
Sample records for aberrant 5s rdna

  1. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization. (United States)

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti


    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  2. Interplay of RNA Pol IV and ROS1 during post-embryonic 5S rDNA chromatin remodeling. (United States)

    Douet, Julien; Blanchard, Bertrand; Cuvillier, Claudine; Tourmente, Sylvette


    We have investigated the chromatin structure of 5S rDNA, a heterochromatic pericentromeric tandemly repeated family, at 2, 3, 4 and 5 days post-germination. Our results revealed a large-scale reorganization of 5S rDNA chromatin that occurs during the first days of development. Unexpectedly, there is a decondensation followed by a 're'condensation of 5S rDNA chromatin, to obtain almost mature nuclei 5 d post-germination. The reorganization of 5S rDNA chromatin is accompanied by a rapid and active demethylation of 5S rDNA mediated by the ROS1 (repressor of silencing 1) demethylase, whereas the plant-specific RNA polymerase IV (Pol IV) is essential to the 5S chromatin 're'condensation. In conclusion, Pol IV and ROS1 collaborate to unlock the 5S rDNA chromatin inherited from the seed, and establish adult features. PMID:18845569

  3. Nucleotide sequence, genomic organization and chromosome localization of 5S rDNA in two species of Curimatidae (Teleostei, Characiformes

    Directory of Open Access Journals (Sweden)

    Lessandra Viviane de Rosa Santos


    Full Text Available The 5S ribosomal DNA (5S rDNA of higher eukaryotes is organized in repeat units of tandem arrays composed of a 5S rDNA coding region, conserved even among non-related taxa, and a variable non-transcribed spacer sequence (NTS. To contribute to knowledge on the organization and evolution of vertebrate 5S rDNA we used PCR, nucleotide sequencing, Southern blot hybridization and chromosome fluorescence in situ hybridization (FISH to investigate 5S rDNA tandem repeats in the South American Curimatidae fish Steindachnerina insculpta and Cyphocharax modesta. 5S rDNA repeats of 180 base pairs (bp from both species were PCR-generated and sequenced evidencing the shortest 5S rDNA monomer so far described in eukaryote species. Southern blotting revealed that both species contained two tandem 5S rDNA classes, the PCR amplified fragment composed of 180 bp monomers and a class of 1600 bp monomers not detected by PCR. Chromosome mapping of the 5S rDNA repeats identified a major locus in both species and a second minor locus only in C. modesta. The Southern blot and chromosome mapping data indicate the presence of different types of 5S rDNA tandem repeats in the Curimatidae genome.

  4. Analysis of 5S rDNA Arrays in Arabidopsis thaliana: Physical Mapping and Chromosome-Specific Polymorphisms


    Cloix, C.; Tutois, S; O. Mathieu; Cuvillier, C.; Espagnol, M C; G. Picard; Tourmente, S


    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning ∼1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units ex...

  5. Molecular organization of the 5S rDNA gene type II in elasmobranchs. (United States)

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian


    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  6. Chromosomal localization of rDNA genes and genomic organization of 5S rDNA in Oreochromis mossambicus, O. urolepis hornorum and their hybrid

    Indian Academy of Sciences (India)

    Hua Ping Zhu; Mai Xin Lu; Feng Ying Gao; Zhang Han Huang; Li Ping Yang; Jain Fang Gui


    In this study, classical and molecular cytogenetic analyses were performed in tilapia fishes, Oreochromis mossambicus (XX/XY sex determination system), O. urolepis hornorum (WZ/ZZ sex determination system) and their hybrid by crossing O. mossambicus female × O. u. hornorum male. An identical karyotype (($2n = 44$, NF (total number of chromosomal arms) = 50) was obtained from three examined tilapia samples. Genomic organization analysis of 5S rDNA revealed two different types of 5S rDNA sequences, 5S type I and 5S type II. Moreover, fluorescence in situ hybridization (FISH) with 5S rDNA probes showed six positive fluorescence signals on six chromosomes of all the analysed metaphases from the three tilapia samples. Subsequently, 45S rDNA probes were also prepared, and six positive fluorescence signals were observed on three chromosome pairs in all analysed metaphases of the three tilapia samples. The correlation between 45 rDNA localization and nucleolar organizer regions (NORs) was confirmed by silver nitrate staining in tilapia fishes. Further, different chromosomal localizations of 5S rDNA and 45S rDNA were verified by two different colour FISH probes. Briefly, the current data provide an insights for hybridization projects and breeding improvement of tilapias.

  7. Structure of 5S rDNA sequence of the gibel carp (Carassius gibelio with 2n=100 chromosomes

    Directory of Open Access Journals (Sweden)

    Lech Kirtiklis


    Our preliminary research has related to diploid individuals of gibel carp (Carassius gibelio with 2n=100 chromosomes. The PCR reaction has resulted in product 340 bp. Sequencing has yielded data on the exact nucleotide sequence and length of 5S rDNA fragment. Studies have shown no difference in length and nucleotide composition of the 5S sequence between males and females. Some study has revealed the influence of polyploidy on the organization and evolution of the 5S rDNA in teleosts fishes, therefore, then we will have studied the 5S rDNA sequences in triploid individuals.

  8. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms. (United States)

    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S


    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  9. Molecular dissection of the rDNA array and of the 5S rDNA gene in Meloidogyne artiellia: phylogenetic and diagnostic implications. (United States)

    Veronico, Pasqua; De Luca, Francesca; De Giorgi, Carla


    The sequence of a 13.423 nucleotide genomic fragment has been determined for the plant parasitic nematode Meloidogyne artiellia. It contains an entire rDNA cluster, the bordering intergenic regions and portions of the flanking coding regions. The sequence analysis of the rDNA repeats suggests homogeneity in M. artiellia, thus providing a further indication of the usefulness of these genes for the diagnostic identification of this species. The comparison of the secondary structures of the internal transcribed spacer 2 region in several Meloidogyne species indicates that RNA folding predictions can be used as a tool of potential diagnostic relevance. The other ribosomal gene, 5S rDNA, has been demonstrated to be functional and located near the trans-spliced leader sequences, in the same arrangement found in the distantly related nematode Caenorhabditis elegans but never in other Meloidogyne thus providing species-specific markers for the identification of several Thylenchida parasitic nematodes. PMID:15135452

  10. Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder. (United States)

    Teschler, Stefanie; Gotthardt, Julia; Dammann, Gerhard; Dammann, Reinhard H


    Borderline personality disorder (BPD) is a serious psychic disease with a high risk for suicide. DNA methylation is a hallmark for aberrant epigenetic regulation and could be involved in the etiology of BPD. Previously, it has been reported that increased DNA methylation of neuropsychiatric genes is found in the blood of patients with BPD compared to healthy controls. Here, we analyzed DNA methylation patterns of the ribosomal RNA gene (rDNA promoter region and 5'-external transcribed spacer/5'ETS) and the promoter of the proline rich membrane anchor 1 gene (PRIMA1) in peripheral blood samples of 24 female patients (mean age (33 ± 11) years) diagnosed with DSM-IV BPD and in 11 female controls (mean age (32 ± 7) years). A significant aberrant methylation of rDNA and PRIMA1 was revealed for BPD patients using pyrosequencing. For the promoter of PRIMA1, the average methylation of six CpG sites was 1.6-fold higher in BPD patients compared to controls. In contrast, the methylation levels of the rDNA promoter region and the 5'ETS were significantly lower (0.9-fold) in patients with BPD compared to controls. Thus, for nine CpGs located in the rDNA promoter region and for four CpGs at the 5'ETS decreased methylation was found in peripheral blood of patients compared to controls. Our results suggest that aberrant methylation of rDNA and PRIMA1 is associated with the pathogenesis of BPD. PMID:26742039

  11. Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder

    Directory of Open Access Journals (Sweden)

    Stefanie Teschler


    Full Text Available Borderline personality disorder (BPD is a serious psychic disease with a high risk for suicide. DNA methylation is a hallmark for aberrant epigenetic regulation and could be involved in the etiology of BPD. Previously, it has been reported that increased DNA methylation of neuropsychiatric genes is found in the blood of patients with BPD compared to healthy controls. Here, we analyzed DNA methylation patterns of the ribosomal RNA gene (rDNA promoter region and 5′-external transcribed spacer/5′ETS and the promoter of the proline rich membrane anchor 1 gene (PRIMA1 in peripheral blood samples of 24 female patients (mean age (33 ± 11 years diagnosed with DSM-IV BPD and in 11 female controls (mean age (32 ± 7 years. A significant aberrant methylation of rDNA and PRIMA1 was revealed for BPD patients using pyrosequencing. For the promoter of PRIMA1, the average methylation of six CpG sites was 1.6-fold higher in BPD patients compared to controls. In contrast, the methylation levels of the rDNA promoter region and the 5′ETS were significantly lower (0.9-fold in patients with BPD compared to controls. Thus, for nine CpGs located in the rDNA promoter region and for four CpGs at the 5′ETS decreased methylation was found in peripheral blood of patients compared to controls. Our results suggest that aberrant methylation of rDNA and PRIMA1 is associated with the pathogenesis of BPD.

  12. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae). (United States)

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro


    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  13. Phylogenetic analysis of encapsulated and non-encapsulated Trichinella species by studying the 5S rDNA tandemly repeated intergenic region. (United States)

    van der Giessen, J W B; Fonville, M; Briels, I; Pozio, E


    The identification of sequence regions in the genomes of pathogens which can be useful to distinguish among species and genotypes, is of great importance for epidemiological, molecular, and phylogenetic studies. The 5S ribosomal DNA intergenic spacer region has been identified as a good target to distinguish among eight Trichinella species and genotypes. The recent discovery of two non-encapsulated species in this genus, Trichinella papuae and Trichinella zimbabwensis, which can infect both mammals and reptiles, has suggested analyzing their 5S rDNA. Amplification of the tandem repeats of the 5S rDNA intergenic region of encapsulated species of Trichinella shows a 751bp fragment, whereas the three non-encapsulated species show a fragment of 800bp with T. pseudospiralis showing an additional fragment of 522bp. Although the size of the 800bp PCR fragments of T. papuae and T. zimbabwensis are similar to that of T. pseudospiralis, there are differences in the 5S rDNA intergenic regions among the three non-encapsulated species. Phylogenetic analysis of the 5S rDNA intergenic regions shows a clustering together of the three non-encapsulated Trichinella species that is well separated from the encapsulated ones. In addition, a single PCR-based method allows distinguishing non-encapsulated and encapsulated species. PMID:16076532

  14. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae). (United States)

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M


    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  15. Molecular confirmation of the genomic constitution of Douglasdeweya (Triticeae: Poaceae): demonstration of the utility of the 5S rDNA sequence as a tool for haplome identification. (United States)

    Baum, Bernard R; Johnson, Douglas A


    A new genus Douglasdeweya containing the two species, Douglasdeweya deweyi and D. wangii was published in 2005 by Yen et al. based upon the results of cytogenetical and morphological findings. The genome constitution of Douglasdeweya-PPStSt-allowed its segregation from the genus Pseudoroegneria which contains the StSt or StStStSt genomes. Our previous work had demonstrated the utility of using 5S rDNA units, especially the non-transcribed spacer sequence variation, for the resolution of genomes (haplomes) previously established by cytology. Here, we show that sequence analysis of the 5S DNA units from these species strongly supports the proposed species relationships of Yen et al. (Can J Bot 83:413-419, 2005), i.e., the PP genome from Agropyron and the StSt genome from Pseudoroegneria. Analysis of the 5S rDNA units constitutes a powerful tool for genomic research especially in the Triticeae. PMID:18421479

  16. Comparative Analysis of Sequences of the 5S rDNA NTS in 7 Wheat Species from Xinjiang of China%新疆7个小麦种5S rDNA及其NTS序列分析

    Institute of Scientific and Technical Information of China (English)

    米日古丽·马木提; 玉山江·麦麦提; 托乎提·艾买提; 李继洋; 何丹; 赵奇


    本研究参照GeneBank中禾本科植物大麦5S rDNA序列,利用PCR技术扩增获得新疆7个小麦种5S rDNA部分序列,进一步与禾本科植物大麦5S rRNA序列比对,得到了5S rDNA结构和NTS边界范围。序列分析发现,不同类型小麦5S rDNA序列保守程度不同,其中大片段保守性较高,小片段相对较低,7个小麦种5S rDNA序列均存在不同程度的插入和缺失序列,同种不同类型和不同种5S rDNA非转录间隔区(NTS)长度和存在位置均呈现不同程度差异。利用MEGA4.0软件,采用邻接法(NJ)和最大简约法(MP)构建分子进化树并计算种间遗传距离。以7个小麦种进化关系的分析结果为依据,利用5S rDNA两种类型片段建立了两种不同的亲缘关系分类依据,旨在为新疆7个小麦种亲缘关系分析提供一定理论依据,以期为后期种间同源关系分析,建立序列集合,推导系统进化与发育关系,重建发育史和遗传育种奠定一定理论依据。%Referring GeneBank in barley grasses 5S rDNA sequences, partial 5S rDNA sequences from several accessions of 7 wheat species from Xinjiang were obtained by polymerase chain reaction, the 5S rDNA structure and NTS boundaries were obtained by further alignments with barley grasses 5S rRNA sequence. Sequence analysis revealed that the degree of the nontranscribed spacer of the different unit classes was different. The nontranscribed spacer of long repeat classes was less variable than that of short repeat classes. Different degrees of insertion and deletion in 5S rDNA sequences of 7 wheat species from Xinjiang was presented and the different degree of difference was presented in 5S rDNA non-transcribed spacer (NTS) length and position exists in different repeats of one species and different species. Molecular phylogenetic tree was constructed and genetic distance between species was calculated by using the MEGA4.0 software, the neighbor-joining method (NJ) and

  17. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)]. (United States)

    Cruz, V P; Oliveira, C; Foresti, F


    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion. PMID:26107907

  18. Population distribution of 45S and 5S rDNA in golden mahseer, Tor putitora: population-specific FISH marker

    Indian Academy of Sciences (India)

    Mamta Singh; Ravindra Kumar; N. S. Nagpure; Basdeo Kushwaha; Indra Mani; U. K. Chauhan; W. S. Lakra


    Chromosomal locations of major 45S and minor 5S ribosomal DNAs (rDNAs) and organization of 5S rRNA genes were analysed in five different populations of golden mahseers (Tor putitora) using fluorescence in situ hybridization (FISH) and Southern blot hybridization. All five populations of T. putitora ($2n = 100$) showed a similar type of macro-karyotype composed of 12 metacentric, 22 submetacentric, 14 subtelocentric and 52 telocentric chromosomes. Analysis of active nucleolar organizer regions (NORs) by silver staining did not show any differences in number and chromosomal position in different populations. But FISH data showed significant difference between the populations, four of the five populations showed six 18S (three pairs) and two 5S (one pair) signals with positional polymorphism, while one population showed eight 18S and four 5S signals, respectively. Southern blot data confirms that 5S rDNA clusters present on two different chromosome pairs in Kosi river population contain non-transcribed spacers (NTS) of same length. In the present study, simultaneous localization of 45S and 5S rDNA by in situ hybridization helped us to develop the discrete population-specific markers in different geographically isolated populations of T. putitora.

  19. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA in the Asteraceae family

    Directory of Open Access Journals (Sweden)

    Garcia Sònia


    Full Text Available Abstract Background In flowering plants and animals the most common ribosomal RNA genes (rDNA organisation is that in which 35S (encoding 18S-5.8S-26S rRNA and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae, a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing, gene copy number (quantitative PCR and chromosomal position (FISH of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases, tribe Gnaphalieae (100% and in the "Heliantheae alliance" (23%. The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic

  20. 砂梨45 S rDNA和5 S rDNA的染色体定位研究%Physical Mapping of the 45 S rDNA and 5 S rDNA to Pear Metaphase Chromosome

    Institute of Scientific and Technical Information of China (English)

    杨光绪; 刁英


    45 S rDNA和5 S rDNA是砂梨中与核糖体RNA合成有关的2个功能片段.通过双色FISH(fluorescence in situ hybridization)确定了45 S rDNA序列和5 S rDNA在砂梨中期染色体上的分布,其中45 S rDNA位于砂梨的第4号,第11号和第15号染色体的短臂末端.5 S rDNA序列位于第12号染色体上着丝粒附近,而在第6和第13号染色体上则分布在长臂上.

  1. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA. (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio


    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. PMID:26789074

  2. Localization of ribosomal genes in three Pimelodus species (Siluriformes, Pimelodidae of the São Francisco River: 5S genes as species markers and conservation of the 18S rDNA sites

    Directory of Open Access Journals (Sweden)

    Caroline Garcia


    Full Text Available Pimelodidae is one of the most representative of Neotropical catfish families. However, these fish are still poorly studied in terms of cytogenetics, especially regarding the application of more accurate techniques such as the chromosomal localization of ribosomal genes. In the present work, fluorescent in situ hybridization with 5S and 18S rDNA probes was employed for rDNA site mapping in Pimelodus sp., P. fur and P. maculatus from the São Francisco River in the Três Marias municipality - MG. The results from the application of the 18S probe confirmed the previous data obtained by silver nitrate staining, identifying a simple nucleolar organizing region system for these species. However, the labeling results from the 5S rDNA probe demonstrated a difference in the number and localization of these sites between the analyzed species. The obtained data allowed inferences on the possible processes involved in the karyotypic evolution of this genus.

  3. Localization of ribosomal genes in three Pimelodus species (Siluriformes, Pimelodidae) of the São Francisco River: 5S genes as species markers and conservation of the 18S rDNA sites


    Caroline Garcia; Orlando Moreira Filho


    Pimelodidae is one of the most representative of Neotropical catfish families. However, these fish are still poorly studied in terms of cytogenetics, especially regarding the application of more accurate techniques such as the chromosomal localization of ribosomal genes. In the present work, fluorescent in situ hybridization with 5S and 18S rDNA probes was employed for rDNA site mapping in Pimelodus sp., P. fur and P. maculatus from the São Francisco River in the Três Marias municipality - MG...

  4. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Panero, J.L.; Široký, Jiří; Kovařík, Aleš


    Roč. 10, č. 176 (2010), s. 1-18. ISSN 1471-2229 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : organization of rDNA unit * intergenic spacer * Asteraceae Subject RIV: BO - Biophysics Impact factor: 4.085, year: 2010

  5. Diversity within the genus Elymus (Poaceae: Triticeae) as investigated by the analysis of the nr5S rDNA variation in species with St and H haplomes. (United States)

    Baum, B R; Edwards, T; Johnson, D A


    The genus Elymus ("Ryegrass") is a repository for a range of species with a variety of haplome contents; hence the pejorative name "dustbin" genus. We have analyzed 1,059 sequences from 128 accessions representing 24 species to investigate the relationships among the StH haplomes-containing species described by Yen and Yang (Genus Elymus Beijing 5:58-362, 2013). Sequences were assigned to "unit classes" of orthologous sequences and subjected to a suite of analyses including BLAST (Basic Local Alignment Search Tool) searches, phylogenetic analysis and population genetic analysis to estimate species diversity. Our results support the genome analyses in Yen and Yang (Genus Elymus Beijing 5:58-362, 2013), i.e., genomic constitution StStHH including variants restricted to Elymus. Population genetic analysis of the 5S nrDNA sequence data revealed that the within-species variance component is roughly ±89 %; thus, we were unable to identify molecular markers capable to separate the 24 species analyzed. Separate phylogenetic analyses of the two unit classes and of all the data exhibit a trend only of the species to cluster on the phylograms. Finally, the analysis provides evidence for the multiple origins of American and Eurasian species. PMID:25248636

  6. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA. (United States)

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette


    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  7. Regulation of Arabidopsis thaliana 5S rRNA Genes. (United States)

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette


    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  8. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana. (United States)

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D


    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  9. Variation in rDNA locus number and position among legume species and detection of 2 linked rDNA loci in the model Medicago truncatula by FISH. (United States)

    Abirached-Darmency, Mona; Prado-Vivant, Emilce; Chelysheva, Liudmila; Pouthier, Thomas


    Within Fabaceae, legume species have a variable genome size, chromosome number, and ploidy level. The genome distribution of ribosomal genes, easily detectable by fluorescent in situ hybridization (FISH), is a good tool for anchoring physical and genetic comparative maps. The organisation of 45S rDNA and 5S loci was analysed by FISH in the 4 closely related species: Pisum sativum, Medicago truncatula, Medicago sativa (2 diploid taxa), and Lathyrus sativus. The 2 types of rDNA arrays displayed interspecific variation in locus number and location, but little intraspecific variation was detected. In the model legume, M. truncatula, the presence of 2 adjacent 45S rDNA loci was demonstrated, and the location of the rDNA loci was independent of the general evolution of the genome DNA. The different parameters relative to clustering of the rDNA loci in specific chromosome regions and the possible basis of rDNA instability are discussed. PMID:16121252

  10. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers. (United States)

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto


    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  11. Chromosomal aberration

    International Nuclear Information System (INIS)

    Chromosomal aberrations are classified into two types, chromosome-type and chromatid-type. Chromosom-type aberrations include terminal deletion, dicentric, ring and interstitial deletion, and chromatid-type aberrations include achromatic lesion, chromatid deletion, isochromatid deletion and chromatid exchange. Clastogens which induce chromosomal aberration are divided into ''S-dependent'' agents and ''S-independent''. It might mean whether they can induce double strand breaks independent of the S phase or not. Double strand breaks may be the ultimate lesions to induce chromosomal aberrations. Caffeine added even in the G2 phase appeared to modify the frequency of chromatid aberrations induced by X-rays and mitomycin C. Those might suggest that the G2 phase involves in the chromatid aberration formation. The double strand breaks might be repaired by ''G2 repair system'', the error of which might yield breakage types of chromatid aberrations and the by-pass of which might yield chromatid exchanges. Chromosome-type aberrations might be formed in the G1 phase. (author)

  12. Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper. (United States)

    Kwon, Jin-Kyung; Kim, Byung-Dong


    The loci of the 5S and 45S rRNA genes were localized on chromosomes in five species of Capsicum, namely, annuum, chacoense, frutescens, baccatum, and chinense by FISH. The 5S rDNA was localized to the distal region of one chromosome in all species observed. The number of 45S rDNA loci varied among species; one in annuum, two in chacoense, frutescens, and chinense, and four in baccatum, with the exceptions that 'CM334' of annuum had three loci and 'tabasco' of frutescens had one locus. 'CM334'-derived BAC clones, 384B09 and 365P05, were screened with 5S rDNA as a probe, and BACs 278M03 and 262A23 were screened with 25S rDNA as a probe. Both ends of these BAC clones were sequenced. FISH with these BAC probes on pachytenes from 'CM334' plant showed one 5S rDNA locus and three 45S rDNA loci, consistent with the patterns on the somatic chromosomes. The 5S rDNA probe was also applied on extended DNA fibers to reveal that its coverage measured as long as 0.439 Mb in the pepper genome. FISH techniques applied on somatic and meiotic chromosomes and fibers have been established for chili to provide valuable information about the copy number variation of 45S rDNA and the actual physical size of the 5S rDNA in chili. PMID:19277503

  13. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells. (United States)

    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena


    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment. PMID:22556029

  14. Multicolor FISH analysis of rDNA and telomere on spinach

    Institute of Scientific and Technical Information of China (English)

    Tianying LAN; Bo LIU; Fengping DONG; Ruiyang CHEN; Xiulan LI; Chengbin CHEN


    In this study,multicolor fluorescence in situ hybridization (FISH) analysis on metaphase chromosomes of spinach with biotin-labeled 25S rDNA,DIG-labeled telomere sequences and biotin-labeled and DIG-labeled 5S rDNA was performed.There were six 25S rDNA loci located on the satellites of the third,the fifth and the sixth chromosomes,and four 5S rDNA loci located on the long arms of the third and the fifth chromosomes.The telomere loci were located on the end of the sixth chromosome and also on both the end and centromeric regions of other chromosomes.This study is an important complement to both traditional karyotype analysis and FISH karyotype analysis in spinach.

  15. Optical Aberrations and Wavefront

    Directory of Open Access Journals (Sweden)

    Nihat Polat


    Full Text Available The deviation of light to create normal retinal image in the optical system is called aberration. Aberrations are divided two subgroup: low-order aberrations (defocus: spherical and cylindrical refractive errors and high-order aberrations (coma, spherical, trefoil, tetrafoil, quadrifoil, pentafoil, secondary astigmatism. Aberrations increase with aging. Spherical aberrations are compensated by positive corneal and negative lenticular spherical aberrations in youth. Total aberrations are elevated by positive corneal and positive lenticular spherical aberrations in elderly. In this study, we aimed to analyze the basic terms regarding optic aberrations which have gained significance recently. (Turk J Ophthalmol 2014; 44: 306-11

  16. Karyotyping of Brassica oleracea L.based on rDNA and Cot-1 DNA fluorescence in situ hybridization

    Institute of Scientific and Technical Information of China (English)

    WANG Taixia; WU Chunhong; HUANG Jinyong; WEI Wenhui


    To explore an effective and reliable karyotyping method in Brassica crop plants,Cot-1 DNA was isolated from Brassica oleracea genome,labeled as probe with Biotin-Nick Translation Mix kit,in situ hybridized to mitotic spreads,and where specific fluorescent bands showed on each chromosome pair.25S and 5S rDNA were labeled as probes with DIG-Nick Translation Mix kit and Biotin-Nick Translation Mix kit,respectively,in situ hybridized to mitotic preparations,where 25S rDNA could be detected on two chromosome pairs and 5S rDNA on only one.Cot-1 DNA contains rDNA and chromosome sites identity between Cot-1 DNA and 25S rDNA was determined by dual-colour fluorescence in situ hybridization.All these showed that the karyotyping technique based on a combination of rDNA and Cot-1 DNA chromosome landmarks is superior to all but one.A more exact karyotype ofB.oleracea has been analyzed based on a combination of rDNA sites,Cot-1 DNA fluorescent bands,chromosome lengths and arm ratios.


    Directory of Open Access Journals (Sweden)



    Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.

  18. A yeast transcription system for the 5S rRNA gene.


    Keulen, H.; Thomas, D. Y.


    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA gen...

  19. Physical Mapping of the 5S Ribosomal RNA Gene in Citreae of Aurantioideae Species using Fluorescence in situ Hybridization


    Yamamoto, Masashi; Asad Asadi Abkenar; Matsumoto, Ryoji; KUBO, Tatsuya; TOMINAGA, Shigeto; ヤマモト, マサシ; マツモト, リョウジ; クボ, タツヤ; トミナガ, シゲト; 山本, 雅史; 松本, 亮司; 久保, 達也; 冨永, 茂人


    The location of the 5S ribosomal RNA gene (rDNA) in species from six genera of the Citreae of Aurantioideae was determined using fluorescence in situ hybridization (FISH). A 5S rDNA probe was labeled with biotin-16-dUTP. The probe was detected using a fluorescein isothiocyanate (FITC)-avidin conjugate with chromosomes counterstained with propidium iodide (PI). When the chromosomes were observed under a G filter, PI-stained chromosomes were classified into the following five types based on the...

  20. Molecular cytogenetic analysis of the Appenine endemic cyprinid fish Squalius lucumonis and three other Italian leuciscines using chromosome banding and FISH with rDNA probes. (United States)

    Rossi, Anna Rita; Milana, Valentina; Hett, Anne Kathrin; Tancioni, Lorenzo


    Karyotype and other chromosomal characteristics of the Appenine endemic cyprinid fish, Toscana stream chub Squalius lucumonis, were analysed using conventional banding and FISH with 45S and 5S rDNA probes. The diploid chromosome number (2n = 50) and karyotype characteristics including pericentromeric heterochromatic blocks and GC-rich CMA(3)-positive sites corresponding to both positive Ag-NORs and 45S rDNA loci on the short arms of a single medium-sized submetacentric chromosome pair were consistent with those found in most European leuciscine cyprinids. On other hand, 5S rDNA FISH in the Toscana stream chub and three other Italian leuciscines, S. squalus, Rutilus rubilio and Telestes muticellus, revealed a species-specific hybridization pattern, i.e. signals on four (S. lucumonis), three (S. squalus and R. rubilio) and two (T. muticellus) chromosome pairs. Whereas all the species shared the 5S rDNA loci on the largest subtelocentric chromosome pair, a "leuciscine" cytotaxonomic marker, S. lucumonis showed both classes of rDNA loci tandem aligned on the short arms of chromosome pair No. 12. The present findings suggest that the observed high variability of 5S rDNA loci provides a powerful tool for investigation of karyotype differentiation in karyologically conservative leuciscine fishes. PMID:23238894

  1. 新疆硬粒小麦5个品种5S rRNA基因重复单元间序列分析%Sequence Analysis of the 5S rRNA Gene Repeat Units in 5 Durum Wheat Species from Xinjiang of China

    Institute of Scientific and Technical Information of China (English)

    米日古丽·马木提; 布热比艳木·吾布力卡斯木; 吾买尔江·库尔班; 帕夏伊木·艾麦提; 赵奇


    本研究参照GenBank禾本科以及前期新疆7个小麦种5S rDNA NTS序列,通过PCR技术扩增获得新疆5个硬粒小麦品种5S rDNA NTS序列,并通过与5S rRNA序列比对,得到5S rDNA NTS序列结构和边界范围。结果显示:5个硬粒小麦品种均存在两种类型5S rDNA NTS序列且相似程度不同,长NTS序列保守性较高,短NTS片段相对较低;短NTS序列存在两处序列缺失现象,两种类型NTS序列存在不同位置和程度的变异位点和变异频率。利用MEG4.0软件,采用邻接法构建了分子进化树并计算获得了品种间遗传距离。对来自不同品种克隆单元基的序列进行比对,得知对于几个组直向是存在的。直系群体的5S rDNA序列有益于硬粒小麦进一步的系统发育分析。%According to GenBank in barley grasses 5S rDNA sequences and previously published 5S rDNA NTS sequences of seven Xinjiang wheat species, 5S rDNA sequences of five durum wheat varieties from Xinjiang were obtained by Polymerase Chain Reaction, the 5S rDNA structure and NTS boundaries were obtained by further alignments with barley grasses 5S rRNA sequence. Sequence analysis revealed that two types of 5S rDNA NTS sequences were presented in five wheat varieties and the nontranscribed spacer of long repeat classes was less variable than that of short repeat classes. Deletion was presented in two parts of 5S rDNA nontranscribed spacer (NTS) length of short repeat class. The different degrees of variable sites and mutation frequency exists in two types of 5S rDNA NTS sequences. Molecular phylogenetic tree was constructed and genetic distance between varieties was calculated by using the MEGA4.0 software and the neighbor-joining method. Sequence comparisons of individual clones (units) isolated from different species have allowed us to confirm that orthology exists for several groups. This demonstration of orthologous groups suggests that the 5S rDNA sequence may be useful for

  2. Sequence Analysis of the 5S rRNA Gene Repeat Units in 5 Durum Wheat Species from Xinjiang of China%新疆硬粒小麦5个品种5S rRNA基因重复单元间序列分析

    Institute of Scientific and Technical Information of China (English)

    米日古丽·马木提; 布热比艳木·吾布力卡斯木; 吾买尔江·库尔班; 帕夏伊木·艾麦提; 赵奇


    本研究参照GenBank禾本科以及前期新疆7个小麦种5S rDNA NTS序列,通过PCR技术扩增获得新疆5个硬粒小麦品种5S rDNA NTS序列,并通过与5S rRNA序列比对,得到5S rDNA NTS序列结构和边界范围。结果显示:5个硬粒小麦品种均存在两种类型5S rDNA NTS序列且相似程度不同,长NTS序列保守性较高,短NTS片段相对较低;短NTS序列存在两处序列缺失现象,两种类型NTS序列存在不同位置和程度的变异位点和变异频率。利用MEG4.0软件,采用邻接法构建了分子进化树并计算获得了品种间遗传距离。对来自不同品种克隆单元基的序列进行比对,得知对于几个组直向是存在的。直系群体的5S rDNA序列有益于硬粒小麦进一步的系统发育分析。%According to GenBank in barley grasses 5S rDNA sequences and previously published 5S rDNA NTS sequences of seven Xinjiang wheat species, 5S rDNA sequences of five durum wheat varieties from Xinjiang were obtained by Polymerase Chain Reaction, the 5S rDNA structure and NTS boundaries were obtained by further alignments with barley grasses 5S rRNA sequence. Sequence analysis revealed that two types of 5S rDNA NTS sequences were presented in five wheat varieties and the nontranscribed spacer of long repeat classes was less variable than that of short repeat classes. Deletion was presented in two parts of 5S rDNA nontranscribed spacer (NTS) length of short repeat class. The different degrees of variable sites and mutation frequency exists in two types of 5S rDNA NTS sequences. Molecular phylogenetic tree was constructed and genetic distance between varieties was calculated by using the MEGA4.0 software and the neighbor-joining method. Sequence comparisons of individual clones (units) isolated from different species have allowed us to confirm that orthology exists for several groups. This demonstration of orthologous groups suggests that the 5S rDNA sequence may be useful for

  3. Aberration Corrected Emittance Exchange

    CERN Document Server

    Nanni, Emilio A


    Full exploitation of emittance exchange (EEX) requires aberration-free performance of a complex imaging system including active radio-frequency (RF) elements which can add temporal distortions. We investigate the performance of an EEX line where the exchange occurs between two dimensions with normalized emittances which differ by orders of magnitude. The transverse emittance is exchanged into the longitudinal dimension using a double dog-leg emittance exchange setup with a 5 cell RF deflector cavity. Aberration correction is performed on the four most dominant aberrations. These include temporal aberrations that are corrected with higher order magnetic optical elements located where longitudinal and transverse emittance are coupled. We demonstrate aberration-free performance of emittances differing by 4 orders of magnitude, i.e. an initial transverse emittance of $\\epsilon_x=1$ pm-rad is exchanged with a longitudinal emittance of $\\epsilon_z=10$ nm-rad.

  4. 5S Practice in IMC: Sharing Experience

    International Nuclear Information System (INIS)

    5S is referred to seiri, seiton, seiso, seiketsu dan shitsuke or known as sorting, straightening, systematic cleaning, standardizing, and sustaining. This practice has been proven effective to help organizations around the world to improved productivity. In Nuclear Malaysia, 5S has been introduced since 7 years ago. Starting on January 2011, Innovation Management Centre (IMC) decides to improve the work place environment to be more conducive to achieve the target of 5S certification within this year. (author)

  5. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Directory of Open Access Journals (Sweden)

    Victor Manuel Gomez-Rodriguez


    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  6. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera). (United States)

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio


    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair. PMID:18066670

  7. Structure and function of the nontranscribed spacer regions of yeast rDNA.


    Skryabin, K G; Eldarov, M A; Larionov, V L; Bayev, A A; Klootwijk, J; de Regt, V C; Veldman, G M; Planta, R J; Georgiev, O I; Hadjiolov, A A


    The sequences of the nontranscribed spacers (NTS) of cloned ribosomal DNA (rDNA) units from both Saccharomyces cerevisiae and Saccharomyces carlsbergensis were determined. The NTS sequences of both species were found to be 93% homologous. The major disparities comprise different frequencies of reiteration of short tracts of six to sixteen basepairs. Most of these reiterations are found within the 1100 basepairs long NTS between the 3'-ends of 26S and 5S rRNA (NTS1). The NTS between the starts...

  8. 5S tuotannonkehityksen työkaluna


    Hautala, Teemu


    Tässä opinnäytetyössä on tutkittu lean-filosofiaan kuuluvan 5S-ohjelman käyttöönottoa mäntätoimisia painevaraajia valmistavassa yrityksessä. Konkreettisia työkaluja kehittämisen tukena käyttävä lean-filosofia on kerännyt menestystä yrityksissä ympäri maailmaa. 5S-ohjelman tarkoitus kehittää työpaikkaa viiden vaiheen avulla visuaalisemmaksi, tehokkaammaksi, turvallisemmaksi ja viihtyisämmäksi. Nimi 5S tulee japanin kielen sanoista seiri (erottele), seiton (järjestele), seiso (puhdista), seiket...

  9. Regulation of rDNA stability by sumoylation

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael


    Repair of DNA lesions by homologous recombination relies on the copying of genetic information from an intact homologous sequence. However, many eukaryotic genomes contain repetitive sequences such as the ribosomal gene locus (rDNA), which poses a risk for illegitimate recombination. Therefore, t...... review is the regulation of recombinational DNA repair at the rDNA locus by sumoylation and the Smc5-Smc6 complex in S. cerevisiae....

  10. Implementacija metode 5S v proces proizvodnje

    Directory of Open Access Journals (Sweden)

    Alojz Gorše


    Full Text Available Abstract: Research Question (RQ: The following research tries to show how the introduction of 5S methodology of work affects the production process itself, where the greatest changes are shown and how they are reflected in performance indicators. Purpose: The purpose of this project is to examine the existing methods and their application in practice as well as show the logic of actions we introduce in a particular process by using the 5S method. We will try to compare all the information using a practical example of company X. The results obtained are the basis for further improvements in an analyzed company. Method: We expect positive results in terms of certain improvements in the working environment within the company, as well as the opportunity for improvement in terms of increased efficiency and, consequently, more profit. Results: The results can represent the basis for achieving eve n better work in other processes in the studied company. It is very important to identify all the key activities that are important in generating profits while all the rest are eliminated from the process. Organization: The 5S model is applicable to all levels of the organization so it can be experienced by the highest levels of management in running a business. Society: The impact of the model will surely be seen by employees as they are offered a model after which they will work well, quickly, safely and without loss of time, which in today's world means competitive advantage. Originality: The research work represents an important contribution to the implementation of the 5S model in the company and to the positive things it brings. Limitations/Future Research: The survey as a case study was done in only one organization, in which they were implemented all phases of the method. In the direction of further research it is reasonable to make a quantitative analysis of the increase in profit, increase employee satisfaction analysis, to determine the reduction

  11. Characterization of ribosomal DNA (rDNA in Drosophila arizonae

    Directory of Open Access Journals (Sweden)

    Francisco Javier Tovar


    Full Text Available Ribosomal DNA (rDNA is a multigenic family composed of one or more clusters of repeating units (RU. Each unit consists of highly conserved sequences codifying 18S, 5.8S and 28S rRNA genes intercalated with poorly conserved regulatory sequences between species. In this work, we analyzed the rDNA of Drosophila arizonae, a member of the mulleri complex (Repleta group. Using genomic restriction patterns, cloning and mapping of some representative rDNA fragments, we were able to construct a representative restriction map. RU in this species are 13.5-14 kb long, restriction sites are completely conserved compared with other drosophilids and the rDNA has an R1 retrotransposable element in some RU. We were unable to detect R2 elements in this species.O DNA ribossômico (rDNA é uma família multigênica composta de um ou mais aglomerados de unidades de repetição (RU. Cada unidade consiste de seqüências altamente conservadas que codificam os rRNAs 18S, 5.8S e 28S, intercaladas com seqüências regulatórias pouco conservadas entre as espécies. Neste trabalho analisamos o rDNA de Drosophila arizonae, um membro do complexo mulleri (grupo Repleta. Usando padrões de restrição genômicos, clonagem e mapeamento de alguns fragmentos de rDNA representativos, estabelecemos um mapa de restrição do rDNA representativo desta espécie. Neste drosofilídeo, a RU tem um tamanho médio de 13.5-14 kb e os sítios de restrição estão completamente conservados com relação a outras drosófilas. Além disto, este rDNA possui um elemento transponível tipo R1 presente em algumas unidades. Neste trabalho não tivemos evidências da presença de elementos R2 no rDNA desta espécie.

  12. In situ chromosomal localization of rDNA sites in "Safed Musli" Chlorophytum ker-gawl and their physical measurement by fiber FISH. (United States)

    Lavania, U C; Basu, S; Srivastava, S; Mukai, Y; Lavania, S


    Fluorescence In Situ Hybridization (FISH) technique has been applied on somatic chromosomes and extended DNA fibers in the medicinally important species of Chlorophytum to elucidate physical localization and measurement of the rDNA sites using two rRNA multigene families homologous to 45S and 5S rDNA. The two species of Chlorophytum, namely C. borivillianum and C. comosum, both with 2n = 28, reveal diversity for copy number and localization of rDNA sites. C. borivillianum is comprised of five 45S-rDNA sites:one each in the secondary constriction region of chromosomes 7, 8, 9; one in the subtelomeric region of the short arm of chromosome 2 and the telomeric region of the short arm of chromosome 12; and one 5S-rDNA site in the subtelomeric region of the long arm of chromosome 1. In C. comosum, there are three 45S-rDNA sites (one each in the short arm of chromosomes 12, 13, and 14) and two 5S-rDNA sites (in the secondary constriction regions of chromosomes 2 and 13). Fiber FISH analysis conducted on extended DNA fibers revealed variation in the size of continuous tandem strings for the two r-DNA families. Taking the standard value of native B DNA equivalent to 3.27 kb for 1 mum, it was estimated that the physical size of continuous DNA strings is of the order of approximately 90 kb, 180 kb, and 300 kb for 45S-rDNA and of the order of 60 kb, 150 kb for 5S-rDNA in C. comosum, grossly in correspondence to their respective physical sizes at metaphase. PMID:15618304

  13. Aberrations in asymmetrical electron lenses

    International Nuclear Information System (INIS)

    Starting from well established knowledge in light-optics we explore the question if electron-optical aberration can be improved in asymmetrical electron lenses. We show that spherical as well as chromatic aberration coefficients are reduced in asymmetric electrostatic einzel lenses when the center electrode is moved away from the center position towards the entrance electrode. Relative improvements up to 40% for both the chromatic and the spherical aberration coefficients can be obtained. We use analytical and numerical calculations to confirm this result for exemplary cases of a lens with fixed length and working distance. The agreement of the two calculation methods is very good. We then derive an estimate for the electron-optical aberration coefficients from light-optics. The derived expressions for chromatic and spherical aberrations are somewhat simpler than the ones derived from electron-optics as they involve integrals only over the electrostatic potential, not over the electron paths. The estimated formulas still agree well with the electron optical calculations. Overall, we are tempted to suggest that the enormous knowledge base of light optics can provide considerable guidance for electron-optical applications. -- Highlights: ► Develops the analogy between light and electron optics in aberration calculations. ► Optimized spherical and chromatic aberrations for an electrostatic einzel lens. ► Comparison between analytic and numerical aberration calculations.

  14. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences. (United States)

    Xie, H; Bain, O; Williams, S A


    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  15. Randomly detected genetically modified (GM maize (Zea mays L. near a transport route revealed a fragile 45S rDNA phenotype.

    Directory of Open Access Journals (Sweden)

    Nomar Espinosa Waminal

    Full Text Available Monitoring of genetically modified (GM crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a "beads-on-a-string" fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed.

  16. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Crhák Khaitová, Lucie; Kovařík, Aleš


    Roč. 12, JUN 20 (2012), ID 95. ISSN 1471-2229 R&D Projects: GA ČR GAP501/10/0208; GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : ARABIDOPSIS-THALIANA * NUCLEOTIDE-SEQUENCES * DNA METHYLATION * GENUS ARTEMISIA Subject RIV: BO - Biophysics Impact factor: 4.354, year: 2012

  17. Aberrations in asymmetrical electron lenses. (United States)

    Fitzgerald, J P S; Word, R C; Könenkamp, R


    Starting from well established knowledge in light-optics we explore the question if electron-optical aberration can be improved in asymmetrical electron lenses. We show that spherical as well as chromatic aberration coefficients are reduced in asymmetric electrostatic einzel lenses when the center electrode is moved away from the center position towards the entrance electrode. Relative improvements up to 40% for both the chromatic and the spherical aberration coefficients can be obtained. We use analytical and numerical calculations to confirm this result for exemplary cases of a lens with fixed length and working distance. The agreement of the two calculation methods is very good. We then derive an estimate for the electron-optical aberration coefficients from light-optics. The derived expressions for chromatic and spherical aberrations are somewhat simpler than the ones derived from electron-optics as they involve integrals only over the electrostatic potential, not over the electron paths. The estimated formulas still agree well with the electron optical calculations. Overall, we are tempted to suggest that the enormous knowledge base of light optics can provide considerable guidance for electron-optical applications. PMID:22206603

  18. Aberrations of diffracted wave fields. (United States)

    Harvey, J E; Shack, R V


    This paper is an attempt to provide new insight into the behavior of near-field scalar diffraction phenomena by showing that the Rayleigh-Sommerfeld diffraction integral is equivalent to the Fourier transform integral of a generalized pupil function which includes a term that represents phase errors in the aperture. This term can be interpreted as describing a conventional wavefront aberration function. The resulting aberration coefficients are calculated and expressed in terms of the aperture diameter, observation distance, and appropriate field parameter for several different geometrical configurations of incident beam and observation space. These aberrations, which are inherently associated with the diffraction process, are precisely the effects ignored when making the usual Fresnel and Fraunhofer approximations. PMID:20203910

  19. Chromosome Aberrations by Heavy Ions (United States)

    Ballarini, Francesca; Ottolenghi, Andrea

    It is well known that mammalian cells exposed to ionizing radiation can show different types of chromosome aberrations (CAs) including dicentrics, translocations, rings, deletions and complex exchanges. Chromosome aberrations are a particularly relevant endpoint in radiobiology, because they play a fundamental role in the pathways leading either to cell death, or to cell conversion to malignancy. In particular, reciprocal translocations involving pairs of specific genes are strongly correlated (and probably also causally-related) with specific tumour types; a typical example is the BCR-ABL translocation for Chronic Myeloid Leukaemia. Furthermore, aberrations can be used for applications in biodosimetry and more generally as biomarkers of exposure and risk, that is the case for cancer patients monitored during Carbon-ion therapy and astronauts exposed to space radiation. Indeed hadron therapy and astronauts' exposure to space radiation represent two of the few scenarios where human beings can be exposed to heavy ions. After a brief introduction on the main general features of chromosome aberrations, in this work we will address key aspects of the current knowledge on chromosome aberration induction, both from an experimental and from a theoretical point of view. More specifically, in vitro data will be summarized and discussed, outlining important issues such as the role of interphase death/mitotic delay and that of complex-exchange scoring. Some available in vivo data on cancer patients and astronauts will be also reported, together with possible interpretation problems. Finally, two of the few available models of chromosome aberration induction by ionizing radiation (including heavy ions) will be described and compared, focusing on the different assumptions adopted by the authors and on how these models can deal with heavy ions.

  20. rDNA mapping, heterochromatin characterization and AT/GC content of Agapanthus africanus (L. Hoffmanns (Agapanthaceae

    Directory of Open Access Journals (Sweden)



    Full Text Available ABSTRACT Agapanthus (Agapanthaceae has 10 species described. However, most taxonomists differ respect to this number because the great phenotypic plasticity of the species. The cytogenetic has been an important tool to aid the plant taxon identification, and to date, all taxa of Agapanthus L'Héritier studied cytologically, presented 2n = 30. Although the species possess large chromosomes, the group is karyologically little explored. This work aimed to increase the cytogenetic knowledge of Agapanthus africanus (L. Hoffmanns by utilization of chromosome banding techniques with DAPI / CMA3 and Fluorescent in situ Hybridization (FISH. In addition, flow cytometry was used for determination of DNA content and the percentage of AT / GC nitrogenous bases. Plants studied showed 2n = 30 chromosomes, ranging from 4.34 - 8.55 µm, with the karyotype formulae (KF = 10m + 5sm. Through FISH, one 45S rDNA signal was observed proximally to centromere of the chromosome 7, while for 5S rDNA sites we observed one signal proximally to centromere of chromosome 9. The 2C DNA content estimated for the species was 2C = 24.4 with 59% of AT and 41% of GC. Our data allowed important upgrade for biology and cytotaxonomy of Agapanthus africanus (L. Hoffmanns.

  1. Distortion of ultrashort pulses caused by aberrations (United States)

    Horváth, Z. L.; Kovács, A. P.; Bor, Zs.

    The effect of the primary wave aberrations (spherical aberration, astigmatism and coma) on ultrashort pulses is studied by the Nijboer-Zernike theory. The results of the geometrical and the wave optical treatments are compared.

  2. Underlag för implementering av 5S


    Nordahl, Tobias


    ABB Capacitors Ludvika started their LEAN-project in november 2010, but still has not the whole factory been introduced to the LEAN-tool called 5S. 5S is only implemented on the ”easiest” work-areas. By implementing 5S, at the workingstation called inburkningen, would make the workstation and the area around it much more structured, clean and systematized. The operators are a little bit skeptical to the work that includes continuous improvement today, because they can not see any progresses. ...

  3. Baseline chromosome aberrations in children

    Czech Academy of Sciences Publication Activity Database

    Merlo, D.F.; Ceppi, M.; Stagi, E.; Bocchini, V.; Šrám, Radim; Rössner st., Pavel


    Roč. 172, - (2007), s. 60-67. ISSN 0378-4274 Grant ostatní: EU(EU) 2002-02198; EU(EU) 2005-016320 Institutional research plan: CEZ:AV0Z50390512 Source of funding: R - rámcový projekt EK ; R - rámcový projekt EK Keywords : chromosome aberrations * children * molecular epidemiology Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 2.826, year: 2007

  4. Aberrant methylation patterns in cancer


    Hudler, Petra; Videtič, Alja


    Epigenetic mechanisms, such as DNA methylation, DNA hydroxymethylation, post-translational modifications (PTMs) of histone proteins affecting nucleosome remodelling, and regulation by small and large non-coding RNAs (ncRNAs) work in concert with cis and trans acting elements to drive appropriate gene expression. Advances in detection methods and development of dedicated platforms and methylation arrays resulted in an explo - sion of information on aberrantly methylated sequences linking devia...



    Brad, Raluca


    The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visua...

  6. 新疆春小麦4个地方品种5S rRNA基因变异分析%The 5S rRNA Gene Sequence Variation of Four Local Variety in Xinjiang Spring Wheat

    Institute of Scientific and Technical Information of China (English)

    布热比艳木·吾布力卡斯木; 吾甫尔·米吉提; 米日古丽·马木提; 维尼拉·吾甫尔; 祖路皮亚·载买尔


    5S rDNA (即5S rRNA基因)是由120 bp的编码区和非转录间隔区(nontranscribed spacers, NTS)组成的串联重复序列,及其NTS区碱基序列和长度在不同的种间甚至在种内都有差异,从而形成种内和种间特有的不同重复单元类型,不同单元类型各自代表不同的基因组型,因此5S rDNA多基因家族是研究物种基因组结构的有效工具。本研究以生长在不同地区的四个新疆春小麦地方品种(黑芒麦)作为供试材料,通过TA克隆法获得了128个5S rRNA基因重复单元,每个品种都有长度为326~422 bp之间的短5S rDNA片段和长度为481~491 bp之间的长5S rDNA片段。通过多次序列比对,Blast比对,聚类分析等方法将所有序列分为不同的5S rDNA单元类型。在ZM5291和ZM52300中发现了Short A2、Short D1、Short G1、Long A1、Long D1和Long{S1等6种不同的单元类型,而在ZM5306和ZM5343中只发现了Short A2、Short D1、Short G1和Long{S1等4种不同的单元类型,丢失了Long A1和Long D1。依据5S rDNA各单元类型在山羊草属和小麦属二倍体物种及其异源多倍体物种中的分布情况确定这四个春小麦地方品种的基因组型为AABBDD,确实是普通小麦。本研究首次在普通小麦中发现了六种不同的5S rDNA单元类型,6种单元类型在这4个地方品种中的分布情况表明ZM5291和ZM53005S rDNA序列的一致进化程度比ZM5306和ZM5343弱,推测生长在不同地区的黑芒麦多倍体物种形成的时代不一样,并ZM5291和ZM5300比ZM5306和ZM5343可能具有来自各基因组祖先的丰富基因资源。本研究结果为鉴别新疆春小麦种质资源的基因组类型以及亲本选配和育种工作提供新的依据。%5S rDNA is organized into arrays of tandem repeats consisting of a 120 bp coding region , and a non-transcribed spacer (NTS) which varies considerably in length and pattern, giving rise to different classes of repeat units in inter

  7. Large Scale Construction Project Innovative Management Through 5-S

    Directory of Open Access Journals (Sweden)

    Hashim Hj. Abdul Ghani Mohd.


    Full Text Available It has been well-recognised that Japanese construction firms are good in safety, hygiene, quality, productivity and image. Over the last century, the Japanese have formalised the technique and name it as '5S' Practice. Through his research in Japan in 1988, the author has re-define the name as '5-S' and developed the world's first 5-S Audit Checklist. Since 1993, he used an innovative 5-S Checklist developed at SIRIM for training and consultancy in no less than 20 countries with over 100,000 persons from around 8,000 organisations world-wide. The objective of this paper is to explain the intricacy of the 5-S so that it can be understood easily and adopted readily by those who may find the tool useful. Some experience will also be shared in this article. It is hoped that this article can arouse the interest of the construction industry in Malaysia to take up this important and effective tool for quality improvement.

  8. Review on Implementation of 5S in Various Organization

    Directory of Open Access Journals (Sweden)

    Vipulkumar C. Patel


    Full Text Available This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ efficiency, safety, security, quality and reduction of the industry pollution, proceedings according to decisions. The 5S methodology permits to analyze the processes running on the workplace and establishment of 5Ssustaining well organized, clean, high effective and high quality workplace. Research clearly show, that very essential is training of workers about the 5S rules. Essential thing is to divide activities on some main steps and to maintain the continuous improvement. This method can be used in all companies. Its result is the effective organization of the workplace.

  9. Complete sequence of the extrachromosomal rDNA molecule from the ciliate Tetrahymena thermophila strain B1868VII

    DEFF Research Database (Denmark)

    Engberg, J; Nielsen, Henrik


    The recent development of rDNA vectors for transformation of Tetrahymena combined with improved microinjection technology should lead to a renewed interest in this organism. In particular, the rDNA itself constitutes an attractive system for biochemical studies. The rDNA is amplified to a level of...

  10. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA in the fish Prochilodus lineatus (Characiformes, Prochilodontidae

    Directory of Open Access Journals (Sweden)

    Marcelo Ricardo Vicari


    Full Text Available We used differential staining techniques (BSG, GTG, AgNO3, DAPI and CMA3 banding and fluorescent in situ hybridization (FISH with 5S and 18S probes to investigated the karyotypic and cytogenetic chracteristics of Prochilodus lineatus specimens from a population in Vila Velha state park (Parque Estadual de Vila Velha, Ponta Grossa, Paraná state, southern Brazil. The specimens studied showed the same karyotype as that found in other P. lineatus populations, i.e. 2n = 54 biarmed chromosomes (40m + 14 sm and c-positive heterochromatin preferentially located pericentromerically in all chromosomes. The presence of partial or totally heterochromatic supernumerary chromosomes with numeric intra-individual variation was confirmed in the analyzed population. The nucleolar organizing regions (NORs were interstitially situated on the long arm of chromosome pair 4 directly beneath the centromere. The differential banding techniques and FISH revealed NOR size polymorphism due to structural events such as breaks and duplication of the larger rDNA site cluster. We also observed syntenic localization of the 5S ribosomal genes in the distal segment of the 45S cluster.

  11. 中国西藏近缘野生大麦5S rDNA NTS序列分析%Comparative Analysis of Sequences of the 5S rDNA NTS in Wild Close Relatives of Barley from Tibet of China

    Institute of Scientific and Technical Information of China (English)

    谭睿; 马得泉; 丁毅


    选取来自西藏不同地理区域的17份近缘野生大麦材料和1份国外的近缘野生大麦材料,利用直接PCR、T-载体转化克隆、克隆产物测序的方法获得了它们的5S核糖体DNA NTS(Nontranscribed intergenic spacer)序列.对这些序列进行测定、分析和比较,构建了分子系统树.结果表明,西藏近缘野生大麦NTS序列包括两段相对保守的保守区A和保守区B以及一段变异较大的变异区V,变异区由若干个TAG碱基的重复序列构成.两段保守区总长度为168~169 bp,长度变异较小,仅相差1 bp.保守区的GC%含量为43.8%,其中有12个核甘酸位点发生变异(占总核甘酸数目的7.1%),变异位点基本上是颠换多于转换,颠换/转换率为1.0~2.0.变异区中TAG重复序列的重复次数从4到17次,而且有部分TAG重复发生了颠换和转换(TAG→TCG,TAG*→TAC).TAG重复序列的多态性是决定NTS序列多态性的主要因素.对西藏近缘野生大麦和麦属其他作物的比较,认为rDNA NTS适合作为属内分类的分子标记.

  12. CTD kinase I is required for the integrity of the rDNA tandem array


    Grenetier, Sabrina; Bouchoux, Céline; Goguel, Valérie


    The genomic stability of the rDNA tandem array is tightly controlled to allow sequence homogenization and to prevent deleterious rearrangements. In this report, we show that the absence of the yeast CTD kinase I (CTDK-I) complex in null mutant strains leads to a decrease in the number of tandem rDNA repeats. Reintroduction of the missing gene induces an increase of rDNA repeats to reach a copy number similar to that of the original strain. Interestingly, while expansion is dependent on Fob1, ...

  13. Chromosomal aberrations and bone marrow toxicity.


    Heddle, J A; Salamone, M F


    The importance of chromosomal aberrations as a proximate cause of bone marrow toxicity is discussed. Since chemicals that can cause nondisjunction are rare, numerical aberrations (aneuploidy, polyploidy) are not ordinarily important. Many structural aberrations, however, can lead directly to cell death and so are proximate causes of toxicity when they occur. The micronucleus test which utilizes the polychromatic erythrocyte is capable of detecting agents (clastogens) that can cause such struc...


    Directory of Open Access Journals (Sweden)

    Raluca BRAD


    Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.

  15. Analyzing Digital Library Initiatives: 5S Theory Perspective (United States)

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko


    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  16. Chromosomal aberrations in ore miners of Slovakia

    International Nuclear Information System (INIS)

    A pilot study was performed in which the incidence of chromosomal aberrations in lymphocytes of miners in ore mines located in Central Slovakia was monitored and related to lifetime underground radon exposure and to lifetime smoking. The conclusions drawn from the results of the study were as follows: the counts of chromosomal aberrations in lymphocytes of miners were significantly higher than in an age matched control group of white-collar staff; the higher counts of chromosomal aberrations could be ascribed to underground exposure of miners and to smoking; a dependence of chromosomal aberration counts on the exposure to radon could not be assessed. (A.K.)

  17. rDNA Genetic Imbalance and Nucleolar Chromatin Restructuring Is Induced by Distant Hybridization between Raphanus sativus and Brassica alboglabra


    Long, Hong; Chen, Chunli; Bing WANG; Feng, Yanni


    The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs) in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional ...

  18. Localização física dos genes ribossomais 5S e 18S em "Ancistrus" sp. da bacia dos rios costeiros no Rio de Janeiro (Loricariidae: Ancistrini. DOI: 10.7902/ecb.v3i1.13

    Directory of Open Access Journals (Sweden)

    Dinaíza Abadia Rocha Reis


    Full Text Available Ancistrus é considerado um gênero diversificado na tribo Ancistrini e corresponde a peixes conhecidos popularmente por “cascudos”.  Os DNAs ribossômicos mais estudados são o rDNA 18S, que participa da formação de Regiões Organizadoras de Nucléolo,  e o rDNA 5S. O objetivo deste trabalho é determinar a localização física dos sítios de DNAr 18S e 5S em Ancistrus sp. da região de Angra dos Reis-RJ, bacia dos rios Costeiros. Através de Hibridação Fluorescente in situ (FISH foram identificados 4 sítios de rDNA 18S localizados em quatro diferentes cromossomos (pares 3 e 14 e 2 sítios de rDNA 5S, localizados em dois cromossomos (par 13, todos em região terminal. Os resultados deste estudo podem ser aplicados em abordagens conservacionistas, podendo auxiliar no entendimento da evolução cromossômica desta espécie e da tribo Ancistrini.

  19. 现代营销"5S"管理

    Institute of Scientific and Technical Information of China (English)



    @@ 现代营销管理理论的日新月异的确为营销领域注入了新鲜血液,从"销售"到"行销"到"营销",从4P理论到C-4P理论、4C理论、5R理论,更多涉及的是销售战略,而在战术方面却鲜有纵深研究.1999年我们在企业推行"5S"现场管理时,我意识到"5S"管理对营销更为重要,也更有难度.我相信,现代营销5S管理必将为众多企业提高核心竞争能力,甚至带来发展的契机.

  20. Calculation of aberration coefficients by ray tracing

    Czech Academy of Sciences Publication Activity Database

    Oral, Martin; Lencová, Bohumila


    Roč. 109, č. 11 (2009), s. 1365-1373. ISSN 0304-3991 R&D Projects: GA AV ČR IAA100650805 Institutional research plan: CEZ:AV0Z20650511 Keywords : Aberrations * Aberration coefficients * Ray tracing * Regression * Fitting Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 2.067, year: 2009

  1. Thermodynamic properties of CaTiF5(s)

    International Nuclear Information System (INIS)

    Calcium titanofluoride CaTiF5(s) was prepared by solid-state reaction of CaF2(s) with TiF3(s) and characterized by X-ray diffraction method. The standard molar isobaric heat capacity (Cp,mo) of CaTiF5(s) was determined by a power compensated differential scanning calorimeter in the temperature from 230K to 710K. A solid-state galvanic cell with CaF2 as electrolyte was used to determine the standard molar Gibbs energy of formation (ΔfGmo) of CaTiF5 in the temperature range from 803K to 1005K. The galvanic cell can be depicted as:(-)Pt,O2(g,101.325kPa)/{CaO(s)+CaF2(s)}//CaF2//{CaTiF5(s)+CaTiO3(s)}/O2 (g,101.325kPa),Pt(+)The second law analysis of present data were carried out to derive the standard entropy Smo(298.15K) and the enthalpy of formation ΔfHmo (298.15K) and the values derived are 68.7J.K-1.mol-1 and -2848.4kJ.mol-1, respectively

  2. Nodal aberration theory applied to freeform surfaces (United States)

    Fuerschbach, Kyle; Rolland, Jannick P.; Thompson, Kevin P.


    When new three-dimensional packages are developed for imaging optical systems, the rotational symmetry of the optical system is often broken, changing its imaging behavior and making the optical performance worse. A method to restore the performance is to use freeform optical surfaces that compensate directly the aberrations introduced from tilting and decentering the optical surfaces. In order to effectively optimize the shape of a freeform surface to restore optical functionality, it is helpful to understand the aberration effect the surface may induce. Using nodal aberration theory the aberration fields induced by a freeform surface in an optical system are explored. These theoretical predications are experimentally validated with the design and implementation of an aberration generating telescope.

  3. Aberration compensation in charged particle projection lithography

    International Nuclear Information System (INIS)

    Projection systems offer the opportunity to increase the throughput for charged particle lithography, because such systems image a large area of a mask directly on to a wafer as a single shot. Shots have to be imaged over a certain range of off-axis distances at the wafer to increase the writing speed, because shot sizes are limited to about 0.25x0.25 mm2 due to aberrations. In a projection system with only lenses, however, the aberrations for off-axis shots are still very large, and some aberration compensation elements need to be introduced. In this paper, three aberration compensation elements (deflectors, stigmators and dynamic focus lenses) are first discussed, a suite of newly developed software, called PROJECTION, based on this principle and our unified aberration theory is then described, and an illustrative example computed with the software is finally given

  4. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization. (United States)

    Dingman, Douglas W


    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. PMID:22510214

  5. Higher-Order Aberrations in Myopic Eyes

    Directory of Open Access Journals (Sweden)

    Farid Karimian


    Full Text Available Purpose: To evaluate the correlation between refractive error and higher-order aberrations (HOAs in patients with myopic astigmatism. Methods: HOAs were measured using the Zywave II aberrometer over a 6 mm pupil. Correlations between HOAs and myopia, astigmatism, and age were analyzed. Results: One hundred and twenty-six eyes of 63 subjects with mean age of 26.4±5.9 years were studied. Mean spherical equivalent refractive error and refractive astigmatism were -4.94±1.63 D and 0.96±1.06 D, respectively. The most common higher-order aberration was primary horizontal trefoil with mean value of 0.069±0.152 μm followed by spherical aberration (-0.064±0.130 μm and primary vertical coma (-0.038±0.148 μm. As the order of aberration increased from third to fifth, its contribution to total HOA decreased: 53.9% for third order, 31.9% for fourth order, and 14.2% for fifth order aberrations. Significant correlations were observed between spherical equivalent refractive error and primary horizontal coma (R=0.231, P=0.022, and root mean square (RMS of spherical aberration (R=0.213, P=0.031; between astigmatism and RMS of total HOA (R=0.251, P=0.032, RMS of fourth order aberration (R=0.35, P<0.001, and primary horizontal coma (R=0.314, P=0.004. Spherical aberration (R=0.214, P=0.034 and secondary vertical coma (R=0.203, P=0.031 significantly increased with age. Conclusion: Primary horizontal trefoil, spherical aberration and primary vertical coma are the predominant higher-order aberrations in eyes with myopic astigmatism.

  6. Epigenetic repression of ribosomal RNA transcription by ROCK-dependent aberrant cytoskeletal organization (United States)

    Wu, Tse-Hsiang; Kuo, Yuan-Yeh; Lee, Hsiao-Hui; Kuo, Jean-Cheng; Ou, Meng-Hsin; Chang, Zee-Fen


    It is known that ribosomal RNA (rRNA) synthesis is regulated by cellular energy and proliferation status. In this study, we investigated rRNA gene transcription in response to cytoskeletal stress. Our data revealed that the cell shape constrained by isotropic but not elongated micropatterns in HeLa cells led to a significant reduction in rRNA transcription dependent on ROCK. Expression of a dominant-active form of ROCK also repressed rRNA transcription. Isotropic constraint and ROCK over-activation led to different types of aberrant F-actin organization, but their suppression effects on rRNA transcription were similarly reversed by inhibition of histone deacetylase (HDAC) or overexpression of a dominant negative form of Nesprin, which shields the signal transmitted from actin filament to the nuclear interior. We further showed that the binding of HDAC1 to the active fraction of rDNA genes is increased by ROCK over-activation, thus reducing H3K9/14 acetylation and suppressing transcription. Our results demonstrate an epigenetic control of active rDNA genes that represses rRNA transcription in response to the cytoskeletal stress. PMID:27350000

  7. Chromosome aberration assays in Allium

    Energy Technology Data Exchange (ETDEWEB)

    Grant, W.F.


    The common onion (Allium cepa) is an excellent plant for the assay of chromosome aberrations after chemical treatment. Other species of Allium (A. cepa var. proliferum, A. carinatum, A. fistulosum and A. sativum) have also been used but to a much lesser extent. Protocols have been given for using root tips from either bulbs or seeds of Allium cepa to study the cytological end-points, such as chromosome breaks and exchanges, which follow the testing of chemicals in somatic cells. It is considered that both mitotic and meiotic end-points should be used to a greater extent in assaying the cytogenetic effects of a chemical. From a literature survey, 148 chemicals are tabulated that have been assayed in 164 Allium tests for their clastogenic effect. Of the 164 assays which have been carried out, 75 are reported as giving a positive reaction, 49 positive and with a dose response, 1 positive and temperature-related, 9 borderline positive, and 30 negative; 76% of the chemicals gave a definite positive response. It is proposed that the Allium test be included among those tests routinely used for assessing chromosomal damage induced by chemicals.

  8. Effect of aberrations in vortex spatial filtering (United States)

    Sharma, Manoj Kumar; Joseph, Joby; Senthilkumaran, P.


    Edge enhancement is a very important operation in image processing and a spiral phase plate can be used as a radial Hilbert mask for isotropic edge enhancement. In this paper we analyze the effect of various Seidel aberrations on the performance of radial Hilbert mask or the vortex phase mask. The aberrated vortex phase mask is implemented optically with the help of a high resolution, spatial light modulator (SLM). It has also been shown that out of various aberrations astigmatism can introduce anisotropy in the Hilbert mask which causes selective edge enhancement.

  9. Toxicity analysis of pesticides on cyanobacterial species by 16S rDNA molecular characterization

    Directory of Open Access Journals (Sweden)

    J. I. Nirmal Kumar


    Full Text Available Damaging effects of endosulfan on native structure of DNA, evident as a result of PCR based assay such as 16S rDNA amplification and sequencing, led to formation of gaps, mismatching of base pairs and dissimilarities in entire 16S rDNA sequences of treated cultures. Endosulfan was the most fatal to Westiellopsis prolifica of 16S rDNA region at 40ppm insecticide induced series of mispairing, and other lesions amounting up to 20% dissimilarity and 7% gaps. Whereas, 16S rDNA region of Anabaena fertilissima was comparatively less influenced with 18% dissimilarity and 7% gaps in response to 12ppm endosulfan, while 16S rDNA gene of Aulosira fertilissima was the least prone to changes with 17% dissimilarity, and 5% gaps under 60ppm endosulfan stress by the end of 16 days. On the other side, impact of fungicide tebuconazole after 16 days reflected identities up to 78% and 8% gaps for 30ppm treated A. fertilissima, while 60ppm treatment instilled 79% similarities with 10% gaps in W. prolifica and 83% identities with 5% gaps of Aulosira fertilissima after 16 days.

  10. Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast

    International Nuclear Information System (INIS)

    HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination

  11. Aberration corrected Lorentz scanning transmission electron microscopy

    International Nuclear Information System (INIS)

    We present results from an aberration corrected scanning transmission electron microscope which has been customised for high resolution quantitative Lorentz microscopy with the sample located in a magnetic field free or low field environment. We discuss the innovations in microscope instrumentation and additional hardware that underpin the imaging improvements in resolution and detection with a focus on developments in differential phase contrast microscopy. Examples from materials possessing nanometre scale variations in magnetisation illustrate the potential for aberration corrected Lorentz imaging as a tool to further our understanding of magnetism on this lengthscale. - Highlights: • Demonstration of nanometre scale resolution in magnetic field free environment using aberration correction in the scanning transmission electron microscope (STEM). • Implementation of differential phase contrast mode of Lorentz microscopy in aberration corrected STEM with improved sensitivity. • Quantitative imaging of magnetic induction of nanostructures in amorphous and cross-section samples

  12. Aberration features in directional dark matter detection

    CERN Document Server

    Bozorgnia, Nassim; Gondolo, Paolo


    The motion of the Earth around the Sun causes an annual change in the magnitude and direction of the arrival velocity of dark matter particles on Earth, in a way analogous to aberration of stellar light. In directional detectors, aberration of weakly interacting massive particles (WIMPs) modulates the pattern of nuclear recoil directions in a way that depends on the orbital velocity of the Earth and the local galactic distribution of WIMP velocities. Knowing the former, WIMP aberration can give information on the latter, besides being a curious way of confirming the revolution of the Earth and the extraterrestrial provenance of WIMPs. While observing the full aberration pattern requires extremely large exposures, we claim that the annual variation of the mean recoil direction or of the event counts over specific solid angles may be detectable with moderately large exposures. For example, integrated counts over galactic hemispheres separated by planes perpendicular to Earth's orbit would modulate annually, res...

  13. Catadioptric aberration correction in cathode lens microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Tromp, R.M. [IBM T.J. Watson Research Center, PO Box 218, Yorktown Heights, NY 10598 (United States); Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Niels Bohrweg 2, 2333 CA Leiden (Netherlands)


    In this paper I briefly review the use of electrostatic electron mirrors to correct the aberrations of the cathode lens objective lens in low energy electron microscope (LEEM) and photo electron emission microscope (PEEM) instruments. These catadioptric systems, combining electrostatic lens elements with a reflecting mirror, offer a compact solution, allowing simultaneous and independent correction of both spherical and chromatic aberrations. A comparison with catadioptric systems in light optics informs our understanding of the working principles behind aberration correction with electron mirrors, and may point the way to further improvements in the latter. With additional developments in detector technology, 1 nm spatial resolution in LEEM appears to be within reach. - Highlights: • The use of electron mirrors for aberration correction in LEEM/PEEM is reviewed. • A comparison is made with similar systems in light optics. • Conditions for 1 nm spatial resolution are discussed.

  14. Catadioptric aberration correction in cathode lens microscopy

    International Nuclear Information System (INIS)

    In this paper I briefly review the use of electrostatic electron mirrors to correct the aberrations of the cathode lens objective lens in low energy electron microscope (LEEM) and photo electron emission microscope (PEEM) instruments. These catadioptric systems, combining electrostatic lens elements with a reflecting mirror, offer a compact solution, allowing simultaneous and independent correction of both spherical and chromatic aberrations. A comparison with catadioptric systems in light optics informs our understanding of the working principles behind aberration correction with electron mirrors, and may point the way to further improvements in the latter. With additional developments in detector technology, 1 nm spatial resolution in LEEM appears to be within reach. - Highlights: • The use of electron mirrors for aberration correction in LEEM/PEEM is reviewed. • A comparison is made with similar systems in light optics. • Conditions for 1 nm spatial resolution are discussed

  15. Sensing Phase Aberrations behind Lyot Coronagraphs (United States)

    Sivaramakrishnan, Anand; Soummer, Rémi; Pueyo, Laurent; Wallace, J. Kent; Shao, Michael


    Direct detection of young extrasolar planets orbiting nearby stars can be accomplished from the ground with extreme adaptive optics and coronagraphy in the near-infrared, as long as this combination can provide an image with a dynamic range of 107 after the data are processed. Slowly varying speckles due to residual phase aberrations that are not measured by the primary wave-front sensor are the primary obstacle to achieving such a dynamic range. In particular, non-common optical path aberrations occurring between the wave-front sensor and the coronagraphic occulting spot degrade performance the most. We analyze the passage of both low and high spatial frequency phase ripples, as well as low-order Zernike aberrations, through an apodized pupil Lyot coronagraph in order to demonstrate the way coronagraphic filtering affects various aberrations. We derive the coronagraphically induced cutoff frequency of the filtering and estimate coronagraphic contrast losses due to low-order Zernike aberrations: tilt, astigmatism, defocus, coma, and spherical aberration. Such slowly varying path errors can be measured behind a coronagraph and corrected by a slowly updated optical path delay precompensation or offset asserted on the wave front by the adaptive optics (AO) system. We suggest ways of measuring and correcting all but the lowest spatial frequency aberrations using Lyot plane wave-front data, in spite of the complex interaction between the coronagraph and those mid-spatial frequency aberrations that cause image plane speckles near the coronagraphic focal plane mask occulter's edge. This investigation provides guidance for next-generation coronagraphic instruments currently under construction.

  16. Aberrant right hepatic artery; A case report

    International Nuclear Information System (INIS)

    We present a rare case of aberrant hepatic artery in a 40-year-old male with a history of chronic cholecystitis. During laparoscopic surgery, the artery found to pass anterior to the body the gallbladder and bifurcating anterior to the gallbladder body. The surgery was un eventful. We present this anomaly of the rare condition of aberrant right hepatic artery which should be in mind during laparoscopic cholecystectomy, because inadverant injury could lead to massive bleeding and increase co morbidities. (author)

  17. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae). (United States)

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A


    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  18. Evaluation of amplified rDNA restriction analysis (ARDRA for the identification of cultured mycobacteria in a diagnostic laboratory

    Directory of Open Access Journals (Sweden)

    Rottiers Sylvianne


    Full Text Available Abstract Background The development of DNA amplification for the direct detection of M. tuberculosis from clinical samples has been a major goal of clinical microbiology during the last ten years. However, the limited sensitivity of most DNA amplification techniques restricts their use to smear positive samples. On the other hand, the development of automated liquid culture has increased the speed and sensitivity of cultivation of mycobacteria. We have opted to combine automated culture with rapid genotypic identification (ARDRA: amplified rDNA restriction analysis for the detection resp. identification of all mycobacterial species at once, instead of attempting direct PCR based detection from clinical samples of M. tuberculosis only. Results During 1998–2000 a total of approx. 3500 clinical samples was screened for the presence of M. tuberculosis. Of the 151 culture positive samples, 61 were M. tuberculosis culture positive. Of the 30 smear positive samples, 26 were M. tuberculosis positive. All but three of these 151 mycobacterial isolates could be identified with ARDRA within on average 36 hours. The three isolates that could not be identified belonged to rare species not yet included in our ARDRA fingerprint library or were isolates with an aberrant pattern. Conclusions In our hands, automated culture in combination with ARDRA provides with accurate, practically applicable, wide range identification of mycobacterial species. The existing identification library covers most species, and can be easily updated when new species are studied or described. The drawback is that ARDRA is culture-dependent, since automated culture of M. tuberculosis takes on average 16.7 days (range 6 to 29 days. However, culture is needed after all to assess the antibiotic susceptibility of the strains.

  19. Chromosome mapping of 5S rRNA genes differentiates Brazilian populations of Leporellus vittatus (Anostomidae, Characiformes

    Directory of Open Access Journals (Sweden)

    Cecilia Teixeira de Aguilar


    Full Text Available Among the anostomid fishes, the genus Leporellus is represented by only three species: L. nattereri, endemic of the Amazon River, L. retropinnis, endemic of the Piracicaba River, and L. vittatus, widely distributed in rivers from Peru, Colombia, Guianas, and different major hydrographic basins of Brazil. A cytogenetic study carried out on specimens of Leporellus vittatus from three major Brazilian hydrographic basins evidenced a karyotype of 54 metacentric and submetacentric chromosomes. C-banding analysis revealed the presence of large pericentromeric heterochromatic segments in all chromosomes and a telomeric block coincident with the NOR sites. Ag, CMA3 or MM staining, and FISH with ribosomal probes located the 45S ribosomal genes on the terminal region of the long arm of the 12th chromosome pair of all populations. Nevertheless, in the specimens from the Paraná and São Francisco Basins the 5S rDNA clusters were interstitially located by FISH on the long arm of the 2nd chromosome pair, while in the specimens from the Tocantins-Araguaia Basin these sites were observed on the long arm of the 9th chromosome pair and on the short arm of the 17th chromosome pair. These data suggest that the species currently named Leporellus vittatus may comprise a complex of cryptic species.

  20. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences (United States)

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F., Jr.; Rodriguez, R.J.


    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  1. Molecular Detection of Toxoplasmosis Using Specific Primers P30, B1, and rDNA

    Directory of Open Access Journals (Sweden)

    Wisnu Nurcahyo


    Full Text Available Study in order to develop molecular techniques using specific primers for the early diagnosis oftoxoplasmosis have been conducted. Detection of Toxoplasma gondii genome was performed usingpolymerase chain reaction (PCR technique. The primers used in this study were rDNA, P30, and B1. ThePCR products were further run using gel electrophoresis (gel 1.5% – 2.0% and the band was documented.Toxoplasma was detected at 500 bp and 600 bp using primer P30 and B1, respectively. Whereas usingprimer rDNA no band was observed. It was assumed that primer rDNA was not sensitive since the targetamplification was 88 bp.

  2. Phylogenetic Analysis of Geographically Diverse Radopholus similis via rDNA Sequence Reveals a Monomorphic Motif


    Kaplan, D. T.; Thomas, W. K.; Frisse, L. M.; Sarah, J. L.; Stanton, J. M.; Speijer, P. R.; Marin, D. H.; Opperman, C. H.


    The nucleic acid sequences of rDNA ITS1 and the rDNA D2/D3 expansion segment were compared for 57 burrowing nematode isolates collected from Australia, Cameroon, Central America, Cuba, Dominican Republic, Florida, Guadeloupe, Hawaii, Nigeria, Honduras, Indonesia, Ivory Coast, Puerto Rico, South Africa, and Uganda. Of the 57 isolates, 55 were morphologically similar to Radopholus similis and seven were citrus-parasitic. The nucleic acid sequences for PCR-amplified ITS1 and for the D2/D3 expans...

  3. Tsetse fly rDNA: an analysis of structure and sequence.


    CROSS, N.C.; Dover, G A


    A genomic library of Glossina morsitans morsitans (tsetse fly) has been constructed in the phage vector EMBL 4 and a complete rDNA unit isolated by using a D. melanogaster rDNA clone as a probe. The overall organisation is typical of higher eukaryotes, including an intergenic spacer consisting of a subrepeating structure. Atypically, however, the 45S precursor RNA promoter was shown to lie within the last subrepeat by S1 mapping; i.e. the last subrepeat extends 90 bp into the ETS. The sequenc...

  4. Systematics of Penicillium simplicissimum based on rDNA sequences, morphology and secondary metabolites

    DEFF Research Database (Denmark)

    Tuthill, D.E.; Frisvad, Jens Christian; Christensen, M.


    supported by differences in micromorphological characters, particularly of the conidia and phialides, and the production of distinct profiles of secondary metabolites by each species. Group-I introns, located in the SSU rDNA, were identified in six of the 21 isolates; their presence was used to test...

  5. Differentiation of anaerobic polycentric fungi by rDNA PCR-RFLP. (United States)

    Fliegerová, K; Mrázek, J; Voigt, K


    The suitability of restriction fragment length polymorphism (RFLP) analysis of the ribosomal DNA cluster for discriminating two genera of anaerobic polycentric fungi, Orpinomyces and Anaeromyces, was determined. Three PCR-amplified DNA fragments--nuclear small subunit (SSU; 18S rDNA), the nuclear large subunit (LSU; 28S rDNA) and internal transcribed spacer (ITS)--were restricted with endonucleases AluI, DraI, HinfI and MboI. Although the SSU DNA fragment could be restricted successfully by all four enzymes, no differences were observed between restriction patterns of Orpinomyces and Anaeromyces. The most polymorphic restriction pattern between Orpinomyces and Anaeromyces resulted from cleavage of LSU rDNA fragments cut by AluI and HinfI and ITS fragment cut by DraI and HinfI. Genus-specific RFLP patterns were determined for Orpinomyces and Anaeromyces genera; the results showed that the PCR-RFLP analysis of rDNA offers an easy and rapid tool for differentiation of two polycentric genera of anaerobic fungi, which could be hardly separated on the basis of morphology. PMID:17007423

  6. Clinorotation influences rDNA and NopA100 localization in nucleoli (United States)

    Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

    The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

  7. Nucleolar dominance and maternal control of 45S rDNA expression. (United States)

    Michalak, Katarzyna; Maciak, Sebastian; Kim, Young Bun; Santopietro, Graciela; Oh, Jung Hun; Kang, Lin; Garner, Harold R; Michalak, Pawel


    Using a system of interspecies hybrids, trihybrids, and recombinants with varying proportions of genomes from three distinct Xenopus species, we provide evidence for de novo epigenetic silencing of paternal 45 S ribosomal ribonucleic acid (rRNA) genes and their species-dependent expression dominance that escapes transcriptional inactivation after homologous recombination. The same pattern of imprinting is maintained in the offspring from mothers being genetic males (ZZ) sex-reversed to females, indicating that maternal control of ribosomal deoxyribonucleic acid (rDNA) expression is not sex-chromosome linked. Nucleolar dominance (nucleolus underdevelopment) in Xenopus hybrids appears to be associated with a major non-Mendelian reduction in the number of 45 S rDNA gene copies rather than a specific pattern of their expression. The loss of rRNA gene copies in F1 hybrids was non-random with respect to the parental species, with the transcriptionally dominant variant preferentially removed from hybrid zygotes. This dramatic disruption in the structure and function of 45 S rDNA impacts transcriptome patterns of small nucleolar RNAs and messenger RNAs, with genes from the ribosome and oxidative stress pathways being among the most affected. Unorthodoxies of rDNA inheritance and expression may be interpreted as hallmarks of genetic conflicts between parental genomes, as well as defensive epigenetic mechanisms employed to restore genome integrity. PMID:26645200

  8. Modelling the formation of polycentric chromosome aberrations

    Energy Technology Data Exchange (ETDEWEB)

    Sachs, R.K.; Tarver, J. (California Univ., Berkeley, CA (United States). Dept. of Mathematics); Yates, B.L.; Morgan, W.F. (California Univ., San Francisco, CA (United States))


    Exchange-type chromosome aberrations produced by ionizing radiation or restriction enzymes are believed to result from pairwise interaction of DNA double-strand breaks (dsb). In addition to dicentrics, such aberrations may include higher-order polycentries (tricentries, tetracentrics, etc.). The authors have developed computer programs that calculate the probability of the various polycentrics for a given average number of pairwise interactions. Two models are used. Model I incorporates kinetic competition between restitution, complete exchanges (illegitimate recombination events), and incomplete exchanges. Model II allows unrestituted breaks even if there is no recombination. The models were applied to experimental observations of aberrations produced in G[sub 1] Chinese hamster ovary cells after electroporation with the restriction enzyme PvuII, which produces blunt-end dsb. (author).

  9. Modelling the formation of polycentric chromosome aberrations

    International Nuclear Information System (INIS)

    Exchange-type chromosome aberrations produced by ionizing radiation or restriction enzymes are believed to result from pairwise interaction of DNA double-strand breaks (dsb). In addition to dicentrics, such aberrations may include higher-order polycentries (tricentries, tetracentrics, etc.). The authors have developed computer programs that calculate the probability of the various polycentrics for a given average number of pairwise interactions. Two models are used. Model I incorporates kinetic competition between restitution, complete exchanges (illegitimate recombination events), and incomplete exchanges. Model II allows unrestituted breaks even if there is no recombination. The models were applied to experimental observations of aberrations produced in G1 Chinese hamster ovary cells after electroporation with the restriction enzyme PvuII, which produces blunt-end dsb. (author)

  10. Chromosomal aberrations induced by alpha particles

    International Nuclear Information System (INIS)

    The chromosomal aberrations produced by the ionizing radiation are commonly used when it is necessary to establish the exposure dose of an individual, it is a study that is used like complement of the traditional physical systems and its application is only in cases in that there is doubt about what indicates the conventional dosimetry. The biological dosimetry is based on the frequency of aberrations in the chromosomes of the lymphocytes of the individual in study and the dose is calculated taking like reference to the dose-response curves previously generated In vitro. A case of apparent over-exposure to alpha particles to which is practiced analysis of chromosomal aberrations to settle down if in fact there was exposure and as much as possible, to determine the presumed dose is presented. (Author)

  11. Estimation of dose from chromosome aberration rate

    International Nuclear Information System (INIS)

    The methods and skills of evaluating dose from correctly scored shromsome aberration rate are presented, and supplemented with corresponding BASIC computer code. The possibility and preventive measures of excessive probability of missing score of the aberrations in some of the current routine score methods are discussed. The use of dose-effect relationship with exposure time correction factor G in evaluating doses and their confidence intervals, dose estimation in mixed n-γ exposure, and identification of high by nonuniform acute exposure to low LET radiation and its dose estimation are discussed in more detail. The difference of estimated dose due to whether the interaction between subleisoms produced by n and γ have been taken into account is examined. In fitting the standard dose-aberration rate curve, proper weighing of experiment points and comparison with commonly accepted values are emphasised, and the coefficient of variation σy√y of the aberration rate y as a function of dose and exposure time is given. In appendix I and II, the dose-aberration rate formula is derived from dual action theory, and the time variation of subleisom is illustrated and in appendix III, the estimation of dose from scores of two different types of aberrations (of other related score) is illustrated. Two computer codes are given in appendix IV, one is a simple code, the other a complete code, including the fitting of standard curve. the skills of using compressed data storage, and the production of simulated 'data ' for testing the curve fitting procedure are also given

  12. The 5s25p 2P-5s5p24P intercombination lines in the In I isoelectronic sequence from Sb III to La IX

    International Nuclear Information System (INIS)

    The 5s25p2P-5s5p24P intercombination lines in indium-like ions have been identified from Sb III to La IX. For Sb III and Te IV previously reported values are confirmed and for I V, the 5s5p24P3/2 level has been revised while all other 5s5p24P levels for all spectra have been reported for the first time. Thirty-three lines are classified, of which 20 are new. (author)

  13. The correction of electron lens aberrations

    Energy Technology Data Exchange (ETDEWEB)

    Hawkes, P.W., E-mail:


    The progress of electron lens aberration correction from about 1990 onwards is chronicled. Reasonably complete lists of publications on this and related topics are appended. A present for Max Haider and Ondrej Krivanek in the year of their 65th birthdays. By a happy coincidence, this review was completed in the year that both Max Haider and Ondrej Krivanek reached the age of 65. It is a pleasure to dedicate it to the two leading actors in the saga of aberration corrector design and construction. They would both wish to associate their colleagues with such a tribute but it is the names of Haider and Krivanek (not forgetting Joachim Zach) that will remain in the annals of electron optics, next to that of Harald Rose. I am proud to know that both regard me as a friend as well as a colleague. - Highlights: • Geometrical aberration correction. • Chromatic aberration correction. • 50 pm resolution. • High-resolution electron energy-loss spectroscopy. • Extensive bibliographies.

  14. Aberration features in directional dark matter detection

    International Nuclear Information System (INIS)

    The motion of the Earth around the Sun causes an annual change in the magnitude and direction of the arrival velocity of dark matter particles on Earth, in a way analogous to aberration of stellar light. In directional detectors, aberration of weakly interacting massive particles (WIMPs) modulates the pattern of nuclear recoil directions in a way that depends on the orbital velocity of the Earth and the local galactic distribution of WIMP velocities. Knowing the former, WIMP aberration can give information on the latter, besides being a curious way of confirming the revolution of the Earth and the extraterrestrial provenance of WIMPs. While observing the full aberration pattern requires extremely large exposures, we claim that the annual variation of the mean recoil direction or of the event counts over specific solid angles may be detectable with moderately large exposures. For example, integrated counts over Galactic hemispheres separated by planes perpendicular to Earth's orbit would modulate annually, resulting in Galactic Hemisphere Annual Modulations (GHAM) with amplitudes larger than the usual non-directional annual modulation

  15. Prenatal hydronephrosis caused by aberrant renal vessels

    DEFF Research Database (Denmark)

    Lenz, K; Thorup, Jørgen Mogens; Rabol, A;


    With routine use of obstetric ultrasonography, fetal low-grade hydronephrosis is commonly detected, but may resolve spontaneously after birth. Two cases are presented to illustrate that in some cases such findings can express intermittent hydronephrosis caused by aberrant renal vessels. Renal det...

  16. The correction of electron lens aberrations

    International Nuclear Information System (INIS)

    The progress of electron lens aberration correction from about 1990 onwards is chronicled. Reasonably complete lists of publications on this and related topics are appended. A present for Max Haider and Ondrej Krivanek in the year of their 65th birthdays. By a happy coincidence, this review was completed in the year that both Max Haider and Ondrej Krivanek reached the age of 65. It is a pleasure to dedicate it to the two leading actors in the saga of aberration corrector design and construction. They would both wish to associate their colleagues with such a tribute but it is the names of Haider and Krivanek (not forgetting Joachim Zach) that will remain in the annals of electron optics, next to that of Harald Rose. I am proud to know that both regard me as a friend as well as a colleague. - Highlights: • Geometrical aberration correction. • Chromatic aberration correction. • 50 pm resolution. • High-resolution electron energy-loss spectroscopy. • Extensive bibliographies

  17. Optical advantages of astigmatic aberration corrected heliostats (United States)

    van Rooyen, De Wet; Schöttl, Peter; Bern, Gregor; Heimsath, Anna; Nitz, Peter


    Astigmatic aberration corrected heliostats adapt their shape in dependence of the incidence angle of the sun on the heliostat. Simulations show that this optical correction leads to a higher concentration ratio at the target and thus in a decrease in required receiver aperture in particular for smaller heliostat fields.

  18. Anti-forensics of chromatic aberration (United States)

    Mayer, Owen; Stamm, Matthew C.


    Over the past decade, a number of information forensic techniques have been developed to identify digital image manipulation and falsification. Recent research has shown, however, that an intelligent forger can use anti-forensic countermeasures to disguise their forgeries. In this paper, an anti-forensic technique is proposed to falsify the lateral chromatic aberration present in a digital image. Lateral chromatic aberration corresponds to the relative contraction or expansion between an image's color channels that occurs due to a lens's inability to focus all wavelengths of light on the same point. Previous work has used localized inconsistencies in an image's chromatic aberration to expose cut-and-paste image forgeries. The anti-forensic technique presented in this paper operates by estimating the expected lateral chromatic aberration at an image location, then removing deviations from this estimate caused by tampering or falsification. Experimental results are presented that demonstrate that our anti-forensic technique can be used to effectively disguise evidence of an image forgery.

  19. Cosmological parameter estimation: impact of CMB aberration

    International Nuclear Information System (INIS)

    The peculiar motion of an observer with respect to the CMB rest frame induces an apparent deflection of the observed CMB photons, i.e. aberration, and a shift in their frequency, i.e. Doppler effect. Both effects distort the temperature multipoles alm's via a mixing matrix at any l. The common lore when performing a CMB based cosmological parameter estimation is to consider that Doppler affects only the l = 1 multipole, and neglect any other corrections. In this paper we reconsider the validity of this assumption, showing that it is actually not robust when sky cuts are included to model CMB foreground contaminations. Assuming a simple fiducial cosmological model with five parameters, we simulated CMB temperature maps of the sky in a WMAP-like and in a Planck-like experiment and added aberration and Doppler effects to the maps. We then analyzed with a MCMC in a Bayesian framework the maps with and without aberration and Doppler effects in order to assess the ability of reconstructing the parameters of the fiducial model. We find that, depending on the specific realization of the simulated data, the parameters can be biased up to one standard deviation for WMAP and almost two standard deviations for Planck. Therefore we conclude that in general it is not a solid assumption to neglect aberration in a CMB based cosmological parameter estimation

  20. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra. (United States)

    Long, Hong; Chen, Chunli; Wang, Bing; Feng, Yanni


    The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs) in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins. PMID:25723542

  1. Adaptive and aberrant reward prediction signals in the human brain.

    NARCIS (Netherlands)

    Roiser, J.P.; Stephan, K.E.; Ouden, H.E.M. den; Friston, K.J.; Joyce, E.M.


    Theories of the positive symptoms of schizophrenia hypothesize a role for aberrant reinforcement signaling driven by dysregulated dopamine transmission. Recently, we provided evidence of aberrant reward learning in symptomatic, but not asymptomatic patients with schizophrenia, using a novel paradigm

  2. Chromosomal distribution of rDNA in Pan paniscus, Gorilla gorilla beringei, and Symphalangus syndactylus: comparison to related primates

    Energy Technology Data Exchange (ETDEWEB)

    Henderson, A.S.; Atwood, K.C.; Warburton, D.


    Hybridization in situ was used to identify rDNA in chromosomes of the pygmy chimpanzee, mountain gorilla, and siamang gibbon. In contrast to other Pongids, and man, the gorilla has only two pairs of rDNA-containing chromosomes. The single pair in the siamang bears no resemblance to the nucleolar chromosome of the closely related lar gibbon. Pan paniscus and P. troglodytes have the same rDNA distribution, and similar karyotypes except in the structure of chromosome 23p. Grain counts over unbanded preparations show that the human, orangutan, and both chimpanzees have about the same total rDNA multiplicity.

  3. Molecular characterization of 18S rDNA partial sequence in Microcosmus (Stolidobranchiata, Pyuridae

    Directory of Open Access Journals (Sweden)



    Full Text Available We present a 18S rDNA based molecular phylogeny of two species of the genus Microcosmus (M. sulcatus and M. claudicans sampled in the Mediterranean, to investigate their phylogenetic position relative to species of the order Stolidobranchiata. The analysis is based on partial sequences (739 bp of the 18S rDNA. Among the 18 variable sites found between the two species, 4 correspond to transitions (ts, 14 to transversions (tv and 4 to deletions/insertions. In the considered Stolidobranchiata, we found 4.3% overall mean number of nucleotide differences and 0.06 (S.E. ±0.01 Kimura 2-parameter distance. The mean number of nucleotide differences between Microcosmus spp. and other Stolidobranchiata species was of 6% and 0.08 (S.E. ±0.01 Kimura 2-parameter distance. A molecular phylogeny obtained by Maximum Parsimony corroborates results of the traditional taxonomy.

  4. Assessment of helminth biodiversity in wild rats using 18S rDNA based metagenomics.

    Directory of Open Access Journals (Sweden)

    Ryusei Tanaka

    Full Text Available Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity.

  5. Systematics of Penicillium simplicissimum based on rDNA sequences, morphology and secondary metabolites

    DEFF Research Database (Denmark)

    Tuthill, D.E.; Frisvad, Jens Christian; Christensen, M.


    supported by differences in micromorphological characters, particularly of the conidia and phialides, and the production of distinct profiles of secondary metabolites by each species. Group-I introns, located in the SSU rDNA, were identified in six of the 21 isolates; their presence was used to test...... the P. simplicissimum group, here referred to as Penicillium spp. I, II and III. The name P. simplicissimum should be used only for isolates which closely match the neotype and NRRL 902 in all characters.......Penicillium simplicissimum is a broadly circumscribed taxon often encountered on soil community lists and in biotechnological reports. Phylogenetic analysis of the ITS1- 5.8S-ITS2 rDNA region indicated that P. simplicissimum s.l. includes several species. Recognition of these species is further...

  6. Transcription of rDNA correlates with a tendency towards intergenomic homogenization in Nicotiana polyploids

    Czech Academy of Sciences Publication Activity Database

    Nešpor Dadejová, Martina; Lim, K.Y.; Součková Skalická, Kamila; Matyášek, Roman; Leitch, A.; Kovařík, Aleš

    Heidelberg, 2007. s. 80-80. [EMBO Conference on Chromatin and Epigenetics. 03.05.2007-06.05.2007, Heidelberg] R&D Projects: GA ČR(CZ) GD204/05/H505; GA ČR(CZ) GA204/05/0687; GA ČR(CZ) GA521/07/0116; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50040507 Keywords : polyploidy * rDNA homogenization * silencing Subject RIV: BO - Biophysics

  7. Uniqueness of the Gossypium mustelinum Genome Revealed by GISH and 45S rDNA FISH

    Institute of Scientific and Technical Information of China (English)

    WU Qiong; STELLY David; SONG Guo-li; WANG Kun-bo; WANG Chun-ying; LIU Fang; LI Shao-hui; ZHANG Xiang-di; WANG Yu-hong; LIU San-hong


    @@ Gossypium mustelinum [-(AD)4"] is one of five tetraploid species in Gossypium.Three pairs of nucleolar organizer regions (NOR) in (AD)4 were detected by FISH with 45S rDNA as a probe,they also were observed with genomic DNA (gDNA) from Gossypium D genome species as probes.Of the three NORs or GISH-NORs,one was super-major and other two were minor,which was distinctly different from other tetraploid cottons.

  8. Genomic and Haplotype Comparison of Butanol Producing Bacteria Based on 16S rDNA


    Ekwan Nofa Wiratno; Suharjono; Agustin Krisna Wardani


    High butanol demand for transportation fuel triggers butanol production development. Exploration of butanolproducing bacteria using genomic comparison and biogeography will help to develop butanol industry. The objectives of this research were butanol production, genome comparison and haplotype analysis of butanolproducing bacteria from Ranu Pani Lake sediment using 16S rDNA sequences. The highest butanol concentrations were showed by Paenibacillus polymyxa RP 2.2 isolate (10.34 g...

  9. Characterizing contrasting soils and sediments with semispecific actinomycete r-DNA PCR primers

    Czech Academy of Sciences Publication Activity Database

    Hill, P.; Krištůfek, Václav; Caballero, S.; Kroetsch, D. J.; Rauch, Ota

    České Budějovice: Institute of Soil Biology AS CR, 2004, s. 88-92. ISBN 80-86525-03-1. [Present methods for investigation of microbial community biodiversity in soils and substrates. Methodological workshop /9./. České Budějovice (CZ), 02.03.2004-03.03.2004] Institutional research plan: CEZ:AV0Z6066911 Keywords : contrasting soils * sediments * semispecific actinomycete r-DNA PCR primers Subject RIV: EH - Ecology, Behaviour

  10. Plant rDNA database: ribosomal DNA loci information goes online

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Garnatje, T.; Kovařík, Aleš


    Roč. 121, č. 4 (2012), s. 389-394. ISSN 0009-5915 R&D Projects: GA ČR(CZ) GAP501/10/0208; GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Keywords : rDNA loci * FISH * database Subject RIV: BO - Biophysics Impact factor: 3.340, year: 2012

  11. Visualization of rDNA spacer transcription in Xenopus oocytes treated with fluorouridine


    Rungger, M.; Crippa, M; Trendelenburg, M F; Scheer, Ulrich; Franke, Werner W


    Under the intluence of 5-tluoro-uridine, the ultrastructure of the rDNA transcription units in Xenopus oocytes is altered. Whereas part of the matrix units maintains anormal aspect or shows various degrees of inhibition, in a strong proportion of the transcription units the alternating pattern of matrix units and fibril-free spacer regions is no longer recognized. Transcriptional complexes are found along the entire DNP axis, including the regions of the spacers. These observations support bi...

  12. Implementation Of 5S Methodology In The Small Scale Industry A Case Study


    R. S. Agrahari; P.A. Dangle; K.V.Chandratre


    Abstract 5S is a basic foundation of Lean Manufacturing systems. It is a tool for cleaning sorting organizing and providing the necessary groundwork for workpiece improvement. This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping. The improvements before and after 5S implementation is shown by pictures in the paper. It also intends to build a s...

  13. Implementation Of 5S Quality Tool In Manufacturing Company A Case Study


    Vibhor Kakkar; Vijay Singh Dalal; Vineet Choraria; Ashish S. Pareta; Anmol Bhatia


    Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivit...

  14. Primary aberrations in focused radially polarized vortex beams (United States)

    Biss, David P.; Brown, T. G.


    We study the effect of primary aberrations on the 3-D polarization of the electric field in a focused lowest order radially polarized beam. A full vector diffraction treatment of the focused beams is used. Attention is given to the effects of primary spherical, astigmatic, and comatic aberrations on the local polarization, Strehl ratio, and aberration induced degradation of the longitudinal field at focus

  15. A phylogeny of the damselfly genus calopteryx (Odonata) using mitochondrial 16S rDNA markers. (United States)

    Misof, B; Anderson, C L; Hadrys, H


    We seek to reconstruct the phylogenetic relationships of the damselfly genus Calopteryx, for which extensive behavioral and morphological knowledge already exists. To date, analyses of the evolutionary pathways of different life history traits have been hampered by the absence of a robust phylogeny based on morphological data. In this study, we concentrate on establishing phylogenetic information from parts of the 16S rDNA gene, which we sequenced for nine Calopteryx species and five outgroup species. The mt 16S rDNA data set did not show signs of saturated variation for ingroup taxa, and phylogenetic reconstructions were insensitive to variation of outgroup taxa. Parsimony, neighbor-joining, and maximum-likelihood reconstructions agreed on parts of the tree. A consensus tree summarizes the significant results and indicates problematic nodes. The 16S rDNA sequences support monophyly of the genera Mnais, Matrona, and Calopteryx. However, the genus Calopteryx may not be monophyletic, since Matrona basilaris and Calopteryx atrata are sister taxa under every parameter setting. The North American and European taxa each appear as monophyletic clades, while the Asian Calopteryx atrata and Calopteryx cornelia are not monophyletic. Our data implies a different paleobiogeographic history of the Eurasian and North American species, with extant Eurasian species complexes shaped by glacial periods, in contrast to extant North American species groups. PMID:10764530

  16. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.


    MacKay, R M; Gray, M W; Doolittle, W F


    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S ...

  17. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.


    Hori, H.; Osawa, S; Murao, K.; Ishikura, H


    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

  18. The correction of electron lens aberrations. (United States)

    Hawkes, P W


    The progress of electron lens aberration correction from about 1990 onwards is chronicled. Reasonably complete lists of publications on this and related topics are appended. A present for Max Haider and Ondrej Krivanek in the year of their 65th birthdays. By a happy coincidence, this review was completed in the year that both Max Haider and Ondrej Krivanek reached the age of 65. It is a pleasure to dedicate it to the two leading actors in the saga of aberration corrector design and construction. They would both wish to associate their colleagues with such a tribute but it is the names of Haider and Krivanek (not forgetting Joachim Zach) that will remain in the annals of electron optics, next to that of Harald Rose. I am proud to know that both regard me as a friend as well as a colleague. PMID:26025209

  19. A populational survey of 45S rDNA polymorphism in the Jefferson salamander Ambystoma jeffersonianum revealed by fluorescence in situ hybridization (FISH)

    Institute of Scientific and Technical Information of China (English)

    Ke BI; James P.BOGART; Jinzhong FU


    The chromosomal localization of 45S ribosomal RNA genes in Ambystoma jeffersonianum was determined by fluorescence in situ hybridization with 18S rDNA fragment as a probe (FISH-rDNA). Our results revealed the presence of rDNA polymorphism among A.jeffersonianum populations in terms of number, location and FISH signal intensity on the chromosomes. Nine rDNA cytotypes were found in ten geographically isolated populations and most of them contained derivative rDNA sites. Our preliminary study provides strong indication of karyotypic diversification of A.jeffersonianum that is demonstrated by intraspecific variation of 45S rDNA cytotypes. rDNA cytotype polymorphism has been described in many other caudate amphibians. We predict that habitat isolation, low dispersal ability and decline of effective population size could facilitate the fixation and accumulation of variable rDNA cytotypes during their chromosome evolution [Current Zoology 55(2):145-149,2009].

  20. Do patients with schizophrenia exhibit aberrant salience?


    Roiser, J. P.; Stephan, K E; den Ouden, H. E. M.; Barnes, T. R. E.; Friston, K.J.; Joyce, E. M.


    BACKGROUND: It has been suggested that some psychotic symptoms reflect ‘aberrant salience’, related to dysfunctional reward learning. To test this hypothesis we investigated whether patients with schizophrenia showed impaired learning of task-relevant stimulusreinforcement associations in the presence of distracting task-irrelevant cues. METHODS: We tested 20 medicated patients with schizophrenia and 17 controls on a reaction time game, the Salience Attribution Test. In this game, ...

  1. Tailored displays to compensate for visual aberrations


    Pamplona, Vitor F.; Oliveira, Manuel M.; Aliaga, Daniel G.; Raskar, Ramesh


    We introduce tailored displays that enhance visual acuity by decomposing virtual objects and placing the resulting anisotropic pieces into the subject's focal range. The goal is to free the viewer from needing wearable optical corrections when looking at displays. Our tailoring process uses aberration and scattering maps to account for refractive errors and cataracts. It splits an object's light field into multiple instances that are each in-focus for a given eye sub-aperture. Their integrati...

  2. Assessing the construct validity of aberrant salience

    Directory of Open Access Journals (Sweden)

    Kristin Schmidt


    Full Text Available We sought to validate the psychometric properties of a recently developed paradigm that aims to measure salience attribution processes proposed to contribute to positive psychotic symptoms, the Salience Attribution Test (SAT. The “aberrant salience” measure from the SAT showed good face validity in previous results, with elevated scores both in high-schizotypy individuals, and in patients with schizophrenia suffering from delusions. Exploring the construct validity of salience attribution variables derived from the SAT is important, since other factors, including latent inhibition/learned irrelevance, attention, probabilistic reward learning, sensitivity to probability, general cognitive ability and working memory could influence these measures. Fifty healthy participants completed schizotypy scales, the SAT, a learned irrelevance task, and a number of other cognitive tasks tapping into potentially confounding processes. Behavioural measures of interest from each task were entered into a principal components analysis, which yielded a five-factor structure accounting for ~75% percent of the variance in behaviour. Implicit aberrant salience was found to load onto its own factor, which was associated with elevated “Introvertive Anhedonia” schizotypy, replicating our previous finding. Learned irrelevance loaded onto a separate factor, which also included implicit adaptive salience, but was not associated with schizotypy. Explicit adaptive and aberrant salience, along with a measure of probabilistic learning, loaded onto a further factor, though this also did not correlate with schizotypy. These results suggest that the measures of learned irrelevance and implicit adaptive salience might be based on similar underlying processes, which are dissociable both from implicit aberrant salience and explicit measures of salience.

  3. FastGroupII: A web-based bioinformatics platform for analyses of large 16S rDNA libraries

    Directory of Open Access Journals (Sweden)

    McNairnie Pat


    Full Text Available Abstract Background High-throughput sequencing makes it possible to rapidly obtain thousands of 16S rDNA sequences from environmental samples. Bioinformatic tools for the analyses of large 16S rDNA sequence databases are needed to comprehensively describe and compare these datasets. Results FastGroupII is a web-based bioinformatics platform to dereplicate large 16S rDNA libraries. FastGroupII provides users with the option of four different dereplication methods, performs rarefaction analysis, and automatically calculates the Shannon-Wiener Index and Chao1. FastGroupII was tested on a set of 16S rDNA sequences from coral-associated Bacteria. The different grouping algorithms produced similar, but not identical, results. This suggests that 16S rDNA datasets need to be analyzed in multiple ways when being used for community ecology studies. Conclusion FastGroupII is an effective bioinformatics tool for the trimming and dereplication of 16S rDNA sequences. Several standard diversity indices are calculated, and the raw sequences are prepared for downstream analyses.

  4. DNA Repair Defects and Chromosomal Aberrations (United States)

    Hada, Megumi; George, K. A.; Huff, J. L.; Pluth, J. M.; Cucinotta, F. A.


    Yields of chromosome aberrations were assessed in cells deficient in DNA doublestrand break (DSB) repair, after exposure to acute or to low-dose-rate (0.018 Gy/hr) gamma rays or acute high LET iron nuclei. We studied several cell lines including fibroblasts deficient in ATM (ataxia telangiectasia mutated; product of the gene that is mutated in ataxia telangiectasia patients) or NBS (nibrin; product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase (DNA-PK) activity. Chromosomes were analyzed using the fluorescence in situ hybridization (FISH) chromosome painting method in cells at the first division post irradiation, and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma irradiation induced greater yields of both simple and complex exchanges in the DSB repair-defective cells than in the normal cells. The quadratic dose-response terms for both simple and complex chromosome exchanges were significantly higher for the ATM- and NBS-deficient lines than for normal fibroblasts. However, in the NBS cells the linear dose-response term was significantly higher only for simple exchanges. The large increases in the quadratic dose-response terms in these repair-defective cell lines points the importance of the functions of ATM and NBS in chromatin modifications to facilitate correct DSB repair and minimize the formation of aberrations. The differences found between ATM- and NBS-deficient cells at low doses suggest that important questions should with regard to applying observations of radiation sensitivity at high dose to low-dose exposures. For aberrations induced by iron nuclei, regression models preferred purely linear dose responses for simple exchanges and quadratic dose responses for complex exchanges. Relative biological effectiveness (RBE) factors of all of

  5. Radiotherapeutical chromosomal aberrations in laryngeal cancer patients

    Directory of Open Access Journals (Sweden)

    Stošić-Divjak Svetlana L.


    Full Text Available Introduction. The authors present the results of cytogenetic analysis of 21 patients with laryngeal carcinomas diagnosed and treated in the period 1995-2000 at the Institute of Otorhinolaryngology and Maxillofacial Surgery, Clinical Center of Serbia and Clinical Center of Novi Sad. Material and methods. The patients were specially monitored and the material was analyzed at the Institute of Human Genetics of the School of Medicine in Belgrade as well as in the Laboratory for Radiological Protection of the Institute of Occupational and Radiological Health 'Dr Dragomir Karajovic' in Belgrade. Results. The incidence of chromosomal aberrations and incidence of exchange of material between sister chromatids were observed in the preparation of the metaphasic lymphocyte chromosomes of the peripheral blood obtained in the culture. Structural aberrations were found on the chromosomes in the form of breakups, rings, translocations and dicentrics as early as after a single exposure of patients to tumor radiation dose of 2 Gy in the field sized 5x7. Out of the total number of 35 cultivated blood samples obtained from 13 patients, 21 were successfully cultivated and they were proved to contain chromosomal aberrations. Some of the peripheral blood samples failed to show cell growth in vitro due to the lethal cell damages in vivo. Discussion.. We have consluded that the number of structural aberrations cannot be used as a biological measure of the absorbed ionizing radiation dose. The presence of aberrations per se is indicative of the mutagenic effect of the ionizing radiation, which was also confirmed in our series on the original model by cultivation of the peripheral blood lymphocytes in the culture of the cells of the volunteer donors upon in vitro radiation. Using the method of bromdeoxyuridylreductase, the increased incidence of SCE as a mutagenic effect was registered. Conclusion. It has been concluded that the increase of absorbed radiation dose in

  6. Chromatic variation of aberration: the role of induced aberrations and raytrace direction (United States)

    Berner, A.; Nobis, T.; Shafer, D.; Gross, H.


    The design and optimization process of an optical system contains several first order steps. The definition of the appropriate lens type and the fixation of the raytrace direction are some of them. The latter can be understood as a hidden assumption rather than an aware design step. This is usually followed by the determination of the paraxial lens layout calculated for the primary wavelength. It is obvious, that for this primary wavelength the paraxial calculations are independent of raytrace direction. Today, most of the lens designs are specified not to work only for one wavelength, but in a certain wavelength range. Considering such rays of other wavelengths, one can observe that depending on the direction there will already occur differences in the first order chromatic aberrations and additionally in the chromatic variation of the third-order aberrations. The reason for this effect are induced aberrations emerging from one surface to the following surfaces by perturbed ray heights and ray angles. It can be shown, that the total amount of surface-resolved first order chromatic aberrations and the chromatic variation of the five primary aberrations can be split into an intrinsic part and an induced part. The intrinsic part is independent of the raytrace direction whereas the induced part is not.

  7. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing


    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich


    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repeti...

  8. The standard molar enthalpies of formation of Pb2Fe2O5(s) and PbFe5O8.5(s) by acid solution calorimetry

    International Nuclear Information System (INIS)

    Highlights: ► Acid solution calorimetry studies to determine the enthalpy of formation of ternary compounds in (Pb + Fe + O) system. ► Standard molar enthalpy of formation of lead ferrites at 298 K. ► The standard enthalpy of formation of Pb2Fe2O5(s) is −(1324.2 ± 11.1) kJ mol−1. ► The standard enthalpy of formation of PbFe5O8.5(s) is −(2347.8 ± 10.7) kJ mol−1. - Abstract: The standard molar enthalpies of formation, ΔfHm0 (298.15 K) of Pb2Fe2O5(s) and PbFe5O8.5(s) have been determined using acid solution calorimetry. The enthalpies of solution of the compounds Pb2Fe2O5(s) and PbFe5O8.5(s), as well as those of mixtures of Fe2O3(s) and Pb3O4(s) in HCl (aq, 6 mol·dm−3) at 298.15 K were measured. Using these values, the standard enthalpies of formation (ΔfHm0) of Pb2Fe2O5(s) and PbFe5O8.5(s) were determined as −(1324.2 ± 11.1) kJ·mol−1 and −(2347.8 ± 10.7) kJ·mol−1, respectively.

  9. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae)

    Czech Academy of Sciences Publication Activity Database

    Mahelka, Václav; Kopecký, David; Baum, B. R.


    Roč. 30, č. 9 (2013), s. 2065-2086. ISSN 0737-4038 R&D Projects: GA ČR GA13-04454S Institutional support: RVO:67985939 ; RVO:61389030 Keywords : Triticeae * polyploidy * roibosomal DNA Subject RIV: EF - Botanics; EF - Botanics (UEB-Q) Impact factor: 14.308, year: 2013

  10. Chromosomal aberrations in ISS crew members (United States)

    Johannes, Christian; Goedecke, Wolfgang; Antonopoulos, Alexandra


    High energy radiation is a major risk factor in manned space missions. Astronauts and cosmonauts are exposed to ionising radiations of cosmic and solar origin, while on the Earth's surface people are well protected by the atmosphere and a deflecting magnetic field. There are now data available describing the dose and the quality of ionising radiation on-board of the International Space Station (ISS). Nonetheless, the effect of increased radiation dose on mutation rates of ISS crew members are hard to predict. Therefore, direct measurements of mutation rates are required in order to better estimate the radiation risk for longer duration missions. The analysis of chromosomal aberrations in peripheral blood lymphocytes is a well established method to measure radiation-induced mutations. We present data of chromosome aberration analyses from lymphocyte metaphase spreads of ISS crew members participating in short term (10-14 days) or long term (around 6 months) missions. From each subject we received two blood samples. The first sample was drawn about 10 days before launch and a second one within 3 days after return from flight. From lymphocyte cultures metaphase plates were prepared on glass slides. Giemsa stained and in situ hybridised metaphases were scored for chromosome changes in pre-flight and post-flight blood samples and the mutation rates were compared. Results obtained in chromosomal studies on long-term flight crew members showed pronounced inter-individual differences in the response to elevated radiation levels. Overall slight but significant elevations of typical radiation induced aberrations, i.e., dicentric chromosomes and reciprocal translocations have been observed. Our data indicate no elevation of mutation rates due to short term stays on-board the ISS.

  11. Achieve Sustainable Hospital Excellence Through 5-S in an Emergency Department in Hong Kong

    Directory of Open Access Journals (Sweden)

    Tsoi Vincent F. K.


    Full Text Available 5-S is the first step towards TQM. Over the last century, the Japanese have formalised the technique and named it as 5-S Practice. Since 1993, Sam Ho has improved and defined its terms in English/Chinese and developed the world's first 5-S Audit Checklist. In the article, an emergency department of a Hong Kong hospital was examined against 5-S 50-point Checklist for the improvement of their quality assurance systems towards its accreditation process with Australian standards. The findings evidently reveal that the impact of 5-S on hospital quality assurance in the unit are positive. Riding on the above scenario, the research aim is to identify whether the 5-S practice is a suitable and effective tool for healthcare quality assurance in an emergency setting which is led towards its accreditation process set by other mechanisms.

  12. Genomic and Haplotype Comparison of Butanol Producing Bacteria Based on 16S rDNA

    Directory of Open Access Journals (Sweden)

    Ekwan Nofa Wiratno


    Full Text Available High butanol demand for transportation fuel triggers butanol production development. Exploration of butanolproducing bacteria using genomic comparison and biogeography will help to develop butanol industry. The objectives of this research were butanol production, genome comparison and haplotype analysis of butanolproducing bacteria from Ranu Pani Lake sediment using 16S rDNA sequences. The highest butanol concentrations were showed by Paenibacillus polymyxa RP 2.2 isolate (10.34 g.L-1, followed by Bacillus methylotrophicus RP 3.2 and B. methylotrophicus RP 7.2 isolate (10.11 g.L-1 and 9.63 g.L-1 respectively. Paenibacillus polymyxa RP 2.2 showed similarity in nucleotide composition (ATGC with B. methylotrophicus RP 3.2, B. methylotrophicus RP 7.2, P. polymyxa CR1, Bacillus amyloliquefaciens NELB-12, and Paenibacillus polymyxa WR-2. Clostridium acetobutylicum ATCC 824 showed similarity in nucleotide composition (ATGC with Clostridium saccharoperbutylacetonicum N1-4, and Clostridium saccharobutylicum Ox29. The lowest G+C content was C. saccharobutylicum Ox29 (51.35%, and the highest was B. methylotrophicus RP 7.2 (55.33%. Conserved region of 16S rDNA (1044 bp were consisted of 17 conserved sequences. The number of Parsimony Informative Site (PIS was 319 spot and single tone was 48 spot. We found in this study that all of butanolproducing bacterial DNA sequences have clustered to 8 haplotypes. Based on the origin of sample, there were three haplotype groups. Bacteria from group A were could produce butanol 8.9-10.34 g.L-1, group B 9.2-14.2 g.L-1 and group C was could produce butanol 0.47 g.L-1. The haplotype analysis of bacteria based on 16S rDNA sequences in this study could predict capability of butanol production.

  13. Aberrant splicing and drug resistance in AML. (United States)

    de Necochea-Campion, Rosalia; Shouse, Geoffrey P; Zhou, Qi; Mirshahidi, Saied; Chen, Chien-Shing


    The advent of next-generation sequencing technologies has unveiled a new window into the heterogeneity of acute myeloid leukemia (AML). In particular, recurrent mutations in spliceosome machinery and genome-wide aberrant splicing events have been recognized as a prominent component of this disease. This review will focus on how these factors influence drug resistance through altered splicing of tumor suppressor and oncogenes and dysregulation of the apoptotic signaling network. A better understanding of these factors in disease progression is necessary to design appropriate therapeutic strategies recognizing specific alternatively spliced or mutated oncogenic targets. PMID:27613060

  14. Aberrations in Fresnel Lenses and Mirrors (United States)

    Gregory, Don


    The NASA/MSFC Shooting Star program revealed a number of technical problems that must be solved before solar thermal propulsion can become a reality. The fundamental problem of interest here is the collection of solar energy. This is the first step in the propulsion process and indeed the most important. Everything else depends on the efficiency and focusing ability of the collection lens or mirror. An initial model of Fresnel lens behavior using a wave optics approach has been completed and the results were encouraging enough to warrant an experimental investigation. This experimental investigation confirmed some of the effects predicted and produced invaluable photographic evidence of coherence based diffraction and aberration.

  15. Sequence comparison of the rDNA introns from six different species of Tetrahymena

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Engberg, J


    We have studied the sequence variation of the rDNA intron among six species of Tetrahymena. From these data, the intron appears to be relatively well conserved in evolution. We have evaluated the sequence variations among the most distant of these species in relation to the secondary structure...... involving compensating base pair changes. Interestingly, one of these is found in a region that is known to be dispensable in the in vitro splicing reaction suggesting differences between the in vivo and in vitro reactions. One of the single nucleotide deletions is found in the so-called "internal guide...

  16. Implementation Of 5S Methodology In The Small Scale Industry A Case Study

    Directory of Open Access Journals (Sweden)

    R. S. Agrahari


    Full Text Available Abstract 5S is a basic foundation of Lean Manufacturing systems. It is a tool for cleaning sorting organizing and providing the necessary groundwork for workpiece improvement. This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping. The improvements before and after 5S implementation is shown by pictures in the paper. It also intends to build a stronger work ethic within the management and workers who would be expected to continue the good practices.

  17. Implementation Of 5S Quality Tool In Manufacturing Company A Case Study

    Directory of Open Access Journals (Sweden)

    Vibhor Kakkar


    Full Text Available Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivity of the company is enhanced to 91 .

  18. The 5S methodology as a tool for improving the organisation


    J. Michalska; D. Szewieczek


    Purpose: The aim of this paper is showing the 5S methodology. In this paper it was introduced the way of implementing the 5S methodology in the company.Design/methodology/approach: In the frames of own research it has been analysed and implemented the 5S rules in the production process.Findings: On the basis of the own research it can be stated, that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs’ reduction, increasing of effectivene...

  19. Implementation of 5S Practices in the Manufacturing Companies: A Case Study

    Directory of Open Access Journals (Sweden)

    Mohd N.A. Rahman


    Full Text Available Problem statement: 5S practice is one of the techniques to improve quality environment, health and safety at the workplace. Evaluation of 5S practice can be done through implementation of 5S audit at each division in the company. Approach: Through 5S audit, it enables each company to identify the potential level of quality improvement and at the same time can analyze their ability and weakness of each division in the company. Therefore, in order to assess the implementation of 5S practice, two manufacturing companies were involved in this study. Results: The study started with understanding background of the company, recognizing divisions to be assessed in the company and come out with the complete 5S checklist for each division for auditing process. Based on the result, both companies basically perform an excellent 5S practice, but there are a few weaknesses that still need to be considered such as arrangement of the documents, tool and equipment. Conclusion/Recommendations: Moreover, both companies agreed that the 5S practice is seen as an effective technique that can improve housekeeping, environmental performance, health and safety standards in their workplace. However, effort and participation from top management is a key factor that determines the success of the 5S practice.

  20. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina


    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert



  1. Sensitivity of singular beams in the presence of Zernike aberrations (United States)

    Dixit, Awakash; Mishra, Sanjay Kumar; Gupta, Arun Kumar


    Singular beams in the presence of Zernike aberrations create an opportunity for various applications such as trapping and manipulation of micro-particles, atomic optics and atmospheric optics. In the milieu of importance of the role of aberrations, sensitivity of singular beams with Zernike aberrations is studied. In this paper, the effect of various Zernike aberrations on a singular beam is reported in terms of its Point Spread Function (PSF) deformations. The intensity distributions around the focal plane, i.e. PSF, of the singular beam of various topological charges and in the presence of different strengths of Zernike aberrations are theoretically estimated by the Huygens-Fresnel diffraction integral. Experimentally, the singular beams have been generated and known strengths of Zernike aberration introduced in the beam by a phase-only Spatial Light Modulator. Metric Ensquared Energy is used to analyze the PSF of the corresponding intensity distributions of the singular beams. The experimental results have been validated with numerical simulation.

  2. Calculation of aberration of electron gun in color picture tubes

    International Nuclear Information System (INIS)

    In a color picture tube, aberration is an important factor influencing the electron beam spot on the screen. This paper discusses a new method which is used to calculate the aberration of an electron gun in a CPT. In this method, electron trajectories are simulated directly in the cathode and the pre-focus lens. In the main lens, the asymptotic aberration is calculated to decide the size of the image. Some results of the calculation are shown in this paper. (orig.)

  3. Monitoring of chromosomal aberrations in natural populations of Pinus pallasiana


    V. P. Koba


    This paper presents the results of monitoring research of the chromosome aberrations at the stage of anaphase-telophase. The statistical characteristics of dynamics of chromosomal aberrations in populations of Pinus pallasiana D. Don across the high-altitude zones of the Mountain Crimea is given. It is established that on the southern macroslope of the Crimean Main Ridge the frequency of chromosomal aberrations in the P. pallasiana stands is higher in the lower zone in comparison with the mid...

  4. Aberrations caused by mechanical misalignments in electrostatic quadrupole lens systems (United States)

    Baranova, L. A.; Read, F. H.

    Image aberrations resulting from small misalignments in quadrupole lenses multiplets have been analysed. Analytical formulas for the coefficients of the beam displacement, astigmatism and coma associated with misalignments in a general quadrupole lens system have been derived. Numerical computations of systems of three and four quadrupole lenses have also been carried out. The aberration figures obtained for systems with and without a mechanical defect are compared. The aberration coefficients that have been obtained can be used for estimating tolerance limits for lens misalignments.

  5. Chromosomal aberrations in children exposed to diagnostic x-rays

    International Nuclear Information System (INIS)

    Among children who have received high x-ray doses congenital dislocation of the hip joint is the predominating diagnosis. In a series of 9 children who had received high x-ray doses (8 with luxation of the hip joint and one with achondroplasia) a significant increase of chromosomal aberrations was found. The increase concerned mainly chromosome type aberrations. The shorter the time since the last x-ray investigation the higher was the frequency of chromosome type aberrations. (author)

  6. Hydronephrosis by an Aberrant Renal Artery: A Case Report


    Park, Byoung Seok; Jeong, Taek Kyun; Ma, Seong Kwon; Kim, Soo Wan; Kim, Nam Ho; Choi, Ki Chul; Jeong, Yong Yeon


    Ureteropelvic junction obstruction is usually intrinsic and is most common in children. Aberrant renal arteries are present in about 30% of individuals. Aberrant renal arteries to the inferior pole cross anteriorly to the ureter and may cause hydronephrosis. To the best of our knowledge, although there are some papers about aberrant renal arteries producing ureteropelvic junction obstruction, there is no report of a case which is diagnosed by the new modalities, such as computed tomography an...

  7. Pattern of Chromosomal Aberrations in Patients from North East Iran


    Saeedeh Ghazaey; Farzaneh Mirzaei; Mitra Ahadian; Fatemeh Keifi; Semiramis Tootian; Mohammad Reza Abbaszadegan


    Objective: Chromosomal aberrations are common causes of multiple anomaly syndromes. Recurrent chromosomal aberrations have been identified by conventional cytogenetic methods used widely as one of the most important clinical diagnostic techniques. Materials and Methods: In this retrospective study, the incidences of chromosomal aberrations were evaluated in a six year period from 2005 to 2011 in Pardis Clinical and Genetics Laboratory on patients referred to from Mashhad and other cities in K...

  8. Hot spots of DNA double-strand breaks in human rDNA units are produced in vivo. (United States)

    Tchurikov, Nickolai A; Yudkin, Dmitry V; Gorbacheva, Maria A; Kulemzina, Anastasia I; Grischenko, Irina V; Fedoseeva, Daria M; Sosin, Dmitri V; Kravatsky, Yuri V; Kretova, Olga V


    Endogenous hot spots of DNA double-strand breaks (DSBs) are tightly linked with transcription patterns and cancer genomics(1,2). There are nine hot spots of DSBs located in human rDNA units(3-6). Here we describe that the profiles of these hot spots coincide with the profiles of γ-H2AX or H2AX, strongly suggesting a high level of in vivo breakage inside rDNA genes. The data were confirmed by microscopic observation of the largest γ-H2AX foci inside nucleoli in interphase chromosomes. In metaphase chromosomes, we observed that only some portion of rDNA clusters possess γ-H2AX foci and that all γ-H2AX foci co-localize with UBF-1 binding sites, which strongly suggests that only active rDNA units possess the hot spots of DSBs. Both γ-H2AX and UBF-1 are epigenetically inherited and thus indicate the rDNA units that were active in the previous cell cycle. These results have implications for diverse fields, including epigenetics and cancer genomics. PMID:27160357

  9. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice. (United States)

    Allen, Julie M; Burleigh, J Gordon; Light, Jessica E; Reed, David L


    Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura). We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain. PMID:27547523

  10. Karyotype analysis and physical mapping of 45S rDNA in eight species of Sophora,Robinia,and Amorpha

    Institute of Scientific and Technical Information of China (English)

    LIU Bo; CHEN Chengbin; LI Xiulan; QI Liwang; HAN Suying


    The karyotype analysis and physical locations of 45S rDNA were carried out by means of fluorescence in situ hybridization in three species,and two forms of Sophora,two species of Robina,and one species of Amorpha.S.japonica L.,S.japonica L.f.oligophylla Franch.,S.japonica L.f.pendula Loud.,and S.xanthantha C.Y.Ma.are all tetraploids with 2n=28.There were four 45S rDNA sites in pericentromeric regions of two Pairs of chromosomes in each of them.S.rubriflora a triploid with 2n=21,and three sites were located in each satellite of group 5 chromosomes.In R.pseudoacacia L.(2n=2x=22),we examined four intensive signals in telomeric regions of two pairs of satellite chromosomes.In R.hispida L.(2n=2x=30),there were four other signals in centromeric regions besides those like in R.pseudoacacia.Amorpha fruticosa L.has most chromosomes(2n=40)among the eight materials,however,there were only six 45S rDNA loci and they laid in centromeric regions,and satellites of three pairs of chromosomes.45S rDNA is a valuable chromosomal landmark in karyotype analysis.The distribution and genomic organization Of rDNA in the three genera were also discussed.

  11. Construction of Porphyra yezoensis Pure Line from Protoplasts and Its 18S rDNA Sequence Determination

    Institute of Scientific and Technical Information of China (English)

    LIU Hongquan; YU Wengong; DAI Jixun; GONG Qianhong; SHI Xiaochong; YANG Kunfeng


    The wild Porphyra yezoensis collected from the Qingdao coast was used to prepare protoplasts by enzyme digestion. The pure line was constructed by cultivating the protoplasts. The 18S rDNA of the P. yezoensis pure line was cloned and sequenced. Sequence analysis was executed for this sequence and other 22 sequences retrieved from GenBank. A phylogenetic tree was constructed using the neighbor-joining method. The results revealed a high diversity of 18S rDNA sequences in genus Porphyra and the considerable variation of 18S rDNA sequences in different strains of the same species P. yezoensis and P. tenera. Significant difference of 18S rDNA sequence was observed between P. yezoensis from Qingdao, China, and the two strains of P. yezoensis from Japan, but the three strains of P. yezoensis formed a stable clade in the phylogenetic tree. These results indicate the possibility of interspecies and intraspecies discrimination of Porphyra using the 18S rDNA sequences.

  12. Chromosome aberration analysis for biological dosimetry: a review

    International Nuclear Information System (INIS)

    Among various biological dosimetry techniques, dicentric chromosome aberration method appears to be the method of choice in analysing accidental radiation exposure in most of the laboratories. The major advantage of this method is its sensitivity as the number of dicentric chromosomes present in control population is too small and more importantly radiation induces mainly dicentric chromosome aberration among unstable aberration. This report brings out the historical development of various cytogenetic methods, the basic structure of DNA, chromosomes and different forms of chromosome aberrations. It also highlights the construction of dose-response curve for dicentric chromosome and its use in the estimation of radiation dose. (author)

  13. Cellular origin of prognostic chromosomal aberrations in AML patients

    DEFF Research Database (Denmark)

    Mora-Jensen, H.; Jendholm, J.; Rapin, N.;


    these aberrations occur in normal hematopoietic stem and progenitor cells (HSCs/HPCs) before definitive leukemic transformation through additional acquisition of a few (that is, mostly 1 or 2) leukemia-promoting driver aberrations. NGS studies on sorted bone marrow (BM) populations of AML patients with...... molecular aberrations that were present in the fully transformed committed HPCs together with the prognostic driver aberration. Adding to this vast heterogeneity and complexity of AML genomes and their clonal evolution, a recent study of a murine AML model demonstrated that t(9;11) AML originating from HSCs...

  14. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A


    stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution...

  15. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A


    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecule...

  16. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.


    Hori, H; Sawada, M.; Osawa, S; Murao, K; Ishikura, H


    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

  17. The 5S methodology as a tool for improving the organisation

    Directory of Open Access Journals (Sweden)

    J. Michalska


    Full Text Available Purpose: The aim of this paper is showing the 5S methodology. In this paper it was introduced the way of implementing the 5S methodology in the company.Design/methodology/approach: In the frames of own research it has been analysed and implemented the 5S rules in the production process.Findings: On the basis of the own research it can be stated, that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs’ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines’ efficiency, safety increasing and reduction of the industry pollution, proceedings according to decisions.Research limitations/implications: The 5S methodology permits to analyse the processes running on the workplace. The 5S is the methodology of creation and maintaining well organized, clean, high effective and high quality workplace.Practical implications: Own research clearly showed, that very essential is training of workers about the 5S rules. Essential thing is to divide activities on some main steps and to maintain the continuous improvement.Originality/value: The 5S method begins each programme of improvement in a company. This method can be used in all companies. Its result is the effective organization of the workplace.

  18. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E


    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  19. The 5S lean method as a tool of industrial management performances (United States)

    Filip, F. C.; Marascu-Klein, V.


    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  20. Initial results on the molecular phylogeny of the Nudibranchia (Gastropoda, Opisthobranchia) based on 18S rDNA data. (United States)

    Wollscheid, E; Wägele, H


    This study investigated nudibranch phylogeny on the basis of 18S rDNA sequence data. 18S rDNA sequence data of 19 taxa representing the major living orders and families of the Nudibranchia were analyzed. Representatives of the Cephalaspidea, Anaspidea, Gymnomorpha, Prosobranchia, and Pulmonata were also sequenced and used as outgroups. An additional 28 gastropod sequences taken from GenBank were also included in our analyses. Phylogenetic analyses of these more than 50 gastropod taxa provide strong evidence for support of the monophyly of the Nudibranchia. The monophyly of the Doridoidea, Cladobranchia, and Aeolidoidea within the Nudibranchia are also strongly supported. Phylogenetic utility and information content of the 18S rDNA sequences for Nudibranchia, and Opisthobranchia in general, are examined using the program SplitsTree as well as phylogenetic reconstructions using distance and parsimony approaches. 0Results based on these molecular data are compared with hypotheses about nudibranch phylogeny inferred from morphological data. PMID:10603252

  1. Diversity analysis of Bemisia tabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region

    Directory of Open Access Journals (Sweden)

    Aline R. Rabello


    Full Text Available The Bemisia tabaci complex is formed by approximately 41 biotypes, two of which (B and BR occur in Brazil. In this work we aimed at obtaining genetic markers to assess the genetic diversity of the different biotypes. In order to do that we analyzed Bemisia tabaci biotypes B, BR, Q and Cassava using molecular techniques including RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. The analyses revealed a high similarity between the individuals of the B and Q biotypes, which could be distinguished from the BR individuals. A phylogenetic tree based on ITS1 rDNA sequence was constructed. This is the first report of the ITS1 rDNA sequence of Bemisia tuberculata and of the BR biotype of B. tabaci.

  2. Organizational Culture 5 S Based on Self - organization Theory%基于自组织理论的企业文化5S

    Institute of Scientific and Technical Information of China (English)



    Based on self - organization theory, this paper puts forward organization cultural 5S, namely synergy, struggle, study, system, and style. On the basis of competition & cooperation dynamic principle and hyper cycle mechanism of self -organization theory, we discuss the interactions of cultural 5S factors which can be summarized by 5S diamond model, and the dynamical evolvement principle of the 5S system. Study is a fluctuation to systems, and systems' evolvements are driven by of synergy and struggle of subsystems; systems consolidate the result of the 3S, and style is produced by the reci-procity of the above 4S. The cultural 5S system' s development can be explained by the hyper cycle process of the 5S fac-tors. Form the above we propose the organization cultural promotion strategies and attempt to provide a reference for con-struction of enterprise culture to organizations.%基于自组织理论提出了企业文化5S,即协同(Synergy)、竞争(Struggle)、学习(Study)、制度(System)、素养(Style);结合自组织理论中的竞争协同机制构建了“企业文化5S钻石模型”以阐释5S各因素间的作用关系:学习形成了系统的涨落力,协同、竞争为文化系统的演进发展提供了动力,制度是对3S成果的巩固和保障,四者的共同作用形成了组织成员的素养;运用超循环原理解释了文化5S系统的动态演进规律.在理论探讨的基础上,提出了企业文化的建设策略,尝试为组织的企业文化建设提供战略指导和实践帮助.

  3. Aberrant angiogenesis: The gateway to diabetic complications

    Directory of Open Access Journals (Sweden)

    Sunil K Kota


    Full Text Available Diabetes Mellitus is a metabolic cum vascular syndrome with resultant abnormalities in both micro- and macrovasculature. The adverse long-term effects of diabetes mellitus have been described to involve many organ systems. Apart from hyperglycemia, abnormalities of angiogenesis may cause or contribute toward many of the clinical manifestations of diabetes. These are implicated in the pathogenesis of vascular abnormalities of the retina, kidneys, and fetus, impaired wound healing, increased risk of rejection of transplanted organs, and impaired formation of coronary collaterals. A perplexing feature of the aberrant angiogenesis is that excessive and insufficient angiogenesis can occur in different organs in the same individual. The current article hereby reviews the molecular mechanisms including abnormalities in growth factors, cytokines, and metabolic derangements, clinical implications, and therapeutic options of dealing with abnormal angiogenesis in diabetes.

  4. Specific Detection of Peronospora tabacina by PCR-amplified rDNA Sequences


    Jwu-Guh Tsay; Chishih Chu; Ya-Han Chuang; Ruey-Shyang Chen


    Peronospora tabacina Adam, a downy mildew fungus, is a devastating disease of tobacco and a pathogen of import prohibition in Taiwan. For quarantine purpose, we developed a nested PCR method to detect this pathogen. With universal primer pair ITS1/ITS4, internal transcribed spacer (ITS) region of pathogen`s rDNA was amplified. Specific PCR primers (PT1/PT2) were designed based on ITS sequence and used to amplify a 493-bp rDNA fragments from P. tabacina. In order to increase the sensitivity, a...

  5. Measurement of B[Y(5S)->Bs(*) anti-Bs(*)] Using phi Mesons

    CERN Document Server

    Huang, G S; Adams, G S; Alexander, J P; Anderson, M; Aquines, O; Artuso, M; Asner, D M; Athar, S B; Berkelman, K; Besson, D; Blusk, S; Bonvicini, G; Briere, R A; Brock, I; Butt, J; Cassel, D G; Cawlfield, C; Chen, J; Cinabro, D; Coan, T E; Cronin-Hennessy, D; Csorna, S E; Cummings, J P; Danko, I; Dobbs, S; Duboscq, J E; Dubrovin, M; Dytman, S A; Ecklund, K M; Edwards, K W; Ehrlich, R; Eisenstein, B I; Ernst, J; Ferguson, T; Fields, L; Gao, K Y; Gao, Y S; Gibbons, L; Gong, D T; Gray, R; Gray, S W; Hartill, D L; He, Q; Heltsley, B K; Hertz, D; Hietala, J; Huang, G S; Insler, J; Jones, C D; Kandaswamy, J; Karliner, I; Kim, D; Klein, T; Kreinick, D L; Kubota, Y; Kuznetsov, V E; Lang, B W; Li, J; Li, Z; Lincoln, A; Liu, F; Love, W; Lowrey, N; López, A; Mahlke-Krüger, H; Mehrabyan, S S; Menaa, N; Metreveli, Z V; Miller, D H; Mountain, R; Muramatsu, H; Méndez, H; Naik, P; Napolitano, J; Nisar, S; Onyisi, P U E; Park, C S; Patel, R; Patterson, J R; Pavlunin, V; Pedlar, T K; Peterson, D; Pivarski, J; Poling, R; Potlia, V; Ramírez, J; Randrianarivony, K; Redjimi, R; Riley, D; Rosner, J L; Rubin, P; Ryd, A; Sadoff, A J; Sanghi, B; Savinov, V; Schwarthoff, H; Scott, A W; Sedlack, C; Selen, M; Seth, K K; Severini, H; Shepherd, M R; Shi, X; Shipsey, I P J; Sia, R; Skwarnicki, T; Smith, A; Stone, S; Stroiney, S; Sun, W M; Tatishvili, G T; Thorndike, E H; Tomaradze, A G; Vogel, H; Wang, J C; Watkins, M E; Weinberger, M; White, E J; Wilksen, T; Wiss, J; Xin, B; Yang, F; Yelton, J; Zhang, K; Zweber, P; al., et


    Knowledge of the Bs decay fraction of the Y(5S) resonance, fs, is important for Bs meson studies at the Y(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423/fb on the Y(5S) resonance, 6.34/fb on the Y(4S) and 2.32/fb in the continuum below the Y(4S), we measure B(Y(5S) -> phi X)=(13.8 +/- 0.7 {+2.3}{-1.5})% and B(Y(4S) -> phi X) = (7.1 +/- 0.1 +/-0.6)%; the ratio of the two rates is (1.9 +/- 0.1 {+0.3}{-0.2}). This is the first measurement of the phi meson yield from the Y(5S). Using these rates, and a model dependent estimate of B(Bs -> phi X), we determine fs = (24.6 +/- 2.9 {+11.0}{-5.3})%. We also update our previous independent measurement of fs made using the inclusive Ds yields to now be (16.8 +/- 2.6 {+6.7}{-3.4)%, due to a better estimate of the number of hadronic events. We also report the total Y(5S) hadronic cross section above continuum to be sigma(e^+e^- -> Y(5S))=(0.301 +/- 0.002 +/- 0.039) nb. This allows us to extract the fraction of B mesons as (58...

  6. Measurement of B9Upsilon(5S) to Bs(*) Bs(*)bar Using phi Mesons

    CERN Document Server

    Huang, G; Pavlunin, V; Sanghi, B; Shipsey, I P J; Xin, B; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Insler, J; Muramatsu, H; Park, C S; Thorndike, E H; Yang, F; Coan, T E; Gao, Y S; Liu, F; Artuso, M; Blusk, S; Butt, J; Li, J; Menaa, N; Mountain, R; Nisar, S; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Asner, D M; Edwards, K W; Briere, R A; Brock, I; Chen, J; Ferguson, T; Tatishvili, G T; Vogel, H; Watkins, M E; Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Gibbons, L; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Onyisi, P U E; Patterson, J R; Peterson, D; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Stroiney, S; Sun, W M; Wilksen, T; Weinberger, M; Athar, S B; Patel, R; Potlia, V; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Wiss, J; Shepherd, M R; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Poling, R; Scott, A W; Smith, A; Zweber, P; Dobbs, S; Metreveli, Z V; Seth, K K; Tomaradze, A G; Ernst, J; Severini, H; Dytman, S A; Love, W; Savinov, V; Aquines, O; Li, Z; López, A; Mehrabyan, S S; Méndez, H; Ramírez, J; al, et


    Knowledge of the Bs decay fraction of the Y(5S) resonance, fs, is important for Bs meson studies at the Y(5S) energy. Using data collected by the CLEO III detector at CESR consisting of 0.423 1/fb on the Y(5S) resonance, 6.34 1/fb on the Y(4S) and 2.32 1/fb in the continuum below the Y(4S), we measure B(Y(5S)-> phi X)=(13.2+/- 0.7 ^{+2.2}_{-1.4})% and B(Y (4S)-> phi X)=(7.1 +/- 0.1 +/- 0.6)%, the ratio of the two rates is (1.9 +/- 0.1 ^{+0.3}_{-0.2}). This is the first measurement of the phi meson yield from the Y(5S). Using these rates, and a model dependent estimate of B(Bs -> phi X), we measure fs=(27.3 +/- 3.2 ^{+14.6}_{-~6.1})%. We update our previous, independent measurement of this branching fraction using the inclusive Ds yields to be (21.8 +/- 3.4 ^{+8.5}_{-4.2})%, due to changes in the $D_s^+ -> phi \\pi^+$ branching fraction and a better estimate of the number of hadronic events. We also report the total Y(5S) hadronic cross section above continuum to be sigma(e^+e^- -> Y(5S))=(0.301 +/- 0.002 +/- 0...

  7. Using nodal aberration theory to understand the aberrations of multiple unobscured three mirror anastigmatic (TMA) telescopes (United States)

    Thompson, Kevin P.; Fuerschbach, Kyle; Schmid, Tobias; Rolland, Jannick P.


    The alignment of three mirror anastigmatic (TMA) telescopes has been studied since their invention in the 60s. Recently, Thompson et al.1 reported that other than the conventional uniform coma over the field caused by misalignment, TMA telescopes display only one other misalignment induced aberration, field-asymmetric, field-linear astigmatism. Currently, an instrument with three TMAs is under development as the primary spectrometer on the James Webb Space Telescope. This paper will report on the application of Nodal Aberration Theory (NAT) to understanding the optical design of an optical system with multiple TMAs as a first step towards investigating and potentially independently analyzing the sensitivities to alignment of this key instrument.

  8. Expressions for third-order aberration theory for holographic images

    Indian Academy of Sciences (India)

    S K Tripathy; S Ananda Rao


    Expressions for third-order aberration in the reconstructed wave front of point objects are established by Meier. But Smith, Neil Mohon, Sweatt independently reported that their results differ from that of Meier. We found that coefficients for spherical aberration, astigmatism, tally with Meier’s while coefficients for distortion and coma differ.

  9. Fifth-order aberrations in magnetic quadrupole-octupole systems

    International Nuclear Information System (INIS)

    Explicit integral expressions are given for the fifth-order geometrical aberration coefficients in rectilinear magnetic quadrupole-octupole systems used for the transport of nonrelativistic charged particle beams. The numerical values of the fifth-order geometrical aberration coefficients for a rare earth cobalt (REC) quadrupole doublet are given as an example. 26 refs., 5 figs., 4 tabs

  10. Aberration analysis calculations for synchrotron radiation beamline design

    International Nuclear Information System (INIS)

    The application of ray deviation calculations based on aberration coefficients for a single optical surface for the design of beamline optical systems is reviewed. A systematic development is presented which allows insight into which aberration may be causing the rays to deviate from perfect focus. A new development allowing analytical calculation of line shape is presented

  11. Statistical virtual eye model based on wavefront aberration


    Wang, Jie-Mei; Liu, Chun-Ling; Luo, Yi-Ning; Liu, Yi-Guang; Hu, Bing-Jie


    Wavefront aberration affects the quality of retinal image directly. This paper reviews the representation and reconstruction of wavefront aberration, as well as the construction of virtual eye model based on Zernike polynomial coefficients. In addition, the promising prospect of virtual eye model is emphasized.

  12. Exact solutions in the scalar diffraction theory of aberrations. (United States)

    Budgor, A B


    A simple exact method is presented for evaluating the circularly symmetric Fresnel-Kirchhoff diffraction integral in the presence of Seidel aberrations, all orders of spherical aberration, and all orders of linear coma. The resultant formulas involve a simple quadrature over a single special function of mathematics. PMID:20221084

  13. Exact solutions in the scalar diffraction theory of aberrations

    International Nuclear Information System (INIS)

    A simple exact method is presented for evaluating the circularly symmetric Fresnel-Kirchhoff diffraction integral in the presence of Seidel aberrations, all orders of spherical aberration, and all orders of linear coma. The resultant formulas involve a simple quadrature over a single special function of mathematics

  14. 5S-menetelmän käyttöönottosuunnitelma


    Väyrynen, Panu


    Tämän opinnäytetyön aiheena oli suunnitella Junttan Oy:n toimintamalliin soveltuvat työkalut 5S:n käyttöönottamiseksi paalutuskoneiden kokoonpanotehtaassa. 5S on yksi Leanin tuotantofilosofian toteuttamiseen käytettävistä menetelmistä, jolla työpaikasta saadaan viiden toimenpiteen avulla tuottavampi, laadukkaampi, turvallisempi ja viihtyisämpi. 5S tulee japaninkielen sanoista seiri (erot-tele), seiton (yksinkertaista), seiso (puhdista), seiketsu (systematisoi) ja shitsuke (standardoi). Työn t...



    Pälli, Timo


    Tämä opinnäytetyö työ tehtiin MastCraft Oy:n tarpeisiin. MastCraft Oy on ylivieskalainen erilaisia teräsrakenteita valmistava yritys. Yrityksellä on vuosikymmenten historia teleliikennemastojen valmistamisesta. Työn organisointiin ja työtapoihin kaivattiin uudistamista. Opinnäytetyön aiheena oli suunnitella 5S-menetelmä ja layout yrityksen tarpeisiin. 5S on laatutyökalu, jonka avulla organisoidaan uudelleen työskentely-ympäristöä. 5S:n avulla saadaan aikaan siisti, toimiva ja turval...

  16. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    DEFF Research Database (Denmark)

    Brown, S; Fournier, M J


    the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

  17. Brown's transport up to third order aberration by artificial intelligence

    International Nuclear Information System (INIS)

    Brown's TRANSPORT is a first and second order matrix multiplication computer program intended for the design of accelerator beam transport systems, neglecting the third order aberration. Recently a new method was developed to derive analytically any order aberration coefficients of general charged particle optic system, applicable to any practical systems, such as accelerators, electron microscopes, lithographs, including those unknown systems yet to be invented. An artificial intelligence program in Turbo Prolog was implemented on IBM-PC 286 or 386 machine to generate automatically the analytical expression of any order aberration coefficients of general charged particle optic system. Based on this new method and technique, Brown's TRANSPORT is extended beyond the second order aberration effect by artificial intelligence, outputting automatically all the analytical expressions up to the third order aberration coefficients

  18. Chromosome aberration analysis based on a beta-binomial distribution

    International Nuclear Information System (INIS)

    Analyses carried out here generalized on earlier studies of chromosomal aberrations in the populations of Hiroshima and Nagasaki, by allowing extra-binomial variation in aberrant cell counts corresponding to within-subject correlations in cell aberrations. Strong within-subject correlations were detected with corresponding standard errors for the average number of aberrant cells that were often substantially larger than was previously assumed. The extra-binomial variation is accomodated in the analysis in the present report, as described in the section on dose-response models, by using a beta-binomial (B-B) variance structure. It is emphasized that we have generally satisfactory agreement between the observed and the B-B fitted frequencies by city-dose category. The chromosomal aberration data considered here are not extensive enough to allow a precise discrimination between competing dose-response models. A quadratic gamma ray and linear neutron model, however, most closely fits the chromosome data. (author)

  19. Brown's TRANSPORT up to third order aberration by artificial intelligence

    International Nuclear Information System (INIS)

    Brown's TRANSPORT is a first and second order matrix multiplication computer program intended for the design of accelerator beam transport systems, neglecting the third order aberration. Recently a new method was developed to derive analytically any order aberration coefficients of general charged particle optic system, applicable to any practical systems, such as accelerators, electron microscopes, lithographs, etc., including those unknown systems yet to be invented. An artificial intelligence program in Turbo Prolog was implemented on IBM-PC 286 or 386 machine to generate automatically the analytical expression of any order aberration coefficients of general charged particle optic system. Based on this new method and technique, Brown's TRANSPORT is extended beyond the second order aberration effects by artificial intelligence, outputing automatically all the analytical expressions up to the third order aberration coefficients

  20. Aberrations of the cathode objective lens up to fifth order. (United States)

    Tromp, R M; Wan, W; Schramm, S M


    In this paper we discuss a topic that was close to Prof. Gertrude Rempfer s interests for many years. On this occasion of her 100th birthday, we remember and honor Gertrude for her many outstanding contributions, and for the inspiring example that she set. We derive theoretical expressions for the aberration coefficients of the uniform electrostatic field up to 5th order and compare these with raytracing calculations for the cathode lens used in Low Energy Electron Microscopy and Photo Electron Emission Microscopy experiments. These higher order aberration coefficients are of interest for aberration corrected experiments in which chromatic (C(c)) and spherical (C₃) aberrations of the microscope are set to zero. The theoretical predictions are in good agreement with the results of raytracing. Calculations of image resolution using the Contrast Transfer Function method show that sub-nanometer resolution is achievable in an aberration corrected LEEM system. PMID:22188906

  1. Identification of Chlorophyceae based on 18S rDNA sequences from Persian Gulf.

    Directory of Open Access Journals (Sweden)

    Raheem Haddad


    Full Text Available Chlorophyceae are important constituents of marine phytoplankton. The taxonomy of Chlorophyceae was traditionally based solely on morphological characteristics. In the present research project, genetic diversity was investigated to analyze five species of Chlorophyceae from waters of the Persian Gulf.A clone library of the ribosomal small subunit RNA gene (18S rDNA in the nuclear genome was constructed by PCR, and then, after examining the clones, selected clones were sequenced. The determined clone sequences were analyzed by a similarity search of the NCBI GenBank database using BLAST.Eleven sequences were identified correctly and used for phylogenetic analysis. We identified species of Chlorophyta (Chlorella sorokiniana, Chlamydomonas sp., Neochloris aquatic, Picochlorum sp. and Nannochloris atomus without the need to conduct extensive colony isolation techniques. Therefore, this improved molecular method can be used to generate a robust database describing the species diversity of environmental samples.

  2. Sequence analysis of the rDNA intergenic spacer of Metarhizium strains isolated in Brazil

    Directory of Open Access Journals (Sweden)

    Fabiana Y. Yanaka-Schäfer


    Full Text Available To assess the extent of genetic variability of rDNA intergenic spacer (IGS in Metarhizium sp., 34 strains (27 isolated in Brazil were sequenced and analyzed together with an additional 20 Metarhizium anisopliae var. anisopliae sequences retrieved from GenBank. Overall, the global nucleotide diversity for the region under study was of 0.090, while for the Brazilian isolates it was only 0.016. Phylogenetic analyses showed four well-supported groups (A, B, C, and D, one of which (D has not been previously identified. All but one of the Brazilian strains cluster in this novel D phylogroup, suggesting that the genetic variation found in Brazil is a subset of the worldwide M. anisopiliae var. anisopliae variation.

  3. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters

    Directory of Open Access Journals (Sweden)

    Daniel Searle


    Full Text Available Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI’s SRA database (BioProject PRJNA294919.

  4. Species markers for equine strongyles detected in intergenic rDNA by PCR-RFLP. (United States)

    Gasser, R B; Stevenson, L A; Chilton, N B; Nansen, P; Bucknell, D G; Beveridge, I


    Five species of equine strongyle belonging to the subfamily Strongylinae (Strongylus edentatus, S. equinus, S. vulgaris, Oesophagodontus robustus and Triodontophorus serratus) and 11 species belonging to the subfamily Cyathostominae (Poteriostomum imparidentatum, P. ratzii, Cylicocyclus insignis, Cc. leptostomus, Cc. nassatus, Cylicostephanus calicatus, Cs. longibursatus, Cs. goldi, Cyathostomum catinatum, Cy. labiatum and Cy. pateratum) were characterized using a polymerase chain reaction-linked restriction fragment length polymorphism technique (PCR-RFLP). Internal transcribed spacer ribosomal DNA was amplified from genomic DNA by polymerase chain reaction (PCR) using conserved primers, digested separately with six restriction endonucleases (AluI, BfaI, CfoI, Hae III, VSpI and XbaI) and the fragments separated by agarose gel electrophoresis. The PCR products of the three Strongylus species were approx. 90-100 bp smaller in size compared with those of the other 13 species. The PCR-RFLP analysis of the rDNA region spanning the first and second internal transcribed spacers plus the 5.85 rDNA gene (ITS+) produced characteristic patterns for each of the 16 species examined, and no variation in RFLP patterns was detected within the species Cy. catinatum, where multiple isolates were analysed. The study demonstrates that the internal transcribed spacer sequences provide genetic markers for the species identification of a range of equine strongyles. These markers will be of use for the identification of egg and larval stages, where morphological characters alone are unreliable. The results also indicate that the spacer sequences will be of use to study the systematics of equine strongyles. PMID:8910892

  5. CORE: a phylogenetically-curated 16S rDNA database of the core oral microbiome.

    Directory of Open Access Journals (Sweden)

    Ann L Griffen

    Full Text Available Comparing bacterial 16S rDNA sequences to GenBank and other large public databases via BLAST often provides results of little use for identification and taxonomic assignment of the organisms of interest. The human microbiome, and in particular the oral microbiome, includes many taxa, and accurate identification of sequence data is essential for studies of these communities. For this purpose, a phylogenetically curated 16S rDNA database of the core oral microbiome, CORE, was developed. The goal was to include a comprehensive and minimally redundant representation of the bacteria that regularly reside in the human oral cavity with computationally robust classification at the level of species and genus. Clades of cultivated and uncultivated taxa were formed based on sequence analyses using multiple criteria, including maximum-likelihood-based topology and bootstrap support, genetic distance, and previous naming. A number of classification inconsistencies for previously named species, especially at the level of genus, were resolved. The performance of the CORE database for identifying clinical sequences was compared to that of three publicly available databases, GenBank nr/nt, RDP and HOMD, using a set of sequencing reads that had not been used in creation of the database. CORE offered improved performance compared to other public databases for identification of human oral bacterial 16S sequences by a number of criteria. In addition, the CORE database and phylogenetic tree provide a framework for measures of community divergence, and the focused size of the database offers advantages of efficiency for BLAST searching of large datasets. The CORE database is available as a searchable interface and for download at

  6. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction]. (United States)

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem


    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p5S it was observed and determined that facilitating the job and setting up a safe environment created a statistically significant effect on

  7. Characterization of a Yellowstone hot spring microbial community by 5S rRNA sequences.


    Stahl, D A; Lane, D J; Olsen, G J; Pace, N R


    The microorganisms inhabiting a 91 degrees C hot spring in Yellowstone National Park were characterized by sequencing 5S rRNAs isolated from the mixed, natural microflora without cultivation. By comparisons of these sequences with reference sequences, the phylogenetic relationships of the hot spring organisms to better characterized ones were established. Quantitation of the total 5S-sized rRNAs revealed a complex microbial community of three dominant members, a predominant archaebacterium af...

  8. Absolute Frequency Measurement of Rubidium 5S-7S Two-Photon Transitions

    CERN Document Server

    Morzynski, Piotr; Ablewski, Piotr; Gartman, Rafal; Gawlik, Wojciech; Maslowski, Piotr; Nagorny, Bartlomiej; Ozimek, Filip; Radzewicz, Czeslaw; Witkowski, Marcin; Ciurylo, Roman; Zawada, Michal


    We report the absolute frequency measurements of rubidium 5S-7S two-photon transitions with a cw laser digitally locked to an atomic transition and referenced to an optical frequency comb. The narrow, two-photon transition, 5S-7S (760 nm) insensitive to first order in a magnetic field, is a promising candidate for frequency reference. The performed tests yield the transition frequency with accuracy better than reported previously.

  9. O5S, Calibration of Organic Scintillation Detector by Monte-Carlo

    International Nuclear Information System (INIS)

    1 - Nature of physical problem solved: O5S is designed to directly simulate the experimental techniques used to obtain the pulse height distribution for a parallel beam of mono-energetic neutrons incident on organic scintillator systems. Developed to accurately calibrate the nominally 2 in. by 2 in. liquid organic scintillator NE-213 (composition CH-1.2), the programme should be readily adaptable to many similar problems. 2 - Method of solution: O5S is a Monte Carlo programme patterned after the general-purpose Monte Carlo neutron transport programme system, O5R. The O5S Monte Carlo experiment follows the course of each neutron through the scintillator and obtains the energy-deposits of the ions produced by elastic scatterings and reactions. The light pulse produced by the neutron is obtained by summing up the contributions of the various ions with the use of appropriate light vs. ion-energy tables. Because of the specialized geometry and simpler cross section needs O5S is able to by-pass many features included in O5R. For instance, neutrons may be followed individually, their histories analyzed as they occur, and upon completion of the experiment, the results analyzed to obtain the pulse-height distribution during one pass on the computer. O5S does allow the absorption of neutrons, but does not allow splitting or Russian roulette (biased weighting schemes). SMOOTHIE is designed to smooth O5S histogram data using Gaussian functions with parameters specified by the user

  10. Genetic Characterization of Nematodirella cameli Based on 18S rDNA and Cytochrome c Oxidase Subunit 1 (CO1

    Directory of Open Access Journals (Sweden)



    Full Text Available To determine the phylogenic position and genetic diversity of Nematodirella cameli two portions of nuclear ribosomal DNA, 18S rDNA and mitochondrial DNA gene, the subunit 1 of cytochrome C oxidase gene (CO1 were sequenced and compared with those previously reported for other nematodes in Trichostrongylina. The phylogenetic trees constructed based upon the 18S rDNA sequences, yielded strong support for close relationship between the N. cameli and Nematodirus battus, with a high bootstrap value of 100%. In the present research, the level of sequence polymorphism among N. cameli isolates was higher for CO1 with 32 polymorphic sites compared to 18S rDNA sequence. Accordingly, molecular assays based on CO1 mitochondrial marker, demonstrated the existence of at least 11 distinct haplotypes (accession nos. JX305966 to JX305976 with an intraspecific diversity of 3-7% in Iran. Whereas, all of N. cameli samples examined herein (n=11, had a unique 18S sequence (accession no. JX305977. In addition, N. cameli CO1 sequences found in this study showed maximum identities to Haemonchus (88% and Ostertagia (87% in BLAST analysis for existing Trichostrongylina sequences. Further information is necessary to infer interspecific and intraspecific phylogenetic relationships between genera and species in Trichostrongylina. This study describes for the first time the nuclear 18S rDNA and mitochondrial CO1 sequence data from Nematodirella cameli species.

  11. Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants

    Czech Academy of Sciences Publication Activity Database

    Muchová, V.; Amiard, S.; Mozgová, I.; Dvořáčková, Martina; Gallego, M.E.; White, C.; Fajkus, Jiří


    Roč. 81, č. 2 (2015), s. 198-209. ISSN 0960-7412 R&D Projects: GA ČR(CZ) GP13-11563P Institutional support: RVO:68081707 Keywords : DNA repair * genome instability * 45S rDNA Subject RIV: BO - Biophysics Impact factor: 5.972, year: 2014

  12. Aberrations of the cathode objective lens up to fifth order

    Energy Technology Data Exchange (ETDEWEB)

    Tromp, R.M., E-mail: [Thomas J. Watson Research Center, IBM Research Division, 1101 Kitchawan Road, P.O. Box 218, Yorktown Heights, NY 10598 (United States); Leiden University, Kamerlingh Onnes Laboratorium, P.O. Box 9504, NL-2300 RA Leiden (Netherlands); Wan, W. [Ernest Orlando Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Mailstop 80R0114, Berkeley, CA 94720 (United States); Schramm, S.M. [Leiden University, Kamerlingh Onnes Laboratorium, P.O. Box 9504, NL-2300 RA Leiden (Netherlands)


    In this paper we discuss a topic that was close to Prof. Gertrude Rempfer s interests for many years. On this occasion of her 100th birthday, we remember and honor Gertrude for her many outstanding contributions, and for the inspiring example that she set. We derive theoretical expressions for the aberration coefficients of the uniform electrostatic field up to 5th order and compare these with raytracing calculations for the cathode lens used in Low Energy Electron Microscopy and Photo Electron Emission Microscopy experiments. These higher order aberration coefficients are of interest for aberration corrected experiments in which chromatic (C{sub c}) and spherical (C{sub 3}) aberrations of the microscope are set to zero. The theoretical predictions are in good agreement with the results of raytracing. Calculations of image resolution using the Contrast Transfer Function method show that sub-nanometer resolution is achievable in an aberration corrected LEEM system. -- Highlights: Black-Right-Pointing-Pointer A theory is presented for the aberrations of the uniform electrostatic field up to fifth order. Black-Right-Pointing-Pointer Such aberrations are important for advanced LEEM and PEEM instruments. Black-Right-Pointing-Pointer Good agreement between theory and raytracing results for a full cathode objective lens. Black-Right-Pointing-Pointer Contrast Transfer Function calculations predict that spatial resolution below 1 nm is achievable.

  13. Chromosome aberrations in solid tumors have a stochastic nature

    Energy Technology Data Exchange (ETDEWEB)

    Castro, Mauro A.A. [Departamento de Bioquimica, Universidade Federal do Rio Grande do Sul, Rua Ramiro Barcelos 2600-anexo, Porto Alegre 90035-003 (Brazil) and Departamento de Medicina Interna, Hospital de Clinicas de Porto Alegre, Universidade Federal do Rio Grande do Sul, Rua Ramiro Barcelos 2350, Porto Alegre 90035-903 (Brazil) and Instituto de Fisica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Porto Alegre 91501-970 (Brazil) and Universidade Luterana do Brasil, Rua Miguel Tostes 101, Canoas 92420-280 (Brazil)]. E-mail:; Onsten, Tor G.H. [Departamento de Medicina Interna, Hospital de Clinicas de Porto Alegre, Universidade Federal do Rio Grande do Sul, Rua Ramiro Barcelos 2350, Porto Alegre 90035-903 (Brazil); Universidade Luterana do Brasil, Rua Miguel Tostes 101, Canoas 92420-280 (Brazil); Moreira, Jose C.F. [Departamento de Bioquimica, Universidade Federal do Rio Grande do Sul, Rua Ramiro Barcelos 2600-anexo, Porto Alegre 90035-003 (Brazil); Almeida, Rita M.C. de [Instituto de Fisica, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Porto Alegre 91501-970 (Brazil)


    An important question nowadays is whether chromosome aberrations are random events or arise from an internal deterministic mechanism, which leads to the delicate task of quantifying the degree of randomness. For this purpose, we have defined several Shannon information functions to evaluate disorder inside a tumor and between tumors of the same kind. We have considered 79 different kinds of solid tumors with 30 or more karyotypes retrieved from the Mitelman Database of Chromosome Aberrations in Cancer. The Kaplan-Meier cumulative survival was also obtained for each solid tumor type in order to correlate data with tumor malignance. The results here show that aberration spread is specific for each tumor type, with high degree of diversity for those tumor types with worst survival indices. Those tumor types with preferential variants (e.g. high proportion of a given karyotype) have shown better survival statistics, indicating that aberration recurrence is a good prognosis. Indeed, global spread of both numerical and structural abnormalities demonstrates the stochastic nature of chromosome aberrations by setting a signature of randomness associated to the production of disorder. These results also indicate that tumor malignancy correlates not only with karyotypic diversity taken from different tumor types but also taken from single tumors. Therefore, by quantifying aberration spread, we could confront diverse models and verify which of them points to the most likely outcome. Our results suggest that the generating process of chromosome aberrations is neither deterministic nor totally random, but produces variations that are distributed between these two boundaries.

  14. Aberrant DNA methylation in cloned ovine embryos

    Institute of Scientific and Technical Information of China (English)

    LIU Lei; HOU Jian; LEI TingHua; BAI JiaHua; GUAN Hong; AN XiaoRong


    By using the approach of immunofluorescence staining with an antibody against 5-methylcytosine (5MeC), the present study detected the DNA methylation patterns of cloned ovine embryos. The em-bryos derived from in vitro fertilization were also examined for reference purpose. The results showed that: (1) during the pre-implantation development, cloned embryos displayed a similar demethylation profile to the fertilized embryos; that is, the methylation level decreased to the lowest at 8-cell stage, and then increased again at morulae stage. However, methylation level was obviously higher in cloned embryos than in stage-matched fertilized embryos, especially at 8-cell stage and afterwards; (2) at blastocyst stage, the methylation pattern in cloned embryos was different from that in fertilized em-bryos. In cloned blastocyst, inner cell mass (ICM) exhibited a comparable level to trophectoderm cells (TE), while in in-vitro fertilized blastocyst the methylation level of ICM was lower than that of TE, which is not consistent with that reported by other authors. These results indicate that DNA methylation is abnormally reprogrammed in cloned embryos, implying that aberrant DNA methylation reprogramming may be one of the factors causing cloned embryos developmental failure.

  15. Aberrant glycosylation associated with enzymes as cancer biomarkers

    Directory of Open Access Journals (Sweden)

    Meany Danni L


    Full Text Available Abstract Background One of the new roles for enzymes in personalized medicine builds on a rational approach to cancer biomarker discovery using enzyme-associated aberrant glycosylation. A hallmark of cancer, aberrant glycosylation is associated with differential expressions of enzymes such as glycosyltransferase and glycosidases. The aberrant expressions of the enzymes in turn cause cancer cells to produce glycoproteins with specific cancer-associated aberrations in glycan structures. Content In this review we provide examples of cancer biomarker discovery using aberrant glycosylation in three areas. First, changes in glycosylation machinery such as glycosyltransferases/glycosidases could be used as cancer biomarkers. Second, most of the clinically useful cancer biomarkers are glycoproteins. Discovery of specific cancer-associated aberrations in glycan structures of these existing biomarkers could improve their cancer specificity, such as the discovery of AFP-L3, fucosylated glycoforms of AFP. Third, cancer-associated aberrations in glycan structures provide a compelling rationale for discovering new biomarkers using glycomic and glycoproteomic technologies. Summary As a hallmark of cancer, aberrant glycosylation allows for the rational design of biomarker discovery efforts. But more important, we need to translate these biomarkers from discovery to clinical diagnostics using good strategies, such as the lessons learned from translating the biomarkers discovered using proteomic technologies to OVA 1, the first FDA-cleared In Vitro Diagnostic Multivariate Index Assay (IVDMIA. These lessons, providing important guidance in current efforts in biomarker discovery and translation, are applicable to the discovery of aberrant glycosylation associated with enzymes as cancer biomarkers as well.

  16. Linkage of 35S and 5S rRNA genes in Artemisia (family Asteraceae): first evidence from angiosperms

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Lim, K.Y.; Chester, M.; Garnatje, T.; Pellicer, J.; Valles, J.; Leitch, A.R.; Kovařík, Aleš

    online, - (2008), s. 1-13. ISSN 0009-5915 R&D Projects: GA ČR(CZ) GA521/07/0116 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : organization of rDNA unit * intergenic spacer * Artemisia Subject RIV: BO - Biophysics Impact factor: 5.111, year: 2008

  17. Measurement of B(Υ(5S)→Bs(*)Bs(*)) using φ mesons

    International Nuclear Information System (INIS)

    Knowledge of the Bs decay fraction of the Υ(5S) resonance, fS, is important for Bs meson studies at the Υ(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423 fb-1 on the Υ(5S) resonance, 6.34 fb-1 on the Υ(4S) and 2.32 fb-1 in the continuum below the Υ(4S), we measure B(Υ(5S)→φX)=(13.8±0.7-1.5+2.3)% and B(Υ(4S)→φX)=(7.1±0.1±0.6)%; the ratio of the two rates is (1.9±0.1-0.2+0.3). This is the first measurement of the φ meson yield from the Υ(5S). Using these rates, and a model dependent estimate of B(Bs→φX), we determine fS=(24.6±2.9-5.3+11.0)%. We also update our previous independent measurement of fS made using the inclusive Ds yields to now be (16.8±2.6-3.4+6.7)%, due to a better estimate of the number of hadronic events. We also report the total Υ(5S) hadronic cross section above continuum to be σ(e+e-→Υ(5S))=(0.301±0.002±0.039) nb. This allows us to extract the fraction of B mesons as (58.9±10.0±9.2)%, equal to 1-fS. Averaging the three methods gives a model dependent result of fS=(21-3+6)%

  18. Differential algebraic method for aberration analysis of typical electrostatic lenses

    International Nuclear Information System (INIS)

    In this paper up to fifth-order geometric and third-order chromatic aberration coefficients of typical electrostatic lenses are calculated by means of the charged particle optics code, COSY INFINITY, based on the differential algebraic (DA) method. A two-tube immersion lens and a symmetric einzel lens have been chosen as two examples, whose axial potential distributions are numerically calculated by a FORTRAN program using the finite difference method. The DA results are in good agreement with those evaluated by the aberration integrals in electron optics. The DA method presented here can easily be extended to aberration analysis of other numerically computed electron lenses, including magnetic lenses

  19. Aberrations of Genetic Material as Biomarkers of Ionizing Radiation Effects

    Energy Technology Data Exchange (ETDEWEB)

    Milacic, S.


    Ionizing radiation is the most powerful mutagen in environmental and working conditions. The result of genotoxic effect of radiation is the development of chromosome aberrations. The structural chromosome aberrations in peripheral blood lymphocytes are dicentric, ring, acentric fragment. The observation of chromosome aberration frequency in lymphocyte karyotype is the conclusive method to assess the absorbed dose of ionizing radiation. Our study compared the incidence of chromosome aberrations in occupationally exposed healthy medical workers and in non-exposed healthy population. We analyzed the effect of working place, dose by thermo luminescence personal dosimeter (TLD), duration of occupational exposure (DOE) and age to the sum of aberrant cells and aberrations. four-year study included 462 subjects, mean-aged 42.3 years, who were occupational exposed to ionizing radiation and 95 subjects, mean-aged 35,2 years, who were not exposed to ionizing radiation, during the same time period and from the same territory. All of them possess thermo luminescence personal dosimeter (TLD) which is read by scanner for thermo luminescence dosimeters. Modified Moorheard's micro method for peripheral blood lymphocytes and conventional cytogenetic technique of chromosome aberration analysis were used for analysis of chromosome aberrations. Stained preparations (Giemsa) are observed in immersion by light microscope. The karyotype of 200 lymphocytes in metaphase is analyzed the most characteristic aberration: dicentric, then the ring and acentric fragments. The increased incidence of chromosome aberrations was found to tbe 21.6% in the exposed group and 2.1% in the controls, while the findings within the limits (non-specific chromosome lesions-gaps breaks, elongations, and exchanges) were equal in both groups (22%). Among occupationally exposed medical workers, the highest incidence was found in nuclear medicine workers (42.6%), then in orthopedists (27.08%). There is highly

  20. High order aberration and straylight evaluation after cataract surgery with implantation of an aspheric,aberration correcting monofocal intraocular lens

    Institute of Scientific and Technical Information of China (English)

    Florian; T; A; Kretz; Tamer; Tandogan; Ramin; Khoramnia; Gerd; U; Auffarth


    ·AIM: To evaluate the quality of vision in respect to high order aberrations and straylight perception after implantation of an aspheric, aberration correcting,monofocal intraocular lens(IOL).·METHODS: Twenty-one patients(34 eyes) aged 50 to83 y underwent cataract surgery with implantation of an aspheric, aberration correcting IOL(Tecnis ZCB00,Abbott Medical Optics). Three months after surgery they were examined for uncorrected(UDVA) and corrected distance visual acuity(CDVA), contrast sensitivity(CS)under photopic and mesopic conditions with and without glare source, ocular high order aberrations(HOA, Zywave II) and retinal straylight(C-Quant).· RESULTS: Postoperatively, patients achieved a postoperative CDVA of 0.0 log MAR or better in 97.1% of eyes. Mean values of high order abberations were +0.02±0.27(primary coma components) and-0.04 ±0.16(spherical aberration term). Straylight values of the C-Quant were 1.35±0.44 log which is within normal range of age matched phakic patients. The CS measurements under mesopic and photopic conditions in combination with and without glare did not show any statistical significance in the patient group observed(P ≥0.28).· CONCLUSION: The implantation of an aspherical aberration correcting monofocal IOL after cataractsurgery resulted in very low residual higher order aberration(HOA) and normal straylight.

  1. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species. (United States)

    Park, Y K; Park, K C; Park, C H; Kim, N S


    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  2. Chromosome aberrations in pesticide-exposed greenhouse workers

    DEFF Research Database (Denmark)

    Lander, B F; Knudsen, Lisbeth E.; Gamborg, M O;


    OBJECTIVES: The aim of this study was to investigate the possibility of subtoxic exposure to pesticides causing chromosome aberrations in greenhouse workers. METHODS: In a cross-sectional and prospective study design chromosome aberration frequencies in cultured lymphocytes were examined for 116...... greenhouse workers exposed to a complex mixture of almost 50 insecticides, fungicides, and growth regulators and also for 29 nonsmoking, nonpesticide-exposed referents. RESULTS: The preseason frequencies of chromosome aberrations were slightly but not statistically significantly elevated for the greenhouse...... workers when they were compared with the referents. After a summer season of pesticide spraying in the greenhouses, the total frequencies of cells with chromosome aberrations were significantly higher than in the preseason samples (P=0.02) and also higher than for the referents (P=0.05). This finding was...

  3. Electron Optics for Biologists: Physical Origins of Spherical Aberrations (United States)

    Geissler, Peter; Zadunaisky, Jose


    Reports on the physical origins of spherical aberrations in axially symmetric electrostatic lenses to convey the essentials of electon optics to those who must think critically about the resolution of the electron microscope. (GS)

  4. CT of ruptured aneurysm of aberrant right subclavian artery. (United States)

    Vega, A; Ortíz, A; Longo, J M; Pagola, M A


    This paper presents the first description of a ruptured aneurysm of an aberrant right subclavian artery. CT clearly demonstrated the vascular malformation as well as the existence of a bilateral hemothorax. PMID:3102065

  5. Lymphocyte chromosome aberrations in partial-body fractionated radiation therapy

    International Nuclear Information System (INIS)

    a relationship between lymphocyte chromosome aberration yields which occur in partial-body fractionated radiation therapy and those yields measured in vitro is derived. These calculations are applied to the case of patients undergoing radiation therapy for mammary carcinoma. (author)

  6. Lymphocyte chromosome aberrations in partial-body fractionated radiation therapy

    Energy Technology Data Exchange (ETDEWEB)

    Ekstrand, K.E.; Dixon, R.L. (Wake Forest Univ., Winston-Salem, NC (USA))


    a relationship between lymphocyte chromosome aberration yields which occur in partial-body fractionated radiation therapy and those yields measured in vitro is derived. These calculations are applied to the case of patients undergoing radiation therapy for mammary carcinoma.

  7. Lens aberration measurement and analysis using a novel pattern (United States)

    Nam, Byung-Ho; Cho, Byeong-Ho; Park, Jong O.; Kim, Dong-Seok; Baek, SungJin; Jeong, JongHo; Nam, ByungSub; Hwang, Young J.; Song, Young Jin


    Lens aberration of the exposure tool causes pattern deformation and position shift. As design rule shrinks, the ratio of printed feature size to applied wavelength for optical lithography is driven inexorably toward resolution limit. In this study, we devised an efficient method to evaluate lens aberration using multi-ring pattern on an attenuated phase-shift mask. Adoption of multi-ring pattern can cut down measurement time and improve measurement repeatability. These patterns are uniformly distributed through entire field in 7 by 7 manner. Lens aberration was evaluated by multi-ring pattern array under conventional or off-axis illumination with KrF stepper of NA 0.65. Multi-ring critical dimension (CD) data was discussed together with the issue of lens aberration such as coma, astigmatism, field curvature, etc. We can apply this new measurement technique to select better lens system efficiently. multi-ring, field size, pattern deformation

  8. Optimizing chromatic aberration calibration using a novel genetic algorithm (United States)

    Fang, Yi-Chin; Liu, Tung-Kuan; MacDonald, John; Chou, Jyh-Horng; Wu, Bo-Wen; Tsai, Hsien-Lin; Chang, En-Hao


    Advances in digitalized image optics has increased the importance of chromatic aberration. The axial and lateral chromatic aberrations of an optical lens depends on the choice of optical glass. Based on statistics from glass companies worldwide, more than 300 optical glasses have been developed for commercial purposes. However, the complexity of optical systems makes it extremely difficult to obtain the right solution to eliminate small chromatic aberration. Even the damped least-squares technique, which is a ray-tracing-based method, is limited owing to its inability to identify an enhanced optical system configuration. Alternatively, this study instead attempts to eliminate even negligible axial and lateral colour aberration by using algorithms involving the theories of geometric optics in triplet lens, binary and real encoding, multiple dynamic crossover and random gene mutation techniques.

  9. Aberrant internal carotid artery in the middle ear

    International Nuclear Information System (INIS)

    The knowledge about the aberrant internal carotid artery (ICA) in the middle ear is essential for clinicians, because a misdiagnosis of the aberrant ICA could have serious consequences such as excessive aural bleeding during a middle ear surgery. A 38-year-old woman presented with tinnitus and hearing difficulties of the left ear that had started 5 years ago. During otoscopy, an anteroinferior bluish mass was seen in the tympanic space. Computed tomography and magnetic resonance imaging demonstrated a left-side aberrant ICA with bony dehiscence of the carotid canal in the middle ear and a reduced diameter of the tympanic ICA. Herein we report a case of an aberrant ICA in the middle ear. We also review the literature regarding this important vascular anomaly of the temporal bone which may lead to disastrous surgical complications.

  10. Aberrant internal carotid artery in the middle ear

    Energy Technology Data Exchange (ETDEWEB)

    Roh, Keun Tak; Kang, Hyun Koo [Dept. of Radiology, Seoul Veterans Hospital, Seoul (Korea, Republic of)


    The knowledge about the aberrant internal carotid artery (ICA) in the middle ear is essential for clinicians, because a misdiagnosis of the aberrant ICA could have serious consequences such as excessive aural bleeding during a middle ear surgery. A 38-year-old woman presented with tinnitus and hearing difficulties of the left ear that had started 5 years ago. During otoscopy, an anteroinferior bluish mass was seen in the tympanic space. Computed tomography and magnetic resonance imaging demonstrated a left-side aberrant ICA with bony dehiscence of the carotid canal in the middle ear and a reduced diameter of the tympanic ICA. Herein we report a case of an aberrant ICA in the middle ear. We also review the literature regarding this important vascular anomaly of the temporal bone which may lead to disastrous surgical complications.

  11. 5S:n käyttöönotto Nomet Oy:ssä


    Nummi, Janne


    Tämän opinnäytetyön aiheena on 5S-toimintamallin käyttöönotto Nomet Oy:n tuotannossa, Tampereen Vehmaisissa. Nomet on alihankintakonepaja, joka on erikoistunut lastuavaan työstöön. Yrityksessä on päätetty ottaa käyttöön Lean- valmistusfilosofiaan pohjautuvaa tuotannon uudistamista. 5S on yksi Leanin monista työkaluista, josta on hyvä lähteä alkuun. 5S:n päätavoitteena on parantaa tuotantoprosesseja siisteyden, järjestyksen ja standardisoinnin avulla. Työssä on esitelty kahdesta tuotannon ...

  12. 5S:n käyttöönotto päällystyskoneella


    Öhman, Niko


    Tämän opinnäytetyön tarkoituksena oli 5S:n käyttöönotto päällystyskoneella. Työ toteutettiin lämpöherkkää paperia valmistavan Jujo Thermal Oy:n päällystyskone kolmoselle. Opinnäytetyön tavoitteena oli työpisteiden käytettävyyden parantaminen ja hukan vähentäminen. Tarkoituksena oli, että työn aikana aikaiseksi saatua aineistoa pystytään hyödyntämään 5S:n käyttöönotossa tehtaan toisella päällystyskoneella. Työkaluna työssä käytettiin työpisteiden organisointiin kehitettyä 5S-menetelmää, joka o...

  13. Photoionization study of Xe 5s: ionization cross sections and photoelectron angular distributions (United States)

    Aarthi, G.; Jose, J.; Deshmukh, S.; Radojevic, V.; Deshmukh, P. C.; Manson, S. T.


    We report studies of photoelectron angular distribution and cross-section for photoionization of xenon 5s electrons using the relativistic multiconfiguration Tamm-Dancoff (MCTD) approximation. We find that MCTD provides a significantly improved agreement with experiment, compared to some of the other relativistic many body approximations such as the relativistic random phase approximation and the relativistic random phase approximation with relaxation, over the entire photon energy region bracketing the near-threshold 5s Cooper minimum, from the 5s threshold up to about 70 eV. The MCTD results in the length form are in much better agreement with the experiment than those in the velocity form, suggesting residual correlations that must be of importance.

  14. Photoionization study of Xe 5s: ionization cross sections and photoelectron angular distributions

    International Nuclear Information System (INIS)

    We report studies of photoelectron angular distribution and cross-section for photoionization of xenon 5s electrons using the relativistic multiconfiguration Tamm–Dancoff (MCTD) approximation. We find that MCTD provides a significantly improved agreement with experiment, compared to some of the other relativistic many body approximations such as the relativistic random phase approximation and the relativistic random phase approximation with relaxation, over the entire photon energy region bracketing the near-threshold 5s Cooper minimum, from the 5s threshold up to about 70 eV. The MCTD results in the length form are in much better agreement with the experiment than those in the velocity form, suggesting residual correlations that must be of importance. (paper)

  15. Global Sustainable Development Through the Integrated Lean Management (Green 5-S Model for TQM

    Directory of Open Access Journals (Sweden)

    Ho Samuel K. M.


    Full Text Available Based on the 'Best Paper-2010' by the TQM Journal, the author has a chance to test out the model in a number of firms in Malaysia through SIRIM. Furthermore, riding on the success, SIRIM has named it as the SIRIM Green 5-S Model. As a result, the aim of this paper is to share the experience of the “SIRIM Green 5-S Model for Sustainable Development”. Since 1993, the author used the proprietary 5-S Checklist for training and consultancy in no less than 10 countries with over 50,000 persons from around 2,000 organisatioins world-wide. On the other hand, HKSAR takes the lead in the global oil energy consumption/GPD. The experience will be shared in this article.

  16. Isoplanatic patch size for aberration correction in ultrasonic imaging (United States)

    Pilkington, Wayne C.

    Methods and experimental results are described for determination of the region size in an aberrating medium over which a single set of aberration estimates can achieve satisfactory b-scan resolution ( i.e., the isoplanatic patch) using time-shift compensation for aberration correction of ultrasonic transmit and receive beams. Based on twenty percent allowable increases in the -12 dB width of the receive or transmit beam focus using cross-correction compared to self-correction, the isoplanatic patch sizes were found to between 3 and 5 millimeters laterally for a linearly-scanned transducer, and at least 12 millimeters axially for a target distance of 55 millimeters and aberration comparable to human abdominal wall. These sizes depend on the aberration severity, reference site axial position, and allowable resolution degradation with cross-correction. The lateral isoplanatic patch size of a linearly scanned image can be more than doubled to match that of a beam-steered acquisition using aberration estimate position matching relative to the tissue surface. Further expansion of the lateral isoplanatic patch size by an additional 50 to 100 percent for both scanning methods is also shown through propagation path matched cross-correction mapping of aberration estimates. The specific mapping required to achieve the best propagation path match depends on the axial distribution of the aberrating structures, the focal depth being imaged, and the cross-correction distance. The effectiveness of alternate methods to derive propagation path matching maps with and without a priori knowledge of aberrator spatial distribution are contrasted; and a means to dynamically adjust correction maps to maximize isoplanatic patch sizes is proposed and verified. Lateral cross-correction mapping and the map changes required for each cross-correction distance can all be implemented with simple shifting of aberration estimates within the transducer aperture. Therefore, use of optimally mapped

  17. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method. (United States)

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J


    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  18. Moment aberrations in magneto-electrostatic plasma lenses (computer simulation)

    CERN Document Server

    Butenko, V I


    In this work moment aberrations in the plasma magneto-electrostatic lenses are considered in more detail with the use of the computer modeling. For solution of the problem we have developed a special computer code - the model of plasma optical focusing device, allowing to display the main parameters and operations of experimental sample of a lens, to simulate the moment and geometrical aberrations and give recommendations on their elimination.

  19. Study of the wavefront aberrations in children with amblyopia

    Institute of Scientific and Technical Information of China (English)

    ZHAO Peng-fei; ZHOU Yue-hua; WANG Ning-li; ZHANG Jing


    Background Amblyopia is a common ophthalmological condition and the wavefront aberrometer is a relatively new diagnostic tool used globally to measure optical characteristics of human eyes as well as to study refractive errors in amblyopic eyes. We studied the wavefront aberration of the amblyopic children's eyes and analyzed the mechanism of the wavefront aberration in the formation of the amblyopia, try to investigate the new evidence of the treatment of the amblyopia, especially in the refractory amblyopia.Methods The WaveScan Wavefront System (VISX, USA) aberrometer was used to investigate four groups of children under dark accommodation and cilliary muscle paralysis. There were 45 cases in the metropic group, 87 in the amblyopic group, 92 in the corrected-amblyopic group and 38 in the refractory amblyopic group. One-way analysis of variance (ANOVA), t-test and multivariate linear regression were used to analyze all the data.Results Third order to 6th order aberrations showed a decreasing trend whereas in the higher order aberrations the main ones were 3rd order coma (Z3-1-Z31), trefoil (Z3-3-Z33) and 4th order aberration (Z40); and 3rd order coma represented the highest percentage of all three main aberrations. Within 3rd order coma, vertical coma (Z3-1) accounted for a greater percentage than horizontal coma (Z31). Significant differences of vertical coma were found among all clinical groups of children: vertical coma in the amblyopic group (0.17±0.15) was significantly higher than in the metropic group (0.11±0.13, P0.05).Conclusions Although lower order aberrations such as defocus (myopia and hyperopia) and astigmatism are major factors determining the quality of the retinal image, higher order aberrations also need to be considered in amblyopic eyes as their effects are significant.

  20. Minimum $G_2$-aberration for nonregular fractional factorial designs


    Tang, Boxin; Deng, Lih-Yuan


    Deng and Tang proposed generalized resolution and minimum aberration criteria for comparing and assessing nonregular fractional factorials, of which Plackett–Burman designs are special cases.A relaxed variant of generalized aberration is proposed and studied in this paper.We show that a best design according to this criterion minimizes the contamination of nonnegligible interactions on the estimation of main effects in the order of importance given by the hierarchical assump...

  1. Photothermal Lens Aberration Effects in Two Laser Thermal Lens Spectrometry


    Bialkowski, Stephen E.


    A comparison of theories describing two laser photothermal lens signals is given. The aberrant nature of this lens is accounted for in a theory which treats the propagation of a monitor laser in terms of a phase shift in this laser beam wave front. The difference between theories are discussed in terms of the predicted signal strengths and temporal behavior. The aberrant theory results in smaller theoretical signal strengths and different functional relationships between signal and analyte le...

  2. Sharpness changes of gaussian beams induced by spherically aberrated lenses (United States)

    Piquero, G.; Mejías, P. M.; Martínez-Herrero, R.


    Sharpness changes of the spatial profile of a gaussian beam induced by spherically aberrated lenses are investigated in terms of the so-called kurtosis parameter. It is shown both theoretically and experimentally that, after a single aberrated lens, it is possible to get flatter and sharper beam intensity distributions than the input gaussian beam depending on the plane where the field is observed. Agreement between analytical and experimental results is discussed.

  3. Pattern of Chromosomal Aberrations in Patients from North East Iran

    Directory of Open Access Journals (Sweden)

    Saeedeh Ghazaey


    Full Text Available Objective: Chromosomal aberrations are common causes of multiple anomaly syndromes. Recurrent chromosomal aberrations have been identified by conventional cytogenetic methods used widely as one of the most important clinical diagnostic techniques.Materials and Methods: In this retrospective study, the incidences of chromosomal aberrations were evaluated in a six year period from 2005 to 2011 in Pardis Clinical and Genetics Laboratory on patients referred to from Mashhad and other cities in Khorasan province. Karyotyping was performed on 3728 patients suspected of having chromosomal abnormalities.Results: The frequencies of the different types of chromosomal abnormalities were determined, and the relative frequencies were calculated in each group. Among these patients, 83.3% had normal karyotypes with no aberrations. The overall incidences of chromosomal abnormalities were 16.7% including sex and autosomal chromosomal anomalies. Of those, 75.1 % showed autosomal chromosomal aberrations. Down syndrome (DS was the most prevalent autosomal aberration in the patients (77.1%. Pericentric inversion of chromosome 9 was seen in 5% of patients. This inversion was prevalent in patients with recurrent spontaneous abortion (RSA. Sex chromosomal aberrations were observed in 24.9% of abnormal patients of which 61% had Turner’s syndrome and 33.5% had Klinefelter’s syndrome.Conclusion: According to the current study, the pattern of chromosomal aberrations in North East of Iran demonstrates the importance of cytogenetic evaluation in patients who show clinical abnormalities. These findings provide a reason for preparing a local cytogenetic data bank to enhance genetic counseling of families who require this service.



    Ovaskainen, Tatu-Pekka


    Opinnäytetyö on tehty Servicepoint Kuopio Oy:n toimeksiannosta. Servicepoint Kuopio on teollisuuden kunnossapitoon automaatio- ja sähköistysprojekteihin sekä robottisovelluksiin erikoistunut yritys. Yrityksen kahden toimipisteen yhdistyminen lisäsi toimipisteellä henkilöstön ja työkalujen määrää. Yrityksessä toteutetaan sovelletusti Lean-ajattelumallia. Yksi Leanin työkaluista on 5S, joka haluttiin ottaa käyttöön yrityksessä. Opinnäytetyön tavoitteena oli ottaa käyttöön 5S-menetelmä Servi...



    Utter, Kimmo


    5S -menetelmä on mm. tehokkuutta, työturvallisuutta ja inventointia parantava työkalu, joka on osa Lean manufacturing:ia. Lean manufacturing, joka tunnetaan myös nimellä Toyota Production Sys-tem, on saanut alkunsa Toyotan tehtailla Japanissa. Se koostuu viidestä vaiheesta: sortteeraus, systematisointi, siivous, standardisointi ja seuranta. Tehtävänäni oli organisoida 5S -menetelmän pilotointi kolmelle kohteelle Metso Jyväskylän huolto-keskuksessa. Tarkoituksena oli raportoinnin lisäksi su...



    Kilpiö, Katriina


    Boliden Kokkola Oy on Euroopan toiseksi suurin ja maailman neljänneksi suurin sinkkitehdas, jonka tuotteisiin kuuluu erikoispuhdas, jopa 99,995-prosenttinen sinkki. Tehdaskierroksilla valimo toimii näyteikkunana asiakkaaseen päin, joten sen on annettava yhtenäinen kuva tehtaan imagon kanssa. Syksyllä 2010 valimolla aloitettiin 5S-laatutyökalun käyttöönotto. 5S:n periaatteena on saada aikaan uudelleen organisoimalla ja standardisoimalla tehdyt muutokset siisti työskentely-ympäristö, jossa...

  7. Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.


    Dekio, S; Yamasaki, R; Jidoi, J; Hori, H.; Osawa, S


    Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together wit...

  8. Lens customization method to minimize aberration in integral imaging (United States)

    Miranda, Matheus; Kim, Jonghyun; Hong, Keehoon; Lee, Byoungho


    Conventionally the elemental lenses of the lens-array used in integral imaging have spherical surface profiles, thus they suffer from intrinsic lens aberrations such as spherical aberration and astigmatism. Aberrations affect the ability of the lens to focus light in a single point, or to collimate light from a point source. In integral imaging, this results in a loss of image quality of the reconstructed image due to distortions. The viewing characteristics of the integral imaging system, such as viewing angle and image resolution, are also affected by aberrations. We propose the use of a custom made aspherical lens-array which was specifically designed to minimize distortions due to aberrations and hence improve the reconstructed image quality. Ray optics calculations are used in order to analyze the aberrations and find the initial lens surface profile. Lens optimization is performed with the aid of numerical simulation software. The designed lens-array is compared to a conventional spherical lens-array of same properties. The design, optimization, and fabrication processes are described and the experiments are presented and compared with the computer simulations.

  9. Ocular aberrations after wavefront optimized LASIK for myopia

    Directory of Open Access Journals (Sweden)

    Padmanabhan Prema


    Full Text Available Purpose: To study the change in ocular aberrations after wavefront optimized (WFO laser in situ keratomileusis ( Lasik for correction of myopia and to analyze causative factors that may influence them. Materials and Methods: This was a prospective case series. WFO Lasik was performed for the correction of myopia, using the hansatome (Bausch and Lomb microkeratome to create the flap and the Allegretto laser (Wavelight Technologie to perform the ablation. The Allegretto wave analyser (Tscherning-type measured the ocular aberrations prior to Lasik , one month and six months postoperatively. Results: The mean age of the 59 patients included in the study was 25±5.64 years and the mean spherical equivalent of the 117 eyes that underwent Lasik0 was -5.33±1.22 preoperatively and -0.21±0.38 postoperatively. Hundred and two eyes of 117 (87% achieved uncorrected visual acuity (UCVA of 20/20 or better after WFO Lasik and 104 of 117 eyes (89% were within ±0.5D of the attempted refractive correction. There was a 1.96-fold increase in total root-mean-square of higher order aberrations. Induced changes in seven of the 22 higher order Zernike terms showed a significant linear correlation with the refractive correction attempted. Larger ablation zones induced less spherical aberration. Conclusion: In spite of an excellent visual outcome, WFO Lasik induces significant higher order aberrations. Large ablation zones reduce the induction of spherical aberration.

  10. A Study of the Impact of Implementing 5s on Efficiency and Effectiveness of Constabularies' Workers

    Directory of Open Access Journals (Sweden)

    Milad Aghaee


    Full Text Available IntroductionPeople always seek ways for improving and using optimally the current facilities which are available. KAIZEN is a Japanese expression which means improvement. In fact, KAIZEN is a continuous improvement which encompasses all people, managers and employees alike, and its philosophy is based on continuous improvement in lifestyle of human beings. Like an umbrella, KAIZEN encompasses all principles for moving to promotion and organizational excellence. 5s is one of these principles, which is an abbreviation for 5 Japanese values, including a set of standards and activities directed at creating a systemic, clean, enjoyable and creative environment. What causes 5s to be included in KAIZEN is implementation of changes and having small but continuous improvements; an improvement which keeps business in competition and helps increase the competitive power of the organization to perform effective and efficient improvements. This research aims to consider the impact of 5s on the efficiency and effectiveness of police forces. In other words, this research is based on considering the relationships between 5s and police force efficiency and effectiveness. Material & MethodsThis research examines a new conceptual model using scientific resources. This is a practical research from the point of its goal. Also, it is a descriptive and survey research which considers the impact of one variable on other variables. So, two groups from two constabularies were selected and a special educational course was implemented relating to the main topic of the research (5s implementation for workers of these constabularies. The data of research were analyzed using SPSS software. Statistical society of this research include all employees in 134 and 140 of the Great Tehran Police Commanding Center. The volume of sample is selected by KOKRAN formula which is a sample volume determination technique. Totally, 132 individuals were chosen from police forces for

  11. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Grierson, Patrick M. [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Acharya, Samir, E-mail: [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Groden, Joanna [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States)


    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription.

  12. Molecular phylogeny of endophytic isolates of Ampelomyces from Iran based on rDNA ITS sequences. (United States)

    Jamali, Samad


    During 2012, five isolates of pycnidial fungi were recovered from roots of tomato (Solanum lycopersicum) plants in Iran. Based on morphological characteristics the presence of Ampelomyces was documented. To confirm morphological identification and clarify the placement of endophytic isolates of Ampelomyces, DNA was extracted from isolates using a genomic DNA purification Kit. Region of internal transcribed spacers 1, 2 and 5.8S genes of rDNA were amplified using ITS4 and ITS1 universal primer set. Amplicons were purified, sequenced and submitted to the GenBank. The resulting sequence (600 bp) was submitted to a BLAST search to find most similar sequences in GenBank. The ITS sequences of isolates obtained in Iran were compared to those of other related authentic sequences obtained from GenBank. Iranian endophytic isolates had 100 % similarity of among themselves, while all isolates of Ampelomyces sequences analyzed had an average of 95.2 % (range 87-100 %) similarity. When Ampelomyces ITS sequences were analyzed by both distance-based and maximum parsimony methods, the Ampelomyces isolates were segregate into 11 distinct clades. The ITS sequences of endophytic isolates obtained in Iran were identical with endophytic isolates from other country including USA, Australia, Hungary and Spain. Our analyses of phylogenetic data showed that endophytic isolates from Iran and other countries are distinct group. The high ITS sequence-divergence values and the phylogenetic analysis suggested the isolates of Ampelomyces in the clades are not closely related and indeed a problematic species complex. PMID:25245955

  13. Comparative molecular analysis of Herbaspirillum strains by RAPD, RFLP, and 16S rDNA sequencing

    Directory of Open Access Journals (Sweden)

    Soares-Ramos Juliana R.L.


    Full Text Available Herbaspirillum spp. are endophytic diazotrophic bacteria associated with important agricultural crops. In this work, we analyzed six strains of H. seropedicae (Z78, M2, ZA69, ZA95, Z152, and Z67 and one strain of H. rubrisubalbicans (M4 by restriction fragment length polymorphism (RFLP using HindIII or DraI restriction endonucleases, random amplified polymorphic DNA (RAPD, and partial sequencing of 16S rDNA. The results of these analyses ascribed the strains studied to three distinct groups: group I, consisting of M2 and M4; group II, of ZA69; and group III, of ZA95, Z78, Z67, and Z152. RAPD fingerprinting showed a higher variability than the other methods, and each strain had a unique electrophoretic pattern with five of the six primers used. Interestingly, H. seropedicae M2 was found by all analyses to be genetically very close to H. rubrisubalbicans M4. Our results show that RAPD can distinguish between all Herbaspirillum strains tested.

  14. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    International Nuclear Information System (INIS)

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription

  15. Identification of a potential fungal species by 18S rDNA for ligninases production. (United States)

    Ferhan, M; Santos, S N; Melo, I S; Yan, N; Sain, M


    Fungal species for ligninases production was investigated by 18S ribosomal DNA sequence analysis. Two primer sets were chosen to amplify a major part of the 18S rDNA, which resulted in intense PCR product of approximately 550-820 bp in size per sample. The results suggest that the 18S rDNA-based approach is a useful tool for identification of unknown potential fungal species for ligninases production. The isolated fungal species produces mainly manganese peroxidase (MnP). The enzyme oxidized a variety of the usual MnP substrates, including lignin related polyphenols. Time course studies showed that maximum production of ligninolytic enzymes MnP (64 IU L⁻¹), lignin peroxidase (26.35 IU L⁻¹), and laccase (5.44 IU L⁻¹), respectively, were achieved after 10 days of cultivation under optimum conditions. Furthermore, the biological decolorization of Remazol Brilliant Blue R dye following 10 days of cultivation was 94 %. NCBI BLAST was used to search for closest matched sequences in the GenBank database and based on sequence homology the first BLAST hit was Dothioraceae sp. LM572 with accession number EF060858.1. PMID:23744034

  16. Bacterial diversity of soil under eucalyptus assessed by 16S rDNA sequencing analysis Diversidade bacteriana de solo sob eucaliptos obtida por seqüenciamento do 16S rDNA


    Érico Leandro da Silveira; Rodrigo Matheus Pereira; Denilson César Scaquitto; Eliamar Aparecida Nascimbém Pedrinho; Silvana Pómpeia Val-Moraes; Ester Wickert; Lúcia Maria Carareto-Alves; Eliana Gertrudes Macedo Lemos


    Studies on the impact of Eucalyptus spp. on Brazilian soils have focused on soil chemical properties and isolating interesting microbial organisms. Few studies have focused on microbial diversity and ecology in Brazil due to limited coverage of traditional cultivation and isolation methods. Molecular microbial ecology methods based on PCR amplified 16S rDNA have enriched the knowledge of soils microbial biodiversity. The objective of this work was to compare and estimate the bacterial diversi...

  17. (2S,4R,5S)-5-Allyl-4-hydroxytetrahydro-2-furylmethyl p-toluenesulfonate


    Evelyn Paz-Morales; Fernando Sartillo-Piscil; Angel Mendoza


    In the title compound, C15H20O5S, the tetrahydrofuran ring shows an envelope conformation. The crystal packing is stabilized by an intermolecular O—H...O hydrogen bond, generating a ribbon structure along the a axis. Two weak intermolecular C—H...O interactions are also observed.

  18. (2S,4R,5S-5-Allyl-4-hydroxytetrahydro-2-furylmethyl p-toluenesulfonate

    Directory of Open Access Journals (Sweden)

    Evelyn Paz-Morales


    Full Text Available In the title compound, C15H20O5S, the tetrahydrofuran ring shows an envelope conformation. The crystal packing is stabilized by an intermolecular O—H...O hydrogen bond, generating a ribbon structure along the a axis. Two weak intermolecular C—H...O interactions are also observed.

  19. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P


    that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is...

  20. Transcranial phase aberration correction using beam simulations and MR-ARFI

    International Nuclear Information System (INIS)

    Purpose: Transcranial magnetic resonance-guided focused ultrasound surgery is a noninvasive technique for causing selective tissue necrosis. Variations in density, thickness, and shape of the skull cause aberrations in the location and shape of the focal zone. In this paper, the authors propose a hybrid simulation-MR-ARFI technique to achieve aberration correction for transcranial MR-guided focused ultrasound surgery. The technique uses ultrasound beam propagation simulations with MR Acoustic Radiation Force Imaging (MR-ARFI) to correct skull-caused phase aberrations. Methods: Skull-based numerical aberrations were obtained from a MR-guided focused ultrasound patient treatment and were added to all elements of the InSightec conformal bone focused ultrasound surgery transducer during transmission. In the first experiment, the 1024 aberrations derived from a human skull were condensed into 16 aberrations by averaging over the transducer area of 64 elements. In the second experiment, all 1024 aberrations were applied to the transducer. The aberrated MR-ARFI images were used in the hybrid simulation-MR-ARFI technique to find 16 estimated aberrations. These estimated aberrations were subtracted from the original aberrations to result in the corrected images. Each aberration experiment (16-aberration and 1024-aberration) was repeated three times. Results: The corrected MR-ARFI image was compared to the aberrated image and the ideal image (image with zero aberrations) for each experiment. The hybrid simulation-MR-ARFI technique resulted in an average increase in focal MR-ARFI phase of 44% for the 16-aberration case and 52% for the 1024-aberration case, and recovered 83% and 39% of the ideal MR-ARFI phase for the 16-aberrations and 1024-aberration case, respectively. Conclusions: Using one MR-ARFI image and noa priori information about the applied phase aberrations, the hybrid simulation-MR-ARFI technique improved the maximum MR-ARFI phase of the beam's focus

  1. Transcranial phase aberration correction using beam simulations and MR-ARFI

    Energy Technology Data Exchange (ETDEWEB)

    Vyas, Urvi, E-mail:; Kaye, Elena; Pauly, Kim Butts [Department of Radiology, Stanford University, Stanford, California 94305 (United States)


    Purpose: Transcranial magnetic resonance-guided focused ultrasound surgery is a noninvasive technique for causing selective tissue necrosis. Variations in density, thickness, and shape of the skull cause aberrations in the location and shape of the focal zone. In this paper, the authors propose a hybrid simulation-MR-ARFI technique to achieve aberration correction for transcranial MR-guided focused ultrasound surgery. The technique uses ultrasound beam propagation simulations with MR Acoustic Radiation Force Imaging (MR-ARFI) to correct skull-caused phase aberrations. Methods: Skull-based numerical aberrations were obtained from a MR-guided focused ultrasound patient treatment and were added to all elements of the InSightec conformal bone focused ultrasound surgery transducer during transmission. In the first experiment, the 1024 aberrations derived from a human skull were condensed into 16 aberrations by averaging over the transducer area of 64 elements. In the second experiment, all 1024 aberrations were applied to the transducer. The aberrated MR-ARFI images were used in the hybrid simulation-MR-ARFI technique to find 16 estimated aberrations. These estimated aberrations were subtracted from the original aberrations to result in the corrected images. Each aberration experiment (16-aberration and 1024-aberration) was repeated three times. Results: The corrected MR-ARFI image was compared to the aberrated image and the ideal image (image with zero aberrations) for each experiment. The hybrid simulation-MR-ARFI technique resulted in an average increase in focal MR-ARFI phase of 44% for the 16-aberration case and 52% for the 1024-aberration case, and recovered 83% and 39% of the ideal MR-ARFI phase for the 16-aberrations and 1024-aberration case, respectively. Conclusions: Using one MR-ARFI image and noa priori information about the applied phase aberrations, the hybrid simulation-MR-ARFI technique improved the maximum MR-ARFI phase of the beam's focus.

  2. Nitrogen-15 labeled 5S RNA. Identification of uridine base pairs in Escherichia coli 5S RNA by 1H-15N multiple quantum NMR

    International Nuclear Information System (INIS)

    Escherichia coli 5S RNA labeled with 15N at N3 of the uridines was isolated from the Sφ-187 uracil auxotroph grown on a minimal medium supplemented with [3-15N]uracil. 1H-15N multiple quantum filtered and 2D chemical shift correlated spectra gave resonances for the uridine imino 1H-15N units whose protons were exchanging slowly with solvent. Peaks with 1H/15N shifts at 11.6/154.8, 11.7/155.0, 11.8/155.5, 12.1/155.0, and 12.2/155.0 ppm were assigned to GU interactions. Two labile high-field AU resonances at 12.6/156.8 and 12.8/157.3 ppm typical of Au pairs in a shielded environment at the end of a helix were seen. Intense AU signals were also found at 13.4/158.5 and 13.6/159.2 ppm where 1H-15N units in normal Watson-Crick pairs resonate. 1H resonances at 10.6 and 13.8 ppm were too weak, presumably because of exchange with water, to give peaks in chemical shift correlated spectra. 1H chemical shifts suggest that the resonance at 13.8 ppm represents a labile AU pair, while the resonance at 10.6 ppm is typical of a tertiary interaction between U and a tightly bound water or a phosphate residue. The NMR data are consistent with proposed secondary structures for 5S RNA

  3. Internal Audit of Quality in 5s Environment: Perception on Critical Factors, Effectiveness and Impact on Organizational Performance


    Nurmazilah Mahzan; Noor Aishah Binti Hassan


    Quality Environment (5S) Practice is a concept which has been widely adopted by organizations as one way to achieve Total Quality Management (TQM) and business excellence. 5S refers to 5 principles to maintain quality which emanate from Japanese word Seiri (sorting), Seiton (straightening), Seiso (shining), Seiketsu (standardize) and Shitsuke (sustain). 5s concept aims to create a conducive, clean and tidy workplace which in turn can improve work quality and performance. Internal audit of 5S ...

  4. Modelling of multi-conjugate adaptive optics for spatially variant aberrations in microscopy

    International Nuclear Information System (INIS)

    Adaptive optics has been implemented in a range of high-resolution microscopes in order to overcome the problems of specimen-induced aberrations. Most implementations have used a single aberration correction across the imaged field. It is known, however, that aberrations often vary across the field of view, so a single correction setting cannot compensate all aberrations. Multi-conjugate adaptive optics (MCAO) has been suggested as a possible method for correction of these spatially variant aberrations. MCAO is modelled to simulate the correction of aberrations, both for simple model specimens and using real aberration data from a biological specimen. (special issue article)

  5. Effects of coal ash pollution on the genetic diversity of Brachionus calyciflorus based on rDNA ITS sequences


    Xinli Wen; Xianling Xiang; Xin Hu; Yinghao Xue; Yilong Xi; Gen Zhang


    In this study, rDNA ITS sequences were analyzed to compare the genetic diversity of Brachionus calyciflorus from the coal ash contaminated (Lake Hui) and two uncontaminated lakes (Lake Tingtang and Lake Fengming). The results showed that two sibling species in Brachionus calyciflorus species complex were defined in both Lake Tingtang and Lake Fengming, but only one sibling species was found in Lake Hui. The coal ash pollution decreased the number of sibling species. Based on the sequences of ...

  6. Identification of organic matter sources in sulfidic late Holocene Antarctic fjord sediments from fossil rDNA sequence analysis


    Coolen, M.J.L.; Volkman, J.K.; Abbas, B.; Muyzer, G; Schouten, S.; Sinninghe Damsté, J. S.


    The 18S ribosomal DNA (rDNA) isolated from sulfidic Holocene sediments and particulate organic matter in the water column of the stratified Small Meromictic Basin (SMB) in Ellis Fjord (eastern Antarctica) was analyzed to identify possible biological sources of organic matter. Previous work had shown that the sediments contained numerous diatom frustules and high contents of a highly branched isoprenoid (HBI) C25:2 alkene (which is a specific biomarker of certain species of the diatom genera N...

  7. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences.


    Black, W C; Piesman, J


    Ticks are parasitiform mites that are obligate hematophagous ectoparasites of amphibians, reptiles, birds, and mammals. A phylogeny for tick families, subfamilies, and genera has been described based on morphological characters, life histories, and host associations. To test the existing phylogeny, we sequenced approximately 460 bp from the 3' end of the mitochondrial 16S rRNA gene (rDNA) in 36 hard- and soft-tick species; a mesostigmatid mite, Dermanyssus gallinae, was used as an outgroup. P...

  8. Molecular phylogeny of the stingless bees (Apidae, Apinae, Meliponini) inferred from mitochondrial 16S rDNA sequences


    Costa, Marco; Marco A. Del Lama,; Melo,Gabriel; Sheppard, Walter


    Sequence data from the mitochondrial 16S rDNA of 34 species from 22 genera of stingless bees plus outgroup sequences from 11 species of other corbiculate bees were used to investigate the phylogenetic relationships among the Meliponini. Equally weighted parsimony and maximum likelihood analyses were performed. Four main clades were recognized in the parsimony consensus tree: (A) Hypotrigona, (B) Austroplebeia, (C) remaining African genera (Plebeina, Meliplebeia, and Axestotrigona) plus the tw...

  9. Type I-like intervening sequences are found in the rDNA of the nematode Ascaris lumbricoides.


    Neuhaus, H; Müller, F.; Etter, A; Tobler, H


    The intervening sequences in the large ribosomal RNA gene of Ascaris lumbricoides var. suum show many similarities to the type I insertions, previously found only in some insect species. They include structural features, but also a presumed transcriptional inactivity in vivo: No transcript of the rDNA intervening sequence in A. lumbricoides could be detected in Northern and dot blot hybridizations. However, the primary structure of the Pol I promoter region is well conserved in interrupted an...

  10. Induction of chromosomal aberrations in human lymphocytes by fission neutrons

    International Nuclear Information System (INIS)

    Chromosome aberrations induced by sparsely ionizing radiation (low-LET) are well known and cytogenetic analyses of irradiated human lymphocytes have been widely applied to biological dosimetry. However, much less is known about chromosome aberrations induced by densely ionizing radiation (high LET), such as that of alpha particles or neutrons. Such particles induce DNA strand breaks, as well as chromosome breakage and rearrangements of high complexity. This damage is more localized and less efficiently repaired than after X- or γ-ray irradiation. This preferential production of complex aberrations by densely ionizing radiation is related to the unique energy deposition patterns, which produces highly localized multiple DNA damage at the chromosomal level. A better knowledge of the interactions between different types of radiation and cellular DNA is of importance, not only from the radiobiological viewpoint but also for dosimetric and therapeutic purposes. The objective of the present study was to analyse the cytogenetic effects of fission neutrons on peripheral blood lymphocytes in order to evaluate structural and numerical aberrations and number of cells in the different mitotic cycles. So, blood samples from five healthy donors, 22-25 years old, of both sexes, were irradiated in the Research Reactor IEA-R1 of our Institute (IPEN/CNEN-SP) with thermal and fast neutrons at doses of 0.2; 0.3; 0.5 and 1.0 Gy. The γ contribution to the total absorbed dose was about 30%. These doses were monitored by thermoluminescent dosemeters: LiF-600 (for neutrons) and LiF-700 (for γ-rays). The data concerning structural aberrations were evaluated with regard to three parameters: percentage of cells with aberrations, number of aberrations/cell and number of dicentric/cell. The cytogenetic results showed an increase in the three parameters after irradiation with neutrons, as a function of radiation dose. Apparently, there was no influence of neutrons on the kinetics of cellular

  11. Bacterial diversity in the Uranium mill-tailings Gittersee as estimated via a 16S rDNA approach

    International Nuclear Information System (INIS)

    Bacterial diversity in a soil sample collected from uranium mill-tailings called Gittersee and situated near the city of Dresden, Germany, was analysed by using a culture-independent 16S rDNA approach exploiting PCR amplification primers 7F and 1513R. The results were compared with those obtained earlier analysing the same sample by using another primer pair, namely 43F-1404R. The two 16S rDNA approaches demonstrated that Proteobacteria were the most predominant group in the sample, followed by Cytophaga/Flavobacterium/ Bacteroidesand by Gram positive bacteria with low and also with high G+C content too. A large number of 16S rDNA sequences from two libraries were identical or almost identical. However, the ratio between the bacterial groups represented in them significantly differed. 7F-1513R primer set retrieved in addition to the above mentioned sequences, also 16S rRNA of green non-sulphur bacteria and representatives of the AD1 and the OP11 divisions. The latter indicates that the 7F-1513R primer set seems to be more reliable in analyses of bacterial diversity. (authors)

  12. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J


    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  13. Chromosome evolution in tiger beetles: Karyotypes and localization of 18S rDNA loci in Neotropical Megacephalini (Coleoptera, Cicindelidae

    Directory of Open Access Journals (Sweden)

    Sónia J.R. Proença


    Full Text Available Four Neotropical tiger beetle species, three from the genus Megacephala and one from the genus Oxycheila, currently assigned to the tribe Megacephalini were examined cytogenetically. All three Megacephala species showed simple sex chromosome systems of the X0/XX type but different numbers of autosomal pairs (15 in M. cruciata, 14 in M. sobrina and 12 in M. rutilans, while Oxycheila tristis was inferred to have a multiple sex chromosome system with four X chromosomes (2n = 24 + X1X2X3X4Y/X1X1X2X2X3X3X4X4. Fluorescence in situ hybridization (FISH using a PCR-amplified 18S rDNA fragment as a probe revealed the presence of rDNA clusters located exclusively on the autosomes in all the Megacephala species (five clusters in M. cruciata, eight in M. sobrina and three in M. rutilans, indicating variability in the number of clusters and the presence of structural polymorphisms. The same methodology showed that O. tristis had six rDNA clusters, apparently also located on the autosomes. Although our data also show cytogenetic variability within the genus Megacephala, our findings support the most accepted hypothesis for chromosome evolution in the family Cicindelidae. The description of multiple sex chromosomes in O. tristis along with phylogenetic analyses and larval morphological characters may be assumed as an additional evidence for the exclusion of the genus Oxycheila and related taxa from the tribe Megacephalini.

  14. Molecular characterization of Stictodora tridactyla (Trematoda: Heterophyidae) from Kuwait Bay using rDNA ITS and mtCO1. (United States)

    Al-Kandari, Wafa Y; Alnaqeeb, Majed A; Isaac, Asha M; Al-Bustan, Suzanne A


    Stictodora tridactyla is an intestinal fluke in the family Heterophyidae that parasitizes shorebirds and mammals, including humans. Its metacercarial cyst stage was reported in the Arabian killifish, Aphanius dispar, at Kuwait Bay. In the present study, Cerithidea cingulata was found to serve as the first intermediate host of S. tridactyla. In order to establish the snail-fish link in the life cycle of S. tridactyla, complete sequences of ribosomal DNA internal transcribed spacer region 1 and 2 (rDNA ITS1 and ITS2) and partial sequence of cytochrome oxidase subunit 1 were obtained for metacercarial cysts isolated from the fish A. dispar and rediae isolated from the snail C. cingulata. Sequence alignment demonstrated that these larval stages belong to the same heterophyid species, S. tridactyla. Phylogenetic analysis based on rDNA ITS1, ITS2, and mtCO1 confirmed the position of S. tridactyla within the Heterophyidae and found it to cluster with Haplorchis spp. The present study represents the first molecular study correlating the larval stages of S. tridactyla using rDNA ITS1, ITS2, and mtCO1 and examining the phylogenetic relationships of S. tridactyla with different heterophyid species. PMID:26268569

  15. Association of DNA with nuclear matrix in in vitro assembled nuclei induced by rDNA from Tetrahymena shanghaiensis in Xenopus egg extracts

    Institute of Scientific and Technical Information of China (English)



    The nuclei assembled from exogenous DNA or chromatin in egg extracts resemble their in vivo counterparts in many aspects.However,the distribution pattern of DNA in these nuclei remains unknown.We introduced rDNA from the macronuclei of Tetrahymena into Xenopus cellfree extracts to examine the association of specific DNA sequences with nuclear matrix(NM) in the nuclei assembled in vitro.Our previous works showed the 5'NTS(nontranscription sequences) of the rDNA specifically bind to the NM system in the macronuclei.We show now the rDNA could induce chromatin assembly and nuclear formation in Xenopus cell-free system.When we extracted the NM system and compared the binding affinity of different regions of rDNA with the NM system,we found that the 5'NTS still hold their binding affinity with insoluble structure of the assembled nuclei in the estracts of Xenopus eggs.

  16. 18S rDNA sequences from microeukaryotes reveal oil indicators in mangrove sediment.

    Directory of Open Access Journals (Sweden)

    Henrique F Santos

    Full Text Available BACKGROUND: Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. CONCLUSIONS

  17. Antimutagenic potential of curcumin on chromosomal aberrations in Allium cepa

    Institute of Scientific and Technical Information of China (English)



    Turmeric has long been used as a spice and food colouring agent in Asia. In the present investigation, the antimutagenic potential of curcumin was evaluated in Allium cepa root meristem cells. So far there is no report on the biological properties of curcumin in plant test systems. The root tip cells were treated with sodium azide at 200 and 300 μg/ml for 3 h and curcumin was given at 5, 10 and 20 μg/ml for 16 h, prior to sodium azide treatment. The tips were squashed after colchicine treatment and the cells were analyzed for chromosome aberration and mitotic index. Curcumin induces chromosomal aberration in Allium cepa root tip cells in an insignificant manner, when compared with untreated control. Sodium azide alone induces chromosomal aberrations significantly with increasing concentrations. The total number of aberrations was significantly reduced in root tip cells pretreated with curcumin. The study reveals that curcumin has antimutagenic potential against sodium azide induced chromosomal aberrations in Allium cepa root meristem cells. In addition, it showed mild cytotoxicity by reducing the percentage of mitotic index in all curcumin treated groups, but the mechanism of action remains unknown. The antimutagenic potential of curcumin is effective at 5 μg/ml in Allium cepa root meristem cells.

  18. Metaphase chromosome aberrations as markers of radiation exposure and dose

    International Nuclear Information System (INIS)

    Chromosome aberration frequency provides the most reliable biological marker of dose for detecting acute accidental radiation exposure. Significant radiation-induced changes in the frequency of chromosome aberrations can be detected at very low doses. Our paper provides information on using molecular chromosome probes ''paints'' to score chromosome damage and illustrates how technical advances make it possible to understand mechanisms involved during formation of chromosome aberrations. In animal studies chromosome aberrations provide a method to relate cellular damage to cellular dose. Using an In vivo/In vitro approach aberrations provided a biological marker of dose from radon progeny exposure which was used to convert WLM to dose in rat tracheal epithelial cells. Injection of Chinese hamsters with 144Ce which produced a low dose rate exposure of bone marrow to either low-LET radiation increased the sensitivity of the cells to subsequent external exposure to 60Co. These studies demonstrated the usefulness of chromosome damage as a biological marker of dose and cellular responsiveness

  19. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.


    Takaiwa, F; Sugiura, M


    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  20. Implementace metody 5S ve výrobním podniku


    Čechová, Petra


    Bakalářská práce se zabývá implementací metody 5S v podniku zaměřeném na výrobu a zpracování skelného vlákna. Teoretická část vysvětluje základní principy filozofie Kaizen. V praktické části je navržena a dále implementována metodika 5S ve společnosti. V závěru práce jsou zhodnoceny přínosy aplikace užité metody.

  1. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium (United States)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.


    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  2. Uudised : Eesti muusikalistaarid Euroopas. Tüüri 5.sümfoonia Tallinnas

    Index Scriptorium Estoniae


    Koit Toome, Ele Millistver ja Lauri Liiv alustavad 1. detsembril Brnos rahvusvahelises muusikalitrupis "Hairi" proovidega. Esietendus on 26. dets. Iserlohni linnas Saksamaal ning etendusi antakse järgmise aasta 16. aprillini Saksa linnades, Austrias, Šveitsis ja Taanis. Erkki-Sven Tüüri 5. sümfoonia tuleb Eestis esiettekandele 10. dets. Estonia Kontserdisaalis, teose esiettekannet selle aasta veebruaris Stuttgardis dirigeeris Olari Elts

  3. A Study of the Impact of Implementing 5s on Efficiency and Effectiveness of Constabularies' Workers


    Milad Aghaee; Asghar Aghaee


    IntroductionPeople always seek ways for improving and using optimally the current facilities which are available. KAIZEN is a Japanese expression which means improvement. In fact, KAIZEN is a continuous improvement which encompasses all people, managers and employees alike, and its philosophy is based on continuous improvement in lifestyle of human beings. Like an umbrella, KAIZEN encompasses all principles for moving to promotion and organizational excellence. 5s is one of these principles, ...

  4. Fuel and coolant motions following pin failure: EPIC models and the PBE-5S experiment

    International Nuclear Information System (INIS)

    The EPIC computer code has been used to analyze the post-fuel-pin-failure behavior in the PBE-5S experiment performed at Sandia Laboratories. The effects of modeling uncertainties on the calculation are examined. The calculations indicate that the majority of the piston motion observed in the test is due to the initial pressurization of the coolant channel by fuel vapor at cladding failure. A more definitive analysis requires improvements in calculational capabilities and experiment diagnostics

  5. Split-plot fractional designs: Is minimum aberration enough?

    DEFF Research Database (Denmark)

    Kulahci, Murat; Ramirez, Jose; Tobias, Randy


    Split-plot experiments are commonly used in industry for product and process improvement. Recent articles on designing split-plot experiments concentrate on minimum aberration as the design criterion. Minimum aberration has been criticized as a design criterion for completely randomized fractional...... factorial design and alternative criteria, such as the maximum number of clear two-factor interactions, are suggested (Wu and Hamada (2000)). The need for alternatives to minimum aberration is even more acute for split-plot designs. In a standard split-plot design, there are several types of two...... completely randomized designs. Consequently, we provide a modified version of the maximum number of clear two-factor interactions design criterion to be used for split-plot designs....

  6. Biological dosimetry: chromosomal aberration analysis for dose assessment

    International Nuclear Information System (INIS)

    In view of the growing importance of chromosomal aberration analysis as a biological dosimeter, the present report provides a concise summary of the scientific background of the subject and a comprehensive source of information at the technical level. After a review of the basic principles of radiation dosimetry and radiation biology basic information on the biology of lymphocytes, the structure of chromosomes and the classification of chromosomal aberrations are presented. This is followed by a presentation of techniques for collecting blood, storing, transporting, culturing, making chromosomal preparations and scaring of aberrations. The physical and statistical parameters involved in dose assessment are discussed and examples of actual dose assessments taken from the scientific literature are given

  7. Measurement of the atmospheric primary aberrations by 4-aperture DIMM

    CERN Document Server

    Shomali, Ramin; Darudi, Ahmad


    The present paper investigates and discusses the ability of the Hartmann test with 4-aperture DIMM to measure the atmospheric primary aberrations which, in turn, can be used for calculation of the atmospheric coherence time. Through performing numerical simulations, we show that the 4-aperture DIMM is able to measure the defocus and astigmatism terms correctly while its results are not reliable for the coma. The most important limitation in the measurement of the primary aberrations by 4-aperture DIMM is the centroid displacements of the spots which are caused by the higher order aberrations. This effect is negligible in calculating of the defocus and astigmatisms, while, it cannot be ignored in the calculation of the coma.

  8. Correcting the Chromatic Aberration in Barrel Distortion of Endoscopic Images

    Directory of Open Access Journals (Sweden)

    Y. M. Harry Ng


    Full Text Available Modern endoscopes offer physicians a wide-angle field of view (FOV for minimally invasive therapies. However, the high level of barrel distortion may prevent accurate perception of image. Fortunately, this kind of distortion may be corrected by digital image processing. In this paper we investigate the chromatic aberrations in the barrel distortion of endoscopic images. In the past, chromatic aberration in endoscopes is corrected by achromatic lenses or active lens control. In contrast, we take a computational approach by modifying the concept of image warping and the existing barrel distortion correction algorithm to tackle the chromatic aberration problem. In addition, an error function for the determination of the level of centroid coincidence is proposed. Simulation and experimental results confirm the effectiveness of our method.

  9. Screening for aberrant behavior in the nuclear industry

    International Nuclear Information System (INIS)

    This paper attempts to promote a fuller understanding of how psychological assessment procedures can be used to reduce the threat from aberrant behavior in the nuclear industry. It begins with a discussion of the scientifically based methods that are used by psychologists in constructing, scoring, and interpreting these procedures. This discussion includes an emphasis on the concepts of validity and reliability and their central importance when one is choosing specific psychological screening tools. Criteria for selecting and using psychological assessment procedures when screening for aberrant behavior are also provided. Some commonly used assessment procedures that satisfy these criteria are discussed. A number a psychological assessment procedures specifically recommended for use in screening for aberrant behavior in the nuclear industry are described

  10. On-line correction of aberrations in particle spectrographs

    International Nuclear Information System (INIS)

    A new method is presented that allows the reconstruction of trajectories and the on-line correction of residual aberrations that limit the resolution of particle spectrographs. Using a computed or fitted high order transfer map that describes the uncorrected aberrations of the spectrograph under consideration, it is possible to determine a pseudo transfer map that allows the computation of the corrected data of interest as well as the reconstructed trajectories in terms of position measurements in two planes near the focal plane. The technique is only limited by the accuracy of the position measurements and the accuracy of the transfer map. In practice the method can be expressed as an inversion of a pseudo transfer map and implemented in the differential algebraic framework. The method will be used to correct residual high aberrations in the S800 spectrograph which is under construction at the National Superconducting Cyclotron Laboratory at Michigan State University

  11. Subwavelength-grating-induced wavefront aberrations: a case study (United States)

    Crabtree, Karlton; Chipman, Russell A.


    The on-axis wavefront aberrations of a one-dimensional subwavelength-grating antireflection coating on an f/1.7 lens surface are shown to be small with noticeable contributions of defocus, astigmatism, and piston. The astigmatism is 0.02 wave, and the magnitude of the piston approaches one wave peak-to-valley. The difference in aberrations between orthogonally polarized wavefronts, or the retardance aberration, shows 0.01 wave of astigmatismlike variation and more than 0.01 wave of retardance-induced defocuslike variation. A small coupling between polarization states occurs in the form of the familiar Maltese cross, yielding a maximum of 3% coupling in the four diagonal edges of the pupil.

  12. Non-Gaussianity and CMB aberration and Doppler

    CERN Document Server

    Catena, Riccardo; Notari, Alessio; Renzi, Alessandro


    The peculiar motion of an observer with respect to the CMB rest frame induces a deflection in the arrival direction of the observed photons (also known as CMB aberration) and a Doppler shift in the measured photon frequencies. As a consequence, aberration and Doppler effects induce non trivial correlations between the harmonic coefficients of the observed CMB temperature maps. In this paper we investigate whether these correlations generate a bias on Non-Gaussianity estimators $f_{NL}$. We perform this analysis simulating a large number of temperature maps with Planck-like resolution (lmax $= 2000$) as different realizations of the same cosmological fiducial model (WMAP7yr). We then add to these maps aberration and Doppler effects employing a modified version of the HEALPix code. We finally evaluate a generalization of the Komatsu, Spergel and Wandelt Non-Gaussianity estimator for all the simulated maps, both when peculiar velocity effects have been considered and when these phenomena have been neglected. Usi...

  13. Radiation-induced chromosome aberrations in human lymphocytes

    International Nuclear Information System (INIS)

    Dose-response relationships for unstable chromosome exchange aberrations were obtained after irradiation with 200 kV X-rays and 60Co gamma rays, the doses ranging within 0.05-3.0 Gy. The data points were fitted to the linear quadratic model Y = C + αD + βD2, and after the chromosome hits leading to two-break unstable aberrations were estimated, to the model average x = C +kD. The results fitted the latter model particularly well, the index of determination being 0.988 for gamma rays and 0.997 for X-rays. The RBE of 200 kV X-rays as compared with 60Co gamma radiation was 1.6, when primary chromosome breaks leading to dicentric and centric ring aberrations were used as the biological endpoint. (author)

  14. Split-plot fractional designs: Is minimum aberration enough?

    DEFF Research Database (Denmark)

    Kulahci, Murat; Ramirez, Jose; Tobias, Randy


    Split-plot experiments are commonly used in industry for product and process improvement. Recent articles on designing split-plot experiments concentrate on minimum aberration as the design criterion. Minimum aberration has been criticized as a design criterion for completely randomized fractional...... factorial design and alternative criteria, such as the maximum number of clear two-factor interactions, are suggested (Wu and Hamada (2000)). The need for alternatives to minimum aberration is even more acute for split-plot designs. In a standard split-plot design, there are several types of two...... for completely randomized designs. Consequently, we provide a modified version of the maximum number of clear two-factor interactions design criterion to be used for split-plot designs....

  15. Stability of chromosome aberrations with post-irradiation time. Implications in retrospective biodosimetry. Chromosome aberration analysis in retrospective biodosimetry

    International Nuclear Information System (INIS)

    The aim of the present study was to evaluate the persistence chromosome aberrations induced by three doses of X-rays. For this purpose fluorescence in situ hybridisation (FISH) painting and multiplex FISH (mFISH) techniques have been applied to a long-term culture of irradiated cells. By painting, at 2 Gy the frequency of apparently simple translocations remained almost invariable during all the culture, whereas at 4 Gy a rapid decline was observed between the first and the second sample, followed by a slight decrease until the end of the culture. Apparently simple dicentrics and complex aberrations disappeared after the first sample at 2 and 4 Gy. When simple aberrations analysed by mFISH are considered, at 2 Gy the frequency of complete plus one-way translocations remained invariable between the first and last sample, but at 4 Gy a 60% decline was observed. True incomplete simple translocations disappeared at 2 and 4 Gy. The analysis by mFISH showed that the frequency of complex aberrations and their complexity increased with dose and tends to disappear in the last sample. Our results indicate that the dose influence on the decrease of the frequency of simple translocations with post-irradiation time cannot be fully explained by the disappearance of true incomplete translocations and complex aberrations. (author)

  16. Use of Chromosome Aberration Frequencies for Biological Dosimetry in Man

    International Nuclear Information System (INIS)

    The vast amount of work on chromosome aberrations induced by radiation exposure under defined biological and physical conditions, has shown that there exist strict relationships between aberration frequencies, radiation quality and absorbed dose in a variety of cell systems. These relationships are such that in many irradiated plant and animal systems the frequency of induced chromosome aberrations has been used to give reliable estimates of the radiation dose to which the system was exposed. A similar extrapolation from induced aberration frequency to absorbed dose can be made with human peripheral blood lymphocytes, if such cells are exposed and cultured in vitro under well defined conditions. Moreover, since aberrations induced in lymphocytes following an in vivo exposure can be detected in the cells when subsequently cultured in vitro, the peripheral blood leucocyte system has been utilized for biological dosimetry in cases where individuals have been accidentally exposed to radiations. In the case of uniform whole-body exposure of an individual, and under defined conditions of in vitro culture, the system may be expected to fulfil most of the requirements for a sensitive and accurate biological measure of absorbed dose. In this context biological variations between individuals may be of importance and the influence of such factors as age and genotype on the radiation response are considered. In cases of partial body exposure, there are a variety of biological factors that may have a considerable influence on the yields of aberrations measured in cells removed from the body shortly after exposure. Factors that are important include: the proportions of lymphocytes located in or passing through the radiation field at the time of exposure; the distribution and mobility of lymphocytes between peripheral blood and the lymphoid systems; differences in the radiation response of lymphocytes of differing types, and differences in the capacities of irradiated and non

  17. A study on optical aberrations in parabolic neutron guides

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yu; Wang, Hongli; Liu, Yuntao [Neutron Scattering Laboratory, China Institute of Atomic Energy, Beijing 102413 (China); Zu, Yong [China International Engineering Consulting Corporation, Beijing 100048 (China); He, Linfeng; Wei, Guohai; Sun, Kai [Neutron Scattering Laboratory, China Institute of Atomic Energy, Beijing 102413 (China); Han, Songbai, E-mail: [Neutron Scattering Laboratory, China Institute of Atomic Energy, Beijing 102413 (China); Chen, Dongfeng, E-mail: [Neutron Scattering Laboratory, China Institute of Atomic Energy, Beijing 102413 (China)


    It is widely believed that a neutron beam can be focused to a small spot using a parabolic guide, which will significantly improve the flux. However, researchers have also noted challenges for the neutron inhomogeneous phase space distribution in parabolic focusing guide systems. In this paper, the sources of most prominent optical aberrations, such as an inhomogeneous phase space distribution and irregular divergence distribution, are discussed, and an optimization solution is also proposed. We indicate that optimizing the parabolic guide geometrical configuration removes almost all of the aberrations and yields a considerable intensity gain factor.

  18. Aberrations of the point spread function of a multimode fiber

    CERN Document Server

    Descloux, Adrien; Pinkse, Pepijn W H


    We investigate the point spread function of a multimode fiber. The distortion of the focal spot created on the fiber output facet is studied for a variety of the parameters. We develop a theoretical model of wavefront shaping through a multimode fiber and use it to confirm our experimental results and analyze the nature of the focal distortions. We show that aberration-free imaging with a large field of view can be achieved by using an appropriate number of segments on the spatial light modulator during the wavefront-shaping procedure. The results describe aberration limits for imaging with multimode fibers as in, e.g., microendoscopy.

  19. Investigation of spherical aberration effects on coherent lidar performance

    DEFF Research Database (Denmark)

    Hu, Qi; Rodrigo, Peter John; Iversen, Theis Faber Quist;


    different telescope configurations using a hard target. It is experimentally and numerically proven that the SA has a significant impact on lidar antenna efficiency and optimal beam truncation ratio. Furthermore, we demonstrate that both effective probing range and spatial resolution of the system are......In this paper we demonstrate experimentally the performance of a monostatic coherent lidar system under the influence of phase aberrations, especially the typically predominant spherical aberration (SA). The performance is evaluated by probing the spatial weighting function of the lidar system with...

  20. Optical imaging and aberrations, p.2 wave diffraction optics

    CERN Document Server

    Mahajan, Virendra N


    Ten years have passed since the publication of the first edition of this classic text in April 2001. Considerable new material amounting to 100 pages has been added in this second edition. Each chapter now contains a Summary section at the end. The new material in Chapter 4 consists of a detailed comparison of Gaussian apodization with a corresponding beam, determination of the optimum value of the Gaussian radius relative to that of the pupil to yield maximum focal-point irradiance, detailed discussion of standard deviation, aberration balancing, and Strehl ratio for primary aberrations, deri

  1. Aberration of a negative ion beam caused by space charge effect

    International Nuclear Information System (INIS)

    Aberrations are inevitable when the charged particle beams are extracted, accelerated, transmitted, and focused with electrostatic and magnetic fields. In this study, we investigate the aberration of a negative ion accelerator for a neutral beam injector theoretically, especially the spherical aberration caused by the negative ion beam expansion due to the space charge effect. The negative ion current density profiles with the spherical aberration are compared with those without the spherical aberration. It is found that the negative ion current density profiles in a log scale are tailed due to the spherical aberration.

  2. Effect of Coma Aberration on Orbital Angular Momentum Spectrum of Vortex Beams

    Institute of Scientific and Technical Information of China (English)

    CHEN Zi-Yang; PU Ji-Xiong


    Spiral spectra of vortex beams with coma aberration are studied.It is shown that the orbital angular momentum (OAM) states of vortex beams with coma aberration are different from those aberration-free vortex beams.Spiral spectra of beams with coma aberration are spreading.It is found that in the presence of coma aberration,the vortex beams contain not only the original OAM component but also other components.A larger coma aberration coefficient and/or a larger beam waist will lead to a wider spreading of the spiral spectrum. The results may have potential applications in information encoding and transmittance.

  3. Relationship between wave aberrations and histological features in ex vivo porcine crystalline lenses (United States)

    Acosta, Eva; Bueno, Juan M.; Schwarz, Christina; Artal, Pablo


    Wave aberrations of isolated ex vivo porcine crystalline lenses were measured by using a point-diffraction interferometer. This method allowed us to gain greater insight into the detailed aberration structure of eye lenses showing systematic presence of some dominant aberrations. In order of significance, astigmatism together with spherical aberration, coma, and trefoil are the main aberrations present in all lenses. We found a high correlation between the axis of both astigmatism and trefoil with the Y-shaped suture planes of the lens, revealing a subtle relationship between the induced aberrations and the histological features.

  4. Digital Libraries: Analysis of Delos Reference Model and 5S Theory

    Directory of Open Access Journals (Sweden)

    Isah, Abdulmumin


    Full Text Available The proliferation of digital libraries (DL in the twenty-first century has revolutionized the way information is generated and disseminated. This has led to various practical and research models of DLs. This paper discusses the concept and development of digital libraries, and examines various components and characteristics of DLs. It further identifies various models and theories of digital libraries with a special focus on the DELOS Reference Model and 5S Theory. The relationship between the two focused frameworks is analyzed for better understanding of their application in the DL universe.



    Kytölä, Erkka-Pekka


    Tämän opinnäytetyön tarkoituksena oli layout-suunnitelman laatiminen ja sen toteuttaminen sekä 5S:n käynnistäminen ja läpivieminen mahdollisimman pitkälle toimeksiannon antaneelle yritykselle. Yrityksen toimialana on pääsääntöisesti metalliteollisuuden alihankintatyöt. Yrityksen toimipaikka sijaitsee Keuruulla. Opinnäytetyön tavoitteena oli muuttaa toimintatapoja tehokkaampaan suuntaan sekä eliminoida esteet tuotannon kasvulta. Teoreettisessa tietoperustassa on käsitelty layout-suunnittel...

  6. Magic wavelengths for the $5s-18s$ transition in rubidium

    CERN Document Server

    Goldschmidt, E A; Koller, S B; Wyllie, R; Brown, R C; Porto, J V; Safronova, U I; Safronova, M S


    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the $5s-18s$ transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  7. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate. (United States)

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C


    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: . PMID:27364428

  8. Design and Comparison of a 1 MW / 5s HTS SMES with Toroidal and Solenoidal Geometry

    CERN Document Server

    Morandi, Antonio; Gholizad, Babak; Grilli, Francesco; Sirois, Frédéric; Zermeño, Víctor M R


    The design of a HTS SMES coil with solenoidal and toroidal geometry is carried out based on a commercially available 2G HTS conductor. A SMES system of practical interest (1 MW / 5 s) is considered. The comparison between ideal toroidal and solenoidal geometry is first discussed and the criteria used for choosing the geometrical parameters of the coils' bore are explained. The design of the real coil is then carried out and the final amount of conductor needed is compared. A preliminary comparison of the two coils in terms of AC loss during one charge discharge cycle is also discussed.

  9. Evolution of green plants as deduced from 5S rRNA sequences


    Hori, Hiroshi; Lim, Byung-Lak; OSAWA, Syozo


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land pl...

  10. Aberration Corrected Photoemission Electron Microscopy with Photonics Applications (United States)

    Fitzgerald, Joseph P. S.

    Photoemission electron microscopy (PEEM) uses photoelectrons excited from material surfaces by incident photons to probe the interaction of light with surfaces with nanometer-scale resolution. The point resolution of PEEM images is strongly limited by spherical and chromatic aberration. Image aberrations primarily originate from the acceleration of photoelectrons and imaging with the objective lens and vary strongly in magnitude with specimen emission characteristics. Spherical and chromatic aberration can be corrected with an electrostatic mirror, and here I develop a triode mirror with hyperbolic geometry that has two adjacent, field-adjustable regions. I present analytic and numerical models of the mirror and show that the optical properties agree to within a few percent. When this mirror is coupled with an electron lens, it can provide a large dynamic range of correction and the coefficients of spherical and chromatic aberration can be varied independently. I report on efforts to realize a triode mirror corrector, including design, characterization, and alignment in our microscope at Portland State University (PSU). PEEM may be used to investigate optically active nanostructures, and we show that photoelectron emission yields can be identified with diffraction, surface plasmons, and dielectric waveguiding. Furthermore, we find that photoelectron micrographs of nanostructured metal and dielectric structures correlate with electromagnetic field calculations. We conclude that photoemission is highly spatially sensitive to the electromagnetic field intensity, allowing the direct visualization of the interaction of light with material surfaces at nanometer scales and over a wide range of incident light frequencies.

  11. Chromosomal aberrations and SCEs as biomarkers of cancer risk

    Czech Academy of Sciences Publication Activity Database

    Norppa, H.; Bonassi, S.; Hansteen, I. L.; Hagmar, L.; Strömberg, U.; Rössner st., Pavel; Boffetta, P.; Lindholm, C.; Gundy, S.; Lazutka, J.; Cebulska-Wasilewska, A.; Fabiánová, E.; Šrám, Radim; Knudsen, L. E.; Barale, R.; Fucic, A.


    Roč. 600, - (2006), s. 37-45. ISSN 0027-5107 Institutional research plan: CEZ:AV0Z50390512 Keywords : biomarkers * chromosomal aberration * sister chromatid exchange Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 4.111, year: 2006

  12. Consequences of Aberrant Hedgehog Signaling During Zebrafish Development

    NARCIS (Netherlands)

    Koudijs, M.J.


    The Hedgehog signaling pathway is controlling proliferation, patterning and differentiation during development of vertebrates and invertebrates. Aberrant Hedgehog activity has been shown to be one of the underlying causes of a number of congenital disorders and multiple types of cancer. We investiga

  13. Geometric aberrations in final focussing for heavy ion fusion

    International Nuclear Information System (INIS)

    A general formulation is developed to estimate third-order distortions of ion beams without detailed calculations. Several candidate heavy ion fusion (HIF) beams are discussed in detail as examples. Some general ideas on constraints which third-order aberrations place on HIF parameters are developed

  14. Impact of primary aberrations on coherent lidar performance

    DEFF Research Database (Denmark)

    Hu, Qi; Rodrigo, Peter John; Iversen, Theis Faber Quist;


    demonstration of these tendencies. Furthermore, our numerical and experimental results show good agreement. We also demonstrate how the truncation of the transmit beam affects the system performance. It is both experimentally and numerically proven that aberration effects have profound impact on the antenna...

  15. Chromosomal aberration frequency in lymphocytes predicts the risk of cancer

    DEFF Research Database (Denmark)

    Bonassi, Stefano; Norppa, Hannu; Ceppi, Marcello;


    Mechanistic evidence linking chromosomal aberration (CA) to early stages of cancer has been recently supported by the results of epidemiological studies that associated CA frequency in peripheral lymphocytes of healthy individuals to future cancer incidence. To overcome the limitations of single...

  16. Frequency and distribution studies of asymmetrical versus symmetrical chromosome aberrations

    International Nuclear Information System (INIS)

    Two aspects of the relationship between Asymmetrical (A) and Symmetrical (S) radiation-induced chromosomal aberrations are considered in this paper. (1) Are A and S truly alternative modes of lesion interaction. Relative frequencies for chromatid-type and chromosome-type are examined, and new lymphocyte data using banding is used to look at this, and also for parallelism in chromosome participation of the two forms for various aberration categories. All the tests applied suggest that A and S are alternative interaction modes. (2) The long-term survival characteristics of A and S are discussed, and the differences in expected frequencies of derived S per surviving cell from chromosome-type and chromatid-types are stressed. Since many in vivo tissues have varying mixtures of potential chromatid and chromosome aberration-bearing target cells, ultimate cell survival and derived S frequencies may differ between tissues for the same absorbed dose. An Appendix gives Relative Corrected Lengths (RCL) for chromosomes of the human karyotype which should be used when testing the various exchange aberration categories for random chromosome participation. (orig.)

  17. Telomere Length in Circulating Lymphocytes: Association with Chromosomal Aberrations

    Czech Academy of Sciences Publication Activity Database

    Hemminki, K.; Rachakonda, S.; Musak, L.; Vymetálková, Veronika; Halasová, E.; Forsti,, A.; Vodičková, Ludmila; Buchancová, J.; Vodička, Pavel; Kumar, R.


    Roč. 54, č. 3 (2015), s. 194-196. ISSN 1045-2257 Institutional support: RVO:68378041 Keywords : structural chromosome aberrations * healthy subjects * relative telomere length * genotoxicity * telomere biology Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.041, year: 2014

  18. Chromosomal aberrations in tire plant workers and interaction with

    Czech Academy of Sciences Publication Activity Database

    Musak, L.; Souček, P.; Vodičková, Ludmila; Naccarati, Alessio; Halasová, E.; Poláková, Veronika; Slyšková, Jana; Susová, S.; Buchancová, J.; Šmerhovský, Z.; Sediková, J.; Klimentová, G.; Osina, O.; Hemminki, K.; Vodička, Pavel


    Roč. 641, 1-2 (2008), s. 36-42. ISSN 0027-5107 R&D Projects: GA MZd NR8563 Institutional research plan: CEZ:AV0Z50390512 Keywords : Chromosomal aberrations * Genetic polymorphisms * DNA repair genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.198, year: 2008

  19. Chromosome aberrations induced in human lymphocytes by neutron irradiation

    International Nuclear Information System (INIS)

    In vitro dose-response curves of unstable chromosome aberrations in human lymphocytes have been obtained for neutron spectra of mean energies 0.7, 0.9, 7.6 and 14.7 MeV. The aberration yields have been fitted to the quadratic function Y = αD + βD2, which is consistent with the single-track and two-track model of aberration formation. However with high-LET radiation, the linear component of yield, corresponding to damage caused by single tracks, predominates, and this term becomes more dominant with increasing LET, so that for fission spectrum neutrons the relationship is linear, Y = αD. At low doses, such as those received by radiation workers, limiting r.b.e. values between 13 and 47 were obtained relative to 60Co γ-radiation. At higher doses, as used in radiotherapy, the values were much lower; ranging from 2.7 to 8 at 200 rad of equivalent γ-radiation. Both sets of r.b.e. values correlated well with track-averaged LET but not with dose-averaged LET. When the numbers of cells without aberrations were plotted against radiation dose, curves were obtained which are similar in shape to those for conventional cell-survival experiments with comparable neutron spectra. The D0 values obtained in the present study are close to those from other cell systems. (author)

  20. Frequency of primary amenorrhea due to chromosomal aberration

    International Nuclear Information System (INIS)

    Objective: To find out the frequency of primary amenorrhea due to chromosomal aberration and the different options available for management. Subjects and Methods: All patients with primary amenorrhea due to chromosomal aberrations were included in study. Patient's detailed history, general physical examination, presence or absence of secondary sexual characteristics, abdominal and pelvic examination finding were noted. Targeted investigations, including ultrasound, hormonal assay, buccal smear and karyotyping results were recorded. The management options were individually tailored with focus n psychological management. Results: Eighteen patients out of 30,000 patients were diagnosed as having primary amenorrhea. Six had primary amenorrhea due to chromosomal aberrations with the frequency of 0.02%. The age at presentation was 20 years and above in 50%. The most common cause was Turner's syndrome seen in 4 out of 6. The presenting symptoms were delay in onset of menstruation in 05 patients and primary infertility in 01 patient. Conclusion: Primary amenorrhea due to chromosomal aberration is an uncommon condition requiring an early and accurate diagnosis. Turner's syndrome is a relatively common cause of this condition. Management should be multi-disciplinary and individualized according to the patient's age and symptom at presentation. Psychological management is very important and counselling throughout treatment is recommended. (author)

  1. Oxidative stress and chromosomal aberrations in an environmentally exposed population

    Czech Academy of Sciences Publication Activity Database

    Rössner ml., Pavel; Rössnerová, Andrea; Šrám, Radim


    Roč. 707, 1-2 (2011), s. 34-41. ISSN 0027-5107 R&D Projects: GA MŽP(CZ) SP/1B3/8/08 Institutional research plan: CEZ:AV0Z50390512 Keywords : air pollution * oxidative stress * chromosomal aberrations Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 2.850, year: 2011

  2. Radiation induced chromosomal aberrations after cardiac catheterization and angiocardiography

    International Nuclear Information System (INIS)

    The relationship between the radiation doses and the chromosomal aberrations of peripheral lymphocytes was studied in patients under-going catheterization with or without angiocardiography. The radiation doses were estimated and chromosomal aberration analyses were carried out in 17 cases. They consisted of 10 males and 7 females at the age of 4 to 26 years with an average of 14 years. Doses in the chest and gonadal regions were measured with calibrated thermoluminescent dosimeters. Peripheral blood samples were taken immediately before and after the diagnostic procedure for chromosome analyses. Results showed that the average doses in the gonad region during cardiac catheterization with and without angiocardiography were 2.4 and 0.83 kC/kg respectively, while those in the chest region were as high as 0.93 and 0.54 kC/kg respectively. The chromosome aberration rate in both groups were significantly higher (2.75-3.33%) than the control value (0.22-0.75%) which was determined before X ray examination. No statistically significant difference of chromosome aberration yield was found between the two groups with and without angiocardiography

  3. Active Optical Control of Quasi-Static Aberrations for ATST (United States)

    Johnson, L. C.; Upton, R.; Rimmele, T. R.; Hubbard, R.; Barden, S. C.


    The Advanced Technology Solar Telescope (ATST) requires active control of quasi-static telescope aberrations in order to achieve the image quality set by its science requirements. Four active mirrors will be used to compensate for optical misalignments induced by changing gravitational forces and thermal gradients. These misalignments manifest themselves primarily as low-order wavefront aberrations that will be measured by a Shack-Hartmann wavefront sensor. When operating in closed-loop with the wavefront sensor, the active optics control algorithm uses a linear least-squares reconstructor incorporating force constraints to limit force applied to the primary mirror while also incorporating a neutral-point constraint on the secondary mirror to limit pointing errors. The resulting system compensates for astigmatism and defocus with rigid-body motion of the secondary mirror and higher-order aberrations with primary mirror bending modes. We demonstrate this reconstruction method and present simulation results that apply the active optics correction to aberrations generated by finite-element modeling of thermal and gravitational effects over a typical day of ATST operation. Quasi-static wavefront errors are corrected to within limits set by wavefront sensor noise in all cases with very little force applied to the primary mirror surface and minimal pointing correction needed.

  4. Frequency of chromosomal aberrations in Prague mothers and their newborns.

    Czech Academy of Sciences Publication Activity Database

    Rössnerová, Andrea; Balascak, I.; Rössner ml., Pavel; Šrám, Radim


    Roč. 699, 1-2 (2010), s. 29-34. ISSN 1383-5718 R&D Projects: GA MŠk 2B06088 Institutional research plan: CEZ:AV0Z50390512 Keywords : Carcinogenic polycyclic aromatic hydrocarbons * Chromosomal aberrations * Fluorescence in situ hybridization Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 2.938, year: 2010

  5. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing. (United States)

    Eastman, Alexander W; Yuan, Ze-Chun


    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

  6. Male meiosis, heterochromatin characterization and chromosomal location of rDNA in Microtomus lunifer (Berg, 1900 (Hemiptera: Reduviidae: Hammacerinae

    Directory of Open Access Journals (Sweden)

    María Poggio


    Full Text Available In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900 by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y, including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in M. conspicillaris (Drury, 1782 (2n=28+XY. However, M. lunifer has a multiple sex chromosome system X1X2Y (male that could have originated by fragmentation of the ancestral X chromosome. Taking into account that M. conspicillaris and M. lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in M. lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants  of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity.

  7. Application of EMA, Fluorescent Staining and FISH of rDNA in Analysis of Aloe vera (L.) Burm. f. Chromosomes


    JHA, Timir Baran; Yamamoto, Masashi; ヤマモト, マサシ; 山本, 雅


    Fluorescent banding patterns and the locations of the ribosomal RNA gene (rDNA) of Indian Aloe vera (L.) Burm. f. chromosomes were determined. Root tips were pretreated in 2 mM 8- hydroxyquinoline at 10 to 12℃ for 3h. The chromosome samples were prepared by the enzymatic maceration and air-drying method (EMA). The best preparation, with all chromosomes relatively extended and well spread without cytoplasm, was obtained following enzymatic condition of 0.67% Cellulase Onozuka RS, 0.5% Macerozy...

  8. Diversity analysis of Bemisia tabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region


    Rabello, Aline R; Paulo R. Queiroz; Kenya C.C. Simões; Hiragi, Cássia O.; Luzia H.C. Lima; Maria Regina V. Oliveira; Angela Mehta


    The Bemisia tabaci complex is formed by approximately 41 biotypes, two of which (B and BR) occur in Brazil. In this work we aimed at obtaining genetic markers to assess the genetic diversity of the different biotypes. In order to do that we analyzed Bemisia tabaci biotypes B, BR, Q and Cassava using molecular techniques including RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. The analyses revealed a high similarity between the individuals of the B and Q biotypes, which could be distin...

  9. Phylogenetic analysis of Thai oyster (Ostreidae) based on partial sequences of the mitochondrial 16S rDNA gene

    DEFF Research Database (Denmark)

    Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik;


    Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen......Bank (T. gigas was used as outgroup). Some specimens were found to be genetically identical despite obvious morphological differences (e.g. four specimens of Crassostrea iredalei from east and west sides of the Malaysian peninsula and Saccostrea forskali and S. cf. malabonensis, both from Thai waters...

  10. PCR amplification of 16S rDNA from lyophilized cell cultures facilitates studies in molecular systematics (United States)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.


    The sequence of the major portion of a Bacillus cycloheptanicus strain SCH(T) 16S rRNA gene is reported. This sequence suggests that B. cycloheptanicus is genetically quite distinct from traditional Bacillus strains (e.g., B. subtilis) and may be properly regarded as belonging to a different genus. The sequence was determined from DNA that was produced by direct amplification of ribosomal DNA from a lyophilized cell pellet with straightforward polymerase chain reaction (PCR) procedures. By obviating the need to revive cell cultures from the lyophile pellet, this approach facilitates rapid 16S rDNA sequencing and thereby advances studies in molecular systematics.

  11. Long-term persistence of chromosome aberrations in uranium miners. (United States)

    Mészáros, Gabriella; Bognár, Gabriella; Köteles, G J


    Chromosome aberration analyses were performed on blood samples from 165 active underground uranium miners between 1981 and 1985. After decommissioning the mine in 1997 chromosome aberration analyses were also included in the medical laboratory investigations of health conditions of 141 subjects between 1998 and 2002 within the framework of a follow-up-study. The numerical data are presented as functions of the exposure categories expressed in working level month up to 600. In the active groups the dicentric level was 7 to 12 times higher than in the unexposed population, the acentrics also higher with more than an order of magnitude, the frequency of total aberrations--including dicentrics, acentrics, rings, deletions, minits and numerical aberrations, i.e. both chromatid and chromosome type of aberrations were also well above the control level. In the group of former uranium miners although there were slight decreases in the dicentrics after 8 to 25 yr, the values were not significantly different from the values of active miners. The frequency of deletions was also maintained in the post-mining period. The frequency of acentrics, however, decreased significantly, but even the lowest values remained 2-3 times higher than the values in the unexposed population.The possibility is suggested that for the long-term persistence of cytogenetic alterations the permanent production and presence of clastogenic factors might be responsible. The comparison of the two datasets suggest a long-term persistence of cytogenetic alterations above the population average values in a large fraction of persons investigated. PMID:15308832

  12. Chromatin structure and ionizing-radiation-induced chromosome aberrations

    International Nuclear Information System (INIS)

    The possible influence of chromatic structure or activity on chromosomal radiosensitivity was studied. A cell line was isolated which contained some 105 copies of an amplified plasmid in a single large mosquito artificial chromosome (MAC). This chromosome was hypersensitive to DNase I. Its radiosensitivity was some three fold greater than normal mosquito chromosomes in the same cell. In cultured human cells irradiated during G0, the initial breakage frequency in chromosome 4, 19 and the euchromatic and heterochromatic portions of the Y chromosome were measured over a wide range of doses by inducing Premature Chromosome Condensation (PCC) immediately after irradiation with Cs-137 gamma rays. No evidence was seen that Y heterochromatin or large fragments of it remained unbroken. The only significant deviation from the expected initial breakage frequency per Gy per unit length of chromosome was that observed for the euchromatic portion of the Y chromosome, with breakage nearly twice that expected. The development of aberrations involving X and Y chromosomes at the first mitosis after irradation was also studied. Normal female cells sustained about twice the frequency of aberrations involving X chromosomes for a dose of 7.3 Gy than the corresponding male cells. Fibroblasts from individuals with supernumerary X chromosomes did not show any further increase in X aberrations for this dos. The frequency of aberrations involving the heterochromatic portion of the long arm of the Y chromosome was about what would be expected for a similar length of autosome, but the euchromatic portion of the Y was about 3 times more radiosensitive per unit length. 5-Azacytidine treatment of cultured human female fibroblasts or fibroblasts from a 49,XXXXY individual, reduced the methylation of cytosine residues in DNA, and resulted in an increased chromosomal radiosensitivity in general, but it did not increase the frequency of aberrations involving the X chromosomes

  13. Non-Gaussianity and CMB aberration and Doppler

    International Nuclear Information System (INIS)

    The peculiar motion of an observer with respect to the CMB rest frame induces a deflection in the arrival direction of the observed photons (also known as CMB aberration) and a Doppler shift in the measured photon frequencies. As a consequence, aberration and Doppler effects induce non trivial correlations between the harmonic coefficients of the observed CMB temperature maps. In this paper we investigate whether these correlations generate a bias on non-Gaussianity estimators fNL. We perform this analysis simulating a large number of temperature maps with Planck-like resolution (lmax = 2000) as different realizations of the same cosmological fiducial model (WMAP7yr). We then add to these maps aberration and Doppler effects employing a modified version of the HEALPix code. We finally evaluate a generalization of the Komatsu, Spergel and Wandelt non-Gaussianity estimator for all the simulated maps, both when peculiar velocity effects have been considered and when these phenomena have been neglected. Using the value v/c = 1.23 × 10−3 for our peculiar velocity, we found that the aberration/Doppler induced non-Gaussian signal is at most of about half of the cosmic variance σ for fNL both in a full-sky and in a cut-sky experimental configuration, for local, equilateral and orthogonal estimators. We conclude therefore that when estimating fNL it is safe to ignore aberration and Doppler effects if the primordial map is already Gaussian. More work is necessary however to assess whether a map which contains non-Gaussianity can be significantly distorted by a peculiar velocity

  14. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure. (United States)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi


    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  15. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure (United States)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi


    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  16. Subjective face recognition difficulties, aberrant sensibility, sleeping disturbances and aberrant eating habits in families with Asperger syndrome

    Directory of Open Access Journals (Sweden)

    Källman Tiia


    Full Text Available Abstract Background The present study was undertaken in order to determine whether a set of clinical features, which are not included in the DSM-IV or ICD-10 for Asperger Syndrome (AS, are associated with AS in particular or whether they are merely a familial trait that is not related to the diagnosis. Methods Ten large families, a total of 138 persons, of whom 58 individuals fulfilled the diagnostic criteria for AS and another 56 did not to fulfill these criteria, were studied using a structured interview focusing on the possible presence of face recognition difficulties, aberrant sensibility and eating habits and sleeping disturbances. Results The prevalence for face recognition difficulties was 46.6% in individuals with AS compared with 10.7% in the control group. The corresponding figures for subjectively reported presence of aberrant sensibilities were 91.4% and 46.6%, for sleeping disturbances 48.3% and 23.2% and for aberrant eating habits 60.3% and 14.3%, respectively. Conclusion An aberrant processing of sensory information appears to be a common feature in AS. The impact of these and other clinical features that are not incorporated in the ICD-10 and DSM-IV on our understanding of AS may hitherto have been underestimated. These associated clinical traits may well be reflected by the behavioural characteristics of these individuals.

  17. Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana

    NARCIS (Netherlands)

    Ji, X.


    Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana. I studied numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana. The large genomic changes are important for

  18. Image transfer with spatial coherence for aberration corrected transmission electron microscopes. (United States)

    Hosokawa, Fumio; Sawada, Hidetaka; Shinkawa, Takao; Sannomiya, Takumi


    The formula of spatial coherence involving an aberration up to six-fold astigmatism is derived for aberration-corrected transmission electron microscopy. Transfer functions for linear imaging are calculated using the newly derived formula with several residual aberrations. Depending on the symmetry and origin of an aberration, the calculated transfer function shows characteristic symmetries. The aberrations that originate from the field's components, having uniformity along the z direction, namely, the n-fold astigmatism, show rotational symmetric damping of the coherence. The aberrations that originate from the field's derivatives with respect to z, such as coma, star, and three lobe, show non-rotational symmetric damping. It is confirmed that the odd-symmetric wave aberrations have influences on the attenuation of an image via spatial coherence. Examples of image simulations of haemoglobin and Si [211] are shown by using the spatial coherence for an aberration-corrected electron microscope. PMID:27155359

  19. Influence of misalignment and aberrations on antenna received power in free-space laser communications (United States)

    Tan, Liying; Yang, Yuqiang; Ma, Jing; Zheng, Guoxian


    To evaluate the influence of wavefront aberrations on antenna received power in free-space laser communications, an aberration attenuation factor is proposed, based on which the power penalty at the receiver due to misalignment and primary aberrations is investigated. It is shown that antenna received power decreases gradually with increasing misalignment and aberrations. A comparison shows that tilt (misalignment) has greater influence than other primary aberrations. When the rms aberration value is 0.1λ, the received power penalties caused by tilt, astigmatism, coma, curvature, and spherical aberrations are about 40%, 36%, 35%, 24%, and 23%, respectively. In addition, the obscuration ratio of the transmitter antenna has a noticeable but relatively minor influence on the aberration attenuation factor.

  20. The Effect of the Asphericity of Myopic Laser Ablation Profiles on the Induction of Wavefront Aberrations


    Bühren, Jens; Nagy, Lana; Yoon, Geunyoung; MacRae, Scott; Kohnen, Thomas; Huxlin, Krystel R.


    A PMMA model study showed that spherical aberration induction in laser refractive surgery is due to loss of ablation efficiency in the corneal periphery. Aspheric ablation induced less spherical aberration and provided better theoretical image quality.

  1. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides AT+CG in the mitogenome of Kamimuria wangi. (United States)

    Seligmann, Hervé


    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA. PMID:25865623

  2. Cylindrotheca closterium Is a Species Complex as Was Evidenced by the Variations of rbcL Gene and SSU rDNA

    Institute of Scientific and Technical Information of China (English)

    LI Haitao; YANG Guanpin; SUN Ying; WU Suihan; ZHANG Xiufang


    The genus Cylindrotheca consists of a small group of marine diatoms with a few species described. Eleven isolates of diatoms identified as Cylindrotheca closterium morphologically were obtained from Jiaozhou Bay with their nuclear-encoded small-subunit ribosomal RNA (SSU rDNA) and chloroplast-encoded rbcL gene sequences determined in this study. Interestingly, very high sequence divergences of SSU rDNA and rbcL gene were found among these isolates, and numerous nucleotide variation of rbcL gene caused relatively few variation of deduced amino acid sequence. Phylogenetic analyses based on SSU rDNA and rbcL gene, respectively, grouped the isolates into 6 clades. Phylogenetic tree of SSU rDNA placed all the Cylindrotheca isolates together, separating them into two lineages clearly. LineageⅠ was composed of the eleven C. closterium isolates obtained in this study together with another C. closterium isolate, but some clades were not well supported. LineageⅡ contained two C. closterium isolates and one C. fusiformis isolate. Phylogenetic analysis of rbcL gene also separated the Cylindrotheca isolates into two well-defined lineages. The eleven C. closterium isolates formed a lineage and all clades were supported strongly. Statistical comparisons of SSU rDNA indicated that the average distance within lineage Ⅰ was significantly higher than that of other microalgae species (P < 0.01). These results suggested the existence of cryptic species within C. closterium.

  3. Identification of Thiobacillus ferrooxidans strains based on restriction fragment length polymorphism analysis of 16S rDNA. (United States)

    Kamimura, K; Wakai, S; Sugio, T


    The 16S rDNA sequences from ten strains of Thiobacillus ferrooxidans were amplified by PCR. The products were compared by performing restriction fragment length polymorphism (RFLP) analysis with restriction endonucleases Alu I, Hap II, Hha I, and Hae III. The RFLP patterns revealed that T. ferrooxidans could be distinguished from other iron- or sulphur-oxidizing bacteria such as T. thiooxidans NB1-3, T. caldus GO-1, Leptospirillum ferrooxidans and the marine iron-oxidizing bacterium strain KU2-11. The RFLP patterns obtained with Alu I, Hap II, and Hae III were the same for nine strains of T. ferrooxidans except for strain ATCC 13661. The RFLP patterns for strains NASF-1 and ATCC 13661 with Hha I were distinct from those for other T. ferrooxidans strains. The 16S rDNA sequence of T. ferrooxidans NASF-1 possessed an additional restriction site for Hha I. These results show that iron-oxidizing bacteria isolated from natural environments were rapidly identified as T. ferrooxidans by the method combining RFLP analysis with physiological analysis. PMID:11414499

  4. Quadrapole mass spectrometer used as a tool to determine Gibbs free energy of formation of ThRh5(s)

    International Nuclear Information System (INIS)

    Gibbs free energy of formation of ThRh5(s) was determined by using Knudsen effusion-quadrupole mass spectrometer in the temperature range 1142≤T(K)≤1275. Gibbs free energy as a function of temperature can be given by: ΔfGo(ThRh5s) (Jmol-1) = -996.6 + 0.357 T(K). (author)

  5. Identification of radiation-induced chromosome aberrations by G-band staining

    International Nuclear Information System (INIS)

    A comparative study was made concerning chromosome aberration, especially symmetrical aberration in 23 serious A-bomb survivors (exposed with more than 100 rad) based upon the observations by using an ordinary staining method (O-method) and a G-band staining method (G-method). By both staining methods, 548 cells of 896 which could be analyzed were identified as normal. Aberration was detected in remaining 348 cells by either method. The number of cells in which aberration was observed by G-method but not by O-method was 55. Cells where aberration was observed by O-method but not by G-method were only 6 in number. Concerning overall aberrations, there were 197 cells in which the number detected kind of aberration by both methods was inconsistent. Also there were 31 cells, aberration of which could not be identified by G-method. The number of cells identified as abnormal by G-method was 342 and 293 by O-method, namely identification of aberration by O-method was 86% of that by G-method. The kinds of aberration are now studying. Results obtained from this study were summarized as follows; aberration which could not be detected by O-method are frequently identified by G-method and most of these aberration are symmetrical. (Kanao, N.)

  6. Low-temperature photoluminescence in CuIn$_5$S$_8$ single crystals

    Indian Academy of Sciences (India)



    Photoluminescence (PL) spectra of CuIn$_5$S$_8$ single crystals grown by Bridgman method have been studied in the wavelength region of 720–1020 nm and in the temperature range of 10–34 K. A broad PL band centred at 861 nm (1.44 eV) was observed at $T$ = 10 K. Variations of emission band has been studied as a function of excitation laser intensity in the 0.5–60.2 mW cm$^{−2}$ range. Radiative transitions from shallow donor level located at 17 meV below thebottom of the conduction band to the acceptor level located at 193 meV above the top of the valence band were suggested to be responsible for the observed PL band. An energy level diagram showing transitions in the band gap of the crystal has been presented.

  7. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    Energy Technology Data Exchange (ETDEWEB)

    Vilkas, M J; Ishikawa, Y; Trabert, E


    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  8. Magnetic resonance imaging analysis of surgical trans-sacral axial L5/S1 interbody fusion

    Institute of Scientific and Technical Information of China (English)

    YAN Ning; HE Shi-sheng; ZHANG Hai-long; GU Guang-fei; LIU Bi-feng; LIU Yan-bin; ZHANG Li-guo; GU Xin; DING Yue; GUO Cheng-bin


    Background Trans-sacral axial L5/S1 interbody fusion (AxiaLIF), a novel surgical procedure, recently adopted in clinical practice, has excellent clinical outcomes. However, there is inadequate data on the feasibility of the approach in all adult patients and the optimal surgical approach is currently unclear; therefore, further studies are required. In order to enhance the surgical approach for AxiaLIF, prospective anatomical imaging optimization is necessary. The objective of this study was to investigate the ability of magnetic resonance imaging (MRI) to achieve an optimal procedural setting.Methods The subjects (n=40) underwent lumbosacral MRI examination. The median sagittal MRI images were analyzed and four measurement markers were defined as follows: the center of the L5/S1 disc (A), the anterior margin of the S1/2 disc space (B), the sacrococcygeal junction (C), and the coccygeal tip (D). The measurement markers were connected to each other to produce five lines (AB, AC, AD, BC, and BD), as reference lines for surgical approaches. The distance between each reference line and the anterior and posterior margins of the L5 and S1 vertebral bodies was measured to determine the safety of the respective approaches.Results In all patients, Lines AB and AC satisfied the imaging safety criteria. Line AB would result in a significant deviation from the median and was determined to be unsuitable for AxiaLIF. Line AD satisfied the imaging safety criteria in 39 patients. However, the anal proximity of the puncture point proved to be limiting. For lines BC and BD, the imaging safety criteria were satisfied in 70% and 45% of patients, respectively.Conclusions The AxiaLIF procedure is a safe technique for insertion of fusion implants in all subjects. Line AC is a favorable reference line for surgical approach and safe for all subjects, while line BC is not suitable for all subjects.

  9. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Jie Hong

    Full Text Available Mechanisms of the progression from Barrett's esophagus (BE to esophageal adenocarcinoma (EA are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  10. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells (United States)

    Cao, Weibiao


    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  11. Retrospective chromosome aberration analysis of former uranium miners

    International Nuclear Information System (INIS)

    In this paper we present our data collected in the period of 1981-1985 on 165 persons exposed by different radon concentrations expressed in working level month (WLM) units from 100 up to 600. Following the decommissioning of the uranium mine in Hungary in 1997 cytogenetic status of 131 persons were within a follow-up-study of their health conditions initiated by the Hungarian Academy of Science. The persons have terminated their underground activities 5 to 20 years before testing. The comparison of the two datasets suggest a long-term persistence of cytogenetic alterations above the population average values in large percentages of persons investigated. The frequency of chromosome aberrations of uranium miners was found increased in function of their exposure to radon. The comparison of the miner's categories 20 years ago and in the recent years demonstrated the long-term existence of aberrations for many years after completion of underground mining activities. (authors)

  12. Relationships between DNA double-strand breaks and chromosomal aberrations

    International Nuclear Information System (INIS)

    Evidence suggests that double strand breaks are induced linearly with radiation dose at frequencies of 30-40 DSB/cell/Gy. It seems possible that there is a fast component not normally related to the induction of chromosomal aberrations, and a second slower component underlying the observed joining of chromosome and chromatid breaks. Radiation induces a mixture of blunt and cohesive-ended DSB probably with a preponderance of the latter which are much less effective at inducing aberrations. Visible chromatid breaks are also induced linearly with dose at much lower frequency than DSB and rejoin with a half-time reminiscent of slowly repairing DSB. It is possible that this slow rejoining reflects underlying repair of biologically important DSB. Rejoining of chromatid breaks and misjoining giving rise to exchanges are thought to be determined by different mechanisms. (UK)

  13. Studies on chromosome aberrations in workers occupationally exposed to radiation

    International Nuclear Information System (INIS)

    Cytogenetic assays for unstable chromosomes were performed on 54 medical radiation workers who are occupationally exposed to radiation and 42 controls. A total of 15,577 metaphase cells were scored. The frequencies of dicentrics and acentric chromosomes on controls were 0.52*10-3 and 0.82*10-2, respectively. On radiation workers those were 2.28*10-3 and 1.34*10-2, respectively. Though the frequencies of all types of chromosome aberrations in the workers were higher than those in the controls, the only significant difference was found in the case of dicentrics (P 0.05) except exposure dose of recent one year (P < 0.05). These results could indicate that low level exposure to ionizing radiation can induce unstable chromosome aberrations in blood lymphocytes

  14. Chromosome aberrations in A-bomb survivors, Hiroshima and Nagasaki

    International Nuclear Information System (INIS)

    Radiation-induced chromosome rearrangements are known to have persisted in the peripheral blood lymphocytes of atomic bomb survivors in Hiroshima and Nagasaki. A dose-response relationship for chromosome aberration frequencies has been observed in both cities. A preliminary analysis of cytogenetic data indicates that the inter-city difference observed with the T65D dose estimate becomes less pronounced with the new DS86 dosimetry system. The regression coefficient of the dose-response curves is nevertheless higher in Hiroshima than in Nagasaki. The majority of chromosome aberrations detectable to date are of the stable type, such as translocations and inversions, and they have formed the dose-response relationship. (author)

  15. Mathematical Modeling of Carcinogenesis Based on Chromosome Aberration Data

    Institute of Scientific and Technical Information of China (English)

    Xiao-bo Li


    Objective: The progression of human cancer is characterized by the accumulation of genetic instability. An increasing number of experimental genetic molecular techniques have been used to detect chromosome aberrations. Previous studies on chromosome abnormalities often focused on identifying the frequent loci of chromosome alterations, but rarely addressed the issue of interrelationship of chromosomal abnormalities. In the last few years, several mathematical models have been employed to construct models of carcinogenesis, in an attempt to identify the time order and cause-and-effect relationship of chromosome aberrations. The principles and applications of these models are reviewed and compared in this paper. Mathematical modeling of carcinogenesis can contribute to our understanding of the molecular genetics of tumor development, and identification of cancer related genes, thus leading to improved clinical practice of cancer.

  16. Chromosome Aberrations in Human Lymphocytes Irradiated with Ionizing Radiation

    International Nuclear Information System (INIS)

    The purpose of the present experiment was to provide data on the dose-dependent production of chromosome aberrations such as dicentrics, centric rings, and excess acentrics. Radiation is one of the more dangerous clastogens in the environment. Ionizing radiation causes chromosome breakages and various cytogenetic aberrations in exposed cells. In an investigation into radiation emergencies, it is important to estimate the dose to exposed persons for several reasons. Physical dosimeters (e. g., film badges) may misrepresent the actual radiation dose and may not be available in a radiological accident or terrorism incident. Biological dosimetry is suitable for estimating the radiation dose during such accidents. The dicentric chromosome assay is very sensitive and a reliable bio-indicator in cases of accidental overexposure

  17. Aberrant Phenotype in Iranian Patients with Acute Myeloid Leukemia

    Directory of Open Access Journals (Sweden)

    Mehdi Jahedi


    Full Text Available Purpose: The aim of this study was to evaluate the incidence of aberrant phenotypes and possible prognostic value in peripheral and bone marrow blood mononuclear cells of Iranian patients with AML. Methods: 56 cases of de novo AML (2010-2012 diagnosed by using an acute panel of monoclonal antibodies by multiparametric flowcytometry. Immunophenotyping was done on fresh bone marrow aspirate and/or peripheral blood samples using the acute panel of MoAbs is stained with Phycoerythrin (PE /fluorescein isothiocyanate (FITC, Allophycocyanin (APC and Peridinin-chlorophyll protein complex (perCP. We investigated Co-expression of lymphoid-associated markers CD2, CD3, CD7, CD 10, CD19, CD20 and CD22 in myeloblasts. Results: Out of the 56 cases, 32 (57.1% showed AP. CD7 was positive in 72.7% of cases in M1 and 28.5% in M2 but M3 and M4 cases lacked this marker. We detected CD2 in 58.35 of M1cases, 21.40% of M2 cases, 33.3 of M3 and 20% of M5; but M4 patients lacked this marker. The CBC analysis demonstrated a wide range of haemoglobin concentration, Platelet and WBC count which varied from normal to anaemia, thrombocytopenia to thrombocytosis and leukopenia to hyper leukocytosis. Conclusions: Our findings showed that CD7 and CD2 were the most common aberrant marker in Iranian patients with AML. However, we are not find any significant correlation between aberrant phenotype changing and MRD in our population. Taken together, this findings help to provide new insights in to the investigation of other aberrant phenotypes that may play roles in diagnosis and therapeutic of AML.

  18. Aberrant left pulmonary artery associated with right pulmonary hypoplasia

    International Nuclear Information System (INIS)

    Aberrant left pulmonary artery (ALPA), or pulmonary artery sling, is an uncommon vascular malformation that is frequently associated with obstructive disorders of the tracheobronquial tree. In newborns, it produces severe respiratory problems. In contrast, in adults, it is usually discovered by change. ALPA has been associated with right pulmonary hypoplasia (RPH) in a small number of cases. We present a new case of ALP associated with right pulmonary hypoplasia in an adult woman, diagnosed by CT and MR. 12 refs

  19. Aberrant functional brain connectome in people with antisocial personality disorder


    Yan Tang; Jun Long; Wei Wang(College of William and Mary); Jian Liao; Hua Xie; Guihu Zhao; Hao Zhang


    Antisocial personality disorder (ASPD) is characterised by a disregard for social obligations and callous unconcern for the feelings of others. Studies have demonstrated that ASPD is associated with abnormalities in brain regions and aberrant functional connectivity. In this paper, topological organisation was examined in resting-state fMRI data obtained from 32 ASPD patients and 32 non-ASPD controls. The frequency-dependent functional networks were constructed using wavelet-based correlation...

  20. Antimutagenic effects of garlic extract on chromosomal aberrations. (United States)

    Shukla, Yogeshwer; Taneja, Pankaj


    Garlic (Allium sativum) has been used since ancient times, as a spice and also for its medicinal properties. In present set of investigations antimutagenic effect of garlic extract (GE) has been evaluated using 'in vivo chromosomal aberration assay' in Swiss albino mice. Cyclophosphamide (CP), a well-known mutagen, was given at a single dose of 25 mg/kg b.w. intraperitoneally. Pretreatment with 1, 2.5 and 5% of freshly prepared GE was given through oral intubation for 5 days prior to CP administration. Animals from all the groups were sacrificed at sampling times of 24 and 48 h and their bone marrow tissue was analyzed for chromosomal damage. The animals of the positive control group (CP alone) shows a significant increase in chromosomal aberrations both at 24 and 48 h sampling time. GE, alone did not significantly induced aberrations at either sampling time, confirming its non-mutagenicity. However in the GE pre-treated and CP post-treated groups, a dose dependent decrease in cytogenetic damage was recorded. A significant suppression in the chromosomal aberrations was recorded following pretreatment with 2.5 and 5% GE administration. The anticytotoxic effects of GE were also evident, as observed by significant increase in mitotic index, when compared to positive control group. Reduction in CP induced clastogenicity by GE was evident at 24 h and to a much greater extent at 48 h of cell cycle. Thus results of the present investigations revealed that GE has chemopreventive potential against CP induced chromosomal mutations in Swiss albino mice. PMID:11790451

  1. An integrative characterization of recurrent molecular aberrations in glioblastoma genomes


    Sintupisut, Nardnisa; Liu, Pei-Ling; Yeang, Chen-Hsiang


    Glioblastoma multiforme (GBM) is the most common and malignant primary brain tumor in adults. Decades of investigations and the recent effort of the Cancer Genome Atlas (TCGA) project have mapped many molecular alterations in GBM cells. Alterations on DNAs may dysregulate gene expressions and drive malignancy of tumors. It is thus important to uncover causal and statistical dependency between ‘effector’ molecular aberrations and ‘target’ gene expressions in GBMs. A rich collection of prior st...

  2. Ocular aberrations after wavefront optimized LASIK for myopia


    Padmanabhan Prema; Basuthkar Subam; Joseph Roy


    Purpose: To study the change in ocular aberrations after wavefront optimized (WFO) laser in situ keratomileusis ( Lasik ) for correction of myopia and to analyze causative factors that may influence them. Materials and Methods: This was a prospective case series. WFO Lasik was performed for the correction of myopia, using the hansatome (Bausch and Lomb) microkeratome to create the flap and the Allegretto laser (Wavelight Technologie) to perform the ablation. The Allegretto wave analyser ...

  3. On the prediction of optical aberrations by personalized eye models


    Navarro, Rafael; González, Luis M; Hernández-Matamoros, José Luis


    Purpose. The purpose of this study is to develop and analyze a method to obtain optical schematic models of individual eyes. Each model should be able to reproduce the measured monochromatic wave aberration with high fidelity. Methods. First, we choose a generic eye model as the input guess and then apply a two-stage customization procedure. Stage 1 consists of replacing, in the initial generic model, those anatomic and optical parameters with experimental data measured on the eye under analy...

  4. Aberrant Gene Promoter Methylation Associated with Sporadic Multiple Colorectal Cancer


    Victoria Gonzalo; Juan José Lozano; Jenifer Muñoz; Francesc Balaguer; Maria Pellisé; Cristina Rodríguez de Miguel; Montserrat Andreu; Rodrigo Jover; Xavier Llor; M Dolores Giráldez; Teresa Ocaña; Anna Serradesanferm; Virginia Alonso-Espinaco; Mireya Jimeno; Miriam Cuatrecasas


    BACKGROUND: Colorectal cancer (CRC) multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-...

  5. An aberrant right lateral branch from right internal thoracic artery


    Salve VM; Ratnaprabha C


    The internal thoracic artery is the largest artery of the thoracic wall. The internal thoracic artery is often mobilized for coronary artery bypass grafting. During routine dissection (MBBS Batch 2009-2010) of a middle aged male cadaver at Dr. Pinnamaneni Siddhartha Institute of Medical Sciences & Research Foundation, Gannavaram, (INDIA); an aberrant right lateral branch from right internal thoracic artery was found. It arose from right internal thoracic artery behind right first rib. It ran ...

  6. Perceptual aberrations impair mental own-body transformations


    Mohr, C.; Blanke, O.; Brugger, P


    Dysfunctional self and bodily processing have been reported from the schizophrenia spectrum. Here, the authors tested 72 students (40 women) to determine whether performance in a mental own-body transformation task relates to self-rated frequency of spontaneously experienced schizotypal body schema alterations (perceptual aberration). Participants provided speeded left-right decisions concerning the body of a visually depicted human figure (front view vs. back view). For men, reaction times t...

  7. Use of chromosome aberrations for predicting genetic hazards to man

    International Nuclear Information System (INIS)

    The question of the use of chromosome aberrations for predicting genetic hazards to man is discussed under the following headings: interspecific comparisons of dicentric and deletion production in peripheral leukocytes; comparison of dicentric yields in leukocytes to reciprocal translocation yield in spermatogonia; recovery of spermatogonia induced translocations in the sons of irradiated males; cytologically and genetically detected deletions; and current gaps in our knowledge and problems of future interest

  8. Evaluation of corneal higher order aberrations in normal topographic patterns


    Mirzajani, Ali; Aghataheri, Sattar; Ghoreishi, Mohammad; Jafarzadepour, Ebrahim; Mohammadinia, Mohadese


    Purpose This study reports the characteristics of corneal higher order aberrations (HOAs) in eyes with normal topographic pattern using the Pentacam scheimpflug system. Methods In this prospective, observational, comparative study, 165 eyes of 97 patients separated into five groups based on corneal topographic patterns were enrolled. All eyes received a comprehensive ophthalmologic examination including corneal tomographic analysis with the Pentacam system. Keratometry, corneal cylinder, and ...

  9. Electron Vortex Production and Control Using Aberration Induced Diffraction Catastrophes (United States)

    Petersen, T. C.; Weyland, M.; Paganin, D. M.; Simula, T. P.; Eastwood, S. A.; Morgan, M. J.


    An aberration corrected electron microscope is used to create electron diffraction catastrophes, containing arrays of intensity zeros threading vortex cores. Vortices are ascribed to these arrays using catastrophe theory, scalar diffraction integrals, and experimentally retrieved phase maps. From measured wave function phases, obtained using focal-series phase retrieval, the orbital angular momentum density is mapped for highly astigmatic electron probes. We observe vortex rings and topological reconnections of nodal lines by tracking the vortex cores using the retrieved phases.

  10. Aberration analysis and efficiency improvement of a bidirectional optical subassembly (United States)

    Wu, Hao; Huang, Zhangdi; Yu, Ziyan; Qian, Xiaoshi; Xu, Fei; Chen, Beckham; Lu, Yanqing


    An approach to improve the coupling efficiency of bidirectional optical subassembly (BOSA) modules is proposed and experimentally demonstrated. We analyzed the wavefront aberration coefficients of a typical BOSA. It was found that the 45-deg wavelength filter induces coma and astigmatism, and then it further deteriorates the laser diode to fiber coupling. We measured the BOSA efficiencies based on a series of different filters. For a typical 0.5-mm filter, 25% coupling efficiency improvement was achieved by optimizing the filter parameters.

  11. Chromosome aberrations and environmental exposures in acute leukemia


    Lindquist, Ragnhild Rosengren


    The aims of this thesis are to evaluate the role of environmental exposures, especially professional exposure to organic solvents and petroleum products in the etiology of acute leukemia and to investigate if there is a correlation between the exposure to a specific leukemogen factor and a clonal chromosome aberration of the leukemic cells. Papers I and II present results of a case-control study of environmental exposures, in all occupations during life-time, medical treatm...

  12. Low Order Aberrations in Band-Limited Lyot Coronagraphs

    CERN Document Server

    Sivaramakrishnan, A; Sivaramakrishnan, A V; Lloyd, J P; Oppenheimer, B R; Makidon, R B; Sivaramakrishnan, Anand; Soummer, Remi; Sivaramakrishnan, Allic V.; Lloyd, James P.; Oppenheimer, Ben R.


    We study the way Lyot coronagraphs with unapodized entrance pupils respond to small, low order phase aberrations. This study is applicable to ground-based adaptive optics coronagraphs operating at 90% and higher Strehl ratios, as well as to some space-based coronagraphs with intrinsically higher Strehl ratio imaging. We utilize a second order expansion of the monochromatic point-spread function (written as a power spectrum of a power series in the phase aberration over clear aperture) to derive analytical expressions for the response of a `band-limited' Lyot coronagraph (BLC) to small, low order, phase aberrations. The BLC possesses a focal plane mask with an occulting spot whose opacity profile is a spatially band-limited function rather than a hard-edged, opaque disk. The BLC is, to first order, insensitive to tilt and astigmatism. Undersizing the stop in the re-imaged pupil plane (the Lyot plane) following the focal plane mask can alleviate second order effects of astigmatism, at the expense of system thro...

  13. Membrane based Deformable Mirror: Intrinsic aberrations and alignment issues

    CERN Document Server

    Bayanna, A Raja; Chatterjee, S; Mathew, Shibu K; Venkatakrishnan, P


    A Deformable Mirror (DM) is an important component of an Adaptive Optics system. It is known that an on-axis spherical/parabolic optical component, placed at an angle to the incident beam introduces defocus as well as astigmatism in the image plane. Although the former can be compensated by changing the focal plane position, the latter cannot be removed by mere optical re-alignment. Since the DM is to be used to compensate a turbulence-induced curvature term in addition to other aberrations, it is necessary to determine the aberrations induced by such (curved DM surface) an optical element when placed at an angle (other than 0 degree) of incidence in the optical path. To this effect, we estimate to a first order, the aberrations introduced by a DM as a function of the incidence angle and deformation of the DM surface. We record images using a simple setup in which the incident beam is reflected by a 37 channel Micro-machined Membrane Deformable Mirror for various angles of incidence. It is observed that astig...

  14. A survey of chromosomal aberrations in lymphocytes of Chernobyl liquidators

    Energy Technology Data Exchange (ETDEWEB)

    Sevan`kaev, A.V.; Moiseenko, V.V.; Zhloba, A.A. [Medical Radiological Research Centre, Obninsk (Russian Federation); Lloyd, D.C.; Edwards, A.A. [National Radiological Protection Board, Chilton (United Kingdom); Braselmann, H. [G.S.F. Institut fuer Strahlenbiologie (Germany)


    Chromosomal aberrations in lymphocytes of 875 Chernobyl liquidators have been scored and by comparison with control subjects the dicentric plus ring and excess acentric fragment frequencies are higher for persons who worked in the exclusion zone in 1986-1988 but not in 1989. Aberration yields are too low for individual biological dosimetry but, after taking account of the time interval between irradiation and blood sampling, the dicentric plus ring frequencies indicate average doses for 1986, 1987 and 1989 in good agreement with the annual averages in the Obninsk Registry. For 1988 the cytogenetic data indicate a significant higher average dose than the Registry. Liquidators who were not issued with a personal film badge tend to have higher aberration yields than those for whom badge data are recorded. This is particularly evident for those persons who worked in the first three months after the accident where physical dosimetry data are less complete or reliable. The persons probably experienced the highest exposures of all liquidators and the chromosomal data suggest an average value of about 300 mGy. (author).

  15. Aberrant behavior and cognitive ability in preschool children

    Directory of Open Access Journals (Sweden)

    Bala Gustav


    Full Text Available The sample included 712 preschool boys and girls at the age of 4 to 7 years (mean 5.96 decimal years and standard deviation .96 from preschool institutions in Novi Sad, Sombor, Sremska Mitrovica and Bačka Palanka. Information concerning 36 indicators of aberrant behavior of the children were supplied by their parents, whereas their cognitive ability was tested by Raven’s progressive colored matrices. Based on factor analysis (promax method, four factors i.e. generators of aberrant behavior in children were singled out: aggression, anxiousness, dissociation, and hysteria, whose relations with cognitive functioning and age were also analyzed by factor analysis. Aberrant behavior and cognitive abilities show significant interrelatedness. Owing to orderly developed cognitive abilities, a child understands essence and reality of problems, realizes possibilities and manners of solving them, and succeeds in realizing successful psycho-social functioning. Developed cognitive abilities enable a child to recognize and understand her/his own reactions in different situations and develop manners of reacting, which leads to strengthening psycho-social safety and adapting behavior in accordance with her/his age and abilities.

  16. Chromosome aberrations in ataxia telangiectasia cells exposed to heavy ions (United States)

    Kawata, T.; Cucinotta, F.; George, K.; Wu, H.; Shigematsu, N.; Furusawa, Y.; Uno, T.; Isobe, K.; Ito, H.

    Understanding of biological effects of heavy ions is important to assess healt h risk in space. One of the most important issues may be to take into account individual susceptibility. Ataxia telangiectasia (A-T) cells are known to exhibit abnormal responses to radiations but the mechanism of hyper radiosensitivity of A-T still remains unknown. We report chromosome aberrations in normal human fibroblasts and AT fibroblasts exposed to low- and high-LET radiations. A chemical-induced premature chromosome condensation (PCC) technique combined with chromosome- painting technique was applied to score chromosome aberrations in G2/M-phase cells. Following gamma irradiation, GM02052 cells were approximately 5 times more sensitive to g-rays than AG1522 cells. GM02052 cells had a much higher frequency of deletions and misrejoining than AG1522 cells. When the frequency of complex type aberrations was compared, GM02052 cells showed more than 10 times higher frequency than AG1522 cells. The results will be compared with those obtained from high-LET irradiations.

  17. Molecular mechanisms in the induction of chromosome aberrations

    International Nuclear Information System (INIS)

    In more recent years there have been attempts to understand the mechanisms giving rise to aberrations on a more molecular basis. This was initially stimulated by the demonstrations of enzyme repair systems in bacteria which repair mutagen-damaged DNA and the obvious suggestion that similar kinds of repair processes in eukaryotes could be responsible for spontaneous and mutagen-induced exchanges in somatic cells, and for recombinational exchanges in meiotic cells. This impetus has been maintained largely by discovery and the acquisition of information on five fronts: (i) increasing knowledge of the and organisation of the eukaryotic chromosome; (ii) a better understanding of the types of lesions induced in DNA by a wide variety of mutagens; (iii) the demonstrations of a variety of repair systems that restore damaged DNA in eukaryotes including man; (iv) the identification and characterisation of mutants defective in DNA repair and which give unusual reponses to aberration induction by specific mutagens; (v) the development of new techniques to visulise sister chromatid exchange and other facets of chromosome substructure. In this presentation some developments are considered and a picture is sketched of our current notions on how recent chromosomal aberrations are formed, by posing a number of questions and attempting to answer them. (Auth.)

  18. Polarization Aberrations in Astronomical Telescopes: The Point Spread Function (United States)

    Breckinridge, James B.; Lam, Wai Sze T.; Chipman, Russell A.


    Detailed knowledge of the image of the point spread function (PSF) is necessary to optimize astronomical coronagraph masks and to understand potential sources of errors in astrometric measurements. The PSF for astronomical telescopes and instruments depends not only on geometric aberrations and scalar wave diffraction but also on those wavefront errors introduced by the physical optics and the polarization properties of reflecting and transmitting surfaces within the optical system. These vector wave aberrations, called polarization aberrations, result from two sources: (1) the mirror coatings necessary to make the highly reflecting mirror surfaces, and (2) the optical prescription with its inevitable non-normal incidence of rays on reflecting surfaces. The purpose of this article is to characterize the importance of polarization aberrations, to describe the analytical tools to calculate the PSF image, and to provide the background to understand how astronomical image data may be affected. To show the order of magnitude of the effects of polarization aberrations on astronomical images, a generic astronomical telescope configuration is analyzed here by modeling a fast Cassegrain telescope followed by a single 90° deviation fold mirror. All mirrors in this example use bare aluminum reflective coatings and the illumination wavelength is 800 nm. Our findings for this example telescope are: (1) The image plane irradiance distribution is the linear superposition of four PSF images: one for each of the two orthogonal polarizations and one for each of two cross-coupled polarization terms. (2) The PSF image is brighter by 9% for one polarization component compared to its orthogonal state. (3) The PSF images for two orthogonal linearly polarization components are shifted with respect to each other, causing the PSF image for unpolarized point sources to become slightly elongated (elliptical) with a centroid separation of about 0.6 mas. This is important for both astrometry

  19. Analysis of chromosome aberration data by hybrid-scale models

    International Nuclear Information System (INIS)

    This paper presents a new methodology for analyzing data of chromosome aberrations, which is useful to understand the characteristics of dose-response relationships and to construct the calibration curves for the biological dosimetry. The hybrid scale of linear and logarithmic scales brings a particular plotting paper, where the normal section paper, two types of semi-log papers and the log-log paper are continuously connected. The hybrid-hybrid plotting paper may contain nine kinds of linear relationships, and these are conveniently called hybrid scale models. One can systematically select the best-fit model among the nine models by among the conditions for a straight line of data points. A biological interpretation is possible with some hybrid-scale models. In this report, the hybrid scale models were applied to separately reported data on chromosome aberrations in human lymphocytes as well as on chromosome breaks in Tradescantia. The results proved that the proposed models fit the data better than the linear-quadratic model, despite the demerit of the increased number of model parameters. We showed that the hybrid-hybrid model (both variables of dose and response using the hybrid scale) provides the best-fit straight lines to be used as the reliable and readable calibration curves of chromosome aberrations. (author)

  20. Alignment induced aberration fields of next generation telescopes (United States)

    Schmid, Tobias; Thompson, Kevin; Rolland, Jannick


    There is a long list of new ground-based optical telescopes being considered around the world. While many are conventional Cassegrain and Ritchey-Chretien designs, some are from a family of three mirror anastigmatic (TMA) telescopes that are configured with an offset field (but still obscured) that trace back to designs developed in the 1970s for military applications. The nodal theory of aberrations, developed in the late 1970s, provides valuable insights into the response of TMA telescopes to alignment errors. Here it is shown for the first time that the alignment limiting aberration in any TMA telescope is a 3rd order astigmatism term with a new field dependence, termed field-asymmetric, field-linear 3rd order astigmatism. It is also shown that a TMA telescope under assembly that is only measured to have excellent/perfect performance onaxis is not aligned in any significant way. This is because the new astigmatic term is always zero on-axis, even though it is large over the field of view. Knowledge of this intrinsic misalignment aberration field for any TMA telescope aids greatly in ensuring it can be aligned successfully. The James Webb Space Telescope (JWST), is used an example of a relevant TMA system.

  1. Effect of therapeutic hypothermia on chromosomal aberration in perinatal asphyxia

    Directory of Open Access Journals (Sweden)

    Bahubali D Gane


    Full Text Available Introduction: Perinatal asphyxia is a major cause for neonatal mortality and morbidity around the world. The reduction of O2results in the generation of reactive oxygen species which interact with nucleic acid and make alteration in the structure and functioning of the genome. We studied the effect of therapeutic hypothermia on chromosomes with karyotyping. Subjects and Methods: Babies in the hypothermia group were cooled for the first 72 h, using gel packs. Rectal temperature of 33–34°C was maintained. Blood sample was collected after completion of therapeutic hypothermia for Chromosomal analysis. It was done with IKAROS Karyotyping system, Metasystems, based on recommendations of International system of human cytogenetic nomenclature. Results: The median chromosomal aberration was lower in hypothermia [2(0-5] than control group [4(1-7] and chromatid breakage was commonest aberration seen. Chromosomal aberration was significantly higher in severe encephalopathy group than moderate encephalopathy group. Conclusion: We conclude that the TH significantly reduces DNA damage in perinatal asphyxia.

  2. Identification of signature and primers specific to genus Pseudomonas using mismatched patterns of 16S rDNA sequences


    Kapley A; Raje DV; Purohit HJ


    Abstract Background Pseudomonas, a soil bacterium, has been observed as a dominant genus that survives in different habitats with wide hostile conditions. We had a basic assumption that the species level variation in 16S rDNA sequences of a bacterial genus is mainly due to substitutions rather than insertion or deletion of bases. Keeping this in view, the aim was to identify a region of 16S rDNA sequence and within that focus on substitution prone stretches indicating species level variation ...

  3. TBP-TAF Complex SL1 Directs RNA Polymerase I Pre-initiation Complex Formation and Stabilizes Upstream Binding Factor at the rDNA Promoter*||


    Friedrich, J. Karsten; Panov, Kostya I.; Cabart, Pavel; Russell, Jackie; Zomerdijk, Joost C. B. M.


    Knowledge of the role of components of the RNA polymerase I transcription machinery is paramount to understanding regulation of rDNA expression. We describe key findings for the roles of essential transcription factor SL1 and activator upstream binding factor (UBF). We demonstrate that human SL1 can direct accurate Pol I transcription in the absence of UBF and can interact with the rDNA promoter independently and stably, consistent with studies of rodent SL1 but contrary to previous reports o...

  4. Phylogeographic structure of cotton pest Adelphocoris suturalis (Hemiptera: Miridae): strong subdivision in China inferred from mtDNA and rDNA ITS markers


    Lijuan Zhang; Hu Li; Shujuan Li; Aibing Zhang; Fei Kou; Huaizhu Xun; Pei Wang; Ying Wang; Fan Song; Jianxin Cui; Jinjie Cui; Gouge, Dawn H.; Wanzhi Cai


    Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populatio...

  5. The nature of Zb states from a combined analysis of Υ(5S) → hb(mP)π+π- and Υ(5S) → B(*) anti B(*)π

    International Nuclear Information System (INIS)

    With a combined analysis of data on Υ(5S) → hb(1P, 2P)π+π- and Υ(5S) → B(*) anti B(*)π in an effective field theory approach, we determine resonance parameters of Zb states in two scenarios. In one scenario we assume that Zb states are pure molecular states, while in the other one we assume that Zb states contain compact components. We find that the present data favor that there should be some compact components inside Zb(') associated with themolecular components. By fitting the invariant mass spectra of Υ(5S) → hb(1P, 2P)π+π- and Υ(5S) → B(*) anti B*π, we determine that the probability of finding the compact components in Zb states may be as large as about 40 %. (orig.)

  6. On the spontaneous frequency of the structural chromosome aberrations (anomalies) in lymphocytes from human blood

    International Nuclear Information System (INIS)

    Chromosomal aberrations are observed both in irradiated cells and in cells which have not been irradiated but submitted to the action of the natural radioactive background. The reasons for these ''spontaneous chromosomal aberrations'' are both the natural radioactivity and a complex of physical, chemical and biological factors. A cytogenetic analysis of 6000 lymphocytes metaphases from the peripheral blood of 47 people indicates that the overall amount of the spontaneous aberrations is 2% with a ratio of chromosomal type aberrations to chromatide type aberrations of 1:5. Chromatide type aberrations are seen as the result of purely mechanical factors acting during slides preparation but yet another unknown moments cannot be excluded. They are more one hit type aberrations - chromatide and chromosomal fragments, wereas the two hit aberrations are very rare - one dicentric per 3000 cells. The chromosome type aberrations are proposed for comparison with radiation induced aberrations in human lymphocytes. They have a frequency of 0.0035 per cell or 0.0040 breakages per cell. Ionizing radiation does not induce qualitatively specific type of aberrations but increases many times the yield of anomalies, which are spontaneously observed. (A.B.)

  7. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system (United States)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo


    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  8. Hard X-ray XAFS beamline, BL5S1, at AichiSR (United States)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.


    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  9. Isolation and 16s rdna sequence analysis of bacteria from dieback affected mango orchards in southern pakistan

    International Nuclear Information System (INIS)

    A broad range of microorganisms are involved in various mango plant diseases such as fungi, algae and bacteria. In order to study the role of bacteria in mango dieback, a survey of infected mango plants in southern Pakistan was carried out. A number of bacterial isolates were obtained from healthy looking and infected mango trees, and their characterization was undertaken by colony PCR and subsequent sequence analysis of 16S rDNA. These analyses revealed the presence of various genera including Acinetobacter, Bacillus, Burkholderia, Cronobacter, Curtobacterium, Enterobacter, Erwinia, Exiguobacterium, Halotelea, Lysinibacillus, Micrococcus, Microbacterium, Pantoea, Pseudomonas, Salmonella and Staphylococcus. It is noteworthy that several members of these genera have been reported as plant pathogens. The present study provided baseline information regarding the phytopathogenic bacteria associated with mango trees in southern Pakistan. (author)

  10. Short communication: Genetic variants of Sarcocystis cruzi in infected Malaysian cattle based on 18S rDNA. (United States)

    Ng, Yit Han; Fong, Mun Yik; Subramaniam, Vellayan; Shahari, Shahhaziq; Lau, Yee Ling


    Sarcocystis species are pathogenic parasites that infect a wide range of animals, including cattle. A high prevalence of cattle sarcocystosis has been reported worldwide, but its status is unknown in Malaysia. This study focused on utilizing 18S rDNA to identify Sarcocystis species in Malaysian cattle and to determine their genetic variants. In this study, only Sarcocystis cruzi was detected in Malaysian cattle. The intra-species S. cruzi phylogenetic tree analysis and principal coordinate analysis (PCoA), respectively displayed two minor groups among the parasite isolates. This finding was supported by high Wright FST value (FST=0.647). The definitive hosts (dogs) may play a fundamental role in the development of S. cruzi genetic variants. Additionally, the existence of microheterogeneity within the S. cruzi merozoites and/or distinct genetic variants arisen from independent merozoites in mature sarcocysts, possibly contributed to the existence of intra-species variations within the population. PMID:26679818

  11. Sequence analysis of the rDNA internal transcribed spacer 2 of five species of South American human malaria mosquitoes. (United States)

    Fritz, G N


    The rDNA internal transcribed spacer 2 (ITS2) was sequenced for 5 species of mosquitoes that may be important vectors of human malaria in certain regions of South America and are difficult to distinguish by morphology: Anopheles evansae, An. nuneztovari, An. rangeli, An. strodei and An. trinkae. ITS2 sequences from samples collected in Ecuador, Bolivia, Venezuela and Brazil were aligned and compared in order to determine the usefulness of this spacer for the elaboration of species specific primers and DNA probes. The ITS2 was found to be different in size (ranging from 333 to 397 bp) and sequence between all pairs of species. Highly variable regions were found primarily at the 3' end of the spacer and were interspersed with relatively conserved sites. Instraspecific sequence variation was limited to a single transversion between specimens of An. rangeli from distant geographic locations suggesting concerted evolution and homogenization of the ITS2. PMID:10520449

  12. Description of the male, redescription of the female and 16S rDNA sequence of Ixodes aulacodi (Ixodidae). (United States)

    Chiţimia-Dobler, Lidia; D'Amico, Gianluca; Yao, Patrick Kouassi; Kalmár, Zsuzsa; Gherman, Călin Mircea; Mihalca, Andrei Daniel; Estrada-Peña, Agustin


    Ixodes (Afrixodes) aulacodiArthur, 1956 is a poorly known species that has been recorded predominantly in the wet countries of western and central Africa, mainly associated to the greater cane rat Thryonomys swinderianus (Temmink). We herein redescribe the female, describe the male (ascribed to the species from specimens found in copula) and provide the 16S rDNA sequence. We also provide complete illustrations of the adults based on specimens found on greater cane rats in Ivory Coast. Ixodes aulacodi is included in the group of species of the subgenus Afrixodes that have horseshoe shaped anal groove, and which lack auriculae and cornua. The female is easily separated when compared with other species because of a unique combination of characters: All the coxae have internal spurs, coxa II has two external spurs, syncoxae are absent, and trochanters I-III have one spur each. The male has a notched hypostome and lacks syncoxae, auriculae and cornua. PMID:26803353

  13. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina (United States)

    Iwanowicz, L.R.; Iwanowicz, D.D.; Pote, L.M.; Blazer, V.S.; Schill, W.B.


    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 ?? 0.3 ??m (range 15.7-20.3) in length, and 5.4 ?? 0.1 ??m (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 ?? 1.1 ??m (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 ?? 0.1 ??m (range 5.48-7.06), while the shorter is 5.7 ?? 0.1 ??m (range 4.8-6.4) in length. Polar capsule width is 1.2 ?? 0.03 ??m (range 1.0-1.54). The total length of the spore is 60.9 ?? 1.2 ??m (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus. ?? American Society of Parasitologists 2008.

  14. Multiple group I introns in the small-subunit rDNA of Botryosphaeria dothidea: implication for intraspecific genetic diversity.

    Directory of Open Access Journals (Sweden)

    Chao Xu

    Full Text Available Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU ribosomal DNA (rDNA sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF for encoding the homing endonuclease (HE, whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron and genotype IV (Bdo.S1199-B were each found in only one strain, whereas genotype I (Bdo.S1199-A and genotype II (Bdo.S943 and Bdo.S1506 occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea.

  15. 5S-menetelmien soveltaminen Lean -työkalujen avulla : Stera Technologies Oy, Turun yksikkö


    Al Take, Muntadar


    Tämän insinöörityön tarkoituksena oli kehittää Stera Technologies Oy:n Turun yksikön kokoonpano- ja tuotannon toimintaa Leanfilosofian ja 5s-työkalujen avulla. Tällä tavoin pyrittiin tehostamaan sekä tuotannon ja kokoonpanoalueen työskentelyä ja toimintaa että parantamaan työturvallisuutta, siisteyttä sekä työskentelyn selkeyttä. Insinöörityön aloituspalaverissa analysoitiin työn tulevat kohteet ja tarvittavat 5s työkalut. 5s-arviointeja käytettiin arvioidessa kokoonpano ja tuotannon 5s-...

  16. Synthesis of (3R,5R-harzialactone A and its (3R,5S-isomer

    Directory of Open Access Journals (Sweden)

    Gowravaram Sabitha


    Full Text Available The total synthesis of (3R,5R-harzialactone A (1 and its (3R,5S-isomer (2 is described. Epoxide opening with thioacetal and diastereoselective reductions are used as key reactions.

  17. Factors Contributing To The Sustainability Of 5S Programmes In Government Hospitals In Regional Director Of Health Services Area Kurunegala

    Directory of Open Access Journals (Sweden)

    Dr. K.W.C.U.K Kendangamuwa


    Full Text Available Abstract Introduction 5S is the stepping stone for many quality improvement concepts and its roots date back to 16th century. When successfully implemented 5S gives many benefits to the organization as well as its stakeholders. Though 5S itself has a tool to sustain most of the organizations find it difficult to sustain the 5S practice over the time. Therefore the objective of this study was to find out the factors contributing to sustainability of 5S programmes in Government Hospitals in RDHS area Kurunegala. Methodology This study was a descriptive cross sectional study with two components. First component was to identify the 5S sustaining hospitals from not sustaining hospitals by validated evaluation sheet. Second component was to determine the factors contributing to sustainability of 5S programmes in selected study setting. Self-administrated questionnaire was used for this purpose. Total study population was 543 employees of all the categories of hospital staff. Calculated sample size was 422 and 375 were responded to the questionnaire giving response rate of 88.9. Results The study revealed that the implemented 5S programmes were sustaining in eight hospitals out of ten i.e. sustaining rate was 80. When it considered the degree of sustainability 50 of the selected hospitals reported more than 70 sustainability. This was considered as favourable trend in government health sector in healthcare quality point of view. Ten factors were studied as contributing factors for the 5S sustainability. Socio- demographic factors were also considered. Those ten factors were top management commitment leadership of the organization commitment of middle amp frontline managers commitment amp satisfaction of employees training amp changing attitude of employees motivation of employees organizational culture group cohesiveness community participation and customer satisfaction. Study revealed that organizational leadership customer satisfaction community

  18. The spatial and temporal distribution of microalgae in the South China Sea: evidence from GIS-based analysis of 18S rDNA sequences

    Institute of Scientific and Technical Information of China (English)

    LI LvYan; HUANG QiaoJuan; WU ShuHui; LIN Duan; CHEN JiaHui; CHEN YueQin


    The purpose of this study was to estimate the spatial and temporal variation of microalgae in the South China Sea and to demonstrate the environmental factors controlling the diversity of microalgae by GIS (geographic information system)-based analysis of 18S rDNA sequences. Six 18S rDNA libraries were constructed from environmental samples collected at different sites in the study area, and more than 600 18S rDNA sequences were determined. The rDNA sequence data were then analyzed by DIVA-GIS software to display the spatial and temporal variation of phytoplankton's composition. It was shown that the autotrophic eukaryotic plankton dominated over the heterotrophic cells in most of our clone libraries, and the dominating phytoplankton was Dinophyceae except for Bacillariophyta at the Xiamen harbor. The percentages of these two groups were controlled by water temperature and salinity. Our results also revealed that the species composition of Chlorophyta showed a close relationship with latitude, changing from Prasinophyceae at the high latitude to Trebouxiophyceae at the low latitude. Several newly classified picoplankton lineages were first uncovered in the South China Sea, including the pico-sized green alga Ostreococcus sp. and Picochlorum eukaryotum, and picobiliphytes, which was just discovered in 2007 with unknown affinities to other eukaryotes. Their spatial and temporal variation were also analyzed and discussed.

  19. The spatial and temporal distribution of microalgae in the South China Sea:evidence from GIS-based analysis of 18S rDNA sequences

    Institute of Scientific and Technical Information of China (English)


    The purpose of this study was to estimate the spatial and temporal variation of microalgae in the South China Sea and to demonstrate the environmental factors controlling the diversity of microalgae by GIS (geographic information system)-based analysis of 18S rDNA sequences. Six 18S rDNA libraries were constructed from environmental samples collected at different sites in the study area, and more than 600 18S rDNA sequences were determined. The rDNA sequence data were then analyzed by DIVA-GIS software to display the spatial and temporal variation of phytoplankton’s composition. It was shown that the autotrophic eukaryotic plankton dominated over the heterotrophic cells in most of our clone libraries, and the dominating phytoplankton was Dinophyceae except for Bacillariophyta at the Xiamen harbor. The percentages of these two groups were controlled by water temperature and salinity. Our results also revealed that the species composition of Chlorophyta showed a close relationship with latitude, changing from Prasinophyceae at the high latitude to Trebouxiophyceae at the low latitude. Several newly classified picoplankton lineages were first uncovered in the South China Sea, including the pico-sized green alga Ostreococcus sp. and Picochlorum eukaryotum, and picobiliphytes, which was just discovered in 2007 with unknown affinities to other eukaryotes. Their spatial and temporal variation were also analyzed and discussed.

  20. Bacterial diversity in a soil sample from Uranium mining waste pile as estimated via a culture-independent 16S rDNA approach

    International Nuclear Information System (INIS)

    Bacterial diversity was studied in a soil sample collected from a uranium mining waste pile situated near the town of Johanngeorgenstadt, Germany. As estimated by ICP-MS analysis the studied sample was highly contaminated with Fe, Al, Mn, Zn, As, Pb and U. The 16S rDNA retrieval, applied in this study, demonstrated that more than the half of the clones of the constructed 16S rDNA library were represented by individual RFLP profiles. This indicates that the composition of the bacterial community in the sample was very complex. However, several 16S rDNA RFLP groups were found to be predominant and they were subjected to a sequence analysis. The most predominant group, which represented about 13% of the clones of the 16S rDNA library, was affiliated with the Holophaga/Acidobacterium phylum. Significant was also the number of the proteobacterial sequences which were distributed in one predominant α-proteobacterial cluster representing 11% of the total number of clones and in two equal-sized β- and γ-proteobacterial clusters representing each 6% of the clones. Two smaller groups representing both 2% of the clones were affiliated with Nitrospira and with the novel division WS3. Three of the analysed sequences were evaluated as a novel, not yet described lineage and one as a putative chimera. (authors)

  1. Comparative Analysis of 18S and 28S rDNA Sequences of Schistosoma japonicum from Mainland China, the Philippines and Japan

    Directory of Open Access Journals (Sweden)

    G.H. Zhao


    Full Text Available In the present study, a portion of the 18S and 28S ribosomal DNA (rDNA sequences of 35 Schistosoma japonicum isolates representing three geographical strains from mainland China, the Philippines and Japan were amplified and compared and phylogenetic relationships were also reconstructed by Unweighted Pair-Group Method with Arithmetic averages (UPGMA using combined 18S and 28S rDNA sequences as well as the corresponding sequences of other species belonging to the Schistosoma genus available in the public database. The results indicated that the partial 18S and 28S rDNA sequences of all S. japonicum isolates were 745 and 618 bp, respectively and displayed low genetic variation among S. japonicum strains and isolates. Phylogenetic analysis revealed that the combined 18S and 28S rDNA sequences were not able to distinguish S. japonicum isolates from three geographical origins but provided an effective molecular marker for the inter-species phylogenetic analysis and differential identification of different Schistosoma species.

  2. Phylogenetic analyses of four species of Ulva and Monostroma grevillei using ITS, rbcL and 18S rDNA sequence data

    Institute of Scientific and Technical Information of China (English)

    LIN Zhongheng; SHEN Songdong; CHEN Weizhou; LI Huihui


    Chlorophyta species are common in the southern and northern coastal areas of China.In recent years,frequent green tide incidents in Chinese coastal waters have raised concerns and attracted the attention of scientists.In this paper,we sequenced the 18S rDNA genes,the internal transcribed spacer (ITS) regions and the rbcL genes in seven organisms and obtained 536-566 bp long ITS sequences,1 377-1 407 bp long rbcL sequences and 1 718-1 761 bp long partial 18S rDNA sequences.The GC base pair content was highest in the ITS regions and lowest in the rbcL genes.The sequencing results showed that the three Ulvaprolifera (or U.pertusa) gene sequences from Qingdao and Nan'ao Island were identical.The ITS,18S rDNA and rbcL genes in U.prolifera and U.pertusa from different sea areas in China were unchanged by geographic distance.U.flexuosa had the least evolutionary distance from U.californica in both the ITS regions (0.009) and the 18S rDNA (0.002).These data verified that Ulva and Enteromorpha are not separate genera.

  3. Chromosomal localization of 45S rDNA, sex-specific C values, and heterochromatin distribution in Coccinia grandis (L.) Voigt. (United States)

    Bhowmick, Biplab Kumar; Yamamoto, Masashi; Jha, Sumita


    Coccinia grandis is a widely distributed dioecious cucurbit in India, with heteromorphic sex chromosomes and X-Y sex determination mode. The present study aids in the cytogenetic characterization of four native populations of this plant employing distribution patterns of 45S rDNA on chromosomes and guanine-cytosine (GC)-rich heterochromatin in the genome coupled with flow cytometric determination of genome sizes. Existence of four nucleolar chromosomes could be confirmed by the presence of four telomeric 45S rDNA signals in both male and female plants. All four 45S rDNA sites are rich in heterochromatin evident from the co-localization of telomeric chromomycin A (CMA)(+ve) signals. The size of 45S rDNA signal was found to differ between the homologues of one nucleolar chromosome pair. The distribution of heterochromatin is found to differ among the male and female populations. The average GC-rich heterochromatin content of male and female populations is 23.27 and 29.86 %, respectively. Moreover, the male plants have a genome size of 0.92 pg/2C while the female plants have a size of 0.73 pg/2C, reflecting a huge genomic divergence between the genders. The great variation in genome size is owing to the presence of Y chromosome in the male populations, playing a multifaceted role in sexual divergence in C. grandis. PMID:25795278

  4. Length polymorphisms for intergenic spacer regions of 16S-23S rDNA in members of the new hydrogen-producing bacteria

    Institute of Scientific and Technical Information of China (English)


    A method based on PCR amplification of the 16S rRNA gene (rDNA) -23S rDNA intergenic spacer regions (ISR) was developed for the identification of species within the novel group hydrogen-producing anaerobes. The sizes of the PCR products varied from 1264 to 398 bp. Strain of isolate Rennanqilyf 3 was characterized as having products of 1262, 398, 638, 437 and 436 bp. The isolate Rennanqilyf 1 had product of 1264 bp. The isolate Rennanqilyf 13 had products of 1261, 579 and 485 bp. Of the 3 species of the novel group hydrogenproducing anaerobes examined, no one was indistinguishable. Two environmental isolates were identified as hydrogen-producing bacteria, which were new species in present taxon. Rennanqilyf 3 could not be associated With any Clostridium sp. Studied. Rennanqilyf 1 could be classified into Clostridium genus. The combination between 16S rDNA equencing and length polymorphisms of IRS in 16S-23S rDNA is a better method for determining species of the hydrogen-producing bacteria.

  5. Aberration-Coreected Electron Microscopy at Brookhaven National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Zhu,Y.; Wall, J.


    The last decade witnessed the rapid development and implementation of aberration correction in electron optics, realizing a more-than-70-year-old dream of aberration-free electron microscopy with a spatial resolution below one angstrom [1-9]. With sophisticated aberration correctors, modern electron microscopes now can reveal local structural information unavailable with neutrons and x-rays, such as the local arrangement of atoms, order/disorder, electronic inhomogeneity, bonding states, spin configuration, quantum confinement, and symmetry breaking [10-17]. Aberration correction through multipole-based correctors, as well as the associated improved stability in accelerating voltage, lens supplies, and goniometers in electron microscopes now enables medium-voltage (200-300kV) microscopes to achieve image resolution at or below 0.1nm. Aberration correction not only improves the instrument's spatial resolution but, equally importantly, allows larger objective lens pole-piece gaps to be employed thus realizing the potential of the instrument as a nanoscale property-measurement tool. That is, while retaining high spatial resolution, we can use various sample stages to observe the materials response under various temperature, electric- and magnetic- fields, and atmospheric environments. Such capabilities afford tremendous opportunities to tackle challenging science and technology issues in physics, chemistry, materials science, and biology. The research goal of the electron microscopy group at the Dept. of Condensed Matter Physics and Materials Science and the Center for Functional Nanomaterials, as well as the Institute for Advanced Electron Microscopy, Brookhaven National Laboratory (BNL), is to elucidate the microscopic origin of the physical- and chemical-behavior of materials, and the role of individual, or groups of atoms, especially in their native functional environments. We plan to accomplish this by developing and implementing various quantitative

  6. Optimal incision sites to reduce corneal aberration variations after small incision phacoemulsification cataract surgery (United States)

    Chu, Ling; Zhao, Jiang-Yue; Zhang, Jin-Song; Meng, Jie; Wang, Ming-Wu; Yang, Ya-Jing; Yu, Jia-Ming


    AIM To analyze the effect of steep meridian small incision phacoemulsification cataract surgery on anterior, posterior and total corneal wavefront aberration. METHODS Steep meridian small incision phacoemulsification cataract surgery was performed in age-related cataract patients which were divided into three groups according to the incision site: 12 o'clock, 9 o'clock and between 9 and 12 o'clock (BENT) incision groups. The preoperative and 3-month postoperative root mean square (RMS) values of anterior, posterior and total corneal wavefront aberration including coma, spherical aberration, and total higher-order aberrations (HOAs), were measured by Pentacam scheimpflug imaging. The mean preoperative and postoperative corneal wavefront aberrations were documented. RESULTS Total corneal aberration and total lower-order aberrations decreased significantly in three groups after operation. RMS value of total HOAs decreased significantly postoperatively in the 12 o'clock incision group (Pastigmatism changes in all three corneal incision location. CONCLUSION Corneal incision of phacoemulsification cataract surgery can affect corneal wavefront aberration. The 12 o'clock corneal incision eliminated more HOAs and the spherical aberrations decreased in BENT incision group obviously when we selected steep meridian small incision. Cataract lens replacement using wavefront-corrected intraocular lens combined with optimized corneal incision site would improve ocular aberration results. PMID:27162725

  7. The fluctuation of high-order aberration's sensitivity in ArF immersion lithography (United States)

    Zhang, Fei; Li, Yanqui


    To achieve smaller and smaller feature sizes in the semiconductor industry, extreme demands are placed on the lithographic optics, specifically the projection lens. Higher numerical aperture (NA) is adopted to obtain higher resolution. However, higher NA scales the impact of geometrical aberrations on lithography performance. Thus, a detailed understanding of the effect of geometrical aberrations on the lithographic process is indispensable. In this paper, we consider some of the surprising phenomena that occur at such high NA. We discuss the impact of flare, polarization state and MSD on higher-order aberration's sensitivity using ArF immersion lithography to print elbow pattern exposed features in photo resist on 65nm node. The higher-order aberration's sensitivity is analyzed when the annular illumination (NA=1.2, sigma out=0.76, sigma in=0.52) is employed. The 3rd, 5th, 7th, 9th geometrical aberrations according to the Fringe convention are discussed. The sensitivities to individual geometrical aberrations are calculated by introducing a fixed amount of aberration for each Zernike coefficient with all other aberrations being zero. On 65nm node, with annular illumination, the high-order aberration's sensitivity is calculated respectively according to the variation of flare, polarization state, and MSD. The results show that flare, polarization state, and MSD can contribute to the high-order aberration's sensitivity. The aberration sensitivities are increasing with the MSD and flare's value rising. The aberration sensitivities can be decreased when the horizontal linear polarized light is adopted. The merits of adjusting polarization state to choke back the aberration sensitivities are presented.

  8. Chromosomal aberrations in Sigmodon hispidus from a Superfund site

    International Nuclear Information System (INIS)

    Cotton rats (Sigmodon hispidus) were collected from an EPA Superfund site located on an abandoned oil refinery. Three trapping grids were located on the refinery and three similar grids were located at uncontaminated localities which served as reference sites. Bone marrow metaphase chromosome preparations were examined for chromosomal damage. For each individual, 50 cells were scored for six classes of chromosomal lesions. For the fall 1991 trapping period, mean number of aberrant cells per individual was 2.33, 0.85, and 1.50 for the three Superfund grids., Mean number of aberrant cells per individual was 2.55, 2.55, and 2.12 from the reference grids. Mean number of lesions per cell was 2.77, 0.86, and 1.9 from the Superfund grids, and 3.55, 2.77, and 2.50 from the reference grids. For the spring 1992 trapping period, more damage was observed in animals from both Superfund and reference sites; however, animals from Superfund grids had more damage than animals from reference grids. Mean number of aberrant cells per individual was 3.50, 3.25, and 3.70 from the Superfund grids, and 2.40, 2.11, and 1.40 from the reference grids. Mean number of lesions per cell was 4.80, 4.25, and 5.50 from the Superfund grids, and 2.60, 2.33, and 1.50 from the reference grids. These data suggest animals may be more susceptible to chromosomal damage during winter months, and animals from the Superfund grids appear to be more severely affected than animals from reference grids

  9. Breast tumor copy number aberration phenotypes and genomic instability

    International Nuclear Information System (INIS)

    Genomic DNA copy number aberrations are frequent in solid tumors, although the underlying causes of chromosomal instability in tumors remain obscure. Genes likely to have genomic instability phenotypes when mutated (e.g. those involved in mitosis, replication, repair, and telomeres) are rarely mutated in chromosomally unstable sporadic tumors, even though such mutations are associated with some heritable cancer prone syndromes. We applied array comparative genomic hybridization (CGH) to the analysis of breast tumors. The variation in the levels of genomic instability amongst tumors prompted us to investigate whether alterations in processes/genes involved in maintenance and/or manipulation of the genome were associated with particular types of genomic instability. We discriminated three breast tumor subtypes based on genomic DNA copy number alterations. The subtypes varied with respect to level of genomic instability. We find that shorter telomeres and altered telomere related gene expression are associated with amplification, implicating telomere attrition as a promoter of this type of aberration in breast cancer. On the other hand, the numbers of chromosomal alterations, particularly low level changes, are associated with altered expression of genes in other functional classes (mitosis, cell cycle, DNA replication and repair). Further, although loss of function instability phenotypes have been demonstrated for many of the genes in model systems, we observed enhanced expression of most genes in tumors, indicating that over expression, rather than deficiency underlies instability. Many of the genes associated with higher frequency of copy number aberrations are direct targets of E2F, supporting the hypothesis that deregulation of the Rb pathway is a major contributor to chromosomal instability in breast tumors. These observations are consistent with failure to find mutations in sporadic tumors in genes that have roles in maintenance or manipulation of the genome

  10. Genome-wide identification of significant aberrations in cancer genome

    Directory of Open Access Journals (Sweden)

    Yuan Xiguo


    Full Text Available Abstract Background Somatic Copy Number Alterations (CNAs in human genomes are present in almost all human cancers. Systematic efforts to characterize such structural variants must effectively distinguish significant consensus events from random background aberrations. Here we introduce Significant Aberration in Cancer (SAIC, a new method for characterizing and assessing the statistical significance of recurrent CNA units. Three main features of SAIC include: (1 exploiting the intrinsic correlation among consecutive probes to assign a score to each CNA unit instead of single probes; (2 performing permutations on CNA units that preserve correlations inherent in the copy number data; and (3 iteratively detecting Significant Copy Number Aberrations (SCAs and estimating an unbiased null distribution by applying an SCA-exclusive permutation scheme. Results We test and compare the performance of SAIC against four peer methods (GISTIC, STAC, KC-SMART, CMDS on a large number of simulation datasets. Experimental results show that SAIC outperforms peer methods in terms of larger area under the Receiver Operating Characteristics curve and increased detection power. We then apply SAIC to analyze structural genomic aberrations acquired in four real cancer genome-wide copy number data sets (ovarian cancer, metastatic prostate cancer, lung adenocarcinoma, glioblastoma. When compared with previously reported results, SAIC successfully identifies most SCAs known to be of biological significance and associated with oncogenes (e.g., KRAS, CCNE1, and MYC or tumor suppressor genes (e.g., CDKN2A/B. Furthermore, SAIC identifies a number of novel SCAs in these copy number data that encompass tumor related genes and may warrant further studies. Conclusions Supported by a well-grounded theoretical framework, SAIC has been developed and used to identify SCAs in various cancer copy number data sets, providing useful information to study the landscape of cancer genomes

  11. Higher Order Aberration and Astigmatism in Children with Hyperopic Amblyopia


    Choi, Seung Kwon; Chang, Ji Woong


    Purpose To investigate the changes in corneal higher-order aberration (HOA) during amblyopia treatment and the correlation between HOA and astigmatism in hyperopic amblyopia children. Methods In this retrospective study, a total of 72 eyes from 72 patients ranging in age from 38 to 161 months were included. Patients were divided into two groups based on the degree of astigmatism. Corneal HOA was measured using a KR-1W aberrometer at the initial visit and at 3-, 6-, and 12-month follow-ups. Co...

  12. Exploiting lens aberrations to create electron vortex beams

    CERN Document Server

    Clark, L; Guzzinati, G; Lubk, A; Mazilu, M; Van Boxem, R; Verbeeck, J


    A model for a new electron vortex beam production method is proposed and experimentally demonstrated. The technique calls on the controlled manipulation of the degrees of freedom of the lens aberrations to achieve a helical phase front. These degrees of freedom are accessible by using the corrector lenses of a transmission electron microscope. The vortex beam is produced through a particular alignment of these lenses into a specifically designed astigmatic state and applying an annular aperture in the condensor plane. Experimental results are found to be in good agreement with simulations.

  13. Modeling aberrations in the Advanced Camera for Surveys (United States)

    Houairi, K.; Casertano, S.; Lallo, M.; Makidon, R. B.


    We present an analysis of the optical model for HST and ACS that shows the possible impact of misalignments of various optical elements on apparent image aberrations. The analysis was aimed at identifying possible causes for apparent variations in coma and astigmatism seen on orbital time scales in HST images. Results indicate that any combinations of mirrors and motions that reproduce the observed coma and astigmatism changes, also predict either large shifts in the image, which is not observed, or require unrealistically large movements of the elements.

  14. Construction of minimum generalized aberration two-level orthogonal arrays


    Evangelaras, Haralambos


    In this paper we explore the problem of constructing two-level Minimum Generalized Aberration (MGA) orthogonal arrays with strength $t$, $n$ runs and $q>t$ columns, using a method that employs the $J$-characteristics of a two-level design. General results for the construction of MGA orthogonal arrays with $t+1$, $t+2$ and $t+3$ columns are given, while all MGA designs with strength $t\\ge 2$, $n \\equiv$ 0 mod 4 runs and $q\\le 6$ are constructed. Results are also given for two-level orthogonal ...

  15. Spatially incoherent illumination interferometry: a PSF almost insensitive to aberrations

    CERN Document Server

    Xiao, Peng; Boccara, A Claude


    We show that with spatially incoherent illumination, the point spread function width of an imaging interferometer like that used in full-field optical coherence tomography (FFOCT) is almost insensitive to aberrations that mostly induce a reduction of the signal level without broadening. This is demonstrated by comparison with traditional scanning OCT and wide-field OCT with spatially coherent illuminations. Theoretical analysis, numerical calculation as well as experimental results are provided to show this specific merit of incoherent illumination in full-field OCT. To the best of our knowledge, this is the first time that such result has been demonstrated.

  16. Intrinsic Instability of Aberration-Corrected Electron Microscopes

    CERN Document Server

    Schramm, S M; Tromp, R M


    Aberration-corrected microscopes with sub-atomic resolution will impact broad areas of science and technology. However, the experimentally observed lifetime of the corrected state is just a few minutes. Here we show that the corrected state is intrinsically unstable; the higher its quality, the more unstable it is. Analyzing the Contrast Transfer Function near optimum correction, we define an 'instability budget' which allows a rational trade-off between resolution and stability. Unless control systems are developed to overcome these challenges, intrinsic instability poses a fundamental limit to the resolution practically achievable in the electron microscope.

  17. Membrane based Deformable Mirror: Intrinsic aberrations and alignment issues


    Bayanna, A. Raja; Louis, Rohan E.; Chatterjee, S; Mathew, Shibu K.; Venkatakrishnan, P


    A Deformable Mirror (DM) is an important component of an Adaptive Optics system. It is known that an on-axis spherical/parabolic optical component, placed at an angle to the incident beam introduces defocus as well as astigmatism in the image plane. Although the former can be compensated by changing the focal plane position, the latter cannot be removed by mere optical re-alignment. Since the DM is to be used to compensate a turbulence-induced curvature term in addition to other aberrations, ...

  18. Explanation of test and assessment of chromosomal aberrations on occupational health examinations for radiation workers

    International Nuclear Information System (INIS)

    Test and Assessment of Chromosomal Aberrations on Occupational Health Examinations for Radiation Workers was formulated for standardizing analysis and outcome assessment of chromosomal aberrations on occupational health examinations for radiation workers. In order to provide experimental and theoretical basis for implementation and extension of this standard, this paper interpreted the standard comprehensively, including some existed problems that methods on detection and outcome assessment of chromosomal aberrations is not unified in different laboratories in China, and related criteria,laws and regulations at home and abroad are not fit for the detection of chromosomal aberrations for radiation workers very well; some introduction on methods of chromosomal slide preparation, discriminant analysis and outcome assessment of chromosomal aberration; and some influencing factors in the quality of chromosomal aberration detection. (authors)

  19. Effects of Turbulent Aberrations on Probability Distribution of Orbital Angular Momentum for Optical Communication

    Institute of Scientific and Technical Information of China (English)

    ZHANG Yi-Xin; CANG Ji


    Effects of atmospheric turbulence tilt, defocus, astigmatism and coma aberrations on the orbital angular mo-mentum measurement probability of photons propagating in weak turbulent regime are modeled with Rytov approximation. By considering the resulting wave as a superposition of angular momentum eigenstates, the or-bital angular momentum measurement probabilities of the transmitted digit axe presented. Our results show that the effect of turbulent tilt aberration on the orbital angular momentum measurement probabilities of photons is the maximum among these four kinds of aberrations. As the aberration order increases, the effects of turbulence aberrations on the measurement probabilities of orbital angular momentum generally decrease, whereas the effect of turbulence defoens can be ignored. For tilt aberration, as the difference between the measured orbital angular momentum and the original orbital angular momentum increases, the orbital angular momentum measurement probabifity decreases.

  20. Effects of Turbulent Aberrations on Probability Distribution of Orbital Angular Momentum for Optical Communication

    International Nuclear Information System (INIS)

    Effects of atmospheric turbulence tilt, defocus, astigmatism and coma aberrations on the orbital angular momentum measurement probability of photons propagating in weak turbulent regime are modeled with Rytov approximation. By considering the resulting wave as a superposition of angular momentum eigenstates, the orbital angular momentum measurement probabilities of the transmitted digit are presented. Our results show that the effect of turbulent tilt aberration on the orbital angular momentum measurement probabilities of photons is the maximum among these four kinds of aberrations. As the aberration order increases, the effects of turbulence aberrations on the measurement probabilities of orbital angular momentum generally decrease, whereas the effect of turbulence defocus can be ignored. For tilt aberration, as the difference between the measured orbital angular momentum and the original orbital angular momentum increases, the orbital angular momentum measurement probability decreases. (fundamental areas of phenomenology (including applications))

  1. Fifth-order canonical geometric aberration analysis of electrostatic round lenses

    CERN Document Server

    Liu Zhi Xiong


    In this paper the fifth-order canonical geometric aberration patterns are analyzed and a numerical example is given on the basis of the analytical expressions of fifth-order aberration coefficients derived in the present work. The fifth-order spherical aberration, astigmatism and field curvature, and distortion are similar to the third-order ones and the fifth-order coma is slightly different. Besides, there are two more aberrations which do not exist in the third-order aberration: they are peanut aberration and elliptical coma in accordance with their shapes. In the numerical example, by using a cross-check of the calculated coefficients with those computed through the differential algebraic method, it has been verified that all the expressions are correct and the computational results are reliable with high precision.

  2. The impact of aberrations on object reconstruction with interferometric synthetic aperture microscopy (United States)

    Adie, Steven G.; Graf, Benedikt W.; Ahmad, Adeel; Darbarsyah, Budiman; Boppart, Stephen A.; Carney, P. Scott


    Interferometric synthetic aperture microscopy (ISAM) reconstructs the scattering potential of a sample with spatially invariant resolution, based on the incident beam profile, the beam scan pattern, the physical model of light sample interaction, and subsequent light collection by the system. In practice, aberrations may influence the beam profile, particularly at higher NA, when ISAM is expected to provide maximum benefit over optical coherence microscopy. Thus it is of interest to determine the effects of aberrations on ISAM reconstructions. In this paper we present the forward model incorporating the effects of aberrations, which forms the basis for aberration correction in ISAM. Simulations and experimental results show that when operating far from focus, modest amounts of spherical aberration can introduce artifacts to the point-spread function, even at relatively low NA ~ 0.1-0.2. Further work will investigate computational methods to correct the effects of aberrations, i.e. to perform virtual adaptive optics.

  3. Correction of optical aberrations in elliptic neutron guides

    Energy Technology Data Exchange (ETDEWEB)

    Bentley, Phillip M., E-mail: [Australian Nuclear Science and Technology Organisation (ANSTO), Locked Bag 2001, Kirrawee DC, NSW 2232 (Australia); European Spallation Source ESS AB, Box 176, 221 00 Lund (Sweden); Kennedy, Shane J. [Australian Nuclear Science and Technology Organisation (ANSTO), Locked Bag 2001, Kirrawee DC, NSW 2232 (Australia); Andersen, Ken H. [European Spallation Source ESS AB, Box 176, 221 00 Lund (Sweden); Martin Rodriguez, Damian [Juelich Centre for Neutron Science, Forschungszentrum Juelich GmbH, 52425 Juelich (Germany); Mildner, David F.R. [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)


    Modern, nonlinear ballistic neutron guides are an attractive concept in neutron beam delivery and instrumentation because they offer increased performance over straight or linearly tapered guides. However, like other ballistic geometries they have the potential to create significantly non-trivial instrumental resolution functions. We address the source of the most prominent optical aberration, namely coma, and we show that for extended sources the off-axis rays have a different focal length from on-axis rays, leading to multiple reflections in the guide system. We illustrate how the interplay between coma, sources of finite size, and mirrors with non-perfect reflectivity can therefore conspire to produce uneven distributions in the neutron beam divergence, a source of complicated resolution functions. To solve these problems, we propose a hybrid elliptic-parabolic guide geometry. Using this new kind of neutron guide shape, it is possible to condition the neutron beam and remove almost all of the aberrations, whilst providing the same performance in beam current as a standard elliptic neutron guide. We highlight the positive implications for neutron scattering instruments that this new shape can bring.

  4. Robustness of BW Aberrance Indices Against Test Length

    Directory of Open Access Journals (Sweden)

    Tsai-Wei Huang


    Full Text Available Many research had shown person fit indices might be influenced by the factor of test length on their detection rates of aberrant responses. The purpose of this study was to examine test length effects on the BW aberrance indices. Three conditions were designed in this study: test length (K, including 25, 50,100, and 200 items, ability ratio (T/K, defined as the total person score divided by test length K, and error ratio (E/K, defined as the number of errors within ability level divided by test length. Four 100-person times varying-item data matrices (100x25, 100x50, 100x100, and 100x200 were randomly generated and permuted 500 times for each data matrix through 20 repeats. Results showed that after partialling out the factors of E/K and T/K, the effect of test length on the association between the two indices was very slight. In nonlinear regression analyses, E/K and T/K can predict more than 76 and 73 percent of the variances of the B index and that of the W index, respectively, but test length with both very slight contributions on them. Furthermore, a very good model fit generated from SEM analyses also showed the effect of test length on the B and W indices were very tiny. All these pieces of evidence endorsed the B and W indices were robust with test length.

  5. New Views of Materials through Aberration-Corrected STEM

    Energy Technology Data Exchange (ETDEWEB)

    Pennycook, Stephen J [ORNL; Chisholm, Matthew F [ORNL; Lupini, Andrew R [ORNL; Varela del Arco, Maria [ORNL; Borisevich, Albina Y [ORNL; Pantelides, Sokrates T. [Vanderbilt University; van Benthem, Klaus [ORNL; Shibata, Naoya [University of Tokyo, Tokyo, Japan; Molina Rubio, Sergio I [ORNL; Rashkeev, Sergey [ORNL


    The successful correction of lens aberrations in scanning transmission electron microscopy has allowed an improvement in resolution by a factor of two in just a few years. The benefits for materials research are far greater than a factor of two might imply, because enhanced resolution also brings enhanced image contrast, and therefore a vast increase in sensitivity to single atoms, both for imaging and electron energy loss spectroscopy. In addition, aberration correction enables simultaneous, aberrationcorrected, Z-contrast and phase contrast imaging, and brings a depth resolution at the nanometer level. It becomes possible to focus directly on features at different depths in the specimen thickness, and three-dimensional information can be extracted with single atom sensitivity. In conjunction with density functional and elasticity theory, these advances provide a new level of insight into the atomistic origins of materials properties. Several examples are discussed that illustrate the potential for applications, including the segregation of rare earth elements to grain boundaries in Si3N4 ceramics, the quantitative analysis of strain-induced growth phenomena in semiconductor quantum wells, the explanation of the enhanced thermal stability of La-doped -alumina as a catalyst support, and the origin of the remarkable catalytic activity of Au nanoparticles.

  6. Chromosome aberrations in workers of beach sand mineral industries

    International Nuclear Information System (INIS)

    Beach Sand Mining (BSM) is a profitable industry earning a sizable income for the country by way of foreign exchange. The Indian coast is rich in rare earths such as ilmenite, rutile, leucoxene, zircon, garnet and sillimanite, and is invariably associated with radioactive monazite. Due to the nature of the separation processes involved and the manual handling, workers in these factories are continuously being exposed to suspended particles containing naturally occurring radioactive materials. An attempt was made to estimate DNA damage using a chromosome aberration assay to monitor radiation effects in workers of BSM industries in India. The study group comprised 27 BSM workers and 20 controls. Percentage yields of dicentrics, acentric fragments and chromatid breaks observed in the control group were 0.058 ± 0.017, 0.073 ± 0.03 and 0.22 ± 0.112, respectively. Percentage yields of dicentrics + centric rings, acentric fragments and chromatid breaks observed in the BSM group were 0.029 ± 0.01 (P value 0.19), 0.24 ± 0.06 (P value 0.006) and 0.455 ± 0.06 (P value 0.0004), respectively. Elevated levels of fragments and chromatid aberrations are suggestive of low-dose radiation effects and also chemically-induced DNA damage. (authors)

  7. Aberrant activity in degenerated retinas revealed by electrical imaging

    Directory of Open Access Journals (Sweden)

    Günther eZeck


    Full Text Available In this review I present and discuss the current understanding of aberrant electrical activity found in the ganglion cell layer (GCL of rod-degenerated (rd mouse retinas. The reported electrophysiological properties revealed by electrical imaging using high-density microelectrode arrays can be subdivided between spiking activity originating from retinal ganglion cells (RGCs and local field potentials reflecting strong trans-membrane currents within the GCL. RGCs in rod-degenerated retinas show increased and rhythmic spiking compared to age-matched wild-type retinas. Fundamental spiking frequencies range from 5 to 15 Hz in various mouse models. The rhythmic RGC spiking is driven by a presynaptic network comprising AII amacrine and bipolar cells. In the healthy retina this rhythm-generating circuit is inhibited by photoreceptor input. A unique physiological feature of rd retinas is rhythmic local field potentials (LFP manifested as spatially-restricted low-frequency (5–15 Hz voltage changes. Their spatiotemporal characterization revealed propagation and correlation with RGC spiking. LFPs rely on gap-junctional coupling and are shaped by glycinergic and by GABAergic transmission. The aberrant RGC spiking and LFPs provide a simple readout of the functionality of the remaining retinal circuitry which can be used in the development of improved vision restoration strategies.

  8. Generic Misalignment Aberration Patterns in Wide-Field Telescopes

    CERN Document Server

    Schechter, Paul L


    Axially symmetric telescopes produce well known "Seidel" off-axis third-order aberration patterns: coma, astigmatism, curvature of field and distortion. When axial symmetry is broken by the small misalignments of optical elements, additional third-order aberration patterns arise: one each for coma, astigmatism and curvature of field and two for distortion. Each of these misalignment patterns is characterized by an associated two-dimensional vector, each of which in turn is a linear combination of the tilt and decenter vectors of the individual optical elements. For an N-mirror telescope, 2(N - 1) patterns must be measured to keep the telescope aligned. For N = 3, as in a three mirror anastigmat, there is a two-dimensional "subspace of benign misalignment" over which the misalignment patterns for third-order coma, astigmatism and curvature of field are identically zero. One would need to measure at least one of the two distortion patterns to keep the telescope aligned. Alternatively, one might measure one of t...

  9. Correction for polychromatic aberration in computed tomography images

    International Nuclear Information System (INIS)

    A method and apparatus for correcting a computed tomography image for polychromatic aberration caused by the non-linear interaction (i.e. the energy dependent attenuation characteristics) of different body constituents, such as bone and soft tissue, with a polychromatic X-ray beam are described in detail. An initial image is conventionally computed from path measurements made as source and detector assembly scan a body section. In the improvement, each image element of the initial computed image representing attenuation is recorded in a store and is compared with two thresholds, one representing bone and the other soft tissue. Depending on the element value relative to the thresholds, a proportion of the respective constituent is allocated to that element location and corresponding bone and soft tissue projections are determined and stored. An error projection generator calculates projections of polychromatic aberration errors in the raw image data from recalled bone and tissue projections using a multidimensional polynomial function which approximates the non-linear interaction involved. After filtering, these are supplied to an image reconstruction computer to compute image element correction values which are subtracted from raw image element values to provide a corrected reconstructed image for display. (author)

  10. Mechanistic modeling of aberrant energy metabolism in human disease

    Directory of Open Access Journals (Sweden)

    Vineet eSangar


    Full Text Available Dysfunction in energy metabolism—including in pathways localized to the mitochondria—has been implicated in the pathogenesis of a wide array of disorders, ranging from cancer to neurodegenerative diseases to type II diabetes. The inherent complexities of energy and mitochondrial metabolism present a significant obstacle in the effort to understand the role that these molecular processes play in the development of disease. To help unravel these complexities, systems biology methods have been applied to develop an array of computational metabolic models, ranging from mitochondria-specific processes to genome-scale cellular networks. These constraint-based models can efficiently simulate aspects of normal and aberrant metabolism in various genetic and environmental conditions. Development of these models leverages—and also provides a powerful means to integrate and interpret—information from a wide range of sources including genomics, proteomics, metabolomics, and enzyme kinetics. Here, we review a variety of mechanistic modeling studies that explore metabolic functions, deficiency disorders, and aberrant biochemical pathways in mitochondria and related regions in the cell.

  11. Correction of optical aberrations in elliptic neutron guides

    International Nuclear Information System (INIS)

    Modern, nonlinear ballistic neutron guides are an attractive concept in neutron beam delivery and instrumentation because they offer increased performance over straight or linearly tapered guides. However, like other ballistic geometries they have the potential to create significantly non-trivial instrumental resolution functions. We address the source of the most prominent optical aberration, namely coma, and we show that for extended sources the off-axis rays have a different focal length from on-axis rays, leading to multiple reflections in the guide system. We illustrate how the interplay between coma, sources of finite size, and mirrors with non-perfect reflectivity can therefore conspire to produce uneven distributions in the neutron beam divergence, a source of complicated resolution functions. To solve these problems, we propose a hybrid elliptic–parabolic guide geometry. Using this new kind of neutron guide shape, it is possible to condition the neutron beam and remove almost all of the aberrations, whilst providing the same performance in beam current as a standard elliptic neutron guide. We highlight the positive implications for neutron scattering instruments that this new shape can bring.

  12. Chromosomal aberrations as etiological factors of intrauterine growth retardation

    Directory of Open Access Journals (Sweden)

    Petrović Bojana


    Full Text Available Background/Aim. Intrauterine growth retardation (IUGR is a pathological condition of pregnancy characterised by birth weight below the 10th centile. A number of fetal, placental and maternal causes can lead to IUGR; although, in most cases no specific causes can be identified. The aim of this study was to determine the part of chromosomal abnormalities in IUGR etiology. Methods. Fetal blood karyotype taken by cordocentesis from 168 fetuses with diagnosed IUGR was analyzed. Results. Chromosomal rearrangements both numerical and structural were detected in 14 cases (12.2%. Two cases were triploid. Patau syndrome, Edwards syndrome and Down syndrome were found in two cases each. There was one case of trisomy 7 (47, XY, +7 and one case of trisomy 16 (47, XX, +16; one translocation, 46, XY, t (2; 14(q23; q32 and a deletion 46, XYdel (12 (p12 as well as two cases of sex chromosomes abnormalities, 45, X (Turner syndrome and 47, XYY. Conclusion. These findings suggest that a consistent number of symmetrical IUGR cases (about 12% can be associated with chromosomal rearrangements. Chromosomal aberrations that cause IUGR are heterogeneous, aberration of autosomes, mostly autosomal trisomies, being the most common.

  13. X-ray induction of mitotic and meiotic chromosome aberrations

    International Nuclear Information System (INIS)

    In 1964 six pairs of rat kangaroo (Potorous tridactylis) were obtained from Australia. The tissues of these animals were used to initiate cell lines. Since this species has a low chromosome number of six pairs, each pair with its own distinctive morphology, it is particularly favorable for cytogenetic research. In cell cultures derived from the corneal endothelial tissues of one animal there emerged a number of haploid cells. The number of haploid cells in the cultures reached as high as 20% of the total mitotic configurations. The in vitro diploid and haploid mixture cell cultures could be a resemblance or a coincidence to the mixture existence of the diploid primary spermatocytes and the haploid secondary spermatocytes (gametes) in the in vivo testicular tissues of the male animals. It would be interesting to compare reactions of the haploid and diploid cell mixture, either in the cultures or in the testes, to x-ray exposure. Two other studies involving x-ray effects on Chinese hamster oocyte maturation and meiotic chromosomes and the x-ray induction of Chinese hamster spermatocyte meiotic chromosome aberrations have been done in this laboratory. A review of these three studies involving diploid and haploid chromosomes may lead to further research in the x-ray induction of chromosome aberrations

  14. Aberrant WNT/β-catenin signaling in parathyroid carcinoma

    Directory of Open Access Journals (Sweden)

    Åkerström Göran


    Full Text Available Abstract Background Parathyroid carcinoma (PC is a very rare malignancy with a high tendency to recur locally, and recurrent disease is difficult to eradicate. In most western European countries and United States, these malignant neoplasms cause less than 1% of the cases with primary hyperparathyroidism, whereas incidence as high as 5% have been reported from Italy, Japan, and India. The molecular etiology of PC is poorly understood. Results The APC (adenomatous polyposis coli tumor suppressor gene was inactivated by DNA methylation in five analyzed PCs, as determined by RT-PCR, Western blotting, and quantitative bisulfite pyrosequencing analyses. This was accompanied by accumulation of stabilized active nonphosphorylated β-catenin, strongly suggesting aberrant activation of the WNT/β-catenin signaling pathway in these tumors. Treatment of a primary PC cell culture with the DNA hypomethylating agent 5-aza-2'-deoxycytidine (decitabine, Dacogen(r induced APC expression, reduced active nonphosphorylated β-catenin, inhibited cell growth, and caused apoptosis. Conclusion Aberrant WNT/β-catenin signaling by lost expression and DNA methylation of APC, and accumulation of active nonphosphorylated β-catenin was observed in the analyzed PCs. We suggest that adjuvant epigenetic therapy should be considered as an additional option in the treatment of patients with recurrent or metastatic parathyroid carcinoma.

  15. Aberrant functional brain connectome in people with antisocial personality disorder (United States)

    Tang, Yan; Long, Jun; Wang, Wei; Liao, Jian; Xie, Hua; Zhao, Guihu; Zhang, Hao


    Antisocial personality disorder (ASPD) is characterised by a disregard for social obligations and callous unconcern for the feelings of others. Studies have demonstrated that ASPD is associated with abnormalities in brain regions and aberrant functional connectivity. In this paper, topological organisation was examined in resting-state fMRI data obtained from 32 ASPD patients and 32 non-ASPD controls. The frequency-dependent functional networks were constructed using wavelet-based correlations over 90 brain regions. The topology of the functional networks of ASPD subjects was analysed via graph theoretical analysis. Furthermore, the abnormal functional connectivity was determined with a network-based statistic (NBS) approach. Our results revealed that, compared with the controls, the ASPD patients exhibited altered topological configuration of the functional connectome in the frequency interval of 0.016–0.031 Hz, as indicated by the increased clustering coefficient and decreased betweenness centrality in the medial superior frontal gyrus, precentral gyrus, Rolandic operculum, superior parietal gyrus, angular gyrus, and middle temporal pole. In addition, the ASPD patients showed increased functional connectivity mainly located in the default-mode network. The present study reveals an aberrant topological organisation of the functional brain network in individuals with ASPD. Our findings provide novel insight into the neuropathological mechanisms of ASPD. PMID:27257047

  16. Aberrant functional brain connectome in people with antisocial personality disorder. (United States)

    Tang, Yan; Long, Jun; Wang, Wei; Liao, Jian; Xie, Hua; Zhao, Guihu; Zhang, Hao


    Antisocial personality disorder (ASPD) is characterised by a disregard for social obligations and callous unconcern for the feelings of others. Studies have demonstrated that ASPD is associated with abnormalities in brain regions and aberrant functional connectivity. In this paper, topological organisation was examined in resting-state fMRI data obtained from 32 ASPD patients and 32 non-ASPD controls. The frequency-dependent functional networks were constructed using wavelet-based correlations over 90 brain regions. The topology of the functional networks of ASPD subjects was analysed via graph theoretical analysis. Furthermore, the abnormal functional connectivity was determined with a network-based statistic (NBS) approach. Our results revealed that, compared with the controls, the ASPD patients exhibited altered topological configuration of the functional connectome in the frequency interval of 0.016-0.031 Hz, as indicated by the increased clustering coefficient and decreased betweenness centrality in the medial superior frontal gyrus, precentral gyrus, Rolandic operculum, superior parietal gyrus, angular gyrus, and middle temporal pole. In addition, the ASPD patients showed increased functional connectivity mainly located in the default-mode network. The present study reveals an aberrant topological organisation of the functional brain network in individuals with ASPD. Our findings provide novel insight into the neuropathological mechanisms of ASPD. PMID:27257047

  17. Mirror-based broadband scanner with minimized aberration (United States)

    Yu, Jiun-Yann; Tzeng, Yu-Yi; Huang, Chen-Han; Chui, Hsiang-Chen; Chu, Shi-Wei


    To obtain specific biochemical information in optical scanning microscopy, labeling technique is routinely required. Instead of the complex and invasive sample preparation procedures, incorporating spectral acquisition, which commonly requires a broadband light source, provides another mechanism to enhance molecular contrast. But most current optical scanning system is lens-based and thus the spectral bandwidth is limited to several hundred nanometers due to anti-reflection coating and chromatic aberration. The spectral range of interest in biological research covers ultraviolet to infrared. For example, the absorption peak of water falls around 3 μm, while most proteins exhibit absorption in the UV-visible regime. For imaging purpose, the transmission window of skin and cerebral tissues fall around 1300 and 1800 nm, respectively. Therefore, to extend the spectral bandwidth of an optical scanning system from visible to mid-infrared, we propose a system composed of metallic coated mirrors. A common issue in such a mirror-based system is aberrations induced by oblique incidence. We propose to compensate astigmatism by exchanging the sagittal and tangential planes of the converging spherical mirrors in the scanning system. With the aid of an optical design software, we build a diffraction-limited broadband scanning system with wavefront flatness better than λ/4 at focal plane. Combined with a mirror-based objective this microscopic system will exhibit full spectral capability and will be useful in microscopic imaging and therapeutic applications.

  18. Concentrations of 4.5S RNA and Ffh protein in Escherichia coli: the stability of Ffh protein is dependent on the concentration of 4.5S RNA.


    Jensen, C G; Pedersen, S.


    We measured the concentrations of both 4.5S RNA and Ffh protein under a variety of growth conditions and found that there were 400 molecules of 4.5S RNA per 10,000 ribosomes in wild-type cells and that the concentration of Ffh protein was one-fourth of that. This difference in concentration is 1 order of magnitude less than that previously reported but still significant. Pulse-chase labeling experiments indicated that Ffh protein is unstable in cells carrying ffh on high-copy-number plasmids ...

  19. Chromosome aberrations in workers of ignalina nuclear power plant

    International Nuclear Information System (INIS)

    Full text of publication follows: The Ignalina Nuclear Power Plant (I.N.P.P.) workers and outside workers including visitors constitute the largest occupational group exposed to low doses of ionizing radiation in Lithuania. In 2004, the annual collective dose to these workers (4392 persons) was 6,83 man Sv. The maximum annual individual dose of I.N.P.P. workers was 19,16 mSv, and of outside workers was 29,41 mSv. However, according to calculations performed by the Lithuanian Radiation Protection Centre, the decommissioning of I.N.P.P. (the I.N.P.P. is to be shut down by 2009) will result in collective dose of 35 man Sv. Therefore, a special attention should be given to implementation of radiation protection programme. The importance of cytogenetic studies in the medical surveillance of radiation-exposed persons is generally acknowledged. The aim of the present study was to analyse chromosome aberration frequencies in lymphocytes of I.N.P.P. workers. The blood sampling of 27 male workers was performed in October 2004, after planned outage of I.N.P.P.. It was estimated that outages of I.N.P.P. Units contributed 84% to all annual occupational collective dose. Average cumulative dose of 18 workers was 290,7 mSv (group A), and of 9 workers - 71,7 mSv (group B). The mean annual doses averaged over the three-year-period were 15,2 mSv and 0,76 mSv, respectively. None of the exposed workers had ever exceeded the permissible dose limit. The average age of group A workers was 45,2 years, and group B 48,2 years. A questionnaire form with details on age, occupational history, smoking habit and alcohol intake, medication, history of recent illness was completed for each person at the time of blood collection. 64 non-exposed male donors approximately matched by age were used as controls (group C). Heparinized venous blood samples were taken and cultures were initiated within 24 h according to the standard procedures. At least 500 first cycle metaphases were analysed from each



    Sadeghipoor Kermani, Zahra; Lu, Yue; Mendez, Erick; Süsstrunk, Sabine


    Chromatic aberration, caused by photographic lens imperfections, results in the image of only one spectral channel being sharp, while the other channels are blurred depending on their wavelengths difference with the sharp channel. We study chromatic aberration for a system that jointly records color and near-infrared (NIR) images on a single sensor. Chromatic aberration in such a system leads to a blurred NIR image when the color image is in-focus and sharp. We propose an algorithm that deblu...

  1. Method for measuring ocular aberrations induced by thermal lensing in vivo (United States)

    Vincelette, Rebecca; Oliver, Jeff; Noojin, Gary; Schuster, Kurt; Shingledecker, Aurora; Welch, Ashley J.


    An adaptive optics imaging system was used to qualitatively observe the types of aberrations induced by an infrared laser in a rhesus eye. Thermal lensing was induced with an infrared laser radiation wavelength of 1150-nm. The adaptive optics system tracked the temporal response of the aberrations at a frequency of 30 Hz for continuous-wave exposures. Results are compared against thermal lensing aberrations induced in an artificial eye.


    Directory of Open Access Journals (Sweden)

    E. S. Voropay


    Full Text Available Schemes of high-aperture and compact optical spectrometers and giperspectrometer with minimized aberrations are presented. In the first scheme usage of inclined plane-parallel plate allows decreasing of astigmatism. In the second scheme off-axis aberrations are practically removed due to axial propagation of light. For giperspectrometer narrowing of light propagation angle through the object lens and turning the light out of dispersion plane lead to minimizing of picture aberrations.

  3. Correction of cell-induced optical aberrations in a fluorescence fluctuation microscope.


    Leroux, Charles-Edouard; Grichine, Alexei; Wang, Irène; Delon, Antoine


    International audience We describe the effect of optical aberrations on fluorescence fluctuations microscopy (FFM), when focusing through a single living cell. FFM measurements are performed in an aqueous fluorescent solution and prove to be a highly sensitive tool to assess the optical aberrations introduced by the cell. We demonstrate an adaptive optics (AO) system to remove the aberration-related bias in the FFM measurements. Our data show that AO is not only useful when imaging deep in...

  4. Early aberrant DNA methylation events in a mouse model of acute myeloid leukemia


    Sonnet, Miriam; Claus, Rainer; Becker, Natalia; Zucknick, Manuela; Petersen, Jana; Lipka, Daniel B.; Oakes, Christopher C.; Andrulis, Mindaugas; Lier, Amelie; Milsom, Michael D.; Witte, Tania; Gu, Lei; Kim-Wanner, Soo-Zin; Schirmacher, Peter; Wulfert, Michael


    Background Aberrant DNA methylation is frequently found in human malignancies including acute myeloid leukemia (AML). While most studies focus on later disease stages, the onset of aberrant DNA methylation events and their dynamics during leukemic progression are largely unknown. Methods We screened genome-wide for aberrant CpG island methylation in three disease stages of a murine AML model that is driven by hypomorphic expression of the hematopoietic transcription factor PU.1. DNA methylati...


    Institute of Scientific and Technical Information of China (English)

    张鸿源; 王兰金; 等


    The chromosomoe and chromatid type aberration can be induced by benzene and the dicentric and ring ones were not observed in vitro experiment but observed in vivo one.In vitro experiment a good linear reression can be given between benzene concentrations and total aberration cells while power regression for radiation dose.The chromosome aberrations induced by benzene combined with radiation in rabbit blood lymphocytes are higher than in bone marryow cells.

  6. Relationship of DNA lesions and their repair to chromosomal aberration production

    International Nuclear Information System (INIS)

    Recent work on the roles of specific kinds of DNA lesions and their enzymatic repair systems in the production of chromosomal aberrations seems consistent with a simple molecular model of chromosomal aberrations formation. Evidence from experiments with the human repair-deficient genetic diseases xeroderma pigmentosom, ataxia telangiectasia, and Fanconi's anemia is reviewed in the light of the contributions to aberration production of single and double polynucleotide strand breaks, base damage, polynucleotide strand crosslinks, and pyrimidine cyclobutane dimers

  7. Optimization of holographic data storage system based on Seidel aberrations reduction (United States)

    Liu, Ren-Chung; Lin, Shiuan-Huei; Hsu, Ken-Yuh


    In this research, we investigate the influence of Seidel aberrations on the point spread function and the probability density function of holographic data storage systems, and thus the storage capacity and bit error rate of storage system can be obtained. The aberrations tolerances of storage systems with different numerical aperture are obtained. Optimization on BER and SC of holographic data storage systems by reducing Seidel aberrations will be demonstrated numerically.



    Matsuoka, R; Asonuma, K.; Takahashi, G; Danjo, T.; Hirana, K.


    This paper reports an experiment conducted to evaluate correction methods of chromatic aberrations in images acquired by a nonmetric digital camera. The chromatic aberration correction methods evaluated in the experiment are classified into two kinds. One is the method to correct image coordinates by using camera calibration results of color-separated images. The other is the method based on the assumption that the magnitude of chromatic aberrations can be expressed by a function of ...

  9. A double pole-gap design for low spherical aberration in thin solenoids

    Energy Technology Data Exchange (ETDEWEB)

    Chandran, Sona, E-mail:; Biswas, Bhaskar


    We here report a new design of a double air-slot or pole-gap type, axially thin, shielded solenoid with lower spherical aberration than conventional single pole-gap type solenoids. The net on-axis field from two optimally distanced pole gaps reduces the spherical aberration. The working principle of the model is also given by a pair of coaxial, in-air, identical current loops which can have lower spherical aberration than a single current loop. The new design is useful to achieve low spherical aberration in axially thin shielded solenoids.

  10. A double pole-gap design for low spherical aberration in thin solenoids

    International Nuclear Information System (INIS)

    We here report a new design of a double air-slot or pole-gap type, axially thin, shielded solenoid with lower spherical aberration than conventional single pole-gap type solenoids. The net on-axis field from two optimally distanced pole gaps reduces the spherical aberration. The working principle of the model is also given by a pair of coaxial, in-air, identical current loops which can have lower spherical aberration than a single current loop. The new design is useful to achieve low spherical aberration in axially thin shielded solenoids

  11. Spherical aberration from trajectories in real and hard-edge solenoid fields

    Indian Academy of Sciences (India)



    For analytical, real and hard-edge solenoidal axial magnetic fields, the low-energy electron trajectories are obtained using the third-order paraxial ray equation. Using the particle trajectories, it is shown that the spherical aberration in the hard-edge model is high and it increases monotonously with hard edginess, although the focal length converges, in agreement with a recentfield and spherical aberration model. The model paved the way for a hard-edge approximation that gives correct focal length and spherical aberration, which is verified here by the trajectory method. In essence, we show that exact hard-edge fields give infinite spherical aberrations.

  12. X-ray-induced chromosome aberrations in Down lymphocytes: an explanation of their increased sensitivity

    International Nuclear Information System (INIS)

    Unstimulated lymphocytes from individuals with Down Syndrome (trisomy 21) are more sensitive to the induction of dicentric and ring aberrations by X rays than normal lymphocytes. Several explanations involving the more rapid rejoining of X-ray-induced lesions in Down cells have been offered. It is shown here that the repair of the DNA damage converted into chromosome aberrations is more rapid in Down cells than normal cells. This more rapid repair results in a higher probability of producing chromosome aberrations, and hence higher aberration frequencies in Down than normal cells

  13. X-ray-induced chromosome aberrations in Down lymphocytes: an explanation of their increased sensitivity

    International Nuclear Information System (INIS)

    Unstimulated lymphocytes from individuals with Down Syndrome (trisomy 21) are more sensitive to the induction of dicentric and ring aberrations by X rays than normal lymphocytes. Several explanations involving the more rapid rejoining of X-ray--induced lesions in Down cells have been offered. It is shown here that the repair of the DNA damage converted into chromosome aberrations is more rapid in Down cells than normal cells. This more rapid repair results in a higher probability of producing chromosomes aberrations, and hence higher aberration frequencies in Down than normal cells

  14. Structural and optical properties of AgIn5S8 films grown by pulsed laser deposition

    International Nuclear Information System (INIS)

    In thin AgIn5S8 films prepared by pulsed laser evaporation of volume crystals on glass substrates crystal structure, composition, morphology, surfaces were investigated, and transmission and reflection spectra were measured in spectral field from 0.5 to 2.5 μm. Coefficient of optical absorption were calculated and energies for direct and indirect interzone transitions were determined. It is shown that obtained experimental results for laser deposited AgIn5S8 layers agree well with the data for volume crystals

  15. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. (United States)

    Black, W C; Piesman, J


    Ticks are parasitiform mites that are obligate hematophagous ectoparasites of amphibians, reptiles, birds, and mammals. A phylogeny for tick families, subfamilies, and genera has been described based on morphological characters, life histories, and host associations. To test the existing phylogeny, we sequenced approximately 460 bp from the 3' end of the mitochondrial 16S rRNA gene (rDNA) in 36 hard- and soft-tick species; a mesostigmatid mite, Dermanyssus gallinae, was used as an outgroup. Phylogenies derived using distance, maximum-parsimony, or maximum-likelihood methods were congruent. The existing phylogeny was largely supported with four exceptions. In hard ticks (Ixodidae), members of Haemaphysalinae were monophyletic with the primitive Amblyomminae and members of Hyalomminae grouped within the Rhipicephalinae. In soft ticks (Argasidae), the derived phylogeny failed to support a monophyletic relationship among members of Ornithodorinae and supported placement of Argasinae as basal to the Ixodidae, suggesting that hard ticks may have originated from an Argas-like ancestor. Because most Argas species are obligate bird octoparasites, this result supports earlier suggestions that hard ticks did not evolve until the late Cretaceous. PMID:7937832

  16. Characterization of Lactobacillus from Algerian goat's milk based on phenotypic, 16S rDNA sequencing and their technological properties

    Directory of Open Access Journals (Sweden)

    Ahmed Marroki


    Full Text Available Nineteen strains of Lactobacillus isolated from goat's milk from farms in north-west of Algeria were characterized. Isolates were identified by phenotypic, physiological and genotypic methods and some of their important technological properties were studied. Phenotypic characterization was carried out by studying physiological, morphological characteristics and carbohydrate fermentation patterns using API 50 CHL system. Isolates were also characterized by partial 16S rDNA sequencing. Results obtained with phenotypic methods were correlated with the genotypic characterization and 13 isolates were identified as L. plantarum, two isolates as L. rhamnosus and one isolate as L. fermentum. Three isolates identified as L. plantarum by phenotypic characterization were found to be L. pentosus by the genotypic method. A large diversity in technological properties (acid production in skim milk, exopolysaccharide production, aminopeptidase activity, antibacterial activity and antibiotic susceptibility was observed. Based on these results, two strains of L. plantarum (LbMS16 and LbMS21 and one strain of L. rhamnosus (LbMF25 have been tentatively selected for use as starter cultures in the manufacture of artisanal fermented dairy products in Algeria.

  17. Detection of novel organisms associated with salpingitis, by use of 16S rDNA polymerase chain reaction. (United States)

    Hebb, Jennifer K; Cohen, Craig R; Astete, Sabina G; Bukusi, Elizabeth A; Totten, Patricia A


    Although Chlamydia trachomatis and Neisseria gonorrhoeae are established causes of salpingitis, the majority of cases have no known etiology. We used broad-range 16S rDNA polymerase chain reaction to identify novel, possibly uncultivable, bacteria associated with salpingitis and identified bacterial 16S sequences in Fallopian-tube specimens from 11 (24%) of 45 consecutive women with laparoscopically confirmed acute salpingitis (the case patients) and from 0 of 44 women seeking tubal ligations (the control subjects) at Kenyatta National Hospital, Nairobi, Kenya. Bacterial phylotypes most closely related to Leptotrichia spp. were detected as the sole phylotypes in 1, and mixed with other bacterial phylotypes in 2, specimens. Novel bacterial phylotypes and those associated with bacterial vaginosis, including Atopobium vaginae, were identified in 3 specimens. N. gonorrhoeae and Streptococcus pyogenes were identified in 2 and 1 specimens, respectively. The finding of novel phylotypes associated with salpingitis has important implications for the etiology, pathogenesis, and treatment of this important reproductive-tract disease syndrome. PMID:15551209

  18. Phylogeny of Populus (Salicaceae) based on nucleotide sequences of chloroplast TRNT-TRNF region and nuclear rDNA. (United States)

    Hamzeh, Mona; Dayanandan, Selvadurai


    The species of the genus Populus, collectively known as poplars, are widely distributed over the northern hemisphere and well known for their ecological, economical, and evolutionary importance. The extensive interspecific hybridization and high morphological diversity in this group pose difficulties in identifying taxonomic units for comparative evolutionary studies and systematics. To understand the evolutionary relationships among poplars and to provide a framework for biosystematic classification, we reconstructed a phylogeny of the genus Populus based on nucleotide sequences of three noncoding regions of the chloroplast DNA (intron of trnL and intergenic regions of trnT-trnL and trnL-trnF) and ITS1 and ITS2 of the nuclear rDNA. The resulting phylogenetic trees showed polyphyletic relationships among species in the sections Tacamahaca and Aigeiros. Based on chloroplast DNA sequence data, P. nigra had a close affinity to species of section Populus, whereas nuclear DNA sequence data suggested a close relationship between P. nigra and species of the section Aigeiros, suggesting a possible hybrid origin for P. nigra. Similarly, the chloroplast DNA sequences of P. tristis and P. szechuanica were similar to that of the species of section Aigeiros, while the nuclear sequences revealed a close affinity to species of the section Tacamahaca, suggesting a hybrid origin for these two Asiatic balsam poplars. The incongruence between phylogenetic trees based on nuclear- and chloroplast-DNA sequence data suggests a reticulate evolution in the genus Populus. PMID:21652373

  19. Identification of cephalopod species from the North and Baltic Seas using morphology, COI and 18S rDNA sequences (United States)

    Gebhardt, Katharina; Knebelsberger, Thomas


    We morphologically analyzed 79 cephalopod specimens from the North and Baltic Seas belonging to 13 separate species. Another 29 specimens showed morphological features of either Alloteuthis mediaor Alloteuthis subulata or were found to be in between. Reliable identification features to distinguish between A. media and A. subulata are currently not available. The analysis of the DNA barcoding region of the COI gene revealed intraspecific distances (uncorrected p) ranging from 0 to 2.13 % (average 0.1 %) and interspecific distances between 3.31 and 22 % (average 15.52 %). All species formed monophyletic clusters in a neighbor-joining analysis and were supported by bootstrap values of ≥99 %. All COI haplotypes belonging to the 29 Alloteuthis specimens were grouped in one cluster. Neither COI nor 18S rDNA sequences helped to distinguish between the different Alloteuthis morphotypes. For species identification purposes, we recommend the use of COI, as it showed higher bootstrap support of species clusters and less amplification and sequencing failure compared to 18S. Our data strongly support the assumption that the genus Alloteuthis is only represented by a single species, at least in the North Sea. It remained unclear whether this species is A. subulata or A. media. All COI sequences including important metadata were uploaded to the Barcode of Life Data Systems and can be used as reference library for the molecular identification of more than 50 % of the cephalopod fauna known from the North and Baltic Seas.

  20. The phylogeny of native and exotic scallops cultured in China based on 16S rDNA sequences

    Institute of Scientific and Technical Information of China (English)

    LIU Baozhong; DONG Bo; XIANG Jianhai; WANG Zaizhao


    Scallops of the Family Pectinidae are a valuable resource in marine industry of the world.Understanding the phylogeny of the family is important for the development of the industry. In this study,partial 16S mitochondrial rDNA genes were obtained from 8 scallop species that are commonly cultured indigenous and transplanted species in China. Phylogenetic relationships of Pectinidae were analyzed based on the 8 sequences and other 5 published ones in GenBank, representing 9 genera of the family. The molecular phylogeny trees were constructed using 3 methods with software PHYLIP. The results showe that total 13 species of scallops clustered in 4 clades. Pecten maximus joins P. jacobaeus then Amusium pleuronectes in cluster, indicating close relationship of genus Amusium with Pecten in evolution. P. yessoensis is close to Chlamysfarreri and C. islandica. No enough material was available to single out genus Patinopecten as an independent monophyletic subfamily. The position ofAdamussium colbecki indicates that it is far from genus Pecten but near to genus Chlamys in evolution.

  1. The phylogeny of native and exotic scallops cultured in China based on 16S rDNA sequences (United States)

    Liu, Baozhong; Dong, Bo; Xiang, Jianhai; Wang, Zaizhao


    Scallops of the Family Pectinidae are a valuable resource in marine industry of the world. Understanding the phylogeny of the family is important for the development of the industry. In this study, partial 16S mitochondrial rDNA genes were obtained from 8 scallop species that are commonly cultured indigenous and transplanted species in China. Phylogenetic relationships of Pectinidae were analyzed based on the 8 sequences and other 5 published ones in GenBank, representing 9 genera of the family. The molecular phylogeny trees were constructed using 3 methods with software PHYLIP. The results showe that total 13 species of scallops clustered in 4 clades. Pecten maximus joins P. jacobaeus then Amusium pleuronectes in cluster, indicating close relationship of genus Amusium with Pecten in evolution. P. yessoensis is close to Chlamys farreri and C. islandica. No enough material was available to single out genus Patinopecten as an independent monophyletic subfamily. The position of Adamussium colbecki indicates that it is far from genus Pecten but near to genus Chlamys in evolution.

  2. Taiwanese Trichogramma of Asian Corn Borer: Morphology, ITS-2 rDNA Characterization, and Natural Wolbachia Infection (United States)

    Wu, Li-Hsin; Hoffmann, Ary A.; Thomson, Linda J.


    Egg parasitoids of the genus Trichogramma are natural enemies of many lepidopteran borers in agricultural areas around the world. It is important to identify the correct species and ideally focus on endemic Trichogramma for pest control in particular crops. In this study, Trichogramma wasps were collected from parasitized eggs of Asian corn borer in Southwestern Taiwan. Three Trichogramma species, Trichogramma ostriniae Pang and Chen, Trichogramma chilonis Ishii, and T. sp. y, were identified based on morphology and the nucleotide sequence of the internal transcribed spacer 2 (ITS-2) region of rDNA. Although T. ostriniae and T. sp. y appear to be morphologically similar, ITS-2 identity between these two taxa is only 89%. Surprisingly, a commercially released Trichogramma colony thought to be T. chilonis possessed 99% identity (ITS-2) with the field T. sp. y individuals. This suggests past contamination leading to subsitution of the laboratory-reared T. chilonis colony by T. sp. y. Natural populations of all three Trichogramma species were found to be infected by a single Wolbachia strain which was identified using a wsp gene sequence. PMID:26896674

  3. Metagenomic Analysis of Slovak Bryndza Cheese Using Next-Generation 16S rDNA Amplicon Sequencing

    Directory of Open Access Journals (Sweden)

    Planý Matej


    Full Text Available Knowledge about diversity and taxonomic structure of the microbial population present in traditional fermented foods plays a key role in starter culture selection, safety improvement and quality enhancement of the end product. Aim of this study was to investigate microbial consortia composition in Slovak bryndza cheese. For this purpose, we used culture-independent approach based on 16S rDNA amplicon sequencing using next generation sequencing platform. Results obtained by the analysis of three commercial (produced on industrial scale in winter season and one traditional (artisanal, most valued, produced in May Slovak bryndza cheese sample were compared. A diverse prokaryotic microflora composed mostly of the genera Lactococcus, Streptococcus, Lactobacillus, and Enterococcus was identified. Lactococcus lactis subsp. lactis and Lactococcus lactis subsp. cremoris were the dominant taxons in all tested samples. Second most abundant species, detected in all bryndza cheeses, were Lactococcus fujiensis and Lactococcus taiwanensis, independently by two different approaches, using different reference 16S rRNA genes databases (Greengenes and NCBI respectively. They have been detected in bryndza cheese samples in substantial amount for the first time. The narrowest microbial diversity was observed in a sample made with a starter culture from pasteurised milk. Metagenomic analysis by high-throughput sequencing using 16S rRNA genes seems to be a powerful tool for studying the structure of the microbial population in cheeses.

  4. Identification of novel spp. of rice and wheat endophytic diazotrophs by 16S rDNA gene and FTIR analysis

    Directory of Open Access Journals (Sweden)

    Mohammad Javad Mehdipour Moghaddam


    Full Text Available In this research, six isolates, including three from three rice roots (PxR1, PxR2 and StR1 and three from three wheat roots (PxW1, PxW2 and PxW3 were isolated as endophytic bacteria and except for StR1, all the isolates were identified as Pseudoxanthomonas based on phenotypic analysis including FTIR and PCR amplification of 16S rDNA. The results showed that PxR1, PxR2, PxW1 and PxW2 were all similar and belonged to a novel species of Pseudoxanthomonas, but PxW3 was from different species. StR1 belonged to a novel species of Stenotrophomonas. Two strains including Azospirillum brasiliense Sp7 (S1 and Azospirillum lipoferum (S2 were selected as standard strains and compared with those isolates however, phenotypic and genotypic analysis verified that those isolates were not Azospirillum. For the first time, it was indicated that Pseudoxanthomonas existed as an endophytic bacterium in rice root.

  5. Broadband Focal Plane Wavefront Control of Amplitude and Phase Aberrations

    CERN Document Server

    Groff, Tyler D; Carlotti, Alexis; Riggs, A J Eldorado


    The Stroke Minimization algorithm developed at the Princeton High Contrast Imaging Laboratory has proven symmetric dark hole generation using minimal stroke on two deformable mirrors (DM) in series. The windowed approach to Stroke Minimization has proven symmetric dark holes over small bandwidths by using three wavelengths to define the bandwidth of correction in the optimization problem. We address the relationship of amplitude and phase aberrations with wavelength, how this changes with multiple DMs, and the implications for simultaneously correcting both to achieve symmetric dark holes. Operating Stroke Minimization in the windowed configuration requires multiple wavelength estimates. To save on exposures, a single estimate is extrapolated to bounding wavelengths using the established relationship in wavelength to produce multiple estimates of the image plane electric field. Here we demonstrate better performance by improving this extrapolation of the estimate to other wavelengths. The accuracy of the func...

  6. Propagation of Aberrations through Phase Induced Amplitude Apodization coronagraph

    CERN Document Server

    Pueyo, Laurent; Shaklan, Stuart; 10.1364/JOSAA.28.000189


    The specification of polishing requirements for the optics in coronagraphs dedicated to exo-planet detection requires careful and accurate optical modelling. Numerical representations of the propagation of aberrations through the system as well as simulations of the broadband wavefront compensation system using multiple DMs are critical when one devises an error budget for such a class of instruments. In this communication we introduce an analytical tool that serves this purpose for Phase Induced Amplitude Apodisation (PIAA) coronagraphs. We first start by deriving the analytical form of the propagation of a harmonic ripple through a PIAA unit. Using this result we derive the chromaticity of the field at any plane in the optical train of a telescope equipped with such a coronagraph. Finally we study the chromatic response of a sequential DM wavefront actuator correcting such a corrugated field and thus quantify the requirements on the manufacturing of PIAA mirrors

  7. Biological dosimetry of ionizing radiation by chromosomal aberration analysis

    International Nuclear Information System (INIS)

    Biological dosimetry consists of estimating absorbed doses for people exposed to radiation by mean biological methods. Several indicators used are based in haematological, biochemical, and cytogenetic data, although nowadays without doubt, the cytogenetic method is considered to be the most reliable. In this case, the study ol chromosomal aberrations, normally dicentric chromosomes, in peripheral lymphocytes can be related to absorbed dose through an experimental calibration curve. An experimental dose-response curve, using dicentric chromosomes analysis, X-rays at 300 kVp, 114 rad/min and temperature 37 degree celsius has been produced. Experimental data is fitted to model Y =α + β1D + β2D 2 , where Y is the number of dicentrics per cell and D the dose. The curve is compared with those produced elsewhere. (Author) 14 refs

  8. Cytogenetic effects of radiotherapy. Breakpoint distribution in induced chromosome aberrations

    International Nuclear Information System (INIS)

    A total of 660 breakpoints were identified in the chromosome aberrations detected in lymphocytes from cancer patients after radiotherapy. The results show that chromosomes 1, 3, and 7 were significantly more affected than other chromosomes by ionizing radiation in vivo. Chromosome arms 1p, 1q, 7q, and 11p were also significantly more affected. Some bands also showed a special sensitivity to radiation, and band 1q32 was the most affected. This band is proposed as a hot point for the clastogenic effect of ionizing radiation. A significant clustering of breakpoints in G bands was also found, especially at the telomeres, as previously described by other authors. Clustering of breakpoints was also observed in bands where fragile sites, protooncogenes, breakpoints involved in chromosomal cancer rearrangements, and breakpoints involved in chromosomal evolution of the Hominoidea are located

  9. Chromosomal aberrations and SCEs as biomarkers of cancer risk

    DEFF Research Database (Denmark)

    Norppa, H; Bonassi, S; Hansteen, I-L; Hagmar, L; Strömberg, U; Rössner, P; Boffetta, P; Lindholm, C; Gundy, S; Lazutka, J; Cebulska-Wasilewska, A; Fabiánová, E; Srám, R J; Knudsen, Lisbeth E.; Barale, R; Fucic, A

    Previous studies have suggested that the frequency of chromosomal aberrations (CAs), but not of sister chromatid exchanges (SCEs), predicts cancer risk. We have further examined this relationship in European cohorts comprising altogether almost 22,000 subjects, in the framework of a European...... collaborative project (CancerRiskBiomarkers). The present paper gives an overview of some of the results of the project, especially as regards CAs and SCEs. The results confirm that a high level of CAs is associated with an increased risk of cancer and indicate that this association does not depend on the time...... between CA analysis and cancer detection, i.e., is obviously not explained by undetected cancer. The present evidence indicates that both chromatid-type and chromosome-type CAs predict cancer, even though some data suggest that chromosome-type CAs may have a more pronounced predictive value than chromatid...

  10. Aberrantly methylated DNA as a biomarker in breast cancer

    DEFF Research Database (Denmark)

    Kristiansen, Søren; Jørgensen, Lars Mønster; Guldberg, Per;


    hypermethylation events, their use as tumor biomarkers is usually not hampered by analytical signals from normal cells, which is a general problem for existing protein tumor markers used for clinical assessment of breast cancer. There is accumulating evidence that DNA-methylation changes in breast cancer patients......Aberrant DNA hypermethylation at gene promoters is a frequent event in human breast cancer. Recent genome-wide studies have identified hundreds of genes that exhibit differential methylation between breast cancer cells and normal breast tissue. Due to the tumor-specific nature of DNA...... occur early during tumorigenesis. This may open up for effective screening, and analysis of blood or nipple aspirate may later help in diagnosing breast cancer. As a more detailed molecular characterization of different types of breast cancer becomes available, the ability to divide patients into...

  11. Sphere-cone-polynomial special window with good aberration characteristic

    International Nuclear Information System (INIS)

    Optical windows with external surfaces shaped to satisfy operational environment needs are known as special windows. A novel special window, a sphere-cone-polynomial (SCP) window, is proposed. The formulas of this window shape are given. An SCP MgF2 window with a fineness ratio of 1.33 is designed as an example. The field-of-regard (FOR) angle is ±75°. From the window system simulation results obtained with the calculated fluid dynamics (CFD) and optical design software, we find that compared to the conventional window forms, the SCP shape can not only introduce relatively less drag in the airflow, but also have the minimal effect on imaging. So the SCP window optical system can achieve a high image quality across a super wide FOR without adding extra aberration correctors. The tolerance analysis results show that the optical performance can be maintained with a reasonable fabricating tolerance to manufacturing errors

  12. Synaptic signaling and aberrant RNA splicing in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Ryan M Smith


    Full Text Available Interactions between presynaptic and postsynaptic cellular adhesion molecules drive synapse maturation during development. These trans-synaptic interactions are regulated by alternative splicing of cellular adhesion molecule RNAs, which ultimately determines neurotransmitter phenotype. The diverse assortment of RNAs produced by alternative splicing generates countless protein isoforms necessary for guiding specialized cell-to-cell connectivity. Failure to generate the appropriate synaptic adhesion proteins is associated with disrupted glutamatergic and gamma-aminobutyric acid signaling, resulting in loss of activity-dependent neuronal plasticity, and risk for developmental disorders, including autism. While the majority of genetic mutations currently linked to autism are rare variants that change the protein coding sequence of synaptic candidate genes, regulatory polymorphisms affecting constitutive and alternative splicing have emerged as risk factors in numerous other diseases, accounting for an estimated 40-60% of general disease risk. Here, we review the relationship between aberrant RNA splicing of synapse-related genes and autism spectrum disorders.

  13. Analysis of a low-aberration holographic scanner. (United States)

    Shiozawa, T; Iwaoka, H


    Low-aberration holographic scanners that eliminate the need tor lenses or mirrors promise to greatly reduce the cost of laser printers and image scanners. This paper describes how the spot profile of such a scanner can be predicted using the Fresnel-Kirchhoff diffraction integral, and the diffraction efficiency of the scanner can be predicted using Kogelnik's coupled-wave theory. Experimental results verity the accuracy of these design methods. For a prototype scanner used in a high-resolution He-Ne laser printer, the measured linearity error was under +/- 100 microm, and the spot size (half-intensity beamwidth) was under 60 microm for a span (scan width) of 280 mm. PMID:20531695

  14. Clinicopathological significance of aberrant Notch receptors in intrahepatic cholangiocarcinoma (United States)

    Wu, Wen-Rui; Shi, Xiang-De; Zhang, Rui; Zhu, Man-Sheng; Xu, Lei-Bo; Yu, Xian-Huan; Zeng, Hong; Wang, Jie; Liu, Chao


    Notch signaling has been reported to be activated to promote biliary epithelial cell differentiation and tubulogenesis during bile duct development. In this study, clinicopathological significance of aberrant expression of Notch receptors in intrahepatic cholangiocarcinoma (ICC) was investigated. Thus, forty-one ICC specimens were examined by immunohistochemistry using anti-Notch1-4 antibodies, respectively. Expression of Notch receptors was scored by percentage of positive tumor cells and intensity of immunostaining. Clinicopathological parameters and survival data were compared with the expression of Notch receptors, respectively. Expression of Notch receptors was identified in cancer cells, as well as in non-neoplastic cells. Compared with adjacent non-tumor liver tissues, Notch1 and 4 were up regulated, and Notch2 and 3 were relatively weaker. Positive immunostaining of Notch1 in ICC cells was detected in 34 cases (82.9%), Notch2 in 23 (56.1%), Notch3 in 16 (39.0%) and Notch4 in 14 (34.1%). Notch1 was overexpressed in cases with tumor size > 5 cm (P = 0.036). Expression of Notch2 was correlated inversely with histological grade (P = 0.016). Overexpression of Notch4 was more common in cases with serum CA125 > 35 U/ml than cases with CA125 ≤ 35 U/ml (P = 0.048). Expression of Notch3 was not correlated with any other clinicopathological parameters. Moreover, Notch4 was related to poor survival (P < 0.001). To conclude, this study reveals that aberrant expression of Notch receptors 1 and 4 might play important roles during ICC progression. PMID:25031748

  15. Aberrant meiotic behavior in Agave tequilana Weber var. azul

    Directory of Open Access Journals (Sweden)

    Rodríguez-Garay Benjamin


    Full Text Available Abstract Background Agave tequilana Weber var. azul, is the only one variety permitted by federal law in México to be used for tequila production which is the most popular contemporary alcoholic beverage made from agave and recognized worldwide. Despite the economic, genetic, and ornamental value of the plant, it has not been subjected to detailed cytogenetic research, which could lead to a better understanding of its reproduction for future genetic improvement. The objective of this work was to study the meiotic behavior in pollen mother cells and its implications on the pollen viability in Agave tequilana Weber var. azul. Results The analysis of Pollen Mother Cells in anaphase I (A-I showed 82.56% of cells with a normal anaphase and, 17.44% with an irregular anaphase. In which 5.28% corresponded to cells with side arm bridges (SAB; 3.68% cells with one bridge and one fragment; 2.58% of irregular anaphase showed cells with one or two lagging chromosomes and 2.95% showed one acentric fragment; cells with two bridges and cells with two bridges and one acentric fragment were observed in frequencies of 1.60% and 1.35% respectively. In anaphase II some cells showed bridges and fragments too. Aberrant A-I cells had many shrunken or empty pollen grains (42.00% and 58.00 % viable pollen. Conclusion The observed meiotic irregularities suggest that structural chromosome aberrations have occurred, such as heterozygous inversions, sister chromatid exchanges, deletions and duplications which in turn are reflected in a low pollen viability.

  16. Aberrant laryngeal location of Onchocerca lupi in a dog. (United States)

    Alho, Ana Margarida; Cruz, Luís; Coelho, Ana; Martinho, Filipe; Mansinho, Mário; Annoscia, Giada; Lia, Riccardo P; Giannelli, Alessio; Otranto, Domenico; de Carvalho, Luís Madeira


    Onchocerca lupi (Spirurida, Onchocercidae) is an emerging vector-borne helminth that causes nodular lesions associated with acute or chronic ocular disease in dogs and cats. Since its first description in dogs in 1991, this zoonotic filarioid has been increasingly reported in Europe and the United States. An 8-year-old outdoor mixed-breed female dog from the Algarve (southern Portugal) was presented with a history of severe dyspnoea. Cervical and thoracic radiographs revealed a slight reduction in the diameter of the cervical trachea and a moderate increase in radiopacity of the laryngeal soft tissue. An exploratory laryngoscopy was performed, revealing filiform worms associated with stenosis of the thyroid cartilage and a purulent necrotic tissue in the larynx lumen. A single sessile nodule, protruding from the dorsal wall of the laryngeal lumen caused a severe reduction of the glottis and tracheal diameter. Fragments of the worms were morphologically and molecularly identified as O. lupi. Histological examination of the nodule showed a granulomatous reaction with sections of coiled gravid female nematodes. Following laryngoscopy, a tracheostomy tube was inserted to relieve dyspnoea and ivermectin (300μg/kg, once a week, for 8weeks) combined with prednisolone was prescribed. The dog showed a complete recovery. Although O. lupi has been isolated in human patients from the spinal cord, this is the first report of an aberrant migration of O. lupi in a dog. The veterinary medical community should pay attention to aberrant location of O. lupi and consider onchocercosis as a differential diagnosis for airway obstruction in dogs. PMID:26732654

  17. Anti-topoisomerase drugs as potent inducers of chromosomal aberrations

    Directory of Open Access Journals (Sweden)

    Loredana Bassi


    Full Text Available DNA topoisomerases catalyze topological changes in DNA that are essential for normal cell cycle progression and therefore they are a preferential target for the development of anticancer drugs. Anti-topoisomerase drugs can be divided into two main classes: "cleavable complex" poisons and catalytic inhibitors. The "cleavable complex" poisons are very effective as anticancer drugs but are also potent inducers of chromosome aberrations so they can cause secondary malignancies. Catalytic inhibitors are cytotoxic but they do not induce chromosome aberrations. Knowledge about the mechanism of action of topoisomerase inhibitors is important to determine the best anti-topoisomerase combinations, with a reduced risk of induction of secondary malignancies.As topoisomerases de DNA catalisam alterações topológicas no DNA que são essenciais para a progressão do ciclo celular normal e, portanto, são um alvo preferencial para o desenvolvimento de drogas anticâncer. Drogas anti-topoisomerases podem ser divididas em duas classes principais: drogas anti-"complexos cliváveis" e inibidores catalíticos. As drogas anti-"complexos cliváveis" são muito eficazes como drogas anticancerígenas, mas são também potentes indutores de aberrações cromossômicas, podendo causar neoplasias malignas secundárias. Inibidores catalíticos são citotóxicos mas não induzem aberrações cromossômicas. Conhecimento a respeito do mecanismo de ação de inibidores de topoisomerases é importante para determinar as melhores combinações anti-topoisomerases, com um reduzido risco de indução de neoplasias malignas secundárias.

  18. Genomic aberrations frequently alter chromatin regulatory genes in chordoma. (United States)

    Wang, Lu; Zehir, Ahmet; Nafa, Khedoudja; Zhou, Nengyi; Berger, Michael F; Casanova, Jacklyn; Sadowska, Justyna; Lu, Chao; Allis, C David; Gounder, Mrinal; Chandhanayingyong, Chandhanarat; Ladanyi, Marc; Boland, Patrick J; Hameed, Meera


    Chordoma is a rare primary bone neoplasm that is resistant to standard chemotherapies. Despite aggressive surgical management, local recurrence and metastasis is not uncommon. To identify the specific genetic aberrations that play key roles in chordoma pathogenesis, we utilized a genome-wide high-resolution SNP-array and next generation sequencing (NGS)-based molecular profiling platform to study 24 patient samples with typical histopathologic features of chordoma. Matching normal tissues were available for 16 samples. SNP-array analysis revealed nonrandom copy number losses across the genome, frequently involving 3, 9p, 1p, 14, 10, and 13. In contrast, copy number gain is uncommon in chordomas. Two minimum deleted regions were observed on 3p within a ∼8 Mb segment at 3p21.1-p21.31, which overlaps SETD2, BAP1 and PBRM1. The minimum deleted region on 9p was mapped to CDKN2A locus at 9p21.3, and homozygous deletion of CDKN2A was detected in 5/22 chordomas (∼23%). NGS-based molecular profiling demonstrated an extremely low level of mutation rate in chordomas, with an average of 0.5 mutations per sample for the 16 cases with matched normal. When the mutated genes were grouped based on molecular functions, many of the mutation events (∼40%) were found in chromatin regulatory genes. The combined copy number and mutation profiling revealed that SETD2 is the single gene affected most frequently in chordomas, either by deletion or by mutations. Our study demonstrated that chordoma belongs to the C-class (copy number changes) tumors whose oncogenic signature is non-random multiple copy number losses across the genome and genomic aberrations frequently alter chromatin regulatory genes. © 2016 Wiley Periodicals, Inc. PMID:27072194

  19. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura


    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  20. Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis. (United States)

    Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo


    The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples. PMID:15183874

  1. 16S rDNA sequence analysis of bacterial isolates from biodeteriorated mural paintings in the Servilia tomb (Necropolis of carmona, Seville, Spain). (United States)

    Heyrman, J; Swings, J


    Bacteria were isolated from damaged mural paintings of the Servilia tomb (necropolis of Carmona, Seville, Spain). Selected strains, representative for different clusters of isolates with similar fatty acid profiles, were analysed by 16S rDNA sequence analysis. Bacillus is the dominant genus among the isolates: members of the rRNA species complexes of B. megaterium, B. pumilus and B. firmus were found as well as several other Bacillus species. One group of halotolerant isolates falls in the Bacillus sensu lato group, with closest relatedness to the genera Salibacillus and Virgibacillus. Other genera found are Artbrobacter, Micrococcus, Streptomyces, Sphingomonas, Paenibacillus, and a genus closely related to Paracraurococcus. Many isolates showed low 16S rDNA sequence similarities with the closest related database entries, a strong indication for the presence of several new species among the isolates. PMID:11822679

  2. Mitogenic response of near-diploid mouse cell line m5S/1M induced by epidermal growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Watanabe, S.; Umeda, M.; Nomura, T.; Kobayashi, T.; Nakano, T.; Arita, H.; Utsumi, H.; Sasaki, M.S.; Inoue, K. (Shionogi Co., Ltd., Osaka (Japan))


    A nonmalignant near-diploid cell line m5s/1M, established by Sasaki and Kodama, was shown to respond to the epidermal growth factor (EGF). The m5s/1M cells showed high sensitivity to post-confluence inhibition of cell division and formed a uniform monolayer after the cells had become confluent. The addition of EGF resulted in loss of contact-dependent inhibition of growth and caused a massive piling up of a multilayered array of cells after they had become confluent. When EGF was removed from the medium, the cell number decreased rapidly, and the cells formed a uniform monolayer at the density observed in the absence of EGF. m5S/1M cells have high- and low-affinity receptors for EGF (approximately 40,000 receptors per cell), and the apparent dissociation constants of the EGF-binding reactions were 3.3 nM and 0.15 nM, respectively. The effect of EGF on the intracellular mobilization of Ca2+ and the formation of inositol phosphates was studied by using the calcium-sensitive fluorescent indicator fura 2 and (3H)inositol. EGF had no effect either on the mobilization of cytosolic free calcium (( Ca2+)i) or on the formation of inositol phosphates in m5s/1M cells, whereas bradykinin induced a rapid increase in both (Ca2+)i and inositol phosphates. Analysis of the glycosphingolipid (GSL) composition of m5S/1M cells showed that globotriaosylceramide (Gb3Cer), which is known to be a Burkitt lymphoma-associated antigen, is specifically expressed in the EGF-treated cells. The expression of Gb3Cer is dependent on the presence of EGF, with a reversible shift in GSL composition being observed in the presence or absence of EGF.

  3. Unexpected accumulation of ncm(5U and ncm(5S(2 (U in a trm9 mutant suggests an additional step in the synthesis of mcm(5U and mcm(5S(2U.

    Directory of Open Access Journals (Sweden)

    Changchun Chen

    Full Text Available BACKGROUND: Transfer RNAs are synthesized as a primary transcript that is processed to produce a mature tRNA. As part of the maturation process, a subset of the nucleosides are modified. Modifications in the anticodon region often modulate the decoding ability of the tRNA. At position 34, the majority of yeast cytosolic tRNA species that have a uridine are modified to 5-carbamoylmethyluridine (ncm(5U, 5-carbamoylmethyl-2'-O-methyluridine (ncm(5Um, 5-methoxycarbonylmethyl-uridine (mcm(5U or 5-methoxycarbonylmethyl-2-thiouridine (mcm(5s(2U. The formation of mcm(5 and ncm(5 side chains involves a complex pathway, where the last step in formation of mcm(5 is a methyl esterification of cm(5 dependent on the Trm9 and Trm112 proteins. METHODOLOGY AND PRINCIPAL FINDINGS: Both Trm9 and Trm112 are required for the last step in formation of mcm(5 side chains at wobble uridines. By co-expressing a histidine-tagged Trm9p together with a native Trm112p in E. coli, these two proteins purified as a complex. The presence of Trm112p dramatically improves the methyltransferase activity of Trm9p in vitro. Single tRNA species that normally contain mcm(5U or mcm(5s(2U nucleosides were isolated from trm9Δ or trm112Δ mutants and the presence of modified nucleosides was analyzed by HPLC. In both mutants, mcm(5U and mcm(5s(2U nucleosides are absent in tRNAs and the major intermediates accumulating were ncm(5U and ncm(5s(2U, not the expected cm(5U and cm(5s(2U. CONCLUSIONS: Trm9p and Trm112p function together at the final step in formation of mcm(5U in tRNA by using the intermediate cm(5U as a substrate. In tRNA isolated from trm9Δ and trm112Δ strains, ncm(5U and ncm(5s(2U nucleosides accumulate, questioning the order of nucleoside intermediate formation of the mcm(5 side chain. We propose two alternative explanations for this observation. One is that the intermediate cm(5U is generated from ncm(5U by a yet unknown mechanism and the other is that cm(5U is formed

  4. Molecular Confirmation that Fasciola gigantica Can Undertake Aberrant Migrations in Human Hosts▿


    Le, Thanh Hoa; Van, Nguyen; Agatsuma, Takeshi; Blair, David; Vercruysse, Jozef; Dorny, Pierre; Nguyen, Thanh Giang Thi; McManus, Donald P.


    Two cases of aberrant migration by the liver fluke Fasciola gigantica in humans are reported. In both cases, subadult worms emerged through the skin. The identity of the worms was confirmed from their DNA sequences. This uncommon human pathogen might be more likely than F. hepatica to undertake aberrant migrations in humans.

  5. Antipain-mediated suppression of X-ray-induced chromosomal aberrations in human lymphocytes

    International Nuclear Information System (INIS)

    The protease inhibitor antipain is known to modulate the number of chromosomal aberrations induced by the S-phase-dependent alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine. Experiments have now been carried out to see if antipain might also affect the yield of aberrations induced by X-rays, which are S-independent and thus produce chromosomal aberrations by a different mechanism. The results show that human lymphocytes exposed to 0.4 or 1.5 Gy of X-rays at 48 h of culture and fixed at 3, 6, 8, 10 or 12 h thereafter contain 27-52% fewer chromatid breaks if the cells are also treated with antipain before irradiation. Because previous studies postulated that antipain could affect the induction of of chromosomal aberrations by suppressing free radical reactions within cells, we also tested whether antipain affects X-ray-induced aberrations when present only during the time of irradiation, as is the case for free radical scavengers, such as L-cysteine. The results indicate that, in contrast to L-cysteine, antipain can suppress the induction of X-ray-induced aberrations even when administered as late as 2 h after irradiation, suggesting that the effects of antipain on aberrations are not attributable to its interference with short-lived radicals within the cells. These data indicate that the formation of chromosome aberrations by S-independent agents can involve an antipain-sensitive process. (author)

  6. Chromosomal Aberrations Associated with Clonal Evolution and Leukemic Transformation in Fanconi Anemia: Clinical and Biological Implications


    Stefan Meyer; Heidemarie Neitzel; Holger Tönnies


    Fanconi anaemia (FA) is an inherited disease with congenital and developmental abnormalities, bone marrow failure, and extreme risk of leukemic transformation. Bone marrow surveillance is an important part of the clinical management of FA and often reveals cytogenetic aberrations. Here, we review bone marrow findings in FA and discuss the clinical and biological implications of chromosomal aberrations associated with leukemic transformation.

  7. Criteria for admissible values of smooth aberrations for nondiffractive laser beams

    Energy Technology Data Exchange (ETDEWEB)

    Malashko, Ya I; Khabibulin, V M [JSC ' Concern PVO ' Almaz-Antey' , Moscow (Russian Federation)


    We have derived analytical expressions, verified by the methods of numerical simulation, to evaluate the angular divergence of nondiffractive laser beams containing smooth aberrations, i.e., spherical defocusing, astigmatism and toroid. Using these expressions we have formulated the criteria for admissible values of smooth aberrations. (laser applications and other topics in quantum electronics)

  8. Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana


    Ji, X.


    Numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana. I studied numerical and structural chromosome aberrations in cauliflower (Brassica oleracea var. botrytis) and Arabidopsis thaliana. The large genomic changes are important for gene balance control, gene expression and regulation, and may affect the plant’s phenotype. Moreover, chromosome changes, in particular polyploidy, inversions and translocations play a signif...

  9. Aberrant ovarian artery arising from the common Iliac artery: Case report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Won Kyung [Dept. of Radiology, Soonchunhyang University Bucheon Hospital, Soonchunhyang University College of Medicine, Bucheon (Korea, Republic of); Yang, Seung Boo; Lee, Jae Myeong [Dept. of Radiology, Soonchunhyang University Gumi Hospital, Soonchunhyang University College of Medicine, Gumi (Korea, Republic of); Goo, Dong Erk; Kim, Yong Jae; Chang, Yun Woo [Dept. of Radiology, Soonchunhyang University Seoul Hospital, Soonchunhyang University College of Medicine, Seoul (Korea, Republic of)


    A 46-year-old Vietnamese woman received embolization therapy in order to control postpartum hemorrhage. Angiography revealed an aberrant ovarian artery arising from the right common iliac artery. Superselective catheterization and subsequent embolization of the aberrant ovarian artery and bilateral uterine arteries were performed. Precise knowledge of the anatomic variations of the ovarian artery is important for successful embolization.

  10. Neospora caninum in bovine fetuses of Minas Gerais, Brazil: genetic characteristics of rDNA Neospora caninum em fetos bovinos de Minas Gerais, Brasil: características genéticas do rDNA

    Directory of Open Access Journals (Sweden)

    Domingos Sávio dos Santos


    Full Text Available Neosporosis is an important cause of abortion in cattle and information on their genetics and host parasite relationships are desirable. Neospora caninum samples obtained from 24 bovine fetuses from Minas Gerais, were genetically analyzed in part of the rDNA region, coding for rRNAs. Previously, brain, heart, liver, skeletal muscle, lung, kidney, spleen, thymus, lymph nodes, ovary or testis, uterus and skin of the ear were analyzed by conventional histopathology and immunohistochemistry. Of these, eight had lesions compatible in the brain and heart and two also in skeletal muscle and liver. Three brains showed antigen identification in immunohistochemistry. Brain and heart tissues were subjected to DNA extraction for PCR, whose product of 588 bp of ITS-1 region was sequenced in three samples. We obtained 96% similarity with dozens of sequences N. caninum deposited in GenBank. The phylogenetic tree showed great conservation among isolates of N. caninum in this study and those deposited in GenBank, while well-defined and specific branches were generated against other Apicomplexa. PCR for this region is useful as a diagnosis, with good analytical specificity, but the ITS-1 region is not suitable for genetic differentiation intra species because the sequences obtained were identical to the others analyzed.A neosporose é uma importante causa de abortos em bovinos, e informações sobre sua genética e relação parasito-hospedeiro são desejáveis. Amostras de Neospora caninum, obtidas de 24 conceptos bovinos oriundos de Minas Gerais, foram analisadas geneticamente em parte da região rDNA, codificadora de rRNAs. Previamente, cérebro, coração, fígado, músculo esquelético, pulmão, rim, baço, timo, linfonodos, ovário ou testículo, útero e pele da orelha foram analisados por histopatologia convencional e imuno-histoquímica. Dessas, oito apresentaram lesões compatíveis no encéfalo e coração e dois também no músculo esquelético e f

  11. Molecular identification of Dunaliella viridis Teod. strain MSV-1 utilizing rDNA ITS sequences and its growth responses to salinity and copper toxicity


    Ali Moradshahi; Hajar Zamani; Mansour Kharati-KoupaeI


    In addition to biochemical, physiological and morphological analysis, molecular studies provide additional information for establishing phylogenetic relationships among different species and strains of the genus Dunaliella. In the present study, based on neighbor- joining analysis of the nuclear rDNA ITS sequence, a novel strain of the green algae Dunaliella viridis was identified from Maharlu salt lake in Shiraz, Iran. The phylogenetic tree shows that the new strain is part of a clade contai...

  12. Preliminary phylogeny of the thrips parasitoids of Turkey based on some morphological scales and 28S D2 rDNA, with description of a new species


    DOĞANLAR, Oğuzhan; Doğanlar, Mikdat; Frary, Anne


    Species of the Ceranisus thrips-attacking genus are difficult to distinguish morphologically. The phylogenetic relationships within the Ceranisus species were explored using nucleotide sequences of the 28S D2 expansion region of the rDNA gene. Bayesian, maximum likelihood, and parsimony inference methods were employed to construct the phylogenetic relationships. Principal component analysis on the Turkish species of Ceranisus, namely antalyacus, menes, bozovaensis, hirsutus, planitianus (a ne...

  13. Systematics and DNA barcoding of free-living marine nematodes with emphasis on tropical desmodorids using nuclear SSU rDNA and mitochondrial COI sequences


    Armenteros, M.; Rojas-Corzo, A; Ruiz-Abierno, A.; Derycke, S.; Backeljau, T.; Decraemer, W.


    The diversity and phylogenetic relationships of the Desmodoridae, a widespread tropical family of free-living marine nematodes, is hitherto poorly known both from molecular and taxonomic points of view. We performed a molecular phylogenetic analysis of marine nematodes to: i) disentangle relationships among tropical desmodorid species; and ii) compare the performance of the nuclear SSU rDNA and mitochondrial COI nucleotide sequences in 42 and 45 nominal species, respectively, to identify spec...

  14. Inferring a classification of the Adenophorea (Nematoda) from nucleotide sequences of the D3 expansion segment (26/28s rDNA)


    Litvaitis, M.K.; Bates, J.W.; Hope, W. D.; Moens, T.


    Nucleotide sequences of the D3 expansion segment of the 28S rDNA gene were used to reconstruct evolutionary relationships within the Adenophorea. Neighbor-joining and parsimony analyses of representatives of most major taxa revealed a paraphyletic Adenophorea (p = 0.0005). Within Adenophorea, the Enoplia, Enoplida, and Enoplina were paraphyletic (p = 0.0024, 0.0014, and 0.0120, respectively). A major division was evident within the Enoplida, with one lineage consisting of a basal Thoracostomo...

  15. Wild Termitomyces Species Collected from Ondo and Ekiti States Are More Related to African Species as Revealed by ITS Region of rDNA


    Victor Olusegun Oyetayo


    Molecular identification of eighteen Termitomyces species collected from two states, Ondo and Ekiti in Nigeria was carried out using the internal transcribed spacer (ITS) region. The amplicons obtained from rDNA of Termitomyces species were compared with existing sequences in the NCBI GenBank. The results of the ITS sequence analysis discriminated between all the Termitomyces species (obtained from Ondo and Ekiti States) and Termitomyces sp. sequences obtained from NCBI GenBank. The degree of...

  16. Inhibition of DNA methylation alters chromatin organization, nuclear positioning and activity of 45S rDNA loci in cycling cells of Q. robur. (United States)

    Bočkor, Vedrana Vičić; Barišić, Darko; Horvat, Tomislav; Maglica, Željka; Vojta, Aleksandar; Zoldoš, Vlatka


    Around 2200 copies of genes encoding ribosomal RNA (rRNA) in pedunculate oak, Quercus robur, are organized into two rDNA loci, the major (NOR-1) and the minor (NOR-2) locus. We present the first cytogenetic evidence indicating that the NOR-1 represents the active nucleolar organizer responsible for rRNA synthesis, while the NOR-2 probably stays transcriptionally silent and does not participate in the formation of the nucleolus in Q. robur, which is a situation resembling the well-known phenomenon of nucleolar dominance. rDNA chromatin topology analyses in cycling root tip cells by light and electron microscopy revealed the minor locus to be highly condensed and located away from the nucleolus, while the major locus was consistently associated with the nucleolus and often exhibited different levels of condensation. In addition, silver precipitation was confined exclusively to the NOR-1 locus. Also, NOR-2 was highly methylated at cytosines and rDNA chromatin was marked with histone modifications characteristic for repressive state. After treatment of the root cells with the methylation inhibitor 5-aza-2'-deoxycytidine, we observed an increase in the total level of rRNA transcripts and a decrease in DNA methylation level at the NOR-2 locus. Also, NOR-2 sites relocalized with respect to the nuclear periphery/nucleolus, however, the relocation did not affect the contribution of this locus to nucleolar formation, nor did it affect rDNA chromatin decondensation, strongly suggesting that NOR-2 has lost the function of rRNA synthesis and nucleolar organization. PMID:25093501

  17. Effects of residual aberrations explored on single-walled carbon nanotubes

    International Nuclear Information System (INIS)

    The effects of geometric residual aberrations such as coma B2 and two-fold astigmatism A1 on the contrast in aberration corrected high resolution transmission electron microscopy (HRTEM) images are investigated on single-walled carbon nanotubes (SWNT). The individual aberrations are adjusted and set up manually using an imaging CS-corrector. We demonstrate how coma B2 can be recognized by an experienced user directly in the image and how it blurs the contrast. Even with uncorrected (resolution limiting) spherical aberration CS the coma B2 has to be considered and must be minimized. Limits for a tolerable coma are given. The experiments are confirmed by image simulations. -- Highlights: ► Individual effects of residual aberrations such as B2, A1, and CS are demonstrated. ► Experimental HRTEM and simulated images of carbon nanotubes are compared. ► A detection limit of 50 nm B2 in a single HRTEM image is determined.

  18. Non-linear character of dose dependences of chromosome aberration frequency in radiation-damaged root

    International Nuclear Information System (INIS)

    The dose dependences of the aberrant anaphases in the root meristem in 48 hours after the irradiation have non-linear character and a plateau in the region about 6-8 Gy. The plateau indicates the activation of recovery processes. In the plateau range, the level of damages for this genotype is 33% for aberrant anaphases (FAA), 2.3 aberrations per aberrant anaphase (A/AC), and 0.74 aberrations for the total number of anaphases. At 10 Gy, the dose curve forms the exponential region caused by the involvement of the large number of new cells with unrepaired damages in the mutation process. The increase of A/AC to 1.1 indicate the ''criticality'' of the meristem radiation damage.

  19. Correlation between Post-LASIK Starburst Symptom and Ocular Wavefront Aberrations

    Institute of Scientific and Technical Information of China (English)

    LIU Yong-Ji; MU Guo-Guang; WANG Zhao-Qi; WANG Yan


    Monochromatic aberrations in post laser in-situ keratomileusis (LASIK) eyes are measured. The data are categorized into reference group and starburst group according to the visual symptoms. Statistic analysis has been made to find the correJation between the ocular wavefront aberrations and the starburst symptom. The rms aberrations of the 3rd and 4th orders for the starburst group are significantly larger than those for the reference group. The starburst symptom shows a strong correlation with vertical coma, total coma, spherical aberrations. For 3-mm pupil size and 5.8-mm pupil size, the modulation transfer function (MTF) of the starburst group are lower than those of the reference group, but their visual acuities are close. MTF and PSF analyses are made for two groups, and the results are consistent with the statistical analysis, which means the difference between the two groups is mainly due to the third- and fourth-order Zernike aberrations.

  20. Influence of wave-front aberrations on bit error rate in inter-satellite laser communications (United States)

    Yang, Yuqiang; Han, Qiqi; Tan, Liying; Ma, Jing; Yu, Siyuan; Yan, Zhibin; Yu, Jianjie; Zhao, Sheng


    We derive the bit error rate (BER) of inter-satellite laser communication (lasercom) links with on-off-keying systems in the presence of both wave-front aberrations and pointing error, but without considering the noise of the detector. Wave-front aberrations induced by receiver terminal have no influence on the BER, while wave-front aberrations induced by transmitter terminal will increase the BER. The BER depends on the area S which is truncated out by the threshold intensity of the detector (such as APD) on the intensity function in the receiver plane, and changes with root mean square (RMS) of wave-front aberrations. Numerical results show that the BER rises with the increasing of RMS value. The influences of Astigmatism, Coma, Curvature and Spherical aberration on the BER are compared. This work can benefit the design of lasercom system.