolution and electron bunch size to achieve the optimum design for two particular applications with market potential: increasing the temporal and spatial resolution of UEDs, and increasing the temporal and spatial resolution of DTEMs. Specialized software packages that have been developed by MEBS, Ltd. were used to calculate the electron optical properties of the key pulse compressor components: namely, the magnetic prism, the electron mirror, and the electron lenses. In the final step, these results were folded

  12. Copy number of the transposon, Pokey, in rDNA is positively correlated with rDNA copy number in Daphnia obtuse [corrected].

    Directory of Open Access Journals (Sweden)

    Kaitlynn LeRiche

    Full Text Available Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼ 87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species.

  13. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p)3P2 - (5s4d)3D2 transition

    CERN Document Server

    Mickelson, P G; Anzel, P; DeSalvo, B J; Nagel, S B; Traverso, A J; Yan, M; Killian, T C

    2009-01-01

    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p)3P2 - (5s4d)3D2 transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p)3P2 dark state are repumped back into the (5s2)1S0 ground state. Spectroscopy of 84Sr, 86Sr, 87Sr, and 88Sr improves the value of the (5s5p)3P2 - (5s4d)3D2 transition frequency for 88Sr and determines the isotope shifts for the transition.

  14. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p)3P2-(5s4d)3D2 transition

    Science.gov (United States)

    Mickelson, P. G.; Martinez de Escobar, Y. N.; Anzel, P.; De Salvo, B. J.; Nagel, S. B.; Traverso, A. J.; Yan, M.; Killian, T. C.

    2009-12-01

    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p)3P2-(5s4d)3D2 transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p)3P2 dark state are repumped back into the (5s2)1S0 ground state. Spectroscopy of 84Sr, 86Sr, 87Sr and 88Sr improves the value of the (5s5p)3P2-(5s4d)3D2 transition frequency and determines the isotope shifts for the transition accurately enough to guide laser-cooling experiments with less abundant isotopes.

  15. Fluorescent in situ hybridization of the ribosomal RNA genes (5S and 35S in the genus Lolium: Lolium canariense, the missing link with Festuca?

    Directory of Open Access Journals (Sweden)

    Inda, Luis A.

    2013-06-01

    Full Text Available Two groups of taxa can be distinguished within the genus Lolium L. based on the pollination system, chromosome size, chromosomal location of nrDNA (5S and 35S (18S-5.8S-26S] and nrDNA phylogeny. The first group includes self-pollinated taxa (L. temulentum, L. persicum and L. remotum, whereas the second group comprises cross-pollinated species (L. perenne, L. multiflorum and L. rigidum. Here we describe that the autogamous species have two 5S sites and four 35S sites in their genome. Two of the 35S sites are present in the chromosomes containing the 5S regions. The allogamous taxa possess two 5S rDNA sites and 6-10 35S sites per genome, depending on the species. Two of these regions (35S may also be present in the chromosomes bearing 5S sites. Our study also demonstrates that Lolium canariense shows a distinctive pattern. It has two 5S and four 35S sites. In this case, the 35S loci are located in different chromosomes than the 5S. This cytogenetic pattern is consistent with that of Festuca pratensis. Thus, despite being allogamous, Lolium canariense does not entirely fit in either of the groups defined for the genus Lolium. The physical mapping of the nrDNA regions in L. canariense is different, and resembles that of F. pratensis, suggesting that this Macaronesian Lolium could be intermediate between Festuca and Lolium.En trabajos previos se ha descrito que el género Lolium L. está formado por dos grupos de taxones basados en el tipo de polinización, tamaño de los cromosomas, localización cromosómica de los loci del ADN ribosómico [5S y 35S (18S-5.8S-26S] y filogenia molecular basada en secuencias de ADN ribosómico. Los dos grupos son: especies autógamas (L. temulentum, L. persicum y L. remotum y especies alógamas (L. perenne, L. multiflorum y L. rigidum. Aquí describimos que según la localización cromosómica de los loci ribosómicos, las especies autógamas tienen dos sitios 5S y cuatro sitios 35S; dos de las cuales coinciden en

  16. Toxicity analysis of pesticides on cyanobacterial species by 16S rDNA molecular characterization

    Directory of Open Access Journals (Sweden)

    J. I. Nirmal Kumar

    2013-06-01

    Full Text Available Damaging effects of endosulfan on native structure of DNA, evident as a result of PCR based assay such as 16S rDNA amplification and sequencing, led to formation of gaps, mismatching of base pairs and dissimilarities in entire 16S rDNA sequences of treated cultures. Endosulfan was the most fatal to Westiellopsis prolifica of 16S rDNA region at 40ppm insecticide induced series of mispairing, and other lesions amounting up to 20% dissimilarity and 7% gaps. Whereas, 16S rDNA region of Anabaena fertilissima was comparatively less influenced with 18% dissimilarity and 7% gaps in response to 12ppm endosulfan, while 16S rDNA gene of Aulosira fertilissima was the least prone to changes with 17% dissimilarity, and 5% gaps under 60ppm endosulfan stress by the end of 16 days. On the other side, impact of fungicide tebuconazole after 16 days reflected identities up to 78% and 8% gaps for 30ppm treated A. fertilissima, while 60ppm treatment instilled 79% similarities with 10% gaps in W. prolifica and 83% identities with 5% gaps of Aulosira fertilissima after 16 days.

  17. An unusual 5S rRNA, from Sulfolobus acidocaldarius, and its implications for a general 5S rRNA structure.

    OpenAIRE

    Stahl, D A; Luehrsen, K R; Woese, C R; Pace, N R

    1981-01-01

    The nucleotide sequence of the 5S ribosomal RNA of the thermoacidophilic archaebacterium Sulfolobus acidocaldarius was determined. The high degree of evident secondary structure in the molecule has implications for the common higher order structure of other 5S rRNAs, both bacterial and eukaryotic.

  18. Anti-forensics of chromatic aberration

    Science.gov (United States)

    Mayer, Owen; Stamm, Matthew C.

    2015-03-01

    Over the past decade, a number of information forensic techniques have been developed to identify digital image manipulation and falsification. Recent research has shown, however, that an intelligent forger can use anti-forensic countermeasures to disguise their forgeries. In this paper, an anti-forensic technique is proposed to falsify the lateral chromatic aberration present in a digital image. Lateral chromatic aberration corresponds to the relative contraction or expansion between an image's color channels that occurs due to a lens's inability to focus all wavelengths of light on the same point. Previous work has used localized inconsistencies in an image's chromatic aberration to expose cut-and-paste image forgeries. The anti-forensic technique presented in this paper operates by estimating the expected lateral chromatic aberration at an image location, then removing deviations from this estimate caused by tampering or falsification. Experimental results are presented that demonstrate that our anti-forensic technique can be used to effectively disguise evidence of an image forgery.

  19. Assessing the construct validity of aberrant salience.

    Science.gov (United States)

    Schmidt, Kristin; Roiser, Jonathan P

    2009-01-01

    We sought to validate the psychometric properties of a recently developed paradigm that aims to measure salience attribution processes proposed to contribute to positive psychotic symptoms, the Salience Attribution Test (SAT). The "aberrant salience" measure from the SAT showed good face validity in previous results, with elevated scores both in high-schizotypy individuals, and in patients with schizophrenia suffering from delusions. Exploring the construct validity of salience attribution variables derived from the SAT is important, since other factors, including latent inhibition/learned irrelevance (LIrr), attention, probabilistic reward learning, sensitivity to probability, general cognitive ability and working memory could influence these measures. Fifty healthy participants completed schizotypy scales, the SAT, a LIrr task, and a number of other cognitive tasks tapping into potentially confounding processes. Behavioural measures of interest from each task were entered into a principal components analysis, which yielded a five-factor structure accounting for approximately 75% of the variance in behaviour. Implicit aberrant salience was found to load onto its own factor, which was associated with elevated "Introvertive Anhedonia" schizotypy, replicating our previous finding. LIrr loaded onto a separate factor, which also included implicit adaptive salience, but was not associated with schizotypy. Explicit adaptive and aberrant salience, along with a measure of probabilistic learning, loaded onto a further factor, though this also did not correlate with schizotypy. These results suggest that the measures of LIrr and implicit adaptive salience might be based on similar underlying processes, which are dissociable both from implicit aberrant salience and explicit measures of salience.

  20. Optical advantages of astigmatic aberration corrected heliostats

    Science.gov (United States)

    van Rooyen, De Wet; Schöttl, Peter; Bern, Gregor; Heimsath, Anna; Nitz, Peter

    2016-05-01

    Astigmatic aberration corrected heliostats adapt their shape in dependence of the incidence angle of the sun on the heliostat. Simulations show that this optical correction leads to a higher concentration ratio at the target and thus in a decrease in required receiver aperture in particular for smaller heliostat fields.

  1. [Aberrant pancreas with a double intestinal location].

    Science.gov (United States)

    Yenon, K; Lethurgie, C; Bokobza, B

    2005-01-01

    The authors report one exceptional case of aberrant pancreas with a double intestinal location (jejunum and Meckel's diverticulum) in a thirty-year-old patient. Digestive haemorrhage and the abdominal colic were the revealing clinical signs. The enteroscopy guided by the enteroscanner, was the indicated complementary investigation for the preoperative diagnosis. The research of other locations during the operation should be systematic.

  2. Functional Analysis and Treatment of Aberrant Behavior.

    Science.gov (United States)

    Mace, F. Charles; And Others

    1991-01-01

    This article reviews general classes of variables which help to maintain aberrant behavior including attention seeking, sensory and perceptual consequences, and access to materials or activities. Suggestions for a methodology providing a comprehensive functional analysis are offered which include descriptive analysis, hypothesis forming,…

  3. The correction of electron lens aberrations

    Energy Technology Data Exchange (ETDEWEB)

    Hawkes, P.W., E-mail: peter.hawkes@cemes.fr

    2015-09-15

    The progress of electron lens aberration correction from about 1990 onwards is chronicled. Reasonably complete lists of publications on this and related topics are appended. A present for Max Haider and Ondrej Krivanek in the year of their 65th birthdays. By a happy coincidence, this review was completed in the year that both Max Haider and Ondrej Krivanek reached the age of 65. It is a pleasure to dedicate it to the two leading actors in the saga of aberration corrector design and construction. They would both wish to associate their colleagues with such a tribute but it is the names of Haider and Krivanek (not forgetting Joachim Zach) that will remain in the annals of electron optics, next to that of Harald Rose. I am proud to know that both regard me as a friend as well as a colleague. - Highlights: • Geometrical aberration correction. • Chromatic aberration correction. • 50 pm resolution. • High-resolution electron energy-loss spectroscopy. • Extensive bibliographies.

  4. Prenatal hydronephrosis caused by aberrant renal vessels

    DEFF Research Database (Denmark)

    Lenz, K; Thorup, Jørgen Mogens; Rabol, A;

    1996-01-01

    With routine use of obstetric ultrasonography, fetal low-grade hydronephrosis is commonly detected, but may resolve spontaneously after birth. Two cases are presented to illustrate that in some cases such findings can express intermittent hydronephrosis caused by aberrant renal vessels. Renal...

  5. Reduced rDNA Copy Number Does Not Affect “Competitive” Chromosome Pairing in XYY Males of Drosophila melanogaster

    OpenAIRE

    Keith A. Maggert

    2014-01-01

    The ribosomal DNA (rDNA) arrays are causal agents in X-Y chromosome pairing in meiosis I of Drosophila males. Despite broad variation in X-linked and Y-linked rDNA copy number, polymorphisms in regulatory/spacer sequences between rRNA genes, and variance in copy number of interrupting R1 and R2 retrotransposable elements, there is little evidence that different rDNA arrays affect pairing efficacy. I investigated whether induced rDNA copy number polymorphisms affect chromosome pairing in a “co...

  6. Molecular Detection of Toxoplasmosis Using Specific Primers P30, B1, and rDNA

    Directory of Open Access Journals (Sweden)

    Wisnu Nurcahyo

    2014-04-01

    Full Text Available Study in order to develop molecular techniques using specific primers for the early diagnosis oftoxoplasmosis have been conducted. Detection of Toxoplasma gondii genome was performed usingpolymerase chain reaction (PCR technique. The primers used in this study were rDNA, P30, and B1. ThePCR products were further run using gel electrophoresis (gel 1.5% – 2.0% and the band was documented.Toxoplasma was detected at 500 bp and 600 bp using primer P30 and B1, respectively. Whereas usingprimer rDNA no band was observed. It was assumed that primer rDNA was not sensitive since the targetamplification was 88 bp.

  7. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    Science.gov (United States)

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  8. Results and prospects for Y(5S) running at B-factories

    OpenAIRE

    Drutskoy, A.

    2008-01-01

    Recent results and future prospects for Y(5S) running at B-factories are discussed. The first Belle measurements with 23.6 fb-1 of data taken at the Y(5S) energy are reported. Eligibility of potential measurements expected with 100 fb-1 and 1000 fb-1 of data at the Y(5S) is estimated.

  9. Functional intron+ and intron- rDNA in the same macronucleus of the ciliate Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Engberg, J

    1985-01-01

    alleles was followed in the total culture and in single cells during their vegetative segregation and it was observed that replication was non-preferential with respect to the two alleles. The diallelic clones were also used to demonstrate that intron-containing rDNA was transcribed and the transcript......Diallelic clones of Tetrahymena pigmentosa containing equal amounts of intron+ and intron- rDNA in the macronucleus were constructed. The macronucleus of the resulting strains divides amitotically during vegetative growth and the diallelic genotype is therefore unstable. The coexistence of the two...

  10. Clinorotation influences rDNA and NopA100 localization in nucleoli

    Science.gov (United States)

    Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

    The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

  11. Relationships between rDNA, Nop1 and Sir complex in biotechnologically relevant distillery yeasts.

    Science.gov (United States)

    Adamczyk, Jagoda; Deregowska, Anna; Potocki, Leszek; Kuna, Ewelina; Kaplan, Jakub; Pabian, Sylwia; Kwiatkowska, Aleksandra; Lewinska, Anna; Wnuk, Maciej

    2016-09-01

    Distillery yeasts are poorly characterized physiological group among the Saccharomyces sensu stricto complex. As industrial yeasts are under constant environmental stress during fermentation processes and the nucleolus is a stress sensor, in the present study, nucleolus-related parameters were evaluated in 22 commercially available distillery yeast strains. Distillery yeasts were found to be a heterogeneous group with a variable content and length of rDNA and degree of nucleolus fragmentation. The levels of rDNA were negatively correlated with Nop1 (r = -0.59, p = 0.0038). Moreover, the protein levels of Sir transcriptional silencing complex and longevity regulators, namely Sir1, Sir2, Sir3 and Fob1, were studied and negative correlations between Sir2 and Nop1 (r = -0.45, p = 0.0332), and between Sir2 and Fob1 (r = -0.49, p = 0.0211) were revealed. In general, S. paradoxus group of distillery yeasts with higher rDNA pools and Sir2 level than S. bayanus group was found to be more tolerant to fermentation-associated stress stimuli, namely mild cold/heat stresses and KCl treatment. We postulate that rDNA state may be considered as a novel factor that may modulate a biotechnological process.

  12. Top2 and Sgs1-Top3 Act Redundantly to Ensure rDNA Replication Termination.

    Directory of Open Access Journals (Sweden)

    Kamilla Mundbjerg

    2015-12-01

    Full Text Available Faithful DNA replication with correct termination is essential for genome stability and transmission of genetic information. Here we have investigated the potential roles of Topoisomerase II (Top2 and the RecQ helicase Sgs1 during late stages of replication. We find that cells lacking Top2 and Sgs1 (or Top3 display two different characteristics during late S/G2 phase, checkpoint activation and accumulation of asymmetric X-structures, which are both independent of homologous recombination. Our data demonstrate that checkpoint activation is caused by a DNA structure formed at the strongest rDNA replication fork barrier (RFB during replication termination, and consistently, checkpoint activation is dependent on the RFB binding protein, Fob1. In contrast, asymmetric X-structures are formed independent of Fob1 at less strong rDNA replication fork barriers. However, both checkpoint activation and formation of asymmetric X-structures are sensitive to conditions, which facilitate fork merging and progression of replication forks through replication fork barriers. Our data are consistent with a redundant role of Top2 and Sgs1 together with Top3 (Sgs1-Top3 in replication fork merging at rDNA barriers. At RFB either Top2 or Sgs1-Top3 is essential to prevent formation of a checkpoint activating DNA structure during termination, but at less strong rDNA barriers absence of the enzymes merely delays replication fork merging, causing an accumulation of asymmetric termination structures, which are solved over time.

  13. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    The extrachromosomal rDNA molecules from a number of Tetrahymena strains were characterized by restriction enzyme mapping using three different restriction enzymes combined with gel blotting and hybridization analysis. Strains from four out of six recently described species were found to contain...

  14. Community structure of arbuscular mycorrhizal fungi in undisturbed vegetation revealed by analyses of LSU rdna sequences

    DEFF Research Database (Denmark)

    Rosendahl, Søren; Holtgrewe-Stukenbrock, Eva

    2004-01-01

    Arbuscular mycorrhizal fungi (AMF) form a mutualistic symbiosis with plant roots and are found in most ecosystems. In this study the community structure of AMF in a clade of the genus Glomus was examined in undisturbed costal grassland using LSU rDNA sequences amplified from roots of Hieracium pi...

  15. Uniqueness of the Gossypium mustelinum Genome Revealed by GISH and 45S rDNA FISH

    Institute of Scientific and Technical Information of China (English)

    STELLY; David

    2008-01-01

    Gossypium mustelinum [(AD)4] is one of five tetraploid species in Gossypium.Three pairs of nucleolar organizer regions(NOR) in(AD)4 were detected by FISH with 45S rDNA as a probe,they also were observed with genomic DNA(gDNA) from Gossypium D genome species as probes.Of the

  16. Systematics of Penicillium simplicissimum based on rDNA sequences, morphology and secondary metabolites

    DEFF Research Database (Denmark)

    Tuthill, D.E.; Frisvad, Jens Christian; Christensen, M.

    2001-01-01

    supported by differences in micromorphological characters, particularly of the conidia and phialides, and the production of distinct profiles of secondary metabolites by each species. Group-I introns, located in the SSU rDNA, were identified in six of the 21 isolates; their presence was used to test...

  17. Plant 45S rDNA clusters are fragile sites and their instability is associated with epigenetic alterations.

    Directory of Open Access Journals (Sweden)

    Min Huang

    Full Text Available Our previous study demonstrated that 45S ribosomal DNA (45S rDNA clusters were chromosome fragile sites expressed spontaneously in Lolium. In this study, fragile phenotypes of 45S rDNA were observed under aphidicolin (APH incubation in several plant species. Further actinomycin D (ActD treatment showed that transcriptional stress might interfere with chromatin packaging, resulting in 45S rDNA fragile expression. These data identified 45S rDNA sites as replication-dependent as well as transcription-dependent fragile sites in plants. In the presence of ActD, a dramatic switch to an open chromatin conformation and accumulated incomplete 5' end of the external transcribed spacer (5'ETS transcripts were observed, accompanied by decreased DNA methylation, decreased levels of histone H3, and increased histone acetylation and levels of H3K4me2, suggesting that these epigenetic alterations are associated with failure of 45S rDNA condensation. Furthermore, the finding that γ-H2AX was accumulated at 45S rDNA sites following ActD treatment suggested that the DNA damage signaling pathway was associated with the appearance of 45S rDNA fragile phenotypes. Our data provide a link between 45S rDNA transcription and chromatin-packaging defects and open the door for further identifying the molecular mechanism involved.

  18. Assessing the construct validity of aberrant salience

    Directory of Open Access Journals (Sweden)

    Kristin Schmidt

    2009-12-01

    Full Text Available We sought to validate the psychometric properties of a recently developed paradigm that aims to measure salience attribution processes proposed to contribute to positive psychotic symptoms, the Salience Attribution Test (SAT. The “aberrant salience” measure from the SAT showed good face validity in previous results, with elevated scores both in high-schizotypy individuals, and in patients with schizophrenia suffering from delusions. Exploring the construct validity of salience attribution variables derived from the SAT is important, since other factors, including latent inhibition/learned irrelevance, attention, probabilistic reward learning, sensitivity to probability, general cognitive ability and working memory could influence these measures. Fifty healthy participants completed schizotypy scales, the SAT, a learned irrelevance task, and a number of other cognitive tasks tapping into potentially confounding processes. Behavioural measures of interest from each task were entered into a principal components analysis, which yielded a five-factor structure accounting for ~75% percent of the variance in behaviour. Implicit aberrant salience was found to load onto its own factor, which was associated with elevated “Introvertive Anhedonia” schizotypy, replicating our previous finding. Learned irrelevance loaded onto a separate factor, which also included implicit adaptive salience, but was not associated with schizotypy. Explicit adaptive and aberrant salience, along with a measure of probabilistic learning, loaded onto a further factor, though this also did not correlate with schizotypy. These results suggest that the measures of learned irrelevance and implicit adaptive salience might be based on similar underlying processes, which are dissociable both from implicit aberrant salience and explicit measures of salience.

  19. Cosmological parameter estimation: impact of CMB aberration

    CERN Document Server

    Catena, Riccardo

    2012-01-01

    The peculiar motion of an observer with respect to the CMB rest frame induces an apparent deflection of the observed CMB photons, i.e. aberration, and a shift in their frequency, i.e. Doppler effect. Both effects distort the temperature multipoles a_lm's via a mixing matrix at any l. The common lore when performing a CMB based cosmological parameter estimation is to consider that Doppler affects only the l=1 multipole, and neglect any other corrections. In this paper we reconsider the validity of this assumption, showing that it is actually not robust when sky cuts are included to model CMB foreground contaminations. Assuming a simple fiducial cosmological model with five parameters, we simulated CMB temperature maps of the sky in a WMAP-like and in a Planck-like experiment and added aberration and Doppler effects to the maps. We then analyzed with a MCMC in a Bayesian framework the maps with and without aberration and Doppler effects in order to assess the ability of reconstructing the parameters of the fidu...

  20. [Familial, structural aberration of the Y chromosome with fertility disorders].

    Science.gov (United States)

    Gall, H; Schmid, M; Schmidtke, J; Schempp, W; Weber, L

    1985-11-01

    Cytogenetic studies on a patient with Klinefelter's syndrome revealed an inherited, structural aberration of the Y-chromosome which has not been described before. The aberrant Y-chromosome was characterized by eight different banding methods. The value of individual staining techniques in studies on Y-heterochromatin aberrations is emphasized. Analysis of the cytogenetic studies (banding methods, restriction endonuclease of DNA, and measurement of the length of the Y-chromosome) permits an interpretation to be made on how the aberrant Y-chromosome originated. The functions of the Y-chromosome are discussed. The decrease in fertility (cryptozoospermia) in the two brothers with the same aberrant Y-chromosome was striking.

  1. DNA Repair Defects and Chromosomal Aberrations

    Science.gov (United States)

    Hada, Megumi; George, K. A.; Huff, J. L.; Pluth, J. M.; Cucinotta, F. A.

    2009-01-01

    Yields of chromosome aberrations were assessed in cells deficient in DNA doublestrand break (DSB) repair, after exposure to acute or to low-dose-rate (0.018 Gy/hr) gamma rays or acute high LET iron nuclei. We studied several cell lines including fibroblasts deficient in ATM (ataxia telangiectasia mutated; product of the gene that is mutated in ataxia telangiectasia patients) or NBS (nibrin; product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase (DNA-PK) activity. Chromosomes were analyzed using the fluorescence in situ hybridization (FISH) chromosome painting method in cells at the first division post irradiation, and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma irradiation induced greater yields of both simple and complex exchanges in the DSB repair-defective cells than in the normal cells. The quadratic dose-response terms for both simple and complex chromosome exchanges were significantly higher for the ATM- and NBS-deficient lines than for normal fibroblasts. However, in the NBS cells the linear dose-response term was significantly higher only for simple exchanges. The large increases in the quadratic dose-response terms in these repair-defective cell lines points the importance of the functions of ATM and NBS in chromatin modifications to facilitate correct DSB repair and minimize the formation of aberrations. The differences found between ATM- and NBS-deficient cells at low doses suggest that important questions should with regard to applying observations of radiation sensitivity at high dose to low-dose exposures. For aberrations induced by iron nuclei, regression models preferred purely linear dose responses for simple exchanges and quadratic dose responses for complex exchanges. Relative biological effectiveness (RBE) factors of all of

  2. Radiotherapeutical chromosomal aberrations in laryngeal cancer patients

    Directory of Open Access Journals (Sweden)

    Stošić-Divjak Svetlana L.

    2009-01-01

    Full Text Available Introduction. The authors present the results of cytogenetic analysis of 21 patients with laryngeal carcinomas diagnosed and treated in the period 1995-2000 at the Institute of Otorhinolaryngology and Maxillofacial Surgery, Clinical Center of Serbia and Clinical Center of Novi Sad. Material and methods. The patients were specially monitored and the material was analyzed at the Institute of Human Genetics of the School of Medicine in Belgrade as well as in the Laboratory for Radiological Protection of the Institute of Occupational and Radiological Health 'Dr Dragomir Karajovic' in Belgrade. Results. The incidence of chromosomal aberrations and incidence of exchange of material between sister chromatids were observed in the preparation of the metaphasic lymphocyte chromosomes of the peripheral blood obtained in the culture. Structural aberrations were found on the chromosomes in the form of breakups, rings, translocations and dicentrics as early as after a single exposure of patients to tumor radiation dose of 2 Gy in the field sized 5x7. Out of the total number of 35 cultivated blood samples obtained from 13 patients, 21 were successfully cultivated and they were proved to contain chromosomal aberrations. Some of the peripheral blood samples failed to show cell growth in vitro due to the lethal cell damages in vivo. Discussion.. We have consluded that the number of structural aberrations cannot be used as a biological measure of the absorbed ionizing radiation dose. The presence of aberrations per se is indicative of the mutagenic effect of the ionizing radiation, which was also confirmed in our series on the original model by cultivation of the peripheral blood lymphocytes in the culture of the cells of the volunteer donors upon in vitro radiation. Using the method of bromdeoxyuridylreductase, the increased incidence of SCE as a mutagenic effect was registered. Conclusion. It has been concluded that the increase of absorbed radiation dose in

  3. Chromatic variation of aberration: the role of induced aberrations and raytrace direction

    Science.gov (United States)

    Berner, A.; Nobis, T.; Shafer, D.; Gross, H.

    2015-09-01

    The design and optimization process of an optical system contains several first order steps. The definition of the appropriate lens type and the fixation of the raytrace direction are some of them. The latter can be understood as a hidden assumption rather than an aware design step. This is usually followed by the determination of the paraxial lens layout calculated for the primary wavelength. It is obvious, that for this primary wavelength the paraxial calculations are independent of raytrace direction. Today, most of the lens designs are specified not to work only for one wavelength, but in a certain wavelength range. Considering such rays of other wavelengths, one can observe that depending on the direction there will already occur differences in the first order chromatic aberrations and additionally in the chromatic variation of the third-order aberrations. The reason for this effect are induced aberrations emerging from one surface to the following surfaces by perturbed ray heights and ray angles. It can be shown, that the total amount of surface-resolved first order chromatic aberrations and the chromatic variation of the five primary aberrations can be split into an intrinsic part and an induced part. The intrinsic part is independent of the raytrace direction whereas the induced part is not.

  4. Nodal aberration theory for wild-filed asymmetric optical systems

    Science.gov (United States)

    Chen, Yang; Cheng, Xuemin; Hao, Qun

    2016-10-01

    Nodal Aberration Theory (NAT) was used to calculate the zero field position in Full Field Display (FFD) for the given aberration term. Aiming at wide-filed non-rotational symmetric decentered optical systems, we have presented the nodal geography behavior of the family of third-order and fifth-order aberrations. Meanwhile, we have calculated the wavefront aberration expressions when one optical element in the system is tilted, which was not at the entrance pupil. By using a three-piece-cellphone lens example in optical design software CodeV, the nodal geography is testified under several situations; and the wavefront aberrations are calculated when the optical element is tilted. The properties of the nodal aberrations are analyzed by using Fringe Zernike coefficients, which are directly related with the wavefront aberration terms and usually obtained by real ray trace and wavefront surface fitting.

  5. Achieve Sustainable Hospital Excellence Through 5-S in an Emergency Department in Hong Kong

    Directory of Open Access Journals (Sweden)

    Tsoi Vincent F. K.

    2014-11-01

    Full Text Available 5-S is the first step towards TQM. Over the last century, the Japanese have formalised the technique and named it as 5-S Practice. Since 1993, Sam Ho has improved and defined its terms in English/Chinese and developed the world's first 5-S Audit Checklist. In the article, an emergency department of a Hong Kong hospital was examined against 5-S 50-point Checklist for the improvement of their quality assurance systems towards its accreditation process with Australian standards. The findings evidently reveal that the impact of 5-S on hospital quality assurance in the unit are positive. Riding on the above scenario, the research aim is to identify whether the 5-S practice is a suitable and effective tool for healthcare quality assurance in an emergency setting which is led towards its accreditation process set by other mechanisms.

  6. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Durovic, P; Kutay, U.; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-c...

  7. Implementation Of 5S Quality Tool In Manufacturing Company A Case Study

    Directory of Open Access Journals (Sweden)

    Vibhor Kakkar

    2015-02-01

    Full Text Available Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivity of the company is enhanced to 91 .

  8. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  9. The Application of "5S" Activity in Electronic Packaging Industry%"5S"管理在电子封装企业中的应用

    Institute of Scientific and Technical Information of China (English)

    潘慧子; 张志胜; 谭光瑞; 史金飞

    2009-01-01

    从电子封装企业的生产现状出发,针对企业内部管理存在的问题,提出在测试车间推行"5S"管理活动的具体实施步骤.分析实施过程中的关键问题并寻找解决方法,制订"5S"管理5级考核标准.实践结果表明,"5S"管理很好地改善了企业工作环境,提升了员工素质,增强了企业竞争力.

  10. Wavefront aberrations of x-ray dynamical diffraction beams.

    Science.gov (United States)

    Liao, Keliang; Hong, Youli; Sheng, Weifan

    2014-10-01

    The effects of dynamical diffraction in x-ray diffractive optics with large numerical aperture render the wavefront aberrations difficult to describe using the aberration polynomials, yet knowledge of them plays an important role in a vast variety of scientific problems ranging from optical testing to adaptive optics. Although the diffraction theory of optical aberrations was established decades ago, its application in the area of x-ray dynamical diffraction theory (DDT) is still lacking. Here, we conduct a theoretical study on the aberration properties of x-ray dynamical diffraction beams. By treating the modulus of the complex envelope as the amplitude weight function in the orthogonalization procedure, we generalize the nonrecursive matrix method for the determination of orthonormal aberration polynomials, wherein Zernike DDT and Legendre DDT polynomials are proposed. As an example, we investigate the aberration evolution inside a tilted multilayer Laue lens. The corresponding Legendre DDT polynomials are obtained numerically, which represent balanced aberrations yielding minimum variance of the classical aberrations of an anamorphic optical system. The balancing of classical aberrations and their standard deviations are discussed. We also present the Strehl ratio of the primary and secondary balanced aberrations.

  11. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    Science.gov (United States)

    Long, Hong; Chen, Chunli; Wang, Bing; Feng, Yanni

    2015-01-01

    The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs) in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins.

  12. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    Science.gov (United States)

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected.

  13. Chromosomal aberrations in ISS crew members

    Science.gov (United States)

    Johannes, Christian; Goedecke, Wolfgang; Antonopoulos, Alexandra

    2012-07-01

    High energy radiation is a major risk factor in manned space missions. Astronauts and cosmonauts are exposed to ionising radiations of cosmic and solar origin, while on the Earth's surface people are well protected by the atmosphere and a deflecting magnetic field. There are now data available describing the dose and the quality of ionising radiation on-board of the International Space Station (ISS). Nonetheless, the effect of increased radiation dose on mutation rates of ISS crew members are hard to predict. Therefore, direct measurements of mutation rates are required in order to better estimate the radiation risk for longer duration missions. The analysis of chromosomal aberrations in peripheral blood lymphocytes is a well established method to measure radiation-induced mutations. We present data of chromosome aberration analyses from lymphocyte metaphase spreads of ISS crew members participating in short term (10-14 days) or long term (around 6 months) missions. From each subject we received two blood samples. The first sample was drawn about 10 days before launch and a second one within 3 days after return from flight. From lymphocyte cultures metaphase plates were prepared on glass slides. Giemsa stained and in situ hybridised metaphases were scored for chromosome changes in pre-flight and post-flight blood samples and the mutation rates were compared. Results obtained in chromosomal studies on long-term flight crew members showed pronounced inter-individual differences in the response to elevated radiation levels. Overall slight but significant elevations of typical radiation induced aberrations, i.e., dicentric chromosomes and reciprocal translocations have been observed. Our data indicate no elevation of mutation rates due to short term stays on-board the ISS.

  14. Aberrations in Fresnel Lenses and Mirrors

    Science.gov (United States)

    Gregory, Don

    1999-01-01

    The NASA/MSFC Shooting Star program revealed a number of technical problems that must be solved before solar thermal propulsion can become a reality. The fundamental problem of interest here is the collection of solar energy. This is the first step in the propulsion process and indeed the most important. Everything else depends on the efficiency and focusing ability of the collection lens or mirror. An initial model of Fresnel lens behavior using a wave optics approach has been completed and the results were encouraging enough to warrant an experimental investigation. This experimental investigation confirmed some of the effects predicted and produced invaluable photographic evidence of coherence based diffraction and aberration.

  15. Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

    Science.gov (United States)

    El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

    2013-07-01

    Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks.

  16. Fragmentary 5S rRNA gene in the human mitochondrial genome

    Energy Technology Data Exchange (ETDEWEB)

    Nierlich, D.P.

    1982-02-01

    The human mitochondrial genoma contains a 23-nucleodtide sequence that is homologous to a part of the 5S rRNA's of bacteria. This homology, the structure of the likely transcript, and the location of the sequence relative to the mitochondrial rRNA genes suggest that the sequence represents a fragmentary 5S rRNA gene.

  17. Assessment of helminth biodiversity in wild rats using 18S rDNA based metagenomics.

    Directory of Open Access Journals (Sweden)

    Ryusei Tanaka

    Full Text Available Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity.

  18. Molecular characterization of 18S rDNA partial sequence in Microcosmus (Stolidobranchiata, Pyuridae

    Directory of Open Access Journals (Sweden)

    D. FULGIONE

    2012-12-01

    Full Text Available We present a 18S rDNA based molecular phylogeny of two species of the genus Microcosmus (M. sulcatus and M. claudicans sampled in the Mediterranean, to investigate their phylogenetic position relative to species of the order Stolidobranchiata. The analysis is based on partial sequences (739 bp of the 18S rDNA. Among the 18 variable sites found between the two species, 4 correspond to transitions (ts, 14 to transversions (tv and 4 to deletions/insertions. In the considered Stolidobranchiata, we found 4.3% overall mean number of nucleotide differences and 0.06 (S.E. ±0.01 Kimura 2-parameter distance. The mean number of nucleotide differences between Microcosmus spp. and other Stolidobranchiata species was of 6% and 0.08 (S.E. ±0.01 Kimura 2-parameter distance. A molecular phylogeny obtained by Maximum Parsimony corroborates results of the traditional taxonomy.

  19. Assessment of helminth biodiversity in wild rats using 18S rDNA based metagenomics.

    Science.gov (United States)

    Tanaka, Ryusei; Hino, Akina; Tsai, Isheng J; Palomares-Rius, Juan Emilio; Yoshida, Ayako; Ogura, Yoshitoshi; Hayashi, Tetsuya; Maruyama, Haruhiko; Kikuchi, Taisei

    2014-01-01

    Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity.

  20. The 5S lean method as a tool of industrial management performances

    Science.gov (United States)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  1. Uniqueness of the Gossypium mustelinum Genome Revealed by GISH and 45S rDNA FISH

    Institute of Scientific and Technical Information of China (English)

    WU Qiong; STELLY David; SONG Guo-li; WANG Kun-bo; WANG Chun-ying; LIU Fang; LI Shao-hui; ZHANG Xiang-di; WANG Yu-hong; LIU San-hong

    2008-01-01

    @@ Gossypium mustelinum [-(AD)4"] is one of five tetraploid species in Gossypium.Three pairs of nucleolar organizer regions (NOR) in (AD)4 were detected by FISH with 45S rDNA as a probe,they also were observed with genomic DNA (gDNA) from Gossypium D genome species as probes.Of the three NORs or GISH-NORs,one was super-major and other two were minor,which was distinctly different from other tetraploid cottons.

  2. Uniqueness of the Gossypium mustelinum Genome Revealed by GISH and 45S rDNA FISH

    Institute of Scientific and Technical Information of China (English)

    Qiong Wu; Fang Liu; Shaohui Li; Guoli Song; Chunying Wang; Xiangdi Zhang; Yuhong Wang

    2013-01-01

    Gossypium mustelinum ((AD)4) is one of five disomic species in Gossypium.Three 45S ribosomal DNA (rDNA) loci were detected in (AD)4 with 45S rDNA as probe,and three pairs of brighter signals were detected with genomic DNA (gDNA) of Gossypium D genome species as probes.The size and the location of these brighter signals were the same as those detected with 45S rDNA as probe,and were named GISH-NOR.One of them was super-major,which accounted for the fact that about one-half of its chromosome at metaphase was located at chromosome 3,and other two were minor and located at chromosomes 5 and 9,respectively.All GISH-NORs were located in A sub-genome chromosomes,separate from the other four allopolypioid cotton species.GISH-NOR were detected with D genome species as probe,but not A.The greatly abnormal sizes and sites of (AD)4 NORs or GISH-NORs indicate a possible mechanism for 45S rDNA diversification following (AD)4 speciation.Comparisons of GISH intensities and GISH-NOR production with gDNA probes between A and D genomes show that the better relationship of (AD)4 is with A genome.The shortest two chromosomes of A sub-genome of G.mustelinum were shorter than the longest chromosome of D sub-genome chromosomes.Therefore,the longest 13 chromosomes of tetraploid cotton being classified as A sub-genome,while the shorter 13 chromosomes being classified as D sub-genome in traditional cytogenetic and karyotype analyses may not be entirely correct.

  3. Aberration measurement from specific photolithographic images: a different approach.

    Science.gov (United States)

    Nomura, H; Tawarayama, K; Kohno, T

    2000-03-01

    Techniques for measurement of higher-order aberrations of a projection optical system in photolithographic exposure tools have been established. Even-type and odd-type aberrations are independently obtained from printed grating patterns on a wafer by three-beam interference under highly coherent illumination. Even-type aberrations, i.e., spherical aberration and astigmatism, are derived from the best focus positions of vertical, horizontal, and oblique grating patterns by an optical microscope. Odd-type aberrations, i.e., coma and three-foil, are obtained by detection of relative shifts of a fine grating pattern to a large pattern by an overlay inspection tool. Quantitative diagnosis of lens aberrations with a krypton fluoride (KrF) excimer laser scanner is demonstrated.

  4. Inheritance of the group I rDNA intron in Tetrahymena pigmentosa.

    Science.gov (United States)

    Nielsen, H; Simon, E M; Engberg, J

    1992-01-01

    We have previously argued from phylogenetic sequence data that the group I intron in the rRNA genes of Tetrahymena was acquired by different Tetrahymena species at different times during evolution. We have now approached the question of intron mobility experimentally by crossing intron+ and intron- strains looking for a strong polarity in the inheritance of the intron (intron homing). Based on the genetic analysis we find that the intron in T. pigmentosa is inherited as a neutral character and that intron+ and intron- alleles segregate in a Mendelian fashion with no sign of intron homing. In an analysis of vegetatively growing cells containing intron+ and intron- rDNA, initially in the same macronucleus, we similarly find no evidence of intron homing. During the course of this work, we observed to our surprise that progeny clones from some crosses contained three types of rDNA. One possible explanation is that T. pigmentosa has two rdn loci in contrast to the single locus found in T. thermophila. Some of the progeny clones from the genetic analysis were expanded for several hundred generations, and allelic assortment of the rDNA was demonstrated by subcloning analysis.

  5. Calibration and removal of lateral chromatic aberration in images

    OpenAIRE

    Mallon, John; Whelan, Paul F.

    2007-01-01

    This paper addresses the problem of compensating for lateral chromatic aberration in digital images through colour plane realignment. Two main contributions are made: the derivation of a model for lateral chromatic aberration in images, and the subsequent calibration of this model from a single view of a chess pattern. These advances lead to a practical and accurate alternative for the compensation of lateral chromatic aberrations. Experimental results validate the proposed models and calibra...

  6. Correcting Aberrations in Complex Magnet Systems for Muon Cooling Channels

    Energy Technology Data Exchange (ETDEWEB)

    J.A. Maloney, B. Erdelyi, A. Afanaciev, R.P. Johnson, Y.S. Derbenev, V.S. Morozov

    2011-03-01

    Designing and simulating complex magnet systems needed for cooling channels in both neutrino factories and muon colliders requires innovative techniques to correct for both chromatic and spherical aberrations. Optimizing complex systems, such as helical magnets for example, is also difficult but essential. By using COSY INFINITY, a differential algebra based code, the transfer and aberration maps can be examined to discover what critical terms have the greatest influence on these aberrations.

  7. Cellular origin of prognostic chromosomal aberrations in AML patients

    DEFF Research Database (Denmark)

    Mora-Jensen, H.; Jendholm, J.; Rapin, N.;

    2015-01-01

    karyotype have demonstrated the presence of prognostic driver aberrations (that is, NPM1, FLT3-ITD and FLT3-TKD) in committed HPCs but not in multipotent HSCs. However, the HSC populations lacking the prognostic driver aberrations contained preleukemic clones harboring a series of recurrent molecular...... aberrations that were present in the fully transformed committed HPCs together with the prognostic driver aberration. Adding to this vast heterogeneity and complexity of AML genomes and their clonal evolution, a recent study of a murine AML model demonstrated that t(9;11) AML originating from HSCs responded...

  8. Measurement of B9Upsilon(5S) to Bs(*) Bs(*)bar Using phi Mesons

    CERN Document Server

    Huang, G; Pavlunin, V; Sanghi, B; Shipsey, I P J; Xin, B; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Insler, J; Muramatsu, H; Park, C S; Thorndike, E H; Yang, F; Coan, T E; Gao, Y S; Liu, F; Artuso, M; Blusk, S; Butt, J; Li, J; Menaa, N; Mountain, R; Nisar, S; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Asner, D M; Edwards, K W; Briere, R A; Brock, I; Chen, J; Ferguson, T; Tatishvili, G T; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Gibbons, L; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Onyisi, P U E; Patterson, J R; Peterson, D; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Stroiney, S; Sun, W M; Wilksen, T; Weinberger, M; Athar, S B; Patel, R; Potlia, V; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Wiss, J; Shepherd, M R; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Poling, R; Scott, A W; Smith, A; Zweber, P; Dobbs, S; Metreveli, Z V; Seth, K K; Tomaradze, A G; Ernst, J; Severini, H; Dytman, S A; Love, W; Savinov, V; Aquines, O; Li, Z; López, A; Mehrabyan, S S; Méndez, H; Ramírez, J; al, et

    2006-01-01

    Knowledge of the Bs decay fraction of the Y(5S) resonance, fs, is important for Bs meson studies at the Y(5S) energy. Using data collected by the CLEO III detector at CESR consisting of 0.423 1/fb on the Y(5S) resonance, 6.34 1/fb on the Y(4S) and 2.32 1/fb in the continuum below the Y(4S), we measure B(Y(5S)-> phi X)=(13.2+/- 0.7 ^{+2.2}_{-1.4})% and B(Y (4S)-> phi X)=(7.1 +/- 0.1 +/- 0.6)%, the ratio of the two rates is (1.9 +/- 0.1 ^{+0.3}_{-0.2}). This is the first measurement of the phi meson yield from the Y(5S). Using these rates, and a model dependent estimate of B(Bs -> phi X), we measure fs=(27.3 +/- 3.2 ^{+14.6}_{-~6.1})%. We update our previous, independent measurement of this branching fraction using the inclusive Ds yields to be (21.8 +/- 3.4 ^{+8.5}_{-4.2})%, due to changes in the $D_s^+ -> phi \\pi^+$ branching fraction and a better estimate of the number of hadronic events. We also report the total Y(5S) hadronic cross section above continuum to be sigma(e^+e^- -> Y(5S))=(0.301 +/- 0.002 +/- 0...

  9. Measurement of B[Y(5S)->Bs(*) anti-Bs(*)] Using phi Mesons

    CERN Document Server

    Huang, G S; Adams, G S; Alexander, J P; Anderson, M; Aquines, O; Artuso, M; Asner, D M; Athar, S B; Berkelman, K; Besson, D; Blusk, S; Bonvicini, G; Briere, R A; Brock, I; Butt, J; Cassel, D G; Cawlfield, C; Chen, J; Cinabro, D; Coan, T E; Cronin-Hennessy, D; Csorna, S E; Cummings, J P; Danko, I; Dobbs, S; Duboscq, J E; Dubrovin, M; Dytman, S A; Ecklund, K M; Edwards, K W; Ehrlich, R; Eisenstein, B I; Ernst, J; Ferguson, T; Fields, L; Gao, K Y; Gao, Y S; Gibbons, L; Gong, D T; Gray, R; Gray, S W; Hartill, D L; He, Q; Heltsley, B K; Hertz, D; Hietala, J; Huang, G S; Insler, J; Jones, C D; Kandaswamy, J; Karliner, I; Kim, D; Klein, T; Kreinick, D L; Kubota, Y; Kuznetsov, V E; Lang, B W; Li, J; Li, Z; Lincoln, A; Liu, F; Love, W; Lowrey, N; López, A; Mahlke-Krüger, H; Mehrabyan, S S; Menaa, N; Metreveli, Z V; Miller, D H; Mountain, R; Muramatsu, H; Méndez, H; Naik, P; Napolitano, J; Nisar, S; Onyisi, P U E; Park, C S; Patel, R; Patterson, J R; Pavlunin, V; Pedlar, T K; Peterson, D; Pivarski, J; Poling, R; Potlia, V; Ramírez, J; Randrianarivony, K; Redjimi, R; Riley, D; Rosner, J L; Rubin, P; Ryd, A; Sadoff, A J; Sanghi, B; Savinov, V; Schwarthoff, H; Scott, A W; Sedlack, C; Selen, M; Seth, K K; Severini, H; Shepherd, M R; Shi, X; Shipsey, I P J; Sia, R; Skwarnicki, T; Smith, A; Stone, S; Stroiney, S; Sun, W M; Tatishvili, G T; Thorndike, E H; Tomaradze, A G; Vogel, H; Wang, J C; Watkins, M E; Weinberger, M; White, E J; Wilksen, T; Wiss, J; Xin, B; Yang, F; Yelton, J; Zhang, K; Zweber, P; al., et

    2007-01-01

    Knowledge of the Bs decay fraction of the Y(5S) resonance, fs, is important for Bs meson studies at the Y(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423/fb on the Y(5S) resonance, 6.34/fb on the Y(4S) and 2.32/fb in the continuum below the Y(4S), we measure B(Y(5S) -> phi X)=(13.8 +/- 0.7 {+2.3}{-1.5})% and B(Y(4S) -> phi X) = (7.1 +/- 0.1 +/-0.6)%; the ratio of the two rates is (1.9 +/- 0.1 {+0.3}{-0.2}). This is the first measurement of the phi meson yield from the Y(5S). Using these rates, and a model dependent estimate of B(Bs -> phi X), we determine fs = (24.6 +/- 2.9 {+11.0}{-5.3})%. We also update our previous independent measurement of fs made using the inclusive Ds yields to now be (16.8 +/- 2.6 {+6.7}{-3.4)%, due to a better estimate of the number of hadronic events. We also report the total Y(5S) hadronic cross section above continuum to be sigma(e^+e^- -> Y(5S))=(0.301 +/- 0.002 +/- 0.039) nb. This allows us to extract the fraction of B mesons as (58...

  10. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits......A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  11. History of myxozoan character evolution on the basis of rDNA and EF-2 data

    Directory of Open Access Journals (Sweden)

    Bartošová Pavla

    2010-07-01

    Full Text Available Abstract Background Phylogenetic relationships among myxosporeans based on ribosomal DNA data disagree with traditional taxonomic classification: a number of myxosporeans with very similar spore morphology are assigned to the same genera even though they are phylogenetically distantly related. The credibility of rDNA as a suitable marker for Myxozoa is uncertain and needs to be proved. Furthermore, we need to know the history of myxospore evolution to understand the great diversity of modern species. Results Phylogenetic analysis of elongation factor 2 supports the ribosomal DNA-based reconstruction of myxozoan evolution. We propose that SSU rDNA is a reliable marker for inferring myxozoan relationships, even though SSU rDNA analysis markedly disagrees with the current taxonomy. The analyses of character evolution of 15 morphological and 5 bionomical characters show the evolution of individual characters and uncover the main evolutionary changes in the myxosporean spore morphology and bionomy. Most bionomical and several morphological characters were found to be congruent with the phylogeny. The summary of character analyses leads to the simulation of myxozoan ancestral morphotypes and their evolution to the current species. As such, the ancestor of all myxozoans appears to have infected the renal tubules of freshwater fish, was sphaerosporid in shape, and had a spore with polar capsules that discharged slightly sideways. After the separation of Malacosporea, the spore of the common myxosporean ancestor then changed to the typical sphaerosporid morphotype. This species inhabited the marine environment as a parasite of the gall bladder of marine fish and ultimately separated into the three main myxosporean lineages evident today. Two of these lineages re-entered the freshwater environment, one as a myxosporean with Chloromyxum and another with a primitive sphaerosporid morphotype. The common ancestor of all marine myxosporeans had a ceratomyxid

  12. Similar patterns of rDNA evolution in synthetic and recently formed natural populations of Tragopogon (Asteraceae allotetraploids

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2010-09-01

    Full Text Available Abstract Background Tragopogon mirus and T. miscellus are allotetraploids (2n = 24 that formed repeatedly during the past 80 years in eastern Washington and adjacent Idaho (USA following the introduction of the diploids T. dubius, T. porrifolius, and T. pratensis (2n = 12 from Europe. In most natural populations of T. mirus and T. miscellus, there are far fewer 35S rRNA genes (rDNA of T. dubius than there are of the other diploid parent (T. porrifolius or T. pratensis. We studied the inheritance of parental rDNA loci in allotetraploids resynthesized from diploid accessions. We investigate the dynamics and directionality of these rDNA losses, as well as the contribution of gene copy number variation in the parental diploids to rDNA variation in the derived tetraploids. Results Using Southern blot hybridization and fluorescent in situ hybridization (FISH, we analyzed copy numbers and distribution of these highly reiterated genes in seven lines of synthetic T. mirus (110 individuals and four lines of synthetic T. miscellus (71 individuals. Variation among diploid parents accounted for most of the observed gene imbalances detected in F1 hybrids but cannot explain frequent deviations from repeat additivity seen in the allotetraploid lines. Polyploid lineages involving the same diploid parents differed in rDNA genotype, indicating that conditions immediately following genome doubling are crucial for rDNA changes. About 19% of the resynthesized allotetraploid individuals had equal rDNA contributions from the diploid parents, 74% were skewed towards either T. porrifolius or T. pratensis-type units, and only 7% had more rDNA copies of T. dubius-origin compared to the other two parents. Similar genotype frequencies were observed among natural populations. Despite directional reduction of units, the additivity of 35S rDNA locus number is maintained in 82% of the synthetic lines and in all natural allotetraploids. Conclusions Uniparental reductions of

  13. 浅议5S-TPM促进安全管理

    Institute of Scientific and Technical Information of China (English)

    葛仔东

    2013-01-01

    安全生产重在现场,设备的稳定性直接影响安全生产,安全强调务实和强执行力,5S-TPM正是不讲空话,强调行动的管理工具.文章结合一年多的5S-TPM实践活动,介绍了在推行过程中5S-TPM对安全管理的促进作用.

  14. A populational survey of 45S rDNA polymorphism in the Jefferson salamander Ambystoma jeffersonianum revealed by fluorescence in situ hybridization (FISH

    Directory of Open Access Journals (Sweden)

    Jinzhong FU

    2009-04-01

    Full Text Available The chromosomal localization of 45S ribosomal RNA genes in Ambystoma jeffersonianum was determined by fluorescence in situ hybridization with 18S rDNA fragment as a probe (FISH-rDNA. Our results revealed the presence of rDNA polymorphism among A.jeffersonianum populations in terms of number, location and FISH signal intensity on the chromosomes. Nine rDNA cytotypes were found in ten geographically isolated populations and most of them contained derivative rDNA sites. Our preliminary study provides strong indication of karyotypic diversification of A.jeffersonianum that is demonstrated by intraspecific variation of 45S rDNA cytotypes. rDNA cytotype polymorphism has been described in many other caudate amphibians. We predict that habitat isolation, low dispersal ability and decline of effective population size could facilitate the fixation and accumulation of variable rDNA cytotypes during their chromosome evolution.

  15. A populational survey of 45S rDNA polymorphism in the Jefferson salamander Ambystoma jeffersonianum revealed by fluorescence in situ hybridization (FISH)

    Institute of Scientific and Technical Information of China (English)

    Ke BI; James P.BOGART; Jinzhong FU

    2009-01-01

    The chromosomal localization of 45S ribosomal RNA genes in Ambystoma jeffersonianum was determined by fluorescence in situ hybridization with 18S rDNA fragment as a probe (FISH-rDNA). Our results revealed the presence of rDNA polymorphism among A.jeffersonianum populations in terms of number, location and FISH signal intensity on the chromosomes. Nine rDNA cytotypes were found in ten geographically isolated populations and most of them contained derivative rDNA sites. Our preliminary study provides strong indication of karyotypic diversification of A.jeffersonianum that is demonstrated by intraspecific variation of 45S rDNA cytotypes. rDNA cytotype polymorphism has been described in many other caudate amphibians. We predict that habitat isolation, low dispersal ability and decline of effective population size could facilitate the fixation and accumulation of variable rDNA cytotypes during their chromosome evolution [Current Zoology 55(2):145-149,2009].

  16. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase.

    Science.gov (United States)

    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M; Ha, Taekjip; Prasanth, Kannanganattu V; Prasanth, Supriya G

    2015-07-01

    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1-interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing.

  17. Nuclear 28S rDNA phylogeny supports the basal placement of Noctiluca scintillans (Dinophyceae; Noctilucales) in dinoflagellates.

    Science.gov (United States)

    Ki, Jang-Seu

    2010-05-01

    Noctiluca scintillans (Macartney) Kofoid et Swezy, 1921 is an unarmoured heterotrophic dinoflagellate with a global distribution, and has been considered as one of the ancestral taxa among dinoflagellates. Recently, 18S rDNA, actin, alpha-, beta-tubulin, and Hsp90-based phylogenies have shown the basal position of the noctilucids. However, the relationships of dinoflagellates in the basal lineages are still controversial. Although the nuclear rDNA (e.g. 18S, ITS-5.8S, and 28S) contains much genetic information, DNA sequences of N. scintillans rDNA molecules were insufficiently characterized as yet. Here the author sequenced a long-range nuclear rDNA, spanning from the 18S to the D5 region of the 28S rDNA, of N. scintillans. The present N. scintillans had a nearly identical genotype (>99.0% similarity) compared to other Noctiluca sequences from different geographic origins. Nucleotide divergence in the partial 28S rDNA was significantly high (pdinoflagellates, two perkinsids, and two apicomplexans as outgroups showed that N. scintillans and Oxyrrhis marina formed a clade that diverged separately from core dinoflagellates.

  18. Aberrant angiogenesis: The gateway to diabetic complications

    Directory of Open Access Journals (Sweden)

    Sunil K Kota

    2012-01-01

    Full Text Available Diabetes Mellitus is a metabolic cum vascular syndrome with resultant abnormalities in both micro- and macrovasculature. The adverse long-term effects of diabetes mellitus have been described to involve many organ systems. Apart from hyperglycemia, abnormalities of angiogenesis may cause or contribute toward many of the clinical manifestations of diabetes. These are implicated in the pathogenesis of vascular abnormalities of the retina, kidneys, and fetus, impaired wound healing, increased risk of rejection of transplanted organs, and impaired formation of coronary collaterals. A perplexing feature of the aberrant angiogenesis is that excessive and insufficient angiogenesis can occur in different organs in the same individual. The current article hereby reviews the molecular mechanisms including abnormalities in growth factors, cytokines, and metabolic derangements, clinical implications, and therapeutic options of dealing with abnormal angiogenesis in diabetes.

  19. Aberrant Gene Expression in Acute Myeloid Leukaemia

    DEFF Research Database (Denmark)

    Bagger, Frederik Otzen

    model to investigate the role of telomerase in AML, we were able to translate the observed effect into human AML patients and identify specific genes involved, which also predict survival patterns in AML patients. During these studies we have applied methods for investigating differentially expressed......Summary Acute Myeloid Leukaemia (AML) is an aggressive cancer of the bone marrow, affecting formation of blood cells during haematopoiesis. This thesis presents investigation of AML using mRNA gene expression profiles (GEP) of samples extracted from the bone marrow of healthy and diseased subjects....... Here GEPs from purified healthy haematopoietic populations, with different levels of differentiation, form the basis for comparison with diseased samples. We present a mathematical transformation of mRNA microarray data to make it possible to compare AML samples, carrying expanded aberrant...

  20. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    DEFF Research Database (Denmark)

    Brown, S; Fournier, M J

    1984-01-01

    in 4.5 S RNA, a dramatic loss in protein synthesis activity, and eventual cell death. Tagging of the chromosomal ffs region with a kanamycin-resistance gene allowed mapping of the 4.5 S RNA gene. Results from this analysis place ffs near lon at approximately ten minutes on the E. coli linkage map.......The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...

  1. Absolute Frequency Measurement of Rubidium 5S-7S Two-Photon Transitions

    CERN Document Server

    Morzynski, Piotr; Ablewski, Piotr; Gartman, Rafal; Gawlik, Wojciech; Maslowski, Piotr; Nagorny, Bartlomiej; Ozimek, Filip; Radzewicz, Czeslaw; Witkowski, Marcin; Ciurylo, Roman; Zawada, Michal

    2013-01-01

    We report the absolute frequency measurements of rubidium 5S-7S two-photon transitions with a cw laser digitally locked to an atomic transition and referenced to an optical frequency comb. The narrow, two-photon transition, 5S-7S (760 nm) insensitive to first order in a magnetic field, is a promising candidate for frequency reference. The performed tests yield the transition frequency with accuracy better than reported previously.

  2. Effect of chromatic aberration on atomic-resolved spherical aberration corrected STEM images.

    Science.gov (United States)

    Kuramochi, Koji; Yamazaki, Takashi; Kotaka, Yasutoshi; Ohtsuka, Masahiro; Hashimoto, Iwao; Watanabe, Kazuto

    2009-12-01

    The effect of the chromatic aberration (C(c)) coefficient in a spherical aberration (C(s))- corrected electromagnetic lens on high-resolution high-angle annular dark field (HAADF) scanning transmission electron microscope (STEM) images is explored in detail. A new method for precise determination of the C(c) coefficient is demonstrated, requiring measurement of an atomic-resolution one-frame through-focal HAADF STEM image. This method is robust with respect to instrumental drift, sample thickness, all lens parameters except C(c), and experimental noise. It is also demonstrated that semi-quantitative structural analysis on the nanometer scale can be achieved by comparing experimental C(s)- corrected HAADF STEM images with their corresponding simulated images when the effects of the C(c) coefficient and spatial incoherence are included.

  3. The 5S RNP Couples p53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress

    Directory of Open Access Journals (Sweden)

    Katherine E. Sloan

    2013-10-01

    Full Text Available Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2 homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP. We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14ARF, a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production.

  4. Design of an aberration corrected low-voltage SEM

    NARCIS (Netherlands)

    Aken, R.H. van; Maas, D.J.; Hagen, C.W.; Barth, J.E.; Kruit, P.

    2010-01-01

    The low-voltage foil corrector is a novel type of foil aberration corrector that can correct for both the spherical and chromatic aberration simultaneously. In order to give a realistic example of the capabilities of this corrector, a design for a low-voltage scanning electron microscope with the lo

  5. Adaptive aberration correction using a triode hyperbolic electron mirror.

    Science.gov (United States)

    Fitzgerald, J P S; Word, R C; Könenkamp, R

    2011-01-01

    A converging electron mirror can be used to compensate spherical and chromatic aberrations in an electron microscope. This paper presents an analytical solution to a novel triode (three electrode) hyperbolic mirror as an improvement to the well-known diode (two electrode) hyperbolic mirror for aberration correction. A weakness of the diode mirror is a lack of flexibility in changing the chromatic and spherical aberration coefficients independently without changes in the mirror geometry. In order to remove this limitation, a third electrode can be added. We calculate the optical properties of the resulting triode mirror analytically on the basis of a simple model field distribution. We present the optical properties-the object/image distance, z(0), and the coefficients of spherical and chromatic aberration, C(s) and C(c), of both mirror types from an analysis of electron trajectories in the mirror field. From this analysis, we demonstrate that while the properties of both designs are similar, the additional parameters in the triode mirror improve the range of aberration that can be corrected. The triode mirror is also able to provide a dynamic adjustment range of chromatic aberration for fixed spherical aberration and focal length, or any permutation of these three parameters. While the dynamic range depends on the values of aberration correction needed, a nominal 10% tuning range is possible for most configurations accompanied by less than 1% change in the other two properties.

  6. Expressions for third-order aberration theory for holographic images

    Indian Academy of Sciences (India)

    S K Tripathy; S Ananda Rao

    2003-01-01

    Expressions for third-order aberration in the reconstructed wave front of point objects are established by Meier. But Smith, Neil Mohon, Sweatt independently reported that their results differ from that of Meier. We found that coefficients for spherical aberration, astigmatism, tally with Meier’s while coefficients for distortion and coma differ.

  7. Numerical correction of aberrations via phase retrieval with speckle illumination

    DEFF Research Database (Denmark)

    Almoro, Percival; Gundu, Phanindra Narayan; Hanson, Steen Grüner

    2009-01-01

    What we believe to be a novel technique for wavefront aberration measurement using speckle patterns is presented. The aberration correction is done numerically. A tilted lens is illuminated with a partially developed speckle field, and the transmitted light intensity is sampled at axially displaced...

  8. Effects of aberrations in spatiotemporal focusing of ultrashort laser pulses.

    Science.gov (United States)

    Sun, Bangshan; Salter, Patrick S; Booth, Martin J

    2014-04-01

    Spatiotemporal focusing, or simultaneous spatial and temporal focusing (SSTF), has already been adopted for various applications in microscopy, photoactivation for biological studies, and laser fabrication. We investigate the effects of aberrations on focus formation in SSTF, in particular, the effects of phase aberrations related to low-order Zernike modes and a refractive index mismatch between the immersion medium and sample. By considering a line focus, we are able to draw direct comparison between the performance of SSTF and conventional spatial focusing (SF). Wide-field SSTF is also investigated and is found to be much more robust to aberrations than either line SSTF or SF. These results show the sensitivity of certain focusing methods to specific aberrations, and can inform on the necessity and benefit of aberration correction.

  9. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    Science.gov (United States)

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (pjob and setting up a safe environment created a statistically significant effect on employees, and some sufficient satisfaction was

  10. Age-related changes in ocular aberrations with accommodation.

    Science.gov (United States)

    Radhakrishnan, Hema; Charman, W Neil

    2007-05-30

    This study investigates the changes in aberrations with monocular accommodation as a function of age. Second-order and higher order wavefront aberrations and pupil size were measured as a function of accommodation demand over the range of 0-4 D in the right eyes of 47 normal subjects with ages between 17 and 56 years. Higher order ocular Zernike aberrations were analyzed for the natural pupil size in terms of their equivalent defocus and were also determined for fixed pupil diameters of 4.5 mm in the unaccommodated eyes and 2.5 mm in the accommodating eyes. With relaxed accommodation (0 D accommodation stimulus), the major change with age was in the value of C4(0), which increased in positive value over the age range studied, although the total higher order RMS wavefront aberration did not increase. When the data were analyzed for natural pupils, spherical aberration was again found to change systematically in the positive direction with age. The equivalent defocus of total higher order RMS error for natural pupils showed no significant correlation with age (p > .05). With active accommodation, spherical aberration was found to decrease and become negative as the accommodative response increased in the younger subjects (40 years), the spherical aberration showed only small changes, some of which were positive, within the limited amplitude of accommodation available. Other higher order aberrations and the RMS of higher order aberrations did not appear to change systematically with accommodation, except in the oldest subjects. The change with age in the relationship between aberration and accommodation is interpreted in terms of the changing gradients of refractive index and surface curvatures of the crystalline lens.

  11. CPD Banding Patterns and Identification of 45S Rdna Sites in Tomato%番茄的CPD带型和45S rDNA位点的鉴别

    Institute of Scientific and Technical Information of China (English)

    佘朝文; 刘静宇; 宋运淳

    2005-01-01

    采用CPD(PI和DAPI组合)染色对番茄减数分裂粗线期和有丝分裂中期染色体进行了显带分析,随后用两种不同的45S rDNA克隆在相同的分裂相进行了荧光原位杂交定位分析.CPD染色在8条粗线期染色体上显示出了10条红色的CPD带纹,在6对有丝分裂中期染色体上显示出了12条CPD带纹.有丝分裂中期染色体上的CPD带纹与粗线期染色体上显著的带纹具有对应性.用改良的CPD染色程序清晰而稳定地显示出这些特征性的CPD带纹为番茄的染色体,特别是有丝分裂中期染色体提供了新的识别标记.用番茄的一个45S rDNA克隆进行的荧光原位杂交,不仅在位于2号染色体短臂的随体上显示了强的杂交信号,而且在粗线期染色体的5个CPD带区或有丝分裂中期染色体的4对CPD带区显示了弱的杂交信号.然而,用来自小麦的45S rDNA克隆pTa71进行的原位杂交却只在随体上显示了杂交信号.鉴于所用的两个45S rDNA克隆在序列上的差异,推断在番茄基因组中只有随体含有45S rDNA单位的编码区,即番茄只有一对45S rDNA位点.%In this study,we performed sequentially combined PI and DAPI (CPD) staining and FiSH with two different 45S rDNA clones on meiotic pachytene and mitotic metaphase chromosomes in tomato. Ten red CPD bands were shown on eight pachytene bivalents,and 12 bands were shown on six pairs of mitotic metaphase chromosomes. The CPD bands exhibited on mitotic metaphase chromosomes corresponded to the prominent bands exhibited on the pachytene chromosomes. The distinctive CPD bands, which could be constantly and clearly detected using the CPD staining procedure we improved, provided new landmarks for chromosome identification in tomato. FISH with the tomato 45S rDNA clone revealed very strong signal(s) in the satellite(s) on the short arm of chromosome 2 as well as weak signals in five CPD banded regions at pachytene or four pairs of CPD banded regions at

  12. S6 Kinase is essential for MYC-dependent rDNA transcription in Drosophila.

    Science.gov (United States)

    Mitchell, Naomi C; Tchoubrieva, Elissaveta B; Chahal, Arjun; Woods, Simone; Lee, Amanda; Lin, Jane I; Parsons, Linda; Jastrzebski, Katarzyna; Poortinga, Gretchen; Hannan, Katherine M; Pearson, Richard B; Hannan, Ross D; Quinn, Leonie M

    2015-10-01

    Increased rates of ribosome biogenesis and biomass accumulation are fundamental properties of rapidly growing and dividing malignant cells. The MYC oncoprotein drives growth predominantly via its ability to upregulate the ribosome biogenesis program, in particular stimulating the activity of the RNA Polymerase I (Pol I) machinery to increase ribosomal RNA (rRNA) transcription. Although MYC function is known to be highly dependent on the cellular signalling context, the pathways interacting with MYC to regulate transcription of ribosomal genes (rDNA) in vivo in response to growth factor status, nutrient availability and cellular stress are only beginning to be understood. To determine factors critical to MYC-dependent stimulation of rDNA transcription in vivo, we performed a transient expression screen for known oncogenic signalling pathways in Drosophila. Strikingly, from the broad range of pathways tested, we found that ribosomal protein S6 Kinase (S6K) activity, downstream of the TOR pathway, was the only factor rate-limiting for the rapid induction of rDNA transcription due to transiently increased MYC. Further, we demonstrated that one of the mechanism(s) by which MYC and S6K cooperate is through coordinate activation of the essential Pol I transcription initiation factor TIF-1A (RRN 3). As Pol I targeted therapy is now in phase 1 clinical trials in patients with haematological malignancies, including those driven by MYC, these data suggest that therapies dually targeting Pol I transcription and S6K activity may be effective in treating MYC-driven tumours.

  13. Supersonic Fe beam source for chromatic aberration-free laser focusing of atoms

    CERN Document Server

    Bosch, R C M; Van der Straten, P; Leeuwen, K A H

    2002-01-01

    A monochromatic Fe beam is generated by heated supersonic expansion of argon seeded with Fe vapor. At a nozzle temperature of 1930 K and 800 torr argon inlet pressure the Fe beam has an axial velocity spread of 8% and intensity of 3 x 10 sup 1 sup 5 s sup - sup 1 sr sup - sup 1 , corresponding to a deposition rate of 10 nm/h at 150 mm from the nozzle. The two-chamber alumina crucibles are chemically stable for liquid Fe. With 400 mm sup 3 Fe we have operated for more than 200 hours without reloading. The power consumption at 1930 K is 750 W. Temperature stability at constant power (without feedback) is better than 30 K. The source is intended for deposition of nano-structures by laser focusing of the Fe beam. The small axial velocity spread virtually eliminates the increase in focal spot size due to chromatic aberration. (authors)

  14. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  15. Chromosome aberrations in solid tumors have a stochastic nature

    Energy Technology Data Exchange (ETDEWEB)

    Castro, Mauro A.A. [Departamento de Bioquimica, Universidade Federal do Rio Grande do Sul, Rua Ramiro Barcelos 2600-anexo, Porto Alegre 90035-003 (Brazil) and Departamento de Medicina Interna, Hospital de Clinicas de Porto Alegre, Universidade Federal do Rio Grande do Sul, Rua Ramiro Barcelos 2350, Porto Alegre 90035-903 (Brazil) and Instituto de Fisica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Porto Alegre 91501-970 (Brazil) and Universidade Luterana do Brasil, Rua Miguel Tostes 101, Canoas 92420-280 (Brazil)]. E-mail: mauro@ufrgs.br; Onsten, Tor G.H. [Departamento de Medicina Interna, Hospital de Clinicas de Porto Alegre, Universidade Federal do Rio Grande do Sul, Rua Ramiro Barcelos 2350, Porto Alegre 90035-903 (Brazil); Universidade Luterana do Brasil, Rua Miguel Tostes 101, Canoas 92420-280 (Brazil); Moreira, Jose C.F. [Departamento de Bioquimica, Universidade Federal do Rio Grande do Sul, Rua Ramiro Barcelos 2600-anexo, Porto Alegre 90035-003 (Brazil); Almeida, Rita M.C. de [Instituto de Fisica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Porto Alegre 91501-970 (Brazil)

    2006-08-30

    An important question nowadays is whether chromosome aberrations are random events or arise from an internal deterministic mechanism, which leads to the delicate task of quantifying the degree of randomness. For this purpose, we have defined several Shannon information functions to evaluate disorder inside a tumor and between tumors of the same kind. We have considered 79 different kinds of solid tumors with 30 or more karyotypes retrieved from the Mitelman Database of Chromosome Aberrations in Cancer. The Kaplan-Meier cumulative survival was also obtained for each solid tumor type in order to correlate data with tumor malignance. The results here show that aberration spread is specific for each tumor type, with high degree of diversity for those tumor types with worst survival indices. Those tumor types with preferential variants (e.g. high proportion of a given karyotype) have shown better survival statistics, indicating that aberration recurrence is a good prognosis. Indeed, global spread of both numerical and structural abnormalities demonstrates the stochastic nature of chromosome aberrations by setting a signature of randomness associated to the production of disorder. These results also indicate that tumor malignancy correlates not only with karyotypic diversity taken from different tumor types but also taken from single tumors. Therefore, by quantifying aberration spread, we could confront diverse models and verify which of them points to the most likely outcome. Our results suggest that the generating process of chromosome aberrations is neither deterministic nor totally random, but produces variations that are distributed between these two boundaries.

  16. Aberrant DNA methylation in cloned ovine embryos

    Institute of Scientific and Technical Information of China (English)

    LIU Lei; HOU Jian; LEI TingHua; BAI JiaHua; GUAN Hong; AN XiaoRong

    2008-01-01

    By using the approach of immunofluorescence staining with an antibody against 5-methylcytosine (5MeC), the present study detected the DNA methylation patterns of cloned ovine embryos. The em-bryos derived from in vitro fertilization were also examined for reference purpose. The results showed that: (1) during the pre-implantation development, cloned embryos displayed a similar demethylation profile to the fertilized embryos; that is, the methylation level decreased to the lowest at 8-cell stage, and then increased again at morulae stage. However, methylation level was obviously higher in cloned embryos than in stage-matched fertilized embryos, especially at 8-cell stage and afterwards; (2) at blastocyst stage, the methylation pattern in cloned embryos was different from that in fertilized em-bryos. In cloned blastocyst, inner cell mass (ICM) exhibited a comparable level to trophectoderm cells (TE), while in in-vitro fertilized blastocyst the methylation level of ICM was lower than that of TE, which is not consistent with that reported by other authors. These results indicate that DNA methylation is abnormally reprogrammed in cloned embryos, implying that aberrant DNA methylation reprogramming may be one of the factors causing cloned embryos developmental failure.

  17. Epigenetic aberrations and therapeutic implications in gliomas.

    Science.gov (United States)

    Natsume, Atsushi; Kondo, Yutaka; Ito, Motokazu; Motomura, Kazuya; Wakabayashi, Toshihiko; Yoshida, Jun

    2010-06-01

    Almost all cancer cells have multiple epigenetic abnormalities, which combine with genetic changes to affect many cellular processes, including cell proliferation and invasion, by silencing tumor-suppressor genes. In this review, we focus on the epigenetic mechanisms of DNA hypomethylation and CpG island hypermethylation in gliomas. Aberrant hypermethylation in promoter CpG islands has been recognized as a key mechanism involved in the silencing of cancer-associated genes and occurs at genes with diverse functions related to tumorigenesis and tumor progression. Such promoter hypermethylation can modulate the sensitivity of glioblastomas to drugs and radiotherapy. As an example, the methylation of the O6-methylguanine DNA methyltransferase (MGMT) promoter is a specific predictive biomarker of tumor responsiveness to chemotherapy with alkylating agents. Further, we reviewed reports on pyrosequencing - a simple technique for the accurate and quantitative analysis of DNA methylation. We believe that the quantification of MGMT methylation by pyrosequencing might enable the selection of patients who are most likely to benefit from chemotherapy. Finally, we also evaluated the potential of de novo NY-ESO-1, the most immunogenic cancer/testis antigen (CTA) discovered thus far, as an immunotherapy target. The use of potent epigenetics-based therapy for cancer cells might restore the abnormally regulated epigenomes to a more normal state through epigenetic reprogramming. Thus, epigenetic therapy may be a promising and potent treatment for human neoplasia.

  18. Discriminatory profile of rDNA sites and trend for acrocentric chromosome formation in the genus Trachinotus Lacépède, 1801 (Perciformes, Carangidae

    Directory of Open Access Journals (Sweden)

    Uedson Jacobina

    2012-10-01

    Full Text Available Chromosomal traits have provided valuable information for phylogeny and taxonomy of several fish groups. Three Atlantic Carangidae species of the genus Trachinotus Lacépède, 1801 (T. goodei Jordan et Evermann, 1896, T. carolinus (Linnaeus, 1766 and T. falcatus (Linnaeus, 1758 were investigated,2n=48 chromosomes but different chromosomal arms (FN number, i.e., 52, 56 and 58, respectively, in view of the different number of two-armed chromosomes found in their karyotypes. Thus, T. goodei, T. carolinus and T. falcatus present a progressive distance from the probable basal karyotype proposed for Perciformes (2n=48 acrocentrics, FN=48. At first sight, these findings do not agree with the phylogenetic hypothesis based on mitochondrial sequences, where T. goodei appear as the most derived species, followed by T. falcatus and T. carolinus, respectively. However, the chromosomal mapping of ribosomal DNAs was informative for clarifying this apparent conflict. Indeed, the multiple 5S and 18S rDNA sites found in T. goodei corroborate the most derived condition for this species. In this sense, the occurrence of the unexpected number of two-armed chromosomes and FN value for this species, as well as for T. carolinus, must be due to additional rounds of acrocentric formation in these species, modifying the macrostructure of their karyotypes.

  19. Global Sustainable Development Through the Integrated Lean Management (Green 5-S Model for TQM

    Directory of Open Access Journals (Sweden)

    Ho Samuel K. M.

    2014-11-01

    Full Text Available Based on the 'Best Paper-2010' by the TQM Journal, the author has a chance to test out the model in a number of firms in Malaysia through SIRIM. Furthermore, riding on the success, SIRIM has named it as the SIRIM Green 5-S Model. As a result, the aim of this paper is to share the experience of the “SIRIM Green 5-S Model for Sustainable Development”. Since 1993, the author used the proprietary 5-S Checklist for training and consultancy in no less than 10 countries with over 50,000 persons from around 2,000 organisatioins world-wide. On the other hand, HKSAR takes the lead in the global oil energy consumption/GPD. The experience will be shared in this article.

  20. 5S:n käyttöönotto Nomet Oy:ssä

    OpenAIRE

    Nummi, Janne

    2012-01-01

    Tämän opinnäytetyön aiheena on 5S-toimintamallin käyttöönotto Nomet Oy:n tuotannossa, Tampereen Vehmaisissa. Nomet on alihankintakonepaja, joka on erikoistunut lastuavaan työstöön. Yrityksessä on päätetty ottaa käyttöön Lean- valmistusfilosofiaan pohjautuvaa tuotannon uudistamista. 5S on yksi Leanin monista työkaluista, josta on hyvä lähteä alkuun. 5S:n päätavoitteena on parantaa tuotantoprosesseja siisteyden, järjestyksen ja standardisoinnin avulla. Työssä on esitelty kahdesta tuotannon ...

  1. Nonviral Gene Targeting at rDNA Locus of Human Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Youjin Hu

    2013-01-01

    Full Text Available Background. Genetic modification, such as the addition of exogenous genes to the MSC genome, is crucial to their use as cellular vehicles. Due to the risks associated with viral vectors such as insertional mutagenesis, the safer nonviral vectors have drawn a great deal of attention. Methods. VEGF, bFGF, vitamin C, and insulin-transferrin-selenium-X were supplemented in the MSC culture medium. The cells’ proliferation and survival capacity was measured by MTT, determination of the cumulative number of cells, and a colony-forming efficiency assay. The plasmid pHr2-NL was constructed and nucleofected into MSCs. The recombinants were selected using G418 and characterized using PCR and Southern blotting. Results. BFGF is critical to MSC growth and it acted synergistically with vitamin C, VEGF, and ITS-X, causing the cells to expand significantly. The neomycin gene was targeted to the rDNA locus of human MSCs using a nonviral human ribosomal targeting vector. The recombinant MSCs retained multipotential differentiation capacity, typical levels of hMSC surface marker expression, and a normal karyotype, and none were tumorigenic in nude mice. Conclusions. Exogenous genes can be targeted to the rDNA locus of human MSCs while maintaining the characteristics of MSCs. This is the first nonviral gene targeting of hMSCs.

  2. Structural analysis of two length variants of the rDNA intergenic spacer from Eruca sativa.

    Science.gov (United States)

    Lakshmikumaran, M; Negi, M S

    1994-03-01

    Restriction enzyme analysis of the rRNA genes of Eruca sativa indicated the presence of many length variants within a single plant and also between different cultivars which is unusual for most crucifers studied so far. Two length variants of the rDNA intergenic spacer (IGS) from a single individual E. sativa (cv. Itsa) plant were cloned and characterized. The complete nucleotide sequences of both the variants (3 kb and 4 kb) were determined. The intergenic spacer contains three families of tandemly repeated DNA sequences denoted as A, B and C. However, the long (4 kb) variant shows the presence of an additional repeat, denoted as D, which is a duplication of a 224 bp sequence just upstream of the putative transcription initiation site. Repeat units belonging to the three different families (A, B and C) were in the size range of 22 to 30 bp. Such short repeat elements are present in the IGS of most of the crucifers analysed so far. Sequence analysis of the variants (3 kb and 4 kb) revealed that the length heterogeneity of the spacer is located at three different regions and is due to the varying copy numbers of repeat units belonging to families A and B. Length variation of the spacer is also due to the presence of a large duplication (D repeats) in the 4 kb variant which is absent in the 3 kb variant. The putative transcription initiation site was identified by comparisons with the rDNA sequences from other plant species.

  3. Protein purification in multicompartment electrolyzers for crystal growth of r-DNA products in microgravity

    Science.gov (United States)

    Righetti, Pier Giorgio; Casale, Elena; Carter, Daniel; Snyder, Robert S.; Wenisch, Elisabeth; Faupel, Michel

    1990-01-01

    Recombinant-DNA (deoxyribonucleic acid) (r-DNA) proteins, produced in large quantities for human consumption, are now available in sufficient amounts for crystal growth. Crystallographic analysis is the only method now available for defining the atomic arrangements within complex biological molecules and decoding, e.g., the structure of the active site. Growing protein crystals in microgravity has become an important aspect of biology in space, since crystals that are large enough and of sufficient quality to permit complete structure determinations are usually obtained. However even small amounts of impurities in a protein preparation are anathema for the growth of a regular crystal lattice. A multicompartment electrolyzer with isoelectric, immobiline membranes, able to purify large quantities of r-DNA proteins is described. The electrolyzer consists of a stack of flow cells, delimited by membranes of very precise isoelectric point (pI, consisting of polyacrylamide supported by glass fiber filters containing Immobiline buffers and titrants to uniquely define a pI value) and very high buffering power, able to titrate all proteins tangent or crossing such membranes. By properly selecting the pI values of two membranes delimiting a flow chamber, a single protein can be kept isoelectric in a single flow chamber and thus, be purified to homogeneity (by the most stringent criterion, charge homogeneity).

  4. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    Science.gov (United States)

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-03

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics.

  5. Karyotype analysis and physical mapping of 45S rDNA in eight species of Sophora,Robinia,and Amorpha

    Institute of Scientific and Technical Information of China (English)

    LIU Bo; CHEN Chengbin; LI Xiulan; QI Liwang; HAN Suying

    2006-01-01

    The karyotype analysis and physical locations of 45S rDNA were carried out by means of fluorescence in situ hybridization in three species,and two forms of Sophora,two species of Robina,and one species of Amorpha.S.japonica L.,S.japonica L.f.oligophylla Franch.,S.japonica L.f.pendula Loud.,and S.xanthantha C.Y.Ma.are all tetraploids with 2n=28.There were four 45S rDNA sites in pericentromeric regions of two Pairs of chromosomes in each of them.S.rubriflora Tsoong.is a triploid with 2n=21,and three sites were located in each satellite of group 5 chromosomes.In R.pseudoacacia L.(2n=2x=22),we examined four intensive signals in telomeric regions of two pairs of satellite chromosomes.In R.hispida L.(2n=2x=30),there were four other signals in centromeric regions besides those like in R.pseudoacacia.Amorpha fruticosa L.has most chromosomes(2n=40)among the eight materials,however,there were only six 45S rDNA loci and they laid in centromeric regions,and satellites of three pairs of chromosomes.45S rDNA is a valuable chromosomal landmark in karyotype analysis.The distribution and genomic organization Of rDNA in the three genera were also discussed.

  6. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice

    Directory of Open Access Journals (Sweden)

    Julie M. Allen

    2016-07-01

    Full Text Available Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura. We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain.

  7. Study of residual aberration for non-imaging focusing heliostat

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Y.T.; Chong, K.K.; Lim, B.H.; Lim, C.S. [Institute of Energy and Environment, Malaysia University of Science and Technology, No. 17, Jalan SS7/26, Kelana Jaya, 47301 Petaling Jaya, Selangor (Malaysia)

    2003-08-01

    Instead of using a specific focusing geometry, a non-imaging focusing heliostat has no fixed geometry but is composed of many small movable element mirrors that can be manoeuvred to eliminate the first-order aberration. Following our previous publication on the principle of non-imaging focusing heliostat, this paper further explores higher order residual aberration that limits the size of the focusing spot. The residual aberration can be partially corrected by offsetting the pivot point of mirrors and pre-setting the tilting angles of mirrors.

  8. Altered gravity influences rDNA and NopA100 localization in nucleoli

    Science.gov (United States)

    Sobol, M. A.; Kordyum, E. L.

    Fundamental discovery of gravisensitivity of cells no specified to gravity perception focused increasing attention on an elucidation of the mechanisms involved in altered gravity effects at the cellular and subcellular levels. The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts with ribosomal and nonribosomal proteins. The mechanisms inducing the changes in the subcomponents of the nucleolus that is morphologically defined yet highly dynamic structure are still unknown in detail. To understand the functional organization of the nucleolus as in the control as under altered gravity conditions it is essential to determine both the precise location of rDNA and the proteins playing the key role in rRNA processing. Lepidium sativum seeds were germinated in 1% agar medium on the slow horizontal clinostat (2 rpm) and in the stationary conditions. We investigated the root meristematic cells dissected from the seedlings grown in darkness for two days. The investigations were carried out with anti-DNA and anti-NopA100 antibodies labeling as well as with TdT procedure, and immunogold electron microscopy. In the stationary growth conditions, the anti-DNA antibody as well TdT procedure were capable of detecting fibrillar centers (FCs) and the dense fibrillar component (DFC) in the nucleolus. In FCs, gold particles were revealed on the condensed chromatin inclusions, internal fibrils of decondensed rDNA and the transition zone FC-DFC. Quantitatively, FCs appeared 1,5 times more densely labeled than DFC. NopA100 was localized in FCs and in DFC. In FCs, the most of protein was revealed in the transition zone FC-DFC. After a quantitative study, FCs and the transition zone FC-DFC appeared to contain NopA100 1,7 times more than DFC. Under the conditions of altered gravity, quantitative data clearly showed a redistribution of nucleolar DNA and NopA100 between FCs and DFC in comparison with the control. In

  9. A Study of the Impact of Implementing 5s on Efficiency and Effectiveness of Constabularies' Workers

    Directory of Open Access Journals (Sweden)

    Milad Aghaee

    2013-01-01

    Full Text Available IntroductionPeople always seek ways for improving and using optimally the current facilities which are available. KAIZEN is a Japanese expression which means improvement. In fact, KAIZEN is a continuous improvement which encompasses all people, managers and employees alike, and its philosophy is based on continuous improvement in lifestyle of human beings. Like an umbrella, KAIZEN encompasses all principles for moving to promotion and organizational excellence. 5s is one of these principles, which is an abbreviation for 5 Japanese values, including a set of standards and activities directed at creating a systemic, clean, enjoyable and creative environment. What causes 5s to be included in KAIZEN is implementation of changes and having small but continuous improvements; an improvement which keeps business in competition and helps increase the competitive power of the organization to perform effective and efficient improvements. This research aims to consider the impact of 5s on the efficiency and effectiveness of police forces. In other words, this research is based on considering the relationships between 5s and police force efficiency and effectiveness. Material & MethodsThis research examines a new conceptual model using scientific resources. This is a practical research from the point of its goal. Also, it is a descriptive and survey research which considers the impact of one variable on other variables. So, two groups from two constabularies were selected and a special educational course was implemented relating to the main topic of the research (5s implementation for workers of these constabularies. The data of research were analyzed using SPSS software. Statistical society of this research include all employees in 134 and 140 of the Great Tehran Police Commanding Center. The volume of sample is selected by KOKRAN formula which is a sample volume determination technique. Totally, 132 individuals were chosen from police forces for

  10. High order aberration and straylight evaluation after cataract surgery with implantation of an aspheric,aberration correcting monofocal intraocular lens

    Institute of Scientific and Technical Information of China (English)

    Florian; T; A; Kretz; Tamer; Tandogan; Ramin; Khoramnia; Gerd; U; Auffarth

    2015-01-01

    ·AIM: To evaluate the quality of vision in respect to high order aberrations and straylight perception after implantation of an aspheric, aberration correcting,monofocal intraocular lens(IOL).·METHODS: Twenty-one patients(34 eyes) aged 50 to83 y underwent cataract surgery with implantation of an aspheric, aberration correcting IOL(Tecnis ZCB00,Abbott Medical Optics). Three months after surgery they were examined for uncorrected(UDVA) and corrected distance visual acuity(CDVA), contrast sensitivity(CS)under photopic and mesopic conditions with and without glare source, ocular high order aberrations(HOA, Zywave II) and retinal straylight(C-Quant).· RESULTS: Postoperatively, patients achieved a postoperative CDVA of 0.0 log MAR or better in 97.1% of eyes. Mean values of high order abberations were +0.02±0.27(primary coma components) and-0.04 ±0.16(spherical aberration term). Straylight values of the C-Quant were 1.35±0.44 log which is within normal range of age matched phakic patients. The CS measurements under mesopic and photopic conditions in combination with and without glare did not show any statistical significance in the patient group observed(P ≥0.28).· CONCLUSION: The implantation of an aspherical aberration correcting monofocal IOL after cataractsurgery resulted in very low residual higher order aberration(HOA) and normal straylight.

  11. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.

    Science.gov (United States)

    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha

    2012-10-12

    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  12. Anisoplanatism in adaptive optics systems due to pupil aberrations

    Energy Technology Data Exchange (ETDEWEB)

    Bauman, B

    2005-08-01

    Adaptive optics systems typically include an optical relay that simultaneously images the science field to be corrected and also a set of pupil planes conjugate to the deformable mirror of the system. Often, in the optical spaces where DM's are placed, the pupils are aberrated, leading to a displacement and/or distortion of the pupil that varies according to field position--producing a type of anisoplanatism, i.e., a degradation of the AO correction with field angle. The pupil aberration phenomenon is described and expressed in terms of Seidel aberrations. An expression for anisoplanatism as a function of pupil distortion is derived, an example of an off-axis parabola is given, and a convenient method for controlling pupil-aberration-generated anisoplanatism is proposed.

  13. Automated spherical aberration correction in scanning confocal microscopy

    NARCIS (Netherlands)

    Yoo, H.W.; Royen, M.E.; van Cappellen, W.A.; Houtsmuller, A.B.; Verhaegen, M.H.G.; Schitter, G.

    2014-01-01

    Mismatch between the refractive indexes of immersion media and glass coverslips introduces spherical aberrations in microscopes especially for high numerical aperture objectives. This contribution demonstrates an automated adjustment of the coverslip correction collar in scanning confocal microscopy

  14. Impact of primary aberrations on coherent lidar performance

    DEFF Research Database (Denmark)

    Hu, Qi; Rodrigo, Peter John; Iversen, Theis Faber Quist;

    2014-01-01

    In this work we investigate the performance of a monostatic coherent lidar system in which the transmit beam is under the influence of primary phase aberrations: spherical aberration (SA) and astigmatism. The experimental investigation is realized by probing the spatial weighting function...... of the lidar system using different optical transceiver configurations. A rotating belt is used as a hard target. Our study shows that the lidar weighting function suffers from both spatial broadening and shift in peak position in the presence of aberration. It is to our knowledge the first experimental...... effciency, the optimum truncation of the transmit beam and the spatial sensitivity of a CW coherent lidar system. Under strong degree of aberration, the spatial confinement is significantly degraded. However for SA, the degradation of the spatial confinement can be reduced by tuning the truncation...

  15. Automated computational aberration correction method for broadband interferometric imaging techniques.

    Science.gov (United States)

    Pande, Paritosh; Liu, Yuan-Zhi; South, Fredrick A; Boppart, Stephen A

    2016-07-15

    Numerical correction of optical aberrations provides an inexpensive and simpler alternative to the traditionally used hardware-based adaptive optics techniques. In this Letter, we present an automated computational aberration correction method for broadband interferometric imaging techniques. In the proposed method, the process of aberration correction is modeled as a filtering operation on the aberrant image using a phase filter in the Fourier domain. The phase filter is expressed as a linear combination of Zernike polynomials with unknown coefficients, which are estimated through an iterative optimization scheme based on maximizing an image sharpness metric. The method is validated on both simulated data and experimental data obtained from a tissue phantom, an ex vivo tissue sample, and an in vivo photoreceptor layer of the human retina.

  16. Aberrant internal carotid artery in the middle ear

    Energy Technology Data Exchange (ETDEWEB)

    Roh, Keun Tak; Kang, Hyun Koo [Dept. of Radiology, Seoul Veterans Hospital, Seoul (Korea, Republic of)

    2014-10-15

    The knowledge about the aberrant internal carotid artery (ICA) in the middle ear is essential for clinicians, because a misdiagnosis of the aberrant ICA could have serious consequences such as excessive aural bleeding during a middle ear surgery. A 38-year-old woman presented with tinnitus and hearing difficulties of the left ear that had started 5 years ago. During otoscopy, an anteroinferior bluish mass was seen in the tympanic space. Computed tomography and magnetic resonance imaging demonstrated a left-side aberrant ICA with bony dehiscence of the carotid canal in the middle ear and a reduced diameter of the tympanic ICA. Herein we report a case of an aberrant ICA in the middle ear. We also review the literature regarding this important vascular anomaly of the temporal bone which may lead to disastrous surgical complications.

  17. Intrinsic Third Order Aberrations in Electrostatic and Magnetic Quadrupoles

    CERN Document Server

    Baartman, R

    2015-01-01

    Intrinsic aberrations are those which occur due to the finite length of the desired field configuration. They are often loosely ascribed to the fringing field. This is misleading as it implies that the effects can be minimized by shaping the fields. In fact, there is an irreducible component related to the broken symmetry. It is present even in the hard-edge limit, and moreover, the other (soft-edge) effects can be simply ascribed to the intrinsic aberration spread over a finite length. We rederive the aberration formulas for quadrupoles using a Hamiltonian formalism. This allows for an easy comparison of electrostatic and magnetic quadrupoles. For different combinations of large and small emittances in the two transverse planes, it is found that in some situations electrostatic quadrupoles have lower aberrations, while in others, magnetic quadrupoles are better. As well, we discuss the ways in which existing transport codes handle quadrupole fringe fields. Pitfalls are pointed out and improvements proposed.

  18. Are persistent delusions in schizophrenia associated with aberrant salience?

    Directory of Open Access Journals (Sweden)

    Rafeef Abboud

    2016-06-01

    Conclusion: These findings do not support the hypothesis that persistent delusions are related to aberrant motivational salience processing in TRS patients. However, they do support the view that patients with schizophrenia have impaired reward learning.

  19. Study of the wavefront aberrations in children with amblyopia

    Institute of Scientific and Technical Information of China (English)

    ZHAO Peng-fei; ZHOU Yue-hua; WANG Ning-li; ZHANG Jing

    2010-01-01

    Background Amblyopia is a common ophthalmological condition and the wavefront aberrometer is a relatively new diagnostic tool used globally to measure optical characteristics of human eyes as well as to study refractive errors in amblyopic eyes. We studied the wavefront aberration of the amblyopic children's eyes and analyzed the mechanism of the wavefront aberration in the formation of the amblyopia, try to investigate the new evidence of the treatment of the amblyopia, especially in the refractory amblyopia.Methods The WaveScan Wavefront System (VISX, USA) aberrometer was used to investigate four groups of children under dark accommodation and cilliary muscle paralysis. There were 45 cases in the metropic group, 87 in the amblyopic group, 92 in the corrected-amblyopic group and 38 in the refractory amblyopic group. One-way analysis of variance (ANOVA), t-test and multivariate linear regression were used to analyze all the data.Results Third order to 6th order aberrations showed a decreasing trend whereas in the higher order aberrations the main ones were 3rd order coma (Z3-1-Z31), trefoil (Z3-3-Z33) and 4th order aberration (Z40); and 3rd order coma represented the highest percentage of all three main aberrations. Within 3rd order coma, vertical coma (Z3-1) accounted for a greater percentage than horizontal coma (Z31). Significant differences of vertical coma were found among all clinical groups of children: vertical coma in the amblyopic group (0.17±0.15) was significantly higher than in the metropic group (0.11±0.13, P0.05).Conclusions Although lower order aberrations such as defocus (myopia and hyperopia) and astigmatism are major factors determining the quality of the retinal image, higher order aberrations also need to be considered in amblyopic eyes as their effects are significant.

  20. Multiplexed aberration measurement for deep tissue imaging in vivo

    OpenAIRE

    Wang, Chen; Liu, Rui; Milkie, Daniel E; Sun, Wenzhi; Tan, Zhongchao; Kerlin, Aaron; Chen, Tsai-Wen; Kim, Douglas S.; Ji, Na

    2014-01-01

    We describe a multiplexed aberration measurement method that modulates the intensity or phase of light rays at multiple pupil segments in parallel to determine their phase gradients. Applicable to fluorescent-protein-labeled structures of arbitrary complexity, it allows us to obtain diffraction-limited resolution in various samples in vivo. For the strongly scattering mouse brain, a single aberration correction improves structural and functional imaging of fine neuronal processes over a large...

  1. Multiplexed aberration measurement for deep tissue imaging in vivo

    Science.gov (United States)

    Wang, Chen; Liu, Rui; Milkie, Daniel E.; Sun, Wenzhi; Tan, Zhongchao; Kerlin, Aaron; Chen, Tsai-Wen; Kim, Douglas S.; Ji, Na

    2014-01-01

    We describe a multiplexed aberration measurement method that modulates the intensity or phase of light rays at multiple pupil segments in parallel to determine their phase gradients. Applicable to fluorescent-protein-labeled structures of arbitrary complexity, it allows us to obtain diffraction-limited resolution in various samples in vivo. For the strongly scattering mouse brain, a single aberration correction improves structural and functional imaging of fine neuronal processes over a large imaging volume. PMID:25128976

  2. Wide-angle chromatic aberration corrector for the human eye.

    Science.gov (United States)

    Benny, Yael; Manzanera, Silvestre; Prieto, Pedro M; Ribak, Erez N; Artal, Pablo

    2007-06-01

    The human eye is affected by large chromatic aberration. This may limit vision and makes it difficult to see fine retinal details in ophthalmoscopy. We designed and built a two-triplet system for correcting the average longitudinal chromatic aberration of the eye while keeping a reasonably wide field of view. Measurements in real eyes were conducted to examine the level and optical quality of the correction. We also performed some tests to evaluate the effect of the corrector on visual performance.

  3. Aberrant cervical thymus mimicking thyroid on ultrasonography: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong Sub; Park, Ju Hyun; Kim, Bong Soo; Park, Ji Kang; Choi, Jae Hyuck [Jeju National Univ. Hospital/Jeju National Univ. School of Medicine, Jeju (Korea, Republic of)

    2012-10-15

    Aberrant cervical thymus is rarely reported in adults. We report a case of solid aberrant cervical thymus in a 27 year old female, which was found incidentally on ultrasonography for the evaluation of the thyroid cancer. On ultrasonography, the lesion was found between the left thyroid and common carotid artery without any remarkable interface echo, and had similar echogenicity to the thyroid. The lesion extended to the upper pole of the left thyroid.

  4. Pattern of Chromosomal Aberrations in Patients from North East Iran

    Directory of Open Access Journals (Sweden)

    Saeedeh Ghazaey

    2013-01-01

    Full Text Available Objective: Chromosomal aberrations are common causes of multiple anomaly syndromes. Recurrent chromosomal aberrations have been identified by conventional cytogenetic methods used widely as one of the most important clinical diagnostic techniques.Materials and Methods: In this retrospective study, the incidences of chromosomal aberrations were evaluated in a six year period from 2005 to 2011 in Pardis Clinical and Genetics Laboratory on patients referred to from Mashhad and other cities in Khorasan province. Karyotyping was performed on 3728 patients suspected of having chromosomal abnormalities.Results: The frequencies of the different types of chromosomal abnormalities were determined, and the relative frequencies were calculated in each group. Among these patients, 83.3% had normal karyotypes with no aberrations. The overall incidences of chromosomal abnormalities were 16.7% including sex and autosomal chromosomal anomalies. Of those, 75.1 % showed autosomal chromosomal aberrations. Down syndrome (DS was the most prevalent autosomal aberration in the patients (77.1%. Pericentric inversion of chromosome 9 was seen in 5% of patients. This inversion was prevalent in patients with recurrent spontaneous abortion (RSA. Sex chromosomal aberrations were observed in 24.9% of abnormal patients of which 61% had Turner’s syndrome and 33.5% had Klinefelter’s syndrome.Conclusion: According to the current study, the pattern of chromosomal aberrations in North East of Iran demonstrates the importance of cytogenetic evaluation in patients who show clinical abnormalities. These findings provide a reason for preparing a local cytogenetic data bank to enhance genetic counseling of families who require this service.

  5. Aberrant Glycosylation as Biomarker for Cancer: Focus on CD43

    Directory of Open Access Journals (Sweden)

    Franca Maria Tuccillo

    2014-01-01

    Full Text Available Glycosylation is a posttranslational modification of proteins playing a major role in cell signalling, immune recognition, and cell-cell interaction because of their glycan branches conferring structure variability and binding specificity to lectin ligands. Aberrant expression of glycan structures as well as occurrence of truncated structures, precursors, or novel structures of glycan may affect ligand-receptor interactions and thus interfere with regulation of cell adhesion, migration, and proliferation. Indeed, aberrant glycosylation represents a hallmark of cancer, reflecting cancer-specific changes in glycan biosynthesis pathways such as the altered expression of glycosyltransferases and glycosidases. Most studies have been carried out to identify changes in serum glycan structures. In most cancers, fucosylation and sialylation are significantly modified. Thus, aberrations in glycan structures can be used as targets to improve existing serum cancer biomarkers. The ability to distinguish differences in the glycosylation of proteins between cancer and control patients emphasizes glycobiology as a promising field for potential biomarker identification. In this review, we discuss the aberrant protein glycosylation associated with human cancer and the identification of protein glycoforms as cancer biomarkers. In particular, we will focus on the aberrant CD43 glycosylation as cancer biomarker and the potential to exploit the UN1 monoclonal antibody (UN1 mAb to identify aberrant CD43 glycoforms.

  6. Dimensions of driving anger and their relationships with aberrant driving.

    Science.gov (United States)

    Zhang, Tingru; Chan, Alan H S; Zhang, Wei

    2015-08-01

    The purpose of this study was to investigate the relationship between driving anger and aberrant driving behaviours. An internet-based questionnaire survey was administered to a sample of Chinese drivers, with driving anger measured by a 14-item short Driving Anger Scale (DAS) and the aberrant driving behaviours measured by a 23-item Driver Behaviour Questionnaire (DBQ). The results of Confirmatory Factor Analysis demonstrated that the three-factor model (hostile gesture, arrival-blocking and safety-blocking) of the DAS fitted the driving anger data well. The Exploratory Factor Analysis on DBQ data differentiated four types of aberrant driving, viz. emotional violation, error, deliberate violation and maintaining progress violation. For the anger-aberration relation, it was found that only "arrival-blocking" anger was a significant positive predictor for all four types of aberrant driving behaviours. The "safety-blocking" anger revealed a negative impact on deliberate violations, a finding different from previously established positive anger-aberration relation. These results suggest that drivers with different patterns of driving anger would show different behavioural tendencies and as a result intervention strategies may be differentially effective for drivers of different profiles.

  7. Internal Audit of Quality in 5s Environment: Perception on Critical Factors, Effectiveness and Impact on Organizational Performance

    OpenAIRE

    2015-01-01

    Quality Environment (5S) Practice is a concept which has been widely adopted by organizations as one way to achieve Total Quality Management (TQM) and business excellence. 5S refers to 5 principles to maintain quality which emanate from Japanese word Seiri (sorting), Seiton (straightening), Seiso (shining), Seiketsu (standardize) and Shitsuke (sustain). 5s concept aims to create a conducive, clean and tidy workplace which in turn can improve work quality and performance. Internal audit of 5S ...

  8. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S

    1991-01-01

    4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...

  9. [PCR rDNA 16S used for the etiological diagnosis of blood culture negative endocarditis].

    Science.gov (United States)

    Baty, G; Lanotte, P; Hocqueloux, L; Prazuck, T; Bret, L; Romano, M; Mereghetti, L

    2010-06-01

    We report the case of a 55 year-old man presenting with a double aortic and mitral endocarditis for which resected valve culture was repeatedly negative. Specific PCR made on valves because of highly positive blood tests for Bartonella henselae remained negative. A molecular approach was made with 16S rDNA PCR, followed by sequencing. Bartonella quintana was identified as the etiology of endocarditis. B. quintana, "fastidious" bacteria, even if hard to identify in a laboratory, is often reported as a blood culture negative endocarditis (BCNE) agent. Molecular biology methods have strongly improved the diagnosis of BCNE. We propose a review of the literature focusing on the interest of broad-spectrum PCR on valve for the etiological diagnosis of BCNE.

  10. Diversity of 16S rDNA and environmental factor influencing microorganisms in Malan ice core

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The research on extrempholic microorganisms in glacial low-temperature environment receives more attention than ever before. Due to the successive chronological records in ice core, it is important to initiate microbiological studies on ice core samples. 23 samples from one ice core, drilled from central Qinghai-Tibetan Plateau, were analyzed. The number of total microorganisms and culturable microorganisms in different layers showed that it related with the content of dust in ice. It is suggested that the distribution of microorganisms in ice depends on the transportation of materials during glacier development. The bacteria diversity in Malan Glacier was analyzed by 16S rDNA sequencing methods, which showed that many sequences were similar to known psychrophilic bacteria.

  11. Sequence analysis of the rDNA intergenic spacer of Metarhizium strains isolated in Brazil

    Directory of Open Access Journals (Sweden)

    Fabiana Y. Yanaka-Schäfer

    2008-01-01

    Full Text Available To assess the extent of genetic variability of rDNA intergenic spacer (IGS in Metarhizium sp., 34 strains (27 isolated in Brazil were sequenced and analyzed together with an additional 20 Metarhizium anisopliae var. anisopliae sequences retrieved from GenBank. Overall, the global nucleotide diversity for the region under study was of 0.090, while for the Brazilian isolates it was only 0.016. Phylogenetic analyses showed four well-supported groups (A, B, C, and D, one of which (D has not been previously identified. All but one of the Brazilian strains cluster in this novel D phylogroup, suggesting that the genetic variation found in Brazil is a subset of the worldwide M. anisopiliae var. anisopliae variation.

  12. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters

    Directory of Open Access Journals (Sweden)

    Daniel Searle

    2016-03-01

    Full Text Available Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI’s SRA database (BioProject PRJNA294919.

  13. Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

    Science.gov (United States)

    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

    2013-11-01

    Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai.

  14. Hosts, distribution and genetic divergence (16S rDNA) of Amblyomma dubitatum (Acari: Ixodidae).

    Science.gov (United States)

    Nava, Santiago; Venzal, José M; Labruna, Marcelo B; Mastropaolo, Mariano; González, Enrique M; Mangold, Atilio J; Guglielmone, Alberto A

    2010-08-01

    We supply information about hosts and distribution of Amblyomma dubitatum. In addition, we carry out an analysis of genetic divergence among specimens of A. dubitatum from different localities and with respect to other Neotropical Amblyomma species, using sequences of 16S rDNA gene. Although specimens of A. dubitatum were collected on several mammal species as cattle horse, Tapirus terrestris, Mazama gouazoubira, Tayassu pecari, Sus scrofa, Cerdocyon thous, Myocastor coypus, Allouata caraya, Glossophaga soricina and man, most records of immature and adult stages of A. dubitatum were made on Hydrochoerus hydrochaeris, making this rodent the principal host for all parasitic stages of this ticks. Cricetidae rodents (Lundomys molitor, Scapteromys tumidus), opossums (Didelphis albiventris) and vizcacha (Lagostomus maximus) also were recorded as hosts for immature stages. All findings of A. dubitatum correspond to localities of Argentina, Brazil, Paraguay and Uruguay, and they were concentrated in the Biogeographical provinces of Pampa, Chaco, Cerrado, Brazilian Atlantic Forest, Parana Forest and Araucaria angustifolia Forest. The distribution of A. dubitatum is narrower than that of its principal host, therefore environmental variables rather than hosts determine the distributional ranges of this tick. The intraspecific genetic divergence among 16S rDNA sequences of A. dubitatum ticks collected in different localities from Argentina, Brazil and Uruguay was in all cases lower than 0.8%, whereas the differences with the remaining Amblyomma species included in the analysis were always bigger than 6.8%. Thus, the taxonomic status of A. dubitatum along its distribution appears to be certain at the specific level.

  15. Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

    Science.gov (United States)

    Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

    2013-10-01

    According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10.

  16. Optical aberrations of intraocular lenses measured in vivo and in vitro

    Science.gov (United States)

    Barbero, Sergio; Marcos, Susana; Jiménez-Alfaro, Ignacio

    2003-10-01

    Corneal and ocular aberrations were measured in a group of eyes before and after cataract surgery with spherical intraocular lens (IOL) implantation by use of well-tested techniques developed in our laboratory. By subtraction of corneal from total aberration maps, we also estimated the optical quality of the intraocular lens in vivo. We found that aberrations in pseudophakic eyes are not significantly different from aberrations in eyes before cataract surgery or from previously reported aberrations in healthy eyes of the same age. However, aberrations in pseudophakic eyes are significantly higher than in young eyes. We found a slight increase of corneal aberrations after surgery. The aberrations of the IOL and the lack of balance of the corneal spherical aberrations by the spherical aberrations of the intraocular lens also degraded the optical quality in pseudophakic eyes. We also measured the aberrations of the IOL in vitro, using an eye cell model, and simulated the aberrations of the IOL on the basis of the IOL's physical parameters. We found a good agreement among in vivo, in vitro, and simulated measures of spherical aberration: Unlike the spherical aberration of the young crystalline lens, which tends to be negative, the spherical aberration of the IOL is positive and increases with lens power. Computer simulations and in vitro measurements show that tilts and decentrations might be contributors to the increased third-order aberrations in vivo in comparison with in vitro measurements.

  17. Persistence of Early Emerging Aberrant Behavior in Children with Developmental Disabilities

    Science.gov (United States)

    Green, Vanessa A.; O'Reilly, Mark; Itchon, Jonathan; Sigafoos, Jeff

    2005-01-01

    This study examined the persistence of early emerging aberrant behavior in 13 preschool children with developmental disabilities. The severity of aberrant behavior was assessed every 6 months over a 3-year period. Teachers completed the assessments using the Aberrant Behavior Checklist [Aman, M. G., & Singh, N. N. (1986). "Aberrant Behavior…

  18. On the Promotion of "5S" Management Activity in Oilfield Enterprises%谈油田企业推广"5S"管理活动

    Institute of Scientific and Technical Information of China (English)

    王春新

    2009-01-01

    @@ 在企业由粗放型管理向精细化管理转型过程中,胜利油田不断探索引入新的管理方法、新的管理理念,以"整理、整顿、清扫、清洁、自律"为内容的"5S"现场管理方法,以其创造并保持干净整洁、条理有序的现场环境、保证安全、消除无效劳动、培养员工养成认真规范的工作习惯,提升员工的满意度与企业品牌为目标的管理方法,引起油田各级领导和员工的重视,2005年油田将其作为一项提升油田现场管理水平的重点工作,在全油田各专业系统进行推进.

  19. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    ., & Garrett, R. A. (1981) Biochemistry 20, 7301--7307], reveal an extensive interaction site for protein L18 and a more localized one for L25. Generally comparable results, with a few important differences, were obtained in a study of the binding sites of the two E. coli proteins on Bacillus...... experiments were performed for both RNAs. The effects of the bound proteins on the ribonuclease digestion of the RNAs could generally be correlated with the results obtained with the E. coli proteins L18 and L25, although there was evidence for an additional protein-induced conformational change in the B...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution...

  20. PERANCANGAN ULANG TATA LETAK FASILITAS PABRIK TAHU DAN PENERAPAN METODE 5S

    Directory of Open Access Journals (Sweden)

    Merry Siska

    2012-12-01

    Full Text Available UD. Dhika Putra merupakan perusahaan yang bergerak dalam pembuatan tahu. Saat ini kondisi layout fasilitas produksi dan kondisi fisik lingkungan kerja di perusahaan mengalami kendala. Penelitian ini bertujuan untuk merancang ulang tata letak fasilitas pabrik pembuatan tahu yang dapat meminimalkan panjang lintasan material handling serta menerapkan metode 5S untuk meningkatkan produktivitas kerja, dengan menggunakan pendekatan Systematic Layout Planning (SLP. Sedangkan metode 5S untuk mengatur kondisi tempat kerja yang berdampak terhadap efektivitas kerja, efisiensi, produktivitas dan keselamatan kerja. Hasil penelitian ini menyimpulkan bahwa layout usulan yang terpilih untuk dijadikan layout akhir dalam penelitian ini menunjukkan penurunan panjang lintasan material handling yang cukup signifikan yaitu 45 m atau sekitar 19,2% lebih pendek dari layout awal.

  1. Perception and analysis of the 5S program at a business service provider

    Directory of Open Access Journals (Sweden)

    André Luiz Emmel Silva

    2016-09-01

    Full Text Available Given the importance that the service sector represents in our economy, the application of concepts and techniques for its administration and models aimed at improving its quality is growing. This article aims to analyze the main aspects of the 5S program in the implementation phase and in the course of its evolution at a service company. The methodology used is qualitative, implemented through a case study structured in 6 steps. The company under study performs strongly on the national market and therefore has a large amount of documents circulating daily through different sectors, which generated the need to implement a methodology capable of streamlining document flow management and reducing the time spent on bureaucracy by its employees. The 5S program was shown to have brought the company greater administrative efficiency and a more pleasant, safe and organized working environment, motivating employees, reducing costs and providing competitive advantages.

  2. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    OpenAIRE

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  3. Uudised : Eesti muusikalistaarid Euroopas. Tüüri 5.sümfoonia Tallinnas

    Index Scriptorium Estoniae

    2005-01-01

    Koit Toome, Ele Millistver ja Lauri Liiv alustavad 1. detsembril Brnos rahvusvahelises muusikalitrupis "Hairi" proovidega. Esietendus on 26. dets. Iserlohni linnas Saksamaal ning etendusi antakse järgmise aasta 16. aprillini Saksa linnades, Austrias, Šveitsis ja Taanis. Erkki-Sven Tüüri 5. sümfoonia tuleb Eestis esiettekandele 10. dets. Estonia Kontserdisaalis, teose esiettekannet selle aasta veebruaris Stuttgardis dirigeeris Olari Elts

  4. Induction of chromosomal aberrations in human lymphocytes by fission neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Marcia Augusta da; Coelho, Paulo Rogerio Pinto; Bartolini, Paolo; Okazaki, Kayo [Instituto de Pesquisas Energeticas e Nucleares (IPEN-CNEN/SP), Sao Paulo, SP (Brazil)], e-mail: kokazaki@ipen.br

    2009-07-01

    Chromosome aberrations induced by sparsely ionizing radiation (low-LET) are well known and cytogenetic analyses of irradiated human lymphocytes have been widely applied to biological dosimetry. However, much less is known about chromosome aberrations induced by densely ionizing radiation (high LET), such as that of alpha particles or neutrons. Such particles induce DNA strand breaks, as well as chromosome breakage and rearrangements of high complexity. This damage is more localized and less efficiently repaired than after X- or {gamma}-ray irradiation. This preferential production of complex aberrations by densely ionizing radiation is related to the unique energy deposition patterns, which produces highly localized multiple DNA damage at the chromosomal level. A better knowledge of the interactions between different types of radiation and cellular DNA is of importance, not only from the radiobiological viewpoint but also for dosimetric and therapeutic purposes. The objective of the present study was to analyse the cytogenetic effects of fission neutrons on peripheral blood lymphocytes in order to evaluate structural and numerical aberrations and number of cells in the different mitotic cycles. So, blood samples from five healthy donors, 22-25 years old, of both sexes, were irradiated in the Research Reactor IEA-R1 of our Institute (IPEN/CNEN-SP) with thermal and fast neutrons at doses of 0.2; 0.3; 0.5 and 1.0 Gy. The {gamma} contribution to the total absorbed dose was about 30%. These doses were monitored by thermoluminescent dosemeters: LiF-600 (for neutrons) and LiF-700 (for {gamma}-rays). The data concerning structural aberrations were evaluated with regard to three parameters: percentage of cells with aberrations, number of aberrations/cell and number of dicentric/cell. The cytogenetic results showed an increase in the three parameters after irradiation with neutrons, as a function of radiation dose. Apparently, there was no influence of neutrons on the

  5. Synthesis and functionalization of a triaryldiamine-base photoconductive/photorefractive composite, and its application to aberrated image restoration

    Science.gov (United States)

    Liang, Yichen

    Organic phoorefractive (PR) composites have recently emerged as an important class of materials for applications including high-density data storage, optical communication, and biomedical imaging. In an effort to further improve their performance, this study focused on the utilization of functionalized semiconductor nanocrystals to photosensitize triaryamine (TPD)-based PR composites, as well as the application of TPD-based PR composites in the restoration of aberrated optical information. A novel approach to functionalize CdSe quantum dot (QCdSe) was firstly introduced where the sulfonated triarydiamine (STPD) was used as charge-transporting ligand to passivate QCdSe. TPD-based photoconductive and PR composites were photosensitized with the STPD-passivated QCdSe (SQCdSe). Due to the charge-transporting capability of STPD, the composites photosensitized with STPD-capped QCdSe exhibited superior performance relative to composites employing more traditional photosensitizers (such as fullerene C60 and trioctylphosphine-capped QCdSe), with figures-of-merit including photoconductivities in excess of 60 pS/cm, two-beam coupling gain coefficients in excess of 110 cm-1, and PR response time of less than 30 ms. In addition, the ability of TPD-based PR composites to correct aberrations associated with a laser beam was described. Here, a severely aberrated laser beam was able to be restored to a nearly unaberrated condition through the PR process, and the potential of this technique for practical applications was well explained. Based on the current experimental geometry, a PR response time of 0.5 s was observed, which is the fastest PR response time reported for a PR composite operating under experimental conditions designed for the correction of optical aberrations.

  6. Construction of special eye models for investigation of chromatic and higher-order aberrations of eyes.

    Science.gov (United States)

    Zhai, Yi; Wang, Yan; Wang, Zhaoqi; Liu, Yongji; Zhang, Lin; He, Yuanqing; Chang, Shengjiang

    2014-01-01

    An achromatic element eliminating only longitudinal chromatic aberration (LCA) while maintaining transverse chromatic aberration (TCA) is established for the eye model, which involves the angle formed by the visual and optical axis. To investigate the impacts of higher-order aberrations on vision, the actual data of higher-order aberrations of human eyes with three typical levels are introduced into the eye model along visual axis. Moreover, three kinds of individual eye models are established to investigate the impacts of higher-order aberrations, chromatic aberration (LCA+TCA), LCA and TCA on vision under the photopic condition, respectively. Results show that for most human eyes, the impact of chromatic aberration on vision is much stronger than that of higher-order aberrations, and the impact of LCA in chromatic aberration dominates. The impact of TCA is approximately equal to that of normal level higher-order aberrations and it can be ignored when LCA exists.

  7. Phylogenetic analysis of Thai oyster (Ostreidae) based on partial sequences of the mitochondrial 16S rDNA gene

    DEFF Research Database (Denmark)

    Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik;

    2006-01-01

    Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen...

  8. ASSESSMENT OF FECAL POLLUTION SOURCES IN PLUM CREEK WATERSHED USING BACTEROIDETES 16S RDNA-BASED ASSAYS

    Science.gov (United States)

    Recently, 16S rDNA Bacteroidetes-targeted PCR assays were developed to discriminate between ruminant and human fecal pollution. These assays are rapid and relatively inexpensive but have been used in a limited number of studies. In this study, we evaluated the efficacy o...

  9. ASSESSMENT OF FECAL POLLUTION SOURCES IN PLUM CREEK WATERSHED USING PCR AND PHYLOGENETIC ANALYSES OF BACTEROIDETES 16S RDNA

    Science.gov (United States)

    Traditional methods for assessing fecal pollution in environmental systems, such as monitoring for fecal coliforms are not capable of discriminating between different sources fecal pollution. Recently, 16S rDNA Bacteroidetes-targeted PCR assays were developed to discriminate betw...

  10. Sequence analysis of rDNA intergenic spacer region (IGS) as a tool for phylogenetic studies in Trichoderma spp.

    Institute of Scientific and Technical Information of China (English)

    Mercatelli Elisabetta; Pecchia Susanna; Ciliegi Sandro; Vannacci Giovanni

    2004-01-01

    @@ Different from ribosomal genes, which contain highly conserved sequences that are detected in all organisms, the intergenic spacer of rDNA (IGS) appears to be the most rapidly-evolving spacer region. For this reason we tested this region for phylogenetic studies.

  11. Variations of 18S rDNA Loci Among Six Populations of Paeonia obovata Maxim. (Paeoniaceae) Revealed by Fluorescence In Situ Hybridization

    Institute of Scientific and Technical Information of China (English)

    Rui Luo; Chao Wang; Daming Zhang

    2006-01-01

    The localization of 18S ribosomal RNA genes (rDNA) by fluorescence in situ hybridization (FISH) had been performed for some species of Paeonia. However, the pattern of 18S rDNA loci among populations is indistinct. In the present study, we localized 18S rDNA loci on meiotic or mitotic chromosomes of six populations of Paeonia obovata Maxim. (Paeoniaceae). Different numbers of rDNA loci were found with different diploid (2n=10) populations, namely eight (Lushi and Mt. Jiuhua populations), 10 (Mt. Taibai population), and seven (Mt. Guandi population), whereas tetraploid (2n=20) populations were all found with 16 loci. All rDNA loci were mapped near telomeres of mitotic chromosomes and there was no chromosome with two loci. The present results show that molecular cytological polymorphism exists among P. obovata diploid populations, indicating that structural variations occurred frequently during the evolutionary history of this species, accompanied with differentiation among populations.

  12. Antimutagenic potential of curcumin on chromosomal aberrations in Allium cepa

    Institute of Scientific and Technical Information of China (English)

    RAGUNATHAN Irulappan; PANNEERSELVAM Natarajan

    2007-01-01

    Turmeric has long been used as a spice and food colouring agent in Asia. In the present investigation, the antimutagenic potential of curcumin was evaluated in Allium cepa root meristem cells. So far there is no report on the biological properties of curcumin in plant test systems. The root tip cells were treated with sodium azide at 200 and 300 μg/ml for 3 h and curcumin was given at 5, 10 and 20 μg/ml for 16 h, prior to sodium azide treatment. The tips were squashed after colchicine treatment and the cells were analyzed for chromosome aberration and mitotic index. Curcumin induces chromosomal aberration in Allium cepa root tip cells in an insignificant manner, when compared with untreated control. Sodium azide alone induces chromosomal aberrations significantly with increasing concentrations. The total number of aberrations was significantly reduced in root tip cells pretreated with curcumin. The study reveals that curcumin has antimutagenic potential against sodium azide induced chromosomal aberrations in Allium cepa root meristem cells. In addition, it showed mild cytotoxicity by reducing the percentage of mitotic index in all curcumin treated groups, but the mechanism of action remains unknown. The antimutagenic potential of curcumin is effective at 5 μg/ml in Allium cepa root meristem cells.

  13. Chromosome aberrations as biomarkers of radiation exposure: Modelling basic mechanisms

    Science.gov (United States)

    Ballarini, F.; Ottolenghi, A.

    The space radiation environment is a mixed field consisting of different particles having different energies, including high charge and energy (HZE) ions. Conventional measurements of absorbed doses may not be sufficient to completely characterise the radiation field and perform reliable estimates of health risks. Biological dosimetry, based on the observation of specific radiation-induced endpoints (typically chromosome aberrations), can be a helpful approach in case of monitored exposure to space radiation or other mixed fields, as well as in case of accidental exposure. Furthermore, various ratios of aberrations (e.g. dicentric chromosomes to centric rings and complex exchanges to simple exchanges) have been suggested as possible fingerprints of radiation quality, although all of them have been subjected to some criticisms. In this context a mechanistic model and a Monte Carlo code for the simulation of chromosome aberration induction were developed. The model, able to provide dose-responses for different aberrations (e.g. dicentrics, rings, fragments, translocations, insertions and other complex exchanges), was further developed to assess the dependence of various ratios of aberrations on radiation quality. The predictions of the model were compared with available data, whose experimental conditions were faithfully reproduced. Particular attention was devoted to the scoring criteria adopted in different laboratories and to possible biases introduced by interphase death and mitotic delay. This latter aspect was investigated by taking into account both metaphase data and data obtained with Premature Chromosome Condensation (PCC).

  14. Spherical aberration and other higher-order aberrations in the human eye : from summary wave-front analysis data to optical variables relevant to visual perception

    NARCIS (Netherlands)

    Jansonius, Nomdo M.

    2010-01-01

    Wave-front analysis data from the human eye are commonly presented using the aberration coefficient c(4)(0) (primary spherical aberration) together with an overall measure of all higher-order aberrations. If groups of subjects are compared, however, the relevance of an observed difference cannot eas

  15. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p){sup 3}P{sub 2}-(5s4d){sup 3}D{sub 2} transition

    Energy Technology Data Exchange (ETDEWEB)

    Mickelson, P G; De Escobar, Y N Martinez; Anzel, P; DeSalvo, B J; Nagel, S B; Traverso, A J; Yan, M; Killian, T C, E-mail: killian@rice.ed [Department of Physics and Astronomy, Rice University, Houston, TX 77251 (United States)

    2009-12-14

    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p){sup 3}P{sub 2}-(5s4d){sup 3}D{sub 2} transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p){sup 3}P{sub 2} dark state are repumped back into the (5s{sup 2}){sup 1}S{sub 0} ground state. Spectroscopy of {sup 84}Sr, {sup 86}Sr, {sup 87}Sr and {sup 88}Sr improves the value of the (5s5p){sup 3}P{sub 2}-(5s4d){sup 3}D{sub 2} transition frequency and determines the isotope shifts for the transition accurately enough to guide laser-cooling experiments with less abundant isotopes.

  16. Non-Gaussianity and CMB aberration and Doppler

    CERN Document Server

    Catena, Riccardo; Notari, Alessio; Renzi, Alessandro

    2013-01-01

    The peculiar motion of an observer with respect to the CMB rest frame induces a deflection in the arrival direction of the observed photons (also known as CMB aberration) and a Doppler shift in the measured photon frequencies. As a consequence, aberration and Doppler effects induce non trivial correlations between the harmonic coefficients of the observed CMB temperature maps. In this paper we investigate whether these correlations generate a bias on Non-Gaussianity estimators $f_{NL}$. We perform this analysis simulating a large number of temperature maps with Planck-like resolution (lmax $= 2000$) as different realizations of the same cosmological fiducial model (WMAP7yr). We then add to these maps aberration and Doppler effects employing a modified version of the HEALPix code. We finally evaluate a generalization of the Komatsu, Spergel and Wandelt Non-Gaussianity estimator for all the simulated maps, both when peculiar velocity effects have been considered and when these phenomena have been neglected. Usi...

  17. Correcting the Chromatic Aberration in Barrel Distortion of Endoscopic Images

    Directory of Open Access Journals (Sweden)

    Y. M. Harry Ng

    2003-04-01

    Full Text Available Modern endoscopes offer physicians a wide-angle field of view (FOV for minimally invasive therapies. However, the high level of barrel distortion may prevent accurate perception of image. Fortunately, this kind of distortion may be corrected by digital image processing. In this paper we investigate the chromatic aberrations in the barrel distortion of endoscopic images. In the past, chromatic aberration in endoscopes is corrected by achromatic lenses or active lens control. In contrast, we take a computational approach by modifying the concept of image warping and the existing barrel distortion correction algorithm to tackle the chromatic aberration problem. In addition, an error function for the determination of the level of centroid coincidence is proposed. Simulation and experimental results confirm the effectiveness of our method.

  18. Split-plot fractional designs: Is minimum aberration enough?

    DEFF Research Database (Denmark)

    Kulahci, Murat; Ramirez, Jose; Tobias, Randy

    2006-01-01

    Split-plot experiments are commonly used in industry for product and process improvement. Recent articles on designing split-plot experiments concentrate on minimum aberration as the design criterion. Minimum aberration has been criticized as a design criterion for completely randomized fractional...... factorial design and alternative criteria, such as the maximum number of clear two-factor interactions, are suggested (Wu and Hamada (2000)). The need for alternatives to minimum aberration is even more acute for split-plot designs. In a standard split-plot design, there are several types of two...... for completely randomized designs. Consequently, we provide a modified version of the maximum number of clear two-factor interactions design criterion to be used for split-plot designs....

  19. Differential aberration correction (DAC) microscopy: a new molecular ruler.

    Science.gov (United States)

    Vallotton, P

    2008-11-01

    Considerable efforts have been deployed towards measuring molecular range distances in fluorescence microscopy. In the 1-10 nm range, Förster energy transfer microscopy is difficult to beat. Above 300 nm, conventional diffraction limited microscopy is suitable. We introduce a simple experimental technique that allows bridging the gap between those two resolution scales in both 2D and 3D with a resolution of about 20 nm. The method relies on a computational approach to accurately correct optical aberrations over the whole field of view. The method is differential because the probes of interest are affected in exactly the same manner by aberrations as are the reference probes used to construct the aberration deformation field. We expect that this technique will have significant implications for investigating structural and functional questions in bio-molecular sciences.

  20. Dynamic compensation of chromatic aberration in a programmable diffractive lens.

    Science.gov (United States)

    Millán, María S; Otón, Joaquín; Pérez-Cabré, Elisabet

    2006-10-02

    A proposal to dynamically compensate chromatic aberration of a programmable phase Fresnel lens displayed on a liquid crystal device and working under broadband illumination is presented. It is based on time multiplexing a set of lenses, designed with a common focal length for different wavelengths, and a tunable spectral filter that makes each sublens work almost monochromatically. Both the tunable filter and the sublens displayed by the spatial light modulator are synchronized. The whole set of sublenses are displayed within the integration time of the sensor. As a result the central order focalization has a unique location at the focal plane and it is common for all selected wavelengths. Transversal chromatic aberration of the polychromatic point spread function is reduced by properly adjusting the pupil size of each sublens. Longitudinal chromatic aberration is compensated by making depth of focus curves coincident for the selected wavelengths. Experimental results are in very good agreement with theory.

  1. Measuring chromatic aberrations in imaging systems using plasmonic nanoparticles

    Science.gov (United States)

    Gennaro, Sylvain D.; Roschuk, Tyler R.; Maier, Stefan A.; Oulton, Rupert F.

    2016-04-01

    Chromatic aberration in optical systems arises from the wavelength dependence of a glass's refractive index. Polychromatic rays incident upon an optical surface are refracted at slightly different angles and in traversing an optical system follow distinct paths creating images displaced according to color. Although arising from dispersion, it manifests as a spatial distortion correctable only with compound lenses with multiple glasses and accumulates in complicated imaging systems. While chromatic aberration is measured with interferometry, simple methods are attractive for their ease of use and low cost. In this letter we retrieve the longitudinal chromatic focal shift of high numerical aperture (NA) microscope objectives from the extinction spectra of metallic nanoparticles within the focal plane. The method is accurate for high NA objectives with apochromatic correction, and enables rapid assessment of the chromatic aberration of any complete microscopy systems, since it is straightforward to implement

  2. Low chromatic aberration hexapole for molecular state selection

    Science.gov (United States)

    Ke, Yi; Deng, Xiao-Bing; Hu, Zhong-Kun

    2016-01-01

    In molecular beam state-selection experiments, the electrostatic hexapole acts as an optical lens, imaging molecules from the source to the focus. The molecular longitudinal velocity spread induces the phenomenon of chromatic aberration, which will reduce the state-selection purity. We propose a scheme which can effectively reduce the chromatic aberration by changing the hexapole voltage operating manner. The hexapole is already charged before molecules arrive at the entrance of the hexapole. When molecules are completely inside the hexapole, the voltage is switched off rapidly at an appropriate time. In this manner, faster molecules travel a longer hexapole focusing region than slower molecules. Therefore the focusing positions of molecules with different velocities become close. Numerical trajectory simulations of molecular state selection are carried out, and the results show that this low chromatic aberration hexapole can significantly improve the state purity from 46.2% to 87.0%.

  3. An approach to remove defocused aberration on array confocal microscope

    Science.gov (United States)

    Huang, Xiangdong; Zhou, Tong; Jia, Jingguo

    2013-01-01

    In order to obtain a high resolution image required for ultra-precision measurement of microstructural object, a new approach is proposed for 3D microstructures. It uses the modulation transfer function with defocus aberration based on the ambiguity function and stable phase principle to achieve an optical phase filter, and utilizes generalized a spheric phase optical element to encode defocus images, and uses deconvolution technology to recover the images. In comparison with conventional optical system, the phase filter used in the optical system can make focal spot smaller when measure object defocusing, eliminates the effect of the defocus aberration, and improves the defocused property. Numerical results indicate the designed phase filter can improve lateral resolution of optical system, and the axial resolution of the optical system is not affect by the filter and defocus aberration. For different defocus plate, the phase filter can make character of modulation transfer function of lateral direction uniform approximation.

  4. Design and Comparison of a 1 MW / 5s HTS SMES with Toroidal and Solenoidal Geometry

    CERN Document Server

    Morandi, Antonio; Gholizad, Babak; Grilli, Francesco; Sirois, Frédéric; Zermeño, Víctor M R

    2015-01-01

    The design of a HTS SMES coil with solenoidal and toroidal geometry is carried out based on a commercially available 2G HTS conductor. A SMES system of practical interest (1 MW / 5 s) is considered. The comparison between ideal toroidal and solenoidal geometry is first discussed and the criteria used for choosing the geometrical parameters of the coils' bore are explained. The design of the real coil is then carried out and the final amount of conductor needed is compared. A preliminary comparison of the two coils in terms of AC loss during one charge discharge cycle is also discussed.

  5. The Tetrahedron Zamolodchikov Algebra and the AdS5 x S5 S-matrix

    CERN Document Server

    Mitev, Vladimir; Tsuboi, Zengo

    2012-01-01

    The S-matrix of the AdS5 x S5 string theory is a tensor product of two centrally extended su(2|2) S-matrices, each of which is related to the R-matrix of the Hubbard model. The R-matrix of the Hubbard model was first found by Shastry, who ingeniously exploited the fact that, for zero coupling, the Hubbard model can be decomposed into two XX models. In this article, we review and clarify this construction from the AdS/CFT perspective and investigate the implications this has for the AdS5 x S5 S-matrix.

  6. Focus correction in an apodized system with spherical aberration.

    Science.gov (United States)

    Bernal-Molina, Paula; Castejón-Mochón, José Francisco; Bradley, Arthur; López-Gil, Norberto

    2015-08-01

    We performed a theoretical and computational analysis of the through-focus axial irradiance in a system with a Gaussian amplitude pupil function and fourth- and sixth-order spherical aberration (SA). Two cases are analyzed: low aberrated systems, and the human eye containing significant levels of SA and a natural apodization produced by the Stiles-Crawford effect. Results show that apodization only produces a refraction change of the plane that maximized the Strehl ratio for eyes containing significant levels of negative SA.

  7. Double aberration correction in a low-energy electron microscope

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, Th., E-mail: schmidtt@fhi-berlin.mpg.de [Fritz-Haber-Institut der Max-Planck-Gesellschaft, Faradayweg 6-8, D-14195 Berlin (Germany); Universitaet Wuerzburg, Experimentelle Physik II, Am Hubland, D-97074 Wuerzburg (Germany); Marchetto, H.; Levesque, P.L. [Fritz-Haber-Institut der Max-Planck-Gesellschaft, Faradayweg 6-8, D-14195 Berlin (Germany); Groh, U.; Maier, F. [Universitaet Wuerzburg, Experimentelle Physik II, Am Hubland, D-97074 Wuerzburg (Germany); Preikszas, D. [Technische Universitaet Darmstadt, Angewandte Physik, Hochschulstrasse 6, D-64289 Darmstadt (Germany); Carl Zeiss NTS GmbH, Carl-Zeiss-Strasse 56, D-73447 Oberkochen (Germany); Hartel, P.; Spehr, R. [Technische Universitaet Darmstadt, Angewandte Physik, Hochschulstrasse 6, D-64289 Darmstadt (Germany); Lilienkamp, G. [Technische Universitaet Clausthal, Physikalisches Institut, Leibnizstrasse 4, D-38678 (Germany); Engel, W. [Fritz-Haber-Institut der Max-Planck-Gesellschaft, Faradayweg 6-8, D-14195 Berlin (Germany); Fink, R. [Universitaet Erlangen-Nuernberg, Physikalische Chemie II, Egerlandstrasse 3, D-91058 Erlangen (Germany); Bauer, E. [Technische Universitaet Clausthal, Physikalisches Institut, Leibnizstrasse 4, D-38678 (Germany); Arizona State University, Department of Physics, Tempe, AZ 85287 (United States); Rose, H. [Technische Universitaet Darmstadt, Angewandte Physik, Hochschulstrasse 6, D-64289 Darmstadt (Germany); Umbach, E. [Universitaet Wuerzburg, Experimentelle Physik II, Am Hubland, D-97074 Wuerzburg (Germany); Freund, H.-J. [Fritz-Haber-Institut der Max-Planck-Gesellschaft, Faradayweg 6-8, D-14195 Berlin (Germany)

    2010-10-15

    The lateral resolution of a surface sensitive low-energy electron microscope (LEEM) has been improved below 4 nm for the first time. This breakthrough has only been possible by simultaneously correcting the unavoidable spherical and chromatic aberrations of the lens system. We present an experimental criterion to quantify the aberration correction and to optimize the electron optical system. The obtained lateral resolution of 2.6 nm in LEEM enables the first surface sensitive, electron microscopic observation of the herringbone reconstruction on the Au(1 1 1) surface.

  8. Aberrations of the point spread function of a multimode fiber

    CERN Document Server

    Descloux, Adrien; Pinkse, Pepijn W H

    2016-01-01

    We investigate the point spread function of a multimode fiber. The distortion of the focal spot created on the fiber output facet is studied for a variety of the parameters. We develop a theoretical model of wavefront shaping through a multimode fiber and use it to confirm our experimental results and analyze the nature of the focal distortions. We show that aberration-free imaging with a large field of view can be achieved by using an appropriate number of segments on the spatial light modulator during the wavefront-shaping procedure. The results describe aberration limits for imaging with multimode fibers as in, e.g., microendoscopy.

  9. Investigation of spherical aberration effects on coherent lidar performance

    DEFF Research Database (Denmark)

    Hu, Qi; Rodrigo, Peter John; Iversen, Theis Faber Quist;

    2013-01-01

    In this paper we demonstrate experimentally the performance of a monostatic coherent lidar system under the influence of phase aberrations, especially the typically predominant spherical aberration (SA). The performance is evaluated by probing the spatial weighting function of the lidar system...... with different telescope configurations using a hard target. It is experimentally and numerically proven that the SA has a significant impact on lidar antenna efficiency and optimal beam truncation ratio. Furthermore, we demonstrate that both effective probing range and spatial resolution of the system...

  10. Aberration compensation and resolution improvement of focus modulation microscopy

    Science.gov (United States)

    Zheng, Juanjuan; Gao, Peng; Shao, Xiaopeng

    2017-01-01

    Confocal laser scanning microscopy (CLSM) has wide applications in biological research and medical diagnosis. However, the spatial resolution and signal to noise ratio (SNR) of CLSM is reduced in the presence of an aberration. Here we improve the pupil-segmentation method to measure and compensate for aberrations in focus modulation CLSM (FM-CLSM), which uses Gaussian-type and doughnut-like foci to scan a sample in sequence. As a result, FM-CLSM can provide images with a high resolution and a high SNR for biomedical or industrial applications.

  11. Pan-cancer analysis of ROS1 genomic aberrations

    OpenAIRE

    Wang, Yidan; 王奕丹

    2015-01-01

    The ROS proto-oncogene 1 (ROS1) encodes the ROS1 receptor kinase. ROS1 rearrangements are known to be oncogenic in glioblastoma, non–small-cell lung carcinoma (NSCLC) and cholangiocarcinoma. The clinical relevance of ROS1 genomic aberrations in other human cancers is largely unexamined. Here, we performed a pan-cancer analysis of ROS1 genomic aberrations across 20 cancer sites by interrogating the whole-exome sequencing data of the Cancer Genome Atlas (TCGA) via the cBioportal (www.cbioportal...

  12. The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes.

    OpenAIRE

    Krol, A; Gallinaro, H; Lazar, E; Jacob, M.; Branlant, C

    1981-01-01

    Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently a...

  13. 铟离子5s21S0-5s5p3P0参考用跃迁频率的精密测量%Absolute Frequency Measurements of the Clock Transition 5s2 1S0-5s5p 3P0 in Singly Ionized Indium

    Institute of Scientific and Technical Information of China (English)

    王延辉; 刘涛; A.Stejskal; 赵燕宁; R.Dumke; 张洁; 陆泽晃; 王力军; 董太乾

    2008-01-01

    报道了建立铟单离子(115In+)光频标实验系统的实验进展.单个离子囚禁在Paul-Straubel型离子阱中,利用激光边带冷却技术将其冷却至最低振动能态.为了探测和测量铟离子参考用跃迁5s2 1S0-5s5p 3P0的频率,使用一台Hz量级超窄线宽激光作为探测激光,用以获得量子跳跃信号.用一台以商用铯原子钟为基准的飞秒光频梳作为测量工具,对其频率进行了20次的精密测量,相对不确定度为5.0×10-14.

  14. 18S rDNA phylogeny of lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa).

    Science.gov (United States)

    Fiore-Donno, Anna Maria; Kamono, Akiko; Meyer, Marianne; Schnittler, Martin; Fukui, Manabu; Cavalier-Smith, Thomas

    2012-01-01

    The phylogenetic position of the slime-mould genus Lamproderma (Myxomycetes, Amoebozoa) challenges traditional taxonomy: although it displays the typical characters of the order Stemonitales, it appears to be sister to Physarales. This study provides a small subunit (18S or SSU) ribosomal RNA gene-based phylogeny of Lamproderma and its allies, with new sequences from 49 specimens in 12 genera. We found that the order Stemonitales and Lamproderma were both ancestral to Physarales and that Lamproderma constitutes several clades intermingled with species of Diacheopsis, Colloderma and Elaeomyxa. We suggest that these genera may have evolved from Lamproderma by multiple losses of fruiting body stalks and that many taxonomic revisions are needed. We found such high genetic diversity within three Lamproderma species that they probably consist of clusters of sibling species. We discuss the contrasts between genetic and morphological divergence and implications for the morphospecies concept, highlighting the phylogenetically most reliable morphological characters and pointing to others that have been overestimated. In addition, we showed that the first part (~600 bases) of the SSU rDNA gene is a valuable tool for phylogeny in Myxomycetes, since it displayed sufficient variability to distinguish closely related taxa and never failed to cluster together specimens considered of the same species.

  15. 18S rDNA phylogeny of lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa.

    Directory of Open Access Journals (Sweden)

    Anna Maria Fiore-Donno

    Full Text Available The phylogenetic position of the slime-mould genus Lamproderma (Myxomycetes, Amoebozoa challenges traditional taxonomy: although it displays the typical characters of the order Stemonitales, it appears to be sister to Physarales. This study provides a small subunit (18S or SSU ribosomal RNA gene-based phylogeny of Lamproderma and its allies, with new sequences from 49 specimens in 12 genera. We found that the order Stemonitales and Lamproderma were both ancestral to Physarales and that Lamproderma constitutes several clades intermingled with species of Diacheopsis, Colloderma and Elaeomyxa. We suggest that these genera may have evolved from Lamproderma by multiple losses of fruiting body stalks and that many taxonomic revisions are needed. We found such high genetic diversity within three Lamproderma species that they probably consist of clusters of sibling species. We discuss the contrasts between genetic and morphological divergence and implications for the morphospecies concept, highlighting the phylogenetically most reliable morphological characters and pointing to others that have been overestimated. In addition, we showed that the first part (~600 bases of the SSU rDNA gene is a valuable tool for phylogeny in Myxomycetes, since it displayed sufficient variability to distinguish closely related taxa and never failed to cluster together specimens considered of the same species.

  16. Karyotypes, heterochromatin, and physical mapping of 18S-26S rDNA in Cactaceae.

    Science.gov (United States)

    Las Peñas, M L; Urdampilleta, J D; Bernardello, G; Forni-Martins, E R

    2009-01-01

    Karyotype analyses in members of the four Cactaceae subfamilies were performed. Numbers and karyotype formula obtained were: Pereskioideae = Pereskiaaculeata(2n = 22; 10 m + 1 sm), Maihuenioideae = Maihuenia patagonica (2n = 22, 9 m + 2 sm; 2n = 44, 18 m + 4 sm), Opuntioideae = Cumulopuntia recurvata(2n = 44; 20 m + 2 sm), Cactoideae = Acanthocalycium spiniflorum (2n = 22; 10 m + 1 sm),Echinopsis tubiflora (2n = 22; 10 m + 1 sm), Trichocereus candicans (2n = 22, 22 m). Chromosomes were small, the average chromosome length was 2.3 mum. Diploid species and the tetraploid C. recurvata had one terminal satellite, whereas the remaining tetraploid species showed four satellited chromosomes. Karyotypes were symmetrical. No CMA(-)/DAPI(+) bands were detected, but CMA(+)/DAPI(-) bands associated with NOR were always found. Pericentromeric heterochromatin was found in C. recurvata, A. spiniflorum, and the tetraploid cytotype of M. patagonica. The locations of the 18S-26S rDNA sites in all species coincided with CMA(+)/DAPI(-) bands; the same occurred with the sizes and numbers of signals for each species. This technique was applied for the first time in metaphase chromosomes in cacti. NOR-bearing pair no.1 may be homeologous in all species examined. In Cactaceae, the 18S-26S loci seem to be highly conserved.

  17. The 18S rDNA sequences support polyphyly of the Hypsibiidae (Eutardigrada

    Directory of Open Access Journals (Sweden)

    Hartmut GREVEN

    2007-09-01

    Full Text Available To extend data on 18S rDNA gene phylogeny within the Eutardigrada and to provide additional information on unclear taxonomic status of a glacier tardigrade Hypsibius klebelsbergi, gene sequences from seven tardigrade species of the family Hypsibiidae (Hypsibius klebelsbergi, Hypsibius cf. convergens 1, Hypsibius cf. convergens 2, Hypsibius scabropygus, Hebensuncus conjungens, Isohypsibius cambrensis, Isohypsibius granulifer were analysed together with previously published sequences from ten further eutardigrade species or species groups. Three distinctly separated clades within the Hypsibiidae, 1 the Ramazzottius - Hebesuncus clade, 2 the Isohypsibius clade (Isohypsibius, Halobiotus, Thulinius, and 3 the Hypsibius clade (Hypsibius spp. have been obtained in each of four phylogenetic trees recovered by Maximum Parsimony, Neighbour Joining, Minimum Evolution and UPGMA. Hybsibius klebelsbergi has been located always within the Hypsibius clade. The detailed sister group relationship was not resolved adequately, but there is robust support for a sister group relationship between the Hypsibius clade and the remaining clades. We cannot exclude that the Ramazzottius - Hebesuncus clade is a sister group of the Macrobiotus clade. Our findings suggest polyphyly of the Hypsibiidae, and thus multiple evolutions of some structures currently applied as diagnostic characters (e.g., claws, buccal apophyses.

  18. CONTRIBUTION TO THE PHYLOGENY OF THE PANGASIIDAE BASED ON MITOCHONDRIAL 12S RDNA

    Directory of Open Access Journals (Sweden)

    L. Pouyaud

    2016-10-01

    Full Text Available Catfishes are generally one of the economically important groups of fresh and brackish water fishes in the world. In many countries, they form a significant part of inland fisheries, and several species have been  introduced in fish culture. Judging from literature, the main constraint to cultivate wild species and to optimise the production of pangasiid catfishes is due to the poorly documented systematics of this family. In the present contribution, the phylogenetic relationships within Pangasiidae are studied to contribute to a better insight in their taxonomy and evolution. The genetic relatedness is inferred using mitochondrial 12S rDNA gene sequences. To resolve the phylogenetic position of Laides in this group of catfish, five genera of Asian and African Schilbeidae are also considered. The results showed that a species group (complex could be clearly seen in the genetic tree. Pangasius is more derive than the other genera. By using approximate molecular clock/evolutionary calibration from  mitochondrial gene, a new episode of  speciation for the family marked explosive radiation about 5- 8 million years ago (mya. This adaptive radiation extended until the Late Pleistocene. Regarding the relationships between the Pangasiidae and Schilbeidae, two families show an allopatric distribution with slight overlap. The Pangasiidae occur mainly in Southeast Asia, while the Schilbeidae are seen mainly on the Indian subcontinent (including Myanmar and Africa. It confirms the separation between  Schilbeidae and Pangasiidae occurred in the Early Miocene.

  19. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Grierson, Patrick M. [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Acharya, Samir, E-mail: samir.acharya@osumc.edu [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Groden, Joanna [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States)

    2013-03-15

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription.

  20. Molecular phylogeny of the butterfly tribe Satyrini (Nymphalidae: Satyrinae) with emphasis on the utility of ribosomal mitochondrial genes 16s rDNA and nuclear 28s rDNA.

    Science.gov (United States)

    Yang, Mingsheng; Zhang, Yalin

    2015-07-09

    The tribe Satyrini is one of the most diverse groups of butterflies, but no robust phylogenetic hypothesis for this group has been achieved. Two rarely used 16s and 28s ribosomal and another seven protein-coding genes were used to reconstruct the phylogeny of the Satyrini, with further aim to evaluate the informativeness of the ribosomal genes. Our maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference (BI) analyses consistently recovered three well-supported clades for the eleven sampled subtribes of Satyrini: clade I includes Eritina and Coenonymphina, being sister to the clade II + clade III; clade II contains Parargina, Mycalesina and Lethina, and the other six subtribes constitute clade III. The placements of the taxonomically unstable Davidina Oberthür and geographically restricted Paroeneis Moore in Satyrina are confirmed for the first time based on molecular evidence. The close relationships of Callerebia Butler, Loxerebia Watkins and Argestina Riley are well-supported. We suggest that Rhaphicera Butler belongs to Lethina. The partitioned Bremer support (PBS) values of MP analysis show that the 16s rDNA contributes well to the nodes representing all the taxa from subtribe to species levels, and the 28s rDNA is informative at the subtribe level. Furthermore, our ML analyses show that the ribosomal genes 16s rDNA and 28s rDNA are informative, because most node support values are lower in the ML tree after the removal of them than that in ML tree constructed based on the full nine-gene dataset. This indicates that some other ribosomal genes should be tentatively used through combining with traditionally used protein-coding genes in further analysis on phylogeny of Satyrini, providing that proper representatives are sampled.

  1. Aberration of a negative ion beam caused by space charge effect

    Energy Technology Data Exchange (ETDEWEB)

    Miyamoto, K. [Naruto University of Education, 748 Nakashima, Takashima, Naruto-cho, Naruto-shi, Tokushima 772-8502 (Japan); Wada, S.; Hatayama, A. [Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan)

    2010-02-15

    Aberrations are inevitable when the charged particle beams are extracted, accelerated, transmitted, and focused with electrostatic and magnetic fields. In this study, we investigate the aberration of a negative ion accelerator for a neutral beam injector theoretically, especially the spherical aberration caused by the negative ion beam expansion due to the space charge effect. The negative ion current density profiles with the spherical aberration are compared with those without the spherical aberration. It is found that the negative ion current density profiles in a log scale are tailed due to the spherical aberration.

  2. Differential algebraic method for arbitrary order curvilinear-axis combined geometric-chromatic aberration analysis

    CERN Document Server

    Cheng Min; Lu Yi Long; Yao Zhen Hua

    2003-01-01

    The principle of differential algebra is applied to analyse and calculate arbitrary order curvilinear-axis combined geometric-chromatic aberrations of electron optical systems. Expressions of differential algebraic form of high order combined aberrations are obtained and arbitrary order combined aberrations can be calculated numerically. As an example, a typical wide electron beam focusing system with curved optical axes named magnetic immersion lens has been studied. All the second-order and third-order combined geometric-chromatic aberrations of the lens have been calculated, and the patterns of the corresponding geometric aberrations and combined aberrations have been given as well.

  3. Effect of Coma Aberration on Orbital Angular Momentum Spectrum of Vortex Beams

    Institute of Scientific and Technical Information of China (English)

    CHEN Zi-Yang; PU Ji-Xiong

    2009-01-01

    Spiral spectra of vortex beams with coma aberration are studied.It is shown that the orbital angular momentum (OAM) states of vortex beams with coma aberration are different from those aberration-free vortex beams.Spiral spectra of beams with coma aberration are spreading.It is found that in the presence of coma aberration,the vortex beams contain not only the original OAM component but also other components.A larger coma aberration coefficient and/or a larger beam waist will lead to a wider spreading of the spiral spectrum. The results may have potential applications in information encoding and transmittance.

  4. Aberrant behavior of preschool children: Evaluation of questionnaire

    Directory of Open Access Journals (Sweden)

    Fajgelj Stanislav

    2007-01-01

    Full Text Available In the study metric characteristics of children aberrant behavior questionnaire were analyzed. The analysis was performed on the sample of 1.165 children, aged 4-7, in preschool institutions in several towns of Vojvodina. The questionnaire contained 36 items of the Likert-type scale and was filled in by one parent of each child. The authors examined main metric characteristics of the complete questionnaire, as well as individual items under the Rasche’s measurement model. Generally, parents seldom notice aberrant behavior in their children. Most frequently they notice stubbornness, while very rarely torturing of animals. The item discrimination, on the whole, was found satisfying. The reliability of the questionnaire is 0.84., and all indicators of misfit are within satisfactory ranges. According to differential functioning of the items, the authors found gender and age specificities of parents’ evaluation of aberrant behavior of their children. Parents often notice stubbornness and moldiness in girls, and aggression in boys. According to the parent’s observations, younger children are characterized by nail nibbling, ticklishness, and fearfulness, whereas older children show a tendency to force their way by crying, waywardness and bed-wetting. By means of factor analysis of the items, three principal facets of aberrant behavior were determined: overindulgence, shyness and quarrelsomeness. Cross validation (hold out showed that these three facets were robust in relation to the selection of the sample.

  5. Using Aberrant Behaviors as Reinforcers for Autistic Children.

    Science.gov (United States)

    Charlop, Marjorie H.; And Others

    1990-01-01

    Three experiments assessed the efficacy of various reinforcers to increase correct task responding in a total of 10 autistic children, aged 6-9. Of the reinforcers used (stereotypy, delayed echolalia, perseverative behavior, and food), task performance was highest with opportunities to engage in aberrant behaviors, and lowest with edible…

  6. Refractive and diffractive neutron optics with reduced chromatic aberration

    DEFF Research Database (Denmark)

    Poulsen, Stefan Othmar; Poulsen, Henning Friis; Bentley, P.M.

    2014-01-01

    by the use of optics for focusing and imaging. Refractive and diffractive optical elements, e.g. compound refractive lenses and Fresnel zone plates, are attractive due to their low cost, and simple alignment. These optical elements, however, suffer from chromatic aberration, which limit their effectiveness...

  7. Polarization aberrations of radiation at the lens focus

    NARCIS (Netherlands)

    Sokolov, AL

    2005-01-01

    The polarization aberrations of radiation at the lens focus are calculated with allowance for diffraction effects. Calculations are performed using the representation of radiation as a coherent set of Hermite-Gauss modes with certain amplitudes, phases, and polarizations. An expression for the longi

  8. The pterygo-spinous muscle--an aberrant (atavic) remnant.

    Science.gov (United States)

    Nathan, H

    1989-01-01

    We report here on an aberrant pterygoid muscle found during a dissection of the infratemporal fossa. We have not noted such a muscle in hundreds of dissections in the area. A few anatomical texts (Piersol, 1911; Testut, Latarjet, 1931) have referred to its possible existence as the pterygo-spinous muscle.

  9. Aberrant nerve fibres within the central nervous system.

    Science.gov (United States)

    Moffie, D

    1992-01-01

    Three cases of aberrant nerve fibres in the spinal cord and medulla oblongata are described. The literature on these fibres is discussed and their possible role in regeneration. Different views on the possibility of regeneration or functional recovery of the central nervous system are mentioned in the light of recent publications, which are more optimistic than before.

  10. The Aberrant Salience Inventory: A New Measure of Psychosis Proneness

    Science.gov (United States)

    Cicero, David C.; Kerns, John G.; McCarthy, Denis M.

    2010-01-01

    Aberrant salience is the unusual or incorrect assignment of salience, significance, or importance to otherwise innocuous stimuli and has been hypothesized to be important for psychosis and psychotic disorders such as schizophrenia. Despite the importance of this concept in psychosis research, no questionnaire measures are available to assess…

  11. [Cytogenetic aberrations in histologically benign infiltratively growing sphenoid wing meningiomas].

    Science.gov (United States)

    Korshunov, A G; Cherekaev, V A; Bekiashev, A Kh; Sycheva, R V

    2007-01-01

    Meningiomas of the sphenoid wing (SW) frequently show an invasive pattern of growth and cause destruction of the adjacent structures. As a result, the rate of recurrent SW meningiomas is as high as 30%. Cytogenetic investigations showed no aberrations specific to invasively growing meningiomas. During this study, the authors evaluated 10 invasive and 5 non-invasive SW meningiomas via comparative genome hybridization (CGH) (matrix CGH), by using the gene chips of GenoSensor Array micromatrixes. The mean number of aberrations in the tumor cells was much greater in case of invasive meningiomas (67.4 versus 40.5 in case of non-invasive SW meningiomas. Furthermore, in invasive SW meningiomas, there were frequently losses in loci 1p, 6q, and 14q and gains in loci 15q and 10, which had been predetermined as molecular markers of stepwise progression of meningioma. Thus, the presence of a complex cytogenetic profile and progression-associated chromosome aberrations in benign SW meningiomas is linked with the increase of their invasive potential. Due to the fact that there are no well-defined adjuvant therapy regimens for recurring meningiomas at present, the revealed genomic aberrations may become potential targets for searching for drugs and a therapeutic intervention in future.

  12. Characterization of S1 nuclease sensitive site at transcription initiation region of Attacus ricini rDNA

    Institute of Scientific and Technical Information of China (English)

    何明亮; 赵慕钧; 靳嘉瑞; 李载平

    1997-01-01

    A single-stranded S1 nuclease hypersensitive site which contains a d(AT)18 sequence structure locat-ed in the 5 -non transcription spacer of silkworm A . ricini ribosomal RNA gene has been reported[1] Using starved-refed silkworms, another S1 nuclease sensitive site was found existing in the rDNA chromatin, while under merely starving, this S1 sensitive site disappeared[2] . Recently this inducible S1 sensitive site has been further determined. It consists of a d(GT)10-d(AT)10 special DNA sequence at the transcription initiation region, and shows a behavior of ease in DNA-unwinding, indicating that S1 nuclease sensitive sites may have an important function in the regulation of rDNA transcription and replication.

  13. Low-temperature photoluminescence in CuIn$_5$S$_8$ single crystals

    Indian Academy of Sciences (India)

    GASANLY N M

    2016-06-01

    Photoluminescence (PL) spectra of CuIn$_5$S$_8$ single crystals grown by Bridgman method have been studied in the wavelength region of 720–1020 nm and in the temperature range of 10–34 K. A broad PL band centred at 861 nm (1.44 eV) was observed at $T$ = 10 K. Variations of emission band has been studied as a function of excitation laser intensity in the 0.5–60.2 mW cm$^{−2}$ range. Radiative transitions from shallow donor level located at 17 meV below thebottom of the conduction band to the acceptor level located at 193 meV above the top of the valence band were suggested to be responsible for the observed PL band. An energy level diagram showing transitions in the band gap of the crystal has been presented.

  14. Direct lateral interbody fusion (DLIF) at the lumbosacral junction L5-S1.

    Science.gov (United States)

    Shirzadi, Ali; Birch, Kurtis; Drazin, Doniel; Liu, John C; Acosta, Frank

    2012-07-01

    The direct lateral interbody fusion (DLIF), a minimally invasive lateral approach for placement of an interbody fusion device, does not require nerve root retraction or any contact with the great vessels and can lead to short operative times with little blood loss. Due to anatomical restrictions, this procedure has not been used at the lumbosacral (L5-S1) junction. Lumbosacral transitional vertebrae (LSTV), a structural anomaly of the lumbosacral spine associated with low back pain, can result in a level being wrongly identified pre-operatively due to misnumbering of the vertebral levels. To our knowledge, use of the DLIF graft in this patient is the first report of an interbody fusion graft being placed at the disc space between the LSTV and S1 via the transpsoas route. We present a review of the literature regarding the LSTV variation as well as the lateral placement of interbody fusion grafts at the lumbosacral junction.

  15. Trends in evolution of 5S rRNA of deuterostomes: bases and homogeneous clusters

    Directory of Open Access Journals (Sweden)

    Sandra Maria Rodrigues Subacius

    2002-01-01

    Full Text Available Evolution of metazoan 5S rRNA sequences was analyzed through base composition and types, location and frequency of clustered bases. Characters from sequences of protostomes did not show regular trends as compared with paleontology dating or organism complexity. Trends of increasing G and C, stronger in G clusters, and decreasing A and U, were detected in deuterostomes, in parallel with evolution of complexity. The multifunctional domain 71-104 was highlighted among conserved stretches. Clusters of C were typical of helices. Those of G were longer, extending from helices into loops or related to bulges, which is suggestive of functional significance. Deuterostomian trends were installed early in the lineage and reached full development in aquatic organisms, not increasing further after reptiles. It can be suggested that ribosomal RNA structures participated in deuterostomian high regulatory complexity, either specifically or as part of the widespread processes of chromosomal regionalization.

  16. "5S"--一个值得借鉴的管理理念

    Institute of Scientific and Technical Information of China (English)

    张平

    2003-01-01

    @@ 我曾在一外资企业上班,工作时间不能干私事、不能会客、不能接打私人电话,各部门除最高主管外一律不得配戴手机,即使是与业务相关的知识也只能利用工余时间"充电",凡有违者,老板或温柔地祝福:"请你一路走好!"或无情地安慰:"公司下次招工,请你再来."自然,打工的日子紧张劳苦.但深深打动我记忆的倒不是此,而是所见高效管理、忙碌有序的"5S"运动.

  17. Donor-acceptor pair recombination in AgIn5S8 single crystals

    Science.gov (United States)

    Gasanly, N. M.; Serpengüzel, A.; Aydinli, A.; Gürlü, O.; Yilmaz, I.

    1999-03-01

    Photoluminescence (PL) spectra of AgIn5S8 single crystals were investigated in the 1.44-1.91 eV energy region and in the 10-170 K temperature range. The PL band was observed to be centered at 1.65 eV at 10 K and an excitation intensity of 0.97 W cm-2. The redshift of this band with increasing temperature and with decreasing excitation intensity was observed. To explain the observed PL behavior, we propose that the emission is due to radiative recombination of a donor-acceptor pair, with an electron occupying a donor level located at 0.06 eV below the conduction band, and a hole occupying an acceptor level located at 0.32 eV above the valence band.

  18. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    Energy Technology Data Exchange (ETDEWEB)

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  19. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    DEFF Research Database (Denmark)

    Christiansen, J; Douthwaite, S R; Christensen, A;

    1985-01-01

    Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the r...

  20. Usefulness of 16S rDNA sequencing for the diagnosis of infective endocarditis caused by Corynebacterium diphtheriae.

    Science.gov (United States)

    Pathipati, Padmaja; Menon, Thangam; Kumar, Naveen; Francis, Thara; Sekar, Prem; Cherian, Kotturathu Mammen

    2012-08-01

    We report a rare case of infective endocarditis caused by Corynebacterium diphtheriae in an 8-year-old boy, 2 years after a right ventricular outflow tract reconstruction with a bovine Contegra valved conduit. The patient recovered well after an RV-PA conduit enblock explantation and replacement with an aortic homograft with antibiotic treatment. All bacteriological cultures of excised tissue and blood were negative. The aetiological agent was identified as C. diphtheriae subsp. gravis by 16s rDNA sequencing.

  1. Sequence analysis of the ITS region and 5.8S rDNA of Porphyra haitanensis

    Institute of Scientific and Technical Information of China (English)

    LI Yanyan; SHEN Songdong; HE Lihong; XU Pu; WANG Guangce

    2009-01-01

    The sequences of the ITS (internal transcribed spacer) and 5.8S rDNA of three cultivated strains of Porphyra haitanensis thalli (NB, PT and ST) were amplified, sequenced and analyzed. In addition, the phylogenic relationships of the sequences identified in this study with those of other Porphyra retrieved from GenBank were evaluated. The results are as follows: the sequences of the ITS and 5.8S rDNA were essentially identical among the three strains. The sequences of ITS1 were 331 bp to 334 bp, while those of the 5.8S rDNA were 158 bp and the sequences of ITS2 ranged from 673 bp to 681 bp. The sequences of the ITS had a high level of homology (up to 99.5%) with that of P. haitanensis (DQ662228) retrieved from GenBank, but were only approximately 50% homologous with those of other species of Porphyra. The results obtained when a phylogenetic tree was constructed coincided with the results of the homology analysis. These results suggest that the three cultivated strains of P. haitanensis evolved conservatively and that the ITS showed evolutionary consistency. However, the sequences of the ITS and 5.8S rDNA of different Porphyra species showed great variations. Therefore, the relationship of Porphyra interspecies phyletic evolution could be judged, which provides the proof for Porphyra identification study. However, proper classifications of the subspecies and the populations of Porphyra should be determined through the use of other molecular techniques to determine the genetic variability and rational phylogenetic relationships.

  2. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs.

  3. Authentication of Curcuma species (Zingiberaceae) based on nuclear 18S rDNA and plastid trnK sequences.

    Science.gov (United States)

    Cao, Hui; Sasaki, Yohei; Fushimi, Hirotoshi; Komatsu, Katsuko

    2010-07-01

    Curcuma drugs have been used discriminatingly for invigorating blood circulation, promoting digestion, and as a cholagogic in China. However, there is confusion about the drug's botanical origins and clinical uses because of morphological similarity of Curcuma plants and drugs. Comparative sequencing of the 18S rRNA gene in nuclear ribosomal DNA (rDNA) and trnK gene in chloroplast DNA (cpDNA) was carried out in order to examine interspecies phylogeny and to identify ultimately Curcuma species. A total of a hundred of accessions of eighteen species were analyzed. This resulted in an aligned matrix of 1810 bp for 18S rDNA and 2 800 bp for trnK. 18S rDNA sequence divergence within the ingroup ranged from 0-0.05%, trnK ranged from 0-0.19%. One base transversion-substituted site (from cytosine to thymine) was observed from the upstream of 18S rDNA at nucleotide position 234 in C. kwangsiensis and Japanese population of C. zedoaria which have separated genetic distance to other Curcuma taxa. Two noncoding regions embedded in trnK intron showed higher variability, including nucleotide substitutions, repeat insertion and deletions. Based on consensus of relationship, eighteen major lineages within Curcuma are recognized at the species level. The results suggest that Curcuma is monophyletic with 100% bootstrap support and sister to the genera Hedychium and Zingiber. The trnK sequences showed considerable variations between Curcuma species and thus were revealed as a promising candidate for barcoding of Curcuma species, which provide valuable characters for inferring relationship within species but are insufficient to resolve relationships among closely related taxa.

  4. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    Science.gov (United States)

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  5. New Paramecium quadecaurelia strains (P. aurelia spp. complex, Ciliophora) identified by molecular markers (rDNA and mtDNA).

    Science.gov (United States)

    Przyboś, Ewa; Tarcz, Sebastian; Dusi, Eike

    2013-08-01

    Paramecium quadecaurelia is a rare species (previously known only from two locations) belonging to the P. aurelia species complex. In the present paper, fragments of an rDNA gene (ITS1-5.8S-ITS2-5' rDNA) and mtDNA genes (cytochrome oxidase subunit I and cytochrome b regions) were employed to assist in the identification and characterization of three new strains collected from Ecuador and Thailand. Molecular data were confirmed by mating reactions. In rDNA and mtDNA trees constructed for species of the P. aurelia complex, all P. quadecaurelia strains, including the three new strains discussed in this study and two known previously from Australia and Africa, form a monophyletic but differentiated clade. The present study shows that genetic differentiation among the strains of P. quadecaurelia is equal to or even greater than the distances between some other P. aurelia species, e.g., P. primaurelia and P. pentaurelia. Such great intra-specific differentiation may indicate a future splitting of the P. quadecaurelia species into reproductively isolated lines.

  6. Targeting of the human coagulation factor IX gene at rDNA locus of human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Xionghao Liu

    Full Text Available BACKGROUND: Genetic modification is a prerequisite to realizing the full potential of human embryonic stem cells (hESCs in human genetic research and regenerative medicine. Unfortunately, the random integration methods that have been the primary techniques used keep creating problems, and the primary alternative method, gene targeting, has been effective in manipulating mouse embryonic stem cells (mESCs but poorly in hESCs. METHODOLOGY/PRINCIPAL FINDINGS: Human ribosomal DNA (rDNA repeats are clustered on the short arm of acrocentric chromosomes. They consist of approximately 400 copies of the 45S pre-RNA (rRNA gene per haploid. In the present study, we targeted a physiological gene, human coagulation factor IX, into the rDNA locus of hESCs via homologous recombination. The relative gene targeting efficiency (>50% and homologous recombination frequency (>10(-5 were more than 10-fold higher than those of loci targeted in previous reports. Meanwhile, the targeted clones retained both a normal karyotype and the main characteristics of ES cells. The transgene was found to be stably and ectopically expressed in targeted hESCs. CONCLUSION/SIGNIFICANCE: This is the first targeting of a human physiological gene at a defined locus on the hESC genome. Our findings indicate that the rDNA locus may serve as an ideal harbor for transgenes in hESCs.

  7. Chromosome evolution in tiger beetles: Karyotypes and localization of 18S rDNA loci in Neotropical Megacephalini (Coleoptera, Cicindelidae

    Directory of Open Access Journals (Sweden)

    Sónia J.R. Proença

    2005-12-01

    Full Text Available Four Neotropical tiger beetle species, three from the genus Megacephala and one from the genus Oxycheila, currently assigned to the tribe Megacephalini were examined cytogenetically. All three Megacephala species showed simple sex chromosome systems of the X0/XX type but different numbers of autosomal pairs (15 in M. cruciata, 14 in M. sobrina and 12 in M. rutilans, while Oxycheila tristis was inferred to have a multiple sex chromosome system with four X chromosomes (2n = 24 + X1X2X3X4Y/X1X1X2X2X3X3X4X4. Fluorescence in situ hybridization (FISH using a PCR-amplified 18S rDNA fragment as a probe revealed the presence of rDNA clusters located exclusively on the autosomes in all the Megacephala species (five clusters in M. cruciata, eight in M. sobrina and three in M. rutilans, indicating variability in the number of clusters and the presence of structural polymorphisms. The same methodology showed that O. tristis had six rDNA clusters, apparently also located on the autosomes. Although our data also show cytogenetic variability within the genus Megacephala, our findings support the most accepted hypothesis for chromosome evolution in the family Cicindelidae. The description of multiple sex chromosomes in O. tristis along with phylogenetic analyses and larval morphological characters may be assumed as an additional evidence for the exclusion of the genus Oxycheila and related taxa from the tribe Megacephalini.

  8. Immunological inter-strain crossreactivity correlated to 18S rDNA sequence types in Acanthamoeba spp.

    Science.gov (United States)

    Walochnik, J; Obwaller, A; Aspöck, H

    2001-02-01

    Various species of the genus Acanthamoeba have been described as potential pathogens; however, differentiation of acanthamoebae remains problematic. The genus has been divided into 12 18S rDNA sequence types, most keratitis causing strains exhibiting sequence type T4. We recently isolated a keratitis causing Acanthamoeba strain showing sequence type T6, but being morphologically identical to a T4 strain. The aim of our study was to find out, whether the 18S rDNA sequence based identification correlates to immunological differentiation. The protein and antigen profiles of the T6 isolate and three reference Acanthamoeba strains were investigated using two sera from Acanthamoeba keratitis patients and one serum from an asymptomatic individual. It was shown, that the T6 strain produces a distinctly different immunological pattern, while patterns within T4 were identical. Affinity purified antibodies were used to further explore immunological cross-reactivity between sequence types. Altogether, the results of our study support the Acanthamoeba 18S rDNA sequence type classification in the investigated strains.

  9. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J

    2010-09-01

    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  10. Subjective face recognition difficulties, aberrant sensibility, sleeping disturbances and aberrant eating habits in families with Asperger syndrome

    Directory of Open Access Journals (Sweden)

    Källman Tiia

    2005-04-01

    Full Text Available Abstract Background The present study was undertaken in order to determine whether a set of clinical features, which are not included in the DSM-IV or ICD-10 for Asperger Syndrome (AS, are associated with AS in particular or whether they are merely a familial trait that is not related to the diagnosis. Methods Ten large families, a total of 138 persons, of whom 58 individuals fulfilled the diagnostic criteria for AS and another 56 did not to fulfill these criteria, were studied using a structured interview focusing on the possible presence of face recognition difficulties, aberrant sensibility and eating habits and sleeping disturbances. Results The prevalence for face recognition difficulties was 46.6% in individuals with AS compared with 10.7% in the control group. The corresponding figures for subjectively reported presence of aberrant sensibilities were 91.4% and 46.6%, for sleeping disturbances 48.3% and 23.2% and for aberrant eating habits 60.3% and 14.3%, respectively. Conclusion An aberrant processing of sensory information appears to be a common feature in AS. The impact of these and other clinical features that are not incorporated in the ICD-10 and DSM-IV on our understanding of AS may hitherto have been underestimated. These associated clinical traits may well be reflected by the behavioural characteristics of these individuals.

  11. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Jie Hong

    Full Text Available Mechanisms of the progression from Barrett's esophagus (BE to esophageal adenocarcinoma (EA are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  12. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Science.gov (United States)

    Hong, Jie; Li, Dan; Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett's esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  13. Investigating bacterial populations in styrene-degrading biofilters by 16S rDNA tag pyrosequencing.

    Science.gov (United States)

    Portune, Kevin J; Pérez, M Carmen; Álvarez-Hornos, F Javier; Gabaldón, Carmen

    2015-01-01

    Microbial biofilms are essential components in the elimination of pollutants within biofilters, yet still little is known regarding the complex relationships between microbial community structure and biodegradation function within these engineered ecosystems. To further explore this relationship, 16S rDNA tag pyrosequencing was applied to samples taken at four time points from a styrene-degrading biofilter undergoing variable operating conditions. Changes in microbial structure were observed between different stages of biofilter operation, and the level of styrene concentration was revealed to be a critical factor affecting these changes. Bacterial genera Azoarcus and Pseudomonas were among the dominant classified genera in the biofilter. Canonical correspondence analysis (CCA) and correlation analysis revealed that the genera Brevundimonas, Hydrogenophaga, and Achromobacter may play important roles in styrene degradation under increasing styrene concentrations. No significant correlations (P > 0.05) could be detected between biofilter operational/functional parameters and biodiversity measurements, although biological heterogeneity within biofilms and/or technical variability within pyrosequencing may have considerably affected these results. Percentages of selected bacterial taxonomic groups detected by fluorescence in situ hybridization (FISH) were compared to results from pyrosequencing in order to assess the effectiveness and limitations of each method for identifying each microbial taxon. Comparison of results revealed discrepancies between the two methods in the detected percentages of numerous taxonomic groups. Biases and technical limitations of both FISH and pyrosequencing, such as the binding of FISH probes to non-target microbial groups and lack of classification of sequences for defined taxonomic groups from pyrosequencing, may partially explain some differences between the two methods.

  14. 18S rDNA sequences from microeukaryotes reveal oil indicators in mangrove sediment.

    Directory of Open Access Journals (Sweden)

    Henrique F Santos

    Full Text Available BACKGROUND: Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. CONCLUSIONS

  15. Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana

    NARCIS (Netherlands)

    Ji, X.

    2014-01-01

    Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana. I studied numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana. The large genomic changes are important for

  16. Association of DNA with nuclear matrix in in vitro assembled nuclei induced by rDNA from Tetrahymena shanghaiensis in Xenopus egg extracts

    Institute of Scientific and Technical Information of China (English)

    CHENYING; BOZHANG; 等

    1997-01-01

    The nuclei assembled from exogenous DNA or chromatin in egg extracts resemble their in vivo counterparts in many aspects.However,the distribution pattern of DNA in these nuclei remains unknown.We introduced rDNA from the macronuclei of Tetrahymena into Xenopus cellfree extracts to examine the association of specific DNA sequences with nuclear matrix(NM) in the nuclei assembled in vitro.Our previous works showed the 5'NTS(nontranscription sequences) of the rDNA specifically bind to the NM system in the macronuclei.We show now the rDNA could induce chromatin assembly and nuclear formation in Xenopus cell-free system.When we extracted the NM system and compared the binding affinity of different regions of rDNA with the NM system,we found that the 5'NTS still hold their binding affinity with insoluble structure of the assembled nuclei in the estracts of Xenopus eggs.

  17. Prediction of anomalous $\\Upsilon(5S)\\to\\Upsilon(1^3D_J)\\eta$ transitions

    CERN Document Server

    Wang, Bo; Liu, Xiang

    2016-01-01

    In this work, we study the hadronic loop contribution to the $\\Upsilon(5S)\\to \\Upsilon(1^3D_J)\\eta$ ($J=1,2,3$) transitions. We predict that the branching ratios of $\\Upsilon(5S)\\to \\Upsilon(1^3D_1)\\eta$, $\\Upsilon(5S)\\to \\Upsilon(1^3D_2)\\eta$ and $\\Upsilon(5S)\\to \\Upsilon(1^3D_3)\\eta$ can reach up to $(0.5\\sim5.1)\\times10^{-3}$, $(0.7\\sim7.5)\\times10^{-3}$ and $(0.9\\sim9.6)\\times10^{-4}$, respectively. Since these predicted hadronic transitions of $\\Upsilon(5S)$ are comparable with these observed $\\Upsilon(5S)\\to \\Upsilon(nS)\\pi^+\\pi^-$ $(n=1,2,3)$, we suggest future experiment like Belle and BelleII to carry out the search for these anomalous $\\Upsilon(5S)\\to \\Upsilon(1^3D_J)\\eta$ transitions.

  18. A Case Study of the Reduction of Aberrant, Repetitive Responses of an Adolescent with Autism.

    Science.gov (United States)

    Gunter, Philip L.; And Others

    1993-01-01

    In this case study, music was applied noncontingently and contingently across four settings with an adolescent male with autism, to reduce aberrant, repetitive vocalizations. The intervention was associated with dramatic reductions in the primary aberrant behavior and reductions in two other aberrant behaviors. Task performance was differentially…

  19. Nodular Hyperplasia Arising from the Lateral Aberrant Thyroid Tissue: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Min Hye; Park, Jeong Seon; Lee, Young Jun [Dept. of Radiology, Hanyang University College of Medicine, Hanyang University Hospital, Seoul (Korea, Republic of)

    2012-06-15

    The presence of aberrant thyroid tissue in the lateral neck is very rare. In addition, nodular hyperplasia in ectopic thyroid has rarely been reported. Due to the unusual location, the presence of lateral aberrant thyroid tissue could be misdiagnosed as a lymphadenopathy, neurogenic tumor, etc. We report on a case of nodular hyperplasia arising from the right lateral aberrant thyroid tissue.

  20. Contribution of the cornea and internal surfaces to the change of ocular aberrations with age

    Science.gov (United States)

    Artal, Pablo; Berrio, Esther; Guirao, Antonio; Piers, Patricia

    2002-01-01

    We studied the age dependence of the relative contributions of the aberrations of the cornea and the internal ocular surfaces to the total aberrations of the eye. We measured the wave-front aberration of the eye with a Hartmann-Shack sensor and the aberrations of the anterior corneal surface from the elevation data provided by a corneal topography system. The aberrations of the internal surfaces were obtained by direct subtraction of the ocular and corneal wave-front data. Measurements were obtained for normal healthy subjects with ages ranging from 20 to 70 years. The magnitude of the RMS wave-front aberration (excluding defocus and astigmatism) of the eye increases more than threefold within the age range considered. However, the aberrations of the anterior corneal surface increase only slightly with age. In most of the younger subjects, total ocular aberrations are lower than corneal aberrations, while in the older subjects the reverse condition occurs. Astigmatism, coma, and spherical aberration of the cornea are larger than in the complete eye in younger subjects, whereas the contrary is true for the older subjects. The internal ocular surfaces compensate, at least in part, for the aberrations associated with the cornea in most younger subjects, but this compensation is not present in the older subjects. These results suggest that the degradation of the ocular optics with age can be explained largely by the loss of the balance between the aberrations of the corneal and the internal surfaces.

  1. 45S rDNA regions are chromosome fragile sites expressed as gaps in vitro on metaphase chromosomes of root-tip meristematic cells in Lolium spp.

    Directory of Open Access Journals (Sweden)

    Jing Huang

    Full Text Available BACKGROUND: In humans, chromosome fragile sites are regions that are especially prone to forming non-staining gaps, constrictions or breaks in one or both of the chromatids on metaphase chromosomes either spontaneously or following partial inhibition of DNA synthesis and have been well identified. So far, no plant chromosome fragile sites similar to those in human chromosomes have been reported. METHODS AND RESULTS: During the course of cytological mapping of rDNA on ryegrass chromosomes, we found that the number of chromosomes plus chromosome fragments was often more than the expected 14 in most cells for Lolium perenne L. cv. Player by close cytological examination using a routine chromosome preparation procedure. Further fluorescent in situ hybridization (FISH using 45S rDNA as a probe indicated that the root-tip cells having more than a 14-chromosome plus chromosome fragment count were a result of chromosome breakage or gap formation in vitro (referred to as chromosome lesions at 45S rDNA sites, and 86% of the cells exhibited chromosome breaks or gaps and all occurred at the sites of 45S rDNA in Lolium perenne L. cv. Player, as well as in L. multiflorum Lam. cv. Top One. Chromatin depletion or decondensation occurred at various locations within the 45S rDNA regions, suggesting heterogeneity of lesions of 45S rDNA sites with respect to their position within the rDNA region. CONCLUSIONS: The chromosome lesions observed in this study are very similar cytologically to that of fragile sites observed in human chromosomes, and thus we conclude that the high frequency of chromosome lesions in vitro in Lolium species is the result of the expression of 45S rDNA fragile sites. Possible causes for the spontaneous expression of fragile sites and their potential biological significance are discussed.

  2. Application of "5 S" Management in University Based in Chemical Laboratory%将"5S"管理方法引入高校基础化学实验室

    Institute of Scientific and Technical Information of China (English)

    刘明星

    2016-01-01

    阐述了源自日本的"5S"管理的含义、 目的和要点.指出了和目前高校基础化学实验室存在现状和问题.结合基础化学实验室的特点和实际情况提出了"5S"管理在化学实验室中具体实施的措施和方法.介绍了"5S"管理在有机化学实验室试点实施中取得的的效果.指出了管理层在基础化学实验室全面推广"5S"管理的过程中需要承担的责任和需要解决的问题.

  3. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    Science.gov (United States)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  4. Species-genomic relationships among the tribasic diploid and polyploid Carthamus taxa based on physical mapping of active and inactive 18S-5.8S-26S and 5S ribosomal RNA gene families, and the two tandemly repeated DNA sequences.

    Science.gov (United States)

    Agrawal, Renuka; Tsujimoto, Hisashi; Tandon, Rajesh; Rao, Satyawada Rama; Raina, Soom Nath

    2013-05-25

    In the genus Carthamus (2n=20, 22, 24, 44, 64; x=10, 11, 12), most of the homologues within and between the chromosome complements are difficult to be identified. In the present work, we used fluorescent in situ hybridisation (FISH) to determine the chromosome distribution of the two rRNA gene families, and the two isolated repeated DNA sequences in the 14 Carthamus taxa. The distinctive variability in the distribution, number and signal intensity of hybridisation sites for 18S-26S and 5S rDNA loci could generally distinguish the 14 Carthamus taxa. Active 18S-26S rDNA sites were generally associated with NOR loci on the nucleolar chromosomes. The two A genome taxa, C. glaucus ssp. anatolicus and C. boissieri with 2n=20, and the two botanical varieties of B genome C. tinctorius (2n=24) had diagnostic FISH patterns. The present results support the origin of C. tinctorius from C. palaestinus. FISH patterns of C. arborescens vis-à-vis the other taxa indicate a clear division of Carthamus taxa into two distinct lineages. Comparative distribution and intensity pattern of 18S-26S rDNA sites could distinguish each of the tetraploid and hexaploid taxa. The present results indicate that C. boissieri (2n=20) is one of the genome donors for C. lanatus and C. lanatus ssp. lanatus (2n=44), and C. lanatus is one of the progenitors for the hexaploid (2n=64) taxa. The association of pCtKpnI-2 repeated sequence with rRNA gene cluster (orphon) in 2-10 nucleolar and non-nucleolar chromosomes and the consistent occurrence of pCtKpnI-1 repeated sequence at the subtelomeric region in all the taxa analysed indicate some functional role of these sequences.

  5. Correction of Optical Aberrations in Elliptic Neutron Guides

    CERN Document Server

    Bentley, Phillip M; Andersen, Ken H; Rodriguez, Damian Martin; Mildner, David F R

    2012-01-01

    Modern, nonlinear ballistic neutron guides are an attractive concept in neutron beam delivery and instrumentation, because they offer increased performance over straight or linearly tapered guides. However, like other ballistic geometries they have the potential to create significantly non-trivial instrumental resolution functions. We address the source of the most prominent optical aberration, namely coma, and we show that for extended sources the off-axis rays have a different focal length from on-axis rays, leading to multiple reflections in the guide system. We illustrate how the interplay between coma, sources of finite size, and mirrors with non-perfect reflectivity can therefore conspire to produce uneven distributions in the neutron beam divergence, the source of complicated resolution functions. To solve these problems, we propose a hybrid elliptic-parabolic guide geometry. Using this new kind of neutron guide shape, it is possible to condition the neutron beam and remove almost all of the aberration...

  6. [Aluminum induces chromosome aberrations in wheat root meristem cells].

    Science.gov (United States)

    Bulanova, N V; Synzynys, B I; Koz'min, G V

    2001-12-01

    The yield and pattern of chromosome structure aberrations in wheat seedlings treated with aluminum nitrate and aluminum sulfate at various concentrations have been determined by the anaphase method. Aluminum has a genotoxic effect causing genome, chromatid, and chromosome aberrations in apical root meristem cells. The relationship between the total yield of structural mutations and the aluminum concentration follows a bell-shaped curve. The mutagenic activity of aluminum nitrate peaks at 10(-3) mg/ml, which is twice as high as the permissible concentration limit (PCL) of aluminum in potable water. The maximum of the mutagenic activity of aluminum sulfate is observed at 5 x 10(-4) mg/ml, i.e., one PCL. Tap water boiled for 2 h in an aluminum vessel has virtually no genotoxic effect on wheat cells.

  7. Mathematical Modeling of Carcinogenesis Based on Chromosome Aberration Data

    Institute of Scientific and Technical Information of China (English)

    Xiao-bo Li

    2009-01-01

    Objective: The progression of human cancer is characterized by the accumulation of genetic instability. An increasing number of experimental genetic molecular techniques have been used to detect chromosome aberrations. Previous studies on chromosome abnormalities often focused on identifying the frequent loci of chromosome alterations, but rarely addressed the issue of interrelationship of chromosomal abnormalities. In the last few years, several mathematical models have been employed to construct models of carcinogenesis, in an attempt to identify the time order and cause-and-effect relationship of chromosome aberrations. The principles and applications of these models are reviewed and compared in this paper. Mathematical modeling of carcinogenesis can contribute to our understanding of the molecular genetics of tumor development, and identification of cancer related genes, thus leading to improved clinical practice of cancer.

  8. Chromatic aberration control for tunable all-silicone membrane microlenses.

    Science.gov (United States)

    Waibel, Philipp; Mader, Daniel; Liebetraut, Peter; Zappe, Hans; Seifert, Andreas

    2011-09-12

    Tunable multi-chamber microfluidic membrane microlenses with achromaticity over a given focal length range are demonstrated. In analogy to a fixed-focus achromatic doublet lens, the multi-lens system is based on a stack of microfluidic cavities filled with optically optimized liquids with precisely defined refractive index and Abbe number, and these are independently pneumatically actuated. The membranes separating the cavities form the refractive optical surfaces, and the curvatures as a function of pressure are calculated using a mechanical model for deformation of flexible plates. The results are combined with optical ray tracing simulations of the multi-lens system to yield chromatic aberration behavior, which is verified experimentally. A focal length tuning range of 5-40 mm and reduction in chromatic aberration of over 30% is demonstrated, limited by the availability of optical fluids.

  9. Filtering chromatic aberration for wide acceptance angle electrostatic lenses.

    Science.gov (United States)

    Fazekas, Ádám; Tóth, László

    2014-07-01

    Chromatic aberration is a major issue for imaging mainly with large acceptance angle electrostatic lenses. Its correction is necessary to take advantage of the outstanding spatial and angular resolution that these lenses provide. We propose a method to eliminate the effect of chromatic aberration on the measured images by determining the impact resulting from higher and lower kinetic energies. Based on a spectral image sequence and a matrix, which describes the transmission function of the lens, a system of linear equations is solved to approximate the 2D spectral intensity distribution of the sample surface. We present the description of our method and preliminary test results, which show significant contrast and image quality improvement. The presented algorithm can also be applied as a software-based energy analyzer.

  10. Aberrantly methylated DNA as a biomarker in breast cancer

    DEFF Research Database (Denmark)

    Kristiansen, Søren; Jørgensen, Lars Mønster; Guldberg, Per;

    2013-01-01

    hypermethylation events, their use as tumor biomarkers is usually not hampered by analytical signals from normal cells, which is a general problem for existing protein tumor markers used for clinical assessment of breast cancer. There is accumulating evidence that DNA-methylation changes in breast cancer patients......Aberrant DNA hypermethylation at gene promoters is a frequent event in human breast cancer. Recent genome-wide studies have identified hundreds of genes that exhibit differential methylation between breast cancer cells and normal breast tissue. Due to the tumor-specific nature of DNA...... into subgroups based on DNA biomarkers may improve prognosis. Serial monitoring of DNA-methylation markers in blood during treatment may be useful, particularly when the cancer burden is below the detection level for standard imaging techniques. Overall, aberrant DNA methylation has a great potential...

  11. Aberrant hippocampal neurogenesis contributes to epilepsy and associated cognitive decline.

    Science.gov (United States)

    Cho, Kyung-Ok; Lybrand, Zane R; Ito, Naoki; Brulet, Rebecca; Tafacory, Farrah; Zhang, Ling; Good, Levi; Ure, Kerstin; Kernie, Steven G; Birnbaum, Shari G; Scharfman, Helen E; Eisch, Amelia J; Hsieh, Jenny

    2015-03-26

    Acute seizures after a severe brain insult can often lead to epilepsy and cognitive impairment. Aberrant hippocampal neurogenesis follows the insult but the role of adult-generated neurons in the development of chronic seizures or associated cognitive deficits remains to be determined. Here we show that the ablation of adult neurogenesis before pilocarpine-induced acute seizures in mice leads to a reduction in chronic seizure frequency. We also show that ablation of neurogenesis normalizes epilepsy-associated cognitive deficits. Remarkably, the effect of ablating adult neurogenesis before acute seizures is long lasting as it suppresses chronic seizure frequency for nearly 1 year. These findings establish a key role of neurogenesis in chronic seizure development and associated memory impairment and suggest that targeting aberrant hippocampal neurogenesis may reduce recurrent seizures and restore cognitive function following a pro-epileptic brain insult.

  12. Aberrations and adaptive optics in super-resolution microscopy.

    Science.gov (United States)

    Booth, Martin; Andrade, Débora; Burke, Daniel; Patton, Brian; Zurauskas, Mantas

    2015-08-01

    As one of the most powerful tools in the biological investigation of cellular structures and dynamic processes, fluorescence microscopy has undergone extraordinary developments in the past decades. The advent of super-resolution techniques has enabled fluorescence microscopy - or rather nanoscopy - to achieve nanoscale resolution in living specimens and unravelled the interior of cells with unprecedented detail. The methods employed in this expanding field of microscopy, however, are especially prone to the detrimental effects of optical aberrations. In this review, we discuss how super-resolution microscopy techniques based upon single-molecule switching, stimulated emission depletion and structured illumination each suffer from aberrations in different ways that are dependent upon intrinsic technical aspects. We discuss the use of adaptive optics as an effective means to overcome this problem.

  13. Detection of epigenetic aberrations in the development of hepatocellular carcinoma.

    Science.gov (United States)

    Zhang, Yujing

    2015-01-01

    Hepatocellular carcinoma (HCC) is the third most common cause of cancer death worldwide. Hepatocarcinogenesis is a complex, multistep process. It is now recognized that HCC is a both genetic and epigenetic disease; genetic and epigenetic components cooperate at all stages of hepatocarcinogenesis. Epigenetic changes involve aberrant DNA methylation, posttranslational histone modifications and aberrant expression of microRNAs all of which can affect the expression of oncogenes, tumor suppressor genes and other tumor-related genes and alter the pathways in cancer development. Several risk factors for HCC, including hepatitis B and C virus infections and exposure to the chemical carcinogen aflatoxin B1 have been found to influence epigenetic changes. Their interactions could play an important role in the initiation and progression of HCC. Discovery and detection of biomarkers for epigenetic changes is a promising area for early diagnosis and risk prediction of HCC.

  14. [239Pu and chromosomal aberrations in human peripheral blood lymphocytes].

    Science.gov (United States)

    Okladnikova, N D; Osovets, S V; Kudriavtseva, T I

    2009-01-01

    The genome status in somatic cells was assessed using the chromosomal aberration (CA) test in peripheral blood lymphocytes from 194 plutonium workers exposed to occupational radiation mainly from low-transportable compounds of airborne 230Pu. Pu body burden at the time of cytogenetic study varied from values close to the method sensitivity to values multiply exceeding the permissible level. Standard (routine) methods of peripheral blood lymphocytes cultivation were applied. Chromatid- and chromosomal-type structural changes were estimated. Aberrations were estimated per 100 examined metaphase cells. The quantitative relationship between the CA frequency and Pu body burden and the absorbed dose to the lung was found. Mathematical processing of results was carried out based on the phenomenological model. The results were shown as theoretical and experimental curves. The threshold of the CA yield was 0.43 +/- 0.03 kBq (Pu body burden) and 6.12 +/- 1.20 cGy (absorbed dose to the lung).

  15. Chromosome Aberrations in Human Lymphocytes Irradiated with Ionizing Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Tae Ho; Kim, Jin Hong; Kim, Jin Kyu [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2014-05-15

    The purpose of the present experiment was to provide data on the dose-dependent production of chromosome aberrations such as dicentrics, centric rings, and excess acentrics. Radiation is one of the more dangerous clastogens in the environment. Ionizing radiation causes chromosome breakages and various cytogenetic aberrations in exposed cells. In an investigation into radiation emergencies, it is important to estimate the dose to exposed persons for several reasons. Physical dosimeters (e. g., film badges) may misrepresent the actual radiation dose and may not be available in a radiological accident or terrorism incident. Biological dosimetry is suitable for estimating the radiation dose during such accidents. The dicentric chromosome assay is very sensitive and a reliable bio-indicator in cases of accidental overexposure.

  16. Chromosomal Aberrations in Humans Induced by Urban Air Pollution

    DEFF Research Database (Denmark)

    Knudsen, Lisbeth E.; Norppa, Hannu; Gamborg, Michael O.

    1999-01-01

    We have studied the influence of individual susceptibility factors on the genotoxic effects of urban air pollution in 106 nonsmoking bus drivers and 101 postal workers in the Copenhagen metropolitan area. We used the frequency of chromosomal aberrations in peripheral blood lymphocytes...... that long-term exposure to urban air pollution (with traffic as the main contributor) induces chromosome damage in human somatic cells. Low DNA repair capacity and GSTM1 and NAT2 variants associated with reduced detoxification ability increase susceptibility to such damage. The effect of the GSTM1 genotype......, which was observed only in the bus drivers, appears to be associated with air pollution, whereas the NAT2 genotype effect, which affected all subjects, may influence the individual response to some other common exposure or the baseline level of chromosomal aberrations....

  17. Chromosomic aberrations in female workers exposed to pesticides

    OpenAIRE

    Cuenca, Patricia; Ramírez, Vanessa

    2014-01-01

    The purpose of this work was to determine if the occupational exposure to those pesticides used at banana plantations’ packaging plants produces genetic damage to somatic cells of female workers. Chromosomal aberrations were scored in lymphocytes of 20 women, 10 female exposed workers and 10 female controls. Workers were recruited from independent farms from two locations in Costa Rica, during January through June in 1996 and 1997. These females had a minimum of three months of work, had neve...

  18. Manipulation of spatiotemporal photon distribution via chromatic aberration.

    Science.gov (United States)

    Li, Yuelin; Chemerisov, Sergey

    2008-09-01

    We demonstrate a spatiotemporal laser-pulse-shaping scheme that exploits the chromatic aberration in a dispersive lens. This normally harmful effect transforms the phase modulation into a beam-size modulation at the focal plane. In combination with the intricate diffraction effect via beam apodization, this method provides a spatiotemporal control of photon distribution with an accuracy of diffraction limit on a time scale of femtoseconds.

  19. Aberration of Light and Motion of Real Particle

    CERN Document Server

    Klacka, J

    2000-01-01

    Correct and complete (to terms of $\\vec{v} / c$ -- $\\vec{v}$ is particle's velocity, $c$ is the speed of light) derivation of equation of motion for real dust particle under the action of electromagnetic radiation is derived. The effect of aberration of light is used. Equation of motion is expressed in terms of particle's optical properties, standardly used in optics for stationary particles.

  20. Coherence and aberration effects in surface plasmon polariton imaging

    OpenAIRE

    Berthel, Martin; Jiang, Quanbo; Chartrand, Camille; Bellessa, Joel; Huant, Serge; Genet, Cyriaque; Drezet, Aurélien

    2016-01-01

    We study theoretically and experimentally coherent imaging of surface plasmon polaritons using either leakage radiation microscopy through a thin metal film or interference microscopy through a thick metal film. Using a rigorous modal formalism based on scalar Whittaker potentials we develop a systematic analytical and vectorial method adapted to the analysis of coherent imaging involving surface plasmon polaritons. The study includes geometrical aberrations due index mismatch which played an...

  1. Chromosome aberrations in ataxia telangiectasia cells exposed to heavy ions

    Science.gov (United States)

    Kawata, T.; Cucinotta, F.; George, K.; Wu, H.; Shigematsu, N.; Furusawa, Y.; Uno, T.; Isobe, K.; Ito, H.

    Understanding of biological effects of heavy ions is important to assess healt h risk in space. One of the most important issues may be to take into account individual susceptibility. Ataxia telangiectasia (A-T) cells are known to exhibit abnormal responses to radiations but the mechanism of hyper radiosensitivity of A-T still remains unknown. We report chromosome aberrations in normal human fibroblasts and AT fibroblasts exposed to low- and high-LET radiations. A chemical-induced premature chromosome condensation (PCC) technique combined with chromosome- painting technique was applied to score chromosome aberrations in G2/M-phase cells. Following gamma irradiation, GM02052 cells were approximately 5 times more sensitive to g-rays than AG1522 cells. GM02052 cells had a much higher frequency of deletions and misrejoining than AG1522 cells. When the frequency of complex type aberrations was compared, GM02052 cells showed more than 10 times higher frequency than AG1522 cells. The results will be compared with those obtained from high-LET irradiations.

  2. Aberrant behavior and cognitive ability in preschool children

    Directory of Open Access Journals (Sweden)

    Bala Gustav

    2007-01-01

    Full Text Available The sample included 712 preschool boys and girls at the age of 4 to 7 years (mean 5.96 decimal years and standard deviation .96 from preschool institutions in Novi Sad, Sombor, Sremska Mitrovica and Bačka Palanka. Information concerning 36 indicators of aberrant behavior of the children were supplied by their parents, whereas their cognitive ability was tested by Raven’s progressive colored matrices. Based on factor analysis (promax method, four factors i.e. generators of aberrant behavior in children were singled out: aggression, anxiousness, dissociation, and hysteria, whose relations with cognitive functioning and age were also analyzed by factor analysis. Aberrant behavior and cognitive abilities show significant interrelatedness. Owing to orderly developed cognitive abilities, a child understands essence and reality of problems, realizes possibilities and manners of solving them, and succeeds in realizing successful psycho-social functioning. Developed cognitive abilities enable a child to recognize and understand her/his own reactions in different situations and develop manners of reacting, which leads to strengthening psycho-social safety and adapting behavior in accordance with her/his age and abilities.

  3. Aberration correction for time-domain ultrasound diffraction tomography.

    Science.gov (United States)

    Mast, T Douglas

    2002-07-01

    Extensions of a time-domain diffraction tomography method, which reconstructs spatially dependent sound speed variations from far-field time-domain acoustic scattering measurements, are presented and analyzed. The resulting reconstructions are quantitative images with applications including ultrasonic mammography, and can also be considered candidate solutions to the time-domain inverse scattering problem. Here, the linearized time-domain inverse scattering problem is shown to have no general solution for finite signal bandwidth. However, an approximate solution to the linearized problem is constructed using a simple delay-and-sum method analogous to "gold standard" ultrasonic beamforming. The form of this solution suggests that the full nonlinear inverse scattering problem can be approximated by applying appropriate angle- and space-dependent time shifts to the time-domain scattering data; this analogy leads to a general approach to aberration correction. Two related methods for aberration correction are presented: one in which delays are computed from estimates of the medium using an efficient straight-ray approximation, and one in which delays are applied directly to a time-dependent linearized reconstruction. Numerical results indicate that these correction methods achieve substantial quality improvements for imaging of large scatterers. The parametric range of applicability for the time-domain diffraction tomography method is increased by about a factor of 2 by aberration correction.

  4. Genomic aberrations of BRCA1-mutated fallopian tube carcinomas.

    Science.gov (United States)

    Hunter, Sally M; Ryland, Georgina L; Moss, Phillip; Gorringe, Kylie L; Campbell, Ian G

    2014-06-01

    Intraepithelial carcinomas of the fallopian tube are putative precursors to high-grade serous carcinomas of the ovary and peritoneum. Molecular characterization of these early precursors is limited but could be the key to identifying tumor biomarkers for early detection. This study presents a genome-wide copy number analysis of occult fallopian tube carcinomas identified through risk-reducing prophylactic oophorectomy from three women with germline BRCA1 mutations, demonstrating that extensive genomic aberrations are already established at this early stage. We found no indication of a difference in the level of genomic aberration observed in fallopian tube carcinomas compared with high-grade serous ovarian carcinomas. These findings suggest that spread to the peritoneal cavity may require no or very little further tumor evolution, which raises the question of what is the real window of opportunity to detect high-grade serous peritoneal carcinoma arising from the fallopian tube before it spreads. Nonetheless, the similarity of the genomic aberrations to those observed in high-grade serous ovarian carcinomas suggests that genetic biomarkers identified in late-stage disease may be relevant for early detection.

  5. Pancreatic cancer genomes reveal aberrations in axon guidance pathway genes.

    Science.gov (United States)

    Biankin, Andrew V; Waddell, Nicola; Kassahn, Karin S; Gingras, Marie-Claude; Muthuswamy, Lakshmi B; Johns, Amber L; Miller, David K; Wilson, Peter J; Patch, Ann-Marie; Wu, Jianmin; Chang, David K; Cowley, Mark J; Gardiner, Brooke B; Song, Sarah; Harliwong, Ivon; Idrisoglu, Senel; Nourse, Craig; Nourbakhsh, Ehsan; Manning, Suzanne; Wani, Shivangi; Gongora, Milena; Pajic, Marina; Scarlett, Christopher J; Gill, Anthony J; Pinho, Andreia V; Rooman, Ilse; Anderson, Matthew; Holmes, Oliver; Leonard, Conrad; Taylor, Darrin; Wood, Scott; Xu, Qinying; Nones, Katia; Fink, J Lynn; Christ, Angelika; Bruxner, Tim; Cloonan, Nicole; Kolle, Gabriel; Newell, Felicity; Pinese, Mark; Mead, R Scott; Humphris, Jeremy L; Kaplan, Warren; Jones, Marc D; Colvin, Emily K; Nagrial, Adnan M; Humphrey, Emily S; Chou, Angela; Chin, Venessa T; Chantrill, Lorraine A; Mawson, Amanda; Samra, Jaswinder S; Kench, James G; Lovell, Jessica A; Daly, Roger J; Merrett, Neil D; Toon, Christopher; Epari, Krishna; Nguyen, Nam Q; Barbour, Andrew; Zeps, Nikolajs; Kakkar, Nipun; Zhao, Fengmei; Wu, Yuan Qing; Wang, Min; Muzny, Donna M; Fisher, William E; Brunicardi, F Charles; Hodges, Sally E; Reid, Jeffrey G; Drummond, Jennifer; Chang, Kyle; Han, Yi; Lewis, Lora R; Dinh, Huyen; Buhay, Christian J; Beck, Timothy; Timms, Lee; Sam, Michelle; Begley, Kimberly; Brown, Andrew; Pai, Deepa; Panchal, Ami; Buchner, Nicholas; De Borja, Richard; Denroche, Robert E; Yung, Christina K; Serra, Stefano; Onetto, Nicole; Mukhopadhyay, Debabrata; Tsao, Ming-Sound; Shaw, Patricia A; Petersen, Gloria M; Gallinger, Steven; Hruban, Ralph H; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Schulick, Richard D; Wolfgang, Christopher L; Morgan, Richard A; Lawlor, Rita T; Capelli, Paola; Corbo, Vincenzo; Scardoni, Maria; Tortora, Giampaolo; Tempero, Margaret A; Mann, Karen M; Jenkins, Nancy A; Perez-Mancera, Pedro A; Adams, David J; Largaespada, David A; Wessels, Lodewyk F A; Rust, Alistair G; Stein, Lincoln D; Tuveson, David A; Copeland, Neal G; Musgrove, Elizabeth A; Scarpa, Aldo; Eshleman, James R; Hudson, Thomas J; Sutherland, Robert L; Wheeler, David A; Pearson, John V; McPherson, John D; Gibbs, Richard A; Grimmond, Sean M

    2012-11-15

    Pancreatic cancer is a highly lethal malignancy with few effective therapies. We performed exome sequencing and copy number analysis to define genomic aberrations in a prospectively accrued clinical cohort (n = 142) of early (stage I and II) sporadic pancreatic ductal adenocarcinoma. Detailed analysis of 99 informative tumours identified substantial heterogeneity with 2,016 non-silent mutations and 1,628 copy-number variations. We define 16 significantly mutated genes, reaffirming known mutations (KRAS, TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A and SF3B1), and uncover novel mutated genes including additional genes involved in chromatin modification (EPC1 and ARID2), DNA damage repair (ATM) and other mechanisms (ZIM2, MAP2K4, NALCN, SLC16A4 and MAGEA6). Integrative analysis with in vitro functional data and animal models provided supportive evidence for potential roles for these genetic aberrations in carcinogenesis. Pathway-based analysis of recurrently mutated genes recapitulated clustering in core signalling pathways in pancreatic ductal adenocarcinoma, and identified new mutated genes in each pathway. We also identified frequent and diverse somatic aberrations in genes described traditionally as embryonic regulators of axon guidance, particularly SLIT/ROBO signalling, which was also evident in murine Sleeping Beauty transposon-mediated somatic mutagenesis models of pancreatic cancer, providing further supportive evidence for the potential involvement of axon guidance genes in pancreatic carcinogenesis.

  6. Effect of therapeutic hypothermia on chromosomal aberration in perinatal asphyxia

    Directory of Open Access Journals (Sweden)

    Bahubali D Gane

    2016-01-01

    Full Text Available Introduction: Perinatal asphyxia is a major cause for neonatal mortality and morbidity around the world. The reduction of O2results in the generation of reactive oxygen species which interact with nucleic acid and make alteration in the structure and functioning of the genome. We studied the effect of therapeutic hypothermia on chromosomes with karyotyping. Subjects and Methods: Babies in the hypothermia group were cooled for the first 72 h, using gel packs. Rectal temperature of 33–34°C was maintained. Blood sample was collected after completion of therapeutic hypothermia for Chromosomal analysis. It was done with IKAROS Karyotyping system, Metasystems, based on recommendations of International system of human cytogenetic nomenclature. Results: The median chromosomal aberration was lower in hypothermia [2(0-5] than control group [4(1-7] and chromatid breakage was commonest aberration seen. Chromosomal aberration was significantly higher in severe encephalopathy group than moderate encephalopathy group. Conclusion: We conclude that the TH significantly reduces DNA damage in perinatal asphyxia.

  7. Incidence of chromosomal aberrations and micronuclei in cave tour guides.

    Science.gov (United States)

    Bilban, M; Bilban-Jakopin, C; Vrhovec, S

    2001-01-01

    An analysis of structural chromosomal aberrations (SCA) and micronucleus tests (MN) were performed in 38 subjects, cave tour guides and in appropriate control group. The dominant type of chromosomal aberrations in tourist guides were chromosomal breaks (0.013 per cell) and acentric fragments (0.011 per cell). In the control group, these aberrations were present up to 0.008 on cells. Considering the analysed cells of the guides in total (33,556), the incidence of dicentric and rings range is below 0.0008 on cells, even though three dicentric and ring chromosoms were found already in the first 1000 in vitro metaphases of some guides. Only 0.0003 dicentrics and neither other translocations were found in control group (ambiental exposure). The incidence of micronuclei in cytokinesis blocked lymphocytes ranged from 12-32 per 500 CB cells in the cave tour guides and from 4-11 per 500 CB cells in control group. Measurements of radon and its daughters were performed at different locations in the cave. Annual doses from 40-60 mSv were estimated per 2000 work hours for cave guides. The changes found in the genome of somatic cells may be related to the exposure doses of radon and its daughters, although smoking should not be ignored.

  8. Analysis of chromosome aberration data by hybrid-scale models

    Energy Technology Data Exchange (ETDEWEB)

    Indrawati, Iwiq [Research and Development on Radiation and Nuclear Biomedical Center, National Nuclear Energy Agency (Indonesia); Kumazawa, Shigeru [Nuclear Technology and Education Center, Japan Atomic Energy Research Institute, Honkomagome, Tokyo (Japan)

    2000-02-01

    This paper presents a new methodology for analyzing data of chromosome aberrations, which is useful to understand the characteristics of dose-response relationships and to construct the calibration curves for the biological dosimetry. The hybrid scale of linear and logarithmic scales brings a particular plotting paper, where the normal section paper, two types of semi-log papers and the log-log paper are continuously connected. The hybrid-hybrid plotting paper may contain nine kinds of linear relationships, and these are conveniently called hybrid scale models. One can systematically select the best-fit model among the nine models by among the conditions for a straight line of data points. A biological interpretation is possible with some hybrid-scale models. In this report, the hybrid scale models were applied to separately reported data on chromosome aberrations in human lymphocytes as well as on chromosome breaks in Tradescantia. The results proved that the proposed models fit the data better than the linear-quadratic model, despite the demerit of the increased number of model parameters. We showed that the hybrid-hybrid model (both variables of dose and response using the hybrid scale) provides the best-fit straight lines to be used as the reliable and readable calibration curves of chromosome aberrations. (author)

  9. Estimation of phase wave-front aberration distribution function using wavelet transform profilometry.

    Science.gov (United States)

    Rahbar, Kambiz; Faez, Karim; Attaran-Kakhki, Ebrahim

    2012-06-01

    Reduction of image quality under the effects of wavefront aberration of the optical system has a direct impact on the vision system's performance. This paper tries to estimate the amount of aberration with the use of wavelet transform profilometry. The basic idea is based on the principle that under aberration effects, the position of the fringes' image on the image plane will change, and this change correlates with the amount of aberration. So the distribution of aberration function can directly be extracted through measuring the amount of changes in the fringes' image on the image plane. Experimental results and the empirical validity of this idea are evaluated.

  10. Factors Contributing To The Sustainability Of 5S Programmes In Government Hospitals In Regional Director Of Health Services Area Kurunegala

    Directory of Open Access Journals (Sweden)

    Dr. K.W.C.U.K Kendangamuwa

    2015-03-01

    Full Text Available Abstract Introduction 5S is the stepping stone for many quality improvement concepts and its roots date back to 16th century. When successfully implemented 5S gives many benefits to the organization as well as its stakeholders. Though 5S itself has a tool to sustain most of the organizations find it difficult to sustain the 5S practice over the time. Therefore the objective of this study was to find out the factors contributing to sustainability of 5S programmes in Government Hospitals in RDHS area Kurunegala. Methodology This study was a descriptive cross sectional study with two components. First component was to identify the 5S sustaining hospitals from not sustaining hospitals by validated evaluation sheet. Second component was to determine the factors contributing to sustainability of 5S programmes in selected study setting. Self-administrated questionnaire was used for this purpose. Total study population was 543 employees of all the categories of hospital staff. Calculated sample size was 422 and 375 were responded to the questionnaire giving response rate of 88.9. Results The study revealed that the implemented 5S programmes were sustaining in eight hospitals out of ten i.e. sustaining rate was 80. When it considered the degree of sustainability 50 of the selected hospitals reported more than 70 sustainability. This was considered as favourable trend in government health sector in healthcare quality point of view. Ten factors were studied as contributing factors for the 5S sustainability. Socio- demographic factors were also considered. Those ten factors were top management commitment leadership of the organization commitment of middle amp frontline managers commitment amp satisfaction of employees training amp changing attitude of employees motivation of employees organizational culture group cohesiveness community participation and customer satisfaction. Study revealed that organizational leadership customer satisfaction community

  11. Bacterial diversity of soil under eucalyptus assessed by 16S rDNA sequencing analysis Diversidade bacteriana de solo sob eucaliptos obtida por seqüenciamento do 16S rDNA

    Directory of Open Access Journals (Sweden)

    Érico Leandro da Silveira

    2006-10-01

    Full Text Available Studies on the impact of Eucalyptus spp. on Brazilian soils have focused on soil chemical properties and isolating interesting microbial organisms. Few studies have focused on microbial diversity and ecology in Brazil due to limited coverage of traditional cultivation and isolation methods. Molecular microbial ecology methods based on PCR amplified 16S rDNA have enriched the knowledge of soils microbial biodiversity. The objective of this work was to compare and estimate the bacterial diversity of sympatric communities within soils from two areas, a native forest (NFA and an eucalyptus arboretum (EAA. PCR primers, whose target soil metagenomic 16S rDNA were used to amplify soil DNA, were cloned using pGEM-T and sequenced to determine bacterial diversity. From the NFA soil 134 clones were analyzed, while 116 clones were analyzed from the EAA soil samples. The sequences were compared with those online at the GenBank. Phylogenetic analyses revealed differences between the soil types and high diversity in both communities. Soil from the Eucalyptus spp. arboretum was found to have a greater bacterial diversity than the soil investigated from the native forest area.Estudos sobre impacto do Eucalyptus spp. em solos brasileiros têm focalizado propriedades químicas do solo e isolamento de microrganismos de interesse. No Brasil há pouco enfoque em ecologia e diversidade microbiana, devido às limitações dos métodos tradicionais de cultivo e isolamento. A utilização de métodos moleculares no estudo da ecologia microbiana baseados na amplificação por PCR do 16S rDNA têm enriquecido o conhecimento da biodiversidade microbiana dos solos. O objetivo deste trabalho foi comparar e estimar a diversidade bacteriana de comunidades simpátricas em solos de duas áreas: uma floresta nativa (NFA e outra adjacente com arboreto de eucaliptos (EAA. Oligonucleotídeos iniciadores foram utilizados para amplificar o 16S rDNA metagenômico do solo, o qual foi

  12. Aberrant muscle syndrome: hypertrophy of the hand and arm due to aberrant muscles with or without hypertrophy of the muscles.

    Science.gov (United States)

    Ogino, Toshihiko; Satake, Hiroshi; Takahara, Masatoshi; Kikuchi, Noriaki; Watanabe, Tadayosi; Iba, Kousuke; Ishii, Seiichi

    2010-06-01

    Five patients were reported in our congenital anomaly registry who had six hands in total with muscular hyperplasia, aberrant muscles, ulnar drift of the fingers in the metacarpophalangeal (MP) joints, flexion contractures of the MP joints, and enlargement of the metacarpal spaces. Thirty patients with unilateral involvement of this condition have been reported previously. We reviewed these cases and found that the condition varied in severity and that it was reported using different names. However, this condition seems different from true macrodactyly and multiple camptodactyly, including windblown hand, and seems to be an isolated entity of congenital upper limb anomaly. The authors recommend 'aberrant muscle syndrome' or 'accessory muscle syndrome' as a diagnostic name, because this seems to be the most common pathological finding in this condition.

  13. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China.

    Science.gov (United States)

    Wang, Haishan; Luo, Xuan; You, Weiwei; Dong, Yunwei; Ke, Caihuan

    2015-01-01

    We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82%) and two rare types 2n = 36 = 11M + 7SM (14%) and 2n = 36 = 10M + 7SM + 1ST (4%). The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA)3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies.

  14. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China.

    Directory of Open Access Journals (Sweden)

    Haishan Wang

    Full Text Available We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82% and two rare types 2n = 36 = 11M + 7SM (14% and 2n = 36 = 10M + 7SM + 1ST (4%. The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies.

  15. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  16. 16S and 23S plastid rDNA phylogenies of Prototheca species and their auxanographic phenotypes1

    Science.gov (United States)

    Ewing, Aren; Brubaker, Shane; Somanchi, Aravind; Yu, Esther; Rudenko, George; Reyes, Nina; Espina, Karen; Grossman, Arthur; Franklin, Scott

    2014-01-01

    Because algae have become more accepted as sources of human nutrition, phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied. This can help establish algal evolutionary relationships. Here, we compare Auxenochlorella protothecoides and 23 strains of Prototheca based on their complete 16S and partial 23S plastid rDNA sequences along with nutrient utilization (auxanographic) profiles. These data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships. PMID:25937672

  17. PCR amplification of 16S rDNA from lyophilized cell cultures facilitates studies in molecular systematics

    Science.gov (United States)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1990-01-01

    The sequence of the major portion of a Bacillus cycloheptanicus strain SCH(T) 16S rRNA gene is reported. This sequence suggests that B. cycloheptanicus is genetically quite distinct from traditional Bacillus strains (e.g., B. subtilis) and may be properly regarded as belonging to a different genus. The sequence was determined from DNA that was produced by direct amplification of ribosomal DNA from a lyophilized cell pellet with straightforward polymerase chain reaction (PCR) procedures. By obviating the need to revive cell cultures from the lyophile pellet, this approach facilitates rapid 16S rDNA sequencing and thereby advances studies in molecular systematics.

  18. The Effective Approach to the Precaution of Safety Accident in Enterprises: 5S Managements%"5S"管理是企业预防安全事故的有效途径

    Institute of Scientific and Technical Information of China (English)

    朱益飞

    2008-01-01

    @@ "5S"管理的内涵 "5S"管理活动,即"整理、整顿、清扫、清洁、素养"管理,是目前国际上先进的企业生产现场管理模式."5S"是日文SETRT(整理)、SEITON(整顿)、SEISO(清扫)、SEIKETSU(清洁)、SHITTSUKE(修养)这5个单词,因为5个单词前面发音都是"S",所以统称为"5S".它的具体类型内容和典型的意思就是倒掉垃圾和仓库长期不要的东西."5S"管理活动,简言之就是"从小事做起,认真、讲究地做好每件事".整理,即把工作场所内所有的物品保持整齐有序的状态,并进行必要的标识,杜绝乱堆乱放、物品混淆,该找的东西找不到等无序现象的出现.

  19. Aerodynamic and engineering design of a 1.5 s high quality microgravity drop tower facility

    Science.gov (United States)

    Belser, Valentin; Breuninger, Jakob; Reilly, Matthew; Laufer, René; Dropmann, Michael; Herdrich, Georg; Hyde, Truell; Röser, Hans-Peter; Fasoulas, Stefanos

    2016-12-01

    Microgravity experiments are essential for research in space science, biology, fluid mechanics, combustion, and material sciences. One way to conduct microgravity experiments on Earth is by using drop tower facilities. These facilities combine a high quality of microgravity, adequate payload masses and have the advantage of virtually unlimited repeatability under same experimental conditions, at a low cost. In a collaboration between the Institute of Space Systems (IRS) at the University of Stuttgart and Baylor University (BU) in Waco, Texas, a new drop tower is currently under development at the Center for Astrophysics, Space Physics and Engineering Research (CASPER). The design parameters of the drop tower ask for at least 1.5 s in free fall duration while providing a quality of at least 10-5 g. Previously, this quality has only been achieved in vacuum drop tower facilities where the capsule experiences virtually zero aerodynamic drag during its free fall. Since this design comes at high costs, a different drop tower design concept, which does not require an evacuated drop shaft, was chosen. It features a dual-capsule system in which the experiment capsule is shielded from aerodynamic forces by surrounding it with a drag shield during the drop. As no other dual-capsule drop tower has been able to achieve a quality as good as or better than 10-5 g previous work optimized the design with an aerodynamic perspective by using computational fluid dynamics (CFD) simulations to determine the ideal shape and size of the outer capsule and to specify the aerodynamically crucial dimensions for the overall system. Experiments later demonstrated that the required quality of microgravity can be met with the proposed design. The main focus of this paper is the mechanical realization of the capsule as well as the development and layout of the surrounding components, such as the release mechanism, the deceleration device and the drop shaft. Because the drop tower facility is a

  20. The Exploration and Practice of Promoting'5S'Management Activities in Oil Production Crew%采油队推行"5S"管理活动的探索与实践

    Institute of Scientific and Technical Information of China (English)

    张晏; 高纯玺; 王顺波; 刘卫东; 单素红

    2007-01-01

    结合油田现场管理的实际,分别对"5S"管理在石油开发系统推行的意义、推行"5S"管理的步骤和方法、具体实施的程序和要点、技术改进和管理创新等方面进行了具体的阐述,阐明在油田开发系统推行"5S"管理活动是切实可行的,能够不断提升基层现场管理水平.

  1. Technical Progress on Synthesis of Chiral (5S)-(4-fluorophenyl)-5-hydroxypentanoic Acid%手性纯(5S)-(4-氟苯)-5-羟基戊酸的制备研究进展

    Institute of Scientific and Technical Information of China (English)

    孙婧; 金保军; 黄金; 王普

    2015-01-01

    (5S)-(4-氟苯)-5-羟基戊酸为制备降血脂药物依替米贝的关键手性中间体.本文综述了制备(5S)-(4-氟苯)-5-羟基戊酸的研究进展.分别从化学法和生物法两方面着重介绍了其不对称合成制备技术的研究现状,并对生物催化制备(5S)-(4-氟苯)-5-羟基戊酸技术的发展进行了展望.

  2. Aberration-Coreected Electron Microscopy at Brookhaven National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Zhu,Y.; Wall, J.

    2008-04-01

    The last decade witnessed the rapid development and implementation of aberration correction in electron optics, realizing a more-than-70-year-old dream of aberration-free electron microscopy with a spatial resolution below one angstrom [1-9]. With sophisticated aberration correctors, modern electron microscopes now can reveal local structural information unavailable with neutrons and x-rays, such as the local arrangement of atoms, order/disorder, electronic inhomogeneity, bonding states, spin configuration, quantum confinement, and symmetry breaking [10-17]. Aberration correction through multipole-based correctors, as well as the associated improved stability in accelerating voltage, lens supplies, and goniometers in electron microscopes now enables medium-voltage (200-300kV) microscopes to achieve image resolution at or below 0.1nm. Aberration correction not only improves the instrument's spatial resolution but, equally importantly, allows larger objective lens pole-piece gaps to be employed thus realizing the potential of the instrument as a nanoscale property-measurement tool. That is, while retaining high spatial resolution, we can use various sample stages to observe the materials response under various temperature, electric- and magnetic- fields, and atmospheric environments. Such capabilities afford tremendous opportunities to tackle challenging science and technology issues in physics, chemistry, materials science, and biology. The research goal of the electron microscopy group at the Dept. of Condensed Matter Physics and Materials Science and the Center for Functional Nanomaterials, as well as the Institute for Advanced Electron Microscopy, Brookhaven National Laboratory (BNL), is to elucidate the microscopic origin of the physical- and chemical-behavior of materials, and the role of individual, or groups of atoms, especially in their native functional environments. We plan to accomplish this by developing and implementing various quantitative

  3. Influence of Misalignment on High-Order Aberration Correction for Normal Human Eyes

    Institute of Scientific and Technical Information of China (English)

    ZHAO Hao-Xin; XU Bing; XUE Li-Xia; DAI Yun; LIU Qian; RAO Xue-Jun

    2008-01-01

    @@ Although a compensation device can correct aberrations of human eyes, the effect will be degraded by its misalignment, especially for high-order aberration correction. We caJculate the positioning tolerance of correction device for high-order aberrations, and within what degree the correcting effect is better than low-order aberration (defocus and astigmatism) correction. With fixed certain misalignment within the positioning tolerance, we calculate the residual wavefront rms aberration of the first-6 to first-35 terms along with the 3rd-5th terms of aberrations corrected, and the combined first-13 terms of aberrations are also studied under the same quantity of misalignment. However, the correction effect of high-order aberrations does not meliorate along with the increase of the high-order terms under some misalignment, moreover, some simple combined terms correction can achieve similar result as complex combinations. These results suggest that it is unnecessary to correct too much the terms of high-order aberrations which are diffcult to accomplish in practice, and gives confdence to correct high-order aberrations out of the laboratory.

  4. Anterior corneal and internal contributions to peripheral aberrations of human eyes

    Science.gov (United States)

    Atchison, David A.

    2004-03-01

    Anterior corneal and internal component contributions to overall peripheral aberrations of five human eyes were determined, based on corneal topography and overall aberration measurements. Anterior corneal position and orientation (tilt) were referenced to the line of sight. Ray tracing was performed through the anterior cornea for 6-mm-diameter pupils at angles out to 40° in both the temporal and the nasal visual fields. In general, both component and overall Zernike aberrations were greater for the nasal than for the temporal visual field. In general, the anterior corneal aberration components were considerably higher than the overall aberrations across the visual field and were balanced to a considerable degree by the internal ocular aberration components. The component and overall levels of Zernike third-order aberrations showed linear trends away from the fixation axis, and the component levels of Zernike fourth-order aberrations showed quadratic trends away from the fixation axis. The second-order, but not higher-order, aberration components were susceptible to the choice of image radius of curvature, while disregarding corneal position and orientation affected second- and higher-order aberration components.

  5. Aberrant promoter hypermethylation in serum DNA from patients with silicosis.

    Science.gov (United States)

    Umemura, Shigeki; Fujimoto, Nobukazu; Hiraki, Akio; Gemba, Kenichi; Takigawa, Nagio; Fujiwara, Keiichi; Fujii, Masanori; Umemura, Hiroshi; Satoh, Mamoru; Tabata, Masahiro; Ueoka, Hiroshi; Kiura, Katsuyuki; Kishimoto, Takumi; Tanimoto, Mitsune

    2008-09-01

    It is well established that patients with silicosis are at high risk for lung cancer; however, it is difficult to detect lung cancer by chest radiography during follow-up treatment of patients with silicosis because of preexisting diffuse pulmonary shadows. The purpose of this study is to evaluate the usefulness of detection of serum DNA methylation for early detection of lung cancer in silicosis. Serum samples from healthy controls (n = 20) and silicosis patients with (n = 11) and without (n = 67) lung cancer were tested for aberrant hypermethylation at the promoters of the DNA repair gene O(6)-methylguanine-DNA methyltransferase (MGMT), p16(INK4a), ras association domain family 1A (RASSF1A), the apoptosis-related gene death-associated protein kinase (DAPK) and retinoic acid receptor beta (RARbeta) by methylation-specific polymerase chain reaction. Aberrant promoter methylation in at least one of five tumor suppressor genes was detected more frequently in the serum DNA of silicosis patients with lung cancer than in that of patients without it (P = 0.006). Furthermore, the odds ratio of having lung cancer was 9.77 (P = 0.009) for those silicosis patients with methylation of at least one gene. Extended exposure to silica (>30 years) was correlated with an increased methylation frequency (P = 0.017); however, methylation status did not correlate with age, smoking history or radiographic findings of silicosis. These results suggest that testing for aberrant promoter methylation of tumor suppressor genes using serum DNA may facilitate early detection of lung cancer in patients with silicosis.

  6. Chromosomal aberrations in ovine lymphocytes exposed in vitro to tolylfluanid.

    Science.gov (United States)

    Sutiaková, Irena; Kovalkovičová, Natália; Sutiak, Václav

    2012-01-01

    Chromosomal aberrations have been used as important cytogenetic biomarkers to study the mutagenic effects of different chemicals in vivo and in vitro. Chromosomal aberrations were evaluated in cultures of sheep lymphocytes in vitro exposed to the fungicide tolylfluanid. Lymphocyte cultures from three donors were exposed to four different concentrations of fungicide (1.10(-4) M(.)L; 1.10(-5) M(.)L; 1.10(-6) M(.)L; 1 × 10(-7) M(.)L). Chromosomal analysis showed a significant (P = 0.018 and 0.038 respectively, Anova test, P Tukey test) increase in the frequency of aberrant cells (ABC) in cultures treated with the highest negative experimental concentrations of tolylfluanid (1.10(-4) M(.)L; 1.10(-5) M(.)L) compared to control. Significantly increased numbers of chromatid breaks (7.67 ± 0.58% against 1.67 ± 2.08%, P = 0.009, Anova test, P Tukey test) and chromatid gaps (7.67 ± 1.15% against 2.67 ± 0.58%, P = 0.003, Anova test, P Tukey test) were observed in ovine cultures treated with the highest experimental concentration of tolylfluanid (1.10(-4) M(.)L). Tolylfluanid induced also chromosomal exchanges (P = 0.038, and 0.016 respectively, Anova test, P Tukey test) in ovine cultures treated with the highest experimental concentrations of tolylfluanid (1.10(-4) M(.)L; 1.10(-5) M(.)L). The mitotic index has not shown any statistical differences between the various treatments and control groups. Our results suggest a significant genotoxic effect of tolylfluanid only at the highest concentration in sheep peripheral lymphocytes in vitro.

  7. Phylogenetic Relationships Among Xiphinema and Xiphidorus Nematode Species from Brazil Inferred from 18S rDNA Sequences.

    Science.gov (United States)

    Oliveira, Claudio M G; Hübschen, Judith; Brown, Derek J F; Ferraz, Luiz C C B; Wright, Frank; Neilson, Roy

    2004-06-01

    Maximum likelihood trees produced from 18S rDNA sequences separated 14 Xiphinema and five Xiphidorus nematode species from Brazil into distinct groups that concurred with their current morphological taxonomic status. Species belonging to the X. americanum group (X. brevicolle, X. diffusum, X. oxycaudatum, and X. peruvianum) formed a single group that was clearly separated from the other Xiphinema species. As with previous taxonomic studies that noted only minor morphological differences between putative X. americanum group species, separation of these species based upon 18S rDNA sequences was inconclusive. Thus it is probable that instead of comprising distinct species, the X. americanum group may in fact represent numerous morphotypes with large inter- and intra- population morphological variability that may be environmentally driven. Within the cluster representing non X. americanum group species, there was little statistical support to clearly separate species. However, three subgroups, comprising (i) the X. setariae/vulgare complex, (ii) X. ifacolum and X. paritaliae, and (iii) X. brasiliense and X. ensiculiferum were well resolved.

  8. Comparison of ITS and 18S rDNA for estimating fungal diversity using PCR-DGGE.

    Science.gov (United States)

    Liu, Jie; Yu, Yaoyao; Cai, Zhang; Bartlam, Mark; Wang, Yingying

    2015-09-01

    Both the internal transcribed spacer (ITS) region and 18S rRNA genes are broadly applied in molecular fingerprinting studies of fungi. However, the differences in those two ribosomal RNA regions are still largely unknown. In the current study, three sets of most suitable subunit ribosomes in ITS and 18S rRNA were compared using denaturing gradient gel electrophoresis (DGGE) under the optimum experimental conditions. Ten samples from both aquatic and soil environments were tested. The results revealed that the ITS region produced range-weighted richness in the range 36-361, which was significantly higher than that produced by 18S rDNA. There was a similar tendency in terms of the Shannon-Weaver diversity index and community dynamics in both water and soil samples. Samples from water and soil were better separated using ITS than 18S rDNA in principal component analysis of DGGE bands. Our study suggests that the ITS region is more precise and has more potential than 18S rRNA genes in fungal community analysis.

  9. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  10. Primary species recognition and phylogeny of Chondrus (Gigartinales, Rhodophyta) using 18S rDNA sequence data

    Institute of Scientific and Technical Information of China (English)

    HU Zimin; ZENG Xiaoqi; ALAN T. Critchley; STEVE L. Morrell; DUAN Delin

    2007-01-01

    The nuclear-encoded small subunit ribosomal RNA gene (18S rDNA) of 16 isolates of Chondrus from 8 countries were sequenced. A total of 1796 nucleotides were obtained and aligned with the phylogenetic analysis conducted. The results suggest that the entity from Dalian, China, regarded as C. sp1 is C. pinnulatus. The C. sp2 previously depicted as C. yendoi or Mazzaella japonica may belong to genus Chondrus. So, 4 Chondrus species, i.e.C.ocellatus, C. nipponicus, C. armatus, and C. pinnulatus are distributed in China. However, the entity from Connemara,Ireland, named C. crispus, is not a Chondrus species but that of Mastocarpus stellatus, although it is morphologically similar to C. crispus. Phylogenetic analysis based on complete 18S rDNA sequence data shows that genus Chondrus includes 3 main lineages: the Northern Pacific lineage, containing C. ocellatus, C. yendoi, and C. nipponicus; C.armatus, and C. pinnulatus form the sub-North Pacific lineage; and the Northern Atlantic Ocean lineage, comprising samples of C. crispus from Canada, Portugal, Ireland, Germany and France. The phylogenetic relationships indicate that genus Chondrus might have a North Pacific ancestral origin, radiated to North Atlantic area, and then formed the species C. crispus.

  11. Coherence and aberration effects in surface plasmon polariton imaging

    Science.gov (United States)

    Berthel, Martin; Jiang, Quanbo; Chartrand, Camille; Bellessa, Joel; Huant, Serge; Genet, Cyriaque; Drezet, Aurélien

    2015-09-01

    We study theoretically and experimentally coherent imaging of surface plasmon polaritons using either leakage radiation microscopy through a thin metal film or interference microscopy through a thick metal film. Using a rigorous modal formalism based on scalar Whittaker potentials, we develop a systematic analytical and vectorial method adapted to the analysis of coherent imaging involving surface plasmon polaritons. The study includes geometrical aberrations due index mismatch which played an important role in the interpretation of recent experiments using leakage radiation microscopy. We compare our theory with experiments using classical or quantum near-field scanning optical microscopy probes and show that the approach leads to a full interpretation of the recorded optical images.

  12. Genome-wide identification of significant aberrations in cancer genome

    Directory of Open Access Journals (Sweden)

    Yuan Xiguo

    2012-07-01

    Full Text Available Abstract Background Somatic Copy Number Alterations (CNAs in human genomes are present in almost all human cancers. Systematic efforts to characterize such structural variants must effectively distinguish significant consensus events from random background aberrations. Here we introduce Significant Aberration in Cancer (SAIC, a new method for characterizing and assessing the statistical significance of recurrent CNA units. Three main features of SAIC include: (1 exploiting the intrinsic correlation among consecutive probes to assign a score to each CNA unit instead of single probes; (2 performing permutations on CNA units that preserve correlations inherent in the copy number data; and (3 iteratively detecting Significant Copy Number Aberrations (SCAs and estimating an unbiased null distribution by applying an SCA-exclusive permutation scheme. Results We test and compare the performance of SAIC against four peer methods (GISTIC, STAC, KC-SMART, CMDS on a large number of simulation datasets. Experimental results show that SAIC outperforms peer methods in terms of larger area under the Receiver Operating Characteristics curve and increased detection power. We then apply SAIC to analyze structural genomic aberrations acquired in four real cancer genome-wide copy number data sets (ovarian cancer, metastatic prostate cancer, lung adenocarcinoma, glioblastoma. When compared with previously reported results, SAIC successfully identifies most SCAs known to be of biological significance and associated with oncogenes (e.g., KRAS, CCNE1, and MYC or tumor suppressor genes (e.g., CDKN2A/B. Furthermore, SAIC identifies a number of novel SCAs in these copy number data that encompass tumor related genes and may warrant further studies. Conclusions Supported by a well-grounded theoretical framework, SAIC has been developed and used to identify SCAs in various cancer copy number data sets, providing useful information to study the landscape of cancer genomes

  13. Propagation of aberrated wavefronts using a ray transfer matrix.

    Science.gov (United States)

    Raasch, Thomas W

    2014-05-01

    A ray transfer matrix is used to calculate the propagation of aberrated wavefronts across a homogeneous refractive index. The wavefront is represented by local surface normals, i.e., by a ray bundle, and the propagation is accomplished by transferring those rays across the space. Wavefront shape is generated from the slopes and positions of the collection of rays. Calculation methods are developed for the paraxial case, for higher-order expansions, and for the exact tangent case. A numerical example is used to compare results between an analytical method and the methods developed here.

  14. Genomic aberrations in lung adenocarcinoma in never smokers.

    Directory of Open Access Journals (Sweden)

    Bastien Job

    Full Text Available BACKGROUND: Lung cancer in never smokers would rank as the seventh most common cause of cancer death worldwide. METHODS AND FINDINGS: We performed high-resolution array comparative genomic hybridization analysis of lung adenocarcinoma in sixty never smokers and identified fourteen new minimal common regions (MCR of gain or loss, of which five contained a single gene (MOCS2, NSUN3, KHDRBS2, SNTG1 and ST18. One larger MCR of gain contained NSD1. One focal amplification and nine gains contained FUS. NSD1 and FUS are oncogenes hitherto not known to be associated with lung cancer. FISH showed that the amplicon containing FUS was joined to the next telomeric amplicon at 16p11.2. FUS was over-expressed in 10 tumors with gain of 16p11.2 compared to 30 tumors without that gain. Other cancer genes present in aberrations included ARNT, BCL9, CDK4, CDKN2B, EGFR, ERBB2, MDM2, MDM4, MET, MYC and KRAS. Unsupervised hierarchical clustering with adjustment for false-discovery rate revealed clusters differing by the level and pattern of aberrations and displaying particular tumor characteristics. One cluster was strongly associated with gain of MYC. Another cluster was characterized by extensive losses containing tumor suppressor genes of which RB1 and WRN. Tumors in that cluster frequently harbored a central scar-like fibrosis. A third cluster was associated with gains on 7p and 7q, containing ETV1 and BRAF, and displayed the highest rate of EGFR mutations. SNP array analysis validated copy-number aberrations and revealed that RB1 and WRN were altered by recurrent copy-neutral loss of heterozygosity. CONCLUSIONS: The present study has uncovered new aberrations containing cancer genes. The oncogene FUS is a candidate gene in the 16p region that is frequently gained in never smokers. Multiple genetic pathways defined by gains of MYC, deletions of RB1 and WRN or gains on 7p and 7q are involved in lung adenocarcinoma in never smokers.

  15. Removing lateral chromatic aberration in bright field optical microscopy.

    Science.gov (United States)

    Guzmán-Altamirano, Miguel; Gutiérrez-Medina, Braulio

    2015-06-01

    We present an efficient alternative to remove lateral chromatic aberration (LCA) in bright field light microscopy images. Our procedure is based on error calibration using time-sequential acquisition at different wavelengths, and error correction through digital image warping. Measurement of the displacements of fiducial marks in the red and green images relative to blue provide calibration factors that are subsequently used in test images to realign color channels digitally. We demonstrate quantitative improvement in the position and boundaries of objects in target slides and in the color content and morphology of specimens in stained biological samples. Our results show a reduction of LCA content below the 0.1% level.

  16. Miniaturized modules for light sheet microscopy with low chromatic aberration.

    Science.gov (United States)

    Bruns, T; Bauer, M; Bruns, S; Meyer, H; Kubin, D; Schneckenburger, H

    2016-12-01

    Two miniaturized fibre-coupled modules for light sheet-based microscopy are described and compared with respect to image quality, chromatic aberration and beam alignment. Whereas in one module the light sheet is created by an achromatic cylindrical lens, reflection by a spherical mirror and concomitant astigmatic distortion are used to create the light sheet in the second module. Test experiments with fluorescent dyes in solution and multicellular tumour spheroids are reported, and some details on construction are given for both systems. Both modules are optimized for imaging individual cell layers of 3D biological samples and can be adapted to fit commercial microscopes.

  17. Coherence and aberration effects in surface plasmon polariton imaging

    CERN Document Server

    Berthel, Martin; Chartrand, Camille; Bellessa, Joel; Huant, Serge; Genet, Cyriaque; Drezet, Aurélien

    2016-01-01

    We study theoretically and experimentally coherent imaging of surface plasmon polaritons using either leakage radiation microscopy through a thin metal film or interference microscopy through a thick metal film. Using a rigorous modal formalism based on scalar Whittaker potentials we develop a systematic analytical and vectorial method adapted to the analysis of coherent imaging involving surface plasmon polaritons. The study includes geometrical aberrations due index mismatch which played an important role in the interpretation of recent experiments using leakage radiation microscopy. We compare our theory with experiments using classical or quantum near-field scanning optical microscopy probes and show that the approach leads to a full interpretation of the recorded optical images.

  18. Adaptive dispersion formula for index interpolation and chromatic aberration correction.

    Science.gov (United States)

    Li, Chia-Ling; Sasián, José

    2014-01-13

    This paper defines and discusses a glass dispersion formula that is adaptive. The formula exhibits superior convergence with a minimum number of coefficients. Using this formula we rationalize the correction of chromatic aberration per spectrum order. We compare the formula with the Sellmeier and Buchdahl formulas for glasses in the Schott catalogue. The six coefficient adaptive formula is found to be the most accurate with an average maximum index of refraction error of 2.91 × 10(-6) within the visible band.

  19. Spatially incoherent illumination interferometry: a PSF almost insensitive to aberrations

    CERN Document Server

    Xiao, Peng; Boccara, A Claude

    2016-01-01

    We show that with spatially incoherent illumination, the point spread function width of an imaging interferometer like that used in full-field optical coherence tomography (FFOCT) is almost insensitive to aberrations that mostly induce a reduction of the signal level without broadening. This is demonstrated by comparison with traditional scanning OCT and wide-field OCT with spatially coherent illuminations. Theoretical analysis, numerical calculation as well as experimental results are provided to show this specific merit of incoherent illumination in full-field OCT. To the best of our knowledge, this is the first time that such result has been demonstrated.

  20. Generic Misalignment Aberration Patterns and the Subspace of Benign Misalignment

    CERN Document Server

    Schechter, Paul L

    2012-01-01

    Q1: Why deploy N wavefront sensors on a three mirror anastigmat (TMA) and not N + 1? Q2: Why measure M Zernike coefficients and not M + 1? Q3: Why control L rigid body degrees of freedom (total) on the secondary and tertiary and not L + 1? The usual answer: "We did a lot of ray tracing and N,M, and L seemed OK." We show how straightforward results from aberration theory may be used to address these questions. We consider, in particular, the case of a three mirror anastigmat.

  1. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides AT+CG in the mitogenome of Kamimuria wangi.

    Science.gov (United States)

    Seligmann, Hervé

    2016-07-01

    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.

  2. Cylindrotheca closterium Is a Species Complex as Was Evidenced by the Variations of rbcL Gene and SSU rDNA

    Institute of Scientific and Technical Information of China (English)

    LI Haitao; YANG Guanpin; SUN Ying; WU Suihan; ZHANG Xiufang

    2007-01-01

    The genus Cylindrotheca consists of a small group of marine diatoms with a few species described. Eleven isolates of diatoms identified as Cylindrotheca closterium morphologically were obtained from Jiaozhou Bay with their nuclear-encoded small-subunit ribosomal RNA (SSU rDNA) and chloroplast-encoded rbcL gene sequences determined in this study. Interestingly, very high sequence divergences of SSU rDNA and rbcL gene were found among these isolates, and numerous nucleotide variation of rbcL gene caused relatively few variation of deduced amino acid sequence. Phylogenetic analyses based on SSU rDNA and rbcL gene, respectively, grouped the isolates into 6 clades. Phylogenetic tree of SSU rDNA placed all the Cylindrotheca isolates together, separating them into two lineages clearly. LineageⅠ was composed of the eleven C. closterium isolates obtained in this study together with another C. closterium isolate, but some clades were not well supported. LineageⅡ contained two C. closterium isolates and one C. fusiformis isolate. Phylogenetic analysis of rbcL gene also separated the Cylindrotheca isolates into two well-defined lineages. The eleven C. closterium isolates formed a lineage and all clades were supported strongly. Statistical comparisons of SSU rDNA indicated that the average distance within lineage Ⅰ was significantly higher than that of other microalgae species (P < 0.01). These results suggested the existence of cryptic species within C. closterium.

  3. Three-dimensional polarization aberration functions in optical system based on three-dimensional polarization ray-tracing calculus

    Science.gov (United States)

    He, Wenjun; Fu, Yuegang; Liu, Zhiying; Zhang, Lei; Wang, Jiake; Zheng, Yang; Li, Yahong

    2017-03-01

    The polarization aberrations of a complex optical system with multi-element lens have been investigated using a 3D polarization aberration function. The 3D polarization ray-tracing matrix has been combined with the optical path difference to obtain a 3D polarization aberration function, which avoids the need for a complicated phase unwrapping process. The polarization aberrations of a microscope objective have been analyzed to include, the distributions of 3D polarization aberration functions, diattenuation aberration, retardance aberration, and polarization-dependent intensity on the exit pupil. Further, the aberrations created by the field of view and the coating on the distribution rules of 3D polarization aberration functions are discussed in detail. Finally a novel appropriate field of view and wavelength correction is proposed for a polarization aberration function which optimizes the image quality of a multi-element optical system.

  4. Transsacral transdiscal L5-S1 screws for the management of high-grade spondylolisthesis in an adolescent.

    Science.gov (United States)

    Palejwala, Ali; Fridley, Jared; Jea, Andrew

    2016-06-01

    The surgical management of high-grade spondylolisthesis in adolescents remains a controversial issue. Because the basic procedure, posterolateral fusion, is associated with a significant rate of pseudarthrosis and listhesis progression, there is a pressing need for alternative surgical techniques. In the present report, the authors describe the case of an adolescent patient with significant low-back pain who was found to have Grade IV spondylolisthesis at L5-S1 that was treated with transsacral transdiscal screw fixation. Bilateral pedicle screws were placed starting from the top of the S-1 pedicle, across the L5-S1 intervertebral disc space, and into the L-5 body. At 14 months after surgery, the patient had considerable improvement in his pain and radiographic fusion across L5-S1. The authors conclude that transsacral transdiscal pedicle screws may serve as an efficacious and safe option for the correction of high-grade spondylolisthesis in adolescent patients.

  5. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    Science.gov (United States)

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex.

  6. Impact of the Japanese 5S management method on patients’ and caretakers’ satisfaction: a quasi-experimental study in Senegal

    Science.gov (United States)

    Kanamori, Shogo; Castro, Marcia C.; Sow, Seydou; Matsuno, Rui; Cissokho, Alioune; Jimba, Masamine

    2016-01-01

    Background The 5S method is a lean management tool for workplace organization, with 5S being an abbreviation for five Japanese words that translate to English as Sort, Set in Order, Shine, Standardize, and Sustain. In Senegal, the 5S intervention program was implemented in 10 health centers in two regions between 2011 and 2014. Objective To identify the impact of the 5S intervention program on the satisfaction of clients (patients and caretakers) who visited the health centers. Design A standardized 5S intervention protocol was implemented in the health centers using a quasi-experimental separate pre-post samples design (four intervention and three control health facilities). A questionnaire with 10 five-point Likert items was used to measure client satisfaction. Linear regression analysis was conducted to identify the intervention's effect on the client satisfaction scores, represented by an equally weighted average of the 10 Likert items (Cronbach's alpha=0.83). Additional regression analyses were conducted to identify the intervention's effect on the scores of each Likert item. Results Backward stepwise linear regression (n=1,928) indicated a statistically significant effect of the 5S intervention, represented by an increase of 0.19 points in the client satisfaction scores in the intervention group, 6 to 8 months after the intervention (p=0.014). Additional regression analyses showed significant score increases of 0.44 (p=0.002), 0.14 (p=0.002), 0.06 (p=0.019), and 0.17 (p=0.044) points on four items, which, respectively were healthcare staff members’ communication, explanations about illnesses or cases, and consultation duration, and clients’ overall satisfaction. Conclusions The 5S has the potential to improve client satisfaction at resource-poor health facilities and could therefore be recommended as a strategic option for improving the quality of healthcare service in low- and middle-income countries. To explore more effective intervention modalities

  7. Impact of the Japanese 5S management method on patients’ and caretakers’ satisfaction: a quasi-experimental study in Senegal

    Directory of Open Access Journals (Sweden)

    Shogo Kanamori

    2016-11-01

    Full Text Available Background: The 5S method is a lean management tool for workplace organization, with 5S being an abbreviation for five Japanese words that translate to English as Sort, Set in Order, Shine, Standardize, and Sustain. In Senegal, the 5S intervention program was implemented in 10 health centers in two regions between 2011 and 2014. Objective: To identify the impact of the 5S intervention program on the satisfaction of clients (patients and caretakers who visited the health centers. Design: A standardized 5S intervention protocol was implemented in the health centers using a quasi-experimental separate pre-post samples design (four intervention and three control health facilities. A questionnaire with 10 five-point Likert items was used to measure client satisfaction. Linear regression analysis was conducted to identify the intervention's effect on the client satisfaction scores, represented by an equally weighted average of the 10 Likert items (Cronbach's alpha=0.83. Additional regression analyses were conducted to identify the intervention's effect on the scores of each Likert item. Results: Backward stepwise linear regression (n=1,928 indicated a statistically significant effect of the 5S intervention, represented by an increase of 0.19 points in the client satisfaction scores in the intervention group, 6 to 8 months after the intervention (p=0.014. Additional regression analyses showed significant score increases of 0.44 (p=0.002, 0.14 (p=0.002, 0.06 (p=0.019, and 0.17 (p=0.044 points on four items, which, respectively were healthcare staff members’ communication, explanations about illnesses or cases, and consultation duration, and clients’ overall satisfaction. Conclusions: The 5S has the potential to improve client satisfaction at resource-poor health facilities and could therefore be recommended as a strategic option for improving the quality of healthcare service in low- and middle-income countries. To explore more effective

  8. The use of 16s rDNA methods in soil microbial ecology Uso de métodos 16S rDNA em ecologia microbiana do solo

    Directory of Open Access Journals (Sweden)

    Andrew Macrae

    2000-06-01

    Full Text Available New and exciting molecular methods, many using the 16S small sub-unit ribosomal nucleic acid molecule, are opening the microbial "black box" in soil. These studies have added much to our knowledge of microbial diversity in soils, and are beginning to advance our understanding of the relationship between this diversity and its function in soil processes. Over the next few years, the knowledge gained from molecular studies will, we hope, lead to improvements in sustainable land management and sustainable exploitation of soil genetic resources. As we enter the third millenium, it is appropriate to review the application of 16S rDNA methods to soil microbiology. This review examines 16S ribosomal DNA (rDNA methods and their application to soil. It mentions their limits and suggests how they may be applied in the future.Novas e excitantes técnicas moleculares muitas usando a fração 16S da subunidade menor da molécula de ácido nucleico ribossomal, estão abrindo a "caixa-preta" da microbiologia do solo. Esses estudos têm acrescentado muito ao nosso conhecimento acerca da diversidade microbiana no solo, e começam a avançar nosso entendimento sobre a relação entre essa diversidade a sua função nos processos no solo. Ao longo dos próximos anos, o conhecimento obtido a partir de técnicas moleculares irão, esperamos, levar a melhoramentos do manejo de áreas sustentáveis da exploração dos recursos genéticos do solo. Com a chegada do terceiro milênio, é apropriado revermos a aplicação das técnicas da fração 16S do rDNA em microbiologia de solo. Esta revisão examina aplicações das técnicas da fração 16S do DNA (RNA no solo, menciona seus limites e sugere como elas poderão ser usadas no futuro.

  9. Influence of spherical aberrations on fundamental mode beam quality under different laser resonators

    Institute of Scientific and Technical Information of China (English)

    Xiang Zhen; Hu Miao; Ge Jian-Hong; Zhao Zhi-Gang; Wang Sha; Liu Chong; Chen Jun

    2009-01-01

    Spherical aberrations of the thermal lens of the active media are severe when solid state lasers are strongly pumped.The fundamental mode profile deteriorates due to the aberrations. Self-consistent modes of a resonator with aberrations are calculated by using the Fox-Li diffraction iterative algorithm. Calculation results show that the aberration induced fundamental mode beam quality deterioration depends greatly on the resonator design. The tolerance of a flat-flat resonator to the aberration coefficient is about 30λ in the middle of stability, where λ is the wavelength of laser beam. But for a dynamically stable resonator, 2λ of spherical aberration will create diffraction loss of more than 40%, if inappropriate design criteria are used. A birefringence compensated laser resonator with two Nd:YAG rods is experimentally studied. The experimental data are in quite good agreement with simulation results.

  10. An experimental study of aero-optical aberration and dithering of supersonic mixing layer via BOS

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The optical performance of supersonic mixing layer is heavily deteriorated by the aero-optical aberration and dithering of coherent structures, but current measuring methods limit the spatiotemporal resolution in relevant studies. A high resolution whole-field aero-optical aberration and dithering measuring method based on the Background Orient Schlieren (BOS) technique was studied. The systematic structure, sensitivity and resolution of BOS are analyzed in this paper. The aero-optical aberration and dithering of streamwise structures in supersonic mixing layers were quantificationally studied with BOS. The aberration field of spanwise structures revealed the ribbon-like aberration structures, which heavily restrict the optical performance of a mixing layer. The quantifications of aero-optical aberration and dithering are very important in studying aero-optical performance of supersonic mixing layer.

  11. Effects of Turbulent Aberrations on Probability Distribution of Orbital Angular Momentum for Optical Communication

    Institute of Scientific and Technical Information of China (English)

    ZHANG Yi-Xin; CANG Ji

    2009-01-01

    Effects of atmospheric turbulence tilt, defocus, astigmatism and coma aberrations on the orbital angular mo-mentum measurement probability of photons propagating in weak turbulent regime are modeled with Rytov approximation. By considering the resulting wave as a superposition of angular momentum eigenstates, the or-bital angular momentum measurement probabilities of the transmitted digit axe presented. Our results show that the effect of turbulent tilt aberration on the orbital angular momentum measurement probabilities of photons is the maximum among these four kinds of aberrations. As the aberration order increases, the effects of turbulence aberrations on the measurement probabilities of orbital angular momentum generally decrease, whereas the effect of turbulence defoens can be ignored. For tilt aberration, as the difference between the measured orbital angular momentum and the original orbital angular momentum increases, the orbital angular momentum measurement probabifity decreases.

  12. Ray and Wave Aberrations Revisited: A Huygens Construction yields Exact Relations

    CERN Document Server

    Restrepo, John; Ihrke, Ivo

    2015-01-01

    The optical aberrations of a system can be described in terms of the wave aberrations, defined as the departure from the ideal spherical wavefront; or the ray aberrations, which are in turn the deviations from the paraxial ray intersection measured in the image plane. The classical connection between the two descriptions is an approximation, the error of which has, so far, not been quantified analytically. We derive exact analytical equations for computing the wavefront surface, the aberrated ray directions, and the transverse ray aberrations in terms of the wave aberrations (OPD) and the reference sphere. We introduce precise conditions for a function to be an OPD function, show that every such function has an associated wavefront, and study the error arising from the classical approximation. We establish strict conditions for the error to be small. We illustrate our results with numerical simulations. Our results show that large numerical apertures and high-frequency OPD functions yield larger approximation...

  13. Ray and wave aberrations revisited: a Huygens-like construction yields exact relations.

    Science.gov (United States)

    Restrepo, John; Stoerck, Pawel J; Ihrke, Ivo

    2016-02-01

    The aberrations of an optical system can be described in terms of the wave aberrations, defined as the departure from the ideal spherical wavefront; or the ray aberrations, which are in turn the deviations from the paraxial ray intersections measured in the image plane. The classical connection between the two descriptions is an approximation, the error of which has, to our knowledge, so far not been quantified analytically. We derive exact analytical equations for computing the wavefront surface, the aberrated ray directions, and the transverse ray aberrations in terms of the wave aberrations (OPD) and the reference sphere. We introduce precise conditions for a function to be an OPD function, show that every such function has an associated wavefront, and study the error arising from the classical approximation. We establish strict conditions for the error to be small. We illustrate our results with numerical simulations. Our results show that large numerical apertures and OPD functions with strong gradients yield larger approximation errors.

  14. Chromosomal aberrations as etiological factors of intrauterine growth retardation

    Directory of Open Access Journals (Sweden)

    Petrović Bojana

    2008-01-01

    Full Text Available Background/Aim. Intrauterine growth retardation (IUGR is a pathological condition of pregnancy characterised by birth weight below the 10th centile. A number of fetal, placental and maternal causes can lead to IUGR; although, in most cases no specific causes can be identified. The aim of this study was to determine the part of chromosomal abnormalities in IUGR etiology. Methods. Fetal blood karyotype taken by cordocentesis from 168 fetuses with diagnosed IUGR was analyzed. Results. Chromosomal rearrangements both numerical and structural were detected in 14 cases (12.2%. Two cases were triploid. Patau syndrome, Edwards syndrome and Down syndrome were found in two cases each. There was one case of trisomy 7 (47, XY, +7 and one case of trisomy 16 (47, XX, +16; one translocation, 46, XY, t (2; 14(q23; q32 and a deletion 46, XYdel (12 (p12 as well as two cases of sex chromosomes abnormalities, 45, X (Turner syndrome and 47, XYY. Conclusion. These findings suggest that a consistent number of symmetrical IUGR cases (about 12% can be associated with chromosomal rearrangements. Chromosomal aberrations that cause IUGR are heterogeneous, aberration of autosomes, mostly autosomal trisomies, being the most common.

  15. A simulation study comparing aberration detection algorithms for syndromic surveillance

    Directory of Open Access Journals (Sweden)

    Painter Ian

    2007-03-01

    Full Text Available Abstract Background The usefulness of syndromic surveillance for early outbreak detection depends in part on effective statistical aberration detection. However, few published studies have compared different detection algorithms on identical data. In the largest simulation study conducted to date, we compared the performance of six aberration detection algorithms on simulated outbreaks superimposed on authentic syndromic surveillance data. Methods We compared three control-chart-based statistics, two exponential weighted moving averages, and a generalized linear model. We simulated 310 unique outbreak signals, and added these to actual daily counts of four syndromes monitored by Public Health – Seattle and King County's syndromic surveillance system. We compared the sensitivity of the six algorithms at detecting these simulated outbreaks at a fixed alert rate of 0.01. Results Stratified by baseline or by outbreak distribution, duration, or size, the generalized linear model was more sensitive than the other algorithms and detected 54% (95% CI = 52%–56% of the simulated epidemics when run at an alert rate of 0.01. However, all of the algorithms had poor sensitivity, particularly for outbreaks that did not begin with a surge of cases. Conclusion When tested on county-level data aggregated across age groups, these algorithms often did not perform well in detecting signals other than large, rapid increases in case counts relative to baseline levels.

  16. Mechanistic modeling of aberrant energy metabolism in human disease

    Directory of Open Access Journals (Sweden)

    Vineet eSangar

    2012-10-01

    Full Text Available Dysfunction in energy metabolism—including in pathways localized to the mitochondria—has been implicated in the pathogenesis of a wide array of disorders, ranging from cancer to neurodegenerative diseases to type II diabetes. The inherent complexities of energy and mitochondrial metabolism present a significant obstacle in the effort to understand the role that these molecular processes play in the development of disease. To help unravel these complexities, systems biology methods have been applied to develop an array of computational metabolic models, ranging from mitochondria-specific processes to genome-scale cellular networks. These constraint-based models can efficiently simulate aspects of normal and aberrant metabolism in various genetic and environmental conditions. Development of these models leverages—and also provides a powerful means to integrate and interpret—information from a wide range of sources including genomics, proteomics, metabolomics, and enzyme kinetics. Here, we review a variety of mechanistic modeling studies that explore metabolic functions, deficiency disorders, and aberrant biochemical pathways in mitochondria and related regions in the cell.

  17. Biclonal chromosomal aberrations in a child with myelodysplastic syndrome.

    Science.gov (United States)

    Jakab, Z; Balogh, E; Kiss, C; Pajor, L; Oláh, E

    1999-01-01

    Hematological malignancies and premalignant diseases are generally of monoclonal origin. The prognostic and therapeutic significance of finding two genetically independent clones remains to be determined. We followed a case of childhood myelodysplastic syndrome showing biclonal chromosomal abnormalities (+8, -7) by conventional cytogenetic examination and double target fluorescence in situ hybridization (FISH). A 7-year-old girl presented with Plaut-Vincent angina and leukopenia. The cytogenetic aberration of +8 was the first sign to suggest MDS. Serial bone marrow controls, prompted by a progressive clinical course detected myelodysplastic changes and a new clonal aberration (-7). The presence of -7 and +8 in two independent clones was verified by double-target FISH. While at diagnosis and during cytokine treatment more cells showed +8, after successful all-trans retinoic acid (ATRA) therapy, the clone with -7 predominated. Following allogeneic bone marrow transplantation the patient displayed donor-derived hematopoesis. Our data stress the significance of cytogenetic and FISH examinations in detecting specific genetic abnormalities and progressive clonal changes as an indicator and guideline for therapy. Different cell clones characterized by different genetic changes might be associated with different biologic features reflected in their response to treatment.

  18. Targeting molecular aberrations in urothelial carcinoma: are we almost there?

    Science.gov (United States)

    Apolo, Andrea B; Kwiatkowski, David J

    2013-01-01

    Advances in tumor biology and cancer genetics have led to the development of effective targeted therapies in oncology over the past decade. However, targeted drug development for urothelial carcinoma has been slower than for some other malignancies. The path forward in drug development is through a better understanding of the aberrant pathways driving urothelial tumor development. Steady progress has been made in the characterization of genomic alterations in urothelial carcinoma. The Cancer Genome Atlas (TCGA) project is well underway in the analysis of a large set of urothelial cancer specimens using multiple approaches and technologies. In addition, there are already many well-established mutations and genetic alterations in urothelial carcinoma that likely contribute in an important way to tumor development. In addition, urothelial cancer genome-wide association studies have identified common variants associated with urothelial cancer risk and protein expression that can potentially be therapeutically targeted. Furthermore, the MET pathway has emerged as an exciting target in multiple tumors, including urothelial carcinoma. Our knowledge of how to clinically target many emerging molecular aberrations in urothelial cancer is still in the early stages of development. However, there is much promise in the ongoing research being conducted in urothelial cancer molecular pathogenesis.

  19. Exercise protects against methamphetamine-induced aberrant neurogenesis

    Science.gov (United States)

    Park, Minseon; Levine, Harry; Toborek, Michal

    2016-01-01

    While no effective therapy is available for the treatment of methamphetamine (METH)-induced neurotoxicity, aerobic exercise is being proposed to improve depressive symptoms and substance abuse outcomes. The present study focuses on the effect of exercise on METH-induced aberrant neurogenesis in the hippocampal dentate gyrus in the context of the blood-brain barrier (BBB) pathology. Mice were administered with METH or saline by i.p. injections for 5 days with an escalating dose regimen. One set of mice was sacrificed 24 h post last injection of METH, and the remaining animals were either subjected to voluntary wheel running (exercised mice) or remained in sedentary housing (sedentary mice). METH administration decreased expression of tight junction (TJ) proteins and increased BBB permeability in the hippocampus. These changes were preserved post METH administration in sedentary mice and were associated with the development of significant aberrations of neural differentiation. Exercise protected against these effects by enhancing the protein expression of TJ proteins, stabilizing the BBB integrity, and enhancing the neural differentiation. In addition, exercise protected against METH-induced systemic increase in inflammatory cytokine levels. These results suggest that exercise can attenuate METH-induced neurotoxicity by protecting against the BBB disruption and related microenvironmental changes in the hippocampus. PMID:27677455

  20. Aberrant regulation of Wnt signaling in hepatocellular carcinoma

    Science.gov (United States)

    Liu, Li-Juan; Xie, Shui-Xiang; Chen, Ya-Tang; Xue, Jing-Ling; Zhang, Chuan-Jie; Zhu, Fan

    2016-01-01

    Hepatocellular carcinoma (HCC) is one of the most lethal malignancies in the world. Several signaling pathways, including the wingless/int-1 (Wnt) signaling pathway, have been shown to be commonly activated in HCC. The Wnt signaling pathway can be triggered via both catenin β1 (CTNNB1)-dependent (also known as “canonical”) and CTNNB1-independent (often referred to as “non-canonical”) pathways. Specifically, the canonical Wnt pathway is one of those most frequently reported in HCC. Aberrant regulation from three complexes (the cell-surface receptor complex, the cytoplasmic destruction complex and the nuclear CTNNB1/T-cell-specific transcription factor/lymphoid enhancer binding factor transcriptional complex) are all involved in HCC. Although the non-canonical Wnt pathway is rarely reported, two main non-canonical pathways, Wnt/planar cell polarity pathway and Wnt/Ca2+ pathway, participate in the regulation of hepatocarcinogenesis. Interestingly, the canonical Wnt pathway is antagonized by non-canonical Wnt signaling in HCC. Moreover, other signaling cascades have also been demonstrated to regulate the Wnt pathway through crosstalk in HCC pathogenesis. This review provides a perspective on the emerging evidence that the aberrant regulation of Wnt signaling is a critical mechanism for the development of HCC. Furthermore, crosstalk between different signaling pathways might be conducive to the development of novel molecular targets of HCC. PMID:27672271

  1. Maternal age, reproduction and chromosomal aberrations in Wistar derived rats.

    Science.gov (United States)

    Niggeschulze, A; Kast, A

    1994-01-01

    The fertility of rats ranges from one to 18 months. In standard teratogenicity testing young, mature females are used which may not reflect the situation in women above 35 years old. Reproduction among different age groups of Wistar ats (strain Chbb: THOM) was compared at 3, 6, 9, 12, 15 and 18 months. At least 20 virgin females were inseminated per age group. The copulation rate did not differ between the groups. From the maternal age of 12 months, the pregnancy rate was significantly decreased, from the age of 9 months, the litter values were significantly lowered and the resorption rates were increased. Maternal age did not influence the incidence of fetal variations and malformations. Additionally, the chromosomal aberration rate in the bone marrow was evaluated in male and female rats. Twelve animals of each sex were scheduled per group, and studied at the age of 1, 3, 6, 12, 15, 18, 21 or 24 months. In males, the aberration rate increased continuously from 0.18 through 3%, while in females the increase continued from 0.33 to 2.29% at 15 months old when a plateau was reached. When testing new compounds for embryotoxicity or genotoxicity in female rats, the animals should be of comparable age to man in order to avoid a misinterpretation of spontaneous abnormalities. From these studies, however, it was concluded that the use of higher age groups of female rats in teratogenicity studies would not improve the risk assessment.

  2. Aberrant WNT/β-catenin signaling in parathyroid carcinoma

    Directory of Open Access Journals (Sweden)

    Åkerström Göran

    2010-11-01

    Full Text Available Abstract Background Parathyroid carcinoma (PC is a very rare malignancy with a high tendency to recur locally, and recurrent disease is difficult to eradicate. In most western European countries and United States, these malignant neoplasms cause less than 1% of the cases with primary hyperparathyroidism, whereas incidence as high as 5% have been reported from Italy, Japan, and India. The molecular etiology of PC is poorly understood. Results The APC (adenomatous polyposis coli tumor suppressor gene was inactivated by DNA methylation in five analyzed PCs, as determined by RT-PCR, Western blotting, and quantitative bisulfite pyrosequencing analyses. This was accompanied by accumulation of stabilized active nonphosphorylated β-catenin, strongly suggesting aberrant activation of the WNT/β-catenin signaling pathway in these tumors. Treatment of a primary PC cell culture with the DNA hypomethylating agent 5-aza-2'-deoxycytidine (decitabine, Dacogen(r induced APC expression, reduced active nonphosphorylated β-catenin, inhibited cell growth, and caused apoptosis. Conclusion Aberrant WNT/β-catenin signaling by lost expression and DNA methylation of APC, and accumulation of active nonphosphorylated β-catenin was observed in the analyzed PCs. We suggest that adjuvant epigenetic therapy should be considered as an additional option in the treatment of patients with recurrent or metastatic parathyroid carcinoma.

  3. Chromosome aberrations in workers of ignalina nuclear power plant

    Energy Technology Data Exchange (ETDEWEB)

    Griciene, B.; Januskeviciute, I.; Mierauskiene, J.; Slapsyte, G. [Vilnius Univ. (Lithuania)

    2006-07-01

    Full text of publication follows: The Ignalina Nuclear Power Plant (I.N.P.P.) workers and outside workers including visitors constitute the largest occupational group exposed to low doses of ionizing radiation in Lithuania. In 2004, the annual collective dose to these workers (4392 persons) was 6,83 man Sv. The maximum annual individual dose of I.N.P.P. workers was 19,16 mSv, and of outside workers was 29,41 mSv. However, according to calculations performed by the Lithuanian Radiation Protection Centre, the decommissioning of I.N.P.P. (the I.N.P.P. is to be shut down by 2009) will result in collective dose of 35 man Sv. Therefore, a special attention should be given to implementation of radiation protection programme. The importance of cytogenetic studies in the medical surveillance of radiation-exposed persons is generally acknowledged. The aim of the present study was to analyse chromosome aberration frequencies in lymphocytes of I.N.P.P. workers. The blood sampling of 27 male workers was performed in October 2004, after planned outage of I.N.P.P.. It was estimated that outages of I.N.P.P. Units contributed 84% to all annual occupational collective dose. Average cumulative dose of 18 workers was 290,7 mSv (group A), and of 9 workers - 71,7 mSv (group B). The mean annual doses averaged over the three-year-period were 15,2 mSv and 0,76 mSv, respectively. None of the exposed workers had ever exceeded the permissible dose limit. The average age of group A workers was 45,2 years, and group B 48,2 years. A questionnaire form with details on age, occupational history, smoking habit and alcohol intake, medication, history of recent illness was completed for each person at the time of blood collection. 64 non-exposed male donors approximately matched by age were used as controls (group C). Heparinized venous blood samples were taken and cultures were initiated within 24 h according to the standard procedures. At least 500 first cycle metaphases were analysed from each

  4. Genetic diversity based on 28S rDNA sequences among populations of Culex quinquefasciatus collected at different locations in Tamil Nadu, India.

    Science.gov (United States)

    Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S

    2015-09-01

    The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.

  5. ABERRATIONS MINIMIZATION FOR IMPROVING CHARACTERISTICS OF COMPACT HIGH-APERTURE DISPERSIVE SPECTROMETERS

    Directory of Open Access Journals (Sweden)

    E. S. Voropay

    2010-01-01

    Full Text Available Schemes of high-aperture and compact optical spectrometers and giperspectrometer with minimized aberrations are presented. In the first scheme usage of inclined plane-parallel plate allows decreasing of astigmatism. In the second scheme off-axis aberrations are practically removed due to axial propagation of light. For giperspectrometer narrowing of light propagation angle through the object lens and turning the light out of dispersion plane lead to minimizing of picture aberrations.

  6. A method of dynamic chromatic aberration correction in low-voltage scanning electron microscopes.

    Science.gov (United States)

    Khursheed, Anjam

    2005-07-01

    A time-of-flight concept that dynamically corrects for chromatic aberration effects in scanning electron microscopes (SEMs) is presented. The method is predicted to reduce the microscope's chromatic aberration by an order of magnitude. The scheme should significantly improve the spatial resolution of low-voltage scanning electron microscopes (LVSEMs). The dynamic means of correcting for chromatic aberration also allows for the possibility of obtaining high image resolution from electron guns that have relatively large energy spreads.

  7. ANALYSES OF CHROMOSOME ABERRATIONS IN LYMPHOCYTES AND BONE MARROW CELLS INDUCED BY RADIATION OR BENZENE

    Institute of Scientific and Technical Information of China (English)

    张鸿源; 王兰金; 等

    1995-01-01

    The chromosomoe and chromatid type aberration can be induced by benzene and the dicentric and ring ones were not observed in vitro experiment but observed in vivo one.In vitro experiment a good linear reression can be given between benzene concentrations and total aberration cells while power regression for radiation dose.The chromosome aberrations induced by benzene combined with radiation in rabbit blood lymphocytes are higher than in bone marryow cells.

  8. Misalignment Induced Aberrations of JWST: Isolating Low Order Primary Figure Residuals from Misalignment

    Science.gov (United States)

    2010-06-07

    7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) Iris AO, Inc. 2680 Bancroft Way Berkeley, CA 04704 8...aberration theory. 15. SUBJECT TERMS Nodal Aberration Theory, James Webb Space Telescope, Misalignment, Segmented , Mirror, Adaptive Optics, Coma...NOT field quadratic K. P. Thompson, “Description of the third-order optical aberrations of near-circular pupil optical systems without symmetry,” J

  9. Higher order aberration comparison between two aspherical intraocular lenses: MC6125AS and Akreos advanced optics

    Institute of Scientific and Technical Information of China (English)

    Mohammad; Taher; Rajabi; Sara; Korouji; Mahgol; Farjadnia; Mohammad; Naderan; Mohammad; Bagher; Rajabi; Bahram; Khosravi; Seyed; Mehdi; Tabatabaie

    2015-01-01

    AIM: To compare higher order aberrations in two aspherical intraocular lenses(IOLs): Akreos advanced optics(AO) and Dr. Schmidt Microcrystalline 6125 aspheric anterior surface(MC6125AS) with each other. METHODS: Forty eyes of 39 patients underwent phacoemulsification and Akreos AO and MC6125 AS were implanted in their eyes in a random manner. Three months post-operatively, higher order aberrations including spherical aberration, coma aberration, and total aberrations were measured and compared.RESULTS: The total aberration was 0.24±0.17 in eyes with Dr. Schmidt and 0.20 ±0.01 in eyes with Akreos AO(P =0.361). The mean of coma aberration was 0.17 ±0.21 and 0.09 ±0.86 in Dr. Schmidt and Akreos lenses,respectively(P =0.825). Total spherical aberration was almost the same in both groups(mean: 0.05, P =0.933).Best corrected visual acuity in Akreos AO(0.10±0.68) and Dr. Schmidt(0.09±0.67) did not differ significantly(P =0.700). CONCLUSION: There is no statistically significant difference in the higher order aberrations between these two aspherical lenses.

  10. Influence of ocular longitudinal chromatic aberration on the selection of aspheric intraocular lenses.

    Science.gov (United States)

    Hong, Xin; Choi, Myoung

    2010-12-06

    Polychromatic defocus could affect the optimal residual spherical aberration that could yield the best image quality for patients with intraocular lenses (IOLs). Modulation transfer functions (MTFs) were generated using a model that included polychromatic defocus. The maximum MTF volume occurred at + 0.05 μm of overall ocular spherical aberration. For 3 case studies, the optimal overall ocular spherical aberration was ~0.05 μm more positive with the contribution of polychromatic defocus than without it. Overall, the model indicated that image quality was usually best when IOLs allowed overall ocular spherical aberration that was slightly positive, rather than strongly positive, zero, or negative.

  11. Theoretical estimates of spherical and chromatic aberration in photoemission electron microscopy.

    Science.gov (United States)

    Fitzgerald, J P S; Word, R C; Könenkamp, R

    2016-01-01

    We present theoretical estimates of the mean coefficients of spherical and chromatic aberration for low energy photoemission electron microscopy (PEEM). Using simple analytic models, we find that the aberration coefficients depend primarily on the difference between the photon energy and the photoemission threshold, as expected. However, the shape of the photoelectron spectral distribution impacts the coefficients by up to 30%. These estimates should allow more precise correction of aberration in PEEM in experimental situations where the aberration coefficients and precise electron energy distribution cannot be readily measured.

  12. Measurement of chromatic aberration in STEM and SCEM by coherent convergent beam electron diffraction.

    Science.gov (United States)

    Zheng, C L; Etheridge, J

    2013-02-01

    A simple method is described for the accurate and precise measurement of chromatic aberration under electron-optical conditions pertinent to scanning transmission electron microscopy (STEM) and scanning confocal electron microscopy (SCEM). The method requires only the measurement of distances in a coherent CBED pattern and knowledge of the electron wavelength and the lattice spacing of a calibration specimen. The chromatic aberration of a spherical-aberration corrected 300 kV thermal field emission TEM is measured in STEM and SCEM operating modes and under different condenser lens settings. The effect of the measured chromatic aberrations on the 3 dimensional intensity distribution of the electron probe is also considered.

  13. Spherical aberration from trajectories in real and hard-edge solenoid fields

    Indian Academy of Sciences (India)

    BISWAS B

    2016-06-01

    For analytical, real and hard-edge solenoidal axial magnetic fields, the low-energy electron trajectories are obtained using the third-order paraxial ray equation. Using the particle trajectories, it is shown that the spherical aberration in the hard-edge model is high and it increases monotonously with hard edginess, although the focal length converges, in agreement with a recentfield and spherical aberration model. The model paved the way for a hard-edge approximation that gives correct focal length and spherical aberration, which is verified here by the trajectory method. In essence, we show that exact hard-edge fields give infinite spherical aberrations.

  14. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  15. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  16. Contralateral interlaminar approach for intraforaminal lumbar degenerative disease with special emphasis on L5-S1 level: A technical note

    Science.gov (United States)

    Zekaj, Edvin; Menghetti, Claudia; Saleh, Christian; Isidori, Alessandra; Bona, Alberto R.; Aimar, Enrico; Servello, Domenico

    2016-01-01

    Background: Intraforaminal disc herniations at the L5-S1 level are extremely surgically challenging lesions. Intracanal approaches frequently require partial or total facetectomy, which may lead to instability. Solely extraforaminal approaches may offer limited visualization of the more medial superiorly exiting and inferiorly exiting nerve roots; this approach is also more complicated at L5-S1 due to the often large L5 transverse process and the iliac wing. Methods: Nine patients with intraforaminal L5-S1 disc herniations, foraminal stenosis, or synovial cysts underwent contralateral interlaminar approaches for lesion resection. Preoperative and postoperative visual analog scale scores were evaluated, and complications were reviewed. Results: All 9 patients demonstrated immediate postoperative clinical improvement. None of the patients exhibited complications and none developed instability or neuropathic disorders. Conclusions: Although the number of cases in our sample was very small (9 in total), the contralateral interlaminar approach appeared to effectively address multiple degenerative L5-S1 foraminal pathologies. Large studies are needed to further evaluate the pros and cons of this approach. PMID:27713854

  17. Protective antibody titres and antigenic competition in multivalent Dichelobacter nodosus fimbrial vaccines using characterised rDNA antigens.

    Science.gov (United States)

    Raadsma, H W; O'Meara, T J; Egerton, J R; Lehrbach, P R; Schwartzkoff, C L

    1994-03-01

    The relationship between K-agglutination antibody titres and protection against experimental challenge with Dichelobacter nodosus, the effect of increasing the number of D. nodosus fimbrial antigens, and the importance of the nature of additional antigens in multivalent vaccines on antibody response and protection against experimental challenge with D. nodosus were examined in Merino sheep. A total of 204 Merino sheep were allocated to one of 12 groups, and vaccinated with preparations containing a variable number of rDNA D. nodosus fimbrial antigens. The most complex vaccine contained ten fimbrial antigens from all major D. nodosus serogroups, while the least complex contained a single fimbrial antigen. In addition to D. nodosus fimbrial antigens, other bacterial rDNA fimbrial antigens (Moraxella bovis Da12d and Escherichia coli K99), and bovine serum albumin (BSA) were used in some vaccines. Antibody titres to fimbrial antigens and BSA were measured by agglutination and ELISA tests, respectively. Antibody titres were determined on five occasions (Weeks 0, 3, 6, 8, and 11 after primary vaccination). All sheep were exposed to an experimental challenge with virulent isolates of D. nodosus from either serogroup A or B, 8 weeks after primary vaccination. For D. nodosus K-agglutinating antibody titres, a strong negative correlation between antibody titre and footrot lesion score was observed. This relationship was influenced by the virulence of the challenge strain. Increasing the number of fimbrial antigens in experimental rDNA D. nodosus fimbrial vaccines resulted in a linear decrease in K-agglutinating antibody titres to individual D. nodosus serogroups. Similarly, a linear decrease in protection to challenge with homologous serogroups was observed as the number of D. nodosus fimbrial antigens represented in the vaccine increased. The reduction in antibody titres in multicomponent vaccines is thought to be due to antigenic competition. The level of competition

  18. Colletotrichum isolates related to Anthracnose of cashew trees in Brazil: morphological and molecular description using LSU rDNA sequences

    Directory of Open Access Journals (Sweden)

    Ana Maria Queijeiro Lopez

    2010-08-01

    Full Text Available Thirty six isolates of fungi obtained from anthracnose lesions of cashew and associated host plants in Brazil, were compared by their cultural, morphological and partial sequences of the 28S ribosomal DNA characters. They showed a high degree of cultural variability. The average mycelial growth rate on all tested media ranged from 10.2-13.3 mm/day between the isolates. Most of them produced perithecia (sterile and fertile and some produced setae (sterile and fertile. All the isolates produced acervuli with predominantly cylindrical conidia (12.4-17.7 µmX 4.8-6.0 µm in width with round ends, which became septate on germination, and produced unlobed or slightlylobed appressoria. Comparison of the D2 domain of the large subunit (LSU rDNA sequences with those of other defined species of Colletotrichum and Glomerella grouped 35 of the isolates with known strains of C. gloeosporioides from different hosts (> 98.9% homology. The one exception (LARS 921 was identical to G. cingulata (LARS 238 from Vigna unguiculata.Trinta e seis isolados de fungos obtidos de lesões de antracnose em cajueiros e outras plantas consorciadas no Brasil, foram comparados quanto a seus aspectos culturais, morfológicos e seqüências parciais do rDNA 28S. Os isolados apresentaram elevado grau de variabilidade cultural, com taxa de crescimento médio, em todos os meios testados, entre 10,2 e 13,3 mm/dia. A maioria deles produziu peritécios (estéreis e férteis, e alguns produziram setas (estéreis e férteis nos diferentes meios. Todos apresentaram acérvulos com predominância de conídios cilíndricos (12,4-17,7 µm X 4,8-6,0 µm, de extremidades arredondadas, formando septos durante a germinação e produzindo apressórios ligeiramente lobados ou lisos. Comparando as seqüências do domínio D2 da larga subunidade (LSU do rDNA dos isolados com aquelas já identificadas de espécies de Colletotrichum/ Glomerella, verificou-se que 35 deles correspondem a C

  19. Use of single-strand conformation polymorphism of amplified 16S rDNA for grouping of bacteria isolated from foods.

    Science.gov (United States)

    Takahashi, Hajime; Kimura, Bon; Tanaka, Yuichiro; Mori, Mayumi; Yokoi, Asami; Fujii, Tateo

    2008-04-01

    The grouping method for isolated strains from foods using single-strand conformation polymorphism (SSCP) after PCR amplification of a portion of 16S rDNA was developed. This method was able to group the strains from various food samples based on 16S rDNA sequence. As 97.8% of the isolated strains from various foods were grouped correctly, use of the PCR-SSCP method enables the prompt and labor-saving analysis of microbial population of food-derived bacterial strains. Advantages in speed and accuracy of bacterial population identification by the PCR-SSCP method have practical application for food suppliers and testing laboratories.

  20. Unexpected accumulation of ncm(5U and ncm(5S(2 (U in a trm9 mutant suggests an additional step in the synthesis of mcm(5U and mcm(5S(2U.

    Directory of Open Access Journals (Sweden)

    Changchun Chen

    Full Text Available BACKGROUND: Transfer RNAs are synthesized as a primary transcript that is processed to produce a mature tRNA. As part of the maturation process, a subset of the nucleosides are modified. Modifications in the anticodon region often modulate the decoding ability of the tRNA. At position 34, the majority of yeast cytosolic tRNA species that have a uridine are modified to 5-carbamoylmethyluridine (ncm(5U, 5-carbamoylmethyl-2'-O-methyluridine (ncm(5Um, 5-methoxycarbonylmethyl-uridine (mcm(5U or 5-methoxycarbonylmethyl-2-thiouridine (mcm(5s(2U. The formation of mcm(5 and ncm(5 side chains involves a complex pathway, where the last step in formation of mcm(5 is a methyl esterification of cm(5 dependent on the Trm9 and Trm112 proteins. METHODOLOGY AND PRINCIPAL FINDINGS: Both Trm9 and Trm112 are required for the last step in formation of mcm(5 side chains at wobble uridines. By co-expressing a histidine-tagged Trm9p together with a native Trm112p in E. coli, these two proteins purified as a complex. The presence of Trm112p dramatically improves the methyltransferase activity of Trm9p in vitro. Single tRNA species that normally contain mcm(5U or mcm(5s(2U nucleosides were isolated from trm9Δ or trm112Δ mutants and the presence of modified nucleosides was analyzed by HPLC. In both mutants, mcm(5U and mcm(5s(2U nucleosides are absent in tRNAs and the major intermediates accumulating were ncm(5U and ncm(5s(2U, not the expected cm(5U and cm(5s(2U. CONCLUSIONS: Trm9p and Trm112p function together at the final step in formation of mcm(5U in tRNA by using the intermediate cm(5U as a substrate. In tRNA isolated from trm9Δ and trm112Δ strains, ncm(5U and ncm(5s(2U nucleosides accumulate, questioning the order of nucleoside intermediate formation of the mcm(5 side chain. We propose two alternative explanations for this observation. One is that the intermediate cm(5U is generated from ncm(5U by a yet unknown mechanism and the other is that cm(5U is formed

  1. Chromosomal aberrations related to metastasis of human solid tumors

    Institute of Scientific and Technical Information of China (English)

    Lun-Xiu Qin

    2002-01-01

    The central role of sequential accumulation of genetic alterations during the development of cancer has been firmly established since the pioneering cytogenetic studies successfully defined recurrent chromosome changes in spedfic types of tumor. In the course of carcinogenesis, cells experience several genetic alterations that are associated with the transition from a preneoplastic lesion to an invasive tumor and finally to the metastatic state. Tumor progression is characterized by stepwise accumulation of genetic alterations.So does the dominant metastatic clone. Modern molecular genetic analyses have clarified that genomic changes accumulate during the development and progression of cancers. In comparison with the corresponding primary tumor,additional events of chromosomal aberrations (including gains or allelic losses) are frequently found in metastases, and the incidence of combined chromosomal alterations in the primary tumor, plus the occurrence of additional aberrations inthe distant metastases, correlated significantly with decreased postmetastatic survival. The deletions at 3p, 4p, 6q, 8p, 10q,11p, 11q, 12p, 13q, 16q, 17p, 18q, 21q, and 22q, as well as the over-representations at 1q, 8q, 9q, 14q and 15q, have been found to associate preferentially with the metastatic phenotype of human cancers. Among of them, the deletions on chromosomes 8p, 17p, 11p and 13p seem to be more significant, and more detail fine regions of them, including 8p11, 8p21-12, 8p22, 8p23, 17p13.3, 11p15.5, and 13q12-13 have been suggested harboring metastasis-suppressor genes.During the past decade, several human chromosomes have been functionally tested through the use of microcell-mediated chromosome transfer (MMCT), and metastasis-suppressor activities have been reported on chromosomes 1, 6, 7, 8, 10,11, 12, 16, and 17. However, it is not actually known at what stage of the metastatic cascade these alterations have occurred.There is still controversial with the association

  2. Stalled RNAP-II molecules bound to non-coding rDNA spacers are required for normal nucleolus architecture.

    Science.gov (United States)

    Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D

    2013-07-01

    The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes.

  3. Short communication: Genetic variants of Sarcocystis cruzi in infected Malaysian cattle based on 18S rDNA.

    Science.gov (United States)

    Ng, Yit Han; Fong, Mun Yik; Subramaniam, Vellayan; Shahari, Shahhaziq; Lau, Yee Ling

    2015-12-01

    Sarcocystis species are pathogenic parasites that infect a wide range of animals, including cattle. A high prevalence of cattle sarcocystosis has been reported worldwide, but its status is unknown in Malaysia. This study focused on utilizing 18S rDNA to identify Sarcocystis species in Malaysian cattle and to determine their genetic variants. In this study, only Sarcocystis cruzi was detected in Malaysian cattle. The intra-species S. cruzi phylogenetic tree analysis and principal coordinate analysis (PCoA), respectively displayed two minor groups among the parasite isolates. This finding was supported by high Wright FST value (FST=0.647). The definitive hosts (dogs) may play a fundamental role in the development of S. cruzi genetic variants. Additionally, the existence of microheterogeneity within the S. cruzi merozoites and/or distinct genetic variants arisen from independent merozoites in mature sarcocysts, possibly contributed to the existence of intra-species variations within the population.

  4. Phylogenetic relationships of five species of Dorippinae (Crustacea, Decapoda) revealed by 16S rDNA sequence analysis

    Institute of Scientific and Technical Information of China (English)

    FANYu; LIXinzheng; SONGLinsheng; CAIZhonghua

    2004-01-01

    A molecular phylogeny is presented for the subfamily Dorippinae (including 9 individuals, representing 5 species and 4 genera), based on the sequence data from 16S rRNA gene. Two-cluster test between lineages in these phylogenetic trees has been performed. On the basis of rate constancy, the rate of nucleotide substitutions of 16S rDNA sequence data is estimated as 0.27% per million years. The analysis strongly supports the recognition of the Dorippinae as a monophyletic subfamily. Phylogenetic tree indicates that the subfamily Dorippinae is divided into two main clades, and genus Dorippe appears basal in the subfamily, diverging from other species 36.6 Ma ago. It is also clear that the Heikea is closely related to the genus Neodorippe. The divergence time between them is 15.8 Ma.

  5. Uptake of copper ion by activated sludge and its bacterial community variation analyzed by 16S rDNA

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The effect and uptake of copper ion on SBR(sequence batch reactor) biological treatment system was studied in this paper. Special nutrient and powder activated carbon(PAC) additive were tested as uptake stimulation technique. Results showed that copper ion had higher effect on unacclimated activated sludge system than on acclimated one. The special nutrient adding could enhance the uptake of copper significantly, while PAC adding could improve the sludge settling and decrease the turbidity of effluent. The variation of bacterial community analyzed by 16S rDNA method showed the acclimation of copper could increase copper resistance species, and excess accumulation could cause some species diminish. It was confirmed that acclimation could improve the resistance and uptake ability of microorganism to heavy metal.

  6. Isolation of culturable endophytic bacteria from Moso bamboo (Phyllostachys edulis and 16S rDNA diversity analysis

    Directory of Open Access Journals (Sweden)

    Yuan Zong-Sheng

    2015-01-01

    Full Text Available We analyzed culturable endophytic bacteria from Moso bamboo (Phyllostachys edulis using traditional bacterial isolation and culture methods and then studied the colony characteristics and diversity with a 16S rDNA sequence analysis. We isolated 82 endophytic bacteria strains belonging to 47 species in 26 genera from the root, rhizome, stem and leaves of Moso bamboo species from populations on Wuyi Mountain, and in the Jiangle and Changting regions. There were significant differences in the composition of the culturable endophytic bacteria isolated from the different areas and from different tissues. The dominant bacteria strains from the Wuyi Mountain samples were Arthrobacter, Staphylococcus, Bacillus and Enterobacter, while the dominant bacteria from the Jiangle samples were Bacillus, Staphylococcus and Curtobacterium, and the dominant bacteria in the Changting samples were Alcaligenes, Pseudomonas, Staphylococcus and Bacillus. Our results demonstrate the abundant diversity of endophytic bacteria in Moso bamboo.

  7. Multiple group I introns in the small-subunit rDNA of Botryosphaeria dothidea: implication for intraspecific genetic diversity.

    Directory of Open Access Journals (Sweden)

    Chao Xu

    Full Text Available Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU ribosomal DNA (rDNA sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF for encoding the homing endonuclease (HE, whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron and genotype IV (Bdo.S1199-B were each found in only one strain, whereas genotype I (Bdo.S1199-A and genotype II (Bdo.S943 and Bdo.S1506 occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea.

  8. Bacterial diversity in spent mushroom compost assessed by amplified rDNA restriction analysis and sequencing of cultivated isolates.

    Science.gov (United States)

    Ntougias, Spyridon; Zervakis, Georgios I; Kavroulakis, Nektarios; Ehaliotis, Constantinos; Papadopoulou, Kalliope K

    2004-11-01

    Spent mushroom compost (SMC) is the residual by-product of commercial Agaricus spp. cultivation, and it is mainly composed of a thermally treated cereal straw/animal manure mixture colonized by the fungal biomass. Research on the valorization of this material is mainly focusing on its use as soil conditioner and plant fertilizer. An investigation of the bacterial diversity in SMC was performed using molecular techniques in order to reveal the origin of SMC microflora and its potential effect on soil microbial communities after incorporation into agricultural soils. The bacterial population was estimated by the plate count method to a mean of 2.7 10(9) colony forming units (cfu) per g of dry weight, while the numbers of Gram-positive and Gram-negative bacteria were 1.9 10(9) and 4.9 10(8) cfu per g dw respectively as estimated by enumeration on semi-selective media. Fifty bacterial isolates were classified into 14 operational taxonomic units (OTUs) following ARDRA-PCR of the 16S rDNA gene. Sequencing of the 16S rDNA amplicon assigned 12 of the 14 OTUs to Gram-positive bacteria, associated with the genera Bacillus, Paenibacillus, Exiguobacterium, Staphylococcus, Desemzia, Carnobacterium, Brevibacterium, Arthrobacter and Microbacterium of the bacterial divisions Firmicutes and Actinobacteria. Two bacterial groups have phylogenetic links with the genera Comamonas and Sphingobacterium, which belong to beta-Proteobacteria and Bacteroidetes respectively. Two potentially novel bacteria are reported, which are associated with the genera Bacillus and Microbacterium. Most of the bacteria identified are of environmental origin, while strains related to species usually isolated from insects, animal and clinical sources were also detected. It appears that bacterial diversity in SMC is greatly affected by the origin of the initial material, its thermal pasteurization treatment and the potential unintended colonization of the mushroom substrate during the cultivation process.

  9. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina

    Science.gov (United States)

    Iwanowicz, L.R.; Iwanowicz, D.D.; Pote, L.M.; Blazer, V.S.; Schill, W.B.

    2008-01-01

    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 ?? 0.3 ??m (range 15.7-20.3) in length, and 5.4 ?? 0.1 ??m (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 ?? 1.1 ??m (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 ?? 0.1 ??m (range 5.48-7.06), while the shorter is 5.7 ?? 0.1 ??m (range 4.8-6.4) in length. Polar capsule width is 1.2 ?? 0.03 ??m (range 1.0-1.54). The total length of the spore is 60.9 ?? 1.2 ??m (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus. ?? American Society of Parasitologists 2008.

  10. The evolution pattern of rDNA ITS in Avena and phylogenetic relationship of the Avena species (Poaceae: Aveneae).

    Science.gov (United States)

    Peng, Yuan-Ying; Baum, Bernard R; Ren, Chang-Zhong; Jiang, Qian-Tao; Chen, Guo-Yue; Zheng, You-Liang; Wei, Yu-Ming

    2010-10-01

    Ribosomal ITS sequences are commonly used for phylogenetic reconstruction because they are included in rDNA repeats, and these repeats often undergo rapid concerted evolution within and between arrays. Therefore, the rDNA ITS copies appear to be virtually identical and can sometimes be treated as a single gene. In this paper we examined ITS polymorphism within and among 13 diploid (A and C genomes), seven tetraploid (AB, AC and CC genomes) and four hexaploid (ACD genome) to infer the extent and direction of concerted evolution, and to reveal the phylogenetic and genome relationship among species of Avena. A total of 170 clones of the ITS1-5.8S-ITS2 fragment were sequenced to carry out haplotype and phylogenetic analysis. In addition, 111 Avena ITS sequences retrieved from GenBank were combined with 170 clones to construct a phylogeny and a network. We demonstrate the major divergence between the A and C genomes whereas the distinction among the A and B/D genomes was generally not possible. High affinity among the A(d) genome species A. damascena and the ACD genome species A. fatua was found, whereas the rest of the ACD genome hexaploids and the AACC tetraploids were highly affiliated with the A(l) genome diploid A. longiglumis. One of the AACC species A. murphyi showed the closest relationship with most of the hexaploid species. Both C(v) and C(p) genome species have been proposed as paternal donors of the C-genome carrying polyploids. Incomplete concerted evolution is responsible for the observed differences among different clones of a single Avena individual. The elimination of C-genome rRNA sequences and the resulting evolutionary inference of hexaploid species are discussed.

  11. Differentiation of Acidithiobacillus ferrooxidans and A. thiooxidans strains based on 16S-23S rDNA spacer polymorphism analysis.

    Science.gov (United States)

    Bergamo, Rogério F; Novo, Maria Teresa M; Veríssimo, Ricardo V; Paulino, Luciana C; Stoppe, Nancy C; Sato, Maria Inês Z; Manfio, Gilson P; Prado, Paulo Inácio; Garcia, Oswaldo; Ottoboni, Laura M M

    2004-09-01

    Restriction fragment length polymorphism (RFLP) and sequence analyses of the PCR-amplified 16S-23S rDNA intergenic spacer (ITS) were used for differentiating Acidithiobacillus thiooxidans strains from other related acidithiobacilli, including A. ferrooxidans and A. caldus. RFLP fingerprints obtained with AluI, DdeI, HaeIII, HinfI and MspI enabled the differentiation of all Acidithiobacillus reference strains into species groups. The A. thiooxidans strains investigated (metal mine isolates) yielded identical RFLP patterns to the A. thiooxidans type strain (ATCC 19377(T)), except for strain DAMS, which had a distinct pattern for all enzymes tested. Fourteen A. ferrooxidans mine strains were assigned to 3 RFLP groups, the majority of which were grouped with A. ferrooxidans ATCC 23270(T). The spacer region of one representative strain from each of the RFLP groups obtained was subjected to sequence analysis, in addition to eleven additional A. thiooxidans strains isolated from sediment and water samples, and A. caldus DSM 8584(T). The tRNA(IIe) and tRNA(Ala) genes, present in all strains analyzed, showed high sequence similarity. Phylogenetic analysis of the ITS sequences differentiated all three Acidithiobacillus species. Inter- and infraspecific genetic variations detected were mainly due to the size and sequence polymorphism of the ITS3 region. Mantel tests showed no significant correlation between ITS sequence similarity and the geographical origin of strains. The results showed that the 16S-23S rDNA spacer region is a useful target for the development of molecular-based methods aimed at the detection, rapid differentiation and identification of acidithiobacilli.

  12. Molecular identification of four phenotypes of human Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA.

    Science.gov (United States)

    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

    2013-11-01

    Classification of Demodex mites has long depended on hosts and morphological characteristics. However, the fact that two species coexist in the same host and phenotype is easily influenced by environment causes difficulty and indeterminacy in traditional classification. Genotype, which directly reflects the molecular structure characteristics, is relatively stable. In this study, species identification of four phenotypes of human Demodex mites was conducted. Mites were morphologically classified into four phenotypes: long- and short-bodied Demodex folliculorum with finger-like terminus and Demodex brevis with finger- or cone-like terminus. The mitochondrial 16S ribosomal DNA (rDNA) fragment of individual mite was amplified, cloned, sequenced, and aligned. Sequence divergences, genetic distances, transition/transversion rates, and phylogenetic trees were analyzed. The results demonstrated that the 16S rDNA sequence of three phenotypes with finger-like terminus was 337 bp, and that of phenotype with cone-like terminus was 342 bp. The divergences, genetic distances, and transition/transversion rates among the three phenotypes with finger-like terminus were 0.0-2.7%, 0.000-0.029, and 5.0-7/0 (5/1-7/0), respectively, indicating an intraspecific variation. Yet, those between these three phenotypes and the one with cone-like terminus were 21.6-22.8%, 2.510-2.589, and 0.47-0.59 (22/47-27/46), respectively, suggesting an interspecific variation. The five phylogenetic trees showed that the three phenotypes with finger-like terminus clustered into one branch, while the phenotype with cone-like terminus clustered into another. In conclusion, terminus is a major morphological characteristic for the identification of human Demodex species. The three phenotypes with finger-like terminus belong to D. folliculorum, while the phenotype with cone-like terminus belongs to D. brevis. Molecular identification can verify and replenish morphological identification.

  13. Distribution, hosts, 16S rDNA sequences and phylogenetic position of the Neotropical tick Amblyomma parvum (Acari: Ixodidae).

    Science.gov (United States)

    Nava, S; Szabó, M P J; Mangold, A J; Guglielmone, A A

    2008-07-01

    The hosts, distribution, intraspecific genetic variation and phylogenetic position of Amblyomma parvum (Acari: Ixodidae) have recently been re-assessed. Data on this tick's hosts and distribution were obtained not only from existing literature but also from unpublished records. Sequences of the ticks' mitochondrial 16S ribosomal DNA (rDNA) were used to evaluate genetic variation among specimens of A. parvum from different localities in Argentina and Brazil, and to explore the phylogenetic relationships between this tick and other Amblyomma species. Although several species of domestic and wild mammal act as hosts for adult A. parvum, most collected adults of this species have come from cattle and goats. Caviid rodents of the subfamily Caviinae appear to be the hosts for the immature stages. So far, A. parvum has been detected in 12 Neotropical biogeographical provinces (Chaco, Cerrado, Eastern Central America, Venezuelan Coast, Pantanal, Parana Forest, Caatinga, Chiapas, Venezuelan Llanos, Monte, Western Panamanian Isthmus, and Roraima) but the Chaco province has provided significantly more specimens than any other (P<0.0001). The 16S rDNA sequences showed just 0.0%-1.1% divergence among the Argentinean A. parvum investigated and no more than 0.2% divergence among the Brazilian specimens. The observed divergence between the Argentinean and Brazilian specimens was, however, greater (3.0%-3.7%). Although there is now molecular and morphological evidence to indicate that A. parvum, A. pseudoparvum, A. auricularium and A. pseudoconcolor are members of a natural group, previous subgeneric classifications do not reflect this grouping. The subgeneric status of these tick species therefore needs to be re-evaluated. The 16S-rDNA-based evaluation of divergence indicates that the gene flow between Argentinean and Brazilian 'A. parvum' is very limited and that the Argentinean 'A. parvum' may be a different species to the Brazilian.

  14. Ocular wavefront aberrations in the common marmoset Callithrix jacchus: effects of age and refractive error.

    Science.gov (United States)

    Coletta, Nancy J; Marcos, Susana; Troilo, David

    2010-11-23

    The common marmoset, Callithrix jacchus, is a primate model for emmetropization studies. The refractive development of the marmoset eye depends on visual experience, so knowledge of the optical quality of the eye is valuable. We report on the wavefront aberrations of the marmoset eye, measured with a clinical Hartmann-Shack aberrometer (COAS, AMO Wavefront Sciences). Aberrations were measured on both eyes of 23 marmosets whose ages ranged from 18 to 452 days. Twenty-one of the subjects were members of studies of emmetropization and accommodation, and two were untreated normal subjects. Eleven of the 21 experimental subjects had worn monocular diffusers and 10 had worn binocular spectacle lenses of equal power. Monocular deprivation or lens rearing began at about 45 days of age and ended at about 108 days of age. All refractions and aberration measures were performed while the eyes were cyclopleged; most aberration measures were made while subjects were awake, but some control measurements were performed under anesthesia. Wavefront error was expressed as a seventh-order Zernike polynomial expansion, using the Optical Society of America's naming convention. Aberrations in young marmosets decreased up to about 100 days of age, after which the higher-order RMS aberration leveled off to about 0.10 μm over a 3 mm diameter pupil. Higher-order aberrations were 1.8 times greater when the subjects were under general anesthesia than when they were awake. Young marmoset eyes were characterized by negative spherical aberration. Form-deprived eyes of the monocular deprivation animals had greater wavefront aberrations than their fellow untreated eyes, particularly for asymmetric aberrations in the odd-numbered Zernike orders. Both lens-treated and form-deprived eyes showed similar significant increases in Z3(-3) trefoil aberration, suggesting the increase in trefoil may be related to factors that do not involve visual feedback.

  15. Environmental Transmission Electron Microscopy in an Aberration-Corrected Environment

    DEFF Research Database (Denmark)

    Hansen, Thomas W.; Wagner, Jakob B.

    2012-01-01

    The increasing use of environmental transmission electron microscopy (ETEM) in materials science provides exciting new possibilities for investigating chemical reactions and understanding both the interaction of fast electrons with gas molecules and the effect of the presence of gas on high......-resolution imaging. A gaseous atmosphere in the pole-piece gap of the objective lens of the microscope alters both the incoming electron wave prior to interaction with the sample and the outgoing wave below the sample. Whereas conventional TEM samples are usually thin (below 100 nm), the gas in the environmental...... cell fills the entire gap between the pole pieces and is thus not spatially localized. By using an FEI Titan environmental transmission electron microscope equipped with a monochromator and an aberration corrector on the objective lens, we have investigated the effects on imaging and spectroscopy...

  16. Aberrantly flattened responsivity to emotional pictures in paranoid schizophrenia.

    Science.gov (United States)

    Lee, Eun; Kim, Jae-Jin; Namkoong, Kee; An, Suk Kyoon; Seok, Jeong-Ho; Lee, Yu Jin; Kang, Jee In; Choi, Jae Hyuk; Hong, Taekyong; Jeon, Jong Hee; Lee, Hong Shick

    2006-08-30

    To investigate the nature of emotional experience in schizophrenia, we examined emotional responses to affective stimuli. Twenty-one outpatients with schizophrenia (9 paranoid, 12 nonparanoid) and 20 normal controls rated the arousal and valence that they experienced from the presentation of 60 pictures. Schizophrenia patients displayed less emotional responsivity to the positive stimuli and they displayed diverse responsivity to the negative stimuli, which depended upon arousal level. Further analysis, using schizophrenia subtype, indicated that nonparanoid patients reported increased negative responsivity and decreased positive responsivity, regardless of arousal level. However, paranoid schizophrenia patients showed enhanced self-reported experiences of emotion to the low arousing stimuli and diminished responsivity to the high arousing stimuli. This pattern was robust to the negative stimuli. These findings suggest that paranoid schizophrenia patients might suffer from aberrantly flattened responses to negative emotional stimuli, and that this may account for paranoid tendency and secondary social isolation in paranoid schizophrenia.

  17. Aberrant microRNA expression in multiple myeloma

    DEFF Research Database (Denmark)

    Dimopoulos, Konstantinos; Gimsing, Peter; Grønbæk, Kirsten

    2013-01-01

    Multiple myeloma (MM) is a devastating disease with a complex biology, and in spite of improved survivability by novel treatment strategies over the last decade, MM is still incurable by current therapy. MicroRNAs (miRNAs) are small, non-coding RNA molecules that regulate gene expression at a post......-transcriptional level. More than half of all protein coding genes are estimated to be controlled by miRNAs, and their expression is frequently deregulated in many diseases, including cancer. Recent studies have reported aberrant miRNA expression patterns in MM, and the function of individual miRNAs in MM has been...... investigated in detail in cell culture and animal models. Here, we review the current knowledge on the role of miRNAs in MM pathogenesis and discuss their potential as prognostic biomarkers and targets for treatment....

  18. Geometrical Aberration Suppression for Large Aperture Sub-THz Lenses

    Science.gov (United States)

    Rachon, M.; Liebert, K.; Siemion, A.; Bomba, J.; Sobczyk, A.; Knap, W.; Coquillat, D.; Suszek, J.; Sypek, M.

    2017-03-01

    Advanced THz setups require high performance optical elements with large numerical apertures and small focal lengths. This is due to the high absorption of humid air and relatively low efficiency of commercially available detectors. Here, we propose a new type of double-sided sub-THz diffractive optical element with suppressed geometrical aberration for narrowband applications (0.3 THz). One side of the element is designed as thin structure in non-paraxial approach which is the exact method, but only for ideally flat elements. The second side will compensate phase distribution differences between ideal thin structure and real volume one. The computer-aided optimization algorithm is performed to design an additional phase distribution of correcting layer assuming volume designing of the first side of the element. The experimental evaluation of the proposed diffractive component created by 3D printing technique shows almost two times larger performance in comparison with uncorrected basic diffractive lens.

  19. Longitudinal chromatic aberration of the human infant eye.

    Science.gov (United States)

    Wang, Jingyun; Candy, T Rowan; Teel, Danielle F W; Jacobs, Robert J

    2008-09-01

    Although the longitudinal chromatic aberration (LCA) of the adult eye has been studied, there are no data collected from the human infant eye. A chromatic retinoscope was used to measure cyclopleged infant and adult refractions with four pseudomonochromatic sources (centered at 472, 538, 589, and 652 nm) and with polychromatic light. The LCA of the infant eyes between 472 and 652 nm was a factor of 1.7 greater than the LCA found in the adult group: infant mean=1.62 D, SD+/- 0.14 D; adult mean=0.96 D, SD+/- 0.17 D. The elevated level of LCA in infant eyes is consistent with the greater optical power of the immature eye and indicates similar chromatic dispersion in infant and adult eyes. The implications for visual performance, defocus detection, and measurement of refraction are discussed.

  20. Geometrical Aberration Suppression for Large Aperture Sub-THz Lenses

    Science.gov (United States)

    Rachon, M.; Liebert, K.; Siemion, A.; Bomba, J.; Sobczyk, A.; Knap, W.; Coquillat, D.; Suszek, J.; Sypek, M.

    2016-11-01

    Advanced THz setups require high performance optical elements with large numerical apertures and small focal lengths. This is due to the high absorption of humid air and relatively low efficiency of commercially available detectors. Here, we propose a new type of double-sided sub-THz diffractive optical element with suppressed geometrical aberration for narrowband applications (0.3 THz). One side of the element is designed as thin structure in non-paraxial approach which is the exact method, but only for ideally flat elements. The second side will compensate phase distribution differences between ideal thin structure and real volume one. The computer-aided optimization algorithm is performed to design an additional phase distribution of correcting layer assuming volume designing of the first side of the element. The experimental evaluation of the proposed diffractive component created by 3D printing technique shows almost two times larger performance in comparison with uncorrected basic diffractive lens.

  1. Mutational consequences of aberrant ion channels in neurological disorders.

    Science.gov (United States)

    Kumar, Dhiraj; Ambasta, Rashmi K; Kumar, Pravir

    2014-11-01

    Neurological channelopathies are attributed to aberrant ion channels affecting CNS, PNS, cardiac, and skeletal muscles. To maintain the homeostasis of excitable tissues, functional ion channels are necessary to rely electrical signals, whereas any malfunctioning serves as an intrinsic factor to develop neurological channelopathies. Molecular basis of these disease is studied based on genetic and biophysical approaches, e.g., loci positional cloning, whereas pathogenesis and bio-behavioral analysis revealed the dependency on genetic mutations and inter-current triggering factors. Although electrophysiological studies revealed the possible mechanisms of diseases, analytical study of ion channels remained unsettled and therefore underlying mechanism in channelopathies is necessary for better clinical application. Herein, we demonstrated (i) structural and functional role of various ion channels (Na(+), K(+), Ca(2+),Cl(-)), (ii) pathophysiology involved in the onset of their associated channelopathies, and (iii) comparative sequence and phylogenetic analysis of diversified sodium, potassium, calcium, and chloride ion channel subtypes.

  2. Prognostic significance of aberrantly silenced ANPEP expression in prostate cancer

    DEFF Research Database (Denmark)

    Sørensen, Karina Dalsgaard; Abildgaard, Mette Opstrup; Haldrup, Christa;

    2013-01-01

    Background:Novel biomarkers for prostate cancer (PC) are urgently needed. This study investigates the expression, epigenetic regulation, and prognostic potential of ANPEP in PC.Methods:Aminopeptidase N (APN; encoded by ANPEP) expression was analysed by immunohistochemistry using tissue microarrays...... nonmalignant and PC tissue samples, and in cell lines.Results:The APN expression was significantly downregulated in PC compared with nonmalignant prostate tissue samples. Aberrant promoter hypermethylation was frequently observed in PC tissue samples, and 5-aza-2'-deoxycytidine induced ANPEP expression...... in three hypermethylated prostate cell lines, suggesting epigenetic silencing. Negative APN immunoreactivity was significantly associated with short RFS and short CSS in the RP and CT cohort, respectively, independently of routine clinicopathological predictors. Combining APN with a known angiogenesis...

  3. The Oncoprotein BRD4-NUT Generates Aberrant Histone Modification Patterns

    Science.gov (United States)

    Zee, Barry M.; Dibona, Amy B.; Alekseyenko, Artyom A.; French, Christopher A.; Kuroda, Mitzi I.

    2016-01-01

    Defects in chromatin proteins frequently manifest in diseases. A striking case of a chromatin-centric disease is NUT-midline carcinoma (NMC), which is characterized by expression of NUT as a fusion partner most frequently with BRD4. ChIP-sequencing studies from NMC patients revealed that BRD4-NUT (B4N) covers large genomic regions and elevates transcription within these domains. To investigate how B4N modulates chromatin, we performed affinity purification of B4N when ectopically expressed in 293-TREx cells and quantified the associated histone posttranslational modifications (PTM) using proteomics. We observed significant enrichment of acetylation particularly on H3 K18 and of combinatorial patterns such as H3 K27 acetylation paired with K36 methylation. We postulate that B4N complexes override the preexisting histone code with new PTM patterns that reflect aberrant transcription and that epigenetically modulate the nucleosome environment toward the NMC state. PMID:27698495

  4. Propagation of Aberrations through Phase Induced Amplitude Apodization coronagraph

    CERN Document Server

    Pueyo, Laurent; Shaklan, Stuart; 10.1364/JOSAA.28.000189

    2011-01-01

    The specification of polishing requirements for the optics in coronagraphs dedicated to exo-planet detection requires careful and accurate optical modelling. Numerical representations of the propagation of aberrations through the system as well as simulations of the broadband wavefront compensation system using multiple DMs are critical when one devises an error budget for such a class of instruments. In this communication we introduce an analytical tool that serves this purpose for Phase Induced Amplitude Apodisation (PIAA) coronagraphs. We first start by deriving the analytical form of the propagation of a harmonic ripple through a PIAA unit. Using this result we derive the chromaticity of the field at any plane in the optical train of a telescope equipped with such a coronagraph. Finally we study the chromatic response of a sequential DM wavefront actuator correcting such a corrugated field and thus quantify the requirements on the manufacturing of PIAA mirrors

  5. Relativistic stellar aberration for the Space Interferometry Mission

    CERN Document Server

    Turyshev, S G

    2002-01-01

    This paper analyses the relativistic stellar aberration requirements for the Space Interferometry Mission (SIM). We address the issue of general relativistic deflection of light by the massive self-gravitating bodies. Specifically, we present estimates for corresponding deflection angles due to the monopole components of the gravitational fields of a large number of celestial bodies in the solar system. We study the possibility of deriving an additional navigational constraints from the need to correct for the gravitational bending of light that is traversing the solar system. It turns out that positions of the outer planets presently may not have a sufficient accuracy for the precision astrometry. However, SIM may significantly improve those simply as a by-product of its astrometric program. We also consider influence of the higher gravitational multipoles, notably the quadrupole and the octupole ones, on the gravitational bending of light. Thus, one will have to model and account for their influence while o...

  6. 5S 管理在高校化学实验室中的应用%The Applications of 5S Management in the University’s Chemical Laboratory

    Institute of Scientific and Technical Information of China (English)

    聂俊琦

    2014-01-01

    5S管理是一种现代管理方法,包含整理、整顿、清扫、清洁和素养五个方面。在实验室推行5S可提升实验室形象、提高实验效率、减少安全隐患、改善实验室精神面貌等。通风橱和实验台等实验场所,试剂与耗材,办公设备是高校化学实验室的重要组成部分,相应地提出了实施5S的具体措施,以期提高实验人员的职业素养和高校化学实验室的管理水平。%5S management was a modern management methods which contained five areas including Seiri, Seiton, Seiso, Seiketsu and Shitsuke.The implementation of 5S in the laboratory can upgrade laboratory appearance, enhance experimental efficiency, reduce security risks, improve mental outlook and so on.Experimental placed including fume hood and experimental bench, reagents and consumables, office equipment are important parts of university’s chemistry lab.Accordingly, the specific measures of applying 5S were proposed and it was expected to improve professionalism of laboratory personnel and management level of university’s chemical lab.

  7. Longitudinal trajectories of aberrant behavior in fragile X syndrome.

    Science.gov (United States)

    Hustyi, Kristin M; Hall, Scott S; Jo, Booil; Lightbody, Amy A; Reiss, Allan L

    2014-11-01

    The Aberrant Behavior Checklist-Community (ABC-C; Aman et al., 1995) has been increasingly adopted as a primary tool for measuring behavioral change in clinical trials for individuals with fragile X syndrome (FXS). To our knowledge, however, no study has documented the longitudinal trajectory of aberrant behaviors in individuals with FXS using the ABC-C. As part of a larger longitudinal study, we examined scores obtained on the ABC-C subscales for 124 children and adolescents (64 males, 60 females) with FXS who had two or more assessments (average interval between assessments was approximately 4 years). Concomitant changes in age-equivalent scores on the Vineland Adaptive Behavior Scales (VABS) were also examined. As expected for an X-linked genetic disorder, males with FXS obtained significantly higher scores on all subscales of the ABC-C and significantly lower age-equivalent scores on the VABS than females with FXS. In both males and females with FXS, scores on the Irritability/Agitation and Hyperactivity/Noncompliance subscales of the ABC-C decreased significantly with age, with little to no change occurring over time on the Lethargy/Social Withdrawal, Stereotypic Behavior, and Inappropriate Speech subscales. The decrease in scores on the Hyperactivity/Noncompliance domain was significantly greater for males than for females. In both males and females, age-equivalent scores on the VABS increased significantly over this developmental period. These results establish a basis upon which to evaluate long-term outcomes from intervention-based research. However, longitudinal direct observational studies are needed to establish whether the severity of problem behavior actually decreases over time in this population.

  8. Anti-topoisomerase drugs as potent inducers of chromosomal aberrations

    Directory of Open Access Journals (Sweden)

    Loredana Bassi

    2000-12-01

    Full Text Available DNA topoisomerases catalyze topological changes in DNA that are essential for normal cell cycle progression and therefore they are a preferential target for the development of anticancer drugs. Anti-topoisomerase drugs can be divided into two main classes: "cleavable complex" poisons and catalytic inhibitors. The "cleavable complex" poisons are very effective as anticancer drugs but are also potent inducers of chromosome aberrations so they can cause secondary malignancies. Catalytic inhibitors are cytotoxic but they do not induce chromosome aberrations. Knowledge about the mechanism of action of topoisomerase inhibitors is important to determine the best anti-topoisomerase combinations, with a reduced risk of induction of secondary malignancies.As topoisomerases de DNA catalisam alterações topológicas no DNA que são essenciais para a progressão do ciclo celular normal e, portanto, são um alvo preferencial para o desenvolvimento de drogas anticâncer. Drogas anti-topoisomerases podem ser divididas em duas classes principais: drogas anti-"complexos cliváveis" e inibidores catalíticos. As drogas anti-"complexos cliváveis" são muito eficazes como drogas anticancerígenas, mas são também potentes indutores de aberrações cromossômicas, podendo causar neoplasias malignas secundárias. Inibidores catalíticos são citotóxicos mas não induzem aberrações cromossômicas. Conhecimento a respeito do mecanismo de ação de inibidores de topoisomerases é importante para determinar as melhores combinações anti-topoisomerases, com um reduzido risco de indução de neoplasias malignas secundárias.

  9. Aberrant meiotic behavior in Agave tequilana Weber var. azul

    Directory of Open Access Journals (Sweden)

    Rodríguez-Garay Benjamin

    2002-10-01

    Full Text Available Abstract Background Agave tequilana Weber var. azul, is the only one variety permitted by federal law in México to be used for tequila production which is the most popular contemporary alcoholic beverage made from agave and recognized worldwide. Despite the economic, genetic, and ornamental value of the plant, it has not been subjected to detailed cytogenetic research, which could lead to a better understanding of its reproduction for future genetic improvement. The objective of this work was to study the meiotic behavior in pollen mother cells and its implications on the pollen viability in Agave tequilana Weber var. azul. Results The analysis of Pollen Mother Cells in anaphase I (A-I showed 82.56% of cells with a normal anaphase and, 17.44% with an irregular anaphase. In which 5.28% corresponded to cells with side arm bridges (SAB; 3.68% cells with one bridge and one fragment; 2.58% of irregular anaphase showed cells with one or two lagging chromosomes and 2.95% showed one acentric fragment; cells with two bridges and cells with two bridges and one acentric fragment were observed in frequencies of 1.60% and 1.35% respectively. In anaphase II some cells showed bridges and fragments too. Aberrant A-I cells had many shrunken or empty pollen grains (42.00% and 58.00 % viable pollen. Conclusion The observed meiotic irregularities suggest that structural chromosome aberrations have occurred, such as heterozygous inversions, sister chromatid exchanges, deletions and duplications which in turn are reflected in a low pollen viability.

  10. A case of valvular pulmonic stenosis and an aberrant coronary artery in a Brittany spaniel.

    Science.gov (United States)

    Estey, Chelsie

    2011-05-01

    Valvular pulmonic stenosis and aberrancy of the right coronary artery with subsequent subvalvular stenosis was found on echocardiographic evaluation of a 9-month-old Brittany spaniel. Previous echocardiography at 4 mo of age revealed the pulmonic stenosis; however, the aberrant coronary artery only became apparent during the second evaluation.

  11. Prostate cancer, prostate cancer death, and death from other causes, among men with metabolic aberrations.

    OpenAIRE

    Häggström, Christel; Stocks, Tanja; Nagel, Gabriele; Manjer, Jonas; Bjørge, Tone; Hallmans, Göran; Engeland, Anders; Ulmer, Hanno; Lindkvist, Björn; Selmer, Randi; Concin, Hans; Tretli, Steinar; Jonsson, Håkan; Stattin, Pär

    2014-01-01

    Few previous studies of metabolic aberrations and prostate cancer risk have taken into account the fact that men with metabolic aberrations have an increased risk of death from causes other than prostate cancer. The aim of this study was to calculate, in a real-life scenario, the risk of prostate cancer diagnosis, prostate cancer death, and death from other causes.

  12. Eliminating chromatic aberration in Gauss-type lens design using a novel genetic algorithm.

    Science.gov (United States)

    Fang, Yi-Chin; Tsai, Chen-Mu; Macdonald, John; Pai, Yang-Chieh

    2007-05-01

    Two different types of Gauss lens design, which effectively eliminate primary chromatic aberration, are presented using an efficient genetic algorithm (GA). The current GA has to deal with too many targets in optical global optimization so that the performance is not much improved. Generally speaking, achromatic aberrations have a great relationship with variable glass sets for all elements. For optics whose design is roughly convergent, glass sets for optics will play a significant role in axial and lateral color aberration. Therefore better results might be derived from the optimal process of eliminating achromatic aberration, which could be carried out by finding feasible glass sets in advance. As an alternative, we propose a new optimization process by using a GA and involving theories of geometrical optics in order to select the best optical glass combination. Two Gauss-type lens designs are employed in this research. First, a telephoto lens design is sensitive to axial aberration because of its long focal length, and second, a wide-angle Gauss design is complicated by lateral color aberration at the extreme corners because Gauss design is well known not to deal well with wide-angle problems. Without numbers of higher chief rays passing the element, it is difficult to correct lateral color aberration altogether for the Gauss design. The results and conclusions show that the attempts to eliminate primary chromatic aberrations were successful.

  13. Simple Demonstration of the Impact of Spherical Aberration on Optical Imaging

    Science.gov (United States)

    Escobar, Isabel; Saavedra, Genaro; Pons, Amparo; Martinez-Corral, Manuel

    2008-01-01

    We present an experiment, well adapted for students of introductory optics courses, for the visualization of the impact of spherical aberration in the point spread function of imaging systems. The demonstrations are based on the analogy between the point-spread function of spherically aberrated systems, and the defocused patterns of 1D slit-like…

  14. Study on the modification of measured wavefront aberration data for customized visual correction

    Science.gov (United States)

    Liu, Ming; Zhang, Yong; Zhang, Zhidong; Quan, Wei; An, Li

    2008-12-01

    Wavefront aberration of human eye is an important foundation for customized vision correction. In most current aberrometers, near infrared light is used to measure ocular wavefront aberration, whereas for customized visual correction, wavefront aberration data in visible range are required. With the measured wavefront aberration, corneal topography and eye's axial lengths data, individual eye models for twenty normal human eyes are constructed with the optical design software ZEMAX. Changing the incidence light wavelength and the refractive indexes of eye models, the values of defocus, astigmatism, higher-order aberrations in the measuring wavelength (833nm) and at the most sensitive wavelength of human eye (555nm) are obtained. Average focus shift between 833nm and 555nm is found to be about 0.94D, and different slightly for different individuals; the differences of astigmatism and higher-order aberrations between 833nm and 555nm are quite slight. For customized visual correction, the measured defocus value should be modified, whereas the measured astigmatism and higher-order aberrations could be used directly for the current correction precision. Individual eye model is a useful tool for accurate transformation of the measured wavefront aberration data into the data for visible spectrum.

  15. Mechanisms for the induction of gastric cancer by Helicobacter pylori infection: aberrant DNA methylation pathway.

    Science.gov (United States)

    Maeda, Masahiro; Moro, Hiroshi; Ushijima, Toshikazu

    2017-03-01

    Multiple pathogenic mechanisms by which Helicobacter pylori infection induces gastric cancer have been established in the last two decades. In particular, aberrant DNA methylation is induced in multiple driver genes, which inactivates them. Methylation profiles in gastric cancer are associated with specific subtypes, such as microsatellite instability. Recent comprehensive and integrated analyses showed that many cancer-related pathways are more frequently altered by aberrant DNA methylation than by mutations. Aberrant DNA methylation can even be present in noncancerous gastric mucosae, producing an "epigenetic field for cancerization." Mechanistically, H. pylori-induced chronic inflammation, but not H. pylori itself, plays a direct role in the induction of aberrant DNA methylation. The expression of three inflammation-related genes, Il1b, Nos2, and Tnf, is highly associated with the induction of aberrant DNA methylation. Importantly, the degree of accumulated aberrant DNA methylation is strongly correlated with gastric cancer risk. A recent multicenter prospective cohort study demonstrated the utility of epigenetic cancer risk diagnosis for metachronous gastric cancer. Suppression of aberrant DNA methylation by a demethylating agent was shown to inhibit gastric cancer development in an animal model. Induction of aberrant DNA methylation is the major pathway by which H. pylori infection induces gastric cancer, and this can be utilized for translational opportunities.

  16. Relationship between radiation induced dicentric chromosome aberrations and micronucleus formation in human lymphocytes.

    Science.gov (United States)

    Hatayoglu, S E; Orta, T

    2007-06-01

    Chromosome damage measured by the chromosome aberration technique is a reliable method to assess the radiation dose absorbed by cells. However, this technique has some disadvantages. Scoring is difficult and requires skill and experience which of these lead low number of cell counts. The micronucleus (MN) technique which also measures chromosome losses has easy scoring criteria leading high numbers of cell counts and therefore holds more statistical power. In this study, the relationship between the results of the micronucleus technique and those obtained by the chromosome aberration technique was investigated after radiation doses of 1Gy, 2Gy, 3Gy and 4Gy to peripheral blood lymphocytes of 3 healthy individuals. Increases in the chromosome damage after radiation were observed in both techniques. When the dicentric aberration frequencies that were measured in the chromosome aberration technique and the micronucleus frequencies were compared, no difference (p > 0.05) between these two independent measures of radiation damage was reported. The relationship between the micronuclei and the free acentric chromosome aberrations measured in the chromosome aberration technique was not significant as well as that between the dicentrics and micronuclei. On the basis of the relationship between the dicentric aberrations and the micronucleus frequencies, the micronucleus technique with an easy and short-term application and with an easy scoring can be used as an alternative to the chromosome aberration technique.

  17. Aberrant Behaviour of Persons with Developmental Disabilities as a Function of the Characteristics of Training Tasks.

    Science.gov (United States)

    Vause, Tricia; Martin, Garry L.; Yu, Dickie

    1999-01-01

    A study used the Assessment of Basic Learning Abilities to assess the abilities of three adults with mental retardation in order to reduce aberrant behavior. There was a higher frequency of aberrant responses during training sessions with training tasks above or below a participant's assessment level on the test. (Contains references.) (CR)

  18. Considerations for comparing radiation-induced chromosome aberration data with predictions from biophysical models

    Science.gov (United States)

    Wu, H.; Furusawa, Y.; George, K.; Kawata, T.; Cucinotta, F.

    Biophysical models addressing the formation of radiation-induced chromosome aberrations are usually based on the assumption that chromosome aberrations are formed by DNA double strand break (DSB) misrejoining, via either the homologous or the non-homologous repair pathway. However, comparing chromosome aberration data with model predictions is not always straightforward. In this paper we discuss some of the aspects that must be considered to make these comparisons meaningful. Firstly, biophysical models are usually applied to DSB rejoining and misrejoining in the G0/G1 phase of the cell cycle, while most chromosome aberration data reported in the literature are analyzed in metaphase. Since cells must progress through the cell cycle check points in order to reach mitosis, model predictions that differ from the metaphase chromosome analysis may actually agree with the aberration data in chromosomes collected in interphase. Secondly, high- LET radiation generally produces more complex aberrations involving exchanges between three or more DSB. While some models have successfully provided quantitative predictions of high-LET radiation induced complex aberrations in human lymphocytes, applying such models to other cell types requires special considerations due to the lack of geometric symmetry of the nucleus. Chromosome aberration data for non-spherical human fibroblast cells bombarded from various directions by high-LET charged particles will be presented, and their implication on physical modeling will be discussed.

  19. Production of the $X_b$ in $\\Upsilon(5S, 6S)\\to \\gamma X_b$ radiative decays

    CERN Document Server

    Wu, Qi; Shao, Fenglan; Wang, Qianwen; Wang, Ruiqin; Zhang, Yawei; Zheng, Ying

    2016-01-01

    In this work, we investigate the production of $X_b$ in the process $\\Upsilon(5S,6S)\\to \\gamma X_b$, where $X_b$ is assumed to be the counterpart of $X(3872)$ in the bottomonium sector as a $B {\\bar B}^*$ molecular state. We use the effective Lagrangian based on the heavy quark symmetry to explore the rescattering mechanism and calculate their production ratios. Our results have shown that the production ratios for the $\\Upsilon(5S,6S) \\to \\gamma X_b$ are orders of $10^{-5}$ with reasonable cutoff parameter range $\\alpha \\simeq 2\\sim 3$. The sizeable production ratios may be accessible at the future experiments like forthcoming BelleII, which will provide important clues to the inner structures of the exotic state $X_b$.

  20. Chromosomal localization of 45S rDNA, sex-specific C values, and heterochromatin distribution in Coccinia grandis (L.) Voigt.

    Science.gov (United States)

    Bhowmick, Biplab Kumar; Yamamoto, Masashi; Jha, Sumita

    2016-01-01

    Coccinia grandis is a widely distributed dioecious cucurbit in India, with heteromorphic sex chromosomes and X-Y sex determination mode. The present study aids in the cytogenetic characterization of four native populations of this plant employing distribution patterns of 45S rDNA on chromosomes and guanine-cytosine (GC)-rich heterochromatin in the genome coupled with flow cytometric determination of genome sizes. Existence of four nucleolar chromosomes could be confirmed by the presence of four telomeric 45S rDNA signals in both male and female plants. All four 45S rDNA sites are rich in heterochromatin evident from the co-localization of telomeric chromomycin A (CMA)(+ve) signals. The size of 45S rDNA signal was found to differ between the homologues of one nucleolar chromosome pair. The distribution of heterochromatin is found to differ among the male and female populations. The average GC-rich heterochromatin content of male and female populations is 23.27 and 29.86 %, respectively. Moreover, the male plants have a genome size of 0.92 pg/2C while the female plants have a size of 0.73 pg/2C, reflecting a huge genomic divergence between the genders. The great variation in genome size is owing to the presence of Y chromosome in the male populations, playing a multifaceted role in sexual divergence in C. grandis.

  1. The spatial and temporal distribution of microalgae in the South China Sea: evidence from GIS-based analysis of 18S rDNA sequences

    Institute of Scientific and Technical Information of China (English)

    LI LvYan; HUANG QiaoJuan; WU ShuHui; LIN Duan; CHEN JiaHui; CHEN YueQin

    2008-01-01

    The purpose of this study was to estimate the spatial and temporal variation of microalgae in the South China Sea and to demonstrate the environmental factors controlling the diversity of microalgae by GIS (geographic information system)-based analysis of 18S rDNA sequences. Six 18S rDNA libraries were constructed from environmental samples collected at different sites in the study area, and more than 600 18S rDNA sequences were determined. The rDNA sequence data were then analyzed by DIVA-GIS software to display the spatial and temporal variation of phytoplankton's composition. It was shown that the autotrophic eukaryotic plankton dominated over the heterotrophic cells in most of our clone libraries, and the dominating phytoplankton was Dinophyceae except for Bacillariophyta at the Xiamen harbor. The percentages of these two groups were controlled by water temperature and salinity. Our results also revealed that the species composition of Chlorophyta showed a close relationship with latitude, changing from Prasinophyceae at the high latitude to Trebouxiophyceae at the low latitude. Several newly classified picoplankton lineages were first uncovered in the South China Sea, including the pico-sized green alga Ostreococcus sp. and Picochlorum eukaryotum, and picobiliphytes, which was just discovered in 2007 with unknown affinities to other eukaryotes. Their spatial and temporal variation were also analyzed and discussed.

  2. Time spans and spacers : Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    NARCIS (Netherlands)

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be

  3. Phylogenetic analyses of four species of Ulva and Monostroma grevillei using ITS, rbcL and 18S rDNA sequence data

    Institute of Scientific and Technical Information of China (English)

    LIN Zhongheng; SHEN Songdong; CHEN Weizhou; LI Huihui

    2013-01-01

    Chlorophyta species are common in the southern and northern coastal areas of China.In recent years,frequent green tide incidents in Chinese coastal waters have raised concerns and attracted the attention of scientists.In this paper,we sequenced the 18S rDNA genes,the internal transcribed spacer (ITS) regions and the rbcL genes in seven organisms and obtained 536-566 bp long ITS sequences,1 377-1 407 bp long rbcL sequences and 1 718-1 761 bp long partial 18S rDNA sequences.The GC base pair content was highest in the ITS regions and lowest in the rbcL genes.The sequencing results showed that the three Ulvaprolifera (or U.pertusa) gene sequences from Qingdao and Nan'ao Island were identical.The ITS,18S rDNA and rbcL genes in U.prolifera and U.pertusa from different sea areas in China were unchanged by geographic distance.U.flexuosa had the least evolutionary distance from U.californica in both the ITS regions (0.009) and the 18S rDNA (0.002).These data verified that Ulva and Enteromorpha are not separate genera.

  4. Phylogenetic analyses of four species of Ulva and Monostroma grevillei using ITS, rbc L and 18S rDNA sequence data

    Science.gov (United States)

    Lin, Zhongheng; Shen, Songdong; Chen, Weizhou; Li, Huihui

    2013-01-01

    Chlorophyta species are common in the southern and northern coastal areas of China. In recent years, frequent green tide incidents in Chinese coastal waters have raised concerns and attracted the attention of scientists. In this paper, we sequenced the 18S rDNA genes, the internal transcribed spacer (ITS) regions and the rbc L genes in seven organisms and obtained 536-566 bp long ITS sequences, 1 377-1 407 bp long rbc L sequences and 1 718-1 761 bp long partial 18S rDNA sequences. The GC base pair content was highest in the ITS regions and lowest in the rbc L genes. The sequencing results showed that the three Ulva prolifera (or U. pertusa) gene sequences from Qingdao and Nan'ao Island were identical. The ITS, 18S rDNA and rbc L genes in U. prolifera and U. pertusa from different sea areas in China were unchanged by geographic distance. U. flexuosa had the least evolutionary distance from U. californica in both the ITS regions (0.009) and the 18S rDNA (0.002). These data verified that Ulva and Enteromorpha are not separate genera.

  5. ON THE IDENTITY OF KARLODINIUM VENEFICUM AND DESCRIPTION OF KARLODINIUM ARMIGER SP. NOV. (DINOPHYCEAE), BASED ON LIGHT AND ELECTRON MICROSCOPY, NUCLEAR-ENCODED LSU RDNA, AND PIGMENT COMPOSITION

    DEFF Research Database (Denmark)

    Bergholtz, Trine; Daugbjerg, Niels; Moestrup, Øjvind;

    2006-01-01

    An undescribed species of the dinoflagellate genus Karlodinium J. Larsen (viz. K. armiger sp. nov.) is described from Alfacs Bay (Spain), using light and electron microscopy, pigment composition, and partial large subunit (LSU) rDNA sequence. The new species differs from the type species of Karlo...

  6. Random amplified polymorphic DNA and restriction enzyme analysis of PCR amplified rDNA in taxonomy: Two identification techniques for food-borne yeasts

    NARCIS (Netherlands)

    Baleiras Couto, M.M.; Vogels, J.T.W.E.; Hofstra, H.; Veld, J.H.J. Huis in't; Vossen, J.M.B.M. van der

    1995-01-01

    The random amplified polymorphic DNA (RAPD) assay and the restriction enzyme analysis of PCR amplified rDNA are compared for the identification of the common spoilage yeasts Zygosaccharomyces bailii, Z. rouxii, Saccharomyces cerevisiae, Candida valida and C. lipolytica. Both techniques proved to be

  7. Variation in copy number of the 28S rDNA of Aspergillus fumigatus measured by droplet digital PCR and analog quantitative real-time PCR.

    Science.gov (United States)

    Alanio, Alexandre; Sturny-Leclère, Aude; Benabou, Marion; Guigue, Nicolas; Bretagne, Stéphane

    2016-08-01

    Droplet digital PCR (ddPCR) after DNA digestion yielded a 28S rDNA copy number of 61 to 86 copies/genome when testing 10 unrelated Aspergillus fumigatus isolates, higher than with quantitative PCR. Unfortunately, ddPCR after DNA digestion did not improve the sensitivity of our PCR assay when testing serum patients with invasive aspergillosis.

  8. The spatial and temporal distribution of microalgae in the South China Sea:evidence from GIS-based analysis of 18S rDNA sequences

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The purpose of this study was to estimate the spatial and temporal variation of microalgae in the South China Sea and to demonstrate the environmental factors controlling the diversity of microalgae by GIS (geographic information system)-based analysis of 18S rDNA sequences. Six 18S rDNA libraries were constructed from environmental samples collected at different sites in the study area, and more than 600 18S rDNA sequences were determined. The rDNA sequence data were then analyzed by DIVA-GIS software to display the spatial and temporal variation of phytoplankton’s composition. It was shown that the autotrophic eukaryotic plankton dominated over the heterotrophic cells in most of our clone libraries, and the dominating phytoplankton was Dinophyceae except for Bacillariophyta at the Xiamen harbor. The percentages of these two groups were controlled by water temperature and salinity. Our results also revealed that the species composition of Chlorophyta showed a close relationship with latitude, changing from Prasinophyceae at the high latitude to Trebouxiophyceae at the low latitude. Several newly classified picoplankton lineages were first uncovered in the South China Sea, including the pico-sized green alga Ostreococcus sp. and Picochlorum eukaryotum, and picobiliphytes, which was just discovered in 2007 with unknown affinities to other eukaryotes. Their spatial and temporal variation were also analyzed and discussed.

  9. Length polymorphisms for intergenic spacer regions of 16S-23S rDNA in members of the new hydrogen-producing bacteria

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A method based on PCR amplification of the 16S rRNA gene (rDNA) -23S rDNA intergenic spacer regions (ISR) was developed for the identification of species within the novel group hydrogen-producing anaerobes. The sizes of the PCR products varied from 1264 to 398 bp. Strain of isolate Rennanqilyf 3 was characterized as having products of 1262, 398, 638, 437 and 436 bp. The isolate Rennanqilyf 1 had product of 1264 bp. The isolate Rennanqilyf 13 had products of 1261, 579 and 485 bp. Of the 3 species of the novel group hydrogenproducing anaerobes examined, no one was indistinguishable. Two environmental isolates were identified as hydrogen-producing bacteria, which were new species in present taxon. Rennanqilyf 3 could not be associated With any Clostridium sp. Studied. Rennanqilyf 1 could be classified into Clostridium genus. The combination between 16S rDNA equencing and length polymorphisms of IRS in 16S-23S rDNA is a better method for determining species of the hydrogen-producing bacteria.

  10. Quantitative analysis of dinoflagellates and diatoms community via Miseq sequencing of actin gene and v9 region of 18S rDNA

    Science.gov (United States)

    Guo, Liliang; Sui, Zhenghong; Liu, Yuan

    2016-01-01

    Miseq sequencing and data analysis for the actin gene and v9 region of 18S rDNA of 7 simulated samples consisting of different mixture of dinoflagellates and diatoms were carried out. Not all the species were detectable in all the 18S v9 samples, and sequence percent in all the v9 samples were not consistent with the corresponding cell percent which may suggest that 18S rDNA copy number in different cells of these species differed greatly which result in the large deviation of the amplification. And 18S rDNA amplification of the microalgae was prone to be contaminated by fungus. The amplification of actin gene all was from the dinoflagellates because of its targeted degenerate primers. All the actin sequences of dinoflagellates were detected in the act samples except act4, and sequence percentage of the dinoflagellates in the act samples was not completely consistent with the dinoflagellates percentage of cell samples, but with certain amplification deviations. Indexes of alpha diversity of actin gene sequencing may be better reflection of community structure, and beta diversity analysis could cluster the dinoflagellates samples with identical or similar composition together and was distinguishable with blooming simulating samples at the generic level. Hence, actin gene was more proper than rDNA as the molecular marker for the community analysis of the dinoflagellates. PMID:27721499

  11. The structure of a single unit of ribosomal RNA gene (rDNA) including intergenic subrepeats in the Australian bulldog ant Myrmecia croslandi (Hymenoptera: Formicidae).

    Science.gov (United States)

    Ohnishi, Hitoshi; Yamamoto, Masa-Toshi

    2004-02-01

    A complete single unit of a ribosomal RNA gene (rDNA) of M. croslandi was sequenced. The ends of the 18S, 5.8S and 28S rRNA genes were determined by using the sequences of D. melanogaster rDNAs as references. Each of the tandemly repeated rDNA units consists of coding and non-coding regions whose arrangement is the same as that of D. melanogaster rDNA. The intergenic spacer (IGS) contains, as in other species, a region with subrepeats, of which the sequences are different from those previously reported in other insect species. The length of IGSs was estimated to be 7-12 kb by genomic Southern hybridization, showing that an rDNA repeating unit of M. croslandi is 14-19 kb-long. The sequences of the coding regions are highly conserved, whereas IGS and ITS (internal transcribed spacer) sequences are not. We obtained clones with insertions of various sizes of R2 elements, the target sequence of which was found in the 28S rRNA coding region. A short segment in the IGS that follows the 3' end of the 28S rRNA gene was predicted to form a secondary structure with long stems.

  12. Design and evaluation of nematode 18S rDNA primers for PCR and denaturing gradient gel electrophoresis (DGGE) of soil community DNA

    NARCIS (Netherlands)

    Waite, I.S.; O'Donnell, A.G.; Harrison, A.; Davies, J.T.; Colvan, S.R.; Ekschmitt, K.; Dogan, H.; Wolters, V.; Bongers, A.M.T.; Bongers, M.; Bakonyi, G.; Nagy, P.; Papatheodorou, E.M.; Stamou, G.P.; Boström, S.

    2003-01-01

    Consensus nematode 185 ribosomal DNA primers were designed by aligning available 185 sequences and identifying a variable region flanked by highly conserved regions. These primers were then used to amplify nematode 18S rDNA from whole soil community DNA extracted from a range of European grassland t

  13. The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes.

    Science.gov (United States)

    Krol, A; Gallinaro, H; Lazar, E; Jacob, M; Branlant, C

    1981-02-25

    Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently according to the cell type. The set with the highest mobility corresponds to U5 RNA. In both rat brain and HeLa cells, U5 RNA was found to be composed of 4 and 5 different molecules respectively (U5A, U5B1-4) differing by a small number of substitutions or insertions. In hen brain, no U5B was detected but U5A' differing from U5A by the absence of the 3'-terminal adenosine. All the U5 RNAs contain the same set of modified nucleotides. They also have the same secondary structure which consists of two hairpins joined together by a 17 nucleotide long single-stranded region. The 3' half of the molecule has a compact conformation. Together, the results suggest that U5 RNAs are transcribed from a multigene family and that mutated genes may be expressed as far as secondary structure is conserved. The conformation of U5 RNA is likely to be related to its function and it is of interest to mention that several similarities of structure are found between U5 and U1A RNA.

  14. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    Directory of Open Access Journals (Sweden)

    Nezih Akca

    2014-01-01

    Full Text Available Context: Little seems to be known about the sexual dysfunction (SD in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois. The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was

  15. 5S implementation of perception to improve quality culture microenterprises apparel textiles in Northern Cone of Lima

    OpenAIRE

    Tinoco Gómez, Oscar; Universidad Nacional Mayor de San Marcos; Tinoco Ángeles, Félix; Universidad Nacional Mayor de San Marcos; Moscoso Huaira, Elvis; Universidad Nacional Mayor de San Marcos

    2016-01-01

    The research, conducted on a microtextile manufacturing workshop allowed the approach of university life with the reality of micro enterprises in the Northern Cone of Lima. First diagnosis microenterprise is made, both in terms of production process and commercial. A workshop was found whose operations are conducted in a relatively small space, without corresponding data sheets. The implementation of 5S had the active participation of the owner and staff of the micro enterprise, the same that...

  16. Effects of the substrate temperature on the properties of CuIn{sub 5}S{sub 8} thin films

    Energy Technology Data Exchange (ETDEWEB)

    Gannouni, M., E-mail: gm_mounir@yahoo.fr [Laboratoire de Photovoltaique et Materiaux Semi-conducteurs - ENIT BP 37, Le belvedere 1002-Tunis (Tunisia); Kanzari, M. [Laboratoire de Photovoltaique et Materiaux Semi-conducteurs - ENIT BP 37, Le belvedere 1002-Tunis (Tunisia)

    2011-10-01

    Structural, optical and electrical properties of CuIn{sub 5}S{sub 8} thin films grown by thermal evaporation have been studied relating the effects of substrate heating conditions of these properties. The CuIn{sub 5}S{sub 8} thin films were carried out at substrate temperatures in the temperature range 100-300 deg. C. The effects of heated substrate on their physico-chemical properties were investigated using X-ray diffraction (XRD), energy-dispersive X-ray spectroscopy (EDX), optical transmission and hot probe method. X-ray diffraction revealed that the films are strong preferred orientation along the (3 1 1) plane upon substrate temperature 200 deg. C and amorphous for the substrate temperatures below 200 deg. C. No secondary phases are observed for all the films. The composition is greatly affected by heated substrate. From the optical transmission and reflection, an important absorption coefficient exceeds 10{sup 5} cm{sup -1} at 800 nm was found. As increasing the substrate temperature, the optical energy band gap decreases from 1.70 eV for the unheated films to 1.25 eV for the deposited films at 300 deg. C. It was found that CuIn{sub 5}S{sub 8} thin film is an n-type semiconductor at 250 deg. C.

  17. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes

    Directory of Open Access Journals (Sweden)

    Won-Suh Choi

    2016-01-01

    Full Text Available Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH, disc angle (DA, disc slope angle, segmental lordotic angle (SLA, lumbar lordotic angle (LLA, and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS, Oswestry disability index (ODI, and patient satisfaction rate (PSR were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21 at 12 months’ follow-up. The most common cage position was anteromedial (15/21. The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21. Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable.

  18. Transitionality in addiction: A "temporal continuum" hypotheses involving the aberrant motivation, the hedonic dysregulation, and the aberrant learning.

    Science.gov (United States)

    Patrono, Enrico; Gasbarri, Antonella; Tomaz, Carlos; Nishijo, Hisao

    2016-08-01

    Addiction is a chronic compulsion and relapsing disorder. It involves several brain areas and circuits, which encode vary functions such as reward, motivation, and memory. Drug addiction is defined as a "pathological pattern of use of a substance", characterized by the loss of control on drug-taking-related behaviors, the pursuance of those behaviors even in the presence of negative consequences, and a strong motivated activity to assume substances. Three different theories guide experimental research on drug addiction. Each of these theories consider singles features, such as an aberrant motivation, a hedonic dysregulation, and an aberrant habit learning as the main actor to explain the entire process of the addictive behaviors. The major goal of this study is to present a new hypotheses of transitionality from a controlled use to abuse of addictive substances trough the overview of the three different theories, considering all the single features of each single theory together on the same "temporal continuum" from use to abuse of addictive substances. Recently, it has been suggested that common neural systems may be activated by natural and pharmacological stimuli, raising the hypotheses that binge-eating disorders could be considered as addictive behaviors. The second goal of this study is to present evidences in order to highlight a possible psycho-bio-physiological superimposition between drug and "food addiction". Finally, interesting questions are brought up starting from last findings about a theoretical/psycho-bio-physiological superimposition between drug and "food addiction" and their possibly same transitionality along the same "temporal continuum" from use to abuse of addictive substances in order to investigate new therapeutic strategies based on new therapeutic strategies based on the individual moments characterizing the transition from the voluntary intake of substances to the maladaptive addictive behavior.

  19. Incomplete concerted evolution and reproductive isolation at the rDNA locus uncovers nine cryptic species within Anopheles longirostris from Papua New Guinea

    Directory of Open Access Journals (Sweden)

    Cooper Robert D

    2010-12-01

    Full Text Available Abstract Background Nuclear ribosomal DNA (rDNA genes and transcribed spacers are highly utilized as taxonomic markers in metazoans despite the lack of a cohesive understanding of their evolution. Here we follow the evolution of the rDNA second internal transcribed spacer (ITS2 and the mitochondrial DNA cytochrome oxidase I subunit in the malaria mosquito Anopheles longirostris from Papua New Guinea (PNG. This morphospecies inhabits a variety of ecological environments indicating that it may comprise a complex of morphologically indistinguishable species. Using collections from over 70 sites in PNG, the mtDNA was assessed via direct DNA sequencing while the ITS2 was assessed at three levels - crude sequence variation through restriction digest, intragenomic copy variant organisation (homogenisation through heteroduplex analysis and DNA sequencing via cloning. Results Genetic evaluation of over 300 individuals revealed that A. longirostris comprises eight ITS2 PCR-RFLP genotypes and nine ITS2 heteroduplex genotypes showing distinct copy variant organization profiles after PCR amplification. Seven of these nine genotypes were found to be sympatric with other genotypes. Phylogenetic analysis of cloned ITS2 PCR products and mtDNA COI confirmed all nine clades with evidence of reproductive isolation at the rDNA locus. Compensatory base changes in the ITS2 secondary structure or in pseudoknots were absent when closely related species were assessed. Individuals from each ITS2 genotype showed the same copy variant heteroduplex profile suggesting that the rDNA array is fixed within each genotype. Conclusion The centromere-proximal position of the rDNA array in Anopheles mosquitoes has probably reduced interchromosomal recombination leaving intrachromosomal events responsible for the observed pattern of concerted evolution we see in these mosquitoes. The stability of these intragenomic ITS2 copy variants within individuals and interbreeding populations

  20. Introduction of a novel 18S rDNA gene arrangement along with distinct ITS region in the saline water microalga Dunaliella.

    Science.gov (United States)

    Hejazi, Mohammad A; Barzegari, Abolfazl; Gharajeh, Nahid Hosseinzadeh; Hejazi, Mohammad S

    2010-04-08

    Comparison of 18S rDNA gene sequences is a very promising method for identification and classification of living organisms. Molecular identification and discrimination of different Dunaliella species were carried out based on the size of 18S rDNA gene and, number and position of introns in the gene. Three types of 18S rDNA structure have already been reported: the gene with a size of ~1770 bp lacking any intron, with a size of ~2170 bp consisting one intron near 5' terminus, and with a size of ~2570 bp harbouring two introns near 5' and 3' termini. Hereby, we report a new 18S rDNA gene arrangement in terms of intron localization and nucleotide sequence in a Dunaliella isolated from Iranian salt lakes (ABRIINW-M1/2). PCR amplification with genus-specific primers resulted in production of a ~2170 bp DNA band, which is similar to that of D. salina 18S rDNA gene containing only one intron near 5' terminus. Whilst, sequence composition of the gene revealed the lack of any intron near 5' terminus in our isolate. Furthermore, another alteration was observed due to the presence of a 440 bp DNA fragment near 3' terminus. Accordingly, 18S rDNA gene of the isolate is clearly different from those of D. salina and any other Dunaliella species reported so far. Moreover, analysis of ITS region sequence showed the diversity of this region compared to the previously reported species. 18S rDNA and ITS sequences of our isolate were submitted with accesion numbers of EU678868 and EU927373 in NCBI database, respectively. The optimum growth rate of this isolate occured at the salinity level of 1 M NaCl. The maximum carotenoid content under stress condition of intense light (400 mumol photon m-2 s-1), high salinity (4 M NaCl) and deficiency of nitrate and phosphate nutritions reached to 240 ng/cell after 15 days.

  1. Cancer biomarkers defined by autoantibody signatures to aberrant O-glycopeptide epitopes

    DEFF Research Database (Denmark)

    Wandall, Hans H; Blixt, Ola; Tarp, Mads A;

    2010-01-01

    -glycopeptide microarray was developed that detected IgG antibodies to aberrant O-glycopeptide epitopes in patients vaccinated with a keyhole limpet hemocyanin-conjugated truncated MUC1 peptide. We detected cancer-associated IgG autoantibodies in sera from breast, ovarian, and prostate cancer patients against different......Autoantibodies to cancer antigens hold promise as biomarkers for early detection of cancer. Proteins that are aberrantly processed in cancer cells are likely to present autoantibody targets. The extracellular mucin MUC1 is overexpressed and aberrantly glycosylated in many cancers; thus, we...... evaluated whether autoantibodies generated to aberrant O-glycoforms of MUC1 might serve as sensitive diagnostic biomarkers for cancer. Using an antibody-based glycoprofiling ELISA assay, we documented that aberrant truncated glycoforms were not detected in sera of cancer patients. An O...

  2. Vision improvement by correcting higher-order aberrations with customized soft contact lenses in keratoconic eyes

    Science.gov (United States)

    Sabesan, Ramkumar; Jeong, Tae Moon; Carvalho, Luis; Cox, Ian G.; Williams, David R.; Yoon, Geunyoung

    2007-04-01

    Higher-order aberration correction in abnormal eyes can result in significant vision improvement, especially in eyes with abnormal corneas. Customized optics such as phase plates and customized contact lenses are one of the most practical, nonsurgical ways to correct these ocular higher-order aberrations. We demonstrate the feasibility of correcting higher-order aberrations and improving visual performance with customized soft contact lenses in keratoconic eyes while compensating for the static decentration and rotation of the lens. A reduction of higher-order aberrations by a factor of 3 on average was obtained in these eyes. The higher-order aberration correction resulted in an average improvement of 2.1 lines in visual acuity over the conventional correction of defocus and astigmatism alone.

  3. Aspherical surfaces design for extreme ultraviolet lithographic objective with correction of thermal aberration

    Science.gov (United States)

    Liu, Yan; Li, Yanqiu

    2016-09-01

    At present, few projection objectives for extreme ultraviolet (EUV) lithography pay attention to correct thermal aberration in optical design phase, which would lead to poor image quality in a practical working environment. We present an aspherical modification method for helping the EUV lithographic objective additionally correct the thermal aberration. Based on the thermal aberration and deformation predicted by integrated optomechanical analysis, the aspherical surfaces in an objective are modified by an iterative algorithm. The modified aspherical surfaces could correct the thermal aberration and maintain the initial high image quality in a practical working environment. A six-mirror EUV lithographic objective with 0.33-numerical aperture is taken as an example to illustrate the presented method. The results show that the thermal aberration can be corrected effectively, and the image quality of the thermally deformed system is improved to the initial design level, which proves the availability of the method.

  4. Correlation between Post-LASIK Starburst Symptom and Ocular Wavefront Aberrations

    Institute of Scientific and Technical Information of China (English)

    LIU Yong-Ji; MU Guo-Guang; WANG Zhao-Qi; WANG Yan

    2006-01-01

    Monochromatic aberrations in post laser in-situ keratomileusis (LASIK) eyes are measured. The data are categorized into reference group and starburst group according to the visual symptoms. Statistic analysis has been made to find the correJation between the ocular wavefront aberrations and the starburst symptom. The rms aberrations of the 3rd and 4th orders for the starburst group are significantly larger than those for the reference group. The starburst symptom shows a strong correlation with vertical coma, total coma, spherical aberrations. For 3-mm pupil size and 5.8-mm pupil size, the modulation transfer function (MTF) of the starburst group are lower than those of the reference group, but their visual acuities are close. MTF and PSF analyses are made for two groups, and the results are consistent with the statistical analysis, which means the difference between the two groups is mainly due to the third- and fourth-order Zernike aberrations.

  5. 3H-labelling of myo-inositol at L-C1 minimizes aberrant 3H in nucleotides

    DEFF Research Database (Denmark)

    Christensen, Søren; Jensen, Annelie Kolbjørn; Simonsen, L.O.

    2002-01-01

    aberrant K3H-labelling, inositol phosphate signalling, (3H)myo-inositol labelling, myo-inositol metabolism......aberrant K3H-labelling, inositol phosphate signalling, (3H)myo-inositol labelling, myo-inositol metabolism...

  6. Aberrant subvesical bile ducts identified during laparoscopic cholecystectomy: A rare case report and review of the literature

    Directory of Open Access Journals (Sweden)

    Theodoros Mariolis-Sapsakos

    2017-01-01

    Conclusion: Aberrant subvesical bile ducts are associated with a high risk of surgical bile duct injury. Nevertheless, meticulous operative technique combined with surgeons’ perpetual awareness concerning this peculiar anatomical aberration leads to a safe laparoscopic cholecystectomy.

  7. Analysis of nodal aberration properties in off-axis freeform system design.

    Science.gov (United States)

    Shi, Haodong; Jiang, Huilin; Zhang, Xin; Wang, Chao; Liu, Tao

    2016-08-20

    Freeform surfaces have the advantage of balancing off-axis aberration. In this paper, based on the framework of nodal aberration theory (NAT) applied to the coaxial system, the third-order astigmatism and coma wave aberration expressions of an off-axis system with Zernike polynomial surfaces are derived. The relationship between the off-axis and surface shape acting on the nodal distributions is revealed. The nodal aberration properties of the off-axis freeform system are analyzed and validated by using full-field displays (FFDs). It has been demonstrated that adding Zernike terms, up to nine, to the off-axis system modifies the nodal locations, but the field dependence of the third-order aberration does not change. On this basis, an off-axis two-mirror freeform system with 500 mm effective focal length (EFL) and 300 mm entrance pupil diameter (EPD) working in long-wave infrared is designed. The field constant aberrations induced by surface tilting are corrected by selecting specific Zernike terms. The design results show that the nodes of third-order astigmatism and coma move back into the field of view (FOV). The modulation transfer function (MTF) curves are above 0.4 at 20 line pairs per millimeter (lp/mm) which meets the infrared reconnaissance requirement. This work provides essential insight and guidance for aberration correction in off-axis freeform system design.

  8. Aberrant DNA methylation occurs in colon neoplasms arising in the azoxymethane colon cancer model.

    Science.gov (United States)

    Borinstein, Scott C; Conerly, Melissa; Dzieciatkowski, Slavomir; Biswas, Swati; Washington, M Kay; Trobridge, Patty; Henikoff, Steve; Grady, William M

    2010-01-01

    Mouse models of intestinal tumors have advanced our understanding of the role of gene mutations in colorectal malignancy. However, the utility of these systems for studying the role of epigenetic alterations in intestinal neoplasms remains to be defined. Consequently, we assessed the role of aberrant DNA methylation in the azoxymethane (AOM) rodent model of colon cancer. AOM induced tumors display global DNA hypomethylation, which is similar to human colorectal cancer. We next assessed the methylation status of a panel of candidate genes previously shown to be aberrantly methylated in human cancer or in mouse models of malignant neoplasms. This analysis revealed different patterns of DNA methylation that were gene specific. Zik1 and Gja9 demonstrated cancer-specific aberrant DNA methylation, whereas, Cdkn2a/p16, Igfbp3, Mgmt, Id4, and Cxcr4 were methylated in both the AOM tumors and normal colon mucosa. No aberrant methylation of Dapk1 or Mlt1 was detected in the neoplasms, but normal colon mucosa samples displayed methylation of these genes. Finally, p19(Arf), Tslc1, Hltf, and Mlh1 were unmethylated in both the AOM tumors and normal colon mucosa. Thus, aberrant DNA methylation does occur in AOM tumors, although the frequency of aberrantly methylated genes appears to be less common than in human colorectal cancer. Additional studies are necessary to further characterize the patterns of aberrantly methylated genes in AOM tumors.

  9. Breaking the spherical and chromatic aberration barrier in transmission electron microscopy.

    Science.gov (United States)

    Freitag, B; Kujawa, S; Mul, P M; Ringnalda, J; Tiemeijer, P C

    2005-02-01

    Since the invention of transmission electron microscopy (TEM) in 1932 (Z. Physik 78 (1932) 318) engineering improvements have advanced system resolutions to levels that are now limited only by the two fundamental aberrations of electron lenses; spherical and chromatic aberration (Z. Phys. 101 (1936) 593). Since both aberrations scale with the dimensions of the lens, research resolution requirements are pushing the designs to lenses with only a few mm space in the pole-piece gap for the specimen. This is in conflict with the demand for more and more space at the specimen, necessary in order to enable novel techniques in TEM, such as He-cooled cryo electron microscopy, 3D-reconstruction through tomography (Science 302 (2003) 1396) TEM in gaseous environments, or in situ experiments (Nature 427 (2004) 426). All these techniques will only be able to achieve Angstrom resolution when the aberration barriers have been overcome. The spherical aberration barrier has recently been broken by introducing spherical aberration correctors (Nature 392 (1998) 392, 418 (2002) 617), but the correction of the remaining chromatic aberrations have proved to be too difficult for the present state of technology (Optik 57 (1980) 73). Here we present an alternative and successful method to eliminate the chromatic blur, which consists of monochromating the TEM beam (Inst. Phys. Conf. Ser. 161 (1999) 191). We show directly interpretable resolutions well below 1A for the first time, which is significantly better than any TEM operating at 200 KV has reached before.

  10. Study on intra-ocular lens aberration measurement in-air

    Science.gov (United States)

    Wang, Yuanyuan; Chen, Jiaojie; Fen, Haihua; Hu, Chuan; Li, Yiyi

    2010-10-01

    In clinical ophthalmology, the wavefront aberration of human eyes is expressed by Zernike polynomial after cataract surgery and intraocular lens implantation, the human eyes aberration will change. The problem of objective evaluation of wavefront aberration introduced by the Intra-ocular (IOL) in-vivo remains unsolved. This paper introduced the measurement principal of IOL wavefront aberration with expression by Zernike polynominal in air. A Hartmann-Shack wavefront sensor system was constructed to measure the wavefront of IOL and to get the corresponding grid patterns. After a series of computer image processing steps, 7th order with 35 items Zernike coefficients was obtained. The IOL of 20.0D power was measured 5 times by this system to get the spherical aberration about 6.73+/-0.02μm, demonstrating the good repeatability of the system. Ten IOLs with the same 20.0D power but difference in surface curvature were chosen for measurement. The spherical aberration observed were in the range of 2.74μm-11.26μm. These results are valuable for the optical design of IOLs and the aberration analysis of human eyes post-operation.

  11. Micronuclei versus Chromosomal Aberrations Induced by X-Ray in Radiosensitive Mammalian Cells.

    Directory of Open Access Journals (Sweden)

    Cristina Plamadeala

    2015-03-01

    Full Text Available An experimental study was accomplished to compare estimation methods of ionizing radiations genotoxicity in mammalian cell cultures by means of two cytogenetic parameters with focus on aberrant cells characterized by multiple chromosomal damages.In vitro study was carried out on the genotoxicity of low-medium doses of 190 kV X-rays absorbed in Chinese hamster ovary cell cultures. Micronuclei and ten types of chromosomal aberrations were identified with Giemsa dying and optical microscope screening.The first parameter consisting in micronuclei relative frequency has led to higher linear correlation coefficient than the second one consistent with chromosomal aberrations relative frequency. However, the latter parameter estimated as the sum of all chromosomal aberrations appeared to be more sensitive to radiation dose increasing in the studied dose range, from 0 to 3 Gy. The number of micronuclei occurring simultaneously in a single cell was not higher than 3, while the number of chromosomal aberrations observed in the same cell reached the value of 5 for doses over 1 Gy.Polynomial dose-response curves were evidenced for cells with Ni micronuclei (i=1,3 while non-monotonic curves were evidenced through detailed analysis of aberrant cells with Ni chromosomal changes [Formula: see text] - in concordance with in vitro studies from literature. The investigation could be important for public health issues where micronucleus screening is routinely applied but also for research purposes where various chromosomal aberrations could be of particular interest.

  12. Heterogeneity of aberrant immunoglobulin expression in cancer cells

    Institute of Scientific and Technical Information of China (English)

    Duosha Hu; Ya Cao; Zhi Duan; Ming Li; Yiqun Jiang; Haidan Liu; Hui Zheng; Lili Li; Ann M Bode; Zigang Dong

    2011-01-01

    Accumulating evidence has shown that immunoglobulin (Ig) is 'unexpectedly' expressed by epithelial cancer cells and that it can promote tumor growth.The main purpose of this study was to explore the components of the cancerous Ig and its possible function.The presence of cancerous Ig in the Golgi apparatus was confirmed by immunofluorescence,indirectly suggesting that the cancerous Ig was processed and packaged in cancer cells.Western blot analysis and ELISA results indicated that cancer cells produced membrane Ig and secreted Ig into the supernatant fraction.The cancerous Ig consists of an α heavy chain and a κ light chain.Finally,by analyzing the Ig components pulled down by protein A beads,the cancerous Ig was found to be structurally distinct from normal Ig.The cancerous Ig was truncated or aberrant.Although the underlying mechanism that causes the abnormalities has not been determined,our current discoveries strengthen our previous findings and promise fruitful future explorations.

  13. Aberrant repair and fibrosis development in skeletal muscle

    Directory of Open Access Journals (Sweden)

    Mann Christopher J

    2011-05-01

    Full Text Available Abstract The repair process of damaged tissue involves the coordinated activities of several cell types in response to local and systemic signals. Following acute tissue injury, infiltrating inflammatory cells and resident stem cells orchestrate their activities to restore tissue homeostasis. However, during chronic tissue damage, such as in muscular dystrophies, the inflammatory-cell infiltration and fibroblast activation persists, while the reparative capacity of stem cells (satellite cells is attenuated. Abnormal dystrophic muscle repair and its end stage, fibrosis, represent the final common pathway of virtually all chronic neurodegenerative muscular diseases. As our understanding of the pathogenesis of muscle fibrosis has progressed, it has become evident that the muscle provides a useful model for the regulation of tissue repair by the local microenvironment, showing interplay among muscle-specific stem cells, inflammatory cells, fibroblasts and extracellular matrix components of the mammalian wound-healing response. This article reviews the emerging findings of the mechanisms that underlie normal versus aberrant muscle-tissue repair.

  14. SiRNA and epigenetic aberrations in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Hamed Mirzaei

    2016-01-01

    Full Text Available Ovarian cancer has the most noteworthy lethal rate around gynecologic malignancies, and it is also considered as the fourth most frequent cancer in the woman in world. Two most critical barriers to treatment of ovarian malignancy are absence of early diagnostic markers and advancement of drug resistance after therapy, especially in advanced stages. Various epigenetic changes have been recognized in ovarian cancer. Recent progresses in our understanding of molecular pathogenesis of ovarian malignancy have dramatically provided potential new targets for molecularly targeted therapies. In very recent years, small interfering RNA (siRNA-mediated gene silencing has been emerging as a novel treatment modality in preclinical studies in the light of its strong gene-specific silencing. Gene suppression mediated by RNA interference (RNAi significantly suppressed gene expression at the messenger RNA (mRNA and protein levels. SiRNAs have therapeutic potential for ovarian cancer through various mechanisms. In this review, we not only provide an overview of siRNA designing for epigenetic silencing of genes aberrantly expressed in ovarian cancer but also we will highlight that the epigenetically silenced genes offer new targets for therapeutic approaches based on re-expression of tumor suppressor genes via demethylating and deacetylating drugs.

  15. Astrocyte Hypertrophy Contributes to Aberrant Neurogenesis after Traumatic Brain Injury

    Directory of Open Access Journals (Sweden)

    Clark Robinson

    2016-01-01

    Full Text Available Traumatic brain injury (TBI is a widespread epidemic with severe cognitive, affective, and behavioral consequences. TBIs typically result in a relatively rapid inflammatory and neuroinflammatory response. A major component of the neuroinflammatory response is astrocytes, a type of glial cell in the brain. Astrocytes are important in maintaining the integrity of neuronal functioning, and it is possible that astrocyte hypertrophy after TBIs might contribute to pathogenesis. The hippocampus is a unique brain region, because neurogenesis persists in adults. Accumulating evidence supports the functional importance of these newborn neurons and their associated astrocytes. Alterations to either of these cell types can influence neuronal functioning. To determine if hypertrophied astrocytes might negatively influence immature neurons in the dentate gyrus, astrocyte and newborn neurons were analyzed at 30 days following a TBI in mice. The results demonstrate a loss of radial glial-like processes extending through the granule cell layer after TBI, as well as ectopic growth and migration of immature dentate neurons. The results further show newborn neurons in close association with hypertrophied astrocytes, suggesting a role for the astrocytes in aberrant neurogenesis. Future studies are needed to determine the functional significance of these alterations to the astrocyte/immature neurons after TBI.

  16. Refractive and diffractive neutron optics with reduced chromatic aberration

    Energy Technology Data Exchange (ETDEWEB)

    Poulsen, S.O., E-mail: stefan.poulsen@northwestern.edu [NEXMAP, Department of Physics, Technical University of Denmark, Anker Engelunds Vej 1, 2800 Kgs. Lyngby (Denmark); Department of Materials Science and Engineering, Northwestern University, Evanston, IL 60208 (United States); Poulsen, H.F. [NEXMAP, Department of Physics, Technical University of Denmark, Anker Engelunds Vej 1, 2800 Kgs. Lyngby (Denmark); Bentley, P.M. [European Spallation Source ESS AB, Box 176, 221 00 Lund (Sweden)

    2014-12-11

    Thermal neutron beams are an indispensable tool in physics research. The spatial and the temporal resolution attainable in experiments are dependent on the flux and collimation of the neutron beam which remain relatively poor, even for modern neutron sources. These difficulties may be mitigated by the use of optics for focusing and imaging. Refractive and diffractive optical elements, e.g. compound refractive lenses and Fresnel zone plates, are attractive due to their low cost, and simple alignment. These optical elements, however, suffer from chromatic aberration, which limit their effectiveness to highly monochromatic beams. This paper presents two novel concepts for focusing and imaging non-monochromatic thermal neutron beams with well-known optical elements: (1) a fast mechanical transfocator based on a compound refractive lens, which actively varies the number of individual lenses in the beam path to focus and image a time-of-flight beam, and (2) a passive optical element consisting of a compound refractive lens, and a Fresnel zone plate, which may focus and image both continuous and pulsed neutron beams.

  17. Perceived no reference image quality measurement for chromatic aberration

    Science.gov (United States)

    Lamb, Anupama B.; Khambete, Madhuri

    2016-03-01

    Today there is need for no reference (NR) objective perceived image quality measurement techniques as conducting subjective experiments and making reference image available is a very difficult task. Very few NR perceived image quality measurement algorithms are available for color distortions like chromatic aberration (CA), color quantization with dither, and color saturation. We proposed NR image quality assessment (NR-IQA) algorithms for images distorted with CA. CA is mostly observed in images taken with digital cameras, having higher sensor resolution with inexpensive lenses. We compared our metric performance with two state-of-the-art NR blur techniques, one full reference IQA technique and three general-purpose NR-IQA techniques, although they are not tailored for CA. We used a CA dataset in the TID-2013 color image database to evaluate performance. Proposed algorithms give comparable performance with state-of-the-art techniques in terms of performance parameters and outperform them in terms of monotonicity and computational complexity. We have also discovered that the proposed CA algorithm best predicts perceived image quality of images distorted with realistic CA.

  18. Profiles of aberrant white matter microstructure in fragile X syndrome.

    Science.gov (United States)

    Hall, Scott S; Dougherty, Robert F; Reiss, Allan L

    2016-01-01

    Previous studies attempting to quantify white matter (WM) microstructure in individuals with fragile X syndrome (FXS) have produced inconsistent findings, most likely due to the various control groups employed, differing analysis methods, and failure to examine for potential motion artifact. In addition, analyses have heretofore lacked sufficient specificity to provide regional information. In this study, we used Automated Fiber-tract Quantification (AFQ) to identify specific regions of aberrant WM microstructure along WM tracts in patients with FXS that differed from controls who were matched on age, IQ and degree of autistic symptoms. Participants were 20 patients with FXS, aged 10 to 23 years, and 20 matched controls. Using Automated Fiber-tract Quantification (AFQ), we created Tract Profiles of fractional anisotropy and mean diffusivity along 18 major WM fascicles. We found that fractional anisotropy was significantly increased in the left and right inferior longitudinal fasciculus (ILF), right uncinate fasciculus, and left cingulum hippocampus in individuals with FXS compared to controls. Conversely, mean diffusivity was significantly decreased in the right ILF in patients with FXS compared to controls. Age was significantly negatively associated with MD values across both groups in 11 tracts. Taken together, these findings indicate that FXS results in abnormal WM microstructure in specific regions of the ILF and uncinate fasciculus, most likely caused by inefficient synaptic pruning as a result of decreased or absent Fragile X Mental Retardation Protein (FMRP). Longitudinal studies are needed to confirm these findings.

  19. Profiles of aberrant white matter microstructure in fragile X syndrome

    Directory of Open Access Journals (Sweden)

    Scott S. Hall

    2016-01-01

    Full Text Available Previous studies attempting to quantify white matter (WM microstructure in individuals with fragile X syndrome (FXS have produced inconsistent findings, most likely due to the various control groups employed, differing analysis methods, and failure to examine for potential motion artifact. In addition, analyses have heretofore lacked sufficient specificity to provide regional information. In this study, we used Automated Fiber-tract Quantification (AFQ to identify specific regions of aberrant WM microstructure along WM tracts in patients with FXS that differed from controls who were matched on age, IQ and degree of autistic symptoms. Participants were 20 patients with FXS, aged 10 to 23 years, and 20 matched controls. Using Automated Fiber-tract Quantification (AFQ, we created Tract Profiles of fractional anisotropy and mean diffusivity along 18 major WM fascicles. We found that fractional anisotropy was significantly increased in the left and right inferior longitudinal fasciculus (ILF, right uncinate fasciculus, and left cingulum hippocampus in individuals with FXS compared to controls. Conversely, mean diffusivity was significantly decreased in the right ILF in patients with FXS compared to controls. Age was significantly negatively associated with MD values across both groups in 11 tracts. Taken together, these findings indicate that FXS results in abnormal WM microstructure in specific regions of the ILF and uncinate fasciculus, most likely caused by inefficient synaptic pruning as a result of decreased or absent Fragile X Mental Retardation Protein (FMRP. Longitudinal studies are needed to confirm these findings.

  20. Aberrant crypt foci as microscopic precursors of colorectal cancer

    Institute of Scientific and Technical Information of China (English)

    Lei Cheng; Mao-De Lai

    2003-01-01

    Since the first detection of aberrant crypt foci (ACF) in carcinogen-treated mice, there have been numerous studies focusing on these microscopically visible lesions both in rodents and in humans. ACF have been generally accepted as precancerous lesions in regard to histopathological characteristics, biochemical and immunohistochemical alterations, and genetic and epigenetic alterations. ACF show variable histological features, ranging from hyperplasia to dysplasia. ACF in human colon are more frequently located in the distal parts than in the proximal parts, which is in accordance with those in colorectal cancer (CRC). The immunohistochemical expressions of carcinoembryonic antigen (CEA), β-catenin, placental cadherin (P-cadherin),epithelial cadherin (E-cadherin), inducible nitric oxide synthase (iNOS), cyclooxygenase (COX-2), and P16INK4a are found to be altered. Genetic mutations of K-ras, APC and p53, and the epigenetic alterations of CpG island methylation of ACF have also been demonstrated. Genomic instabilities due to the defect of mismatch repair (MMR) system are detectable in ACF Two hypotheses have been proposed.One is the "dysplasia ACF-adenoma-carcinoma sequence",the other is "heteroplastic ACF-adenoma-carcinoma sequence". The malignant potential of ACF, especially dyspiastic ACF, makes it necessary to reveal the nature of these lesions, and to prevent CRC from the earliest possible stage. The technique of magnifying chromoscope makes it possible to detect "in vivo' ACF, which is beneficial to colon cancer research, identifying high-risk populations for CRC,and developing preventive procedures.