WorldWideScience

Sample records for aberrant 5s rdna

  1. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Science.gov (United States)

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    Science.gov (United States)

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S rDNA

  3. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Science.gov (United States)

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  4. The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

    Science.gov (United States)

    Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

    2015-12-03

    The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

  5. Uncovering the molecular organization of unusual highly scattered 5S rDNA: The case of Chariesterus armatus (Heteroptera).

    Science.gov (United States)

    Bardella, Vanessa Bellini; Cabral-de-Mello, Diogo Cavalcanti

    2018-03-10

    One cluster of 5S rDNA per haploid genome is the most common pattern among Heteroptera. However, in Chariesterus armatus, highly scattered signals were noticed. We isolated and characterized the entire 5S rDNA unit of C. armatus aiming to a deeper knowledge of molecular organization of the 5S rDNA among Heteroptera and to understand possible causes and consequences of 5S rDNA chromosomal spreading. For a comparative analysis, we performed the same approach in Holymenia histrio with 5S rDNA restricted to one bivalent. Multiple 5S rDNA variants were observed in both species, though they were more variable in C. armatus, with some of variants corresponding to pseudogenes. These pseudogenes suggest birth-and-death mechanism, though homogenization was also observed (concerted evolution), indicating evolution through mixed model. Association between transposable elements and 5S rDNA was not observed, suggesting spreading of 5S rDNA through other mechanisms, like ectopic recombination. Scattered organization is a rare example for 5S rDNA, and such organization in C. armatus genome could have led to the high diversification of sequences favoring their pseudogenization. Copyright © 2017. Published by Elsevier B.V.

  6. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Science.gov (United States)

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  7. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    Science.gov (United States)

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  8. A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).

    Science.gov (United States)

    Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao

    2017-01-01

    In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.

  9. Discrimination of Shark species by simple PCR of 5S rDNA repeats

    OpenAIRE

    Pinhal, Danillo [UNESP; Gadig, Otto Bismarck Fazzano [UNESP; Wasko, Adriane Pinto [UNESP; Oliveira, Claudio [UNESP; Ron, Ernesto; Foresti, Fausto [UNESP; Martins, Cesar [UNESP

    2008-01-01

    Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat u...

  10. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish.

    Science.gov (United States)

    Glugoski, Larissa; Giuliano-Caetano, Lucia; Moreira-Filho, Orlando; Vicari, Marcelo R; Nogaroto, Viviane

    2018-04-15

    Co-located 5S rDNA genes and interstitial telomeric sites (ITS) revealed the involvement of multiple 5S rDNA clusters in chromosome rearrangements of Loricariidae. Interstitial (TTAGGG)n vestiges, in addition to telomeric sites, can coincide with locations of chromosomal rearrangements, and they are considered to be hotspots for chromosome breaks. This study aimed the molecular characterization of 5S rDNA in two Rineloricaria latirostris populations and examination of roles of 5S rDNA in breakpoint sites and its in situ localization. Rineloricaria latirostris from Brazil's Das Pedras river (2n = 46 chromosomes) presented five pairs identified using a 5S rDNA probe, in addition to a pair bearing a co-located ITS/5S rDNA. Rineloricaria latirostris from the Piumhi river (2n = 48 chromosomes) revealed two pairs containing 5S rDNA, without ITS. A 702-bp amplified sequence, using 5S rDNA primers, revealed an insertion of the hAT transposable element (TE), referred to as a degenerate 5S rDNA. Double-FISH (fluorescence in situ hybridization) demonstrated co-localization of 5S rDNA/degenerate 5S rDNA, 5S rDNA/hAT and ITS/5S rDNA from the Das Pedras river population. Piumhi river isolates possessed only 5S rDNA sites. We suggest that the degenerate 5S rDNA was generated by unequal crossing over, which was driven by invasion of hAT, establishing a breakpoint region susceptible to chromosome breakage, non-homologous recombination and Robertsonian (Rb) fusion. Furthermore, the presence of clusters of 5S rDNA at fusion points in other armored catfish species suggests its re-use and that these regions represent hotspots for evolutionary rearrangements within Loricariidae genomes. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.

    Science.gov (United States)

    Roa, Fernando; Guerra, Marcelo

    2015-01-01

    5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.

  12. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Science.gov (United States)

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  13. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    Science.gov (United States)

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  14. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    Science.gov (United States)

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. © 2014 S. Karger AG, Basel.

  15. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    Science.gov (United States)

    He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  16. Heterochromatin diversity and its co-localization with 5S and 45S rDNA sites in chromosomes of four Maxillaria species (Orchidaceae

    Directory of Open Access Journals (Sweden)

    Juliano S. Cabral

    2006-01-01

    Full Text Available We investigated four orchids of the genus Maxillaria (M. discolor, M. acicularis, M. notylioglossa and M. desvauxiana in regard to the position of heterochromatin blocks as revealed using chromomycin A3 (CMA and 4'-6-diamidino-2-phenylindole (DAPI fluorochrome staining and 5S and 45S rDNA sites using fluorescence in situ hybridization (FISH. The species showed differences in chromosome number and a diversified pattern of CMA+ and DAPI+ bands, including heteromorphism for CMA+ bands. The 5S and 45S rDNA sites also varied in number and most of them were co-localized with CMA+ bands. The relationship between 5S rDNA sites and CMA+ bands was more evident in M. notylioglossa, in which the brighter CMA+ bands were associated with large 5S rDNA sites. However, not all 5S and 45S rDNA sites were co-localized with CMA+ bands, probably due to technical constraints. We compare these results to banding data from other species and suggest that not all blocks of tandemly repetitive sequences, such as 5S rDNA sites, can be observed as heterochromatin blocks.

  17. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    Science.gov (United States)

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

  18. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    Science.gov (United States)

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  19. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    Science.gov (United States)

    2011-01-01

    Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815

  1. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    Science.gov (United States)

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  2. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    Science.gov (United States)

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  3. Evolutionary Dynamics of 5S rDNA and Recurrent Association of Transposable Elements in Electric Fish of the Family Gymnotidae (Gymnotiformes): The Case of Gymnotus mamiraua.

    Science.gov (United States)

    da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana

    2016-01-01

    Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.

  4. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.).

    Science.gov (United States)

    Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš

    2017-05-18

    Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation

  5. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Science.gov (United States)

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  6. Organization and variation analysis of 5S rDNA in gynogenetic offspring of Carassius auratus red var. (♀) × Megalobrama amblycephala (♂).

    Science.gov (United States)

    Qin, QinBo; Wang, Juan; Wang, YuDe; Liu, Yun; Liu, ShaoJun

    2015-03-13

    The offspring with 100 chromosomes (abbreviated as GRCC) have been obtained in the first generation of Carassius auratus red var. (abbreviated as RCC, 2n = 100) (♀) × Megalobrama amblycephala (abbreviated as BSB, 2n = 48) (♂), in which the females and unexpected males both are found. Chromosomal and karyotypic analysis has been reported in GRCC which gynogenesis origin has been suggested, but lack genetic evidence. Fluorescence in situ hybridization with species-specific centromere probes directly proves that GRCC possess two sets of RCC-derived chromosomes. Sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (abbreviated as NTS) reveals that three types of 5S rDNA class (class I; class II and class III) in GRCC are completely inherited from their female parent (RCC), and show obvious base variations and insertions-deletions. Fluorescence in situ hybridization with the entire 5S rDNA probe reveals obvious chromosomal loci (class I and class II) variation in GRCC. This paper provides directly genetic evidence that GRCC is gynogenesis origin. In addition, our result is also reveals that distant hybridization inducing gynogenesis can lead to sequence and partial chromosomal loci of 5S rDNA gene obvious variation.

  7. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

    Science.gov (United States)

    Cruz, V P; Oliveira, C; Foresti, F

    2015-01-01

    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.

  8. Evidence for 5S rDNA horizontal transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families.

    Science.gov (United States)

    Merlo, Manuel A; Cross, Ismael; Palazón, José L; Ubeda-Manzanaro, María; Sarasquete, Carmen; Rebordinos, Laureana

    2012-10-07

    The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes and Clupeiformes orders. Two

  9. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801 based on the analysis of three multigene families

    Directory of Open Access Journals (Sweden)

    Merlo Manuel A

    2012-10-01

    Full Text Available Abstract Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH. Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not

  10. Heterochromatin diversity and its co-localization with 5S and 45S rDNA sites in chromosomes of four Maxillaria species (Orchidaceae)

    OpenAIRE

    Cabral, Juliano S.; Felix, Leonardo P.; Guerra, Marcelo

    2006-01-01

    We investigated four orchids of the genus Maxillaria (M. discolor, M. acicularis, M. notylioglossa and M. desvauxiana) in regard to the position of heterochromatin blocks as revealed using chromomycin A3 (CMA) and 4'-6-diamidino-2-phenylindole (DAPI) fluorochrome staining and 5S and 45S rDNA sites using fluorescence in situ hybridization (FISH). The species showed differences in chromosome number and a diversified pattern of CMA+ and DAPI+ bands, including heteromorphism for CMA+ bands. The 5...

  11. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Science.gov (United States)

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  12. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

    Science.gov (United States)

    Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  13. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae: Evolutionary Tendencies in the Genus

    Directory of Open Access Journals (Sweden)

    Vanessa Bueno

    2014-01-01

    Full Text Available Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  14. Karyotypes and fish detection of 5s and 45s rdna loci in chinese medicinal plant atractylodes lancea subsp. luotianensis: cytological evidence for the new taxonomic unit

    International Nuclear Information System (INIS)

    Duan, Y.S.; Zhu, B.; Li, Z.Y.

    2015-01-01

    Atractylodes lancea (Thunb.) DC. in the Asteraceae family produces the atractylodes rhizome which is widely used as a traditional medicine in China. The subspecies A. lancea (Thunb.) DC subsp. Luotianensis distributed in mountainous Luotian and Yingshan regions in Hubei Province presented distinct morphology and superior medicinal quality. This study firstly reported the chromosome karyotype of this subspecies and the detection of 5S and 45S rDNA loci by fluorescent in situ hybridization. The karyotype was 2n=24=12m+12sm (2SAT). A single locus of 5S rDNA and two loci of 45S rDNA loci were identified and separated on different chromosomes. Its one pair of the satellited chromosomes rather than two pairs in other Atractylodes species yet still with 2n=24 occurred likely after its occupation of this geographic location. The evidence of karyotype differentiation of this subspecies native to the area is useful for elucidating the genome structure and identifying chromosomes. (author)

  15. The formation of diploid and triploid hybrids of female grass carp × male blunt snout bream and their 5S rDNA analysis.

    Science.gov (United States)

    He, Weiguo; Xie, Lihua; Li, Tangluo; Liu, Shaojun; Xiao, Jun; Hu, Jie; Wang, Jing; Qin, Qinbo; Liu, Yun

    2013-11-23

    Hybridization is a useful strategy to alter the genotypes and phenotypes of the offspring. It could transfer the genome of one species to another through combing the different genome of parents in the hybrid offspring. And the offspring may exhibit advantages in growth rate, disease resistance, survival rate and appearance, which resulting from the combination of the beneficial traits from both parents. Diploid and triploid hybrids of female grass carp (Ctenopharyngodon idellus, GC, Cyprininae, 2n = 48) × male blunt snout bream (Megalobrama amblycephala, BSB, Cultrinae, 2n = 48) were successfully obtained by distant hybridization. Diploid hybrids had 48 chromosomes, with one set from GC and one set from BSB. Triploid hybrids possessed 72 chromosomes, with two sets from GC and one set from BSB.The morphological traits, growth rates, and feeding ecology of the parents and hybrid offspring were compared and analyzed. The two kinds of hybrid offspring exhibited significantly phenotypic divergence from GC and BSB. 2nGB hybrids showed similar growth rate compared to that of GC, and 3nGB hybrids significantly higher results. Furthermore, the feeding ecology of hybrid progeny was omnivorous.The 5S rDNA of GC, BSB and their hybrid offspring were also cloned and sequenced. There was only one type of 5S rDNA (designated type I: 180 bp) in GC and one type of 5S rDNA (designated type II: 188 bp) in BSB. However, in the hybrid progeny, diploid and triploid hybrids both inherited type I and type II from their parents, respectively. In addition, a chimera of type I and type II was observed in the genome of diploid and triploid hybrids, excepting a 10 bp of polyA insertion in type II sequence of the chimera of the diploid hybrids. This is the first report of diploid and triploid hybrids being produced by crossing GC and BSB, which have the same chromosome number. The obtainment of two new hybrid offspring has significance in fish genetic breeding. The results illustrate the effect

  16. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).

    Science.gov (United States)

    Mahelka, Václav; Kopecky, David; Baum, Bernard R

    2013-09-01

    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass.

  17. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Novel genomes and genome constitutions identified by GISH and 5S rDNA and knotted1 genomic sequences in the genus Setaria.

    Science.gov (United States)

    Zhao, Meicheng; Zhi, Hui; Doust, Andrew N; Li, Wei; Wang, Yongfang; Li, Haiquan; Jia, Guanqing; Wang, Yongqiang; Zhang, Ning; Diao, Xianmin

    2013-04-11

    The Setaria genus is increasingly of interest to researchers, as its two species, S. viridis and S. italica, are being developed as models for understanding C4 photosynthesis and plant functional genomics. The genome constitution of Setaria species has been studied in the diploid species S. viridis, S. adhaerans and S. grisebachii, where three genomes A, B and C were identified respectively. Two allotetraploid species, S. verticillata and S. faberi, were found to have AABB genomes, and one autotetraploid species, S. queenslandica, with an AAAA genome, has also been identified. The genomes and genome constitutions of most other species remain unknown, even though it was thought there are approximately 125 species in the genus distributed world-wide. GISH was performed to detect the genome constitutions of Eurasia species of S. glauca, S. plicata, and S. arenaria, with the known A, B and C genomes as probes. No or very poor hybridization signal was detected indicating that their genomes are different from those already described. GISH was also performed reciprocally between S. glauca, S. plicata, and S. arenaria genomes, but no hybridization signals between each other were found. The two sets of chromosomes of S. lachnea both hybridized strong signals with only the known C genome of S. grisebachii. Chromosomes of Qing 9, an accession formerly considered as S. viridis, hybridized strong signal only to B genome of S. adherans. Phylogenetic trees constructed with 5S rDNA and knotted1 markers, clearly classify the samples in this study into six clusters, matching the GISH results, and suggesting that the F genome of S. arenaria is basal in the genus. Three novel genomes in the Setaria genus were identified and designated as genome D (S. glauca), E (S. plicata) and F (S. arenaria) respectively. The genome constitution of tetraploid S. lachnea is putatively CCC'C'. Qing 9 is a B genome species indigenous to China and is hypothesized to be a newly identified species. The

  19. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Panero, J.L.; Široký, Jiří; Kovařík, Aleš

    2010-01-01

    Roč. 10, č. 176 (2010), s. 1-18 ISSN 1471-2229 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : organization of rDNA unit * intergenic spacer * Asteraceae Subject RIV: BO - Biophysics Impact factor: 4.085, year: 2010

  20. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.)

    Czech Academy of Sciences Publication Activity Database

    Symonová, R.; Ocalewicz, K.; Kirtiklis, L.; Delmastro, G. B.; Pelikánová, Šárka; Garcia, S.; Kovařík, Aleš

    2017-01-01

    Roč. 18, č. 391 (2017), č. článku 391. ISSN 1471-2164 R&D Projects: GA ČR GA14-02940S; GA ČR GBP501/12/G090 Institutional support: RVO:67985904 ; RVO:68081707 Keywords : rDNA * evolution * chromosome Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 3.729, year: 2016

  1. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Directory of Open Access Journals (Sweden)

    Garcia Sònia

    2012-06-01

    Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.

  2. Novel Bacteriocinogenic Lactobacillus plantarum Strains and Their Differentiation by Sequence Analysis of 16S rDNA, 16S-23S and 23S-5S Intergenic Spacer Regions and Randomly Amplified Polymorphic DNA Analysis

    Directory of Open Access Journals (Sweden)

    Morteza Shojaei Moghadam

    2010-01-01

    Full Text Available Six strains of bacteriocinogenic Lactobacillus plantarum (TL1, RG11, RS5, UL4, RG14 and RI11 isolated from Malaysian foods were investigated for their structural bacteriocin genes. A new combination of plantaricin EF and plantaricin W bacteriocin structural genes was successfully amplified from all studied strains, suggesting that they were novel bacteriocin-producing L. plantarum strains. A four-base pair variable region was detected in the short 16S-23S intergenic spacer regions of the studied strains by a comparative analysis with 17 L. plantarum strains deposited in the GenBank, implying they were new genotypes. The studied L. plantarum strains were subsequently differentiated into four groups on the basis of the detected four-base pair variable region of the short 16S-23S intergenic spacer region. Further analysis of the DNA sequence of 23S-5S intergenic spacer region revealed only one type of 23S-5S intergenic spacer region present in the studied strains, indicating it was highly conserved among the studied L. plantarum strains. Three randomly amplified polymorphic DNA experiments using three different combinations of arbitrary primers successfully differentiated the studied L. plantarum strains from each other, confirming they were different strains. In conclusion, the studied L. plantarum strains were shown to be novel bacteriocin producers and high level of strain discrimination could be achieved with a combination of randomly amplified polymorphic DNA analysis and the analysis of the variable region of short 16S-23S intergenic spacer region present in L. plantarum strains.

  3. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  4. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Science.gov (United States)

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  5. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  6. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    Directory of Open Access Journals (Sweden)

    Daniël O. Warmerdam

    2016-03-01

    Full Text Available rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5 as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability.

  7. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    OpenAIRE

    Warmerdam, Daniël O.; van den Berg, Jeroen; Medema, René H.

    2016-01-01

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of b...

  8. Mapping of rDNA on the chromosomes of Eleusine species by fluorescence in situ hybridization.

    Science.gov (United States)

    Bisht, M S; Mukai, Y

    2000-12-01

    Mapping of rDNA sites on the chromosomes of four diploid and two tetraploid species of Eleusine has provided valuable information on genome relationship between the species. Presence of 18S-5.8S-26S rDNA on the largest pair of the chromosomes, location of 5S rDNA at four sites on two pairs of chromosomes and presence of 18S-5.8S-26S and 5S rDNA at same location on one pair of chromosomes have clearly differentiated E. multiflora from rest of the species of Eleusine. The two tetraploid species, E. coracana and E. africana have the same number of 18S-5.8S-26S and 5S rDNA sites and located at similar position on the chromosomes. Diploid species, E. indica, E. floccifolia and E. tristachya have the same 18S-5.8S-26S sites and location on the chromosomes which also resembled with the two pairs of 18S-5.8S-26S rDNA locations in tetraploid species, E. coracana and E. africana. The 5S rDNA sites on chromosomes of E. indica and E. floccifolia were also comparable to the 5S rDNA sites of E. africana and E. coracana. The similarity of the rDNA sites and their location on chromosomes in the three diploid and two polyploid species also supports the view that genome donors to tetraploid species may be from these diploid species.

  9. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  10. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Science.gov (United States)

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  11. Chromosomal aberration

    International Nuclear Information System (INIS)

    Ishii, Yutaka

    1988-01-01

    Chromosomal aberrations are classified into two types, chromosome-type and chromatid-type. Chromosom-type aberrations include terminal deletion, dicentric, ring and interstitial deletion, and chromatid-type aberrations include achromatic lesion, chromatid deletion, isochromatid deletion and chromatid exchange. Clastogens which induce chromosomal aberration are divided into ''S-dependent'' agents and ''S-independent''. It might mean whether they can induce double strand breaks independent of the S phase or not. Double strand breaks may be the ultimate lesions to induce chromosomal aberrations. Caffeine added even in the G 2 phase appeared to modify the frequency of chromatid aberrations induced by X-rays and mitomycin C. Those might suggest that the G 2 phase involves in the chromatid aberration formation. The double strand breaks might be repaired by ''G 2 repair system'', the error of which might yield breakage types of chromatid aberrations and the by-pass of which might yield chromatid exchanges. Chromosome-type aberrations might be formed in the G 1 phase. (author)

  12. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    Science.gov (United States)

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  13. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  14. Cytogenetic features of rRNA genes across land plants: analysis of the Plant rDNA database

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Kovařík, Aleš; Leitch, A. R.; Garnatje, T.

    2017-01-01

    Roč. 89, č. 5 (2017), s. 1020-1030 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GC16-02149J Institutional support: RVO:68081707 Keywords : in-situ hybridization * 5s rdna * 45s rdna * concerted evolution Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 5.901, year: 2016

  15. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats.

    Science.gov (United States)

    Warmerdam, Daniël O; van den Berg, Jeroen; Medema, René H

    2016-03-22

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5) as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Mapping of the 18S and 5S ribosomal RNA genes in Astyanax altiparanae Garutti & Britski, 2000 (Teleostei, Characidae from the upper Paraná river basin, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Alexandre Fernandes

    2006-01-01

    Full Text Available Fluorescence in situ hybridization (FISH was undertaken in order to determinate the chromosomal distribution pattern of 18S and 5S ribosomal DNAs (rDNA in four populations of the characid fish Astyanax altiparanae from the upper Paraná river basin, Brazil. The 18S rDNA probe FISH revealed numerical and positional variations among specimens from the Keçaba stream compared to specimens of the other populations studied. In contrast to the variable 18S rDNA distribution pattern, highly stable chromosomal positioning of the 5S rDNA sites was observed in the four A. altiparanae populations. Divergence in the distribution pattern of 18S and 5S rDNA sites is also discussed.

  17. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  18. 5S IN QUALITY MANAGEMENT

    Directory of Open Access Journals (Sweden)

    BOCA GRATIELA DANA

    2015-07-01

    Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.

  19. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA

    Czech Academy of Sciences Publication Activity Database

    Kumke, K.; Macas, Jiří; Fuchs, J.; Altschmied, L.; Kour, J.; Dhar, M.K.; Houben, A.

    2016-01-01

    Roč. 148, č. 1 (2016), s. 68-73 ISSN 1424-8581 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Polymorhpic A chromosome segment * Satellite repeat * Supernumerary chromosome * 5S rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

  20. Optical Aberrations and Wavefront

    Directory of Open Access Journals (Sweden)

    Nihat Polat

    2014-08-01

    Full Text Available The deviation of light to create normal retinal image in the optical system is called aberration. Aberrations are divided two subgroup: low-order aberrations (defocus: spherical and cylindrical refractive errors and high-order aberrations (coma, spherical, trefoil, tetrafoil, quadrifoil, pentafoil, secondary astigmatism. Aberrations increase with aging. Spherical aberrations are compensated by positive corneal and negative lenticular spherical aberrations in youth. Total aberrations are elevated by positive corneal and positive lenticular spherical aberrations in elderly. In this study, we aimed to analyze the basic terms regarding optic aberrations which have gained significance recently. (Turk J Ophthalmol 2014; 44: 306-11

  1. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  2. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  3. ADN ribosomique 5S chez Arabidopsis thaliana : dynamique chromatinienne et ARN polymérase IV

    OpenAIRE

    Douet , Julien

    2008-01-01

    In Arabidopsis thaliana, 5S rRNA genes are found clustered at pericentromeric heterochromatin of chromosomes 3, 4 and 5. 5S rRNA genes transcription is epigenetically regulated through the formation of specific chromatin structure. In order to determine the events that lead to the establishment of such structures, a study during the first steps of post-germinative plant development was done. Unexpectedly, we observed a decondensation followed by a rapid "re"condensation of 5S rDNA chromatin. ...

  4. Heterochromatin and rDNA sites distribution in the holocentric chromosomes of Cuscuta approximata Bab. (Convolvulaceae).

    Science.gov (United States)

    Guerra, Marcelo; García, Miguel A

    2004-02-01

    Cuscuta is a widely distributed genus of holoparasitic plants. Holocentric chromosomes have been reported only in species of one of its subgenera (Cuscuta subg. Cuscuta). In this work, a representative of this subgenus, Cuscuta approximata, was investigated looking for its mitotic and meiotic chromosome behaviour and the heterochromatin distribution. The mitotic chromosomes showed neither primary constriction nor Rabl orientation whereas the meiotic ones exhibited the typical quadripartite structure characteristic of holocentrics, supporting the assumption of holocentric chromosomes as a synapomorphy of Cuscuta subg. Cuscuta. Chromosomes and interphase nuclei displayed many heterochromatic blocks that stained deeply with hematoxylin, 4',6-diamidino-2-phenylindole (DAPI), or after C banding. The banded karyotype showed terminal or subterminal bands in all chromosomes and central bands in some of them. The single pair of 45S rDNA sites was observed at the end of the largest chromosome pair, close to a DAPI band and a 5S rDNA site. Two other 5S rDNA site pairs were found, both closely associated with DAPI bands. The noteworthy giant nuclei of glandular cells of petals and ovary wall exhibited large chromocentres typical of polytenic nuclei. The chromosomal location of heterochromatin and rDNA sites and the structure of the endoreplicated nuclei of C. approximata seemed to be similar to those known in monocentric nuclei, suggesting that centromeric organization has little or no effect on chromatin organization.

  5. Variations in 5S rDNAs in diploid and tetraploid offspring of red crucian carp × common carp.

    Science.gov (United States)

    Ye, Lihai; Zhang, Chun; Tang, Xiaojun; Chen, Yiyi; Liu, Shaojun

    2017-08-08

    The allotetraploid hybrid fish (4nAT) that was created in a previous study through an intergeneric cross between red crucian carp (Carassius auratus red var., ♀) and common carp (Cyprinus carpio L., ♂) provided an excellent platform to investigate the effect of hybridization and polyploidization on the evolution of 5S rDNA. The 5S rDNAs of paternal common carp were made up of a coding sequence (CDS) and a non-transcribed spacer (NTS) unit, and while the 5S rDNAs of maternal red crucian carp contained a CDS and a NTS unit, they also contained a variable number of interposed regions (IPRs). The CDSs of the 5S rDNAs in both parental fishes were conserved, while their NTS units seemed to have been subjected to rapid evolution. The diploid hybrid 2nF 1 inherited all the types of 5S rDNAs in both progenitors and there were no signs of homeologous recombination in the 5S rDNAs of 2nF 1 by sequencing of PCR products. We obtained two segments of 5S rDNA with a total length of 16,457 bp from allotetraploid offspring 4nAT through bacterial artificial chromosome (BAC) sequencing. Using this sequence together with the 5S rDNA sequences amplified from the genomic DNA of 4nAT, we deduced that the 5S rDNAs of 4nAT might be inherited from the maternal progenitor red crucian carp. Additionally, the IPRs in the 5S rDNAs of 4nAT contained A-repeats and TA-repeats, which was not the case for the IPRs in the 5S rDNAs of 2nF 1 . We also detected two signals of a 200-bp fragment of 5S rDNA in the chromosomes of parental progenitors and hybrid progenies by fluorescence in situ hybridization (FISH). We deduced that during the evolution of 5S rDNAs in different ploidy hybrid fishes, interlocus gene conversion events and tandem repeat insertion events might occurred in the process of polyploidization. This study provided new insights into the relationship among the evolution of 5S rDNAs, hybridization and polyploidization, which were significant in clarifying the genome evolution of

  6. Karyotype and chromosomal characteristics of Ag-NOR sites and 5S rDNA in European smelt, Osmerus eperlanus

    Czech Academy of Sciences Publication Activity Database

    Ocalewicz, K.; Hliwa, P.; Krol, J.; Rábová, Marie; Stabinski, R.; Ráb, Petr

    2007-01-01

    Roč. 131, - (2007), s. 29-35 ISSN 0016-6707 R&D Projects: GA AV ČR IAA6045405; GA MŠk LC06073 Institutional research plan: CEZ:AV0Z50450515 Keywords : chromosome banding * cytotaxonomy of smelt * fish cytogenetics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.396, year: 2007

  7. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  8. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Directory of Open Access Journals (Sweden)

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  9. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    Science.gov (United States)

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  10. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    Science.gov (United States)

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair.

  11. 5S-menetelmän implementointi

    OpenAIRE

    Kaikula, Kari-Marko

    2017-01-01

    Tässä opinnäytetyössä tavoiteltiin siisteyden ja järjestyksen tuomista 5S-menetelmän avulla Helen Oy:n kunnossapidon varaosavarastoon Salmisaaren voimalaitoksella. Helen Oy on Helsingin kaupungin omistama energia-alan yritys. Kehittämistehtävänä työssä oli 5S-menetelmän implementointi. Tutkimuksen tarkoituksena oli tutkia niitä seikkoja, jotka vaikuttavat 5S-menetelmän käyttöönottoon. 5S on menetelmä, jolla tuodaan siisteyttä ja järjestystä työympäristöön. Tutkimusmenetelmänä oli toiminta...

  12. Evolution of rDNA in Nicotiana Allopolyploids: A Potential Link between rDNA Homogenization and Epigenetics

    Science.gov (United States)

    Kovarik, Ales; Dadejova, Martina; Lim, Yoong K.; Chase, Mark W.; Clarkson, James J.; Knapp, Sandra; Leitch, Andrew R.

    2008-01-01

    Background The evolution and biology of rDNA have interested biologists for many years, in part, because of two intriguing processes: (1) nucleolar dominance and (2) sequence homogenization. We review patterns of evolution in rDNA in the angiosperm genus Nicotiana to determine consequences of allopolyploidy on these processes. Scope Allopolyploid species of Nicotiana are ideal for studying rDNA evolution because phylogenetic reconstruction of DNA sequences has revealed patterns of species divergence and their parents. From these studies we also know that polyploids formed over widely different timeframes (thousands to millions of years), enabling comparative and temporal studies of rDNA structure, activity and chromosomal distribution. In addition studies on synthetic polyploids enable the consequences of de novo polyploidy on rDNA activity to be determined. Conclusions We propose that rDNA epigenetic expression patterns established even in F1 hybrids have a material influence on the likely patterns of divergence of rDNA. It is the active rDNA units that are vulnerable to homogenization, which probably acts to reduce mutational load across the active array. Those rDNA units that are epigenetically silenced may be less vulnerable to sequence homogenization. Selection cannot act on these silenced genes, and they are likely to accumulate mutations and eventually be eliminated from the genome. It is likely that whole silenced arrays will be deleted in polyploids of 1 million years of age and older. PMID:18310159

  13. 5S-menetelmän pilotointi

    OpenAIRE

    Lampela, Saara

    2017-01-01

    Tämän opinnäytetyön tavoitteena oli siisteys- ja järjestystason parantaminen 5S-menetelmän avulla UPM Kaukaan paperitehtaalla. 5S on tuottavuuden parantamiseen keskittyvä lean-työkalu, jonka päätehtäväksi paperitehtaalla määritettiin erityisesti seisokkitilanteissa työvälineiden ja tavaroiden etsimiseen käytetyn ajan vähentäminen sekä työn yleinen jouhevoituminen. 5S-menetelmän nimi tulee japanin kielen sanoista Seiri, Seiton, Seiso, Seiketsu ja Shitsuke. Suomeksi vaiheet ovat lajittelu, järj...

  14. The 5s25p2 - (5s25p5d + 5s5p3 + 5s25p6s + 5s25p7s) transitions in Sb II and 5s25p - (5s5p2 + 5s2nl) transitions in Sb III

    International Nuclear Information System (INIS)

    Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.

    1989-01-01

    The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig

  15. Generalized oscillator strengths for 5s, 5s', and 5p excitations of krypton

    International Nuclear Information System (INIS)

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-01-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s ' , 5p [5/2] 3,2 , 5p [3/2] 1,2 , and 5p [1/2] 0 transitions of krypton have been determined in a large K 2 region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s ' transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s ' transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)

  16. Extrachromosomal circles of satellite repeats and 5S ribosomal DNA in human cells

    Directory of Open Access Journals (Sweden)

    Cohen Sarit

    2010-03-01

    Full Text Available Abstract Background Extrachomosomal circular DNA (eccDNA is ubiquitous in eukaryotic organisms and was detected in every organism tested, including in humans. A two-dimensional gel electrophoresis facilitates the detection of eccDNA in preparations of genomic DNA. Using this technique we have previously demonstrated that most of eccDNA consists of exact multiples of chromosomal tandemly repeated DNA, including both coding genes and satellite DNA. Results Here we report the occurrence of eccDNA in every tested human cell line. It has heterogeneous mass ranging from less than 2 kb to over 20 kb. We describe eccDNA homologous to human alpha satellite and the SstI mega satellite. Moreover, we show, for the first time, circular multimers of the human 5S ribosomal DNA (rDNA, similar to previous findings in Drosophila and plants. We further demonstrate structures that correspond to intermediates of rolling circle replication, which emerge from the circular multimers of 5S rDNA and SstI satellite. Conclusions These findings, and previous reports, support the general notion that every chromosomal tandem repeat is prone to generate eccDNA in eukryoric organisms including humans. They suggest the possible involvement of eccDNA in the length variability observed in arrays of tandem repeats. The implications of eccDNA on genome biology may include mechanisms of centromere evolution, concerted evolution and homogenization of tandem repeats and genomic plasticity.

  17. Regulation of rDNA stability by sumoylation

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2009-01-01

    Repair of DNA lesions by homologous recombination relies on the copying of genetic information from an intact homologous sequence. However, many eukaryotic genomes contain repetitive sequences such as the ribosomal gene locus (rDNA), which poses a risk for illegitimate recombination. Therefore, t......6 complex and sumoylation of Rad52, which directs DNA double-strand breaks in the rDNA to relocalize from within the nucleolus to the nucleoplasm before association with the recombination machinery. The relocalization before repair is important for maintaining rDNA stability. The focus...

  18. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  19. Implementacija metode 5S v proces proizvodnje

    Directory of Open Access Journals (Sweden)

    Alojz Gorše

    2016-03-01

    Full Text Available Abstract: Research Question (RQ: The following research tries to show how the introduction of 5S methodology of work affects the production process itself, where the greatest changes are shown and how they are reflected in performance indicators. Purpose: The purpose of this project is to examine the existing methods and their application in practice as well as show the logic of actions we introduce in a particular process by using the 5S method. We will try to compare all the information using a practical example of company X. The results obtained are the basis for further improvements in an analyzed company. Method: We expect positive results in terms of certain improvements in the working environment within the company, as well as the opportunity for improvement in terms of increased efficiency and, consequently, more profit. Results: The results can represent the basis for achieving eve n better work in other processes in the studied company. It is very important to identify all the key activities that are important in generating profits while all the rest are eliminated from the process. Organization: The 5S model is applicable to all levels of the organization so it can be experienced by the highest levels of management in running a business. Society: The impact of the model will surely be seen by employees as they are offered a model after which they will work well, quickly, safely and without loss of time, which in today's world means competitive advantage. Originality: The research work represents an important contribution to the implementation of the 5S model in the company and to the positive things it brings. Limitations/Future Research: The survey as a case study was done in only one organization, in which they were implemented all phases of the method. In the direction of further research it is reasonable to make a quantitative analysis of the increase in profit, increase employee satisfaction analysis, to determine the reduction

  20. Mutations and chromosomal aberrations

    International Nuclear Information System (INIS)

    Kihlman, B.A.

    1977-01-01

    The genetic changes of mutations and chromosomal aberrations are discussed. The consequences of both depend not only on the type of genetic change produced but also on the type of cell that is affected and on the development stage of the organism. (C.F.)

  1. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  2. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    Science.gov (United States)

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  3. Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).

    Science.gov (United States)

    Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata

    2015-08-01

    Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

  4. Aberrant hepatic artery

    International Nuclear Information System (INIS)

    Konstam, M.A.; Novelline, R.A.; Athanasoulis, C.A.

    1979-01-01

    In a patient undergoing selective hepatic arteriography for suspected liver trauma, a nonopacified area of the liver, initially thought to represent a hepatic hematoma, was later discovered to be due to the presence of an accessory right hepatic artery arising from the superior mesenteric artery. This case illustrates the need for a search for aberrant vasculature whenever a liver hematoma is suspected on the basis of a selective hepatic arteriogram. (orig.) [de

  5. Optical traps with geometric aberrations

    International Nuclear Information System (INIS)

    Roichman, Yael; Waldron, Alex; Gardel, Emily; Grier, David G.

    2006-01-01

    We assess the influence of geometric aberrations on the in-plane performance of optical traps by studying the dynamics of trapped colloidal spheres in deliberately distorted holographic optical tweezers. The lateral stiffness of the traps turns out to be insensitive to moderate amounts of coma, astigmatism, and spherical aberration. Moreover holographic aberration correction enables us to compensate inherent shortcomings in the optical train, thereby adaptively improving its performance. We also demonstrate the effects of geometric aberrations on the intensity profiles of optical vortices, whose readily measured deformations suggest a method for rapidly estimating and correcting geometric aberrations in holographic trapping systems

  6. Trichostrongylus colubriformis rDNA polymorphism associated with arrested development

    Czech Academy of Sciences Publication Activity Database

    Langrová, I.; Zouhar, M.; Vadlejch, J.; Borovský, M.; Jankovská, I.; Lytvynets, Andrej

    2008-01-01

    Roč. 103, č. 2 (2008), s. 401-403 ISSN 0932-0113 Institutional research plan: CEZ:AV0Z50110509 Keywords : arrested development * polymorphism * rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.473, year: 2008

  7. Third release of the plant rDNA database with updated content and information on telomere composition and sequenced plant genomes

    Czech Academy of Sciences Publication Activity Database

    Vitales, D.; D'Ambrosio, U.; Galvez, F.; Kovařík, Aleš; Garcia, S.

    2017-01-01

    Roč. 303, č. 8 (2017), s. 1115-1121 ISSN 0378-2697 R&D Projects: GA ČR(CZ) GC16-02149J Institutional support: RVO:68081707 Keywords : in-situ hybridization * ribosomal-rna genes * 5s rdna Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 1.239, year: 2016

  8. The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

    OpenAIRE

    1986-01-01

    We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

  9. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    Science.gov (United States)

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  10. Evolution of rDNA in Nicotiana allopolyploids: A potential link between rDNa homogenization and epigenetics

    Czech Academy of Sciences Publication Activity Database

    Kovařík, Aleš; Nešpor Dadejová, Martina; Lim, Y.K.; Chase, M.W.; Clarkson, J.J.; Knapp, S.; Leitch, A.R.

    2008-01-01

    Roč. 101, č. 6 (2008), s. 815-823 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA521/07/0116 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : rDNA * allopolyploidy * evolution-Nicotiana Subject RIV: BO - Biophysics Impact factor: 2.755, year: 2008

  11. Aberration studies and computer algebra

    International Nuclear Information System (INIS)

    Hawkes, P.W.

    1981-01-01

    The labour of calculating expressions for aberration coefficients is considerably lightened if a computer algebra language is used to perform the various substitutions and expansions involved. After a brief discussion of matrix representations of aberration coefficients, a particular language, which has shown itself to be well adapted to particle optics, is described and applied to the study of high frequency cavity lenses. (orig.)

  12. Camera processing with chromatic aberration.

    Science.gov (United States)

    Korneliussen, Jan Tore; Hirakawa, Keigo

    2014-10-01

    Since the refractive index of materials commonly used for lens depends on the wavelengths of light, practical camera optics fail to converge light to a single point on an image plane. Known as chromatic aberration, this phenomenon distorts image details by introducing magnification error, defocus blur, and color fringes. Though achromatic and apochromatic lens designs reduce chromatic aberration to a degree, they are complex and expensive and they do not offer a perfect correction. In this paper, we propose a new postcapture processing scheme designed to overcome these problems computationally. Specifically, the proposed solution is comprised of chromatic aberration-tolerant demosaicking algorithm and post-demosaicking chromatic aberration correction. Experiments with simulated and real sensor data verify that the chromatic aberration is effectively corrected.

  13. In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes

    International Nuclear Information System (INIS)

    Schubert, I.; Baeumlein, H.; Wobus, U.

    1978-01-01

    In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)

  14. Making safety an integral part of 5S in healthcare.

    Science.gov (United States)

    Ikuma, Laura H; Nahmens, Isabelina

    2014-01-01

    Healthcare faces major challenges with provider safety and rising costs, and many organizations are using Lean to instigate change. One Lean tool, 5S, is becoming popular for improving efficiency of physical work environments, and it can also improve safety. This paper demonstrates that safety is an integral part of 5S by examining five specific 5S events in acute care facilities. We provide two arguments for how safety is linked to 5S:1. Safety is affected by 5S events, regardless of whether safety is a specific goal and 2. Safety can and should permeate all five S's as part of a comprehensive plan for system improvement. Reports of 5S events from five departments in one health system were used to evaluate how changes made at each step of the 5S impacted safety. Safety was affected positively in each step of the 5S through initial safety goals and side effects of other changes. The case studies show that 5S can be a mechanism for improving safety. Practitioners may reap additional safety benefits by incorporating safety into 5S events through a safety analysis before the 5S, safety goals and considerations during the 5S, and follow-up safety analysis.

  15. Randomly detected genetically modified (GM maize (Zea mays L. near a transport route revealed a fragile 45S rDNA phenotype.

    Directory of Open Access Journals (Sweden)

    Nomar Espinosa Waminal

    Full Text Available Monitoring of genetically modified (GM crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a "beads-on-a-string" fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed.

  16. Developmental regulation of Xenopus 5S RNA genes

    International Nuclear Information System (INIS)

    Wormington, W.M.; Schlissel, M.; Brown, D.D.

    1983-01-01

    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  17. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Crhák Khaitová, Lucie; Kovařík, Aleš

    2012-01-01

    Roč. 12, JUN 20 (2012), ID 95 ISSN 1471-2229 R&D Projects: GA ČR GAP501/10/0208; GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : ARABIDOPSIS-THALIANA * NUCLEOTIDE-SEQUENCES * DNA METHYLATION * GENUS ARTEMISIA Subject RIV: BO - Biophysics Impact factor: 4.354, year: 2012

  18. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Kovařík, Aleš

    2013-01-01

    Roč. 111, č. 1 (2013), s. 23-33 ISSN 0018-067X R&D Projects: GA ČR(CZ) GA13-10057S; GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : rRNA gene organisation * intergenic spacer * Ginkgo Subject RIV: BO - Biophysics Impact factor: 3.804, year: 2013

  19. Gene mapping of 28S and 5S rDNA sites in chromosomes of two Barbus species and their F1 hybrids (Teleostei, Cyprinidae

    Directory of Open Access Journals (Sweden)

    Aneta Spoz

    2015-11-01

    Chromosomal location of ribosomal DNA sequences is useful for comparative cytogenetic fish studies due to their relatively fast rate of evolution. The results of species from the family Barbinae comparatively presented here for the first time, and they may support further taxonomical studies of the Barbus species.

  20. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    Science.gov (United States)

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

  1. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    Science.gov (United States)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  2. Review on Implementation of 5S in Various Organization

    OpenAIRE

    Vipulkumar C. Patel; Dr. Hemant Thakkar

    2014-01-01

    This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ effic...

  3. PROBLEMS OF IMPLEMENTATION 5S PRACTICES IN AN INDUSTRIAL COMPANY

    Directory of Open Access Journals (Sweden)

    Beata GALA

    2013-10-01

    Full Text Available 5S is a one of the tools of Lean Management enabling to organize workplace in an effective way. It could be implemented in all the spheres of the company. The article provides the theoretic description of Lean Management and 5S and also shows a case study based on gained experience. The author also describe the problems occured during the implementation of the 5S.

  4. Increased 5S rRNA oxidation in Alzheimer's disease.

    Science.gov (United States)

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  5. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. rDNA mapping, heterochromatin characterization and AT/GC content of Agapanthus africanus (L. Hoffmanns (Agapanthaceae

    Directory of Open Access Journals (Sweden)

    ARYANE C. REIS

    2016-01-01

    Full Text Available ABSTRACT Agapanthus (Agapanthaceae has 10 species described. However, most taxonomists differ respect to this number because the great phenotypic plasticity of the species. The cytogenetic has been an important tool to aid the plant taxon identification, and to date, all taxa of Agapanthus L'Héritier studied cytologically, presented 2n = 30. Although the species possess large chromosomes, the group is karyologically little explored. This work aimed to increase the cytogenetic knowledge of Agapanthus africanus (L. Hoffmanns by utilization of chromosome banding techniques with DAPI / CMA3 and Fluorescent in situ Hybridization (FISH. In addition, flow cytometry was used for determination of DNA content and the percentage of AT / GC nitrogenous bases. Plants studied showed 2n = 30 chromosomes, ranging from 4.34 - 8.55 µm, with the karyotype formulae (KF = 10m + 5sm. Through FISH, one 45S rDNA signal was observed proximally to centromere of the chromosome 7, while for 5S rDNA sites we observed one signal proximally to centromere of chromosome 9. The 2C DNA content estimated for the species was 2C = 24.4 with 59% of AT and 41% of GC. Our data allowed important upgrade for biology and cytotaxonomy of Agapanthus africanus (L. Hoffmanns.

  7. Low-energy foil aberration corrector

    International Nuclear Information System (INIS)

    Aken, R.H. van; Hagen, C.W.; Barth, J.E.; Kruit, P.

    2002-01-01

    A spherical and chromatic aberration corrector for electron microscopes is proposed, consisting of a thin foil sandwiched between two apertures. The electrons are retarded at the foil to almost zero energy, so that they can travel ballistically through the foil. It is shown that such a low-voltage corrector has a negative spherical aberration for not too large distances between aperture and foil, as well as a negative chromatic aberration. For various distances the third- and fifth-order spherical aberration coefficients and the first- and second-order chromatic aberration coefficients are calculated using ray tracing. Provided that the foils have sufficient electron transmission the corrector is able to correct the third-order spherical aberration and the first-order chromatic aberration of a typical low-voltage scanning electron microscope. Preliminary results show that the fifth-order spherical aberration and the second-order chromatic aberration can be kept sufficiently low

  8. Determination of aberration center of Ronchigram for automated aberration correctors in scanning transmission electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sannomiya, Takumi, E-mail: sannomiya@mtl.titech.ac.jp [Tokyo Institute of Technology, Ookayama, Tokyo (Japan); Sawada, Hidetaka; Nakamichi, Tomohiro; Hosokawa, Fumio [JEOL Limited, Akishima, Tokyo (Japan); Nakamura, Yoshio; Tanishiro, Yasumasa; Takayanagi, Kunio [Tokyo Institute of Technology, Ookayama, Tokyo (Japan)

    2013-12-15

    A generic method to determine the aberration center is established, which can be utilized for aberration calculation and axis alignment for aberration corrected electron microscopes. In this method, decentering induced secondary aberrations from inherent primary aberrations are minimized to find the appropriate axis center. The fitness function to find the optimal decentering vector for the axis was defined as a sum of decentering induced secondary aberrations with properly distributed weight values according to the aberration order. Since the appropriate decentering vector is determined from the aberration values calculated at an arbitrary center axis, only one aberration measurement is in principle required to find the center, resulting in /very fast center search. This approach was tested for the Ronchigram based aberration calculation method for aberration corrected scanning transmission electron microscopy. Both in simulation and in experiments, the center search was confirmed to work well although the convergence to find the best axis becomes slower with larger primary aberrations. Such aberration center determination is expected to fully automatize the aberration correction procedures, which used to require pre-alignment of experienced users. This approach is also applicable to automated aperture positioning. - Highlights: • A generic method to determine the aberration center is established for (S)TEM. • Decentering induced secondary aberrations are utilized to find the center. • The method is tested on Ronchigrams both in simulation and experiment. • Proper weighting of the aberration gives a good convergence. • Larger primary aberration results in a slower convergence.

  9. The Art of Optical Aberrations

    Science.gov (United States)

    Wylde, Clarissa Eileen Kenney

    Art and optics are inseparable. Though seemingly opposite disciplines, the combination of art and optics has significantly impacted both culture and science as they are now known. As history has run its course, in the sciences, arts, and their fruitful combinations, optical aberrations have proved to be a problematic hindrance to progress. In an effort to eradicate aberrations the simple beauty of these aberrational forms has been labeled as undesirable and discarded. Here, rather than approach aberrations as erroneous, these beautiful forms are elevated to be the photographic subject in a new body of work, On the Bright Side. Though many recording methods could be utilized, this work was composed on classic, medium-format, photographic film using white-light, Michelson interferometry. The resulting images are both a representation of the true light rays that interacted on the distorted mirror surfaces (data) and the artist's compositional eye for what parts of the interferogram are chosen and displayed. A detailed description of the captivating interdisciplinary procedure is documented and presented alongside the final artwork, CCD digital reference images, and deformable mirror contour maps. This alluring marriage between the arts and sciences opens up a heretofore minimally explored aspect of the inextricable art-optics connection. It additionally provides a fascinating new conversation on the importance of light and optics in photographic composition.

  10. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    NARCIS (Netherlands)

    Warmerdam, Daniel O.; van den Berg, Jeroen; Medema, Rene H.

    2016-01-01

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded

  11. Chromosomal locations of four minor rDNA loci and a marker microsatellite sequence in barley

    DEFF Research Database (Denmark)

    Pedersen, C.; Linde-Laursen, I.

    1994-01-01

    is located about 54% out on the short arm of chromosome 4 and it has not previously been reported in barley. We have designated the new locus Nor-I6. rDNA loci on homoeologous group 4 chromosomes have not yet been reported in other Triticeae species. The origin of these 4 minor rDNA loci is discussed...

  12. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  13. Large Scale Construction Project Innovative Management Through 5-S

    Directory of Open Access Journals (Sweden)

    Hashim Hj. Abdul Ghani Mohd.

    2014-11-01

    Full Text Available It has been well-recognised that Japanese construction firms are good in safety, hygiene, quality, productivity and image. Over the last century, the Japanese have formalised the technique and name it as '5S' Practice. Through his research in Japan in 1988, the author has re-define the name as '5-S' and developed the world's first 5-S Audit Checklist. Since 1993, he used an innovative 5-S Checklist developed at SIRIM for training and consultancy in no less than 20 countries with over 100,000 persons from around 8,000 organisations world-wide. The objective of this paper is to explain the intricacy of the 5-S so that it can be understood easily and adopted readily by those who may find the tool useful. Some experience will also be shared in this article. It is hoped that this article can arouse the interest of the construction industry in Malaysia to take up this important and effective tool for quality improvement.

  14. Implementation of 5S Method for Ergonomic Laboratory

    Science.gov (United States)

    Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus

    2017-06-01

    This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment

  15. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

    Directory of Open Access Journals (Sweden)

    Elizabeth X. Kwan

    2016-09-01

    Full Text Available The Saccharomyces cerevisiae ribosomal DNA (rDNA locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae.

  16. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants.

    Science.gov (United States)

    Kwan, Elizabeth X; Wang, Xiaobin S; Amemiya, Haley M; Brewer, Bonita J; Raghuraman, M K

    2016-09-08

    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. Copyright © 2016 Kwan et al.

  17. Freeform aberrations in phase space: an example.

    Science.gov (United States)

    Babington, James

    2017-06-01

    We consider how optical propagation and aberrations of freeform systems can be formulated in phase space. As an example system, a freeform prism is analyzed and discussed. Symmetry considerations and their group theory descriptions are given some importance. Numerical aberrations are also highlighted and put into the context of the underlying aberration theory.

  18. Strong decays and dipion transitions of Y(5S)

    International Nuclear Information System (INIS)

    Simonov, Yu.A.; Veselov, A.I.

    2009-01-01

    Dipion transitions of Y(nS) with n=5, n ' =1,2,3 are studied using the Field Correlator Method, applied previously to dipion transitions with n=2,3,4. The only two parameters of effective Lagrangian were fixed in that earlier study, and total widths Γ ππ (5,n ' ) as well as pionless decay widths Γ BB (5S), Γ BB* (5S), Γ B*B* (5S) and Γ KK (5,n ' ) were calculated and are in a reasonable agreement with experiment. The experimental ππ spectra for (5,1) and (5,2) transitions are well reproduced taking into account FSI in the ππ

  19. Assessment of application of 5S practices in ceramic industry

    Directory of Open Access Journals (Sweden)

    Danel Kleszcz

    2017-10-01

    Full Text Available Results of research connected with determining the degree of implementation of 5S practices in ceramics industry are discussed in this paper. Direct survey with employees of companies plus ex-pert interview was used in the research. A 21 point scale was used to assess the degree of implemen-tation the 5S practices at individual stages of the manufacturing process. The specificity of produc-tion in ceramics industry enforces maintaining the regime of cleanliness during production. The research revealed that the level of conscious implementation of the 5S practices in companies de-pends on the culture of organization and the degree of involvement of employees in the improvement actions in their company. The presented results are a part of the research aimed at determining refer-ence requirements for companies in terms of implementation and making use of the Lean Manage-ment (LM instruments.

  20. 5S-toimintamallin kehittäminen nostintuotannossa

    OpenAIRE

    Laine, Atte

    2017-01-01

    TIIVISTELMÄ Opinnäytetyön aiheena oli kehittää 5S-toimintamallia Konecranes Finland Oy:n nostintuotannossa Hämeenlinnan nostintehtaalla. Konecranesilla käytetään Lean Six Sigma -menetelmiä prosessien ja liiketoiminnan kehittämiseen ja 5S-toimintamalli on yksi näistä Lean Six Sigmaan kuuluvista menetelmistä. Se on jo osittain käytössä Hämeenlinnan nostintehtaalla ja nyt tehtaan nostinkokoonpanoon oli saatava sama toimintamalli kuin muillakin tehtaan osastoilla. Opinnäytetyössä perehdyttiin...

  1. Radiative transitions from Υ(5S) to molecular bottomonium

    International Nuclear Information System (INIS)

    Voloshin, M. B.

    2011-01-01

    The heavy quark spin symmetry implies that in addition to the recently observed Z(10610) and Z(10650) molecular resonances with I G =1 + , there should exist two or four molecular bottomonium-like states with I G =1 - . Properties of these G-odd states are considered, including their production in the radiative transitions from Υ(5S), by applying the same symmetry to the Υ(5S) resonance and the transition amplitudes. The considered radiative processes can provide a realistic option for observing the yet hypothetical states.

  2. Pathophysiology of MDS: genomic aberrations.

    Science.gov (United States)

    Ichikawa, Motoshi

    2016-01-01

    Myelodysplastic syndromes (MDS) are characterized by clonal proliferation of hematopoietic stem/progenitor cells and their apoptosis, and show a propensity to progress to acute myelogenous leukemia (AML). Although MDS are recognized as neoplastic diseases caused by genomic aberrations of hematopoietic cells, the details of the genetic abnormalities underlying disease development have not as yet been fully elucidated due to difficulties in analyzing chromosomal abnormalities. Recent advances in comprehensive analyses of disease genomes including whole-genome sequencing technologies have revealed the genomic abnormalities in MDS. Surprisingly, gene mutations were found in approximately 80-90% of cases with MDS, and the novel mutations discovered with these technologies included previously unknown, MDS-specific, mutations such as those of the genes in the RNA-splicing machinery. It is anticipated that these recent studies will shed new light on the pathophysiology of MDS due to genomic aberrations.

  3. TEXTILE INDUSTRY APPLICATION OF THE 5S METHOD

    Directory of Open Access Journals (Sweden)

    Raluca BRAD

    2015-05-01

    Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.

  4. Analyzing Digital Library Initiatives: 5S Theory Perspective

    Science.gov (United States)

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  5. Mask-induced aberration in EUV lithography

    Science.gov (United States)

    Nakajima, Yumi; Sato, Takashi; Inanami, Ryoichi; Nakasugi, Tetsuro; Higashiki, Tatsuhiko

    2009-04-01

    We estimated aberrations using Zernike sensitivity analysis. We found the difference of the tolerated aberration with line direction for illumination. The tolerated aberration of perpendicular line for illumination is much smaller than that of parallel line. We consider this difference to be attributable to the mask 3D effect. We call it mask-induced aberration. In the case of the perpendicular line for illumination, there was a difference in CD between right line and left line without aberration. In this report, we discuss the possibility of pattern formation in NA 0.25 generation EUV lithography tool. In perpendicular pattern for EUV light, the dominant part of aberration is mask-induced aberration. In EUV lithography, pattern correction based on the mask topography effect will be more important.

  6. Correlations between corneal and total wavefront aberrations

    Science.gov (United States)

    Mrochen, Michael; Jankov, Mirko; Bueeler, Michael; Seiler, Theo

    2002-06-01

    Purpose: Corneal topography data expressed as corneal aberrations are frequently used to report corneal laser surgery results. However, the optical image quality at the retina depends on all optical elements of the eye such as the human lens. Thus, the aim of this study was to investigate the correlations between the corneal and total wavefront aberrations and to discuss the importance of corneal aberrations for representing corneal laser surgery results. Methods: Thirty three eyes of 22 myopic subjects were measured with a corneal topography system and a Tschernig-type wavefront analyzer after the pupils were dilated to at least 6 mm in diameter. All measurements were centered with respect to the line of sight. Corneal and total wavefront aberrations were calculated up to the 6th Zernike order in the same reference plane. Results: Statistically significant correlations (p the corneal and total wavefront aberrations were found for the astigmatism (C3,C5) and all 3rd Zernike order coefficients such as coma (C7,C8). No statistically significant correlations were found for all 4th to 6th order Zernike coefficients except for the 5th order horizontal coma C18 (p equals 0.003). On average, all Zernike coefficients for the corneal aberrations were found to be larger compared to Zernike coefficients for the total wavefront aberrations. Conclusions: Corneal aberrations are only of limited use for representing the optical quality of the human eye after corneal laser surgery. This is due to the lack of correlation between corneal and total wavefront aberrations in most of the higher order aberrations. Besides this, the data present in this study yield towards an aberration balancing between corneal aberrations and the optical elements within the eye that reduces the aberration from the cornea by a certain degree. Consequently, ideal customized ablations have to take both, corneal and total wavefront aberrations, into consideration.

  7. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. © 2013 Elsevier Inc. All rights reserved.

  8. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    Science.gov (United States)

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  9. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    Science.gov (United States)

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  10. [18S-25S rDNA variation in tissue culture of some Gentiana L. species].

    Science.gov (United States)

    Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A

    2007-01-01

    18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.

  11. Karyotyping and in situ chromosomal localization of rDNA sites in black cumin Bunium persicum (Boiss B. Fedtsch,1915 (Apiaceae

    Directory of Open Access Journals (Sweden)

    R. K. Chahota

    2011-11-01

    Full Text Available The fluorescent in situ hybridization (FISH technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes. The bicolour FISH technique involving 18S-5.8S-26S and 5S ribosomal RNA genes as probes was used to assign physical localization and measurement of rDNA sites on homologous pairs of chromosomes. The two 18S-5.8S-26S rRNA gene sites were at the terminal regions of the short arms of the chromosomes 1 and 2 involving NOR region of chromosome 1. The 5S rDNA sites were found on subtelomeric region of the long arm of the chromosome number 5 and at interstitial regions of the short arm of chromosome 7. Based on direct visual analysis of chromosome length, morphology and position of FISH signals, a pioneer attempt has been made to construct metaphase karyotype in B. persicum, an endangered medicinal plant of North Western Himalayas.

  12. Karyotype characterization of Crotalaria juncea (L. by chromosome banding and physical mapping of 18S-5.8S-26S and 5S rRNA gene sites

    Directory of Open Access Journals (Sweden)

    Mateus Mondin

    2007-01-01

    Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.

  13. Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs

    International Nuclear Information System (INIS)

    Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.

    1986-01-01

    5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)

  14. Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.

    Science.gov (United States)

    Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly

    2016-11-01

    Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.

  15. Chromosomal aberrations in ore miners of Slovakia

    International Nuclear Information System (INIS)

    Beno, M.; Vladar, M.; Nikodemova, D.; Vicanova, M.; Durcik, M.

    1998-01-01

    A pilot study was performed in which the incidence of chromosomal aberrations in lymphocytes of miners in ore mines located in Central Slovakia was monitored and related to lifetime underground radon exposure and to lifetime smoking. The conclusions drawn from the results of the study were as follows: the counts of chromosomal aberrations in lymphocytes of miners were significantly higher than in an age matched control group of white-collar staff; the higher counts of chromosomal aberrations could be ascribed to underground exposure of miners and to smoking; a dependence of chromosomal aberration counts on the exposure to radon could not be assessed. (A.K.)

  16. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE

    2006-01-01

    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  17. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Science.gov (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  18. The RTR Complex Partner RMI2 and the DNA Helicase RTEL1 Are Both Independently Involved in Preserving the Stability of 45S rDNA Repeats in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Sarah Röhrig

    2016-10-01

    Full Text Available The stability of repetitive sequences in complex eukaryotic genomes is safeguarded by factors suppressing homologues recombination. Prominent in this is the role of the RTR complex. In plants, it consists of the RecQ helicase RECQ4A, the topoisomerase TOP3α and RMI1. Like mammals, but not yeast, plants harbor an additional complex partner, RMI2. Here, we demonstrate that, in Arabidopsis thaliana, RMI2 is involved in the repair of aberrant replication intermediates in root meristems as well as in intrastrand crosslink repair. In both instances, RMI2 is involved independently of the DNA helicase RTEL1. Surprisingly, simultaneous loss of RMI2 and RTEL1 leads to loss of male fertility. As both the RTR complex and RTEL1 are involved in suppression of homologous recombination (HR, we tested the efficiency of HR in the double mutant rmi2-2 rtel1-1 and found a synergistic enhancement (80-fold. Searching for natural target sequences we found that RTEL1 is required for stabilizing 45S rDNA repeats. In the double mutant with rmi2-2 the number of 45S rDNA repeats is further decreased sustaining independent roles of both factors in this process. Thus, loss of suppression of HR does not only lead to a destabilization of rDNA repeats but might be especially deleterious for tissues undergoing multiple cell divisions such as the male germline.

  19. The RTR Complex Partner RMI2 and the DNA Helicase RTEL1 Are Both Independently Involved in Preserving the Stability of 45S rDNA Repeats in Arabidopsis thaliana.

    Science.gov (United States)

    Röhrig, Sarah; Schröpfer, Susan; Knoll, Alexander; Puchta, Holger

    2016-10-01

    The stability of repetitive sequences in complex eukaryotic genomes is safeguarded by factors suppressing homologues recombination. Prominent in this is the role of the RTR complex. In plants, it consists of the RecQ helicase RECQ4A, the topoisomerase TOP3α and RMI1. Like mammals, but not yeast, plants harbor an additional complex partner, RMI2. Here, we demonstrate that, in Arabidopsis thaliana, RMI2 is involved in the repair of aberrant replication intermediates in root meristems as well as in intrastrand crosslink repair. In both instances, RMI2 is involved independently of the DNA helicase RTEL1. Surprisingly, simultaneous loss of RMI2 and RTEL1 leads to loss of male fertility. As both the RTR complex and RTEL1 are involved in suppression of homologous recombination (HR), we tested the efficiency of HR in the double mutant rmi2-2 rtel1-1 and found a synergistic enhancement (80-fold). Searching for natural target sequences we found that RTEL1 is required for stabilizing 45S rDNA repeats. In the double mutant with rmi2-2 the number of 45S rDNA repeats is further decreased sustaining independent roles of both factors in this process. Thus, loss of suppression of HR does not only lead to a destabilization of rDNA repeats but might be especially deleterious for tissues undergoing multiple cell divisions such as the male germline.

  20. Possible mechanisms of chromosome aberrations. 2. Formation of aberrations after UV-irradiation

    International Nuclear Information System (INIS)

    Lebedeva, L.I.

    1982-01-01

    One of mechanisms of chromosome aberrations after UV-radiation of animal cells initiated by thymine dimerization from different dna threads (by cross joints) and finished in mitosis metaphase is discussed. The model of aberration formation, taking a count of peculiarities of chromosome ansate structure and predicting the important role of chromosome isolation during mitosis in realization of structural aberrations, is suggested. An attempt to present aberration formation under conditions of exact repair is the distinguishing feature of the model

  1. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...

  2. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex

    Science.gov (United States)

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa

    2016-01-01

    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  3. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Science.gov (United States)

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc

  4. Copy number of the transposon, Pokey, in rDNA is positively correlated with rDNA copy number in Daphnia obtuse [corrected].

    Directory of Open Access Journals (Sweden)

    Kaitlynn LeRiche

    Full Text Available Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼ 87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species.

  5. Rooting Out Aberrant Behavior in Training.

    Science.gov (United States)

    Kokalis, Jerry, Jr.; Paquin, Dave

    1989-01-01

    Discusses aberrant, or disruptive, behavior in an industrial/business, classroom-based, instructor-led training setting. Three examples of aberrant behavior are described, typical case studies are provided for each, and preventive (long-term) and corrective (on-the-spot) strategies for dealing with the problems are discussed. (LRW)

  6. Nodal aberration theory applied to freeform surfaces

    Science.gov (United States)

    Fuerschbach, Kyle; Rolland, Jannick P.; Thompson, Kevin P.

    2014-12-01

    When new three-dimensional packages are developed for imaging optical systems, the rotational symmetry of the optical system is often broken, changing its imaging behavior and making the optical performance worse. A method to restore the performance is to use freeform optical surfaces that compensate directly the aberrations introduced from tilting and decentering the optical surfaces. In order to effectively optimize the shape of a freeform surface to restore optical functionality, it is helpful to understand the aberration effect the surface may induce. Using nodal aberration theory the aberration fields induced by a freeform surface in an optical system are explored. These theoretical predications are experimentally validated with the design and implementation of an aberration generating telescope.

  7. Aberration characteristics of immersion lenses for LVSEM

    International Nuclear Information System (INIS)

    Khursheed, Anjam

    2002-01-01

    This paper investigates the on-axis aberration characteristics of various immersion objective lenses for low voltage scanning electron microscopy (LVSEM). A simple aperture lens model is used to generate smooth axial field distributions. The simulation results show that mixed field electric-magnetic immersion lenses are predicted to have between 1.5 and 2 times smaller aberration limited probe diameters than their pure-field counterparts. At a landing energy of 1 keV, mixed field immersion lenses operating at the vacuum electrical field breakdown limit are predicted to have on-axis aberration coefficients between 50 and 60 μm, yielding an ultimate image resolution of below 1 nm. These aberrations lie in the same range as those for LVSEM systems that employ aberration correctors

  8. [Monochromatic aberration in accommodation. Dynamic wavefront analysis].

    Science.gov (United States)

    Fritzsch, M; Dawczynski, J; Jurkutat, S; Vollandt, R; Strobel, J

    2011-06-01

    Monochromatic aberrations may influence the visual acuity of the eye. They are not stable and can be affected by different factors. The subject of the following paper is the dynamic investigation of the changes in wavefront aberration with accommodation. Dynamic measurement of higher and lower order aberrations was performed with a WASCA Wavefront Analyzer (Carl-Zeiss-Meditec) and a specially constructed target device for aligning objects in far and near distances on 25 subjects aged from 15 to 27 years old. Wavefront aberrations showed some significant changes in accommodation. In addition to the characteristic sphere reaction accompanying miosis and changes in horizontal prism (Z(1) (1)) in the sense of a convergence movement of the eyeball also occurred. Furthermore defocus rose (Z(2) (0)) and astigmatism (Z(2) (-2)) changed. In higher-order aberrations a decrease in coma-like Zernike polynomials (Z(3) (-1), Z(3) (1)) was found. The most obvious change appeared in spherical aberration (Z(4) (0)) which increased and changed from positive to negative. In addition the secondary astigmatism (Z(4) (-2)) and quadrafoil (Z(4) (4)) rise also increased. The total root mean square (RMS), as well as the higher-order aberrations (RMS-HO) significantly increased in accommodation which is associated with a theoretical reduction of visual acuity. An analysis of the influence of pupil size on aberrations showed significant increases in defocus, spherical aberration, quadrafoil, RMS and RMS HO by increasing pupil diameter. By accommodation-associated miosis, the growing aberrations are partially compensated by focusing on near objects. Temporal analysis of the accommodation process with dynamic wavefront analysis revealed significant delays in pupil response and changing of prism in relation to the sphere reaction. In accommodation to near objects a discrete time ahead of third order aberrations in relation to the sphere response was found. Using dynamic wavefront measurement

  9. Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast

    International Nuclear Information System (INIS)

    Lin, Y.H.; Keil, R.L.

    1991-01-01

    HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination

  10. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    Science.gov (United States)

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  11. Flow cytogenetics: progress toward chromosomal aberration detection

    International Nuclear Information System (INIS)

    Carrano, A.V.; Gray, J.W.; Van Dilla, M.A.

    1977-01-01

    Using clonal derivatives of the Chinese hamster M3-1 cell line, we demonstrate the potential of flow systems to karyotype homogeneous aberrations (aberrations which are identical and present in every cell) and to detect heterogeneous aberrations (aberrations which occur randomly in a population and are not identical in every cell). Flow cytometry (FCM) of ethidium bromide stained isolated chromosomes from clone 650A of the M3-1 cells distinguishes nine chromosome types from the fourteen present in the actual karyotype. X-irradiation of this parent 650A clone produced two sub-clones with an altered flow karyotype, that is, their FCM distributions were characterized by the addition of new peaks and alterations in area under existing peaks. From the relative DNA content and area for each peak, as determined by computer analysis, we predicted that each clone had undergone a reciprocal translocation involving chromosomes from two peaks. This prediction was confirmed by Giemsa-banding the metaphase cells. Heterogeneous aberrations are reflected in the flow karyotype as an increase in background, that is, an increase in area underlying the chromosome peaks. This increase is dose dependent but, as yet, the sample variability has been too large for quantitative analysis. Flow sorting of the valleys between chromosome peaks produces enriched fractions of aberrant chromosomes for visual analysis. These approaches are potentially applicable to the analysis of chromsomal aberrations induced by environmental contaminants

  12. Iteration of ultrasound aberration correction methods

    Science.gov (United States)

    Maasoey, Svein-Erik; Angelsen, Bjoern; Varslot, Trond

    2004-05-01

    Aberration in ultrasound medical imaging is usually modeled by time-delay and amplitude variations concentrated on the transmitting/receiving array. This filter process is here denoted a TDA filter. The TDA filter is an approximation to the physical aberration process, which occurs over an extended part of the human body wall. Estimation of the TDA filter, and performing correction on transmit and receive, has proven difficult. It has yet to be shown that this method works adequately for severe aberration. Estimation of the TDA filter can be iterated by retransmitting a corrected signal and re-estimate until a convergence criterion is fulfilled (adaptive imaging). Two methods for estimating time-delay and amplitude variations in receive signals from random scatterers have been developed. One method correlates each element signal with a reference signal. The other method use eigenvalue decomposition of the receive cross-spectrum matrix, based upon a receive energy-maximizing criterion. Simulations of iterating aberration correction with a TDA filter have been investigated to study its convergence properties. A weak and strong human-body wall model generated aberration. Both emulated the human abdominal wall. Results after iteration improve aberration correction substantially, and both estimation methods converge, even for the case of strong aberration.

  13. DEPLOYMENT OF 5S SYSTEM IN ARCHIVES MANAGEMENT

    Directory of Open Access Journals (Sweden)

    Marcelo Cavaglieri

    2017-06-01

    Full Text Available An efficient document management brings various benefits, not only for professionals of the area but, mainly, for business managers who can use this information in their decisionmaking to enjoy competitive advantages on competitors. Having in mind that effectiveness is a constant pursuit for any company in order to achieve their strategic goals and improve the techniques which enable more productivity using fewer financial resources. In this sense, it was sought to apply the 5S philosophy in the document file management of Santa Fé Company, once it is necessary to improve the current processes with less waste and more efficiency, with a view to the need to suit the client more efficiently before their information necessities. Regarding to the method used, it is characterized as a researchaction in a quali-quantitative approach, classified as exploratory and descriptive. Among the obtained research results, it stands out in a quantitative way the reduction of waste, with significant gains of Lead Time, diminishing the time to process the activities. Financial gains were also obtained with a better use of resources and a redesigning of the way to keeping the documents. In a qualitative way, a better working environment is highlighted and increase of the service efficiency in bringing more customer satisfaction.

  14. Diagnostic radiation and chromosome aberrations

    International Nuclear Information System (INIS)

    Patil, S.R.; Hecht, F.; Lubs, H.A.; Kimberling, W.; Brown, J.; Gerald, P.S.; Summitt, R.L.

    1977-01-01

    Some evidence is presented suggesting that diagnostic X-rays may be important in the origin of a new chromosomal abnormality other than Down syndrome. Chromosome analyses have been carried out on 4342 children, seven or eight years old. Maternal diagnostic irradiation in the year before conception and up to third lunar month of the index pregnancy was recorded, before the chromosome study began, together with a large amount of family and clinical data. Information on X-ray exposure was supplied by the mothers, s o radiation dosage could not be estimated. 21 children (including a pair of twins and a pair of siblings) born to 19 mothers had chromosomal aberrations. The mothers of six children with inherited translocations, rearrangements and XYY karyotypes were excluded, and 3 (23%) of the remaining 13 mothers had received abdominal and pelvic X-ray exposures. In the whole sample, however, only 6% of the mothers had diagnostic irradiation. Two of these mothers, aged sixteen and twenty, gave birth to a child each with de-novo autosomal translocations, and the third mother, aged thirty-two, had a child with a complex mosaicism involving one X chromosome. Although the sample size of the mothers with chromosomally abnormal children is small, the results are significant. (U.K.)

  15. Diagnostic radiation and chromosome aberrations

    Energy Technology Data Exchange (ETDEWEB)

    Patil, S R; Hecht, F [Dept. of Pediatrics, Child Development and Rehabilitation Center, Univ. of Oregon Health Sciences Center, Portland, Oregon (USA); Lubs, H A; Kimberling, W; Brown, J; Gerald, P S; Summitt, R L

    1977-01-15

    Some evidence is presented suggesting that diagnostic X-rays may be important in the origin of a new chromosomal abnormality other than Down syndrome. Chromosome analyses have been carried out on 4342 children, seven or eight years old. Maternal diagnostic irradiation in the year before conception and up to third lunar month of the index pregnancy was recorded, before the chromosome study began, together with a large amount of family and clinical data. Information on X-ray exposure was supplied by the mothers, so radiation dosage could not be estimated. 21 children (including a pair of twins and a pair of siblings) born to 19 mothers had chromosomal aberrations. The mothers of six children with inherited translocations, rearrangements and XYY karyotypes were excluded, and 3 (23%) of the remaining 13 mothers had received abdominal and pelvic X-ray exposures. In the whole sample, however, only 6% of the mothers had diagnostic irradiation. Two of these mothers, aged sixteen and twenty, gave birth to a child each with de-novo autosomal translocations, and the third mother, aged thirty-two, had a child with a complex mosaicism involving one X chromosome. Although the sample size of the mothers with chromosomally abnormal children is small, the results are significant.

  16. Chromosome aberration assays in Allium

    Energy Technology Data Exchange (ETDEWEB)

    Grant, W.F.

    1982-01-01

    The common onion (Allium cepa) is an excellent plant for the assay of chromosome aberrations after chemical treatment. Other species of Allium (A. cepa var. proliferum, A. carinatum, A. fistulosum and A. sativum) have also been used but to a much lesser extent. Protocols have been given for using root tips from either bulbs or seeds of Allium cepa to study the cytological end-points, such as chromosome breaks and exchanges, which follow the testing of chemicals in somatic cells. It is considered that both mitotic and meiotic end-points should be used to a greater extent in assaying the cytogenetic effects of a chemical. From a literature survey, 148 chemicals are tabulated that have been assayed in 164 Allium tests for their clastogenic effect. Of the 164 assays which have been carried out, 75 are reported as giving a positive reaction, 49 positive and with a dose response, 1 positive and temperature-related, 9 borderline positive, and 30 negative; 76% of the chemicals gave a definite positive response. It is proposed that the Allium test be included among those tests routinely used for assessing chromosomal damage induced by chemicals.

  17. Aberrant regeneration of the third cranial nerve.

    Science.gov (United States)

    Shrestha, U D; Adhikari, S

    2012-01-01

    Aberrant regeneration of the third cranial nerve is most commonly due to its damage by trauma. A ten-month old child presented with the history of a fall from a four-storey building. She developed traumatic third nerve palsy and eventually the clinical features of aberrant regeneration of the third cranial nerve. The adduction of the eye improved over time. She was advised for patching for the strabismic amblyopia as well. Traumatic third nerve palsy may result in aberrant regeneration of the third cranial nerve. In younger patients, motility of the eye in different gazes may improve over time. © NEPjOPH.

  18. Transverse correlation vanishing due to phase aberrations

    CSIR Research Space (South Africa)

    Godin, T

    2011-06-01

    Full Text Available of the effects of each aberration on the ratio Sp ?? / , the following condition are imposed: 0max3max2max1 )()()( ??????? === . (9) It is assumed that the phase aberration is set in the beam-waist plane of radius mmW 5.10 = . Arbitrarily, the value... of max? is fixed to twice the incident beam width, 0max 2W=? , where the intensity is only 0.03% of the on-axis value. In the following we will express the aberration 0? in number of equivalent wavelengths given by the ratio )2/(00 pi...

  19. Evaluation of amplified rDNA restriction analysis (ARDRA for the identification of cultured mycobacteria in a diagnostic laboratory

    Directory of Open Access Journals (Sweden)

    Rottiers Sylvianne

    2002-03-01

    Full Text Available Abstract Background The development of DNA amplification for the direct detection of M. tuberculosis from clinical samples has been a major goal of clinical microbiology during the last ten years. However, the limited sensitivity of most DNA amplification techniques restricts their use to smear positive samples. On the other hand, the development of automated liquid culture has increased the speed and sensitivity of cultivation of mycobacteria. We have opted to combine automated culture with rapid genotypic identification (ARDRA: amplified rDNA restriction analysis for the detection resp. identification of all mycobacterial species at once, instead of attempting direct PCR based detection from clinical samples of M. tuberculosis only. Results During 1998–2000 a total of approx. 3500 clinical samples was screened for the presence of M. tuberculosis. Of the 151 culture positive samples, 61 were M. tuberculosis culture positive. Of the 30 smear positive samples, 26 were M. tuberculosis positive. All but three of these 151 mycobacterial isolates could be identified with ARDRA within on average 36 hours. The three isolates that could not be identified belonged to rare species not yet included in our ARDRA fingerprint library or were isolates with an aberrant pattern. Conclusions In our hands, automated culture in combination with ARDRA provides with accurate, practically applicable, wide range identification of mycobacterial species. The existing identification library covers most species, and can be easily updated when new species are studied or described. The drawback is that ARDRA is culture-dependent, since automated culture of M. tuberculosis takes on average 16.7 days (range 6 to 29 days. However, culture is needed after all to assess the antibiotic susceptibility of the strains.

  20. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    Science.gov (United States)

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  1. Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.

    Science.gov (United States)

    Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří

    2016-11-01

    Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.

  2. rKnowledge: The Spatial Diffusion of rDNA Methods

    OpenAIRE

    Maryann Feldman; Dieter Kogler; David Rigby

    2013-01-01

    The 1980 patent granted to Stanley Cohen and Herbert Boyer for their development of rDNA technology played a critical role in the establishment of the modern biotechnology industry. From the birth of this general purpose technology in the San Francisco Bay area, rDNA-related knowledge diffused across sectors and regions of the U.S. economy. The local absorption and application of rDNA technology is tracked across metropolitan areas with USPTO patent data. The influence of cognitive, geographi...

  3. Catadioptric aberration correction in cathode lens microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Tromp, R.M. [IBM T.J. Watson Research Center, PO Box 218, Yorktown Heights, NY 10598 (United States); Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Niels Bohrweg 2, 2333 CA Leiden (Netherlands)

    2015-04-15

    In this paper I briefly review the use of electrostatic electron mirrors to correct the aberrations of the cathode lens objective lens in low energy electron microscope (LEEM) and photo electron emission microscope (PEEM) instruments. These catadioptric systems, combining electrostatic lens elements with a reflecting mirror, offer a compact solution, allowing simultaneous and independent correction of both spherical and chromatic aberrations. A comparison with catadioptric systems in light optics informs our understanding of the working principles behind aberration correction with electron mirrors, and may point the way to further improvements in the latter. With additional developments in detector technology, 1 nm spatial resolution in LEEM appears to be within reach. - Highlights: • The use of electron mirrors for aberration correction in LEEM/PEEM is reviewed. • A comparison is made with similar systems in light optics. • Conditions for 1 nm spatial resolution are discussed.

  4. Observation of the strongest 5s2 5p6 5d-(5s2 5p5 5d6s+5s25p6 7p) transitions in Au XI to Bi XV ions

    International Nuclear Information System (INIS)

    Churilov, S.S.; Joshi, Y.N.

    2001-01-01

    The spectra of gold till bismuth were studied in the 90-135 A region. Nine most intense lines belonging to the 5s 2 5p 6 5d-5s 2 5p 5 5d6s array were identified in Au XI to Bi XV ions. The 5s 2 5p 6 7p 2 P 3/2,1/2 levels in Au XI and the 5s 2 5p 6 7p 2 P 3/2 level in Hg XII were also identified. The observed wavelengths and intensities agree quite well with the Hartree-Fock calculations. (orig.)

  5. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Science.gov (United States)

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  6. Pulse compressor with aberration correction

    Energy Technology Data Exchange (ETDEWEB)

    Mankos, Marian [Electron Optica, Inc., Palo Alto, CA (United States)

    2015-11-30

    In this SBIR project, Electron Optica, Inc. (EOI) is developing an electron mirror-based pulse compressor attachment to new and retrofitted dynamic transmission electron microscopes (DTEMs) and ultrafast electron diffraction (UED) cameras for improving the temporal resolution of these instruments from the characteristic range of a few picoseconds to a few nanoseconds and beyond, into the sub-100 femtosecond range. The improvement will enable electron microscopes and diffraction cameras to better resolve the dynamics of reactions in the areas of solid state physics, chemistry, and biology. EOI’s pulse compressor technology utilizes the combination of electron mirror optics and a magnetic beam separator to compress the electron pulse. The design exploits the symmetry inherent in reversing the electron trajectory in the mirror in order to compress the temporally broadened beam. This system also simultaneously corrects the chromatic and spherical aberration of the objective lens for improved spatial resolution. This correction will be found valuable as the source size is reduced with laser-triggered point source emitters. With such emitters, it might be possible to significantly reduce the illuminated area and carry out ultrafast diffraction experiments from small regions of the sample, e.g. from individual grains or nanoparticles. During phase I, EOI drafted a set of candidate pulse compressor architectures and evaluated the trade-offs between temporal resolution and electron bunch size to achieve the optimum design for two particular applications with market potential: increasing the temporal and spatial resolution of UEDs, and increasing the temporal and spatial resolution of DTEMs. Specialized software packages that have been developed by MEBS, Ltd. were used to calculate the electron optical properties of the key pulse compressor components: namely, the magnetic prism, the electron mirror, and the electron lenses. In the final step, these results were folded

  7. Modulation of immune response to rDNA hepatitis B vaccination by psychological stress

    NARCIS (Netherlands)

    L. Jabaaij (Lea); J. van Hattum (Jan); A.J.J.M. Vingerhoets (Ad); F.G. Oostveen (Frank); H.J. Duivenvoorden (Hugo); R.E. Ballieux (Rudy)

    1996-01-01

    textabstractIn a previous study it was shown that antibody formation after vaccination with a low-dose recombinant DNA (rDNA) hepatitis B vaccine was negatively influenced by psychological stress. The present study was designed to assess whether the same inverse relation between HBs-antibody levels

  8. Systematics of Penicillium simplicissimum based on rDNA sequences, morphology and secondary metabolites

    DEFF Research Database (Denmark)

    Tuthill, D.E.; Frisvad, Jens Christian; Christensen, M.

    2001-01-01

    supported by differences in micromorphological characters, particularly of the conidia and phialides, and the production of distinct profiles of secondary metabolites by each species. Group-I introns, located in the SSU rDNA, were identified in six of the 21 isolates; their presence was used to test...

  9. Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA

    Directory of Open Access Journals (Sweden)

    Zhongai Li

    2015-01-01

    Conclusions: NiCl2 application caused variation of DNA methylation of the Arabidopsis genomic and offspring's. NiCl2 also resulted in nucleolar injury and deformity of root tip cells. The methylation rate of 18S rDNA also changed by adding NiCl2.

  10. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    an intron in the 26s rRNA coding region. The evolutionary relationship among the species of the T. pyriformis complex was examined on the basis of the rDNA maps with emphasis on similarities between two of the new species and the widely studied T. thermophila and T. pigmentosa. Examination of a large number...

  11. Clinorotation influences rDNA and NopA100 localization in nucleoli

    Science.gov (United States)

    Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

    The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

  12. Improving the Analysis of Dinoflagellate Phylogeny based on rDNA

    DEFF Research Database (Denmark)

    Murray, Shauna; Jørgensen, Mårten Flø; Ho, Simon Y.W.

    2005-01-01

    Phylogenetic studies of dinoflagellates are often conducted using rDNA sequences. In analyses to date, the monophyly of some of the major lineages of dinoflagellates remain to be demonstrated. There are several reasons for this uncertainty, one of which may be the use of models of evolution that ...

  13. Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.

    Science.gov (United States)

    Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua

    2004-01-01

    In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae. Copyright 2004 WILEY-VCH Verlag GmbH & Co.

  14. Community structure of arbuscular mycorrhizal fungi in undisturbed vegetation revealed by analyses of LSU rdna sequences

    DEFF Research Database (Denmark)

    Rosendahl, Søren; Holtgrewe-Stukenbrock, Eva

    2004-01-01

    Arbuscular mycorrhizal fungi (AMF) form a mutualistic symbiosis with plant roots and are found in most ecosystems. In this study the community structure of AMF in a clade of the genus Glomus was examined in undisturbed costal grassland using LSU rDNA sequences amplified from roots of Hieracium...

  15. Geometric characteristics of aberrations of plane-symmetric optical systems

    International Nuclear Information System (INIS)

    Lu Lijun; Deng Zhiyong

    2009-01-01

    The geometric characteristics of aberrations of plane-symmetric optical systems are studied in detail with a wave-aberration theory. It is dealt with as an extension of the Seidel aberrations to realize a consistent aberration theory from axially symmetric to plane-symmetric systems. The aberration distribution is analyzed with the spot diagram of a ray and an aberration curve. Moreover, the root-mean-square value and the centroid of aberration distribution are discussed. The numerical results are obtained with the focusing optics of a toroidal mirror at grazing incidence.

  16. Fluorescent in situ hybridization of the ribosomal RNA genes (5S and 35S in the genus Lolium: Lolium canariense, the missing link with Festuca?

    Directory of Open Access Journals (Sweden)

    Inda, Luis A.

    2013-06-01

    Full Text Available Two groups of taxa can be distinguished within the genus Lolium L. based on the pollination system, chromosome size, chromosomal location of nrDNA (5S and 35S (18S-5.8S-26S] and nrDNA phylogeny. The first group includes self-pollinated taxa (L. temulentum, L. persicum and L. remotum, whereas the second group comprises cross-pollinated species (L. perenne, L. multiflorum and L. rigidum. Here we describe that the autogamous species have two 5S sites and four 35S sites in their genome. Two of the 35S sites are present in the chromosomes containing the 5S regions. The allogamous taxa possess two 5S rDNA sites and 6-10 35S sites per genome, depending on the species. Two of these regions (35S may also be present in the chromosomes bearing 5S sites. Our study also demonstrates that Lolium canariense shows a distinctive pattern. It has two 5S and four 35S sites. In this case, the 35S loci are located in different chromosomes than the 5S. This cytogenetic pattern is consistent with that of Festuca pratensis. Thus, despite being allogamous, Lolium canariense does not entirely fit in either of the groups defined for the genus Lolium. The physical mapping of the nrDNA regions in L. canariense is different, and resembles that of F. pratensis, suggesting that this Macaronesian Lolium could be intermediate between Festuca and Lolium.En trabajos previos se ha descrito que el género Lolium L. está formado por dos grupos de taxones basados en el tipo de polinización, tamaño de los cromosomas, localización cromosómica de los loci del ADN ribosómico [5S y 35S (18S-5.8S-26S] y filogenia molecular basada en secuencias de ADN ribosómico. Los dos grupos son: especies autógamas (L. temulentum, L. persicum y L. remotum y especies alógamas (L. perenne, L. multiflorum y L. rigidum. Aquí describimos que según la localización cromosómica de los loci ribosómicos, las especies autógamas tienen dos sitios 5S y cuatro sitios 35S; dos de las cuales coinciden en

  17. The calculation of oscillator strengths for the 5s21S0→5s5p1,3P1 transitions in Cd-like ions

    International Nuclear Information System (INIS)

    Li Guangyuan

    1998-01-01

    The screened hydrogenic model is employed to calculate the oscillator strength of the 5s 2 1 S 0 -5s5p 1 P 1 resonance transition in Cd-like ions (Z = 48 -74). The expression for the oscillator strength of the 5s 2 1 S 0 -5s5p 3 P1 is given, with the introduction of the correctional coefficient K and the mixing angle in jj-coupling. The results are compared with that of other authors, and some discussions are also given

  18. Spherical aberrations of human astigmatic corneas.

    Science.gov (United States)

    Zhao, Huawei; Dai, Guang-Ming; Chen, Li; Weeber, Henk A; Piers, Patricia A

    2011-11-01

    To evaluate whether the average spherical aberration of human astigmatic corneas is statistically equivalent to human nonastigmatic corneas. Spherical aberrations of 445 astigmatic corneas prior to laser vision correction were retrospectively investigated to determine Zernike coefficients for central corneal areas 6 mm in diameter using CTView (Sarver and Associates). Data were divided into groups according to cylinder power (0.01 to 0.25 diopters [D], 0.26 to 0.75 D, 0.76 to 1.06 D, 1.07 to 1.53 D, 1.54 to 2.00 D, and >2.00 D) and according to age by decade. Spherical aberrations were correlated with age and astigmatic power among groups and the entire population. Statistical analyses were conducted, and P.05 for all tested groups). Mean spherical aberration of astigmatic corneas was not correlated significantly with cylinder power or age (P>.05). Spherical aberrations are similar to those of nonastigmatic corneas, permitting the use of these additional data in the design of aspheric toric intra-ocular lenses. Copyright 2011, SLACK Incorporated.

  19. Frequencies of chromosome aberration on radiation workers

    International Nuclear Information System (INIS)

    Yanti Lusiyanti; Zubaidah Alatas

    2016-01-01

    Radiation exposure of the body can cause damage to the genetic material in cells (cytogenetic) in the form of changes in the structure or chromosomal aberrations in peripheral blood lymphocytes. Chromosomal aberrations can be unstable as dicentric and ring chromosomes, and is stable as translocation. Dicentric chromosome is the gold standard biomarker due to radiation exposure, and chromosome translocation is a biomarker for retrospective biodosimetry. The aim of this studi is to conduct examination of chromosomal aberrations in the radiation worker to determine the potential damage of cell that may arise due to occupational radiation exposure. The examination have been carried out on blood samples from 55 radiation workers in the range of 5-30 year of service. Chromosome aberration frequency measurement starts with blood sampling, culturing, harvesting, slide preparations, and lymphocyte chromosome staining with Giemsa and painting with Fluorescence In Situ Hybridization (FISH) technique. The results showed that chromosomal translocations are not found in blood samples radiation workers and dicentric chromosomes found only on 2 blood samples of radiation workers with a frequency of 0.001/cell. The frequency of chromosomal aberrations in the blood cells such workers within normal limits and this means that the workers have been implemented a radiation safety aspects very well. (author)

  20. Hyperfine structure in 5s4d 3D-5snf transitions of 87Sr

    International Nuclear Information System (INIS)

    Bushaw, B.A.; Kluge, H.J.; Lantzsch, J.; Schwalbach, R.; Stenner, J.; Stevens, H.; Wendt, K.; Zimmer, K.

    1993-01-01

    The hyperfine spectra of the 5s4d 3 D 1 -5s20f, 5s4d 3 D 2 -5s23f, and 5s4d 3 D 3 -5s32f transitions of 87 Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a 5s and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d 3 D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  1. Recurrent branchial sinus tract with aberrant extension.

    Science.gov (United States)

    Barret, J P

    2004-01-01

    Second branchial cysts are the commonest lesions among congenital lateral neck anomalies. Good knowledge of anatomy and embryology are necessary for proper treatment. Surgical treatment involves resection of all branchial remnants, which extend laterally in the neck, medial to the sternocleidomastoid muscle with cranial extension to the pharynx and ipsilateral tonsillar fosa. However, infections and previous surgery can distort anatomy, making the approach to branchial anomalies more difficult. We present a case of a 17-year-old patient who presented with a second branchial tract anomaly with an aberrant extension to the midline and part of the contralateral neck. Previous surgical interventions and chronic infections may have been the primary cause for this aberrant tract. All head and neck surgeons should bear in mind that aberrant presentations may exist when reoperating on chronic branchial cysts fistulas.

  2. An aberrant precision account of autism.

    Directory of Open Access Journals (Sweden)

    Rebecca P Lawson

    2014-05-01

    Full Text Available Autism is a neurodevelopmental disorder characterised by problems with social-communication, restricted interests and repetitive behaviour. A recent and controversial article presented a compelling normative explanation for the perceptual symptoms of autism in terms of a failure of Bayesian inference (Pellicano and Burr, 2012. In response, we suggested that when Bayesian interference is grounded in its neural instantiation – namely, predictive coding – many features of autistic perception can be attributed to aberrant precision (or beliefs about precision within the context of hierarchical message passing in the brain (Friston et al., 2013. Here, we unpack the aberrant precision account of autism. Specifically, we consider how empirical findings – that speak directly or indirectly to neurobiological mechanisms – are consistent with the aberrant encoding of precision in autism; in particular, an imbalance of the precision ascribed to sensory evidence relative to prior beliefs.

  3. Chromosomal aberrations induced by alpha particles

    International Nuclear Information System (INIS)

    Guerrero C, C.; Brena V, M.

    2005-01-01

    The chromosomal aberrations produced by the ionizing radiation are commonly used when it is necessary to establish the exposure dose of an individual, it is a study that is used like complement of the traditional physical systems and its application is only in cases in that there is doubt about what indicates the conventional dosimetry. The biological dosimetry is based on the frequency of aberrations in the chromosomes of the lymphocytes of the individual in study and the dose is calculated taking like reference to the dose-response curves previously generated In vitro. A case of apparent over-exposure to alpha particles to which is practiced analysis of chromosomal aberrations to settle down if in fact there was exposure and as much as possible, to determine the presumed dose is presented. (Author)

  4. Electrostatic axisymmetric mirror with removable spherical aberration

    International Nuclear Information System (INIS)

    Birmuzaev, S.B.; Serikbaeva, G.S.; Hizirova, M.A.

    1999-01-01

    The electrostatic axisymmetric mirror, assembled from three coaxial cylinders with an equal diameter d and under the potential v1, v2 and v3, was computed. The proportions of geometrical and electric parameters of the mirror, with which the spherical 3-order aberration may be eliminated, were determined. The computation outcomes of the case, when the focal power of the mirror is enough large and the object plane in the focus is out of its field, are presented (Fig. 1 - potentials proportion that makes elimination of the spherical aberration possible; Fig. 2 - the focus coordinates when the spherical aberration is eliminated). The geometrical values are presented by d, and the electric ones are presented by v1. The figures on the curves present a length of the second (middle) electrode. The zero point is located in the middle of the gap between the first and second electrodes The investigated mirror may be used as a lens for the transmission electron microscope

  5. Estimation of dose from chromosome aberration rate

    International Nuclear Information System (INIS)

    Li Deping

    1990-01-01

    The methods and skills of evaluating dose from correctly scored shromsome aberration rate are presented, and supplemented with corresponding BASIC computer code. The possibility and preventive measures of excessive probability of missing score of the aberrations in some of the current routine score methods are discussed. The use of dose-effect relationship with exposure time correction factor G in evaluating doses and their confidence intervals, dose estimation in mixed n-γ exposure, and identification of high by nonuniform acute exposure to low LET radiation and its dose estimation are discussed in more detail. The difference of estimated dose due to whether the interaction between subleisoms produced by n and γ have been taken into account is examined. In fitting the standard dose-aberration rate curve, proper weighing of experiment points and comparison with commonly accepted values are emphasised, and the coefficient of variation σ y √y of the aberration rate y as a function of dose and exposure time is given. In appendix I and II, the dose-aberration rate formula is derived from dual action theory, and the time variation of subleisom is illustrated and in appendix III, the estimation of dose from scores of two different types of aberrations (of other related score) is illustrated. Two computer codes are given in appendix IV, one is a simple code, the other a complete code, including the fitting of standard curve. the skills of using compressed data storage, and the production of simulated 'data ' for testing the curve fitting procedure are also given

  6. Electron correlation in the 4d-16p→5s-26p and 5s-15p-16p resonance Auger transitions of Xe

    International Nuclear Information System (INIS)

    Osmekhin, S.; Nikkinen, J.; Sankari, R.; Maeaettae, M.; Kukk, E.; Huttula, M.; Heinaesmaeki, S.; Aksela, H.; Aksela, S.

    2007-01-01

    The Xe 4d -1 6p→5s 0 5p 6 6p and 5s 1 5p 5 6p resonant Auger transitions have been studied both theoretically and experimentally. High resolution resonant Auger spectra have been recoded with different photon bandwidths which have enabled to separate the first step Auger transition from the overlapping second step transitions. Theoretical calculations using multi-configuration Dirac-Fock approach with different configuration expansions were carried out, compared to each other and to the experiment. The calculations with the largest basis set were found to reproduce the distribution of the intensity to the main and satellite lines in both the 5s 0 5p 6 6p and 5s 1 5p 5 6p Auger groups reasonably well, and to predict the structure of the 4d -1 6p→5s 0 5p 6 6p main lines very well

  7. Aberration Correction in the Brewer Spectrophotometer

    International Nuclear Information System (INIS)

    Johnston, J.E.; Kerr, J.B.; McElroy, C.T.; Wardle, D.I.

    2000-01-01

    The optical design of the Brewer Spectrophotometer has been optimised for measurements in the 300-320 nm wavelength range. An aberration resolution limit that is much less than the 0.6 nm FWHM (full width at half maximum) is achieved by using an Ebert-Fastie spectrometer design, modified by the inclusion tilted lens that optimises performance at 310 nm. The small contribution of the remaining aberration to the measured instrument function is critical to radiometric measurement quality. Ramifications of this design to the development of instrumentation with enhanced scanning abilities are discussed. (author)

  8. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    Directory of Open Access Journals (Sweden)

    Hong Long

    Full Text Available The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins.

  9. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    Science.gov (United States)

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

    Science.gov (United States)

    El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

    2013-07-01

    Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.

  11. Effect of aberrations in human eye on contrast sensitivity function

    Science.gov (United States)

    Quan, Wei; Wang, Feng-lin; Wang, Zhao-qi

    2011-06-01

    The quantitative analysis of the effect of aberrations in human eye on vision has important clinical value in the correction of aberrations. The wave-front aberrations of human eyes were measured with the Hartmann-Shack wave-front sensor and modulation transfer function (MTF) was computed from the wave-front aberrations. Contrast sensitivity function (CSF) was obtained from MTF and the retinal aerial image modulation (AIM). It is shown that the 2nd, 3rd, 4th, 5th, 6th Zernike aberrations deteriorate contrast sensitivity function. When the 2nd, 3rd, 4th, 5th, 6th Zernike aberrations are corrected high contrast sensitivity function can be obtained.

  12. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  13. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

    Science.gov (United States)

    Kamina, Anyango D; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  14. Spectral estimation for characterization of acoustic aberration.

    Science.gov (United States)

    Varslot, Trond; Angelsen, Bjørn; Waag, Robert C

    2004-07-01

    Spectral estimation based on acoustic backscatter from a motionless stochastic medium is described for characterization of aberration in ultrasonic imaging. The underlying assumptions for the estimation are: The correlation length of the medium is short compared to the length of the transmitted acoustic pulse, an isoplanatic region of sufficient size exists around the focal point, and the backscatter can be modeled as an ergodic stochastic process. The motivation for this work is ultrasonic imaging with aberration correction. Measurements were performed using a two-dimensional array system with 80 x 80 transducer elements and an element pitch of 0.6 mm. The f number for the measurements was 1.2 and the center frequency was 3.0 MHz with a 53% bandwidth. Relative phase of aberration was extracted from estimated cross spectra using a robust least-mean-square-error method based on an orthogonal expansion of the phase differences of neighboring wave forms as a function of frequency. Estimates of cross-spectrum phase from measurements of random scattering through a tissue-mimicking aberrator have confidence bands approximately +/- 5 degrees wide. Both phase and magnitude are in good agreement with a reference characterization obtained from a point scatterer.

  15. The correction of electron lens aberrations

    Energy Technology Data Exchange (ETDEWEB)

    Hawkes, P.W., E-mail: peter.hawkes@cemes.fr

    2015-09-15

    The progress of electron lens aberration correction from about 1990 onwards is chronicled. Reasonably complete lists of publications on this and related topics are appended. A present for Max Haider and Ondrej Krivanek in the year of their 65th birthdays. By a happy coincidence, this review was completed in the year that both Max Haider and Ondrej Krivanek reached the age of 65. It is a pleasure to dedicate it to the two leading actors in the saga of aberration corrector design and construction. They would both wish to associate their colleagues with such a tribute but it is the names of Haider and Krivanek (not forgetting Joachim Zach) that will remain in the annals of electron optics, next to that of Harald Rose. I am proud to know that both regard me as a friend as well as a colleague. - Highlights: • Geometrical aberration correction. • Chromatic aberration correction. • 50 pm resolution. • High-resolution electron energy-loss spectroscopy. • Extensive bibliographies.

  16. Quality factor of aberrated gaussian laser beams

    CSIR Research Space (South Africa)

    Mafusire, C

    2010-09-01

    Full Text Available 15 20 25 30 35 M 4 © CSIR 2010 www.csir.co.za Conclusion • Laser beam quality depends on - y-Astigmatism - y-Coma - x-Coma - y-Triangular astigmatism - x-Triangular astigmatism - Spherical aberration...

  17. The correction of electron lens aberrations

    International Nuclear Information System (INIS)

    Hawkes, P.W.

    2015-01-01

    The progress of electron lens aberration correction from about 1990 onwards is chronicled. Reasonably complete lists of publications on this and related topics are appended. A present for Max Haider and Ondrej Krivanek in the year of their 65th birthdays. By a happy coincidence, this review was completed in the year that both Max Haider and Ondrej Krivanek reached the age of 65. It is a pleasure to dedicate it to the two leading actors in the saga of aberration corrector design and construction. They would both wish to associate their colleagues with such a tribute but it is the names of Haider and Krivanek (not forgetting Joachim Zach) that will remain in the annals of electron optics, next to that of Harald Rose. I am proud to know that both regard me as a friend as well as a colleague. - Highlights: • Geometrical aberration correction. • Chromatic aberration correction. • 50 pm resolution. • High-resolution electron energy-loss spectroscopy. • Extensive bibliographies

  18. Plant rDNA database: ribosomal DNA loci information goes online

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Garnatje, T.; Kovařík, Aleš

    2012-01-01

    Roč. 121, č. 4 (2012), s. 389-394 ISSN 0009-5915 R&D Projects: GA ČR(CZ) GAP501/10/0208; GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Keywords : rDNA loci * FISH * database Subject RIV: BO - Biophysics Impact factor: 3.340, year: 2012

  19. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

    Science.gov (United States)

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

    2014-05-01

    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  20. Non-random intrachromosomal distribution of radiation-induced chromatid aberrations in Vicia faba. [Aberration clustering

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, I; Rieger, R [Akademie der Wissenschaften der DDR, Gatersleben. Zentralinst. fuer Genetik und Kulturpflanzenforschung

    1976-04-01

    A reconstructed karyotype of Vicia faba, with all chromosomes individually distinguishable, was treated with X-rays, fast neutrons, (/sup 3/H) uridine (/sup 3/HU). The distribution within metaphase chromosomes of induced chromatid aberrations was non-random for all agents used. Aberration clustering, in part agent specific, occurred in chromosome segments containing heterochromatin as defined by the presence of G bands. The pattern of aberration clustering found after treatment with /sup 3/HU did not allow the recognition of chromosome regions active in transcription during treatment. Furthermore, it was impossible to obtain unambiguous indications of the presence of AT- and GC-base clusters from the patterns of /sup 3/HT- and /sup 3/HC-induced chromatid aberrations, respectively. Possible reasons underlying these observations are discussed.

  1. TRE5-A retrotransposition profiling reveals putative RNA polymerase III transcription complex binding sites on the Dictyostelium extrachromosomal rDNA element.

    Directory of Open Access Journals (Sweden)

    Thomas Spaller

    Full Text Available The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.

  2. Measuring and correcting aberrations of a cathode objective lens

    International Nuclear Information System (INIS)

    Tromp, R.M.

    2011-01-01

    In this paper I discuss several theoretical and practical aspects related to measuring and correcting the chromatic and spherical aberrations of a cathode objective lens as used in Low Energy Electron Microscopy (LEEM) and Photo Electron Emission Microscopy (PEEM) experiments. Special attention is paid to the various components of the cathode objective lens as they contribute to chromatic and spherical aberrations, and affect practical methods for aberration correction. This analysis has enabled us to correct a LEEM instrument for the spherical and chromatic aberrations of the objective lens. -- Research highlights: → Presents a comprehensive theory of the relation between chromatic aberration and lens current in a cathode objective lens. → Presents practical methods for measuring both spherical and chromatic aberrations of a cathode objective lens. → Presents measurements of these aberrations in good agreement with theory. → Presents practical methods for measuring and correcting these aberrations with an electron mirror.

  3. The prediction of spherical aberration with schematic eyes.

    Science.gov (United States)

    Liou, H L; Brennan, N A

    1996-07-01

    Many model eyes have been proposed; they differ in optical characteristics and therefore have different aberrations and image quality. In predicting the visual performance of the eye, we are most concerned with the central foveal vision. Spherical aberration is the only on-axis monochromatic aberration and can be used as a criterion to assess the degree of resemblance of eye models to the human eye. We reviewed and compiled experimental values of the spherical aberration of the eye, calculated the spherical aberration of several different categories of model eyes and compared the calculated results to the experimental data. Results show an over-estimation of spherical aberration by all models, the finite schematic eyes predicting values of spherical aberration closest to the experimental data. Current model eyes do not predict the average experimental values of the spherical aberration of the eye. A new model eye satisfying this assessment criterion is required for investigations of the visual performance of the eye.

  4. A populational survey of 45S rDNA polymorphism in the Jefferson salamander Ambystoma jeffersonianum revealed by fluorescence in situ hybridization (FISH

    Directory of Open Access Journals (Sweden)

    Jinzhong FU

    2009-04-01

    Full Text Available The chromosomal localization of 45S ribosomal RNA genes in Ambystoma jeffersonianum was determined by fluorescence in situ hybridization with 18S rDNA fragment as a probe (FISH-rDNA. Our results revealed the presence of rDNA polymorphism among A.jeffersonianum populations in terms of number, location and FISH signal intensity on the chromosomes. Nine rDNA cytotypes were found in ten geographically isolated populations and most of them contained derivative rDNA sites. Our preliminary study provides strong indication of karyotypic diversification of A.jeffersonianum that is demonstrated by intraspecific variation of 45S rDNA cytotypes. rDNA cytotype polymorphism has been described in many other caudate amphibians. We predict that habitat isolation, low dispersal ability and decline of effective population size could facilitate the fixation and accumulation of variable rDNA cytotypes during their chromosome evolution.

  5. Similar patterns of rDNA evolution in synthetic and recently formed natural populations of Tragopogon (Asteraceae allotetraploids

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2010-09-01

    Full Text Available Abstract Background Tragopogon mirus and T. miscellus are allotetraploids (2n = 24 that formed repeatedly during the past 80 years in eastern Washington and adjacent Idaho (USA following the introduction of the diploids T. dubius, T. porrifolius, and T. pratensis (2n = 12 from Europe. In most natural populations of T. mirus and T. miscellus, there are far fewer 35S rRNA genes (rDNA of T. dubius than there are of the other diploid parent (T. porrifolius or T. pratensis. We studied the inheritance of parental rDNA loci in allotetraploids resynthesized from diploid accessions. We investigate the dynamics and directionality of these rDNA losses, as well as the contribution of gene copy number variation in the parental diploids to rDNA variation in the derived tetraploids. Results Using Southern blot hybridization and fluorescent in situ hybridization (FISH, we analyzed copy numbers and distribution of these highly reiterated genes in seven lines of synthetic T. mirus (110 individuals and four lines of synthetic T. miscellus (71 individuals. Variation among diploid parents accounted for most of the observed gene imbalances detected in F1 hybrids but cannot explain frequent deviations from repeat additivity seen in the allotetraploid lines. Polyploid lineages involving the same diploid parents differed in rDNA genotype, indicating that conditions immediately following genome doubling are crucial for rDNA changes. About 19% of the resynthesized allotetraploid individuals had equal rDNA contributions from the diploid parents, 74% were skewed towards either T. porrifolius or T. pratensis-type units, and only 7% had more rDNA copies of T. dubius-origin compared to the other two parents. Similar genotype frequencies were observed among natural populations. Despite directional reduction of units, the additivity of 35S rDNA locus number is maintained in 82% of the synthetic lines and in all natural allotetraploids. Conclusions Uniparental reductions of

  6. Theoretical investigation of aberrations upon ametropic human eyes

    Science.gov (United States)

    Tan, Bo; Chen, Ying-Ling; Lewis, J. W. L.; Baker, Kevin

    2003-11-01

    The human eye aberrations are important for visual acuity and ophthalmic diagnostics and surgical procedures. Reported monochromatic aberration data of the normal 20/20 human eyes are scarce. There exist even fewer reports of the relation between ametropic conditions and aberrations. We theoretically investigate the monochromatic and chromatic aberrations of human eyes for refractive errors of -10 to +10 diopters. Schematic human eye models are employed using optical design software for axial, index, and refractive types of ametropia.

  7. Formation of diploid and triploid hybrid groupers (hybridization of Epinephelus coioides ♀ × Epinephelus lanceolatus ♂) and their 5S gene analysis.

    Science.gov (United States)

    Huang, Wen; Qin, Qinbo; Yang, Huirong; Li, Shuisheng; Hu, Chaoqun; Wang, Yude; Zhang, Yong; Liu, Shaojun; Lin, Haoran

    2016-10-07

    Interspecies hybridization is widely used to achieve heterosis or hybrid vigor, which has been observed and harnessed by breeders for centuries. Natural allopolyploid hybrids generally exhibit more superior heterosis than both the diploid progenies and their parental species. However, polyploid formation processes have been long ignored, the genetic basis of heterosis in polyploids remains elusive. In the present study, triploid hybrids had been demonstrated to contain two sets of chromosomes from mother species and one set from father species. Cellular polyploidization process in the embryos had been traced. The triploid hybrids might be formed by failure formation of the second polarized genome during the second meiosis stage. Four spindle centers were observed in anaphase stage of the first cell division. Three spindle centers were observed in side of cell plate after the first cell division. The 5S rDNA genes of four types of groupers were cloned and analyzed. The diploid and triploid hybrids had been proved to contain the tandem chimera structures which were recombined by maternal and paternal monomer units. The results indicated that genome re-fusion had occurred in the hybrid progenies. To further elucidate the genetic patterns of diploid and triploid hybrids, fluorescence chromosome location had been carried out, maternal 5S gene (M-386) were used as the probe. The triploid hybrids contained fewer fluorescence loci numbers than the maternal species. The results indicated that participation of paternal 5S gene in the triploid hybrid genome had degraded the match rates of M-386 probe. Our study is the first to investigate the cellular formation processes of natural allopolyploids in hybrid fish, the cellular polyploidization process may be caused by failure formation of the second polarized genome during the meiosis, and our results will provide the molecular basis of hybrid vigor in interspecies hybridization.

  8. Ocular higher-order aberrations in a school children population

    Directory of Open Access Journals (Sweden)

    George Papamastorakis

    2015-04-01

    Conclusions: Differences in the low levels of ocular spherical aberration in young children possibly reflect differences in lenticular spherical aberration and relate to the gradient refractive index of the lens. The evaluation of spherical aberration at certain stages of eye growth may help to better understand the underlying mechanisms of myopia development.

  9. Coronary artery with aberrant origin malignant right

    International Nuclear Information System (INIS)

    Ozcan, E.; Bozlar, U.; Demirkol, S.; Saglam, M.

    2012-01-01

    Full text: Introduction: Congenital anomalies of the coronary arteries is a major cause of sudden death, especially in young patients. Objectives and tasks: In this study we aim to present a young patient with chest pain who had malignant right coronary artery (RCA) with aberrant origin. Materials and methods: 24-year-old man who applied cardiology clinic for chest pain and palpitations especially after exercise, was referred to our clinic for coronary computed tomography (CT) angiography to evaluate coronary artery anomalies. Results: In CT angiography; we detected aberrant RCA with origin of tubularly part of ascendant aorta with a malignant course between aorta and pulmonary artery. Left main coronary artery, left anterior descending and circumflex artery had normal origin and course. Conclusion: Coronary artery with malignant course may cause sudden death especially after exercise. Coronary CT angiography has an important role in diagnosis of congenital coronary artery anomalies, with high resolution multiplanner reformatted images

  10. Assessing the construct validity of aberrant salience

    Directory of Open Access Journals (Sweden)

    Kristin Schmidt

    2009-12-01

    Full Text Available We sought to validate the psychometric properties of a recently developed paradigm that aims to measure salience attribution processes proposed to contribute to positive psychotic symptoms, the Salience Attribution Test (SAT. The “aberrant salience” measure from the SAT showed good face validity in previous results, with elevated scores both in high-schizotypy individuals, and in patients with schizophrenia suffering from delusions. Exploring the construct validity of salience attribution variables derived from the SAT is important, since other factors, including latent inhibition/learned irrelevance, attention, probabilistic reward learning, sensitivity to probability, general cognitive ability and working memory could influence these measures. Fifty healthy participants completed schizotypy scales, the SAT, a learned irrelevance task, and a number of other cognitive tasks tapping into potentially confounding processes. Behavioural measures of interest from each task were entered into a principal components analysis, which yielded a five-factor structure accounting for ~75% percent of the variance in behaviour. Implicit aberrant salience was found to load onto its own factor, which was associated with elevated “Introvertive Anhedonia” schizotypy, replicating our previous finding. Learned irrelevance loaded onto a separate factor, which also included implicit adaptive salience, but was not associated with schizotypy. Explicit adaptive and aberrant salience, along with a measure of probabilistic learning, loaded onto a further factor, though this also did not correlate with schizotypy. These results suggest that the measures of learned irrelevance and implicit adaptive salience might be based on similar underlying processes, which are dissociable both from implicit aberrant salience and explicit measures of salience.

  11. Aberrant PO2 values in proficiency testing.

    Science.gov (United States)

    Fonzi, C E; Clausen, J L; Mahoney, J

    1993-03-01

    We prospectively determined the frequency of aberrant vials of fluorocarbon/buffer used for proficiency testing of measurements of pH, PCO2, and PO2, using 20 duplicate vials from 12 lots of fluorocarbon/buffer and two arterial blood gas analyzers in eight reference laboratories. We defined aberrant vials as vials for which both duplicate measurements differed from the mean value of repeated measurements for the specific instrument (for each lot of testing materials) by > 0.04 for pH, > 10% of the mean or 3.0 mm Hg, whichever was greater, for PCO2; or > 10% of the mean or 6 mm Hg, whichever was greater, for PO2. Four of 1620 vials (0.25%) were aberrant, all based on PO2 measurements (range of mean values: pH, 7.181-7.631; PCO2, 12.7-65.9; PO2, 32.5-150.1) were 0.0055 for pH, 0.67 mm Hg for PCO2, and 1.65 mm Hg for PO2. Deliberate contamination of the fluorocarbon emulsion with room air, as might occur during sampling from the vial, indicated that only minor increases in PO2 (e.g., 1.0 mm Hg at PO2 of 56 mm Hg) occur when samples are aspirated. Larger increases in PO2 (mean 7.1 mm Hg at a PO2 of 66 mm Hg) occurred when the syringe samples were contaminated with room air. We conclude that isolated aberrant measurements of PO2 in blood gas proficiency testing attributable to vial contents can occur, but the frequency is very low.

  12. Achieve Sustainable Hospital Excellence Through 5-S in an Emergency Department in Hong Kong

    Directory of Open Access Journals (Sweden)

    Tsoi Vincent F. K.

    2014-11-01

    Full Text Available 5-S is the first step towards TQM. Over the last century, the Japanese have formalised the technique and named it as 5-S Practice. Since 1993, Sam Ho has improved and defined its terms in English/Chinese and developed the world's first 5-S Audit Checklist. In the article, an emergency department of a Hong Kong hospital was examined against 5-S 50-point Checklist for the improvement of their quality assurance systems towards its accreditation process with Australian standards. The findings evidently reveal that the impact of 5-S on hospital quality assurance in the unit are positive. Riding on the above scenario, the research aim is to identify whether the 5-S practice is a suitable and effective tool for healthcare quality assurance in an emergency setting which is led towards its accreditation process set by other mechanisms.

  13. Study of radiation-induced chromosomal aberrations

    International Nuclear Information System (INIS)

    Wolfring, E.

    2004-06-01

    A method for determining chromosomal aberrations was established for the purpose of examining the relative biological effectiveness (RBE) of photon radiation with respect to mammary epithelium cells. Cells were exposed to 25 kV X-radiation and to 200 kV X-radiation for comparison and the resulting concentrations of chromosomal aberrations were compared. The RBE M value for radiation-induced fragmentation was found to be 4.2 ± 2.4, while the RBE M value for radiation-induced generation of dicentric chromosomes was found to be 0.5 ± 0.5. In addition to the evaluation of chromosomal aberrations the number of cell cycles undergone by the cells was monitored by means of BrDU staining. As expected, the proportion of cells which underwent more than one cell cycle following exposure to 5 Gy was very low in both cases, amounting to 1.9% (25 kV) and 3.2 (200 kV). Non-radiated cells yielded control values of 26.0% and 12.6%, suggesting variations in external conditions from day to day

  14. Chromosome aberration assays in barley (Hordeum vulgare)

    Energy Technology Data Exchange (ETDEWEB)

    Constantin, M J [Univ. of Tennessee, Knoxville; Nilan, R A

    1982-01-01

    Barley is an exceellent organism for studies of induced chromosome aberrations because of its few (2n = 2x = 14) relatively large chromosomes. Root-tip and shoot-tip cells have been used extensively for the study of ionizing radiation-induced chromosome aberrations. The general procedures are well known, the technology is simple and easy to learn, and the assays are relatively quick and inexpensive. Both root tips and shoot tips can be used for the study of chemical mutagens as well as ionizing radiations. Pollen mother cells are well suited for studying the effects of mutagens on meiotic chromosomes. The literature review for the Gene-Tox Program reported on 61 chemicals tested for their effects on barley chromosomes. Of these, 90% were reported to be either positive or positive dose-related, while 7% were negative and 3% were questionable. Barley assays based on chromosomal aberrations are useful to detect the clastogenic potency of chemicals under laboratory conditions. Indications are that the data from barley can be used to corroborate data obtained from other organisms. Among the classes of chemicals assayed were: alcohols and phenols; alkaloids; epoxides; alkyl sulfates; amides and sulfonamides; aromatic amines; aryl halides; aziridines; alkenes; carbamates; hydroazides; nitroaromatics; nitrosamides; nitrosources; phenothiazines; and polycyclic aromatic hydrocarbons.

  15. Aberrant phenotypes in peripheral T cell lymphomas.

    Science.gov (United States)

    Hastrup, N; Ralfkiaer, E; Pallesen, G

    1989-01-01

    Seventy six peripheral T cell lymphomas were examined immunohistologically to test their reactivity with a panel of monoclonal antibodies against 11 T cell associated antigens (CD1-8, CD27, UCHL1, and the T cell antigen receptor). Sixty two (82%) lymphomas showed aberrant phenotypes, and four main categories were distinguished as follows: (i) lack of one or several pan-T cell antigens (49, 64% of the cases); (ii) loss of both the CD4 and CD8 antigens (11, 15% of the cases); (iii) coexpression of the CD4 and CD8 antigens (13, 17% of the cases); and (iv) expression of the CD1 antigen (eight, 11% of the cases). No correlation was seen between the occurrence of aberrant phenotypes and the histological subtype. It is concluded that the demonstration of an aberrant phenotype is a valuable supplement to histological assessment in the diagnosis of peripheral T cell lymphomas. It is recommended that the panel of monoclonal antibodies against T cell differentiation antigens should be fairly large, as apparently any antigen may be lost in the process of malignant transformation. Images Figure PMID:2469701

  16. The 5S methodology as a tool for improving the organisation

    OpenAIRE

    J. Michalska; D. Szewieczek

    2007-01-01

    Purpose: The aim of this paper is showing the 5S methodology. In this paper it was introduced the way of implementing the 5S methodology in the company.Design/methodology/approach: In the frames of own research it has been analysed and implemented the 5S rules in the production process.Findings: On the basis of the own research it can be stated, that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs’ reduction, increasing of effectivene...

  17. Interaction of higher plant ribosomal 5S RNAs with ''Xenopus laevis'' transcriptional factor IIIA

    International Nuclear Information System (INIS)

    Barciszewska, M.Z.

    1994-01-01

    In this paper transcriptional factor IIIA (TFIIIA) has been used as a probe for identity of three-dimensional-structure of eukaryotic 5S rRNAs. I was interested in finding a common motif in plant and ''Xenopus'' 5S rRNAs for TFIIIA recognition. I found that the two eukaryotic 5S rRNAs (from wheat germ and lupin seeds) are recognized by ''X. laevis'' TFIIIA and the data clearly suggest that these 5S rRNAs have very similar if not identical three-dimensional structures. Also effects of various conditions on stability of these complexes have been studied. (author). 30 refs, 6 figs, 1 tab

  18. Manifestation of Strongly Delocalized Atomic States in the 5s Photoionization of Xenon

    International Nuclear Information System (INIS)

    Schmoranzer, H.; Lauer, S.; Vollweiler, F.; Reichardt, G.; Schartner, K.; Mentzel, G.; Wilhelmi, O.; Sukhorukov, V.L.; Lagutin, B.M.; Petrov, I.D.

    1997-01-01

    The photoionization (PI) of the Xe atom was investigated in the vicinity of the 5s -shell threshold by photon-induced fluorescence spectroscopy. The highest resolution so far attained of 2meV enabled us to observe a new series of resonance structures in the 5s -PI cross section closely above threshold. Calculations of the partial 5s - and 5p -PI cross sections were performed taking into account many-electron correlations. These structures were related with strongly delocalized f -resonances which affect the 5s -PI cross section due to their mixing with p -resonances. copyright 1997 The American Physical Society

  19. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  20. 4p-5s transitions in In XIII, In XIV and In XV

    International Nuclear Information System (INIS)

    Carroll, P.K.; Costello, J.T.; O'Sullivan, G.

    1986-01-01

    The spectrum of an indium plasma produced by a 1.5 J, 25 ns ruby laser was recorded in the XUV. At wavelengths below 100 A, the spectrum is dominated by 4p-5s transitions in a number of ion stages. Many lines arising from 4p 6 4d-4p 5 4d5s, 4p 6 -4p 5 5s and 4p 5 -4p 4 5s transitions in In XIII, In XIV and In XV have been identified by isoelectronic extrapolation and Dirac-Fock calculations. (orig.)

  1. Implementation Of 5S Methodology In The Small Scale Industry A Case Study

    Directory of Open Access Journals (Sweden)

    R. S. Agrahari

    2015-04-01

    Full Text Available Abstract 5S is a basic foundation of Lean Manufacturing systems. It is a tool for cleaning sorting organizing and providing the necessary groundwork for workpiece improvement. This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping. The improvements before and after 5S implementation is shown by pictures in the paper. It also intends to build a stronger work ethic within the management and workers who would be expected to continue the good practices.

  2. Implementation Of 5S Quality Tool In Manufacturing Company A Case Study

    Directory of Open Access Journals (Sweden)

    Vibhor Kakkar

    2015-02-01

    Full Text Available Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivity of the company is enhanced to 91 .

  3. Nodal aberration theory for wild-filed asymmetric optical systems

    Science.gov (United States)

    Chen, Yang; Cheng, Xuemin; Hao, Qun

    2016-10-01

    Nodal Aberration Theory (NAT) was used to calculate the zero field position in Full Field Display (FFD) for the given aberration term. Aiming at wide-filed non-rotational symmetric decentered optical systems, we have presented the nodal geography behavior of the family of third-order and fifth-order aberrations. Meanwhile, we have calculated the wavefront aberration expressions when one optical element in the system is tilted, which was not at the entrance pupil. By using a three-piece-cellphone lens example in optical design software CodeV, the nodal geography is testified under several situations; and the wavefront aberrations are calculated when the optical element is tilted. The properties of the nodal aberrations are analyzed by using Fringe Zernike coefficients, which are directly related with the wavefront aberration terms and usually obtained by real ray trace and wavefront surface fitting.

  4. DNA Repair Defects and Chromosomal Aberrations

    Science.gov (United States)

    Hada, Megumi; George, K. A.; Huff, J. L.; Pluth, J. M.; Cucinotta, F. A.

    2009-01-01

    Yields of chromosome aberrations were assessed in cells deficient in DNA doublestrand break (DSB) repair, after exposure to acute or to low-dose-rate (0.018 Gy/hr) gamma rays or acute high LET iron nuclei. We studied several cell lines including fibroblasts deficient in ATM (ataxia telangiectasia mutated; product of the gene that is mutated in ataxia telangiectasia patients) or NBS (nibrin; product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase (DNA-PK) activity. Chromosomes were analyzed using the fluorescence in situ hybridization (FISH) chromosome painting method in cells at the first division post irradiation, and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma irradiation induced greater yields of both simple and complex exchanges in the DSB repair-defective cells than in the normal cells. The quadratic dose-response terms for both simple and complex chromosome exchanges were significantly higher for the ATM- and NBS-deficient lines than for normal fibroblasts. However, in the NBS cells the linear dose-response term was significantly higher only for simple exchanges. The large increases in the quadratic dose-response terms in these repair-defective cell lines points the importance of the functions of ATM and NBS in chromatin modifications to facilitate correct DSB repair and minimize the formation of aberrations. The differences found between ATM- and NBS-deficient cells at low doses suggest that important questions should with regard to applying observations of radiation sensitivity at high dose to low-dose exposures. For aberrations induced by iron nuclei, regression models preferred purely linear dose responses for simple exchanges and quadratic dose responses for complex exchanges. Relative biological effectiveness (RBE) factors of all of

  5. Comparing the potential for identification of lactobacillus spp. of 16s rDNA variable regions

    International Nuclear Information System (INIS)

    Riano Pachon, Diego Mauricio; Vanegas Lopez, Maria Consuelo; Gonzalez Garcia, Laura Natalia

    2013-01-01

    16s rDNA is used for bacterial identification because its variation rate between species allows differentiation. The gene for this ribosomal subunit has 9 variable regions and some of them give more information than others. We were interested in evaluating the potential for species identification of each region and their combinations. We extracted the V1 to V8 regions of 16s rDNA from different strains and species of Lactobacillus and analyzed them using STAP (ss-RNA Taxonomy Assigning Pipeline) and RDP (Ribosomal Database Project) multiclassifier packages. Phylogenetic trees obtained by maximum likelihood analyses were compared. Classification results show that many regions give the correct genus classification using RDP and STAP; however they are not enough to classify up to the level of species. V5V6 region presents the highest quantity of informative fragments but also present the highest rate of false negatives. V1V3 region presents the highest rate of true positives (species) using STAP and the region V5V8 in RDP (genus).The phylogenetic result shows that the reference topology could be obtained using different combination of regions as V1V3 and V1V8.The experimental validation was done using commercial strains from a probiotic tampon. Sequencing analysis show that the V1V3 region gives the same information and result as the complete 16s rDNA; the three isolated strains correspond to the strains indicated in the product. We conclude that the V1V3 region is the minimum required region to classify Lactobacillus spp. in the correct way and this region is useful in metagenomics to analyze probiotics samples.

  6. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  7. The prohibition order according to paragraph 5 S. 4 EnWG; Die Untersagungsverfuegung nach paragraph 5 S. 4 EnWG

    Energy Technology Data Exchange (ETDEWEB)

    Rauch, Karsten [WSW Netz GmbH, Wuppertal (Germany)

    2011-02-10

    The introduction of prosecutorial investigation on suspicion of delaying the insolvency proceedings published in the autumn 2010 results to a general question of whether and to what extent a concomitant intervention of the regulatory authorities is indicated. Central to this are the basis for authorization given in paragraph 5 S. 4 Energy Economy Law and the related prohibition authority.

  8. Decay rate ratios of Υ(5S)→B anti B reactions

    International Nuclear Information System (INIS)

    Hwang, Dae Sung; Son, Hyungsuk

    2010-01-01

    We calculate the decay rate ratios for OZI allowed decays of Υ(5S) to two B mesons by using the decay amplitudes which incorporate the wave function of the Υ(5S) state. We obtain the result that the branching ratio of the Υ(5S) decay to B s * anti B s * is much larger than the branching ratio to B s anti B s * or anti B s B s * , in good agreement with the recent experimental results of CLEO and BELLE. This agreement with the experimental results is made possible since the nodes of the Υ(5S) radial wave function induce the nodes of the decay amplitude. We find that the results for the Υ(5S) decays to B u (*) anti B u (*) or B d (*) anti B d (*) pairs are sensitive to the parameter values used for the potential between heavy quarks. (orig.)

  9. How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?

    International Nuclear Information System (INIS)

    Pelczar, P.; Fiett, J.; Bartnik, E.

    1994-01-01

    We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig

  10. The 5S lean method as a tool of industrial management performances

    Science.gov (United States)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  11. The transitions 4p-5s in Y VI, Zr VII, Nb VIII and Mo IX

    International Nuclear Information System (INIS)

    Chaghtai, M.S.Z.; Rahimullah, K.; Khatoon, S.

    1976-01-01

    With the help of the spectra recorded in the Physics Department of Lund University, Y VI, Zr VII, Nb VIII and Mo IX are freshly analysed. The five 4s 2 4p 4 ground levels and the ten 4s 2 4p 3 5s levels of previous analyses are confirmed in the first three spectra, except for revising in Y VI the 4p 4 1 S 0 and 4p 3 5s( 4 Ssub(3/2)) 2 levels and interchanging 5s( 2 Dsub(3/2)) 1 with 5s( 2 Dsub(3/2)) 2 . All level values are improved due to the new measurements. A new analysis of Mo IX establishing all the 4p 4 and 4p 3 5s levels is being reported. (Auth.)

  12. The β-1,3-glucanosyltransferase Gas1 regulates Sir2-mediated rDNA stability in Saccharomyces cerevisiae.

    Science.gov (United States)

    Ha, Cheol Woong; Kim, Kwantae; Chang, Yeon Ji; Kim, Bongkeun; Huh, Won-Ki

    2014-07-01

    In Saccharomyces cerevisiae, the stability of highly repetitive rDNA array is maintained through transcriptional silencing. Recently, a β-1,3-glucanosyltransferase Gas1 has been shown to play a significant role in the regulation of transcriptional silencing in S. cerevisiae. Here, we show that the gas1Δ mutation increases rDNA silencing in a Sir2-dependent manner. Remarkably, the gas1Δ mutation induces nuclear localization of Msn2/4 and stimulates the expression of PNC1, a gene encoding a nicotinamidase that functions as a Sir2 activator. The lack of enzymatic activity of Gas1 or treatment with a cell wall-damaging agent, Congo red, exhibits effects similar to those of the gas1Δ mutation. Furthermore, the loss of Gas1 or Congo red treatment lowers the cAMP-dependent protein kinase (PKA) activity in a cell wall integrity MAP kinase Slt2-dependent manner. Collectively, our results suggest that the dysfunction of Gas1 plays a positive role in the maintenance of rDNA integrity by decreasing PKA activity and inducing the accumulation of Msn2/4 in the nucleus. It seems that nuclear-localized Msn2/4 stimulate the expression of Pnc1, thereby enhancing the association of Sir2 with rDNA and promoting rDNA stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

    Science.gov (United States)

    McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

    2008-10-01

    The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

  14. Molecular technique reveals high variability of 18S rDNA distribution in harvestmen (Opiliones, Phalangiidae) from South Africa.

    Science.gov (United States)

    Šťáhlavský, František; Opatova, Vera; Just, Pavel; Lotz, Leon N; Haddad, Charles R

    2018-01-01

    The knowledge of cytogenetics in the harvestmen family Phalangiidae has been based on taxa from the Northern Hemisphere. We performed cytogenetic analysis on Guruia africana (Karsch, 1878) (2n=24) and four species of the genus Rhampsinitus Simon, 1879 (2n=24, 26, 34) from South Africa. Fluorescence in situ hybridization with an 18S rDNA probe was used to analyze the number and the distribution of this cluster in the family Phalangiidae for the first time. The results support the cytogenetic characteristics typical for the majority of harvestmen taxa, i.e. the predominance of small biarmed chromosomes and the absence of morphologically well-differentiated sex chromosomes as an ancestral state. We identified the number of 18S rDNA sites ranging from two in R. qachasneki Kauri, 1962 to seven in one population of R. leighi Pocock, 1903. Moreover, we found differences in the number and localization of 18S rDNA sites in R. leighi between populations from two localities and between sexes of R. capensis (Loman, 1898). The heterozygous states of the 18S rDNA sites in these species may indicate the presence of XX/XY and ZZ/ZW sex chromosomes, and the possible existence of these systems in harvestmen is discussed. The variability of the 18S rDNA sites indicates intensive chromosomal changes during the differentiation of the karyotypes, which is in contrast to the usual uniformity in chromosomal morphology known from harvestmen so far.

  15. Different patterns of rDNA distribution in Pisum sativum nucleoli correlate with different levels of nucleolar activity

    International Nuclear Information System (INIS)

    Highett, M.I.; Rawlins, D.J.; Shaw, P.J.

    1993-01-01

    We have used in situ hybridization with probes to rDNA, labelled either with digoxygenin or directly with fluorescein, to determine the arrangement of these genes within the nucleoli of Pisum sativum L. root cells. Confocal laser scanning microscopy was used to image the three-dimensional structures revealed, but we have also compared this technique with deconvolution of conventional (wide-field) fluorescence images measured with a cooled CCD camera, and have shown that the results are remarkably similar. When the deconvolution technique was applied to the confocal data it gave clearer images than could be achieved by confocal microscopy alone. We have analysed the distribution of rDNA in the different cell types observable in root tips: the quiescent centre; active meristematic cells; and relatively differentiated root cap, epidermal and cortical cells. In addition to four perinucleolar knobs of condensed, inactive rDNA genes, corresponding to the four nucleolar organizers in P. sativum, which were the most brightly labelled structures, several characteristic patterns of intranucleolar labelling were apparent, including bright foci, large central chromatin masses, and fine, decondensed interconnecting fibres. The larger and more active the nucleolus, the smaller the proportion of condensed perinucleolar rDNA. In some large and active meristematic nucleoli, all the internal rDNA is decondensed, showing that transcription cannot be restricted to the bright foci, and is most likely to occur on the decondensed fibres. (author)

  16. Evolutionary insight on localization of 18S, 28S rDNA genes on homologous chromosomes in Primates genomes

    Science.gov (United States)

    Mazzoleni, Sofia; Rovatsos, Michail; Schillaci, Odessa; Dumas, Francesca

    2018-01-01

    Abstract We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH) in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876) (Scandentia), in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates. PMID:29416829

  17. Evolutionary insight on localization of 18S, 28S rDNA genes on homologous chromosomes in Primates genomes

    Directory of Open Access Journals (Sweden)

    Sofia Mazzoleni

    2018-01-01

    Full Text Available We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876 (Scandentia, in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates.

  18. Ultrastructural and autoradiographic studies of nucleolar development and rDNA transcription in preimplantation mouse embryos

    Energy Technology Data Exchange (ETDEWEB)

    Geuskens, M.; Alexandre, H. (Universite Libre de Bruxelles (Belgium). Dep. de Biologie Moleculaire)

    1984-06-01

    The development of the nucleoli and the sites of rDNA transcription have been studies by high-resolution autoradiography during the cleavage stages of mouse embryos. The appearance of fibrillar centres at the periphery of the fibrillar primary nucleoli has been observed at the 4-cell stage. Several fibrillar centres interconnected by electron-dense fibrillar strands, form a reticulated region around the fibrillar mass at the 6- to 8-cell stage. After a 10 min pulse with (/sup 3/H)uridine, only this peripheral network is labelled. At the late morula and at the blastocyst stage, the fibrillar component (nucleolonema) of the reticulated nucleoli is labelled after 10 min (/sup 3/H)uridine incorporation. When the embryos are reincubated for 2 h in cold medium, the label is localized mainly in the granular component. Fibrillar centres are not labelled. Autoradiograms of in vitro developed embryos pulsed for 2 h with (/sup 3/H)uridine confirm that the central fibrillar core of the nucleoli of 6- to 8-cell embryos is never labelled. Thus, the fibrillar constituent of this core is not homologous to the fibrillar component of the nucleoli of later stage embryos, which is the site of active rDNA transcription. An interpretation of nucleologenesis during early mouse embryogenesis is proposed.

  19. Ultrastructural and autoradiographic studies of nucleolar development and rDNA transcription in preimplantation mouse embryos

    International Nuclear Information System (INIS)

    Geuskens, M.; Alexandre, H.

    1984-01-01

    The development of the nucleoli and the sites of rDNA transcription have been studies by high-resolution autoradiography during the cleavage stages of mouse embryos. The appearance of fibrillar centres at the periphery of the fibrillar primary nucleoli has been observed at the 4-cell stage. Several fibrillar centres interconnected by electron-dense fibrillar strands, form a reticulated region around the fibrillar mass at the 6- to 8-cell stage. After a 10 min pulse with ( 3 H)uridine, only this peripheral network is labelled. At the late morula and at the blastocyst stage, the fibrillar component (nucleolonema) of the reticulated nucleoli is labelled after 10 min ( 3 H)uridine incorporation. When the embryos are reincubated for 2 h in cold medium, the label is localized mainly in the granular component. Fibrillar centres are not labelled. Autoradiograms of in vitro developed embryos pulsed for 2 h with ( 3 H)uridine confirm that the central fibrillar core of the nucleoli of 6- to 8-cell embryos is never labelled. Thus, the fibrillar constituent of this core is not homologous to the fibrillar component of the nucleoli of later stage embryos, which is the site of active rDNA transcription. An interpretation of nucleologenesis during early mouse embryogenesis is proposed. (author)

  20. Asymmetric epigenetic modification and elimination of rDNA sequences by polyploidization in wheat.

    Science.gov (United States)

    Guo, Xiang; Han, Fangpu

    2014-11-01

    rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. © 2014 American Society of Plant Biologists. All rights reserved.

  1. [Phylogenetic relationships among the genera of Taxodiaceae and Cupressaceae from 28S rDNA sequences].

    Science.gov (United States)

    Li, Chun-Xiang; Yang, Qun

    2003-03-01

    DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.

  2. Nonviral Gene Targeting at rDNA Locus of Human Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Youjin Hu

    2013-01-01

    Full Text Available Background. Genetic modification, such as the addition of exogenous genes to the MSC genome, is crucial to their use as cellular vehicles. Due to the risks associated with viral vectors such as insertional mutagenesis, the safer nonviral vectors have drawn a great deal of attention. Methods. VEGF, bFGF, vitamin C, and insulin-transferrin-selenium-X were supplemented in the MSC culture medium. The cells’ proliferation and survival capacity was measured by MTT, determination of the cumulative number of cells, and a colony-forming efficiency assay. The plasmid pHr2-NL was constructed and nucleofected into MSCs. The recombinants were selected using G418 and characterized using PCR and Southern blotting. Results. BFGF is critical to MSC growth and it acted synergistically with vitamin C, VEGF, and ITS-X, causing the cells to expand significantly. The neomycin gene was targeted to the rDNA locus of human MSCs using a nonviral human ribosomal targeting vector. The recombinant MSCs retained multipotential differentiation capacity, typical levels of hMSC surface marker expression, and a normal karyotype, and none were tumorigenic in nude mice. Conclusions. Exogenous genes can be targeted to the rDNA locus of human MSCs while maintaining the characteristics of MSCs. This is the first nonviral gene targeting of hMSCs.

  3. Survival and transmission of symmetrical chromosomal aberrations

    International Nuclear Information System (INIS)

    Savage, J.R.K.

    1979-01-01

    The interaction between the lesions to produce chromosomal structural changes may be either asymmetrical (A) or symmetrical (S). In A, one or more acentric fragments are always produced, and there may also be the mechanical separation problems resulting from bridges at anaphase, while S-changes never produce fragment, and pose no mechanical problem in cell division. If A and S events occur with equal frequency, it might be an indication that they are truly the alternative modes of lesion interaction. Unstimulated lymphocytes were irradiated with 2.68 Gy 250 kV X-ray, and metaphases were sampled at 50 h after the stimulation. Preparations were complete diploid cells, and any obvious second division cells were rejected. So far as dermal repair and fibroblast functions are concerned, aberration burden seems to have little consequence from the view-point of the long-term survival in vivo. Large numbers of aberrations (mainly S translocation and terminal deletion) were found in the samples taken up to 60 years after therapy. Skin biopsies were removed 1 day and 6 months after irradiation and cultured. In irradiated cells, reciprocal translocations dominated, followed by terminal deletions, then inversions, while no chromosome-type aberration was seen in the control cells. a) The relative occurrence of A : S changes, b) long-term survival in vivo, c) the possibility of in vivo repair, and d) some unusual features of translocation found in Syrian hamsters are reviewed. The relevance or importance of major S events is clearly dependent upon the cells, the tissues or the organisms in which they occur. (Yamashita, S.)

  4. Altered gravity influences rDNA and NopA100 localization in nucleoli

    Science.gov (United States)

    Sobol, M. A.; Kordyum, E. L.

    Fundamental discovery of gravisensitivity of cells no specified to gravity perception focused increasing attention on an elucidation of the mechanisms involved in altered gravity effects at the cellular and subcellular levels. The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts with ribosomal and nonribosomal proteins. The mechanisms inducing the changes in the subcomponents of the nucleolus that is morphologically defined yet highly dynamic structure are still unknown in detail. To understand the functional organization of the nucleolus as in the control as under altered gravity conditions it is essential to determine both the precise location of rDNA and the proteins playing the key role in rRNA processing. Lepidium sativum seeds were germinated in 1% agar medium on the slow horizontal clinostat (2 rpm) and in the stationary conditions. We investigated the root meristematic cells dissected from the seedlings grown in darkness for two days. The investigations were carried out with anti-DNA and anti-NopA100 antibodies labeling as well as with TdT procedure, and immunogold electron microscopy. In the stationary growth conditions, the anti-DNA antibody as well TdT procedure were capable of detecting fibrillar centers (FCs) and the dense fibrillar component (DFC) in the nucleolus. In FCs, gold particles were revealed on the condensed chromatin inclusions, internal fibrils of decondensed rDNA and the transition zone FC-DFC. Quantitatively, FCs appeared 1,5 times more densely labeled than DFC. NopA100 was localized in FCs and in DFC. In FCs, the most of protein was revealed in the transition zone FC-DFC. After a quantitative study, FCs and the transition zone FC-DFC appeared to contain NopA100 1,7 times more than DFC. Under the conditions of altered gravity, quantitative data clearly showed a redistribution of nucleolar DNA and NopA100 between FCs and DFC in comparison with the control. In

  5. Distribution of 45S rDNA in Modern Rose Cultivars (Rosa hybrida), Rosa rugosa, and Their Interspecific Hybrids Revealed by Fluorescence in situ Hybridization.

    Science.gov (United States)

    Ding, Xiao-Liu; Xu, Ting-Liang; Wang, Jing; Luo, Le; Yu, Chao; Dong, Gui-Min; Pan, Hui-Tang; Zhang, Qi-Xiang

    2016-01-01

    To elucidate the evolutionary dynamics of the location and number of rDNA loci in the process of polyploidization in the genus Rosa, we examined 45S rDNA sites in the chromosomes of 6 modern rose cultivars (R. hybrida), 5 R. rugosa cultivars, and 20 hybrid progenies by fluorescence in situ hybridization. Variation in the number of rDNA sites in parents and their interspecific hybrids was detected. As expected, 4 rDNA sites were observed in the genomes of 4 modern rose cultivars, while 3 hybridization sites were observed in the 2 others. Two expected rDNA sites were found in 2 R. rugosa cultivars, while in the other 3 R. rugosa cultivars 4 sites were present. Among the 20 R. hybrida × R. rugosa offspring, 13 carried the expected number of rDNA sites, and 1 had 6 hybridization sites, which exceeded the expected number by far. The other 6 offspring had either 2 or 3 hybridization sites, which was less than expected. Differences in the number of rDNA loci were observed in interspecific offspring, indicating that rDNA loci exhibit instability after distant hybridization events. Abnormal chromosome pairing may be the main factor explaining the variation in rDNA sites during polyploidization. © 2016 S. Karger AG, Basel.

  6. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  7. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    International Nuclear Information System (INIS)

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus

  8. Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.

    Science.gov (United States)

    Holland, Michelle L; Lowe, Robert; Caton, Paul W; Gemma, Carolina; Carbajosa, Guillermo; Danson, Amy F; Carpenter, Asha A M; Loche, Elena; Ozanne, Susan E; Rakyan, Vardhman K

    2016-07-29

    A suboptimal early-life environment, due to poor nutrition or stress during pregnancy, can influence lifelong phenotypes in the progeny. Epigenetic factors are thought to be key mediators of these effects. We show that protein restriction in mice from conception until weaning induces a linear correlation between growth restriction and DNA methylation at ribosomal DNA (rDNA). This epigenetic response remains into adulthood and is restricted to rDNA copies associated with a specific genetic variant within the promoter. Related effects are also found in models of maternal high-fat or obesogenic diets. Our work identifies environmentally induced epigenetic dynamics that are dependent on underlying genetic variation and establishes rDNA as a genomic target of nutritional insults. Copyright © 2016, American Association for the Advancement of Science.

  9. The Large Subunit rDNA Sequence of Plasmodiophora brassicae Does not Contain Intra-species Polymorphism.

    Science.gov (United States)

    Schwelm, Arne; Berney, Cédric; Dixelius, Christina; Bass, David; Neuhauser, Sigrid

    2016-12-01

    Clubroot disease caused by Plasmodiophora brassicae is one of the most important diseases of cultivated brassicas. P. brassicae occurs in pathotypes which differ in the aggressiveness towards their Brassica host plants. To date no DNA based method to distinguish these pathotypes has been described. In 2011 polymorphism within the 28S rDNA of P. brassicae was reported which potentially could allow to distinguish pathotypes without the need of time-consuming bioassays. However, isolates of P. brassicae from around the world analysed in this study do not show polymorphism in their LSU rDNA sequences. The previously described polymorphism most likely derived from soil inhabiting Cercozoa more specifically Neoheteromita-like glissomonads. Here we correct the LSU rDNA sequence of P. brassicae. By using FISH we demonstrate that our newly generated sequence belongs to the causal agent of clubroot disease. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

  10. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  11. Eye aberration analysis with Zernike polynomials

    Science.gov (United States)

    Molebny, Vasyl V.; Chyzh, Igor H.; Sokurenko, Vyacheslav M.; Pallikaris, Ioannis G.; Naoumidis, Leonidas P.

    1998-06-01

    New horizons for accurate photorefractive sight correction, afforded by novel flying spot technologies, require adequate measurements of photorefractive properties of an eye. Proposed techniques of eye refraction mapping present results of measurements for finite number of points of eye aperture, requiring to approximate these data by 3D surface. A technique of wave front approximation with Zernike polynomials is described, using optimization of the number of polynomial coefficients. Criterion of optimization is the nearest proximity of the resulted continuous surface to the values calculated for given discrete points. Methodology includes statistical evaluation of minimal root mean square deviation (RMSD) of transverse aberrations, in particular, varying consecutively the values of maximal coefficient indices of Zernike polynomials, recalculating the coefficients, and computing the value of RMSD. Optimization is finished at minimal value of RMSD. Formulas are given for computing ametropia, size of the spot of light on retina, caused by spherical aberration, coma, and astigmatism. Results are illustrated by experimental data, that could be of interest for other applications, where detailed evaluation of eye parameters is needed.

  12. Aberrant Myokine Signaling in Congenital Myotonic Dystrophy

    Directory of Open Access Journals (Sweden)

    Masayuki Nakamori

    2017-10-01

    Full Text Available Summary: Myotonic dystrophy types 1 (DM1 and 2 (DM2 are dominantly inherited neuromuscular disorders caused by a toxic gain of function of expanded CUG and CCUG repeats, respectively. Although both disorders are clinically similar, congenital myotonic dystrophy (CDM, a severe DM form, is found only in DM1. CDM is also characterized by muscle fiber immaturity not observed in adult DM, suggesting specific pathological mechanisms. Here, we revealed upregulation of the interleukin-6 (IL-6 myokine signaling pathway in CDM muscles. We also found a correlation between muscle immaturity and not only IL-6 expression but also expanded CTG repeat length and CpG methylation status upstream of the repeats. Aberrant CpG methylation was associated with transcriptional dysregulation at the repeat locus, increasing the toxic RNA burden that upregulates IL-6. Because the IL-6 pathway is involved in myocyte maturation and muscle atrophy, our results indicate that enhanced RNA toxicity contributes to severe CDM phenotypes through aberrant IL-6 signaling. : Congenital myotonic dystrophy (CDM manifests characteristic genetic (very large CTG repeat expansions, epigenetic (CpG hypermethylation upstream of the repeat, and phenotypic (muscle immaturity features not seen in adult DM. Nakamori et al. find phenotype-genotype and epigenotype correlation in CDM muscle and reveal involvement of the IL-6 myokine signaling pathway in the disease process. Keywords: CTCF, ER stress, IL-6, muscular dystrophy, NF-κB, trinucleotide, cytokine, splicing

  13. Higher order aberrations of the eye: Part one

    Directory of Open Access Journals (Sweden)

    Marsha Oberholzer

    2016-06-01

    Full Text Available This article is the first in a series of two articles that provide a comprehensive literature review of higher order aberrations (HOAs of the eye. The present article mainly explains the general principles of such HOAs as well as HOAs of importance, and the measuring apparatus used to measure HOAs of the eye. The second article in the series discusses factors contributing to variable results in measurements of HOAs of the eye. Keywords: Higher order aberrations; wavefront aberrations; aberrometer

  14. Chromosomal aberrations in children exposed to diagnostic x-rays

    International Nuclear Information System (INIS)

    Nordenson, I.; Beckman, G.; Beckman, L.; Lemperg, R.

    1980-01-01

    Among children who have received high x-ray doses congenital dislocation of the hip joint is the predominating diagnosis. In a series of 9 children who had received high x-ray doses (8 with luxation of the hip joint and one with achondroplasia) a significant increase of chromosomal aberrations was found. The increase concerned mainly chromosome type aberrations. The shorter the time since the last x-ray investigation the higher was the frequency of chromosome type aberrations. (author)

  15. Third-rank chromatic aberrations of electron lenses.

    Science.gov (United States)

    Liu, Zhixiong

    2018-02-01

    In this paper the third-rank chromatic aberration coefficients of round electron lenses are analytically derived and numerically calculated by Mathematica. Furthermore, the numerical results are cross-checked by the differential algebraic (DA) method, which verifies that all the formulas for the third-rank chromatic aberration coefficients are completely correct. It is hoped that this work would be helpful for further chromatic aberration correction in electron microscopy. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Higher order monochromatic aberrations of the human infant eye

    OpenAIRE

    Wang, Jingyun; Candy, T. Rowan

    2005-01-01

    The monochromatic optical aberrations of the eye degrade retinal image quality. Any significant aberrations during postnatal development could contribute to infants’ immature visual performance and provide signals for the control of eye growth. Aberrations of human infant eyes from 5 to 7 weeks old were compared with those of adult subjects using a model of an adultlike infant eye that accounted for differences in both eye and pupil size. Data were collected using the COAS Shack-Hartmann wave...

  17. Whole eye wavefront aberrations in Mexican male subjects.

    Science.gov (United States)

    Cantú, Roberto; Rosales, Marco A; Tepichín, Eduardo; Curioca, Andrée; Montes, Victor; Bonilla, Julio

    2004-01-01

    To analyze the characteristics, incidence, and appearance of wavefront aberrations in undilated, normal, unoperated eyes. Eighty-eight eyes of 44 healthy male Mexican subjects (mean age 25.32 years, range 18 to 36 yr) were divided into three groups based on uncorrected visual acuity of greater than or equal to 20/20, 20/30, or 20/40. UCVA measurements were obtained using an Acuity Max computer screen chart. Wavefront aberrations were measured with the Nidek OPD-Scan ARK 10000, Ver. 1.11b. All measurements were carried out at the same center by the same technician during a single session, following manufacturer instructions. Background illumination was 3 Lux. Wavefront aberration measurements for each group were statistically analyzed using StatView; an average eye was characterized and the resulting aberrations were simulated using MATLAB. We obtained wavefront aberration maps for the 20/20 undilated normal unoperated eyes for total, low, and high order aberration coefficients. Wavefront maps for right eyes were practically the same as those for left eyes. Higher aberrations did not contribute substantially to total wavefront analysis. Average aberrations of this "normal eye" will be used as criteria to decide the necessity of wavefront-guided ablation in our facilities. We will focus on the nearly zero average of high order aberrations in this normal whole eye as a reference to be matched.

  18. Radiation-induced chromosome aberrations in the rat peripheral blood

    International Nuclear Information System (INIS)

    Ziemba-Zoltowska, B.; Bocian, E.; Radwan, I.; Rosiek, O.; Sablinski, J.

    1978-01-01

    Chromosome aberrations in rat lymphocytes of peripheral blood after X (in vitro and in vivo) and 3 H tritiated water (in vivo) irradiations were studied. The yield of chromosome aberrations after in vivo and in vitro exposure to X-rays was similar. The frequency of chromosome aberrations three weeks after exposure to X-rays and soon after irradiation was practically on the same level. The yield of chromosome aberrations determined three weeks after injection with tritiated water or X-rays exposure was similar. (author)

  19. Aberration design of zoom lens systems using thick lens modules.

    Science.gov (United States)

    Zhang, Jinkai; Chen, Xiaobo; Xi, Juntong; Wu, Zhuoqi

    2014-12-20

    A systematic approach for the aberration design of a zoom lens system using a thick lens module is presented. Each component is treated as a thick lens module at the beginning of the design. A thick lens module refers to a thick lens component with a real lens structure, like lens materials, lens curvatures, lens thicknesses, and lens interval distances. All nine third-order aberrations of a thick lens component are considered during the design. The relationship of component aberrations in different zoom positions can be approximated from the aberration shift. After minimizing the aberrations of the zoom lens system, the nine third-order aberrations of every lens component can be determined. Then the thick lens structure of every lens component can be determined after optimization according to their first-order properties and third-order aberration targets. After a third optimization for minimum practical third-order aberrations of a zoom lens system, the aberration design using the thick lens module is complete, which provides a practical zoom lens system with thick lens structures. A double-sided telecentric zoom lens system is designed using the thick lens module in this paper, which shows that this method is practical for zoom lens design.

  20. Chromosome aberration analysis for biological dosimetry: a review

    International Nuclear Information System (INIS)

    Paul, S.F.D.; Venkatachalam, P.; Jeevanram, R.K.

    1996-01-01

    Among various biological dosimetry techniques, dicentric chromosome aberration method appears to be the method of choice in analysing accidental radiation exposure in most of the laboratories. The major advantage of this method is its sensitivity as the number of dicentric chromosomes present in control population is too small and more importantly radiation induces mainly dicentric chromosome aberration among unstable aberration. This report brings out the historical development of various cytogenetic methods, the basic structure of DNA, chromosomes and different forms of chromosome aberrations. It also highlights the construction of dose-response curve for dicentric chromosome and its use in the estimation of radiation dose. (author)

  1. Imaging characteristics of Zernike and annular polynomial aberrations.

    Science.gov (United States)

    Mahajan, Virendra N; Díaz, José Antonio

    2013-04-01

    The general equations for the point-spread function (PSF) and optical transfer function (OTF) are given for any pupil shape, and they are applied to optical imaging systems with circular and annular pupils. The symmetry properties of the PSF, the real and imaginary parts of the OTF, and the modulation transfer function (MTF) of a system with a circular pupil aberrated by a Zernike circle polynomial aberration are derived. The interferograms and PSFs are illustrated for some typical polynomial aberrations with a sigma value of one wave, and 3D PSFs and MTFs are shown for 0.1 wave. The Strehl ratio is also calculated for polynomial aberrations with a sigma value of 0.1 wave, and shown to be well estimated from the sigma value. The numerical results are compared with the corresponding results in the literature. Because of the same angular dependence of the corresponding annular and circle polynomial aberrations, the symmetry properties of systems with annular pupils aberrated by an annular polynomial aberration are the same as those for a circular pupil aberrated by a corresponding circle polynomial aberration. They are also illustrated with numerical examples.

  2. Chromosome aberrations: plants to human and Feulgen to FISH

    International Nuclear Information System (INIS)

    Natarajan, A.T.

    2005-01-01

    Chromosome aberrations and their impact on human health have been recognized for a long time. In the 1950s, in India, studies on induced chromosome aberrations in plants were initiated by Swaminathan and his students. I trace here the impact of these initial studies on further developments in this field. The studies which were started in plants have been extended to mammals (including human) and the simple squash and solid staining have been improved by molecular cytogenetic techniques, thus enabling accurate identification and quantification of different types of chromosome aberrations. These studies have also thrown light on the mechanisms of chromosome aberration formation, especially following exposure to ionizing radiation. (author)

  3. Electron microscopic in situ hybridization and autoradiography: Localization and transcription of rDNA in human lymphocyte nucleoli

    International Nuclear Information System (INIS)

    Wachtler, F.; Mosgoeller, W.S.; Schwarzacher, H.G.

    1990-01-01

    The distribution of ribosomal DNA (rDNA) in the nucleoli of human lymphocytes was revealed by in situ hybridization with a nonautoradiographic procedure at the electron microscopic level. rDNA is located in the dense fibrillar component of the nucleolus but not in the fibrillar centers. In the same cells the incorporation of tritiated uridine takes place in the dense fibrillar component of the nucleolus as seen by autoradiography followed by gold latensification. From these findings it can be concluded that the transcription of ribosomal DNA takes place in the dense fibrillar component of the nucleolus

  4. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  5. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Science.gov (United States)

    Czifra, György

    2017-09-01

    Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: "YES", because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  6. Hyperfine splitting of B mesons and Bs production at the Υ(5S)

    International Nuclear Information System (INIS)

    Lee-Franzini, J.; Heintz, U.; Lovelock, D.M.J.; Narain, M.; Schamberger, R.D.; Willins, J.; Yanagisawa, C.; Franzini, P.; Tuts, P.M.

    1990-01-01

    Using the Columbia University--Stony Brook (CUSB-II) detector we have studied the inclusive photon spectrum from 2.9x10 4 Υ(5S) decays. We observe a strong signal due to B * →Bγ decays. From this we obtain (i) the average B * -B mass difference, 46.7±0.4 MeV, (ii) the photon yield per Υ(5S) decay, left-angle γ/Υ(5S)right-angle=1.09±0.06, and (iii) the average velocity of the B * 's, left-angle β right-angle=0.156±0.010, for a mix of nonstrange (B) and strange (B s ) B * mesons from Υ(5S) decays. From the shape of the photon line, we find that both B and B s mesons are produced with nearly equal values for the hyperfine splitting of the B and B s meson systems

  7. Peak shifts due to B(*)-B(*) rescattering in Υ(5S) dipion transitions

    International Nuclear Information System (INIS)

    Meng Ce; Chao Kuangta

    2008-01-01

    We study the energy distributions of dipion transitions Υ(5S) to Υ(1S,2S,3S)π + π - in the final-state rescattering model. Since the Υ(5S) is well above the open bottom thresholds, the dipion transitions are expected to mainly proceed through the real processes Υ(5S)→B ( * ) B ( * ) and B ( * ) B ( * ) →Υ(1S,2S,3S)π + π - . We find that the energy distributions of Υ(1S,2S,3S)π + π - markedly differ from that of Υ(5S)→B ( * ) B ( * ) . In particular, the resonance peak will be pushed up by about 7-20 MeV for these dipion transitions relative to the main hadronic decay modes. These predictions can be used to test the final-state rescattering mechanism in hadronic transitions for heavy quarkonia above the open flavor thresholds.

  8. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    DEFF Research Database (Denmark)

    Brown, S; Fournier, M J

    1984-01-01

    The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

  9. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  10. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  11. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  12. Y(5S): What has been learned and what can be learned

    International Nuclear Information System (INIS)

    Blusk, S.R.

    2007-01-01

    We present recent measurements of B and B s 0 production using data collected on the Y(5S) resonance at CLEO and Belle. We also briefly discuss what can be learned using sufficiently larger data samples in the future

  13. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Directory of Open Access Journals (Sweden)

    Czifra György

    2017-09-01

    Full Text Available Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: “YES”, because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  14. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    Science.gov (United States)

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p5S it was observed and determined that facilitating the job and setting up a safe environment created a statistically significant effect on

  15. O5S, Calibration of Organic Scintillation Detector by Monte-Carlo

    International Nuclear Information System (INIS)

    1985-01-01

    1 - Nature of physical problem solved: O5S is designed to directly simulate the experimental techniques used to obtain the pulse height distribution for a parallel beam of mono-energetic neutrons incident on organic scintillator systems. Developed to accurately calibrate the nominally 2 in. by 2 in. liquid organic scintillator NE-213 (composition CH-1.2), the programme should be readily adaptable to many similar problems. 2 - Method of solution: O5S is a Monte Carlo programme patterned after the general-purpose Monte Carlo neutron transport programme system, O5R. The O5S Monte Carlo experiment follows the course of each neutron through the scintillator and obtains the energy-deposits of the ions produced by elastic scatterings and reactions. The light pulse produced by the neutron is obtained by summing up the contributions of the various ions with the use of appropriate light vs. ion-energy tables. Because of the specialized geometry and simpler cross section needs O5S is able to by-pass many features included in O5R. For instance, neutrons may be followed individually, their histories analyzed as they occur, and upon completion of the experiment, the results analyzed to obtain the pulse-height distribution during one pass on the computer. O5S does allow the absorption of neutrons, but does not allow splitting or Russian roulette (biased weighting schemes). SMOOTHIE is designed to smooth O5S histogram data using Gaussian functions with parameters specified by the user

  16. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Adaptive aberration correction using a triode hyperbolic electron mirror

    International Nuclear Information System (INIS)

    Fitzgerald, J.P.S.; Word, R.C.; Koenenkamp, R.

    2011-01-01

    A converging electron mirror can be used to compensate spherical and chromatic aberrations in an electron microscope. This paper presents an analytical solution to a novel triode (three electrode) hyperbolic mirror as an improvement to the well-known diode (two electrode) hyperbolic mirror for aberration correction. A weakness of the diode mirror is a lack of flexibility in changing the chromatic and spherical aberration coefficients independently without changes in the mirror geometry. In order to remove this limitation, a third electrode can be added. We calculate the optical properties of the resulting triode mirror analytically on the basis of a simple model field distribution. We present the optical properties-the object/image distance, z 0 , and the coefficients of spherical and chromatic aberration, C s and C c , of both mirror types from an analysis of electron trajectories in the mirror field. From this analysis, we demonstrate that while the properties of both designs are similar, the additional parameters in the triode mirror improve the range of aberration that can be corrected. The triode mirror is also able to provide a dynamic adjustment range of chromatic aberration for fixed spherical aberration and focal length, or any permutation of these three parameters. While the dynamic range depends on the values of aberration correction needed, a nominal 10% tuning range is possible for most configurations accompanied by less than 1% change in the other two properties. -- Highlights: → Electrostatic aberration correction for chromatic and spherical aberration in electron optics. → Simultaneous correction of spherical and chromatic aberrations over a wide, adjustable range. → Analytic and quantitative description of correction parameters.

  18. Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

    Science.gov (United States)

    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

    2013-11-01

    Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai.

  19. CORE: a phylogenetically-curated 16S rDNA database of the core oral microbiome.

    Directory of Open Access Journals (Sweden)

    Ann L Griffen

    2011-04-01

    Full Text Available Comparing bacterial 16S rDNA sequences to GenBank and other large public databases via BLAST often provides results of little use for identification and taxonomic assignment of the organisms of interest. The human microbiome, and in particular the oral microbiome, includes many taxa, and accurate identification of sequence data is essential for studies of these communities. For this purpose, a phylogenetically curated 16S rDNA database of the core oral microbiome, CORE, was developed. The goal was to include a comprehensive and minimally redundant representation of the bacteria that regularly reside in the human oral cavity with computationally robust classification at the level of species and genus. Clades of cultivated and uncultivated taxa were formed based on sequence analyses using multiple criteria, including maximum-likelihood-based topology and bootstrap support, genetic distance, and previous naming. A number of classification inconsistencies for previously named species, especially at the level of genus, were resolved. The performance of the CORE database for identifying clinical sequences was compared to that of three publicly available databases, GenBank nr/nt, RDP and HOMD, using a set of sequencing reads that had not been used in creation of the database. CORE offered improved performance compared to other public databases for identification of human oral bacterial 16S sequences by a number of criteria. In addition, the CORE database and phylogenetic tree provide a framework for measures of community divergence, and the focused size of the database offers advantages of efficiency for BLAST searching of large datasets. The CORE database is available as a searchable interface and for download at http://microbiome.osu.edu.

  20. Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.

    Science.gov (United States)

    Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen

    2017-01-01

    Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of

  1. Measurement of B(Υ(5S)→Bs(*)Bs(*)) using φ mesons

    International Nuclear Information System (INIS)

    Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Coan, T. E.; Gao, Y. S.; Liu, F.

    2007-01-01

    Knowledge of the B s decay fraction of the Υ(5S) resonance, f S , is important for B s meson studies at the Υ(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423 fb -1 on the Υ(5S) resonance, 6.34 fb -1 on the Υ(4S) and 2.32 fb -1 in the continuum below the Υ(4S), we measure B(Υ(5S)→φX)=(13.8±0.7 -1.5 +2.3 )% and B(Υ(4S)→φX)=(7.1±0.1±0.6)%; the ratio of the two rates is (1.9±0.1 -0.2 +0.3 ). This is the first measurement of the φ meson yield from the Υ(5S). Using these rates, and a model dependent estimate of B(B s →φX), we determine f S =(24.6±2.9 -5.3 +11.0 )%. We also update our previous independent measurement of f S made using the inclusive D s yields to now be (16.8±2.6 -3.4 +6.7 )%, due to a better estimate of the number of hadronic events. We also report the total Υ(5S) hadronic cross section above continuum to be σ(e + e - →Υ(5S))=(0.301±0.002±0.039) nb. This allows us to extract the fraction of B mesons as (58.9±10.0±9.2)%, equal to 1-f S . Averaging the three methods gives a model dependent result of f S =(21 -3 +6 )%

  2. Chromosome aberrations induced by radiation. With special reference to possible relation between chromosome aberrations and carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Kamada, N [Hiroshima Univ. (Japan). Research Inst. for Nuclear Medicine and Biology

    1980-02-01

    Chromosome aberration seems to be one of the most conspicuous residual abnormalities recognizable in radiation-exposed persons for many years after exposure. Knowledge of the biological significance of these abnormalities seems to be necessary for understanding of the effect of radiation on humans, especially in relation to possible leukemic development. Cytogenetic studies were performed on the bone marrow cells, T and B lymphocytes, and fibroblasts in atomic bomb-survivors who were in apparent good health (105 cases), atomic bomb exposed patients who had prolonged periods of blood disorders which terminated in acute leukemia (8 cases), and who had no such abnormalities (6 cases). All patients with chronic myelocytic leukemia (CML) and a history of atomic bomb exposure showed Philadelphia chromosome, a characteristic chromosome abnormality for CML. The persistent chromosome aberrations of bone marrow cells, T and B lymphocytes found among the atomic bomb survivors with or without blood disorders may give some clue to solve the problems of carcinogenesis.

  3. Fifth-order aberrations in magnetic quadrupole-octupole systems

    International Nuclear Information System (INIS)

    Ling, K.M.

    1990-01-01

    Explicit integral expressions are given for the fifth-order geometrical aberration coefficients in rectilinear magnetic quadrupole-octupole systems used for the transport of nonrelativistic charged particle beams. The numerical values of the fifth-order geometrical aberration coefficients for a rare earth cobalt (REC) quadrupole doublet are given as an example. 26 refs., 5 figs., 4 tabs

  4. An aberrant uterus: Case report | Ondieki | East African Medical ...

    African Journals Online (AJOL)

    A case of an aberrant uterus is presented and literature reviewed. The patient presented with abnormal uterine bleeding, left iliac fossa pain and was managed by excising the aberrant uterus. This case was an enigma as it didn't present in the classical way one with anomalies of the uterus would present. Despite ...

  5. Accuracy of modal wavefront estimation from eye transverse aberration measurements

    Science.gov (United States)

    Chyzh, Igor H.; Sokurenko, Vyacheslav M.

    2001-01-01

    The influence of random errors in measurement of eye transverse aberrations on the accuracy of reconstructing wave aberration as well as ametropia and astigmatism parameters is investigated. The dependence of mentioned errors on a ratio between the number of measurement points and the number of polynomial coefficients is found for different pupil location of measurement points. Recommendations are proposed for setting these ratios.

  6. Statistical estimation of ultrasonic propagation path parameters for aberration correction.

    Science.gov (United States)

    Waag, Robert C; Astheimer, Jeffrey P

    2005-05-01

    Parameters in a linear filter model for ultrasonic propagation are found using statistical estimation. The model uses an inhomogeneous-medium Green's function that is decomposed into a homogeneous-transmission term and a path-dependent aberration term. Power and cross-power spectra of random-medium scattering are estimated over the frequency band of the transmit-receive system by using closely situated scattering volumes. The frequency-domain magnitude of the aberration is obtained from a normalization of the power spectrum. The corresponding phase is reconstructed from cross-power spectra of subaperture signals at adjacent receive positions by a recursion. The subapertures constrain the receive sensitivity pattern to eliminate measurement system phase contributions. The recursion uses a Laplacian-based algorithm to obtain phase from phase differences. Pulse-echo waveforms were acquired from a point reflector and a tissue-like scattering phantom through a tissue-mimicking aberration path from neighboring volumes having essentially the same aberration path. Propagation path aberration parameters calculated from the measurements of random scattering through the aberration phantom agree with corresponding parameters calculated for the same aberrator and array position by using echoes from the point reflector. The results indicate the approach describes, in addition to time shifts, waveform amplitude and shape changes produced by propagation through distributed aberration under realistic conditions.

  7. Aberration analysis calculations for synchrotron radiation beamline design

    International Nuclear Information System (INIS)

    McKinney, W.R.; Howells, M.; Padmore, H.A.

    1997-09-01

    The application of ray deviation calculations based on aberration coefficients for a single optical surface for the design of beamline optical systems is reviewed. A systematic development is presented which allows insight into which aberration may be causing the rays to deviate from perfect focus. A new development allowing analytical calculation of line shape is presented

  8. Chromatic aberrations of two-electrode transaxial mirrors

    International Nuclear Information System (INIS)

    Bejzina, L.G.; Karetskaya, S.P.

    1991-01-01

    Second order chromatic aberrations of electrostatic two-electrode transaxial mirrors in case the beam axial trajectory of charged particles is curvilinear are considered. Interrelations between coefficients of linear and angular chromatic aberrations are determined. Values of these coefficients for concave and convex transaxial mirrors with plane electrodes in dependence on potential ratio on electrodes by different onnular clearance radii are presented

  9. Sextupole system for the correction of spherical aberration

    Science.gov (United States)

    Crewe, A.V.; Kopf, D.A.

    In an electron beam device in which an electron beam is developed and then focused by a lens to a particular spot, there is provided a means for eliminating spherical aberration. A sextupole electromagnetic lens is positioned between two focusing lenses. The interaction of the sextupole with the beam compensates for spherical aberration. (GHT)

  10. Third-order monochromatic aberrations via Fermat's principle

    International Nuclear Information System (INIS)

    Marasco, A.; Romano, A.

    2006-01-01

    By Fermat's principle and particular optical paths, which are not rays, a new aberration function is introduced. This function allows to derive, without resorting to the whole Hamiltonian formalism, the third-order geometrical aberrations of an optical system with a symmetry of revolution

  11. Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in the internal transcribed spacer rDNA region in fungi

    Science.gov (United States)

    Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud

    2013-01-01

    The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...

  12. Phylogenetic analysis of Thai oyster (Ostreidae) based on partial sequences of the mitochondrial 16S rDNA gene

    DEFF Research Database (Denmark)

    Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik

    2006-01-01

    Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen...

  13. Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants

    Czech Academy of Sciences Publication Activity Database

    Muchová, V.; Amiard, S.; Mozgová, I.; Dvořáčková, Martina; Gallego, M.E.; White, C.; Fajkus, Jiří

    2015-01-01

    Roč. 81, č. 2 (2015), s. 198-209 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GP13-11563P Institutional support: RVO:68081707 Keywords : DNA repair * genome instability * 45S rDNA Subject RIV: BO - Biophysics Impact factor: 5.468, year: 2015

  14. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  15. Chromosome aberration analysis based on a beta-binomial distribution

    International Nuclear Information System (INIS)

    Otake, Masanori; Prentice, R.L.

    1983-10-01

    Analyses carried out here generalized on earlier studies of chromosomal aberrations in the populations of Hiroshima and Nagasaki, by allowing extra-binomial variation in aberrant cell counts corresponding to within-subject correlations in cell aberrations. Strong within-subject correlations were detected with corresponding standard errors for the average number of aberrant cells that were often substantially larger than was previously assumed. The extra-binomial variation is accomodated in the analysis in the present report, as described in the section on dose-response models, by using a beta-binomial (B-B) variance structure. It is emphasized that we have generally satisfactory agreement between the observed and the B-B fitted frequencies by city-dose category. The chromosomal aberration data considered here are not extensive enough to allow a precise discrimination between competing dose-response models. A quadratic gamma ray and linear neutron model, however, most closely fits the chromosome data. (author)

  16. Chromosomal aberrations in bone marrow of continuously irradiated rats

    Energy Technology Data Exchange (ETDEWEB)

    Chlebosky, O; Praslicka, M; Chlebovska, K [Univerzita P.J. Safarika, Kosice (Czechoslovakia). Prirodovedecka Fakulta

    1975-01-01

    Research on chromosomal aberrations of the bone marrow in continuously irradiated rats showed that chromosomal aberrations are a highly sensitive indicator of radiation injury. An increase in the chromosomal aberration frequency was already found on the 5th day at daily doses of 0.5 R, i.e. a 12% increase at a total dose of 25 R. In the steady-state stage at daily doses of 0.5; 1; 2.5 R, the number of chromosomal aberrations stabilized at values of about 20%; at daily doses of 5 and 10 R at values of 30.=., at daily doses of 53 R at 45%, at a daily dose of 82.5 R, the number of chromosomal aberrations increased to 55%.

  17. Image based method for aberration measurement of lithographic tools

    Science.gov (United States)

    Xu, Shuang; Tao, Bo; Guo, Yongxing; Li, Gongfa

    2018-01-01

    Information of lens aberration of lithographic tools is important as it directly affects the intensity distribution in the image plane. Zernike polynomials are commonly used for a mathematical description of lens aberrations. Due to the advantage of lower cost and easier implementation of tools, image based measurement techniques have been widely used. Lithographic tools are typically partially coherent systems that can be described by a bilinear model, which entails time consuming calculations and does not lend a simple and intuitive relationship between lens aberrations and the resulted images. Previous methods for retrieving lens aberrations in such partially coherent systems involve through-focus image measurements and time-consuming iterative algorithms. In this work, we propose a method for aberration measurement in lithographic tools, which only requires measuring two images of intensity distribution. Two linear formulations are derived in matrix forms that directly relate the measured images to the unknown Zernike coefficients. Consequently, an efficient non-iterative solution is obtained.

  18. Cell survival and radiation induced chromosome aberrations. Pt. 2

    International Nuclear Information System (INIS)

    Bauchinger, M.; Schmid, E.; Braselmann, H.

    1986-01-01

    Human peripheral lymphocytes were irradiated in whole blood with 0.5-4.0 Gy of 220 kVp X-rays and the frequency of chromosome aberrations was determined in 1st or 2nd division metaphases discriminated by fluorescence plus giemsa staining. Using the empirical distributions of aberrations among cells, cell survival and transmission of aberrations were investigated. Considering both daughter cells, we found that 20% of fragments and 55% of dicentrics or ring chromosomes are lost during the 1st cell division; i.e. cell survival rate from 1st to 2nd generation is mainly influenced by anaphase bridging of these two-hit aberrations. Cell survival to 2nd mitosis was calculated considering this situation and compared with the survival derived from the fraction of M1 cells without unstable aberrations. The resulting shouldered survival curves showed significantly different slopes, indicating that cell reproductive death is overestimated in the latter approach. (orig.)

  19. Brown's TRANSPORT up to third order aberration by artificial intelligence

    International Nuclear Information System (INIS)

    Xia Jiawen; Xie Xi; Qiao Qingwen

    1991-01-01

    Brown's TRANSPORT is a first and second order matrix multiplication computer program intended for the design of accelerator beam transport systems, neglecting the third order aberration. Recently a new method was developed to derive analytically any order aberration coefficients of general charged particle optic system, applicable to any practical systems, such as accelerators, electron microscopes, lithographs, etc., including those unknown systems yet to be invented. An artificial intelligence program in Turbo Prolog was implemented on IBM-PC 286 or 386 machine to generate automatically the analytical expression of any order aberration coefficients of general charged particle optic system. Based on this new method and technique, Brown's TRANSPORT is extended beyond the second order aberration effects by artificial intelligence, outputing automatically all the analytical expressions up to the third order aberration coefficients

  20. Brown's transport up to third order aberration by artificial intelligence

    International Nuclear Information System (INIS)

    Xia Jiawen; Xie Xi; Qiao Qingwen

    1992-01-01

    Brown's TRANSPORT is a first and second order matrix multiplication computer program intended for the design of accelerator beam transport systems, neglecting the third order aberration. Recently a new method was developed to derive analytically any order aberration coefficients of general charged particle optic system, applicable to any practical systems, such as accelerators, electron microscopes, lithographs, including those unknown systems yet to be invented. An artificial intelligence program in Turbo Prolog was implemented on IBM-PC 286 or 386 machine to generate automatically the analytical expression of any order aberration coefficients of general charged particle optic system. Based on this new method and technique, Brown's TRANSPORT is extended beyond the second order aberration effect by artificial intelligence, outputting automatically all the analytical expressions up to the third order aberration coefficients

  1. Prospects for electron beam aberration correction using sculpted phase masks

    Energy Technology Data Exchange (ETDEWEB)

    Shiloh, Roy, E-mail: royshilo@post.tau.ac.il; Remez, Roei; Arie, Ady

    2016-04-15

    Technological advances in fabrication methods allowed the microscopy community to take incremental steps towards perfecting the electron microscope, and magnetic lens design in particular. Still, state of the art aberration-corrected microscopes are yet 20–30 times shy of the theoretical electron diffraction limit. Moreover, these microscopes consume significant physical space and are very expensive. Here, we show how a thin, sculpted membrane is used as a phase-mask to induce specific aberrations into an electron beam probe in a standard high resolution TEM. In particular, we experimentally demonstrate beam splitting, two-fold astigmatism, three-fold astigmatism, and spherical aberration. - Highlights: • Thin membranes can be used as aberration correctors in electron columns. • We demonstrate tilt, twofold-, threefold-astigmatism, and spherical aberrations. • Experimental and physical-optics simulation results are in good agreement. • Advantages in cost, size, nonmagnetism, and nearly-arbitrary correction.

  2. Aberration-corrected STEM: current performance and future directions

    Energy Technology Data Exchange (ETDEWEB)

    Nellist, P D [Department of Physics, University of Dublin, Trinity College, Dublin 2 (Ireland); Chisholm, M F [Condensed Matter Sciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6030 (United States); Lupini, A R [Condensed Matter Sciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6030 (United States); Borisevich, A [Condensed Matter Sciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6030 (United States); Jr, W H Sides [Condensed Matter Sciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6030 (United States); Pennycook, S J [Condensed Matter Sciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6030 (United States); Dellby, N [Nion Co., 1102 8th St., Kirkland, WA 98033 (United States); Keyse, R [Nion Co., 1102 8th St., Kirkland, WA 98033 (United States); Krivanek, O L [Nion Co., 1102 8th St., Kirkland, WA 98033 (United States); Murfitt, M F [Nion Co., 1102 8th St., Kirkland, WA 98033 (United States); Szilagyi, Z S [Nion Co., 1102 8th St., Kirkland, WA 98033 (United States)

    2006-02-22

    Through the correction of spherical aberration in the scanning transmission electron microscope (STEM), the resolving of a 78 pm atomic column spacing has been demonstrated along with information transfer to 61 pm. The achievement of this resolution required careful control of microscope instabilities, parasitic aberrations and the compensation of uncorrected, higher order aberrations. Many of these issues are improved in a next generation STEM fitted with a new design of aberration corrector, and an initial result demonstrating aberration correction to a convergence semi-angle of 40 mrad is shown. The improved spatial resolution and beam convergence allowed for by such correction has implications for the way in which experiments are performed and how STEM data should be interpreted.

  3. Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

    Science.gov (United States)

    Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

    1984-01-01

    Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

  4. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

    1987-01-01

    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  6. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  7. Implementation of 5S in Manufacturing Industry: A Case of Foreign Workers in Melaka

    Directory of Open Access Journals (Sweden)

    Chee Houa San

    2018-01-01

    Full Text Available Lean manufacturing system has been infiltrated in manufacturing sectors across the world. In fact, Lean manufacturing system is a practice which regards the use of the resources, creation of value for the end customers, and as the ways to eliminate the waste. There are several tools that can be used to eliminate the waste within the industry. This research is a study of the implementation of 5S in manufacturing industry. Despite this, the research study focused on manufacturing industry, which has been implemented 5S system in Melaka State. Although there are number of tools and technique available to help in improving the manufacturing process, however, there is only few industries could implement the tools successfully. In this research, foreign workers play a main role in implement the 5S systems as the manufacturing industry in Malaysia adopt large amount of foreign workers to work as employees. Therefore, it is important to ensure the foreign workers truly understand the concept of 5S system and adopt the best ways to implement it in order to have better performance. This research study has been proposed by the research model of the barriers to implementation of 5S in manufacturing industry among foreign workers. A several research method has been adopted to do the research, such as descriptive research design with quantitative methods, survey questionnaire and cross-sectional studies.

  8. Wave aberrations in rhesus monkeys with vision-induced ametropias

    Science.gov (United States)

    Ramamirtham, Ramkumar; Kee, Chea-su; Hung, Li-Fang; Qiao-Grider, Ying; Huang, Juan; Roorda, Austin; Smith, Earl L.

    2007-01-01

    The purpose of this study was to investigate the relationship between refractive errors and high-order aberrations in infant rhesus monkeys. Specifically, we compared the monochromatic wave aberrations measured with a Shack-Hartman wavefront sensor between normal monkeys and monkeys with vision-induced refractive errors. Shortly after birth, both normal monkeys and treated monkeys reared with optically induced defocus or form deprivation showed a decrease in the magnitude of high-order aberrations with age. However, the decrease in aberrations was typically smaller in the treated animals. Thus, at the end of the lens-rearing period, higher than normal amounts of aberrations were observed in treated eyes, both hyperopic and myopic eyes and treated eyes that developed astigmatism, but not spherical ametropias. The total RMS wavefront error increased with the degree of spherical refractive error, but was not correlated with the degree of astigmatism. Both myopic and hyperopic treated eyes showed elevated amounts of coma and trefoil and the degree of trefoil increased with the degree of spherical ametropia. Myopic eyes also exhibited a much higher prevalence of positive spherical aberration than normal or treated hyperopic eyes. Following the onset of unrestricted vision, the amount of high-order aberrations decreased in the treated monkeys that also recovered from the experimentally induced refractive errors. Our results demonstrate that high-order aberrations are influenced by visual experience in young primates and that the increase in high-order aberrations in our treated monkeys appears to be an optical byproduct of the vision-induced alterations in ocular growth that underlie changes in refractive error. The results from our study suggest that the higher amounts of wave aberrations observed in ametropic humans are likely to be a consequence, rather than a cause, of abnormal refractive development. PMID:17825347

  9. Aberration-free intraocular lenses - What does this really mean?

    Science.gov (United States)

    Langenbucher, Achim; Schröder, Simon; Cayless, Alan; Eppig, Timo

    2017-09-01

    So-called aberration-free intraocular lenses (IOLs) are well established in modern cataract surgery. Usually, they are designed to perfectly refract a collimated light beam onto the focal point. We show how much aberration can be expected with such an IOL in a convergent light beam such as that found anterior to the human cornea. Additionally, the aberration in a collimated beam is estimated for an IOL that has no aberrations in the convergent beam. The convergent beam is modelled as the pencil of rays corresponding to the spherical wavefront resulting from a typical corneal power of 43m -1 . The IOLs are modelled as infinitely thin phase plates with 20m -1 optical power placed 5mm behind the cornea. Their aberrations are reported in terms of optical path length difference and longitudinal spherical aberration (LSA) of the marginal rays, as well as nominal spherical aberration (SA) calculated based on a Zernike representation of the wavefront-error at the corneal plane within a 6mm aperture. The IOL designed to have no aberrations in a collimated light beam has an optical path length difference of -1.8μm, and LSA of 0.15m -1 in the convergent beam of a typical eye. The corresponding nominal SA is 0.065μm. The IOL designed to have no aberrations in a convergent light beam has an optical path length difference of 1.8μm, and LSA of -0.15m -1 in the collimated beam. An IOL designed to have no aberrations in a collimated light beam will increase the SA of a patient's eye after implantation. Copyright © 2017. Published by Elsevier GmbH.

  10. Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability

    International Nuclear Information System (INIS)

    Tao Weitao; Budd, Martin; Campbell, Judith L.

    2003-01-01

    We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1Δ double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1Δ alone. However, surprisingly, the dna2-2 sgs1Δ lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1Δ lethality is only partially suppressed by deletion of rad51Δ. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones

  11. Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability

    Energy Technology Data Exchange (ETDEWEB)

    Tao Weitao; Budd, Martin; Campbell, Judith L

    2003-11-27

    We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1{delta} double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1{delta} alone. However, surprisingly, the dna2-2 sgs1{delta} lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1{delta} lethality is only partially suppressed by deletion of rad51{delta}. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones.

  12. Studies of inelastic cross-section in Rb(7S) + Rb(5S) collisions

    International Nuclear Information System (INIS)

    Caiyan, L.; Ekers, A.; Latvia Univ., Riga; Klavins, J.; Jansons, M.

    1996-01-01

    The cross section σ = (8 ± 4) x 10 -15 cm 2 was determined for the Rb(7S) + Rb(5S) → Rb(5D) + Rb(5S) excitation energy transfer process, and the quenching cross section σ q = (2 ± 1) x 10 -14 cm 2 for the Rb(5D) state in collisions with ground state Rb atoms. Applying rubidium quasimolecular asymptotic potential curves at relatively large internuclear distances, a qualitative interpretation of the experimental results is presented. It is shown that the quenching of the Rb(5D) atoms in collisions may be explained by a reversed energy pooling process Rb(5D) + Rb(5S) → Rb(5P) + Rb(5P). (orig.)

  13. 5S rRNA-derived and tRNA-derived SINEs in fruit bats.

    Science.gov (United States)

    Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

    2009-05-01

    Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.

  14. IMPLEMENTING THE 5S METHOD IN THE PRODUCTION SYSTEM OF DACIA & RENAULT

    Directory of Open Access Journals (Sweden)

    Marin CIOBANU

    2014-11-01

    Full Text Available The aim of this paper is to demonstrate the usefulness of the 5S method in addressing the issues of continuous improvement of productivity and quality of work. There are presented the 5 steps, techniques and the adjacent tools. Solutions implemented in the production system Dacia & Renault are indicated. This article provides a practical framework. The 5S method follows the Deming PDCA cycle which constitutes the starting point of the SDCA cycle of continuous improvement of the company's activities in order to obtain excellence. The implementing time of the method depends on the resources and materials allocated. Deployment of 5S is achieved by a scheme of "3+2": the first 3S are tangible and immediate actions, the last 2S appeal to specific management actions. The efficacy of their own workplace in total autonomy creates comfort in the work environment and gives personal benefits to workers.

  15. Ethical and psychological factors in 5S and total productive maintenance

    Directory of Open Access Journals (Sweden)

    Jamal Ahmed Hama Kareem

    2017-08-01

    Full Text Available Purpose: The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results.  Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b Panneerselvam (2012 Singh et al. (2013 and Poduval & Pramod (2015 in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM that are used to bring out the best productivity.

  16. Ethical and psychological factors in 5S and total productive maintenance

    International Nuclear Information System (INIS)

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-01-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  17. Ethical and psychological factors in 5S and total productive maintenance

    Energy Technology Data Exchange (ETDEWEB)

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-07-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  18. 5S-MENETELMÄN KÄYTTÖÖNOTTO SERVICEPOINTILLA

    OpenAIRE

    Ovaskainen, Tatu-Pekka

    2014-01-01

    Opinnäytetyö on tehty Servicepoint Kuopio Oy:n toimeksiannosta. Servicepoint Kuopio on teollisuuden kunnossapitoon automaatio- ja sähköistysprojekteihin sekä robottisovelluksiin erikoistunut yritys. Yrityksen kahden toimipisteen yhdistyminen lisäsi toimipisteellä henkilöstön ja työkalujen määrää. Yrityksessä toteutetaan sovelletusti Lean-ajattelumallia. Yksi Leanin työkaluista on 5S, joka haluttiin ottaa käyttöön yrityksessä. Opinnäytetyön tavoitteena oli ottaa käyttöön 5S-menetelmä Servi...

  19. 5S-menetelmän käyttöönotto Case: Planmeca Oy

    OpenAIRE

    Velic, Adel

    2014-01-01

    Opinnäytetyön tavoitteena on tutkia Planmeca Oy:n panoraamaröntgentuotannossa syksyllä 2012 toteutetun 5S-projektin onnistuneisuutta. Työ kattaa sekä 5S-periaatteiden mukaisesti suunniteltujen ja toteutettujen panoraamaröntgentuotannon Elko-, Pystytys 1 -, Pystytys 2 - sekä Potilastuki- ja skannausmekanismitiimin työpisteiden että projektin toteutustavan onnistuneisuuden mittaamisen. Tutkimusmenetelmänä käytetään Elko-, Pystytys 1 -, Pystytys 2 - sekä Potilastuki- ja skannausmekanismitiim...

  20. Carbon magnetic resonance spectroscopy on carbon-13-labeled uracil in 5S ribonucleic acid

    International Nuclear Information System (INIS)

    Hamill, W.D.; Grant, D.M.; Cooper, R.B.; Harmon, S.A.

    1978-01-01

    The carbon-13 nuclear magnetic resonance spectra of the 13 C-enriched C-4 uridine carbons in 5S ribosomal ribonucleic acid of Salmonella typhimurium, strain JL-1055, was obtained. The most striking feature of the 5S RNA spectrum was the large number of well-resolved lines in the uridine band covering a chemical shift range of approximately 3.6 ppM. This data was used to obtain information on the secondary structure. The number of uridines involved in secondary interactions is estimated to be at least 75% and may be as high as 95%

  1. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  2. Higher-Order Wavefront Aberrations for Populations of Young Emmetropes and Myopes

    Directory of Open Access Journals (Sweden)

    Jinhua Bao

    2009-01-01

    Conclusions: Human eyes have systematical higher order aberrations in population, and factors that cause bilateral symmetry of wavefront aberrations between the right and left eyes made important contribution to the systematical aberrations.

  3. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  4. Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders.

    Science.gov (United States)

    Calo, Eliezer; Gu, Bo; Bowen, Margot E; Aryan, Fardin; Zalc, Antoine; Liang, Jialiang; Flynn, Ryan A; Swigut, Tomek; Chang, Howard Y; Attardi, Laura D; Wysocka, Joanna

    2018-02-01

    Many craniofacial disorders are caused by heterozygous mutations in general regulators of housekeeping cellular functions such as transcription or ribosome biogenesis. Although it is understood that many of these malformations are a consequence of defects in cranial neural crest cells, a cell type that gives rise to most of the facial structures during embryogenesis, the mechanism underlying cell-type selectivity of these defects remains largely unknown. By exploring molecular functions of DDX21, a DEAD-box RNA helicase involved in control of both RNA polymerase (Pol) I- and II-dependent transcriptional arms of ribosome biogenesis, we uncovered a previously unappreciated mechanism linking nucleolar dysfunction, ribosomal DNA (rDNA) damage, and craniofacial malformations. Here we demonstrate that genetic perturbations associated with Treacher Collins syndrome, a craniofacial disorder caused by heterozygous mutations in components of the Pol I transcriptional machinery or its cofactor TCOF1 (ref. 1), lead to relocalization of DDX21 from the nucleolus to the nucleoplasm, its loss from the chromatin targets, as well as inhibition of rRNA processing and downregulation of ribosomal protein gene transcription. These effects are cell-type-selective, cell-autonomous, and involve activation of p53 tumour-suppressor protein. We further show that cranial neural crest cells are sensitized to p53-mediated apoptosis, but blocking DDX21 loss from the nucleolus and chromatin rescues both the susceptibility to apoptosis and the craniofacial phenotypes associated with Treacher Collins syndrome. This mechanism is not restricted to cranial neural crest cells, as blood formation is also hypersensitive to loss of DDX21 functions. Accordingly, ribosomal gene perturbations associated with Diamond-Blackfan anaemia disrupt DDX21 localization. At the molecular level, we demonstrate that impaired rRNA synthesis elicits a DNA damage response, and that rDNA damage results in tissue-selective and

  5. Supersonic Fe beam source for chromatic aberration-free laser focusing of atoms

    CERN Document Server

    Bosch, R C M; Van der Straten, P; Leeuwen, K A H

    2002-01-01

    A monochromatic Fe beam is generated by heated supersonic expansion of argon seeded with Fe vapor. At a nozzle temperature of 1930 K and 800 torr argon inlet pressure the Fe beam has an axial velocity spread of 8% and intensity of 3 x 10 sup 1 sup 5 s sup - sup 1 sr sup - sup 1 , corresponding to a deposition rate of 10 nm/h at 150 mm from the nozzle. The two-chamber alumina crucibles are chemically stable for liquid Fe. With 400 mm sup 3 Fe we have operated for more than 200 hours without reloading. The power consumption at 1930 K is 750 W. Temperature stability at constant power (without feedback) is better than 30 K. The source is intended for deposition of nano-structures by laser focusing of the Fe beam. The small axial velocity spread virtually eliminates the increase in focal spot size due to chromatic aberration. (authors)

  6. The Mechanisms of Aberrant Protein Aggregation

    Science.gov (United States)

    Cohen, Samuel; Vendruscolo, Michele; Dobson, Chris; Knowles, Tuomas

    2012-02-01

    We discuss the development of a kinetic theory for understanding the aberrant loss of solubility of proteins. The failure to maintain protein solubility results often in the assembly of organized linear structures, commonly known as amyloid fibrils, the formation of which is associated with over 50 clinical disorders including Alzheimer's and Parkinson's diseases. A true microscopic understanding of the mechanisms that drive these aggregation processes has proved difficult to achieve. To address this challenge, we apply the methodologies of chemical kinetics to the biomolecular self-assembly pathways related to protein aggregation. We discuss the relevant master equation and analytical approaches to studying it. In particular, we derive the underlying rate laws in closed-form using a self-consistent solution scheme; the solutions that we obtain reveal scaling behaviors that are very generally present in systems of growing linear aggregates, and, moreover, provide a general route through which to relate experimental measurements to mechanistic information. We conclude by outlining a study of the aggregation of the Alzheimer's amyloid-beta peptide. The study identifies the dominant microscopic mechanism of aggregation and reveals previously unidentified therapeutic strategies.

  7. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study.

    Science.gov (United States)

    Hanf, Matthieu; Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-11-08

    To assess at country level the association of mortality in under 5s with a large set of determinants. Longitudinal study. 193 United Nations member countries, 2000-09. Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. National rate of deaths in under 5s per 1000 live births The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015.

  8. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    Science.gov (United States)

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Ba 5s photoionization in the region of the second Cooper minimum

    International Nuclear Information System (INIS)

    Whitfield, S B; Wehlitz, R; Dolmatov, V K

    2011-01-01

    We investigate the 5s angular distribution parameter and partial photoionization cross section of atomic Ba in the region of the second Cooper minimum covering a photon energy region from 120 to 260 eV. We observe a strong drop in the Ba 5s β value from 2.0, reaching a minimum of 1.57 ± 0.07 at a photon energy of 150 eV. The β value then slowly rises back towards its nominal value of 2.0 at photon energies beyond the minimum. Our measured 5s partial cross section also shows a pronounced dip around 170 eV due to interchannel coupling with the Ba 4d photoelectrons. After combining our measurements with previous experimental values at lower photon energies, we obtain a consistent data set spanning the photon energy range prior to the onset of the partial cross section maximum and through the cross section minimum. We also calculate the 5s partial cross section under several different levels of approximation. We find that the generalized random-phase approximation with exchange calculation models the shape and position of the combined experimental cross section data set rather well after incorporating experimental ionization energies and a shift in the photon energy scale.

  10. Dramatic nondipole effects in low-energy photoionization: Experimental and theoretical study of Xe 5s

    International Nuclear Information System (INIS)

    Hemmers, O.; Lindle, D.W.; Baker, J.; Hudson, A.; Lotrakul, M.; Tran, I.C.; Guillemin, R.; Stolte, W.C.; Wolska, A.; Yu, S.W.; Kanter, E.P.; Kraessig, B.; Southworth, S.H.; Wehlitz, R.; Rolles, D.; Amusia, M.Ya.; Cheng, K.T.; Chernysheva, L.V.; Johnson, W.R.; Manson, S.T.

    2003-01-01

    The Xe 5s nondipole photoelectron parameter γ is obtained experimentally and theoretically from threshold to ∼200 eV photon energy. Significant nondipole effects are seen even in the threshold region of this valence shell photoionization. In addition, contrary to previous understanding, clear evidence of interchannel coupling among quadrupole photoionization channels is found

  11. Cellular origin of prognostic chromosomal aberrations in AML patients

    DEFF Research Database (Denmark)

    Mora-Jensen, H.; Jendholm, J.; Rapin, N.

    2015-01-01

    chromosomal structural rearrangements and single nucleotide variants (SNVs). Conventional AML diagnostics and recent seminal next-generation sequencing (NGS) studies have identified more than 200 recurrent genetic aberrations presenting in various combinations in individual patients. Significantly, many...... of these aberrations occur in normal hematopoietic stem and progenitor cells (HSCs/HPCs) before definitive leukemic transformation through additional acquisition of a few (that is, mostly 1 or 2) leukemia-promoting driver aberrations. NGS studies on sorted bone marrow (BM) populations of AML patients with a normal...

  12. Chromosome aberrations analysis of Serbia population from 1985 to 1995

    International Nuclear Information System (INIS)

    Jovicic, D.; Markovic, B.; Milacic, S.; Joksic, G.

    1996-01-01

    After the accident of NE Chernobyl in May 1986, Chernobyl's fallout with unhomogeneous dispersion of radioactive material in atmosphere caused the difference in contamination of the Serbia territory. The highest contamination was found to be in region Uzice, and the lowest in the region Nis. Two groups of population from these regions were undergone chromosome aberration analysis during 1987, 1988 and 1989. year. The results of our examination show increased frequency of structural chromosome aberrations/dicentrics, rings, peri centric inversions and acentric/ in the Uzice population, especially in the 1987. year. In 1985 and 1995 year have not been found chromosome aberrations. 2 refs.; 1 figs.; 2 tabs

  13. Extraforaminal Lumbar Interbody Fusion at the L5-S1 Level: Technical Considerations and Feasibility.

    Science.gov (United States)

    Kurzbuch, Arthur Robert; Kaech, Denis; Baranowski, Pawel; Baranowska, Alicja; Recoules-Arche, Didier

    2017-09-01

    Background  Extraforaminal lumbar interbody fusion (ELIF) surgery is a muscle-sparing approach that allows the treatment of various degenerative spinal diseases. It is technical challenging to perform the ELIF approach at the L5-S1 level because the sacral ala obstructs the view of the intervertebral disk space. Methods  We reported earlier on the ELIF technique in which the intervertebral disk is targeted at an angle of 45 degrees relative to the midline. In this article we describe the technical process we developed to overcome the anatomic relation between the sacral ala and the intervertebral disk space L5-S1 that hinders the ELIF approach at this level. We then report in a retrospective analysis on the short-term clinical and radiologic outcome of 100 consecutive patients with degenerative L5-S1 pathologies who underwent ELIF surgery. Results  The L5-S1 ELIF approach could be realized in all patients. The short-term clinical outcome was evaluated 5 months after surgery: 92% of the patients were satisfied with their postoperative result; 8% had a poor result. Overall, 17% of the patients presented light radicular or low back pain not influencing their daily activity, and 82% of the patients working before surgery returned to work 3 to 7 months after surgery. The radiologic outcome was documented by computed tomography at 5 months after surgery and showed fusion in 99% of the patients. Lumbar magnetic resonance imaging performed in 5 patients at 6 months after surgery revealed the integrity of the paraspinal muscles. Conclusions  ELIF surgery at the L5-S1 level is technically feasible for various degenerative spinal diseases. Analysis of the clinical and radiologic data in a consecutive retrospective cohort of patients who underwent this surgical procedure showed a good short-term clinical outcome and fusion rate. Georg Thieme Verlag KG Stuttgart · New York.

  14. An apparent Acanthamoeba genotype is the product of a chimeric 18S rDNA artifact.

    Science.gov (United States)

    Corsaro, Daniele; Venditti, Danielle

    2018-02-01

    Free-living amoebae of the genus Acanthamoeba are potentially pathogenic protozoa widespread in the environment. The detection/diagnosis as well as environmental survey strategies is mainly based on the identification of the 18S rDNA sequences of the strains that allow the recovery of various distinct genotypes/subgenotypes. The accurate recording of such data is important to better know the environmental distribution of distinct genotypes and how they may be preferentially associated with disease. Recently, a putative new acanthamoebal genotype T99 was introduced, which comprises only environmental clones apparently with some anomalous features. Here, we analyze these sequences through partial treeing and BLAST analyses and find that they are actually chimeras. Our results show that the putative T99 genotype is very likely formed by chimeric sequences including a middle fragment from acanthamoebae of genotype T13, while the 5'- and 3'-end fragments came from a nematode and a cercozoan, respectively. Molecular phylogenies of Acanthamoeba including T99 are consequently erroneous as genotype T99 does not exist in nature. Careful identification of Acanthamoeba genotypes is therefore critical for both phylogenetic and diagnostic applications.

  15. 18S rDNA phylogeny of lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa.

    Directory of Open Access Journals (Sweden)

    Anna Maria Fiore-Donno

    Full Text Available The phylogenetic position of the slime-mould genus Lamproderma (Myxomycetes, Amoebozoa challenges traditional taxonomy: although it displays the typical characters of the order Stemonitales, it appears to be sister to Physarales. This study provides a small subunit (18S or SSU ribosomal RNA gene-based phylogeny of Lamproderma and its allies, with new sequences from 49 specimens in 12 genera. We found that the order Stemonitales and Lamproderma were both ancestral to Physarales and that Lamproderma constitutes several clades intermingled with species of Diacheopsis, Colloderma and Elaeomyxa. We suggest that these genera may have evolved from Lamproderma by multiple losses of fruiting body stalks and that many taxonomic revisions are needed. We found such high genetic diversity within three Lamproderma species that they probably consist of clusters of sibling species. We discuss the contrasts between genetic and morphological divergence and implications for the morphospecies concept, highlighting the phylogenetically most reliable morphological characters and pointing to others that have been overestimated. In addition, we showed that the first part (~600 bases of the SSU rDNA gene is a valuable tool for phylogeny in Myxomycetes, since it displayed sufficient variability to distinguish closely related taxa and never failed to cluster together specimens considered of the same species.

  16. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    International Nuclear Information System (INIS)

    Grierson, Patrick M.; Acharya, Samir; Groden, Joanna

    2013-01-01

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription

  17. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Grierson, Patrick M. [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Acharya, Samir, E-mail: samir.acharya@osumc.edu [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Groden, Joanna [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States)

    2013-03-15

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription.

  18. CONTRIBUTION TO THE PHYLOGENY OF THE PANGASIIDAE BASED ON MITOCHONDRIAL 12S RDNA

    Directory of Open Access Journals (Sweden)

    L. Pouyaud

    2016-10-01

    Full Text Available Catfishes are generally one of the economically important groups of fresh and brackish water fishes in the world. In many countries, they form a significant part of inland fisheries, and several species have been  introduced in fish culture. Judging from literature, the main constraint to cultivate wild species and to optimise the production of pangasiid catfishes is due to the poorly documented systematics of this family. In the present contribution, the phylogenetic relationships within Pangasiidae are studied to contribute to a better insight in their taxonomy and evolution. The genetic relatedness is inferred using mitochondrial 12S rDNA gene sequences. To resolve the phylogenetic position of Laides in this group of catfish, five genera of Asian and African Schilbeidae are also considered. The results showed that a species group (complex could be clearly seen in the genetic tree. Pangasius is more derive than the other genera. By using approximate molecular clock/evolutionary calibration from  mitochondrial gene, a new episode of  speciation for the family marked explosive radiation about 5- 8 million years ago (mya. This adaptive radiation extended until the Late Pleistocene. Regarding the relationships between the Pangasiidae and Schilbeidae, two families show an allopatric distribution with slight overlap. The Pangasiidae occur mainly in Southeast Asia, while the Schilbeidae are seen mainly on the Indian subcontinent (including Myanmar and Africa. It confirms the separation between  Schilbeidae and Pangasiidae occurred in the Early Miocene.

  19. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences.

    Science.gov (United States)

    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K; Maitra, S S

    2015-01-01

    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about "methanogenic archaea composition" and "abundance" in the contrasting ecosystems like "landfill" and "marshland" may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  20. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences

    Directory of Open Access Journals (Sweden)

    Shailendra Yadav

    2015-01-01

    Full Text Available Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic and Thaumarchaeota (mesophilic, were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  1. Comparative molecular analysis of Herbaspirillum strains by RAPD, RFLP, and 16S rDNA sequencing

    Directory of Open Access Journals (Sweden)

    Soares-Ramos Juliana R.L.

    2003-01-01

    Full Text Available Herbaspirillum spp. are endophytic diazotrophic bacteria associated with important agricultural crops. In this work, we analyzed six strains of H. seropedicae (Z78, M2, ZA69, ZA95, Z152, and Z67 and one strain of H. rubrisubalbicans (M4 by restriction fragment length polymorphism (RFLP using HindIII or DraI restriction endonucleases, random amplified polymorphic DNA (RAPD, and partial sequencing of 16S rDNA. The results of these analyses ascribed the strains studied to three distinct groups: group I, consisting of M2 and M4; group II, of ZA69; and group III, of ZA95, Z78, Z67, and Z152. RAPD fingerprinting showed a higher variability than the other methods, and each strain had a unique electrophoretic pattern with five of the six primers used. Interestingly, H. seropedicae M2 was found by all analyses to be genetically very close to H. rubrisubalbicans M4. Our results show that RAPD can distinguish between all Herbaspirillum strains tested.

  2. Morphology and rDNA phylogeny of a Mediterranean Coolia monotis (Dinophyceae strain from Greece

    Directory of Open Access Journals (Sweden)

    Nicolas P. Dolapsakis

    2006-03-01

    Full Text Available Sequences of LSU and SSU ribosomal RNA genes and phylogeny have not been widely investigated for the dinoflagellate Coolia monotis Meunier, and no information is available on the small and large rDNA subunits of Mediterranean strains. A strain isolated from the Thermaikos Gulf in northern Greece was identified as C. monotis—a new record for the Greek algal flora—using thecal morphology by light, epifluorescence and scanning electron microscopy. The small subunit and partial (D1/D2 large subunit sequences were analyzed and compared to other strains of C. monotis and dinoflagellates from various regions. Thecal architecture showed that the Greek strain of C. monotis was phenotypically similar, but not identical, to other strains reported in literature. The partial LSU sequence (700 bp was found to vary by 113 bp positions (16% from the C. monotis strain from New Zealand, whereas the SSU (1757 bp had 15 bp differences (0.85% from the strain from Norway. Phylogenetic tree construction showed that the Greek strain fell within the Coolia clade and had a close relationship with the families Ostreopsidaceae and Goniodomaceae of the order Gonyaulacales. Preliminary findings suggest the existence of different genotype strains of C. monotis with large intraspecific genetic variability and minimal morphological differentiation (similar phenotypes. Certain ecological and evolutionary implications of these findings are discussed.

  3. Karyotypes, heterochromatin, and physical mapping of 18S-26S rDNA in Cactaceae.

    Science.gov (United States)

    Las Peñas, M L; Urdampilleta, J D; Bernardello, G; Forni-Martins, E R

    2009-01-01

    Karyotype analyses in members of the four Cactaceae subfamilies were performed. Numbers and karyotype formula obtained were: Pereskioideae = Pereskiaaculeata(2n = 22; 10 m + 1 sm), Maihuenioideae = Maihuenia patagonica (2n = 22, 9 m + 2 sm; 2n = 44, 18 m + 4 sm), Opuntioideae = Cumulopuntia recurvata(2n = 44; 20 m + 2 sm), Cactoideae = Acanthocalycium spiniflorum (2n = 22; 10 m + 1 sm),Echinopsis tubiflora (2n = 22; 10 m + 1 sm), Trichocereus candicans (2n = 22, 22 m). Chromosomes were small, the average chromosome length was 2.3 mum. Diploid species and the tetraploid C. recurvata had one terminal satellite, whereas the remaining tetraploid species showed four satellited chromosomes. Karyotypes were symmetrical. No CMA(-)/DAPI(+) bands were detected, but CMA(+)/DAPI(-) bands associated with NOR were always found. Pericentromeric heterochromatin was found in C. recurvata, A. spiniflorum, and the tetraploid cytotype of M. patagonica. The locations of the 18S-26S rDNA sites in all species coincided with CMA(+)/DAPI(-) bands; the same occurred with the sizes and numbers of signals for each species. This technique was applied for the first time in metaphase chromosomes in cacti. NOR-bearing pair no.1 may be homeologous in all species examined. In Cactaceae, the 18S-26S loci seem to be highly conserved. Copyright 2009 S. Karger AG, Basel.

  4. High and uneven levels of 45S rDNA site-number variation across wild populations of a diploid plant genus (Anacyclus, Asteraceae).

    Science.gov (United States)

    Rosato, Marcela; Álvarez, Inés; Nieto Feliner, Gonzalo; Rosselló, Josep A

    2017-01-01

    The nuclear genome harbours hundreds to several thousand copies of ribosomal DNA. Despite their essential role in cellular ribogenesis few studies have addressed intrapopulation, interpopulation and interspecific levels of rDNA variability in wild plants. Some studies have assessed the extent of rDNA variation at the sequence and copy-number level with large sampling in several species. However, comparable studies on rDNA site number variation in plants, assessed with extensive hierarchical sampling at several levels (individuals, populations, species) are lacking. In exploring the possible causes for ribosomal loci dynamism, we have used the diploid genus Anacyclus (Asteraceae) as a suitable system to examine the evolution of ribosomal loci. To this end, the number and chromosomal position of 45S rDNA sites have been determined in 196 individuals from 47 populations in all Anacyclus species using FISH. The 45S rDNA site-number has been assessed in a significant sample of seed plants, which usually exhibit rather consistent features, except for polyploid plants. In contrast, the level of rDNA site-number variation detected in Anacyclus is outstanding in the context of angiosperms particularly regarding populations of the same species. The number of 45S rDNA sites ranged from four to 11, accounting for 14 karyological ribosomal phenotypes. Our results are not even across species and geographical areas, and show that there is no clear association between the number of 45S rDNA loci and the life cycle in Anacyclus. A single rDNA phenotype was detected in several species, but a more complex pattern that included intra-specific and intra-population polymorphisms was recorded in A. homogamos, A. clavatus and A. valentinus, three weedy species showing large and overlapping distribution ranges. It is likely that part of the cytogenetic changes and inferred dynamism found in these species have been triggered by genomic rearrangements resulting from contemporary

  5. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  6. Chromosomal distribution of pTa-535, pTa-86, pTa-713, 35S rDNA repetitive sequences in interspecific hexaploid hybrids of common wheat (Triticum aestivum L.) and spelt (Triticum spelta L.).

    Science.gov (United States)

    Goriewa-Duba, Klaudia; Duba, Adrian; Kwiatek, Michał; Wiśniewska, Halina; Wachowska, Urszula; Wiwart, Marian

    2018-01-01

    Fluorescent in situ hybridization (FISH) relies on fluorescent-labeled probes to detect specific DNA sequences in the genome, and it is widely used in cytogenetic analyses. The aim of this study was to determine the karyotype of T. aestivum and T. spelta hybrids and their parental components (three common wheat cultivars and five spelt breeding lines), to identify chromosomal aberrations in the evaluated wheat lines, and to analyze the distribution of polymorphisms of repetitive sequences in the examined hybrids. The FISH procedure was carried out with four DNA clones, pTa-86, pTa-535, pTa-713 and 35S rDNA used as probes. The observed polymorphisms between the investigated lines of common wheat, spelt and their hybrids was relatively low. However, differences were observed in the distribution of repetitive sequences on chromosomes 4A, 6A, 1B and 6B in selected hybrid genomes. The polymorphisms observed in common wheat and spelt hybrids carry valuable information for wheat breeders. The results of our study are also a valuable source of knowledge about genome organization and diversification in common wheat, spelt and their hybrids. The relevant information is essential for common wheat breeders, and it can contribute to breeding programs aimed at biodiversity preservation.

  7. Chromosomal distribution of pTa-535, pTa-86, pTa-713, 35S rDNA repetitive sequences in interspecific hexaploid hybrids of common wheat (Triticum aestivum L. and spelt (Triticum spelta L..

    Directory of Open Access Journals (Sweden)

    Klaudia Goriewa-Duba

    Full Text Available Fluorescent in situ hybridization (FISH relies on fluorescent-labeled probes to detect specific DNA sequences in the genome, and it is widely used in cytogenetic analyses. The aim of this study was to determine the karyotype of T. aestivum and T. spelta hybrids and their parental components (three common wheat cultivars and five spelt breeding lines, to identify chromosomal aberrations in the evaluated wheat lines, and to analyze the distribution of polymorphisms of repetitive sequences in the examined hybrids. The FISH procedure was carried out with four DNA clones, pTa-86, pTa-535, pTa-713 and 35S rDNA used as probes. The observed polymorphisms between the investigated lines of common wheat, spelt and their hybrids was relatively low. However, differences were observed in the distribution of repetitive sequences on chromosomes 4A, 6A, 1B and 6B in selected hybrid genomes. The polymorphisms observed in common wheat and spelt hybrids carry valuable information for wheat breeders. The results of our study are also a valuable source of knowledge about genome organization and diversification in common wheat, spelt and their hybrids. The relevant information is essential for common wheat breeders, and it can contribute to breeding programs aimed at biodiversity preservation.

  8. Chromosome aberration studies and microdosimetry with radiations of varying quality

    International Nuclear Information System (INIS)

    Grillmaier, R.E.; Bihy, L.; Menzel, H.G.; Schuhmacher, H.

    1978-01-01

    To investigate the biological effectivity of complex irradiation fields encountered in radiation protection and high LET radiation therapy and to find meaningful specification of radiation quality closely related to the biological effectivity, correlated chromosome aberration studies and microdosimetric investigations have been carried out using cyclotron produced collimated fast neutrons. Human lymphocytes have been irradiated at different dose levels in the direct beam and in different positions in the penumbra and the rates of acentric fragments and dicentrics have been determined. In identical positions microdosimetric measurements have been performed. The dose relationship of aberration rates after irradiation in the direct beam, the aberration rates observed in the penumbra and the microdosimetric quantities ysub(D), ysub(F) and y* are presented and their relations are discussed. Furthermore the dose relationship of chromosome aberrations induced by 60 Co-γ-rays has been investigated and used to establish the RBE dose relationship of cyclotron neutrons

  9. Chromosome aberrations in pesticide-exposed greenhouse workers

    DEFF Research Database (Denmark)

    Lander, B F; Knudsen, Lisbeth E.; Gamborg, M O

    2000-01-01

    OBJECTIVES: The aim of this study was to investigate the possibility of subtoxic exposure to pesticides causing chromosome aberrations in greenhouse workers. METHODS: In a cross-sectional and prospective study design chromosome aberration frequencies in cultured lymphocytes were examined for 116...... greenhouse workers exposed to a complex mixture of almost 50 insecticides, fungicides, and growth regulators and also for 29 nonsmoking, nonpesticide-exposed referents. RESULTS: The preseason frequencies of chromosome aberrations were slightly but not statistically significantly elevated for the greenhouse...... workers when they were compared with the referents. After a summer season of pesticide spraying in the greenhouses, the total frequencies of cells with chromosome aberrations were significantly higher than in the preseason samples (P=0.02) and also higher than for the referents (P=0.05). This finding...

  10. Brillouin micro-spectroscopy through aberrations via sensorless adaptive optics

    Science.gov (United States)

    Edrei, Eitan; Scarcelli, Giuliano

    2018-04-01

    Brillouin spectroscopy is a powerful optical technique for non-contact viscoelastic characterizations which has recently found applications in three-dimensional mapping of biological samples. Brillouin spectroscopy performances are rapidly degraded by optical aberrations and have therefore been limited to homogenous transparent samples. In this work, we developed an adaptive optics (AO) configuration designed for Brillouin scattering spectroscopy to engineer the incident wavefront and correct for aberrations. Our configuration does not require direct wavefront sensing and the injection of a "guide-star"; hence, it can be implemented without the need for sample pre-treatment. We used our AO-Brillouin spectrometer in aberrated phantoms and biological samples and obtained improved precision and resolution of Brillouin spectral analysis; we demonstrated 2.5-fold enhancement in Brillouin signal strength and 1.4-fold improvement in axial resolution because of the correction of optical aberrations.

  11. Aberrant Chromatin Modification as a Mechanism of Prostate Cancer Progression

    National Research Council Canada - National Science Library

    Chen, Hongwu

    2004-01-01

    .... However, the underlying mechanism is still unclear. The purpose of this study is to test the hypothesis that aberrant chromatin modification plays a critical role in prostate cancer progression...

  12. Aberrant internal carotid artery in the middle ear

    Energy Technology Data Exchange (ETDEWEB)

    Roh, Keun Tak; Kang, Hyun Koo [Dept. of Radiology, Seoul Veterans Hospital, Seoul (Korea, Republic of)

    2014-10-15

    The knowledge about the aberrant internal carotid artery (ICA) in the middle ear is essential for clinicians, because a misdiagnosis of the aberrant ICA could have serious consequences such as excessive aural bleeding during a middle ear surgery. A 38-year-old woman presented with tinnitus and hearing difficulties of the left ear that had started 5 years ago. During otoscopy, an anteroinferior bluish mass was seen in the tympanic space. Computed tomography and magnetic resonance imaging demonstrated a left-side aberrant ICA with bony dehiscence of the carotid canal in the middle ear and a reduced diameter of the tympanic ICA. Herein we report a case of an aberrant ICA in the middle ear. We also review the literature regarding this important vascular anomaly of the temporal bone which may lead to disastrous surgical complications.

  13. Aberrant internal carotid artery in the middle ear

    International Nuclear Information System (INIS)

    Roh, Keun Tak; Kang, Hyun Koo

    2014-01-01

    The knowledge about the aberrant internal carotid artery (ICA) in the middle ear is essential for clinicians, because a misdiagnosis of the aberrant ICA could have serious consequences such as excessive aural bleeding during a middle ear surgery. A 38-year-old woman presented with tinnitus and hearing difficulties of the left ear that had started 5 years ago. During otoscopy, an anteroinferior bluish mass was seen in the tympanic space. Computed tomography and magnetic resonance imaging demonstrated a left-side aberrant ICA with bony dehiscence of the carotid canal in the middle ear and a reduced diameter of the tympanic ICA. Herein we report a case of an aberrant ICA in the middle ear. We also review the literature regarding this important vascular anomaly of the temporal bone which may lead to disastrous surgical complications.

  14. Establishing working standards of chromosome aberrations analysis for biological dosimetry

    International Nuclear Information System (INIS)

    Bui Thi Kim Luyen; Tran Que; Pham Ngoc Duy; Nguyen Thi Kim Anh; Ha Thi Ngoc Lien

    2015-01-01

    Biological dosimetry is an dose assessment method using specify bio markers of radiation. IAEA (International Atomic Energy Agency) and ISO (International Organization for Standardization) defined that dicentric chromosome is specify for radiation, it is a gold standard for biodosimetry. Along with the documents published by IAEA, WHO, ISO and OECD, our results of study on the chromosome aberrations induced by radiation were organized systematically in nine standards that dealing with chromosome aberration test and micronucleus test in human peripheral blood lymphocytes in vitro. This standard addresses: the reference dose-effect for dose estimation, the minimum detection levels, cell culture, slide preparation, scoring procedure for chromosome aberrations use for biodosimetry, the criteria for converting aberration frequency into absorbed dose, reporting of results. Following these standards, the automatic analysis devices were calibrated for improving biological dosimetry method. This standard will be used to acquire and maintain accreditation of the Biological Dosimetry laboratory in Nuclear Research Institute. (author)

  15. Low level dose induced chromosome aberrations in human blood lymphocytes

    International Nuclear Information System (INIS)

    Pohl-Rueling, J.

    1992-01-01

    Unstable structural aberrations in chromosomes of human blood lymphocytes cannot be used as biological dosemeters in the low dose range, when extrapolating from high doses using a linear dose response, as required by the original formula of the dual radiation action theory. A survey is given of experimental dose-response curves of chromosome aberrations, obtained in investigations not only by this institute, in cooperation with many other laboratories, but also by various authors in different areas of the world. The results are not compatible with the predicted linear dose relationships at in vivo dose ranges up to 30 mGy.y -1 . The aberration frequencies rise sharply with dose within the normal environmental exposure up to about twice that level. At higher doses, aberration frequencies increase less rapidly and reach a plateau. Some in vitro experiments of various authors with higher doses of low LET radiations, up to about 400 mGy have found dose responses with steps. (author)

  16. Electron Optics for Biologists: Physical Origins of Spherical Aberrations

    Science.gov (United States)

    Geissler, Peter; Zadunaisky, Jose

    1974-01-01

    Reports on the physical origins of spherical aberrations in axially symmetric electrostatic lenses to convey the essentials of electon optics to those who must think critically about the resolution of the electron microscope. (GS)

  17. Zernike phase spatial filter for measuring the aberrations

    OpenAIRE

    Svetlana N. Khonina; Victor V. Kotlyar; Dmitriy V. Kirsh

    2015-01-01

    To measure directly the wavefront aberration coefficients, we propose to use the multi8order diffractive element fitted with the set of Zernike polynomials. Polynomials of lowest degree describe defocusing (ametropy) and astigmatism. Coefficients of highest degree correspond to the spherical aberration of oblique rays that occurs as a consequence of misalignment of the crystalline lens and foveola, as well as deflection at the periphery of the crystalline lens. Mul^order elements allow severa...

  18. Aberrant alternative splicing is another hallmark of cancer.

    Science.gov (United States)

    Ladomery, Michael

    2013-01-01

    The vast majority of human genes are alternatively spliced. Not surprisingly, aberrant alternative splicing is increasingly linked to cancer. Splice isoforms often encode proteins that have distinct and even antagonistic properties. The abnormal expression of splice factors and splice factor kinases in cancer changes the alternative splicing of critically important pre-mRNAs. Aberrant alternative splicing should be added to the growing list of cancer hallmarks.

  19. Aberrant Alternative Splicing Is Another Hallmark of Cancer

    OpenAIRE

    Ladomery, Michael

    2013-01-01

    The vast majority of human genes are alternatively spliced. Not surprisingly, aberrant alternative splicing is increasingly linked to cancer. Splice isoforms often encode proteins that have distinct and even antagonistic properties. The abnormal expression of splice factors and splice factor kinases in cancer changes the alternative splicing of critically important pre-mRNAs. Aberrant alternative splicing should be added to the growing list of cancer hallmarks.

  20. Aberrant Recapitulation of Developmental Program: Novel Target in Scleroderma

    Science.gov (United States)

    2015-12-01

    AWARD NUMBER: W81XWH-12-1-0472 TITLE: “Aberrant Recapitulation of Developmental Program: Novel Target in Scleroderma ” PRINCIPAL INVESTIGATOR...SUBTITLE Aberrant Recapitulation of Developmental Program: Novel Target in Scleroderma 5a. CONTRACT NUMBER W81XWH-12-1-0472 5b. GRANT NUMBER 5c. PROGRAM...SPONSOR/MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT 13. SUPPLEMENTARY NOTES 14. ABSTRACT Fibrosis in scleroderma is associated

  1. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Ellipsometry study of optical parameters of AgIn5S8 crystals

    Science.gov (United States)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  3. Ellipsometry study of optical parameters of AgIn{sub 5}S{sub 8} crystals

    Energy Technology Data Exchange (ETDEWEB)

    Isik, Mehmet, E-mail: mehmet.isik@atilim.edu.tr [Department of Electrical and Electronics Engineering, Atilim University, 06836 Ankara (Turkey); Gasanly, Nizami [Department of Physics, Middle East Technical University, 06800 Ankara (Turkey); Virtual International Scientific Research Centre, Baku State University, 1148 Baku (Azerbaijan)

    2015-12-01

    AgIn{sub 5}S{sub 8} crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2–6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn{sub 5}S{sub 8} crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  4. Perception and analysis of the 5S program at a business service provider

    Directory of Open Access Journals (Sweden)

    André Luiz Emmel Silva

    2016-09-01

    Full Text Available Given the importance that the service sector represents in our economy, the application of concepts and techniques for its administration and models aimed at improving its quality is growing. This article aims to analyze the main aspects of the 5S program in the implementation phase and in the course of its evolution at a service company. The methodology used is qualitative, implemented through a case study structured in 6 steps. The company under study performs strongly on the national market and therefore has a large amount of documents circulating daily through different sectors, which generated the need to implement a methodology capable of streamlining document flow management and reducing the time spent on bureaucracy by its employees. The 5S program was shown to have brought the company greater administrative efficiency and a more pleasant, safe and organized working environment, motivating employees, reducing costs and providing competitive advantages.

  5. Implementation of 5S tools as a starting point in business process reengineering

    Directory of Open Access Journals (Sweden)

    Vorkapić Miloš 0000-0002-3463-8665

    2017-01-01

    Full Text Available The paper deals with the analysis of elements which represent a starting point in implementation of a business process reengineering. We have used Lean tools through the analysis of 5S model in our research. On the example of finalization of the finished transmitter in IHMT-CMT production, 5S tools were implemented with a focus on Quality elements although the theory shows that BPR and TQM are two opposite activities in an enterprise. We wanted to distinguish the significance of employees’ self-discipline which helps the process of product finalization to develop in time and without waste and losses. In addition, the employees keep their work place clean, tidy and functional.

  6. The blue light indicator in rubidium 5S-5P-5D cascade excitation

    Science.gov (United States)

    Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan

    2017-07-01

    The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S → 5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.

  7. Attosecond relative delay among xenon 5p, 5s, and 4d photoionization

    Science.gov (United States)

    Magrakvelidze, Maia; Madjet, Mohamed; Chakraborty, Himadri

    2017-04-01

    Attosecond Wigner-Smith (WS) time delays of the photoemissions of Xe valence 5p, 5s, and core 4d electrons are investigated in details using the time-dependent local density approximation (TDLDA). Electron correlations determine the energy-dependent structures in ionization phases of the dipole channels and in the resulting WS delays at various shape resonances, induced by the collective motion of 4d electrons, and at various Cooper minima. We find that our calculation closely agrees with the streaking measurement for the delay of 4d relative to 5s, and predicts accelerated emission of 5p with respect to 4d as was experimentally observed at similar photon energies for Xe atoms adsorbed on the tungsten surface. This work was supported by the U.S. National Science Foundation.

  8. Dimensions of driving anger and their relationships with aberrant driving.

    Science.gov (United States)

    Zhang, Tingru; Chan, Alan H S; Zhang, Wei

    2015-08-01

    The purpose of this study was to investigate the relationship between driving anger and aberrant driving behaviours. An internet-based questionnaire survey was administered to a sample of Chinese drivers, with driving anger measured by a 14-item short Driving Anger Scale (DAS) and the aberrant driving behaviours measured by a 23-item Driver Behaviour Questionnaire (DBQ). The results of Confirmatory Factor Analysis demonstrated that the three-factor model (hostile gesture, arrival-blocking and safety-blocking) of the DAS fitted the driving anger data well. The Exploratory Factor Analysis on DBQ data differentiated four types of aberrant driving, viz. emotional violation, error, deliberate violation and maintaining progress violation. For the anger-aberration relation, it was found that only "arrival-blocking" anger was a significant positive predictor for all four types of aberrant driving behaviours. The "safety-blocking" anger revealed a negative impact on deliberate violations, a finding different from previously established positive anger-aberration relation. These results suggest that drivers with different patterns of driving anger would show different behavioural tendencies and as a result intervention strategies may be differentially effective for drivers of different profiles. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Science.gov (United States)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-02-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

  10. New antiferromagnetic semiconductor CuCr1.5Sb0.5S4

    International Nuclear Information System (INIS)

    Kesler, Ya.A.; Koroleva, L.I.; Mikheev, M.G.; Odintsov, A.G.; Filimonov, D.S.

    1993-01-01

    New halcogenide compound with spinel-antiferromagnetic semiconductor CuCr 1.5 Sb 0.5 S 4 are obtained and studied for the first time. Magnetic properties of this compound, namely, magnetization linear dependence, maximum on PHI(T) curve in the low-temperature area and realization of the Curie-Weis law for paramagnetic susceptibility with negative paramagnetic temperature testiby to the fact that this compound is antiferromagnetic

  11. Uudised : Eesti muusikalistaarid Euroopas. Tüüri 5.sümfoonia Tallinnas

    Index Scriptorium Estoniae

    2005-01-01

    Koit Toome, Ele Millistver ja Lauri Liiv alustavad 1. detsembril Brnos rahvusvahelises muusikalitrupis "Hairi" proovidega. Esietendus on 26. dets. Iserlohni linnas Saksamaal ning etendusi antakse järgmise aasta 16. aprillini Saksa linnades, Austrias, Šveitsis ja Taanis. Erkki-Sven Tüüri 5. sümfoonia tuleb Eestis esiettekandele 10. dets. Estonia Kontserdisaalis, teose esiettekannet selle aasta veebruaris Stuttgardis dirigeeris Olari Elts

  12. Fuel and coolant motions following pin failure: EPIC models and the PBE-5S experiment

    International Nuclear Information System (INIS)

    Garner, P.L.; Abramson, P.B.

    1979-01-01

    The EPIC computer code has been used to analyze the post-fuel-pin-failure behavior in the PBE-5S experiment performed at Sandia Laboratories. The effects of modeling uncertainties on the calculation are examined. The calculations indicate that the majority of the piston motion observed in the test is due to the initial pressurization of the coolant channel by fuel vapor at cladding failure. A more definitive analysis requires improvements in calculational capabilities and experiment diagnostics

  13. The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.

    Science.gov (United States)

    Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

    2017-10-27

    The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com

  14. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J

    2010-09-01

    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  15. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA expansion segments and DNA barcodes.

    Science.gov (United States)

    Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang

    2010-09-13

    The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  16. The Comparison of Biochemical and Sequencing 16S rDNA Gene Methods to Identify Nontuberculous Mycobacteria

    Directory of Open Access Journals (Sweden)

    Shafipour1, M.

    2014-11-01

    Full Text Available The identification of Mycobacteria in the species level has great medical importance. Biochemical tests are laborious and time-consuming, so new techniques could be used to identify the species. This research aimed to the comparison of biochemical and sequencing 16S rDNA gene methods to identify nontuberculous Mycobacteria in patients suspected to tuberculosis in Golestan province which is the most prevalent region of tuberculosis in Iran. Among 3336 patients suspected to tuberculosis referred to hospitals and health care centres in Golestan province during 2010-2011, 319 (9.56% culture positive cases were collected. Identification of species by using biochemical tests was done. On the samples recognized as nontuberculous Mycobacteria, after DNA extraction by boiling, 16S rDNA PCR was done and their sequencing were identified by NCBI BLAST. Of the 319 positive samples in Golestan Province, 300 cases were M.tuberculosis and 19 cases (5.01% were identified as nontuberculous Mycobacteria by biochemical tests. 15 out of 19 nontuberculous Mycobacteria were identified by PCR and sequencing method as similar by biochemical methods (similarity rate: 78.9%. But after PCR, 1 case known as M.simiae by biochemical test was identified as M. lentiflavum and 3 other cases were identified as Nocardia. Biochemical methods corresponded to the 16S rDNA PCR and sequencing in 78.9% of cases. However, in identification of M. lentiflavum and Nocaria sp. the molecular method is better than biochemical methods.

  17. Synthesis and growth mechanism of Zn0.5Cd0.5S nanohexagon dendrite

    Science.gov (United States)

    Yu, Wen; Fang, Pengfei; Wang, Shaojie

    2014-12-01

    Hierarchical Zn0.5Cd0.5S nanohexagon dendrites were synthesized by a one-step hydrothermal method. The Zn0.5Cd0.5S nanohexagon dendrites were made up of nanohexagons with a side length of about 90 nm. The nanohexagons were regularly arranged forming as embranchments which were parallel to each other along certain hexagonal directions. Furthermore, these embranchments made up primary trunks shaping as dendrites. The growth mechanism of Zn0.5Cd0.5S nanohexagon dendrites was proposed in which molecular soft template and lowest energy principle played key roles. By adjusting the composition of the reactants, a series of ZnxCd1-xS solid solutions could be obtained. The morphology of the synthesized ZnxCd1-xS depended much on the x value. The UV-vis spectra absorb edges of the ZnxCd1-xS samples continuously shifted indicating the changes of the band gap.

  18. Evidence-based management of otitis media: a 5S model approach.

    Science.gov (United States)

    Wasson, J D; Yung, M W

    2015-02-01

    The 5S model proposes five hierarchical levels (systems, summaries, synopses, syntheses and studies) of pre-appraised evidence to guide evidence-based practice. This review aimed to identify and summarise pre-appraised evidence at the highest available 5S level for the management of different subsets of otitis media: acute otitis media, otitis media with effusion, chronic suppurative otitis media and cholesteatoma in both adults and children. Data sources were pre-appraised evidence resources. Evidence freely available from sources at the highest available level of the 5S model were summarised for this review. System level evidence exists for acute otitis media and otitis media with effusion. Summary level evidence exists for recurrent acute otitis media and medical management of chronic suppurative otitis media. There is an absence of randomised controlled trials to prove the efficacy of surgical management of chronic suppurative otitis media and cholesteatoma. Until randomised controlled trial data are generated, consensus publications on the surgical management of chronic suppurative otitis media and cholesteatoma should be used to guide best practice.

  19. Why are our children wasting: Determinants of wasting among under 5s in Ghana.

    Science.gov (United States)

    Darteh, Eugene Kofuor Maafo; Acquah, Evelyn; Darteh, Florie

    2017-09-01

    Wasting is one of the indicators of malnutrition known to contribute to the deaths occurring from childhood malnutrition. It is the measure of body mass in relation to body length used to explain recent nutritional status. This paper examines the determinants of wasting among under 5s in Ghana. Data were drawn from the 2014 Ghana Demographic and Health Survey children's records file to examine the determinants of wasting among children. A total of 2720 children under 5 years with valid anthropometric data were used. Data on wasting were collected by measuring the weight and height of all children under 5 years of age. Bi-variate and multi-variate statistics are used to examine the determinants of wasting. The bi-variate analysis showed significant differences ( p 5s according to age of the child, region, and wealth status. On the other hand, the multi-variate analysis revealed that the odds of wasting were lower among children aged 24-35 months (Odds ratio (OR) = 0.37; p 5s. Also, efforts should be made by the relevant government agencies and other stakeholders to strengthen the socio-economic status of mothers to enable them to provide adequate nutrition and improve access to health insurance for their children in order to reduce the incidence of wasting among these children.

  20. Distraction manipulation reduction of an L5-S1 disk herniation.

    Science.gov (United States)

    Cox, J M; Hazen, L J; Mungovan, M

    1993-06-01

    A computed tomography (CT)-confirmed L5-S1 disk protrusion is reported to be reduced following chiropractic adjustment, as seen on repeat CT scanning. Correlation of the CT reports with the patient's symptoms before and after manipulation is reported. A 38-yr-old female was treated for low back pain and right lower extremity first sacral dermatome sciatica. CT confirmed disk herniations at both the L4-L5 and L5-S1 levels were found. Motor weakness of the right gluteus maximus muscle was found and extremely tight hamstring muscles accompanying positive straight leg signs were elicited. A clinical and imaging diagnosis of an L5-S1 disk herniation was made. Distraction type chiropractic manipulation, electrical stimulation, exercises, nutrition advice and low back wellness class were administered with complete relief of sciatic pain and nearly complete relief of low back pain. Chiropractic distraction manipulation is an effective treatment of lumbar disk herniation, if the chiropractor is observant during its administration for patient tolerance to manipulation under distraction and any signs of neurological deficit demanding other types of care.

  1. 18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment

    Science.gov (United States)

    Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.

    2010-01-01

    Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that

  2. Molecular phylogeny of Oncaeidae (Copepoda using nuclear ribosomal internal transcribed spacer (ITS rDNA.

    Directory of Open Access Journals (Sweden)

    Iole Di Capua

    Full Text Available Copepods belonging to the Oncaeidae family are commonly and abundantly found in marine zooplankton. In the Mediterranean Sea, forty-seven oncaeid species occur, of which eleven in the Gulf of Naples. In this Gulf, several Oncaea species were morphologically analysed and described at the end of the XIX century by W. Giesbrecht. In the same area, oncaeids are being investigated over seasonal and inter-annual scales at the long-term coastal station LTER-MC. In the present work, we identified six oncaeid species using the nuclear ribosomal internal transcribed spacers (ITS rDNA and the mitochondrial cytochrome c oxidase subunit I (mtCOI. Phylogenetic analyses based on these two genomic regions validated the sisterhood of the genera Triconia and the Oncaea sensu stricto. ITS1 and ITS2 phylogenies produced incongruent results about the position of Oncaea curta, calling for further investigations on this species. We also characterised the ITS2 region by secondary structure predictions and found that all the sequences analysed presented the distinct eukaryotic hallmarks. A Compensatory Base Change search corroborated the close relationship between O. venusta and O. curta and between O. media and O. venusta already identified by ITS phylogenies. The present results, which stem from the integration of molecular and morphological taxonomy, represent an encouraging step towards an improved knowledge of copepod biodiversity: The two complementary approaches, when applied to long-term copepod monitoring, will also help to better understanding their genetic variations and ecological niches of co-occurring species.

  3. Investigating bacterial populations in styrene-degrading biofilters by 16S rDNA tag pyrosequencing.

    Science.gov (United States)

    Portune, Kevin J; Pérez, M Carmen; Álvarez-Hornos, F Javier; Gabaldón, Carmen

    2015-01-01

    Microbial biofilms are essential components in the elimination of pollutants within biofilters, yet still little is known regarding the complex relationships between microbial community structure and biodegradation function within these engineered ecosystems. To further explore this relationship, 16S rDNA tag pyrosequencing was applied to samples taken at four time points from a styrene-degrading biofilter undergoing variable operating conditions. Changes in microbial structure were observed between different stages of biofilter operation, and the level of styrene concentration was revealed to be a critical factor affecting these changes. Bacterial genera Azoarcus and Pseudomonas were among the dominant classified genera in the biofilter. Canonical correspondence analysis (CCA) and correlation analysis revealed that the genera Brevundimonas, Hydrogenophaga, and Achromobacter may play important roles in styrene degradation under increasing styrene concentrations. No significant correlations (P > 0.05) could be detected between biofilter operational/functional parameters and biodiversity measurements, although biological heterogeneity within biofilms and/or technical variability within pyrosequencing may have considerably affected these results. Percentages of selected bacterial taxonomic groups detected by fluorescence in situ hybridization (FISH) were compared to results from pyrosequencing in order to assess the effectiveness and limitations of each method for identifying each microbial taxon. Comparison of results revealed discrepancies between the two methods in the detected percentages of numerous taxonomic groups. Biases and technical limitations of both FISH and pyrosequencing, such as the binding of FISH probes to non-target microbial groups and lack of classification of sequences for defined taxonomic groups from pyrosequencing, may partially explain some differences between the two methods.

  4. Concatenated SSU and LSU rDNA data confirm the main evolutionary trends within myxosporeans (Myxozoa: Myxosporea) and provide effective tool for their molecular phylogenetics

    Czech Academy of Sciences Publication Activity Database

    Bartošová, Pavla; Fiala, Ivan; Hypša, Václav

    2009-01-01

    Roč. 53, č. 1 (2009), s. 81-93 ISSN 1055-7903 R&D Projects: GA AV ČR KJB600960701; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : myxosporea * phylogeny * LBA * LSU rDNA * 28S * SSU rDNA * 18S * D domains Subject RIV: EG - Zoology Impact factor: 3.556, year: 2009

  5. Construction of special eye models for investigation of chromatic and higher-order aberrations of eyes.

    Science.gov (United States)

    Zhai, Yi; Wang, Yan; Wang, Zhaoqi; Liu, Yongji; Zhang, Lin; He, Yuanqing; Chang, Shengjiang

    2014-01-01

    An achromatic element eliminating only longitudinal chromatic aberration (LCA) while maintaining transverse chromatic aberration (TCA) is established for the eye model, which involves the angle formed by the visual and optical axis. To investigate the impacts of higher-order aberrations on vision, the actual data of higher-order aberrations of human eyes with three typical levels are introduced into the eye model along visual axis. Moreover, three kinds of individual eye models are established to investigate the impacts of higher-order aberrations, chromatic aberration (LCA+TCA), LCA and TCA on vision under the photopic condition, respectively. Results show that for most human eyes, the impact of chromatic aberration on vision is much stronger than that of higher-order aberrations, and the impact of LCA in chromatic aberration dominates. The impact of TCA is approximately equal to that of normal level higher-order aberrations and it can be ignored when LCA exists.

  6. Induction of chromosomal aberrations in human lymphocytes by fission neutrons

    International Nuclear Information System (INIS)

    Silva, Marcia Augusta da; Coelho, Paulo Rogerio Pinto; Bartolini, Paolo; Okazaki, Kayo

    2009-01-01

    Chromosome aberrations induced by sparsely ionizing radiation (low-LET) are well known and cytogenetic analyses of irradiated human lymphocytes have been widely applied to biological dosimetry. However, much less is known about chromosome aberrations induced by densely ionizing radiation (high LET), such as that of alpha particles or neutrons. Such particles induce DNA strand breaks, as well as chromosome breakage and rearrangements of high complexity. This damage is more localized and less efficiently repaired than after X- or γ-ray irradiation. This preferential production of complex aberrations by densely ionizing radiation is related to the unique energy deposition patterns, which produces highly localized multiple DNA damage at the chromosomal level. A better knowledge of the interactions between different types of radiation and cellular DNA is of importance, not only from the radiobiological viewpoint but also for dosimetric and therapeutic purposes. The objective of the present study was to analyse the cytogenetic effects of fission neutrons on peripheral blood lymphocytes in order to evaluate structural and numerical aberrations and number of cells in the different mitotic cycles. So, blood samples from five healthy donors, 22-25 years old, of both sexes, were irradiated in the Research Reactor IEA-R1 of our Institute (IPEN/CNEN-SP) with thermal and fast neutrons at doses of 0.2; 0.3; 0.5 and 1.0 Gy. The γ contribution to the total absorbed dose was about 30%. These doses were monitored by thermoluminescent dosemeters: LiF-600 (for neutrons) and LiF-700 (for γ-rays). The data concerning structural aberrations were evaluated with regard to three parameters: percentage of cells with aberrations, number of aberrations/cell and number of dicentric/cell. The cytogenetic results showed an increase in the three parameters after irradiation with neutrons, as a function of radiation dose. Apparently, there was no influence of neutrons on the kinetics of cellular

  7. Acute Smc5/6 depletion reveals its primary role in rDNA replication by restraining recombination at fork pausing sites.

    Directory of Open Access Journals (Sweden)

    Xiao P Peng

    2018-01-01

    Full Text Available Smc5/6, a member of the conserved SMC family of complexes, is essential for growth in most organisms. Its exact functions in a mitotic cell cycle are controversial, as chronic Smc5/6 loss-of-function alleles produce varying phenotypes. To circumvent this issue, we acutely depleted Smc5/6 in budding yeast and determined the first cell cycle consequences of Smc5/6 removal. We found a striking primary defect in replication of the ribosomal DNA (rDNA array. Each rDNA repeat contains a programmed replication fork barrier (RFB established by the Fob1 protein. Fob1 removal improves rDNA replication in Smc5/6 depleted cells, implicating Smc5/6 in the management of programmed fork pausing. A similar improvement is achieved by removing the DNA helicase Mph1 whose recombinogenic activity can be inhibited by Smc5/6 under DNA damage conditions. DNA 2D gel analyses further show that Smc5/6 loss increases recombination structures at RFB regions; moreover, mph1∆ and fob1∆ similarly reduce this accumulation. These findings point to an important mitotic role for Smc5/6 in restraining recombination events when protein barriers in rDNA stall replication forks. As rDNA maintenance influences multiple essential cellular processes, Smc5/6 likely links rDNA stability to overall mitotic growth.

  8. Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

    Science.gov (United States)

    Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

    2016-01-01

    Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

  9. 5S-MENETELMÄN KÄYTTÖÖNOTTO: LUVATA PORI OY

    OpenAIRE

    Rantanen, Suvi

    2015-01-01

    Opinnäytetyön aiheena oli 5S-menetelmän käyttöönotto Luvata Pori Oy:n tuotannos-sa. Tutkimuksen lähtökohtana ja ongelmana oli siisteyden ja järjestyksen puute. Ta-voitteena oli aikaansaada valittuun pilottikohteeseen toimivat, siistit ja turvalliset tuotantotilat sekä luoda järjestelmä, jonka avulla ylläpidetään saavutettu taso. Lisäksi tavoiteltiin hukan poistamista ja Luvatan Lean toimintatavan syventämistä. Projekti toteutettiin toimintatutkimuksena syksyn 2015 aikana. Tutkimuksen teor...

  10. Ionizing radiation and frequency of chromosomal aberrations in exposed personnel

    International Nuclear Information System (INIS)

    Spasojevic-Tisma, Vera; Pavlovic, Snezana

    2008-01-01

    Full text: Frequencies of chromosomal aberrations in lymphocytes of peripheral blood were investigated among the observed groups of subjects who were exposed to low radiation doses (external exposure) in comparison with the control group. The first group of subjects is involved in the production of radioisotope technetium, whose accumulated work exposure time ranges between 3 and 30 years. The second group works on inspection of the medical X-ray equipment, whose accumulated work exposure time is between 2 and 34 years. The third group worked on decontamination of the terrain from depleted uranium radioactive ammunition. These workers were involved in mechanical removal of the surface soil layer to a depth of 50 cm. They were selected out of a group of professionals otherwise exposed to radiation from confined sources in their daily work. The accumulated work exposure of this group ranged from 2 to 34 years. The control group consisted of individuals not working in the ionizing radiation zone. The average yearly absorbed dose measured by TL dosimeters for all three observed groups did not exceed 2 mSv. The chromosomal aberrations were analyzed by a modified Moorhead method. The objective of the study was to establish the existence of differences in the frequencies of chromosomal aberrations change with respect to the source type, i.e. type of radioactive emission. Comparisons of the chromosomal changes in the observed groups revealed that the group working on technetium production had an increase in the frequency of chromosomal aberrations with respect to control. The aberrations found were of the acentric fragment and chromosomal break types. A comparison of the exposed groups between each other, no statistically significant differences in the numbers of chromosomal aberrations were found. Soil decontamination from depleted uranium did not contribute to the relative radiation risk, since it lasted only a few months, and was done by the professionals fully clothed

  11. Revisiting Cross-Channel Information Transfer for Chromatic Aberration Correction

    KAUST Repository

    Sun, Tiancheng; Peng, Yifan; Heidrich, Wolfgang

    2017-01-01

    Image aberrations can cause severe degradation in image quality for consumer-level cameras, especially under the current tendency to reduce the complexity of lens designs in order to shrink the overall size of modules. In simplified optical designs, chromatic aberration can be one of the most significant causes for degraded image quality, and it can be quite difficult to remove in post-processing, since it results in strong blurs in at least some of the color channels. In this work, we revisit the pixel-wise similarity between different color channels of the image and accordingly propose a novel algorithm for correcting chromatic aberration based on this cross-channel correlation. In contrast to recent weak prior-based models, ours uses strong pixel-wise fitting and transfer, which lead to significant quality improvements for large chromatic aberrations. Experimental results on both synthetic and real world images captured by different optical systems demonstrate that the chromatic aberration can be significantly reduced using our approach.

  12. Radiation-induced cellular reproductive death and chromosome aberrations

    International Nuclear Information System (INIS)

    Bedford, J.S.; Mitchell, J.B.; Griggs, H.G.; Bender, M.A.

    1978-01-01

    If a major mode of cell killing by ionizing radiation is the death of cells containing visible chromosomal aberrations, as for example from anaphase-bridge formation at mitosis, then cells bearing such aberrations should be selectively eliminated from the population, resulting in an increased survival potential for the population remaining at each succeeding cell generation. Using synchronized V79B Chinese hamster cells, we measured the aberration frequency and the colony-forming ability of mitotic cells at each of the first three generations following irradiation in G1. Cells were resynchronized by mechanial harvest at each succeeding mitosis after irradiation in order to avoid mixing of generations in the cell population at later sampling times. As anticipated, the chromosome aberration frequencies decreased markedly from the first to the second and from the second to the third mitosis. The surviving fraction, however, was virtually the same for plating assays carried out immediately after irradiation, at the first, or at the second mitosis. The surviving fraction was significantly higher for cells reaching the third postirradiation mitosis. Survival and aberration frequencies were assayed again at approximately the fourteenth postirradiation division, by which time the irradiated and control populations were not significantly different

  13. Primary chromatic aberration elimination via optimization work with genetic algorithm

    Science.gov (United States)

    Wu, Bo-Wen; Liu, Tung-Kuan; Fang, Yi-Chin; Chou, Jyh-Horng; Tsai, Hsien-Lin; Chang, En-Hao

    2008-09-01

    Chromatic Aberration plays a part in modern optical systems, especially in digitalized and smart optical systems. Much effort has been devoted to eliminating specific chromatic aberration in order to match the demand for advanced digitalized optical products. Basically, the elimination of axial chromatic and lateral color aberration of an optical lens and system depends on the selection of optical glass. According to reports from glass companies all over the world, the number of various newly developed optical glasses in the market exceeds three hundred. However, due to the complexity of a practical optical system, optical designers have so far had difficulty in finding the right solution to eliminate small axial and lateral chromatic aberration except by the Damped Least Squares (DLS) method, which is limited in so far as the DLS method has not yet managed to find a better optical system configuration. In the present research, genetic algorithms are used to replace traditional DLS so as to eliminate axial and lateral chromatic, by combining the theories of geometric optics in Tessar type lenses and a technique involving Binary/Real Encoding, Multiple Dynamic Crossover and Random Gene Mutation to find a much better configuration for optical glasses. By implementing the algorithms outlined in this paper, satisfactory results can be achieved in eliminating axial and lateral color aberration.

  14. Chromosomal aberrations in subjects exposed to ionizing radiation

    International Nuclear Information System (INIS)

    Jovicic, D.; Milacic, S.; Kovacevic, R.; Tanaskovic, I.

    2006-01-01

    Occupational exposure is particularly delicate because of chronic exposure to low doses of ionizing radiation and its cumulative effect, where it is important to consider the biological response of body to given conditions of exposure. The objective of this study was the observation of the recovery of the DNA damages in subjects working in the radiation area in two different intervals.Group I, consisting of 30 subjects, was exposed to ionizing radiation and unstable chromosomal aberrations were identified. Group II included the same, re-examined subjects (30) 9 months later. It was verified that 5 (16.67%) subjects still had unstable chromosomal aberrations, although they had been excluded from radiation area Controls groups (C) consisted of 64 subjects that were not exposed to mutagenic agents.The comparison of the control group with the two studied groups revealed the reduction of the unstable aberrations (p<0.05). The total effective doses, which increased with the years spent in radiation area, reflected the yield of chromosomal aberrations. The presence of chromosomal aberrations in some subjects, after the exclusion from the ionising radiation exposure, suggests that the time needed for the recovery of the DNA damages is different, which indicates the individual differences in radiosensitivity as well as different of the reparatory cellular response. (author)

  15. Revisiting Cross-Channel Information Transfer for Chromatic Aberration Correction

    KAUST Repository

    Sun, Tiancheng

    2017-12-25

    Image aberrations can cause severe degradation in image quality for consumer-level cameras, especially under the current tendency to reduce the complexity of lens designs in order to shrink the overall size of modules. In simplified optical designs, chromatic aberration can be one of the most significant causes for degraded image quality, and it can be quite difficult to remove in post-processing, since it results in strong blurs in at least some of the color channels. In this work, we revisit the pixel-wise similarity between different color channels of the image and accordingly propose a novel algorithm for correcting chromatic aberration based on this cross-channel correlation. In contrast to recent weak prior-based models, ours uses strong pixel-wise fitting and transfer, which lead to significant quality improvements for large chromatic aberrations. Experimental results on both synthetic and real world images captured by different optical systems demonstrate that the chromatic aberration can be significantly reduced using our approach.

  16. Spherical aberration and other higher-order aberrations in the human eye : from summary wave-front analysis data to optical variables relevant to visual perception

    NARCIS (Netherlands)

    Jansonius, Nomdo M.

    Wave-front analysis data from the human eye are commonly presented using the aberration coefficient c(4)(0) (primary spherical aberration) together with an overall measure of all higher-order aberrations. If groups of subjects are compared, however, the relevance of an observed difference cannot

  17. Intelligent Diagnostic Assistant for Complicated Skin Diseases through C5's Algorithm.

    Science.gov (United States)

    Jeddi, Fatemeh Rangraz; Arabfard, Masoud; Kermany, Zahra Arab

    2017-09-01

    Intelligent Diagnostic Assistant can be used for complicated diagnosis of skin diseases, which are among the most common causes of disability. The aim of this study was to design and implement a computerized intelligent diagnostic assistant for complicated skin diseases through C5's Algorithm. An applied-developmental study was done in 2015. Knowledge base was developed based on interviews with dermatologists through questionnaires and checklists. Knowledge representation was obtained from the train data in the database using Excel Microsoft Office. Clementine Software and C5's Algorithms were applied to draw the decision tree. Analysis of test accuracy was performed based on rules extracted using inference chains. The rules extracted from the decision tree were entered into the CLIPS programming environment and the intelligent diagnostic assistant was designed then. The rules were defined using forward chaining inference technique and were entered into Clips programming environment as RULE. The accuracy and error rates obtained in the training phase from the decision tree were 99.56% and 0.44%, respectively. The accuracy of the decision tree was 98% and the error was 2% in the test phase. Intelligent diagnostic assistant can be used as a reliable system with high accuracy, sensitivity, specificity, and agreement.

  18. Spondylolysis and End Plate Arthrosis at L5-S1: A Cadaveric Study.

    Science.gov (United States)

    McCunniff, Peter T; Yoo, Hojun; Yu, Charles; Bajwa, Navkirat S; Toy, Jason O; Ahn, Uri M; Ahn, Nicholas

    2017-01-01

    This study examined the effect of bilateral and unilateral L5 pars defects on the degree of disk degeneration at the L5-S1 level in cadaveric specimens. An observational study was performed of 690 cadaveric specimens selected at random. These specimens represent individuals who died between 1893 and 1938. The study included 558 male and 132 female cadavers. Of the 120 specimens with L5 spondylolysis, 95 cases were bilateral and 25 were unilateral. The remaining 544 specimens were used as the control cohort. Degenerative disk disease was measured by the classification of Eubanks et al. According to this classification, degenerative disk disease was graded from no arthrosis (grade 0) to complete ankylosis (grade IV). Linear regression analysis corrected for age, sex, and race showed that subjects with bilateral spondylolysis at L5 had a statistically significant increase in the amount of disk degeneration (P=.02) compared with those with unilateral lesions. Student's t tests showed significant differences (Pspondylolysis above what would be predicted in the normal control population. A positive correlation was found between the number of pars defects at L5 and the degree of disk degeneration at L5-S1. These results support the idea that individuals with spondylolysis at these levels may be at increased risk for development of low back pain and reduced quality of life. [Orthopedics. 2017; 40(1):e59-e64.]. Copyright 2016, SLACK Incorporated.

  19. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  20. Bacterial diversity of soil under eucalyptus assessed by 16S rDNA sequencing analysis Diversidade bacteriana de solo sob eucaliptos obtida por seqüenciamento do 16S rDNA

    Directory of Open Access Journals (Sweden)

    Érico Leandro da Silveira

    2006-10-01

    Full Text Available Studies on the impact of Eucalyptus spp. on Brazilian soils have focused on soil chemical properties and isolating interesting microbial organisms. Few studies have focused on microbial diversity and ecology in Brazil due to limited coverage of traditional cultivation and isolation methods. Molecular microbial ecology methods based on PCR amplified 16S rDNA have enriched the knowledge of soils microbial biodiversity. The objective of this work was to compare and estimate the bacterial diversity of sympatric communities within soils from two areas, a native forest (NFA and an eucalyptus arboretum (EAA. PCR primers, whose target soil metagenomic 16S rDNA were used to amplify soil DNA, were cloned using pGEM-T and sequenced to determine bacterial diversity. From the NFA soil 134 clones were analyzed, while 116 clones were analyzed from the EAA soil samples. The sequences were compared with those online at the GenBank. Phylogenetic analyses revealed differences between the soil types and high diversity in both communities. Soil from the Eucalyptus spp. arboretum was found to have a greater bacterial diversity than the soil investigated from the native forest area.Estudos sobre impacto do Eucalyptus spp. em solos brasileiros têm focalizado propriedades químicas do solo e isolamento de microrganismos de interesse. No Brasil há pouco enfoque em ecologia e diversidade microbiana, devido às limitações dos métodos tradicionais de cultivo e isolamento. A utilização de métodos moleculares no estudo da ecologia microbiana baseados na amplificação por PCR do 16S rDNA têm enriquecido o conhecimento da biodiversidade microbiana dos solos. O objetivo deste trabalho foi comparar e estimar a diversidade bacteriana de comunidades simpátricas em solos de duas áreas: uma floresta nativa (NFA e outra adjacente com arboreto de eucaliptos (EAA. Oligonucleotídeos iniciadores foram utilizados para amplificar o 16S rDNA metagenômico do solo, o qual foi

  1. Spectral analysis of 5s25p2(6p+6d+7s) configurations of Ba VI

    International Nuclear Information System (INIS)

    Sharma, M.K.; Tauheed, A.; Rahimullah, K.

    2014-01-01

    The sixth spectrum of barium (Ba VI) has been investigated with the aid of experimental recordings made on a 3-m normal incidence vacuum spectrograph of Antigonish laboratory (Canada) in the wavelength region 300–2080 Å using triggered spark as an excitation source. The spectral analysis has been extended considerably to include new configuration the 5s 2 5p 2 6p in odd parity matrix and the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations in even parity matrix. Previously reported levels of the ground configuration (5s 2 5p 3 ) and three lowest excited configurations the 5s5p 4 , 5s 2 5p 2 5d and 5s 2 5p 2 6s have been confirmed and the two unknown levels of the 5s 2 5p 2 5d configuration with J=9/2, have now been established through the identification of transitions from the 5s 2 5p 2 6p levels. All twenty one levels of the 5s 2 5p 2 6p configuration and twenty nine levels out of thirty six of the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations have now been established. Hartree–Fock calculations involving configuration interactions support the analyses. The accuracy of our wavelength measurement is ±0.005 Å for sharp lines. - Highlights: • The spectrum of Ba was recorded on a 3-m spectrograph with triggered spark source. • Atomic transitions for Ba VI were identified to established new energy levels. • CI calculations with relativistic corrections were made for theoretical predictions. • Weighted oscillator strength (gf) and transition probabilities (gA) were calculated

  2. Aberrations in preliminary design of ITER divertor impurity influx monitor

    Energy Technology Data Exchange (ETDEWEB)

    Kitazawa, Sin-iti, E-mail: kitazawa.siniti@jaea.go.jp [Naka Fusion Institute, Japan Atomic Energy Agency, JAEA, Naka 311-0193 (Japan); Ogawa, Hiroaki [Naka Fusion Institute, Japan Atomic Energy Agency, JAEA, Naka 311-0193 (Japan); Katsunuma, Atsushi; Kitazawa, Daisuke [Core Technology Center, Nikon Corporation, Yokohama 244-8533 (Japan); Ohmori, Keisuke [Customized Products Business Unit, Nikon Corporation, Mito 310-0843 (Japan)

    2015-12-15

    Highlights: • Divertor impurity influx monitor for ITER (DIM) is procured by JADA. • DIM is designed to observe light from nuclear fusion plasma directly. • DIM is under preliminary design phase. • The spot diagrams were suppressed within the core of receiving fiber. • The aberration of DIM is suppressed in the preliminary design. - Abstract: Divertor impurity influx monitor for ITER (DIM) is a diagnostic system that observes light from nuclear fusion plasma directly. This system is affected by various aberrations because it observes light from the fan-array chord near the divertor in the ultraviolet–near infrared wavelength range. The aberrations should be suppressed to the extent possible to observe the light with very high spatial resolution. In the preliminary design of DIM, spot diagrams were suppressed within the core of the receiving fiber's cross section, and the resulting spatial resolutions satisfied the design requirements.

  3. Estimation and Compensation of aberrations in Spatial Light Modulators

    International Nuclear Information System (INIS)

    Arias, Augusto; Castaneda, Roman

    2011-01-01

    The spatial light modulator (SLM) Holoeye LC-R720 is based on LCoS (Liquid Crystal on Silicon) technology. Due to the induced curvatures on the silicon plate by the production process, there are static aberrations in the wave-fronts modified by the SLM. In order to calculate the aberrated wave-front we used phase-shifting interferometry, an optimization algorithm for far field propagation, and the geometric characterization of the focal spot along the caustic. Zernike polynomials were used for expanding and comparing the wave-fronts. The aberration compensation was carried out by displaying the conjugated transmittance on the SLM. The complexity of the experimental setup and the requirements of the digital processing of each estimation method were comparatively analyzed.

  4. Screening for aberrant behavior in the nuclear industry

    International Nuclear Information System (INIS)

    Borofsky, G.L.

    1987-01-01

    This paper attempts to promote a fuller understanding of how psychological assessment procedures can be used to reduce the threat from aberrant behavior in the nuclear industry. It begins with a discussion of the scientifically based methods that are used by psychologists in constructing, scoring, and interpreting these procedures. This discussion includes an emphasis on the concepts of validity and reliability and their central importance when one is choosing specific psychological screening tools. Criteria for selecting and using psychological assessment procedures when screening for aberrant behavior are also provided. Some commonly used assessment procedures that satisfy these criteria are discussed. A number a psychological assessment procedures specifically recommended for use in screening for aberrant behavior in the nuclear industry are described

  5. Split-plot fractional designs: Is minimum aberration enough?

    DEFF Research Database (Denmark)

    Kulahci, Murat; Ramirez, Jose; Tobias, Randy

    2006-01-01

    Split-plot experiments are commonly used in industry for product and process improvement. Recent articles on designing split-plot experiments concentrate on minimum aberration as the design criterion. Minimum aberration has been criticized as a design criterion for completely randomized fractional...... factorial design and alternative criteria, such as the maximum number of clear two-factor interactions, are suggested (Wu and Hamada (2000)). The need for alternatives to minimum aberration is even more acute for split-plot designs. In a standard split-plot design, there are several types of two...... for completely randomized designs. Consequently, we provide a modified version of the maximum number of clear two-factor interactions design criterion to be used for split-plot designs....

  6. [Frequency of chromosome aberrations in residents of the Semipalatinsk Oblast].

    Science.gov (United States)

    Gubitskaia, E G; Akhmatullina, N B; Vsevolodov, E B; Bishnevskaia, S S; Sharipov, I K; Cherednichenko, O G

    1999-06-01

    Cytogenetic analysis of the population of the Beskaragai district of the Semipalatinsk oblast adjacent to the territory of the nuclear test site was conducted by means of an ecological genetic questionnaire and cytogenetic examination of metaphase chromosomes. An increase in the total mutation level in the region was observed. The frequency of chromosome aberrations among the population of the Beskaragai district (3.2%) was statistically significantly (about 1.5 times) higher than the background levels in the clear regions (from 1 to 2%). Furthermore, the frequency of aberrations in adolescents was comparable with that in the adults. The spectrum of chromosome aberrations pointed to a significant contribution of radiation component to the mutagenesis.

  7. Low chromatic aberration hexapole for molecular state selection

    International Nuclear Information System (INIS)

    Ke, Yi; Deng, Xiao-Bing; Hu, Zhong-Kun

    2016-01-01

    In molecular beam state-selection experiments, the electrostatic hexapole acts as an optical lens, imaging molecules from the source to the focus. The molecular longitudinal velocity spread induces the phenomenon of chromatic aberration, which will reduce the state-selection purity. We propose a scheme which can effectively reduce the chromatic aberration by changing the hexapole voltage operating manner. The hexapole is already charged before molecules arrive at the entrance of the hexapole. When molecules are completely inside the hexapole, the voltage is switched off rapidly at an appropriate time. In this manner, faster molecules travel a longer hexapole focusing region than slower molecules. Therefore the focusing positions of molecules with different velocities become close. Numerical trajectory simulations of molecular state selection are carried out, and the results show that this low chromatic aberration hexapole can significantly improve the state purity from 46.2% to 87.0%. (paper)

  8. Biological dosimetry: chromosomal aberration analysis for dose assessment

    International Nuclear Information System (INIS)

    1986-01-01

    In view of the growing importance of chromosomal aberration analysis as a biological dosimeter, the present report provides a concise summary of the scientific background of the subject and a comprehensive source of information at the technical level. After a review of the basic principles of radiation dosimetry and radiation biology basic information on the biology of lymphocytes, the structure of chromosomes and the classification of chromosomal aberrations are presented. This is followed by a presentation of techniques for collecting blood, storing, transporting, culturing, making chromosomal preparations and scaring of aberrations. The physical and statistical parameters involved in dose assessment are discussed and examples of actual dose assessments taken from the scientific literature are given

  9. Correcting the Chromatic Aberration in Barrel Distortion of Endoscopic Images

    Directory of Open Access Journals (Sweden)

    Y. M. Harry Ng

    2003-04-01

    Full Text Available Modern endoscopes offer physicians a wide-angle field of view (FOV for minimally invasive therapies. However, the high level of barrel distortion may prevent accurate perception of image. Fortunately, this kind of distortion may be corrected by digital image processing. In this paper we investigate the chromatic aberrations in the barrel distortion of endoscopic images. In the past, chromatic aberration in endoscopes is corrected by achromatic lenses or active lens control. In contrast, we take a computational approach by modifying the concept of image warping and the existing barrel distortion correction algorithm to tackle the chromatic aberration problem. In addition, an error function for the determination of the level of centroid coincidence is proposed. Simulation and experimental results confirm the effectiveness of our method.

  10. Circumflex coronary artery with aberrant origin and atherosclerosis

    International Nuclear Information System (INIS)

    Ozcan, E.; Bozlar, U.; Celik, T.; Tasar, M.

    2012-01-01

    Full text: Introduction: Circumflex (Cx) coronary artery congenital anomaly is reported to be less than 1% incidence. Coronary arteries with aberrant origin are more likely to have atherosclerosis according to some published literatures. Objectives and tasks: In this study we aim to present computed tomography (CT) angiography findings of a patient, who has Cx artery with aberrant origin and atherosclerotic. Materials and methods: 57-year-old woman without any symptoms who has risk factors to atherosclerosis was referred to our clinic for coronary CT angiography. Results: In CT angiography; we detected Cx coronary artery with aberrant origin (right sinus of valsalva) and retroaortic course. Also we saw intimal irregularities and calcified plaque causing severe narrowing in the proximal segment of artery. Right coronary and left anterior descendant arteries had mild atherosclerosis. Conclusion: Coroner CT angiography, which allows multiplanar imaging with high resolution, is an effective diagnostic tool for coronary artery disease, like not only congenital anomalies but also acquired atherosclerotic disease

  11. An electron microscope for the aberration-corrected era

    Energy Technology Data Exchange (ETDEWEB)

    Krivanek, O.L. [Nion Co., 1102 8th Street, Kirkland, WA 98033 (United States)], E-mail: krivanek.ondrej@gmail.com; Corbin, G.J.; Dellby, N.; Elston, B.F.; Keyse, R.J.; Murfitt, M.F.; Own, C.S.; Szilagyi, Z.S.; Woodruff, J.W. [Nion Co., 1102 8th Street, Kirkland, WA 98033 (United States)

    2008-02-15

    Improved resolution made possible by aberration correction has greatly increased the demands on the performance of all parts of high-end electron microscopes. In order to meet these demands, we have designed and built an entirely new scanning transmission electron microscope (STEM). The microscope includes a flexible illumination system that allows the properties of its probe to be changed on-the-fly, a third-generation aberration corrector which corrects all geometric aberrations up to fifth order, an ultra-responsive yet stable five-axis sample stage, and a flexible configuration of optimized detectors. The microscope features many innovations, such as a modular column assembled from building blocks that can be stacked in almost any order, in situ storage and cleaning facilities for up to five samples, computer-controlled loading of samples into the column, and self-diagnosing electronics. The microscope construction is described, and examples of its capabilities are shown.

  12. An electron microscope for the aberration-corrected era

    International Nuclear Information System (INIS)

    Krivanek, O.L.; Corbin, G.J.; Dellby, N.; Elston, B.F.; Keyse, R.J.; Murfitt, M.F.; Own, C.S.; Szilagyi, Z.S.; Woodruff, J.W.

    2008-01-01

    Improved resolution made possible by aberration correction has greatly increased the demands on the performance of all parts of high-end electron microscopes. In order to meet these demands, we have designed and built an entirely new scanning transmission electron microscope (STEM). The microscope includes a flexible illumination system that allows the properties of its probe to be changed on-the-fly, a third-generation aberration corrector which corrects all geometric aberrations up to fifth order, an ultra-responsive yet stable five-axis sample stage, and a flexible configuration of optimized detectors. The microscope features many innovations, such as a modular column assembled from building blocks that can be stacked in almost any order, in situ storage and cleaning facilities for up to five samples, computer-controlled loading of samples into the column, and self-diagnosing electronics. The microscope construction is described, and examples of its capabilities are shown

  13. Aberrations in preliminary design of ITER divertor impurity influx monitor

    International Nuclear Information System (INIS)

    Kitazawa, Sin-iti; Ogawa, Hiroaki; Katsunuma, Atsushi; Kitazawa, Daisuke; Ohmori, Keisuke

    2015-01-01

    Highlights: • Divertor impurity influx monitor for ITER (DIM) is procured by JADA. • DIM is designed to observe light from nuclear fusion plasma directly. • DIM is under preliminary design phase. • The spot diagrams were suppressed within the core of receiving fiber. • The aberration of DIM is suppressed in the preliminary design. - Abstract: Divertor impurity influx monitor for ITER (DIM) is a diagnostic system that observes light from nuclear fusion plasma directly. This system is affected by various aberrations because it observes light from the fan-array chord near the divertor in the ultraviolet–near infrared wavelength range. The aberrations should be suppressed to the extent possible to observe the light with very high spatial resolution. In the preliminary design of DIM, spot diagrams were suppressed within the core of the receiving fiber's cross section, and the resulting spatial resolutions satisfied the design requirements.

  14. Hyperfine structure in 5s4d [sup 3]D-5snf transitions of [sup 87]Sr

    Energy Technology Data Exchange (ETDEWEB)

    Bushaw, B.A. (Pacific Northwest Lab., Richland, WA (United States)); Kluge, H.J. (Mainz Univ. (Germany). Inst. fuer Physik); Lantzsch, J. (Mainz Univ. (Germany). Inst. fuer Physik); Schwalbach, R. (Mainz Univ. (Germany). Inst. fuer Physik); Stenner, J. (Mainz Univ. (Germany). Inst. fuer Physik); Stevens, H. (Mainz Univ. (Germany). Inst. fuer Physik); Wendt, K. (Mainz Univ. (Germany). Inst. fuer Physik); Zimmer, K. (Mainz Univ. (Germany). Inst. fuer Physik)

    1993-12-01

    The hyperfine spectra of the 5s4d[sup 3]D[sub 1]-5s20f, 5s4d[sup 3]D[sub 2]-5s23f, and 5s4d[sup 3]D[sub 3]-5s32f transitions of [sup 87]Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a[sub 5s] and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d[sup 3]D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  15. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S

    1991-01-01

    4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....

  16. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  17. In vivo chromatic aberration in eyes implanted with intraocular lenses.

    Science.gov (United States)

    Pérez-Merino, Pablo; Dorronsoro, Carlos; Llorente, Lourdes; Durán, Sonia; Jiménez-Alfaro, Ignacio; Marcos, Susana

    2013-04-12

    To measure in vivo and objectively the monochromatic aberrations at different wavelengths, and the chromatic difference of focus between green and infrared wavelengths in eyes implanted with two models of intraocular lenses (IOL). EIGHTEEN EYES PARTICIPATED IN THIS STUDY: nine implanted with Tecnis ZB99 1-Piece acrylic IOL and nine implanted with AcrySof SN60WF IOL. A custom-developed laser ray tracing (LRT) aberrometer was used to measure the optical aberrations, at 532 nm and 785 nm wavelengths. The monochromatic wave aberrations were described using a fifth-order Zernike polynomial expansion. The chromatic difference of focus was estimated as the difference between the equivalent spherical errors corresponding to each wavelength. Wave aberration measurements were highly reproducible. Except for the defocus term, no significant differences in high order aberrations (HOA) were found between wavelengths. The average chromatic difference of focus was 0.46 ± 0.15 diopters (D) in the Tecnis group, and 0.75 ± 0.12 D in the AcrySof group, and the difference was statistically significant (P Chromatic difference of focus in the AcrySof group was not statistically significantly different from the Longitudinal chromatic aberration (LCA) previously reported in a phakic population (0.78 ± 0.16 D). The impact of LCA on retinal image quality (measured in terms of Strehl ratio) was drastically reduced when considering HOA and astigmatism in comparison with a diffraction-limited eye, yielding the differences in retinal image quality between Tecnis and AcrySof IOLs not significant. LRT aberrometry at different wavelengths is a reproducible technique to evaluate the chromatic difference of focus objectively in eyes implanted with IOLs. Replacement of the crystalline lens by the IOL did not increase chromatic difference of focus above that of phakic eyes in any of the groups. The AcrySof group showed chromatic difference of focus values very similar to physiological values in

  18. In vivo longitudinal chromatic aberration of pseudophakic eyes.

    Science.gov (United States)

    Siedlecki, Damian; Jóźwik, Agnieszka; Zając, Marek; Hill-Bator, Aneta; Turno-Kręcicka, Anna

    2014-02-01

    To present the results of longitudinal chromatic aberration measurements on two groups of pseudophakic eyes in comparison to healthy eyes. The longitudinal chromatic aberration of the eye, defined as chromatic difference of refraction with disabled accommodation, was measured with the use of a visual refractometer with a custom-designed target illuminator consisting of a narrow-band RGB diode (blue λb = 470 ± 15 nm; green λg = 525 ± 18 nm; red λr = 660 ± 10 nm). The measurements were performed on nine eyes implanted with AcrySof IQ SN60WF, 14 eyes implanted with AcrySof SA60AT, and 10 phakic eyes under cycloplegia. The mean values of the longitudinal chromatic aberration between 470 and 660 nm for the control group was 1.12 ± 0.14 D. For SA60AT group, it was 1.45 ± 0.42 D whereas for SN60WF it was 1.17 ± 0.52 D. The statistical test showed significant difference between SA60AT and the control group (p chromatic aberration in vivo can be easily and reliably estimated with an adapted visual refractometer. The two groups of pseudophakic eyes measured in this study showed different values of chromatic aberration. Its magnitude for SA60AT group was significantly larger than for the control group whereas for SN60WF the difference was not significant. The optical material used for intraocular lens design may have significant influence on the magnitude of the chromatic aberration of the pseudophakic eye, and therefore on its optical and visual performance in polychromatic light.

  19. Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

    Science.gov (United States)

    Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

    2012-12-01

    The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

  20. Male meiosis, heterochromatin characterization and chromosomal location of rDNA in Microtomus lunifer (Berg, 1900 (Hemiptera: Reduviidae: Hammacerinae

    Directory of Open Access Journals (Sweden)

    María Poggio

    2011-05-01

    Full Text Available In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900 by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y, including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in M. conspicillaris (Drury, 1782 (2n=28+XY. However, M. lunifer has a multiple sex chromosome system X1X2Y (male that could have originated by fragmentation of the ancestral X chromosome. Taking into account that M. conspicillaris and M. lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in M. lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants  of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity.

  1. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  2. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China.

    Directory of Open Access Journals (Sweden)

    Haishan Wang

    Full Text Available We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82% and two rare types 2n = 36 = 11M + 7SM (14% and 2n = 36 = 10M + 7SM + 1ST (4%. The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies.

  3. Scaling laws for aberrations in magnetic quadrupole lens systems

    International Nuclear Information System (INIS)

    Moses, R.W.; Heighway, E.A.; Christian, R.S.; Dragt, A.J.

    1987-01-01

    A comparison has been made of the third-order (spherical) abberrations in magnetic quadrupole lenses for use in conventional charged particle beam transport systems. An analytical description of the abberrations is presented and this is compared with the results of high order numerical integration. The dependence of the aberration strength on the system geometry and f number is given and a comparison of doublet and triplet systems made. The reduction of the aberrations in both doublet and triplet systems using embedded magnetic octupole lenses is also discussed and analytical predictions are given

  4. Aberration compensation using a spatial light modulator LCD

    International Nuclear Information System (INIS)

    Amezquita, R; Rincon, O; Torres, Y M

    2011-01-01

    The dynamic correction of aberrations introduced in optical systems have been a widely discussed topic in the past 10 years. Adaptive optics is the most important developed field where the Shack-Hartmann sensors and deformable mirrors are used for the measurement and correction of wavefronts. In this paper, an interferometric set-up which uses a Spatial Light Modulator (SLM) as an active element is proposed. Using this SLM a procedure for the compensation of all phase aberrations present in the experimental setup is shown.

  5. Measurement of eye aberrations in a speckle field

    International Nuclear Information System (INIS)

    Larichev, A V; Ivanov, P V; Iroshnikov, N G; Shmalgauzen, V I

    2001-01-01

    The influence of speckles on the performance of a Shark-Hartmann wavefront sensor is investigated in the eye aberration studies. The dependence of the phase distortion measurement error on the characteristic speckle size is determined experimentally. Scanning of the reference source was used to suppress the speckle structure of the laser beam scattered by the retina. The technique developed by us made it possible to study the time dependence of the human eye aberrations with a resolution of 30 ms. (laser applications and other topics in quantum electronics)

  6. Selective corneal optical aberration (SCOA) for customized ablation

    Science.gov (United States)

    Jean, Benedikt J.; Bende, Thomas

    2001-06-01

    Wavefront analysis still have some technical problems which may be solved within the next years. There are some limitations to use wavefront as a diagnostic tool for customized ablation alone. An ideal combination would be wavefront and topography. Meanwhile Selective Corneal Aberration is a method to visualize the optical quality of a measured corneal surface. It is based on a true measured 3D elevation information of a video topometer. Thus values can be interpreted either using Zernike polynomials or visualized as a so called color coded surface quality map. This map gives a quality factor (corneal aberration) for each measured point of the cornea.

  7. Static telescope aberration measurement using lucky imaging techniques

    Science.gov (United States)

    López-Marrero, Marcos; Rodríguez-Ramos, Luis Fernando; Marichal-Hernández, José Gil; Rodríguez-Ramos, José Manuel

    2012-07-01

    A procedure has been developed to compute static aberrations once the telescope PSF has been measured with the lucky imaging technique, using a nearby star close to the object of interest as the point source to probe the optical system. This PSF is iteratively turned into a phase map at the pupil using the Gerchberg-Saxton algorithm and then converted to the appropriate actuation information for a deformable mirror having low actuator number but large stroke capability. The main advantage of this procedure is related with the capability of correcting static aberration at the specific pointing direction and without the need of a wavefront sensor.

  8. Propagation of highly aberrated laser beams in nonquadratic plasma waveguides

    International Nuclear Information System (INIS)

    Feit, M.D.; Fleck, J.A. Jr.; Morris, J.R.

    1977-01-01

    The propagation of a laser beam in a plasma column several meters long with a realistic electron density distribution is examined. The electron density distribution is based on laser-beam heating at z=0, but is otherwise uncoupled to the laser beam. The aberrated nature of the resulting lenslike medium leads to essentially aperiodic beam properties, which contrast with the completely periodic properties of Gaussian beams propagating in quadratic lenslike media. The beam is nonetheless stably trapped. These aberrated-beam properties also help to stabilize the beam against axial variations in refractive index

  9. Elimination of aberrations in wide-aperture magnetoelectrostatic plasma lenses

    International Nuclear Information System (INIS)

    Butenko, V.I.; Ivanov, B.I.

    2003-01-01

    A computer model is devised for a Morozov plasma lens, in which the magnetic surfaces are equipotential surfaces of the electric field. Results are presented from numerical modeling of the focusing of ions with allowance for their longitudinal, radial, and azimuthal motions. The strengths and spatial distributions of the magnetic and electric fields are optimized. The methods for removing moment, geometric, and chromatic aberrations are analyzed. The effect of a discrete distribution of the potentials on ion focusing is modeled, and the related aberrations are examined. A computer model of an achromatic two-lens system is considered

  10. Papillary carcinoma in median aberrant thyroid (ectopic) - case report.

    Science.gov (United States)

    Hebbar K, Ashwin; K, Shashidhar; Deshmane, Vijaya Laxmi; Kumar, Veerendra; Arjunan, Ravi

    2014-06-01

    Median ectopic thyroid may be encountered anywhere from the foramen caecum to the diaphragm. Non lingual median aberrant thyroid (incomplete descent) usually found in the infrahyoid region and malignant transformation in this ectopic thyroid tissue is very rare. We report an extremely rare case of papillary carcinoma in non lingual median aberrant thyroid in a 25-year-old female. The differentiation between a carcinoma arising in the median ectopic thyroid tissue and a metastatic papillary carcinoma from an occult primary in the main thyroid gland is also discussed.

  11. Diversity analysis of Bemisia tabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region

    OpenAIRE

    Rabello, Aline R.; Queiroz, Paulo R.; Simões, Kenya C.C.; Hiragi, Cássia O.; Lima, Luzia H.C.; Oliveira, Maria Regina V.; Mehta, Angela

    2008-01-01

    The Bemisia tabaci complex is formed by approximately 41 biotypes, two of which (B and BR) occur in Brazil. In this work we aimed at obtaining genetic markers to assess the genetic diversity of the different biotypes. In order to do that we analyzed Bemisia tabaci biotypes B, BR, Q and Cassava using molecular techniques including RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. The analyses revealed a high similarity between the individuals of the B and Q biotypes, which could be distin...

  12. Cooperation of nuclear reactor controller ARM-5S and turbine TVER-02

    International Nuclear Information System (INIS)

    Wagner, K.; Lnenicka, B.; Pokorny, F.; Prochazka, F.

    1985-01-01

    Turbines of Czechoslovak make provided with controllers TVER-02 are installed in WWER-440 nuclear power plants under construction in Czechoslovakia. Reactor output is controlled using Soviet-made controllers ARM-5S which already comprise turbine controllers. The problems are analyzed of cooperation of both controllers, especially their parameters and transient processes in typical operating situations. The analysis uses the results of measurements performed during the power start-up of Unit 1 of the V-2 nuclear power plant at Jaslovske Bohunice. The results show that two types of control modes can be selected for the operation of the entire unit: the control to constant unit output, and control of unit output varying with turbine load selected on the TVER-02 controller or given by the demand of the power network. (Z.M.)

  13. Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

    Science.gov (United States)

    Cibik, R; Lepage, E; Talliez, P

    2000-06-01

    For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

  14. Aberration of a negative ion beam caused by space charge effect.

    Science.gov (United States)

    Miyamoto, K; Wada, S; Hatayama, A

    2010-02-01

    Aberrations are inevitable when the charged particle beams are extracted, accelerated, transmitted, and focused with electrostatic and magnetic fields. In this study, we investigate the aberration of a negative ion accelerator for a neutral beam injector theoretically, especially the spherical aberration caused by the negative ion beam expansion due to the space charge effect. The negative ion current density profiles with the spherical aberration are compared with those without the spherical aberration. It is found that the negative ion current density profiles in a log scale are tailed due to the spherical aberration.

  15. Aberration of a negative ion beam caused by space charge effect

    International Nuclear Information System (INIS)

    Miyamoto, K.; Wada, S.; Hatayama, A.

    2010-01-01

    Aberrations are inevitable when the charged particle beams are extracted, accelerated, transmitted, and focused with electrostatic and magnetic fields. In this study, we investigate the aberration of a negative ion accelerator for a neutral beam injector theoretically, especially the spherical aberration caused by the negative ion beam expansion due to the space charge effect. The negative ion current density profiles with the spherical aberration are compared with those without the spherical aberration. It is found that the negative ion current density profiles in a log scale are tailed due to the spherical aberration.

  16. Aberration of a negative ion beam caused by space charge effect

    Energy Technology Data Exchange (ETDEWEB)

    Miyamoto, K. [Naruto University of Education, 748 Nakashima, Takashima, Naruto-cho, Naruto-shi, Tokushima 772-8502 (Japan); Wada, S.; Hatayama, A. [Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan)

    2010-02-15

    Aberrations are inevitable when the charged particle beams are extracted, accelerated, transmitted, and focused with electrostatic and magnetic fields. In this study, we investigate the aberration of a negative ion accelerator for a neutral beam injector theoretically, especially the spherical aberration caused by the negative ion beam expansion due to the space charge effect. The negative ion current density profiles with the spherical aberration are compared with those without the spherical aberration. It is found that the negative ion current density profiles in a log scale are tailed due to the spherical aberration.

  17. Differential algebraic method for arbitrary order curvilinear-axis combined geometric-chromatic aberration analysis

    International Nuclear Information System (INIS)

    Cheng Min; Tang Tiantong; Lu Yilong; Yao Zhenhua

    2003-01-01

    The principle of differential algebra is applied to analyse and calculate arbitrary order curvilinear-axis combined geometric-chromatic aberrations of electron optical systems. Expressions of differential algebraic form of high order combined aberrations are obtained and arbitrary order combined aberrations can be calculated numerically. As an example, a typical wide electron beam focusing system with curved optical axes named magnetic immersion lens has been studied. All the second-order and third-order combined geometric-chromatic aberrations of the lens have been calculated, and the patterns of the corresponding geometric aberrations and combined aberrations have been given as well

  18. Novel plumage aberrations in Paraguayan non-Passerine Birds, and the definition of a new plumage aberration unique to Psittacidae

    Directory of Open Access Journals (Sweden)

    Paul Smith

    2017-07-01

    Full Text Available Anomalous plumage colourations are reported for three species of non-passerine birds from Paraguay, Limpkin (Aramaus guarauna; Aramidae, Nanday Parakeet (Nandayus nenday; Psittacidae, and the Little Woodpecker (Veniliornis passerinus; Picidae. A leucistic Limpkin is the first published report of a colour anomaly for the family Aramidae. The colour aberration in N. nenday is hypothesised to be a result of an excess of red psittacofulvin pigments, which are unique to the Psittacidae. Although the mechanisms causing this colour aberration remain unknown, we suggest the term psittacofulvism for the phenotypic effect observed.

  19. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  20. Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon

    International Nuclear Information System (INIS)

    Johnson, W. R.; Cheng, K. T.

    2001-01-01

    Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter γ 5s exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of γ 5s is also found near the second minimum of the 5s cross section at 150 eV, where γ 5s reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter ζ 5p =γ 5p +3δ 5p , which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in γ 5s and ζ 5p arise from correlation enhanced by shape resonances in the 4p→f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled

  1. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  2. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  3. New trends and techniques in chromosome aberration analysis

    International Nuclear Information System (INIS)

    Bender, M.A.

    1978-01-01

    The following topics are discussed: automation of chromosome analysis; storage of fixed cells from cultures of lymphocytes obtained routinely during periodic employee medical examinations; analysis of banded chromosomes; identification of first division metaphases; sister chromatid exchange; and patterns of aberration induction

  4. Chromosome aberrations in Norwegian reindeer following the Chernobyl accident

    International Nuclear Information System (INIS)

    Røed, K.H.; Jacobsen, M.

    1995-01-01

    Chromosome analyses were carried out on peripheral blood lymphocytes of semi-domestic reindeer in Norway which had been exposed to varying amounts of radiocesium emanating from the Chernobyl accident. The sampling was done in the period 1987-1990. The material included 192 reindeer, originating from four herds in central Norway, an area considerably affected by fallout from the Chernobyl accident, and from three herds in northern Norway which was unaffected by fallout from the accident. Significant heterogeneity in the distribution of chromosome aberrations between herds was observed. The pattern of chromosome aberration frequencies between herds was not related to the variation in radiocesium exposure from the Chernobyl accident. Other factors than the Chernobyl accident appear therefore to be of importance for the distribution of aberration frequencies found among present herds. Within the most contaminated area the reindeer born in 1986 showed significantly more chromosome aberrations than those born both before and after 1986. This could suggest that the Chernobyl accident fallout created an effect particularly among calves, during the immediate post-accident period in the most exposed areas

  5. Effects of ocular aberrations on contrast detection in noise.

    Science.gov (United States)

    Liang, Bo; Liu, Rong; Dai, Yun; Zhou, Jiawei; Zhou, Yifeng; Zhang, Yudong

    2012-08-06

    We use adaptive optics (AO) techniques to manipulate the ocular aberrations and elucidate the effects of these ocular aberrations on contrast detection in a noisy background. The detectability of sine wave gratings at frequencies of 4, 8, and 16 circles per degree (cpd) was measured in a standard two-interval force-choice staircase procedure against backgrounds of various levels of white noise. The observer's ocular aberrations were either corrected with AO or left uncorrected. In low levels of external noise, contrast detection thresholds are always lowered by AO correction, whereas in high levels of external noise, they are generally elevated by AO correction. Higher levels of external noise are required to make this threshold elevation observable when signal spatial frequencies increase from 4 to 16 cpd. The linear-amplifier-model fit shows that mostly sampling efficiency and equivalent noise both decrease with AO correction. Our findings indicate that ocular aberrations could be beneficial for contrast detection in high-level noises. The implications of these findings are discussed.

  6. Telomere Length in Circulating Lymphocytes: Association with Chromosomal Aberrations

    Czech Academy of Sciences Publication Activity Database

    Hemminki, K.; Rachakonda, S.; Musak, L.; Vymetálková, Veronika; Halasová, E.; Forsti,, A.; Vodičková, Ludmila; Buchancová, J.; Vodička, Pavel; Kumar, R.

    2015-01-01

    Roč. 54, č. 3 (2015), s. 194-196 ISSN 1045-2257 Institutional support: RVO:68378041 Keywords : structural chromosome aberrations * healthy subjects * relative telomere length * genotoxicity * telomere biology Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.960, year: 2015

  7. Joint denoising, demosaicing, and chromatic aberration correction for UHD video

    Science.gov (United States)

    Jovanov, Ljubomir; Philips, Wilfried; Damstra, Klaas Jan; Ellenbroek, Frank

    2017-09-01

    High-resolution video capture is crucial for numerous applications such as surveillance, security, industrial inspection, medical imaging and digital entertainment. In the last two decades, we are witnessing a dramatic increase of the spatial resolution and the maximal frame rate of video capturing devices. In order to achieve further resolution increase, numerous challenges will be facing us. Due to the reduced size of the pixel, the amount of light also reduces, leading to the increased noise level. Moreover, the reduced pixel size makes the lens imprecisions more pronounced, which especially applies to chromatic aberrations. Even in the case when high quality lenses are used some chromatic aberration artefacts will remain. Next, noise level additionally increases due to the higher frame rates. To reduce the complexity and the price of the camera, one sensor captures all three colors, by relying on Color Filter Arrays. In order to obtain full resolution color image, missing color components have to be interpolated, i.e. demosaicked, which is more challenging than in the case of lower resolution, due to the increased noise and aberrations. In this paper, we propose a new method, which jointly performs chromatic aberration correction, denoising and demosaicking. By jointly performing the reduction of all artefacts, we are reducing the overall complexity of the system and the introduction of new artefacts. In order to reduce possible flicker we also perform temporal video enhancement. We evaluate the proposed method on a number of publicly available UHD sequences and on sequences recorded in our studio.

  8. Using Aberrant Behaviors as Reinforcers for Autistic Children.

    Science.gov (United States)

    Charlop, Marjorie H.; And Others

    1990-01-01

    Three experiments assessed the efficacy of various reinforcers to increase correct task responding in a total of 10 autistic children, aged 6-9. Of the reinforcers used (stereotypy, delayed echolalia, perseverative behavior, and food), task performance was highest with opportunities to engage in aberrant behaviors, and lowest with edible…

  9. Chromosome aberrations and cell survival in irradiated mammalian cells

    International Nuclear Information System (INIS)

    Tremp, J.

    1981-01-01

    A possible correlation between chromosome aberrations and reduced proliferation capacity or cell death was investigated. Synchronized Chinese hamster fibroblast cells were irradiated with 300 rad of x rays in early G 1 . Despite synchronization the cells reached the subsequent mitosis at different times. The frequency of chromosome aberrations was determined in the postirradiation division at 2-h intervals. The highest frequency occurred in cells with a first cell cycle of medium length. The colony-forming ability of mitotic cells was measured in parallel samples by following the progress of individual mitoses. The proportion of cells forming macrocolonies decreased with increasing cell cycle length, and the number of non-colony-forming cells increased. Irrespective of various first cell cycle lengths and different frequencies of chromosome aberrations, the number of cells forming microcolonies remained constant. A correlation was found between the absence of chromosome aberrations and the ability of cells to form macrocolonies. However, cells with a long first cell cycle formed fewer macrocolonies than expected

  10. Refractive and diffractive neutron optics with reduced chromatic aberration

    DEFF Research Database (Denmark)

    Poulsen, Stefan Othmar; Poulsen, Henning Friis; Bentley, P.M.

    2014-01-01

    by the use of optics for focusing and imaging. Refractive and diffractive optical elements, e.g. compound refractive lenses and Fresnel zone plates, are attractive due to their low cost, and simple alignment. These optical elements, however, suffer from chromatic aberration, which limit their effectiveness...

  11. Frequency of primary amenorrhea due to chromosomal aberration

    International Nuclear Information System (INIS)

    Jabbar, S.

    2004-01-01

    Objective: To find out the frequency of primary amenorrhea due to chromosomal aberration and the different options available for management. Subjects and Methods: All patients with primary amenorrhea due to chromosomal aberrations were included in study. Patient's detailed history, general physical examination, presence or absence of secondary sexual characteristics, abdominal and pelvic examination finding were noted. Targeted investigations, including ultrasound, hormonal assay, buccal smear and karyotyping results were recorded. The management options were individually tailored with focus n psychological management. Results: Eighteen patients out of 30,000 patients were diagnosed as having primary amenorrhea. Six had primary amenorrhea due to chromosomal aberrations with the frequency of 0.02%. The age at presentation was 20 years and above in 50%. The most common cause was Turner's syndrome seen in 4 out of 6. The presenting symptoms were delay in onset of menstruation in 05 patients and primary infertility in 01 patient. Conclusion: Primary amenorrhea due to chromosomal aberration is an uncommon condition requiring an early and accurate diagnosis. Turner's syndrome is a relatively common cause of this condition. Management should be multi-disciplinary and individualized according to the patient's age and symptom at presentation. Psychological management is very important and counselling throughout treatment is recommended. (author)

  12. Thermal lensing measurement from the coefficient of defocus aberration

    CSIR Research Space (South Africa)

    Bell, Teboho

    2016-03-01

    Full Text Available We measured the thermally induced lens from the coefficient of defocus aberration using a Shack-Hartmann wavefront sensor (SHWFS). As a calibration technique, we infer the focal length of standard lenses probed by a collimated Gaussian beam...

  13. Thermally induced lensing determination from the coefficient of defocus aberration

    CSIR Research Space (South Africa)

    Bell, Teboho

    2014-07-01

    Full Text Available The effects of a temperature gradient in a laser crystal in an end-pumped configuration in a solid-state laser resonator results in thermally induced aberrations. Of particular interest we measure the thermally induced lens from the coefficient...

  14. Testicular artery arising from an aberrant right renal artery | Suluba ...

    African Journals Online (AJOL)

    This case report we discovered the rare variation of the origin of the right testicular artery arising from the right aberrant renal artery with double renal artery irrigating both left and right kidneys. These variations in the testicular arteries and renal arteries have implication to surgical procedures such as orchidopexy repair for ...

  15. Iatrogenic injury of an aberrant right posterior sectoral bile duct

    African Journals Online (AJOL)

    (Figs 1 and 2). A week later, an endoscopic retrograde cholangiopancreatography. (ERCP) examination was performed. This showed no filling of the right posterior sectoral ducts but normal opacification of the other ducts. (Figs 3a and b). These findings led to the diagnosis of an aberrant right posterior sectoral bile duct that ...

  16. Chromosomal aberrations in tire plant workers and interaction with

    Czech Academy of Sciences Publication Activity Database

    Musak, L.; Souček, P.; Vodičková, Ludmila; Naccarati, Alessio; Halasová, E.; Poláková, Veronika; Slyšková, Jana; Susová, S.; Buchancová, J.; Šmerhovský, Z.; Sediková, J.; Klimentová, G.; Osina, O.; Hemminki, K.; Vodička, Pavel

    2008-01-01

    Roč. 641, 1-2 (2008), s. 36-42 ISSN 0027-5107 R&D Projects: GA MZd NR8563 Institutional research plan: CEZ:AV0Z50390512 Keywords : Chromosomal aberrations * Genetic polymorphisms * DNA repair genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.198, year: 2008

  17. Oxidative stress and chromosomal aberrations in an environmentally exposed population

    Czech Academy of Sciences Publication Activity Database

    Rössner ml., Pavel; Rössnerová, Andrea; Šrám, Radim

    2011-01-01

    Roč. 707, 1-2 (2011), s. 34-41 ISSN 0027-5107 R&D Projects: GA MŽP(CZ) SP/1B3/8/08 Institutional research plan: CEZ:AV0Z50390512 Keywords : air pollution * oxidative stress * chromosomal aberrations Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 2.850, year: 2011

  18. Aberrant nerve fibres within the central nervous system.

    Science.gov (United States)

    Moffie, D

    1992-01-01

    Three cases of aberrant nerve fibres in the spinal cord and medulla oblongata are described. The literature on these fibres is discussed and their possible role in regeneration. Different views on the possibility of regeneration or functional recovery of the central nervous system are mentioned in the light of recent publications, which are more optimistic than before.

  19. The Aberrant Salience Inventory: A New Measure of Psychosis Proneness

    Science.gov (United States)

    Cicero, David C.; Kerns, John G.; McCarthy, Denis M.

    2010-01-01

    Aberrant salience is the unusual or incorrect assignment of salience, significance, or importance to otherwise innocuous stimuli and has been hypothesized to be important for psychosis and psychotic disorders such as schizophrenia. Despite the importance of this concept in psychosis research, no questionnaire measures are available to assess…

  20. Holographic gratings for spectrographic applications: Study of aberrations

    Science.gov (United States)

    Bhatia, M. S.

    1975-01-01

    The design and fabrication of holographic gratings requires an understanding of Fermat's principle. This principle states that the path of a light ray from one point to another is that which requires the least time. The aberrant, optical path of an object point to an image was studied using Fermat principles.

  1. Evidence that two types of 18S rDNA coexist in the genome of Dugesia (Schmidtea) mediterranea (Platyhelminthes, Turbellaria, Tricladida).

    Science.gov (United States)

    Carranza, S; Giribet, G; Ribera, C; Baguñà; Riutort, M

    1996-07-01

    Sequences of 18S ribosomal DNA (rDNA) are increasingly being used to infer phylogenetic relationships among living taxa. Although the 18S rDNA belongs to a multigene family, all its copies are kept homogeneous by concerted evolution (Dover 1982; Hillis and Dixon 1991). To date, there is only one well-characterized exception to this rule, the protozoan Plasmodium (Gunderson et al. 1987; Waters, Syin, and McCutchan 1989; Qari et al. 1994). Here we report the 1st case of 18S rDNA polymorphism within a metazoan species. Two types (I and II) of 18S rDNA have been found and sequenced in the platyhelminth Dugesia (Schmidtea) mediterranea (Turbellaria, Seriata, Tricladida). Southern blot analysis suggested that both types of rDNA are present in the genome of this flatworm. This was confirmed through sequence comparisons and phylogenetic analysis using the neighbor-joining method and bootstrap test. Although secondary structure analysis suggests that both types are functional, only type I seems to be transcribed to RNA, as demonstrated by Northern blot analysis. The finding of different types of 18S rDNAs in a single genome stresses the need for analyzing a large number of clones whenever 18S sequences obtained by PCR amplification and cloning are being used in phylogenetic reconstruction.

  2. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides AT+CG in the mitogenome of Kamimuria wangi.

    Science.gov (United States)

    Seligmann, Hervé

    2016-07-01

    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.

  3. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Jie Hong

    Full Text Available Mechanisms of the progression from Barrett's esophagus (BE to esophageal adenocarcinoma (EA are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  4. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  5. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  6. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina.

    Science.gov (United States)

    Iwanowicz, Luke R; Iwanowicz, Deborah D; Pote, Linda M; Blazer, Vicki S; Schill, William B

    2008-02-01

    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 +/- 0.3 microm (range 15.7-20.3) in length, and 5.4 +/- 0.1 microm (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 +/- 1.1 microm (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 +/- 0.1 microm (range 5.48-7.06), while the shorter is 5.7 +/- 0.1 microm (range 4.8-6.4) in length. Polar capsule width is 1.2 +/- 0.03 microm (range 1.0-1.54). The total length of the spore is 60.9 +/- 1.2 microm (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus.

  7. Lethality of radiation-induced chromosome aberrations in human tumour cell lines with different radiosensitivities.

    Science.gov (United States)

    Coco-Martin, J M; Ottenheim, C P; Bartelink, H; Begg, A C

    1996-03-01

    In order to find an explanation for the eventual disappearance of all chromosome aberrations in two radiosensitive human tumour cell lines, the type and stability of different aberration types was investigated in more detail. To classify the aberrations into unstable and stable types, three-colour fluorescence in situ hybridization was performed, including a whole-chromosome probe, a pancentromere probe, and a stain for total DNA. This technique enables the appropriate classification of the aberrations principally by the presence (stable) or not (unstable) of a single centromere per chromosome. Unstable-type aberrations were found to disappear within 7 days (several divisions) in the two radiosensitive and the two radioresistant tumour lines investigated. Stable-type aberrations were found to remain at an approximately constant level over the duration of the experiment (14 days; 8-10 divisions) in the two radioresistant lines. In contrast, the majority of these stable-type aberrations had disappeared by 14 days in the two radiosensitive lines. The previous findings of disappearance of total aberrations in radiosensitive cells was therefore not due to a reduced induction of stable-type aberrations, but the complete disappearance of cells with this aberration type. These results could not be explained by differences in apoptosis or G1 blocks. Two possible explanations for these unexpected findings involve non-random induction of unstable-type aberrations, or lethality of stable-type aberrations. The results suggest caution in the use of stable-type aberration numbers as a predictor for radiosensitivity.

  8. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

    Science.gov (United States)

    Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

    2011-01-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

  9. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    Science.gov (United States)

    Leontis, N B; Westhof, E

    1998-09-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  10. Chromatin structure and ionizing-radiation-induced chromosome aberrations

    International Nuclear Information System (INIS)

    Muehlmann-Diaz, M.C.

    1993-01-01

    The possible influence of chromatic structure or activity on chromosomal radiosensitivity was studied. A cell line was isolated which contained some 10 5 copies of an amplified plasmid in a single large mosquito artificial chromosome (MAC). This chromosome was hypersensitive to DNase I. Its radiosensitivity was some three fold greater than normal mosquito chromosomes in the same cell. In cultured human cells irradiated during G 0 , the initial breakage frequency in chromosome 4, 19 and the euchromatic and heterochromatic portions of the Y chromosome were measured over a wide range of doses by inducing Premature Chromosome Condensation (PCC) immediately after irradiation with Cs-137 gamma rays. No evidence was seen that Y heterochromatin or large fragments of it remained unbroken. The only significant deviation from the expected initial breakage frequency per Gy per unit length of chromosome was that observed for the euchromatic portion of the Y chromosome, with breakage nearly twice that expected. The development of aberrations involving X and Y chromosomes at the first mitosis after irradation was also studied. Normal female cells sustained about twice the frequency of aberrations involving X chromosomes for a dose of 7.3 Gy than the corresponding male cells. Fibroblasts from individuals with supernumerary X chromosomes did not show any further increase in X aberrations for this dos. The frequency of aberrations involving the heterochromatic portion of the long arm of the Y chromosome was about what would be expected for a similar length of autosome, but the euchromatic portion of the Y was about 3 times more radiosensitive per unit length. 5-Azacytidine treatment of cultured human female fibroblasts or fibroblasts from a 49,XXXXY individual, reduced the methylation of cytosine residues in DNA, and resulted in an increased chromosomal radiosensitivity in general, but it did not increase the frequency of aberrations involving the X chromosomes

  11. Effect of prosthesis endplate lordosis angles on L5-S1 kinematics after disc arthroplasty.

    Science.gov (United States)

    Tsitsopoulos, Parmenion P; Wojewnik, Bartosz; Voronov, Leonard I; Havey, Robert M; Renner, Susan M; Zelenakova, Julia; McIntosh, Braden; Carandang, Gerard; Abjornson, Celeste; Patwardhan, Avinash G

    2012-06-01

    We hypothesized that L5-S1 kinematics will not be affected by the lordosis distribution between the prosthesis endplates. Twelve cadaveric lumbosacral spines (51.3 ± 9.8 years) were implanted with 6° or 11° prostheses (ProDisc-L) with four combinations of superior/inferior lordosis (6°/0°, 3°/3°, 11°/0°, 3°/8°). Specimens were tested intact and after prostheses implantation with different lordosis distributions. Center of rotation (COR) and range of motion (ROM) were quantified. Six-degree lordosis prostheses (n = 7) showed no difference in flexion-extension ROM, regardless of design (6°/0° or 3°/3°) (p > 0.05). In lateral bending (LB), both designs reduced ROM (p lordosis prostheses (n = 5) showed no difference in flexion-extension ROM for either design (p > 0.05). LB ROM decreased with distributed lordosis prostheses (3°/8°) (p lordosis distribution among the two prosthesis endplates. The ProDisc-L prosthesis design where all lordosis is concentrated in the superior endplate yielded COR locations that were anterior and caudal to intact controls. The prosthesis with lordosis distributed between the two endplates yielded a COR that tended to be closer to intact. Further clinical and biomechanical studies are needed to assess the long-term impact of lordosis angle distribution on the fate of the facet joints.

  12. Evolution of green plants as deduced from 5S rRNA sequences.

    Science.gov (United States)

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  13. Subjective face recognition difficulties, aberrant sensibility, sleeping disturbances and aberrant eating habits in families with Asperger syndrome

    Directory of Open Access Journals (Sweden)

    Källman Tiia

    2005-04-01

    Full Text Available Abstract Background The present study was undertaken in order to determine whether a set of clinical features, which are not included in the DSM-IV or ICD-10 for Asperger Syndrome (AS, are associated with AS in particular or whether they are merely a familial trait that is not related to the diagnosis. Methods Ten large families, a total of 138 persons, of whom 58 individuals fulfilled the diagnostic criteria for AS and another 56 did not to fulfill these criteria, were studied using a structured interview focusing on the possible presence of face recognition difficulties, aberrant sensibility and eating habits and sleeping disturbances. Results The prevalence for face recognition difficulties was 46.6% in individuals with AS compared with 10.7% in the control group. The corresponding figures for subjectively reported presence of aberrant sensibilities were 91.4% and 46.6%, for sleeping disturbances 48.3% and 23.2% and for aberrant eating habits 60.3% and 14.3%, respectively. Conclusion An aberrant processing of sensory information appears to be a common feature in AS. The impact of these and other clinical features that are not incorporated in the ICD-10 and DSM-IV on our understanding of AS may hitherto have been underestimated. These associated clinical traits may well be reflected by the behavioural characteristics of these individuals.

  14. The use of 16s rDNA methods in soil microbial ecology Uso de métodos 16S rDNA em ecologia microbiana do solo

    Directory of Open Access Journals (Sweden)

    Andrew Macrae

    2000-06-01

    Full Text Available New and exciting molecular methods, many using the 16S small sub-unit ribosomal nucleic acid molecule, are opening the microbial "black box" in soil. These studies have added much to our knowledge of microbial diversity in soils, and are beginning to advance our understanding of the relationship between this diversity and its function in soil processes. Over the next few years, the knowledge gained from molecular studies will, we hope, lead to improvements in sustainable land management and sustainable exploitation of soil genetic resources. As we enter the third millenium, it is appropriate to review the application of 16S rDNA methods to soil microbiology. This review examines 16S ribosomal DNA (rDNA methods and their application to soil. It mentions their limits and suggests how they may be applied in the future.Novas e excitantes técnicas moleculares muitas usando a fração 16S da subunidade menor da molécula de ácido nucleico ribossomal, estão abrindo a "caixa-preta" da microbiologia do solo. Esses estudos têm acrescentado muito ao nosso conhecimento acerca da diversidade microbiana no solo, e começam a avançar nosso entendimento sobre a relação entre essa diversidade a sua função nos processos no solo. Ao longo dos próximos anos, o conhecimento obtido a partir de técnicas moleculares irão, esperamos, levar a melhoramentos do manejo de áreas sustentáveis da exploração dos recursos genéticos do solo. Com a chegada do terceiro milênio, é apropriado revermos a aplicação das técnicas da fração 16S do rDNA em microbiologia de solo. Esta revisão examina aplicações das técnicas da fração 16S do DNA (RNA no solo, menciona seus limites e sugere como elas poderão ser usadas no futuro.

  15. Study of chromosome aberrations on the workers occupationally exposed to thorium and rare earth mixed dust

    International Nuclear Information System (INIS)

    Zhang Wei; Wang Chunyan; Lv Huiming; Zhang Cuilan; Hao Shuxia; Su Xu; Jia Kejun; Liu Yufei

    2008-01-01

    Objective: To study the effect of thorium and rare earth mixed dust on chromosome aberrations in the lymphocytes of occupational exposed workers. Methods: Analyses of unstable chromosome aberrations on 53 occupational exposed workers and 58 control workers were carried out by the conventional Giemsa staining method. Fluorescence in situ hybridization method was performed to analyze the chromosome stable aberrations on 10 occupational exposed workers and l0 control workers. Results: The frequencies of chromosomal aberration cells, dicentrics plus rings, total aberrations in exposed workers were significantly higher than those in controls. No significant difference was found in the frequency of acentric aberrations between exposed and non-exposed workers. No significant difference was found in the frequency of translocations between exposed and non-exposed workers. Conclusions: Chronically occupational exposure to thorium and rare earth mixed dust can increase the induction of unstable chromosome aberration, but the increase of stable chromosome aberrations (translocation) can not be observed. (authors)

  16. An accurate optical design method for synchrotron radiation beamlines with wave-front aberration theory

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Xiaojiang, E-mail: slsyxj@nus.edu.sg; Diao, Caozheng; Breese, Mark B. H. [Singapore Synchrotron Light Source, National University of Singapore, Singapore 117603 (Singapore)

    2016-07-27

    An aberration calculation method which was developed by Lu [1] can treat individual aberration term precisely. Spectral aberration is the linear sum of these aberration terms, and the aberrations of multi-element systems also can be calculated correctly when the stretching ratio, defined herein, is unity. Evaluation of focusing mirror-grating systems which are optimized according to Lu’s method, along with the Light Path Function (LPF) and the Spot Diagram method (SD) are discussed to confirm the advantage of Lu’s methodology. Lu’s aberration terms are derived from a precise wave-front treatment, whereas the terms of the power series expansion of the light path function do not yield an accurate sum of the aberrations. Moreover, Lu’s aberration terms can be individually optimized. This is not possible with the analytical spot diagram formulae.

  17. Genetic diversity based on 28S rDNA sequences among populations of Culex quinquefasciatus collected at different locations in Tamil Nadu, India.

    Science.gov (United States)

    Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S

    2015-09-01

    The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.

  18. Is ITS-2 rDNA suitable marker for genetic characterization of Sarcoptes mites from different wild animals in different geographic areas?

    Science.gov (United States)

    Alasaad, S; Soglia, D; Spalenza, V; Maione, S; Soriguer, R C; Pérez, J M; Rasero, R; Degiorgis, M P Ryser; Nimmervoll, H; Zhu, X Q; Rossi, L

    2009-02-05

    The present study examined the relationship among individual Sarcoptes scabiei mites from 13 wild mammalian populations belonging to nine species in four European countries using the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) as genetic marker. The ITS-2 plus primer flanking 5.8S and 28S rDNA (ITS-2+) was amplified from individual mites by polymerase chain reaction (PCR) and the amplicons were sequenced directly. A total of 148 ITS-2+ sequences of 404bp in length were obtained and 67 variable sites were identified (16.59%). UPGMA analyses did not show any geographical or host-specific clustering, and a similar outcome was obtained using population pairwise Fst statistics. These results demonstrated that ITS-2 rDNA does not appear to be suitable for examining genetic diversity among mite populations.

  19. The nature of Zb states from a combined analysis of Υ(5S) → hb(mP)π+π- and Υ(5S) → B(*) anti B(*)π

    International Nuclear Information System (INIS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-01-01

    With a combined analysis of data on Υ(5S) → h b (1P, 2P)π + π - and Υ(5S) → B (*) anti B (*) π in an effective field theory approach, we determine resonance parameters of Z b states in two scenarios. In one scenario we assume that Z b states are pure molecular states, while in the other one we assume that Z b states contain compact components. We find that the present data favor that there should be some compact components inside Z b (') associated with themolecular components. By fitting the invariant mass spectra of Υ(5S) → h b (1P, 2P)π + π - and Υ(5S) → B (*) anti B * π, we determine that the probability of finding the compact components in Z b states may be as large as about 40 %. (orig.)

  20. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  1. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    DEFF Research Database (Denmark)

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

  2. The effect of aberrated recording beams on reflecting Bragg gratings

    Science.gov (United States)

    SeGall, Marc; Ott, Daniel; Divliansky, Ivan; Glebov, Leonid B.

    2013-03-01

    The effect of aberrations present in the recording beams of a holographic setup is discussed regarding the period and spectral response of a reflecting volume Bragg grating. Imperfect recording beams result in spatially varying resonant wavelengths and the side lobes of the spectrum are washed out. Asymmetrical spectra, spectral broadening, and a reduction in peak diffraction efficiency may also be present, though these effects are less significant for gratings with wider spectral widths. Reflecting Bragg gratings (RBGs) are used as elements in a variety of applications including spectral beam combining1,2, mode locking3,4, longitudinal and transverse mode selection in lasers5,6, and sensing7,8. For applications requiring narrow spectral selectivity9, or large apertures10, these gratings must have a uniform period throughout the length of the recording medium, which may be on the order of millimeters. However, when using typical recording techniques such as two-beam interference for large aperture gratings and phase-mask recording of fiber gratings, aberrations from the optical elements in the system result in an imperfect grating structure11-13. In this paper we consider the effects of aberrations on large aperture gratings recorded in thick media using the two-beam interference technique. Previous works in analyzing the effects of aberrations have considered the effects of aberrations in a single recording plane where the beams perfectly overlap. Such an approach is valid for thin media (on the order of tens of microns), but for thick recording media (on the order of several millimeters) there will be a significant shift in the positions of the beams relative to each other as they traverse the recording medium. Therefore, the fringe pattern produced will not be constant throughout the grating if one or both beams have a non-uniform wavefront. Such non-uniform gratings may have a wider spectral width, a shifted resonant wavelength, or other problems. It is

  3. Nodular Hyperplasia Arising from the Lateral Aberrant Thyroid Tissue: A Case Report

    International Nuclear Information System (INIS)

    Jeong, Min Hye; Park, Jeong Seon; Lee, Young Jun

    2012-01-01

    The presence of aberrant thyroid tissue in the lateral neck is very rare. In addition, nodular hyperplasia in ectopic thyroid has rarely been reported. Due to the unusual location, the presence of lateral aberrant thyroid tissue could be misdiagnosed as a lymphadenopathy, neurogenic tumor, etc. We report on a case of nodular hyperplasia arising from the right lateral aberrant thyroid tissue.

  4. Image transfer with spatial coherence for aberration corrected transmission electron microscopes

    International Nuclear Information System (INIS)

    Hosokawa, Fumio; Sawada, Hidetaka; Shinkawa, Takao; Sannomiya, Takumi

    2016-01-01

    The formula of spatial coherence involving an aberration up to six-fold astigmatism is derived for aberration-corrected transmission electron microscopy. Transfer functions for linear imaging are calculated using the newly derived formula with several residual aberrations. Depending on the symmetry and origin of an aberration, the calculated transfer function shows characteristic symmetries. The aberrations that originate from the field’s components, having uniformity along the z direction, namely, the n-fold astigmatism, show rotational symmetric damping of the coherence. The aberrations that originate from the field’s derivatives with respect to z, such as coma, star, and three lobe, show non-rotational symmetric damping. It is confirmed that the odd-symmetric wave aberrations have influences on the attenuation of an image via spatial coherence. Examples of image simulations of haemoglobin and Si [211] are shown by using the spatial coherence for an aberration-corrected electron microscope. - Highlights: • The formula of partial coherence for aberration corrected TEM is derived. • Transfer functions are calculated with several residual aberrations. • The calculated transfer function shows the characteristic damping. • The odd-symmetric wave aberrations can cause the attenuation of image via coherence. • The examples of aberration corrected TEM image simulations are shown.

  5. Detecting Aberrant Response Patterns in the Rasch Model. Rapport 87-3.

    Science.gov (United States)

    Kogut, Jan

    In this paper, the detection of response patterns aberrant from the Rasch model is considered. For this purpose, a new person fit index, recently developed by I. W. Molenaar (1987) and an iterative estimation procedure are used in a simulation study of Rasch model data mixed with aberrant data. Three kinds of aberrant response behavior are…

  6. Image transfer with spatial coherence for aberration corrected transmission electron microscopes

    Energy Technology Data Exchange (ETDEWEB)

    Hosokawa, Fumio, E-mail: hosokawa@bio-net.co.jp [BioNet Ltd., 2-3-28 Nishikityo, Tachikwa, Tokyo (Japan); Tokyo Institute of Technology, 4259 Nagatsuta, Midoriku, Yokohama 226-8503 (Japan); Sawada, Hidetaka [JEOL (UK) Ltd., JEOL House, Silver Court, Watchmead, Welwyn Garden City, Herts AL7 1LT (United Kingdom); Shinkawa, Takao [BioNet Ltd., 2-3-28 Nishikityo, Tachikwa, Tokyo (Japan); Sannomiya, Takumi [Tokyo Institute of Technology, 4259 Nagatsuta, Midoriku, Yokohama 226-8503 (Japan)

    2016-08-15

    The formula of spatial coherence involving an aberration up to six-fold astigmatism is derived for aberration-corrected transmission electron microscopy. Transfer functions for linear imaging are calculated using the newly derived formula with several residual aberrations. Depending on the symmetry and origin of an aberration, the calculated transfer function shows characteristic symmetries. The aberrations that originate from the field’s components, having uniformity along the z direction, namely, the n-fold astigmatism, show rotational symmetric damping of the coherence. The aberrations that originate from the field’s derivatives with respect to z, such as coma, star, and three lobe, show non-rotational symmetric damping. It is confirmed that the odd-symmetric wave aberrations have influences on the attenuation of an image via spatial coherence. Examples of image simulations of haemoglobin and Si [211] are shown by using the spatial coherence for an aberration-corrected electron microscope. - Highlights: • The formula of partial coherence for aberration corrected TEM is derived. • Transfer functions are calculated with several residual aberrations. • The calculated transfer function shows the characteristic damping. • The odd-symmetric wave aberrations can cause the attenuation of image via coherence. • The examples of aberration corrected TEM image simulations are shown.

  7. Phylogeographic structure of cotton pest Adelphocoris suturalis (Hemiptera: Miridae): strong subdivision in China inferred from mtDNA and rDNA ITS markers

    OpenAIRE

    Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H.; Cai, Wanzhi

    2015-01-01

    Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populatio...

  8. Comparative physical mapping of 18S rDNA in the karyotypes of six leafcutter ant species of the genera Atta and Acromyrmex (Formicidae: Myrmicinae).

    Science.gov (United States)

    Teixeira, Gisele Amaro; Barros, Luísa Antônia Campos; de Aguiar, Hilton Jeferson Alves Cardoso; das Graças Pompolo, Silvia

    2017-10-01

    Leafcutter ants of the Atta and Acromyrmex genera are important plagues in different cultures. Cytogenetic data on chromosome number, morphology, and chromosomal banding pattern are only available for 17 species of leafcutter ants. Molecular cytogenetic data for the detection of ribosomal genes by the FISH technique are scarce, and only 15 Neotropical ant species have been studied. This study aimed to physically map the 18S ribosomal RNA genes (rDNA) of six leafcutter ants belonging to the genera Atta and Acromyrmex using FISH. The results were compared with data on the fluorochrome CMA 3 currently available for these species. All analyzed species presented the 18S rDNA on one pair of chromosomes. In Acromyrmex subterraneus molestans and Ac. aspersus, FISH signals were observed in the terminal region of the short arm of the largest subtelocentric pair, while in Atta bisphaerica, A. laevigata, and A. sexdens, FISH signals were observed in the interstitial region of the long arm of the fourth metacentric pair. In Acromyrmex striatus, 18S rDNA was located in the interstitial region of the second metacentric pair. The karyotypic formula for Ac. aspersus was 2n = 38 (8m + 10sm + 16st + 4a), representing the first report in this species. The observed 18S rDNA regions in A. laevigata, A. sexdens, A. bisphaerica, Ac. aspersus, and Ac. subterraneus molestans corresponded to the CMA 3 + bands, while in Ac. striatus, several GC-rich bands and one pair of 18S rDNA bands were observed. No differential bands were visible using the DAPI fluorochrome. Karyotype uniformity with previously studied Atta spp. was also observed at the level of molecular cytogenetics using 18S rDNA FISH. A difference in the size of the chromosomal pair carrying the 18S rDNA gene was observed in Ac. striatus (2n = 22) and Atta spp. (2n = 22) highlighting the dissimilarity between these species. The results from the present study contribute to the description of 18S rDNA clusters

  9. Structural and optical properties of AgIn5S8

    Science.gov (United States)

    Rincón, Carlos A. Durante; Durán, Larissa T.; Medina, Josefa Estévez; Castro, Jaime A.; León, Máximo; Fermín, Jose R.

    2017-12-01

    Compounds of the chalcogenide family Ag-In-VI (VI = S, Se, Te) are interesting materials due to their stoichiometric stability and potential application in nonlinear optics and solar cells. A polycrystalline ingot of AgIn5S8, an ordered vacancy semiconductor, was prepared by direct fusion of the stoichiometric mixture of the elements in an evacuated quartz ampoule. The presence of a single phase with cubic structure was confirmed by X-ray powder diffraction at room temperature. The lattice parameter, a, was calculated, giving 10.821750 Å. Samples in evacuated quartz ampoules were used to perform Differential Thermal Analysis measurements, showing congruent melting at 1110∘C. Transmittance and reflectivity measurements were used to calculate the absorption coefficient α. From the plot of (αhν)2 versus hν, two direct transitions are observed at 1.25 eV and 1.88 eV. While the higher energy direct transition has been observed by other authors, the direct nature of the lower energy transition was confirmed from the fitting of the plot of the reflectivity versus 1/hν between 0.53 eV-1 (1.89 eV) and 0.55 eV-1 (1.82 eV), obtaining a value of 1.29 eV. The real refractive index n and the high-frequency dielectric constant 𝜀∞ were also obtained from the fit of the reflectivity, resulting to be 2.68 and 7.2, respectively.

  10. Colletotrichum isolates related to Anthracnose of cashew trees in Brazil: morphological and molecular description using LSU rDNA sequences

    Directory of Open Access Journals (Sweden)

    Ana Maria Queijeiro Lopez

    2010-08-01

    Full Text Available Thirty six isolates of fungi obtained from anthracnose lesions of cashew and associated host plants in Brazil, were compared by their cultural, morphological and partial sequences of the 28S ribosomal DNA characters. They showed a high degree of cultural variability. The average mycelial growth rate on all tested media ranged from 10.2-13.3 mm/day between the isolates. Most of them produced perithecia (sterile and fertile and some produced setae (sterile and fertile. All the isolates produced acervuli with predominantly cylindrical conidia (12.4-17.7 µmX 4.8-6.0 µm in width with round ends, which became septate on germination, and produced unlobed or slightlylobed appressoria. Comparison of the D2 domain of the large subunit (LSU rDNA sequences with those of other defined species of Colletotrichum and Glomerella grouped 35 of the isolates with known strains of C. gloeosporioides from different hosts (> 98.9% homology. The one exception (LARS 921 was identical to G. cingulata (LARS 238 from Vigna unguiculata.Trinta e seis isolados de fungos obtidos de lesões de antracnose em cajueiros e outras plantas consorciadas no Brasil, foram comparados quanto a seus aspectos culturais, morfológicos e seqüências parciais do rDNA 28S. Os isolados apresentaram elevado grau de variabilidade cultural, com taxa de crescimento médio, em todos os meios testados, entre 10,2 e 13,3 mm/dia. A maioria deles produziu peritécios (estéreis e férteis, e alguns produziram setas (estéreis e férteis nos diferentes meios. Todos apresentaram acérvulos com predominância de conídios cilíndricos (12,4-17,7 µm X 4,8-6,0 µm, de extremidades arredondadas, formando septos durante a germinação e produzindo apressórios ligeiramente lobados ou lisos. Comparando as seqüências do domínio D2 da larga subunidade (LSU do rDNA dos isolados com aquelas já identificadas de espécies de Colletotrichum/ Glomerella, verificou-se que 35 deles correspondem a C

  11. Discussion on the method to increase the successful rate of L5/S1 intervertebral disc puncture

    International Nuclear Information System (INIS)

    Zhong Xianyi; Li Liangjun; Yu Chengxin

    2007-01-01

    Objective: To study the effective methods of L 5 /S 1 intervertebral disc puncture without drilling to solve the barriers from iliaca. Methods: (1) puncturing with belly-buttock sticking out: to enlarge waist sacro-iliaca angle to move the puncture point up; (2) puncturing through intervertebral edge: puncturing through L 5 to 1/3 intervertebral disc to make the puncture point move Up; (3) puncturing through L 5 /S 1 intervertebral disc with the self-made puncture location instrument. Results with the methods, 280 cases with L 5 /S 1 intervertebral disc protrusion have been successfully punctured, with successful rate 100%. Conclusion: These methods are ideal and easy to use to treat L 5 /S 1 intervertebral disc protrusion puncture, and worth popularizing. (authors)

  12. Factors Contributing To The Sustainability Of 5S Programmes In Government Hospitals In Regional Director Of Health Services Area Kurunegala

    Directory of Open Access Journals (Sweden)

    Dr. K.W.C.U.K Kendangamuwa

    2015-03-01

    Full Text Available Abstract Introduction 5S is the stepping stone for many quality improvement concepts and its roots date back to 16th century. When successfully implemented 5S gives many benefits to the organization as well as its stakeholders. Though 5S itself has a tool to sustain most of the organizations find it difficult to sustain the 5S practice over the time. Therefore the objective of this study was to find out the factors contributing to sustainability of 5S programmes in Government Hospitals in RDHS area Kurunegala. Methodology This study was a descriptive cross sectional study with two components. First component was to identify the 5S sustaining hospitals from not sustaining hospitals by validated evaluation sheet. Second component was to determine the factors contributing to sustainability of 5S programmes in selected study setting. Self-administrated questionnaire was used for this purpose. Total study population was 543 employees of all the categories of hospital staff. Calculated sample size was 422 and 375 were responded to the questionnaire giving response rate of 88.9. Results The study revealed that the implemented 5S programmes were sustaining in eight hospitals out of ten i.e. sustaining rate was 80. When it considered the degree of sustainability 50 of the selected hospitals reported more than 70 sustainability. This was considered as favourable trend in government health sector in healthcare quality point of view. Ten factors were studied as contributing factors for the 5S sustainability. Socio- demographic factors were also considered. Those ten factors were top management commitment leadership of the organization commitment of middle amp frontline managers commitment amp satisfaction of employees training amp changing attitude of employees motivation of employees organizational culture group cohesiveness community participation and customer satisfaction. Study revealed that organizational leadership customer satisfaction community

  13. Absolute transition probabilities of 5s-5p transitions of Kr I from interferometric measurements in LTE-plasmas

    International Nuclear Information System (INIS)

    Kaschek, K.; Ernst, G.K.; Boetticher, W.

    1984-01-01

    Absolute transition probabilities of nine 5s-5p transitions of Kr I have been evaluated by using the hook method. The plasma was produced in a shock tube. The population density of the 5s-levels was calculated, under the assumption of LTE, from the electron density and the ground state number measured by means of a dual wavelength interferometer. An evaluation is given which proves the validity of the LTE assumption. (orig.)

  14. Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Terao, K.; Uchiumi, T.; Ogata, K.

    1980-01-01

    After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)

  15. Measurements of the Exclusive Decays of the Υ(5S) to B Meson Final States and Improved Bs* Mass Measurement

    International Nuclear Information System (INIS)

    Aquines, O.; Li, Z.; Lopez, A.; Mendez, H.; Ramirez, J.; Huang, G.S.; Miller, D.H.; Pavlunin, V.; Sanghi, B.; Shipsey, I.P.J.; Xin, B.; Adams, G.S.; Anderson, M.; Cummings, J.P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C.S.

    2006-01-01

    Using 420 pb -1 of data collected on the Υ(5S) resonance with the CLEO III detector, we reconstruct B mesons in 25 exclusive decay channels to measure or set upper limits on the decay rate of Υ(5S) into B meson final states. We measure the inclusive B cross section to be σ(Υ(5S)→BB(X))=(0.177±0.030±0.016) nb and make the first measurements of the production rates of σ(Υ(5S)→B*B*)=(0.131±0.025±0.014) nb and σ(Υ(5S)→BB*)=(0.043±0.016±0.006) nb, respectively. We set 90% confidence level limits of σ(Υ(5S)→BB) ( * ) B ( * ) π) s * mass to date, M(B s *)=(5411.7±1.6±0.6) MeV/c 2

  16. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    Science.gov (United States)

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  17. Aberrations and adaptive optics in super-resolution microscopy

    Science.gov (United States)

    Booth, Martin; Andrade, Débora; Burke, Daniel; Patton, Brian; Zurauskas, Mantas

    2015-01-01

    As one of the most powerful tools in the biological investigation of cellular structures and dynamic processes, fluorescence microscopy has undergone extraordinary developments in the past decades. The advent of super-resolution techniques has enabled fluorescence microscopy – or rather nanoscopy – to achieve nanoscale resolution in living specimens and unravelled the interior of cells with unprecedented detail. The methods employed in this expanding field of microscopy, however, are especially prone to the detrimental effects of optical aberrations. In this review, we discuss how super-resolution microscopy techniques based upon single-molecule switching, stimulated emission depletion and structured illumination each suffer from aberrations in different ways that are dependent upon intrinsic technical aspects. We discuss the use of adaptive optics as an effective means to overcome this problem. PMID:26124194

  18. Chromosome Aberrations in Human Lymphocytes Irradiated with Ionizing Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Tae Ho; Kim, Jin Hong; Kim, Jin Kyu [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2014-05-15

    The purpose of the present experiment was to provide data on the dose-dependent production of chromosome aberrations such as dicentrics, centric rings, and excess acentrics. Radiation is one of the more dangerous clastogens in the environment. Ionizing radiation causes chromosome breakages and various cytogenetic aberrations in exposed cells. In an investigation into radiation emergencies, it is important to estimate the dose to exposed persons for several reasons. Physical dosimeters (e. g., film badges) may misrepresent the actual radiation dose and may not be available in a radiological accident or terrorism incident. Biological dosimetry is suitable for estimating the radiation dose during such accidents. The dicentric chromosome assay is very sensitive and a reliable bio-indicator in cases of accidental overexposure.

  19. Retrospective chromosome aberration analysis of former uranium miners

    International Nuclear Information System (INIS)

    Meszaros, G.; Bognar, G.; Koeteles, G. J.

    2003-01-01

    In this paper we present our data collected in the period of 1981-1985 on 165 persons exposed by different radon concentrations expressed in working level month (WLM) units from 100 up to 600. Following the decommissioning of the uranium mine in Hungary in 1997 cytogenetic status of 131 persons were within a follow-up-study of their health conditions initiated by the Hungarian Academy of Science. The persons have terminated their underground activities 5 to 20 years before testing. The comparison of the two datasets suggest a long-term persistence of cytogenetic alterations above the population average values in large percentages of persons investigated. The frequency of chromosome aberrations of uranium miners was found increased in function of their exposure to radon. The comparison of the miner's categories 20 years ago and in the recent years demonstrated the long-term existence of aberrations for many years after completion of underground mining activities. (authors)

  20. Measuring chromatic aberrations in imaging systems using plasmonic nanoparticles.

    Science.gov (United States)

    Gennaro, Sylvain D; Roschuk, Tyler R; Maier, Stefan A; Oulton, Rupert F

    2016-04-01

    We demonstrate a method to measure chromatic aberrations of microscope objectives with metallic nanoparticles using white light. Extinction spectra are recorded while scanning a single nanoparticle through a lens's focal plane. We show a direct correlation between the focal wavelength and the longitudinal chromatic focal shift through our analysis of the variations between the scanned extinction spectra at each scan position and the peak extinction over the entire scan. The method has been tested on achromat and apochromat objectives using aluminum disks varying in size from 260-520 nm. Our method is straightforward, robust, low cost, and broadband with a sensitivity suitable for assessing longitudinal chromatic aberrations in high-numerical-aperture apochromatic corrected lenses.