WorldWideScience

Sample records for abcb1 slc6a2 slc6a3

  1. SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

    Directory of Open Access Journals (Sweden)

    Chi-Jiunn Pan

    Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

  2. SLC22A1-ABCB1 haplotype profiles predict imatinib pharmacokinetics in Asian patients with chronic myeloid leukemia.

    Directory of Open Access Journals (Sweden)

    Onkar Singh

    Full Text Available OBJECTIVE: This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM pharmacokinetics in Asian patients with chronic myeloid leukemia (CML. PATIENTS AND METHODS: Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each and CML patients (n = 38 were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h and clearance (CL were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. RESULTS: Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T, to be significantly associated with IM clearance (p = 0.013. Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2 L/hr/mg: CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h than patients carrying 0 or 1 copy [CL (10(-2 L/hr/mg: 2.19 vs 3.29, p = 0.026; C(0h (10(-6 1/ml: 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h (p = 0.002 and 0.009, respectively. CONCLUSION: This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.

  3. Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.

    Science.gov (United States)

    Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay

    2017-07-05

    Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The

  4. Drug Clearance from Cerebrospinal Fluid Mediated by Organic Anion Transporters 1 (Slc22a6) and 3 (Slc22a8) at Arachnoid Membrane of Rats.

    Science.gov (United States)

    Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya

    2018-03-05

    Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.

  5. Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

    Science.gov (United States)

    Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

    2017-10-01

    Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

  6. Upregulation of the Creatine Transporter Slc6A8 by Klotho

    Directory of Open Access Journals (Sweden)

    Ahmad Almilaji

    2014-11-01

    Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.

  7. SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.

    Science.gov (United States)

    Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A

    2016-11-01

    Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

    Science.gov (United States)

    Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

    2013-01-01

    Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

  9. The dopamine transporter protein gene (SLC6A3): Primary linage mapping and linkage studies in Tourette syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others

    1995-12-10

    The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.

  10. A 40-bp VNTR polymorphism in the 3'-untranslated region of DAT1/SLC6A3 is associated with ADHD but not with alcoholism.

    Science.gov (United States)

    Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J

    2015-06-11

    ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.

  11. Association between the SLC6A3 A1343G polymorphism and schizophrenia Associação entre o polimorfismo A1343G do SLC6A3 e esquizofrenia

    Directory of Open Access Journals (Sweden)

    Quirino Cordeiro

    2010-10-01

    Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between a new single nucleotide polymorphism (rs6347 located in exon 9 of the protein transporter (SLC6A3 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 235 patients and 834 controls matched by gender and age. There were statistical differences in the allelic (χ2=5.97, 1d.f. , p=0.01, OR=1.33-1.05Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para a esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para estudos moleculares em pacientes com esquizofrenia, pois os antipsicóticos, em especial os de primeira geração, exercem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a associação entre um novo polimorfismo de nucleotídeo único (rs6347 localizado no exon 9 do gene do transportador de dopamina (SLC6A3 e esquizofrenia. Um total de 235 pacientes e 834 controles pareados para sexo e idade foi selecionado para a investigação da distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferenças estatisticamente significantes nas distribuições alélicas (χ2=5,97, 1d.f. , p=0,01, OR=1,33-1,051,69 e genotípicas (χ2=6,56, 2d.f. , p=0,03 entre pacientes e controles. Assim, o polimorfismo SLC6A3 A1343G mostrou associação com esquizofrenia na amostra estudada.

  12. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    DEFF Research Database (Denmark)

    Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...

  13. Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

    Science.gov (United States)

    Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

    2014-04-01

    Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

    Directory of Open Access Journals (Sweden)

    Kaifeng Yin

    2017-05-01

    Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

  15. Genetic moderation of cocaine subjective effects by variation in the TPH1, TPH2, and SLC6A4 serotonin genes.

    Science.gov (United States)

    Patriquin, Michelle A; Hamon, Sara C; Harding, Mark J; Nielsen, Ellen M; Newton, Thomas F; De La Garza, Richard; Nielsen, David A

    2017-10-01

    This study investigated variants of tryptophan hydroxylase (TPH)1, TPH2, and SLC6A4 in the moderation of the subjective effects of cocaine. Non-treatment-seeking cocaine-dependent individuals (N=66) were intravenously administered saline and cocaine (40 mg) in a randomized order. Participants self-reported subjective effects of cocaine using a visual analog scale starting before administration of saline or cocaine (-15 min) to up to 20 min after infusion. Self-report ratings on the visual analog scale ranged from 0 (no effect) to 100 (greatest effect). Participants were genotyped for the TPH1 rs1799913, TPH2 rs4290270, and SLC6A4 5-HTTLPR variants. Repeated-measures analysis of covariance was used to examine changes in subjective effect scores over time while controlling for population structure. Participants carrying the TPH1 rs1799913 A allele reported greater subjective response to cocaine for 'stimulated' and 'access' relative to the CC genotype group. Those carrying the TPH2 rs4290270 A allele reported higher 'good effect' and lower 'depressed' effect relative to the TT genotype group. Those carrying the SLC6A4 5-HTTLPR S' allele reported greater 'desire' and 'access' compared with the L'L' genotype group. These findings indicate that TPH1, TPH2, and SLC6A4 variants moderate the subjective effects of cocaine in non-treatment-seeking cocaine-dependent participants.

  16. Epigenetic adaptation of the placental serotonin transporter gene (SLC6A4 to gestational diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Sofia Blazevic

    Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.

  17. Investigation of SLC6A4 gene expression in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Şener

    2015-06-01

    Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169

  18. AVPR1a and SLC6A4 Gene Polymorphisms Are Associated with Creative Dance Performance.

    Directory of Open Access Journals (Sweden)

    2005-09-01

    Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits-dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

  19. AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.

    Directory of Open Access Journals (Sweden)

    Rachel Bachner-Melman

    2005-09-01

    Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits--dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

  20. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    Science.gov (United States)

    Carvill, Gemma L.; McMahon, Jacinta M.; Schneider, Amy; Zemel, Matthew; Myers, Candace T.; Saykally, Julia; Nguyen, John; Robbiano, Angela; Zara, Federico; Specchio, Nicola; Mecarelli, Oriano; Smith, Robert L.; Leventer, Richard J.; Møller, Rikke S.; Nikanorova, Marina; Dimova, Petia; Jordanova, Albena; Petrou, Steven; Helbig, Ingo; Striano, Pasquale; Weckhuysen, Sarah; Berkovic, Samuel F.; Scheffer, Ingrid E.; Mefford, Heather C.

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutations in seven individuals, all of whom have epilepsy with myoclonic-atonic seizures (MAE). We describe two truncations and four missense alterations, all of which most likely lead to loss of function of GAT-1 and thus reduced GABA re-uptake from the synapse. These individuals share many of the electrophysiological properties of Gat1-deficient mice, including spontaneous spike-wave discharges. Overall, pathogenic mutations occurred in 6/160 individuals with MAE, accounting for ∼4% of unsolved MAE cases. PMID:25865495

  1. Additive composite ABCG2, SLC2A9 and SLC22A12 scores of high-risk alleles with alcohol use modulate gout risk.

    Science.gov (United States)

    Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin

    2016-09-01

    The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.

  2. SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

    DEFF Research Database (Denmark)

    Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

    2007-01-01

    Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

  3. No Association of BDNF, COMT, MAOA, SLC6A3, and SLC6A4 Genes and Depressive Symptoms in a Sample of Healthy Colombian Subjects.

    Science.gov (United States)

    González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A

    2015-01-01

    Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.

  4. Major involvement of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) in uptake of biotin and pantothenic acid by human brain capillary endothelial cells.

    Science.gov (United States)

    Uchida, Yasuo; Ito, Katsuaki; Ohtsuki, Sumio; Kubo, Yoshiyuki; Suzuki, Takashi; Terasaki, Tetsuya

    2015-07-01

    The purpose of this study was to clarify the expression of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) and its contribution to the supply of biotin and pantothenic acid to the human brain via the blood-brain barrier. DNA microarray and immunohistochemical analyses confirmed that SLC5A6 is expressed in microvessels of human brain. The absolute expression levels of SLC5A6 protein in isolated human and monkey brain microvessels were 1.19 and 0.597 fmol/μg protein, respectively, as determined by a quantitative targeted absolute proteomics technique. Using an antibody-free method established by Kubo et al. (2015), we found that SLC5A6 was preferentially localized at the luminal membrane of brain capillary endothelium. Knock-down analysis using SLC5A6 siRNA showed that SLC5A6 accounts for 88.7% and 98.6% of total [(3) H]biotin and [(3) H]pantothenic acid uptakes, respectively, by human cerebral microvascular endothelial cell line hCMEC/D3. SLC5A6-mediated transport in hCMEC/D3 was markedly inhibited not only by biotin and pantothenic acid, but also by prostaglandin E2, lipoic acid, docosahexaenoic acid, indomethacin, ketoprofen, diclofenac, ibuprofen, phenylbutazone, and flurbiprofen. This study is the first to confirm expression of SLC5A6 in human brain microvessels and to provide evidence that SLC5A6 is a major contributor to luminal uptake of biotin and pantothenic acid at the human blood-brain barrier. In humans, it was unclear (not concluded) about what transport system at the blood-brain barrier (BBB) is responsible for the brain uptakes of two vitamins, biotin and pantothenic acid, which are necessary for brain proper function. This study clarified for the first time that the solute carrier 5A6/Na(+) -dependent multivitamin transporter SLC5A6/SMVT is responsible for the supplies of biotin and pantothenic acid into brain across the BBB in humans. DHA, docosahexaenoic acid; NSAID, non-steroidal anti-inflammatory drug; PGE2, prostaglandin E2. © 2015

  5. Neurotransmitter Transporter-Like: a male germline-specific SLC6 transporter required for Drosophila spermiogenesis.

    Directory of Open Access Journals (Sweden)

    Nabanita Chatterjee

    2011-01-01

    Full Text Available The SLC6 class of membrane transporters, known primarily as neurotransmitter transporters, is increasingly appreciated for its roles in nutritional uptake of amino acids and other developmentally specific functions. A Drosophila SLC6 gene, Neurotransmitter transporter-like (Ntl, is expressed only in the male germline. Mobilization of a transposon inserted near the 3' end of the Ntl coding region yields male-sterile mutants defining a single complementation group. Germline transformation with Ntl cDNAs under control of male germline-specific control elements restores Ntl/Ntl homozygotes to normal fertility, indicating that Ntl is required only in the germ cells. In mutant males, sperm morphogenesis appears normal, with elongated, individualized and coiled spermiogenic cysts accumulating at the base of the testes. However, no sperm are transferred to the seminal vesicle. The level of polyglycylation of Ntl mutant sperm tubulin appears to be significantly lower than that of wild type controls. Glycine transporters are the most closely related SLC6 transporters to Ntl, suggesting that Ntl functions as a glycine transporter in developing sperm, where augmentation of the cytosolic pool of glycine may be required for the polyglycylation of the massive amounts of tubulin in the fly's giant sperm. The male-sterile phenotype of Ntl mutants may provide a powerful genetic system for studying the function of an SLC6 transporter family in a model organism.

  6. Sequence variation and linkage disequilibrium in the GABA transporter-1 gene (SLC6A1 in five populations: implications for pharmacogenetic research

    Directory of Open Access Journals (Sweden)

    Sughondhabirom Atapol

    2007-10-01

    Full Text Available Abstract Background GABA transporter-1 (GAT-1; genetic locus SLC6A1 is emerging as a novel target for treatment of neuropsychiatric disorders. To understand how population differences might influence strategies for pharmacogenetic studies, we identified patterns of genetic variation and linkage disequilibrium (LD in SLC6A1 in five populations representing three continental groups. Results We resequenced 12.4 kb of SLC6A1, including the promoters, exons and flanking intronic regions in African-American, Thai, Hmong, Finnish, and European-American subjects (total n = 40. LD in SLC6A1 was examined by genotyping 16 SNPs in larger samples. Sixty-three variants were identified through resequencing. Common population-specific variants were found in African-Americans, including a novel 21-bp promoter region variable number tandem repeat (VNTR, but no such variants were found in any of the other populations studied. Low levels of LD and the absence of major LD blocks were characteristic of all five populations. African-Americans had the highest genetic diversity. European-Americans and Finns did not differ in genetic diversity or LD patterns. Although the Hmong had the highest level of LD, our results suggest that a strategy based on the use of tag SNPs would not translate to a major improvement in genotyping efficiency. Conclusion Owing to the low level of LD and presence of recombination hotspots, SLC6A1 may be an example of a problematic gene for association and haplotype tagging-based genetic studies. The 21-bp promoter region VNTR polymorphism is a putatively functional candidate allele for studies focusing on variation in GAT-1 function in the African-American population.

  7. SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation

    DEFF Research Database (Denmark)

    Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N

    2011-01-01

    The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...

  8. Impact of genetic polymorphisms of SLC2A2, SLC2A5, and KHK on metabolic phenotypes in hypertensive individuals.

    Directory of Open Access Journals (Sweden)

    MyPhuong T Le

    Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.

  9. A haplotype of the norepinephrine transporter gene (SLC6A2) is associated with visual memory in attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Shang, Chi-Yung; Chiang, Huey-Ling; Gau, Susan Shur-Fen

    2015-04-03

    Attention-deficit/hyperactivity disorder (ADHD) is a common heritable childhood-onset psychiatric disorder with impaired visual memory. Based on the evidence from treatment effect of atomoxetine, which interacts directly with the norepinephrine transporter, on visual memory in children with ADHD, this study examined the linkage disequilibrium structure of the norepinephrine transporter gene (SLC6A2) and the association between SLC6A2 and ADHD and visual memory, a promising endophenotype for ADHD. This family-based association sample consisted of 382 probands with DSM-IV ADHD and their family members (n=1298 in total) of Han Chinese in Taiwan. Visual memory was assessed by the Pattern Recognition Memory (PRM) and Spatial Recognition Memory (SRM) tasks of the Cambridge Neuropsychological Test Automated Battery (CANTAB). We screened 21 polymorphisms across SLC6A2 and used the Family-Based Association Test (FBAT) to test the associations of SLC6A2 polymorphisms with ADHD and the PRM and SRM measures. In haplotype analyses, a haplotype rs36011 (T)/rs1566652 (G) was significantly associated with ADHD (minimal p=0.045) after adjustment for multiple testing. In quantitative analyses, this TG haplotype also demonstrated significant associations with visual memory measures, including mean latency of correct responses in PRM (minimal p=0.019), total correct responses in PRM (minimal p=0.018), and total correct responses in SRM (minimal p=0.015). Our novel finding of the haplotype rs36011 (T)/rs1566652 (G) as a novel genetic marker involved in both ADHD disease susceptibility and visual memory suggests that allelic variations in SLC6A2 could provide insight into the pathways leading from genotype to phenotype of ADHD. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Association between a genetic variant in the serotonin transporter gene (SLC6A4 and suicidal behavior in patients with schizophrenia

    Directory of Open Access Journals (Sweden)

    Lindholm Carlström Eva

    2012-05-01

    Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.

  11. Risk and protective genetic variants in suicidal behaviour: association with SLC1A2, SLC1A3, 5-HTR1B &NTRK2 polymorphisms.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2012-02-01

    BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.

  12. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Directory of Open Access Journals (Sweden)

    Anna Rita Cappello

    2018-04-01

    Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  13. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Science.gov (United States)

    Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

    2018-04-01

    The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  14. Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.

    Directory of Open Access Journals (Sweden)

    Deborah Cook

    2008-09-01

    Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.

  15. Development of imatinib and dasatinib resistance: dynamics of expression of drug transporters ABCB1, ABCC1, ABCG2, MVP, and SLC22A1.

    Science.gov (United States)

    Gromicho, Marta; Dinis, Joana; Magalhães, Marta; Fernandes, Alexandra R; Tavares, Purificação; Laires, António; Rueff, José; Rodrigues, António Sebastião

    2011-10-01

    About 20% of patients with chronic myeloid leukemia (CML) do not respond to treatment with imatinib either initially or because of acquired resistance. To study the development of CML drug resistance, an in vitro experimental system comprising cell lines with different resistance levels was established by exposing K562 cells to increasing concentrations of imatinib and dasatinib anticancer agents. The mRNA levels of BCR- ABL1 and of genes involved in drug transport or redistribution (ABCB1, ABCC1, ABCC3, ABCG2, MVP, and SLC22A1) were measured and the ABL1 kinase domain sequenced. Results excluded BCR- ABL1 overexpression and mutations as relevant resistance mechanisms. Most studied transporters were overexpressed in the majority of resistant cell lines. Their expression pattern was dynamic: varying with resistance level and chronic drug exposure. Studied efflux transporters may have an important role at the initial stages of resistance, but after prolonged exposure and for higher doses of drugs other mechanisms might take place.

  16. The orphan transporter v7-3 (slc6a15) is a Na+-dependent neutral amino acid transporter (B0AT2)

    DEFF Research Database (Denmark)

    Bröer, Angelika; Tietze, Nadine; Kowalczuk, Sonja

    2006-01-01

    . The transporter is functionally and sequence related to B(0)AT1 (slc6a19) and was hence named B(0)AT2. Leucine, isoleucine, valine, proline and methionine were recognized by the transporter, with values of K(0.5) (half-saturation constant) ranging from 40 to 200 microM. Alanine, glutamine and phenylalanine were...

  17. A genetic-demographic approach reveals a gender-specific association of SLC6A3/DAT1 40 bp-VNTR with life-expectancy.

    Science.gov (United States)

    Hadi, Fazal; Dato, Serena; Carpi, Francesco M; Prontera, Paolo; Crucianelli, Francesca; Renda, Federica; Passarino, Giuseppe; Napolioni, Valerio

    2015-06-01

    Several recent lines of evidence are proving an important role for dopamine in the aging process and in the determination of life span. Components of the dopaminergic system may represent good candidates for longevity studies. Herein, we tested the possible association of the functional SLC6A3/DAT1 40-bp VNTR with life-expectancy in a healthy population of Central Italy (N = 993) by applying a genetic-demographic approach that takes into account the demographic information and different survival rates between sexes for modeling the survival of specific allele carriers in the population. Male carriers of S*/S* genotype showed a lower survival chance across most of the lifespan respect to the survival of DAT1*L-carriers (P = 0.021). The same analyses gave non-significant results in females. Several studies already reported significant sex differences in dopamine metabolism and its related biological pathways. Thus, we can hypothesize that the SLC6A3/DAT1 40 bp-VNTR may affect life expectancy in a sex-specific way. Moreover, it is conceivable that DAT1 S*/S* carriers, who are prone to assume "risk" type behaviors, may be dropped out of the "healthy" population by a sort of "demographic selection".

  18. The renal urate transporter SLC17A1 locus: confirmation of association with gout.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R

    2012-04-27

    Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.

  19. Associação entre polimorfismo SLC6A3 3’UTR VNTR e a resposta ao tratamento da dependência de nicotina

    Directory of Open Access Journals (Sweden)

    Guilherme Rubino de Azevedo Focchi

    2011-01-01

    Full Text Available Objetivo: Avaliar a associação entre a resposta ao tratamento da dependência de nicotina com bupropiona e a presença do polimorfismo SLC6A3 3’UTR VNTR, localizado no gene que codifica o transportador dopaminérgico. Método: Foram acompanhados no Ambulatório de Tabagismo do Instituto de Psiquiatria da Faculdade de Medicina da USP 100 pacientes do sexo masculino com diagnóstico de dependência de nicotina, sem outras patologias. Todos receberam bupropiona até 300 mg ao dia por 12 semanas, associada à terapia cognitivo-comportamental em grupo. A Escala de Fagerström foi aplicada no início e no final do tratamento, e avaliou-se a parada do uso de cigarros na última semana de tratamento e um mês após. Os pacientes tiveram 10 ml de sangue colhidos e genotipados para a existência do polimorfismo SLC6A3 3’UTR VNTR. Resultados: Não foi encontrada associação entre cessação do uso de cigarro e presença do polimorfismo. Conclusão: São necessários mais estudos para avaliar se a presença do polimorfismo SLC6A3 3’UTR VNTR estaria relacionada à melhor resposta ao tratamento da dependência de nicotina.

  20. Homozygous SLC6A17 Mutations Cause Autosomal-Recessive Intellectual Disability with Progressive Tremor, Speech Impairment, and Behavioral Problems

    Science.gov (United States)

    Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans

    2015-01-01

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. PMID:25704603

  1. Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction

    Directory of Open Access Journals (Sweden)

    Yun-Fang Jia

    2017-07-01

    Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.

  2. Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.

    Directory of Open Access Journals (Sweden)

    Jing Yuan

    Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.

  3. SLC6A1 gene involvement in susceptibility to attention-deficit/hyperactivity disorder: A case-control study and gene-environment interaction.

    Science.gov (United States)

    Yuan, Fang-Fen; Gu, Xue; Huang, Xin; Zhong, Yan; Wu, Jing

    2017-07-03

    Attention-deficit/hyperactivity disorder (ADHD) is an early onset childhood neurodevelopmental disorder with an estimated heritability of approximately 76%. We conducted a case-control study to explore the role of the SLC6A1 gene in ADHD. The genotypes of eight variants were determined using Sequenom MassARRAY technology. The participants in the study were 302 children with ADHD and 411 controls. ADHD symptoms were assessed using the Conners Parent Symptom Questionnaire. In our study, rs2944366 was consistently shown to be associated with the ADHD risk in the dominant model (odds ratio [OR]=0.554, 95% confidence interval [CI]=0.404-0.760), and nominally associated with Hyperactive index score (P=0.027). In addition, rs1170695 has been found to be associated with the ADHD risk in the addictive model (OR=1.457, 95%CI=1.173-1.809), while rs9990174 was associated with the Hyperactive index score (P=0.010). Intriguingly, gene-environmental interactions analysis consistently revealed the potential interactions of rs1170695 with blood lead (P mul =0.044) to modify the ADHD risk. Expression quantitative trait loci analysis suggested that these positive single nucleotide polymorphisms (SNPs) may mediate SLC6A1 gene expression. Therefore, our results suggest that selected SLC6A1 gene variants may have a significant effect on the ADHD risk. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Molecular Properties of Drugs Interacting with SLC22 Transporters OAT1, OAT3, OCT1, and OCT2: A Machine-Learning Approach.

    Science.gov (United States)

    Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K

    2016-10-01

    Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue

  5. Homozygous SLC6A17 mutations cause autosomal-recessive intellectual disability with progressive tremor, speech impairment, and behavioral problems.

    Science.gov (United States)

    Iqbal, Zafar; Willemsen, Marjolein H; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; de Brouwer, Arjan P M; Marouillat, Sylviane; Wienker, Thomas F; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans

    2015-03-05

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  6. Association of polymorphisms in 5-HTT (SLC6A4) and MAOA genes with measures of obesity in young adults of Portuguese origin.

    Science.gov (United States)

    Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio

    2016-01-01

    To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.

  7. Interaction of GABA-mimetics with the taurine transporter (TauT, Slc6a6) in hyperosmotic treated caco-2, LLC-PK1 and rat renal SKPT cells

    DEFF Research Database (Denmark)

    Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob Munk

    2016-01-01

    The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells....... Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1......) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2...

  8. Treatment of intractable epilepsy in a female with SLC6A8 deficiency

    NARCIS (Netherlands)

    Mercimek-Mahmutoglu, S.; Connolly, M.B.; Poskitt, K.J.; Horvath, G.A.; Lowry, N.; Salomons, G.S.; Casey, B.; Sinclair, G.; Davis, C.; Jakobs, C.; Stockler-Ipsiroglu, S.

    2010-01-01

    A female heterozygous for a novel, disease causing, missense mutation in the X-linked cerebral creatine transporter (SLC6A8) gene (c.1067G > T, p.Gly356Val) presented with intractable epilepsy, mild intellectual disability and moderately reduced cerebral creatine levels. Treatment with creatine

  9. Dicty_cDB: SLC466 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

  10. Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Kayo Ikeda

    2017-11-01

    Full Text Available Summary: Foxp3+ regulatory T (Treg cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs, including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3+ Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3+ Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. : Treg cells regulate excess immune responses and are highly proliferative in vivo. Ikeda et al. find that branched-chain amino acids (BCAAs are essentially required to maintain expansion and the suppressive capacity of Treg cells via Slc3a2 and mTORC1. Keywords: Treg cells, amino acids, immunometabolism, immune regulation, transporter

  11. Dicty_cDB: SLC436 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

  12. Language disorder with mild intellectual disability in a child affected by a novel mutation of SLC6A8 gene.

    Science.gov (United States)

    Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G

    2011-02-01

    We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.

  13. Deletions at SLC18A1 increased the risk of CRC and lower SLC18A1 expression associated with poor CRC outcome.

    Science.gov (United States)

    Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode

    2017-10-26

    Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Lack of association between VNTR polymorphism of dopamine transporter gene (SLC6A3 and schizophrenia in a Brazilian sample Ausência de associação entre o polimorfismo VNTR do gene do transportador de dopamina (SLC6A3 e esquizofrenia em uma população brasileira

    Directory of Open Access Journals (Sweden)

    Quirino Cordeiro

    2004-12-01

    Full Text Available A role of dopaminergic dysfunction has been postulated in the aetiology of schizophrenia. We hypothesized that variations in the dopamine transporter gene (SLC6A3 may be associated with schizophrenia. We conducted case-control and family based analysis on the polymorphic SLC6A3 variable number tandem repeat (VNTR in a sample of 220 schizophrenic patients, 226 gender and ethnic matched controls, and 49 additional case-parent trios. No differences were found in allelic or genotypic distributions between cases and controls and no significant transmission distortions from heterozygous parents to schizophrenic offspring were detected. Thus, our results do not support an association of the SLC6A3 VNTR with schizophrenia in our sample.Genes do sistema dopaminérgico são de escolha para a pesquisa de susceptibilidade para a esquizofrenia. Desse modo, possível contribuição do polimorfismo do gene do transportador de dopamina (SLC6A3 no aumento da vulnerabilidade para a esquizofrenia foi investigada no presente estudo. Analisou-se a distribuição do sítio polimórfico do gene do transportador de dopamina (VNTR em uma população de 220 pacientes com esquizofrenia (critério diagnóstico: DSM-IV e comparou-se com a distribuição em uma população controle de 226 indivíduos pareados para sexo e etnia. Nenhuma diferença foi observada na distribuição dos alelos entre casos e controles. O mesmo polimorfismo também foi investigado em uma segunda amostra composta por 49 trios (pais e probando. O resultado também foi negativo. Tais dados não dão suporte para a participação do polimorfismo do gene do transportador de dopamina no aumento de susceptibilidade para esquizofrenia na amostra estudada.

  15. Dicty_cDB: SLC419 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

  16. Screening of SLC26A4, FOXI1, KCNJ10, and GJB2 in bilateral deafness patients with inner ear malformation.

    Science.gov (United States)

    Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan

    2012-06-01

    Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.

  17. OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.

    Science.gov (United States)

    Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy

    2017-05-30

    Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.

  18. Dicty_cDB: SLC456 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

  19. SLC6A3 polymorphism and response to methylphenidate in children with ADHD: A systematic review and meta-analysis.

    Science.gov (United States)

    Soleimani, Robabeh; Salehi, Zivar; Soltanipour, Soheil; Hasandokht, Tolou; Jalali, Mir Mohammad

    2018-04-01

    Methylphenidate (MPH) is the most commonly used treatment for attention-deficit hyperactivity disorder (ADHD) in children. However, the response to MPH is not similar in all patients. This meta-analysis investigated the potential role of SLC6A3 polymorphisms in response to MPH in children with ADHD. Clinical trials or naturalistic studies were selected from electronic databases. A meta-analysis was conducted using a random-effects model. Cohen's d effect size and 95% confidence intervals (CIs) were determined. Sensitivity analysis and meta-regression were performed. Q-statistic and Egger's tests were conducted to evaluate heterogeneity and publication bias, respectively. The Grading of Recommendations Assessment, Development and Evaluation (GRADE) system was used to assess the quality of evidence. Sixteen studies with follow-up periods of 1-28 weeks were eligible. The mean treatment acceptability of MPH was 97.2%. In contrast to clinical trials, the meta-analysis of naturalistic studies indicated that children without 10/10 repeat carriers had better response to MPH (Cohen's d: -0.09 and 0.44, respectively). The 9/9 repeat polymorphism had no effect on the response rate (Cohen's d: -0.43). In the meta-regression, a significant association was observed between baseline severity of ADHD, MPH dosage, and combined type of ADHD in some genetic models. Sensitivity analysis indicated the robustness of our findings. No publication bias was observed in our meta-analysis. The GRADE evaluations revealed very low levels of confidence for each outcome of response to MPH. The results of clinical trials and naturalistic studies regarding the effect size between different polymorphisms of SLC6A3 were contradictory. Therefore, further research is recommended. © 2017 Wiley Periodicals, Inc.

  20. Lack of Association between a 3'UTR VNTR Polymorphism of Dopamine Transporter Gene (SLC6A3) and ADHD in a Brazilian Sample of Adult Patients

    Science.gov (United States)

    Aperecida da Silva, Maria; Cordeiro, Quirino; Louza, Mario; Vallada, Homero

    2011-01-01

    Objective: To investigate a possible association between a 3'UTR VNTR polymorphism of the dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. Method: Study Case-control with 102 ADHD adult outpatients ("DSM-IV" criteria) and 479 healthy controls. The primers' sequence used were: 3'UTR-Forward: 5' TGT GGT…

  1. Dicty_cDB: SLC486 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

  2. SLC2A9 is a high-capacity urate transporter in humans.

    Directory of Open Access Journals (Sweden)

    Mark J Caulfield

    2008-10-01

    ] 0.9 to 1.05, p > 0.33 by meta-analysis of an SLC2A9 variant in six case-control studies including 11,897 participants. In a separate meta-analysis of four population studies including 11,629 participants we found no association of SLC2A9 with systolic (effect size -0.12 mm Hg, 95% CI -0.68 to 0.43, p = 0.664 or diastolic blood pressure (effect size -0.03 mm Hg, 95% CI -0.39 to 0.31, p = 0.82.This study provides evidence that SLC2A9 splice variants act as high-capacity urate transporters and is one of the first functional characterisations of findings from genome-wide association scans. We did not find an association of the SLC2A9 gene with blood pressure in this study. Our findings suggest potential pathogenic mechanisms that could offer a new drug target for gout.

  3. Homozygous SLC6A17 Mutations Cause Autosomal-Recessive Intellectual Disability with Progressive Tremor, Speech Impairment, and Behavioral Problems

    OpenAIRE

    Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia

    2015-01-01

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neu...

  4. CYP2D6*4, CYP3A5*3 and ABCB1 3435T polymorphisms and drug-related falls in elderly people

    NARCIS (Netherlands)

    Blonk, Maren I.; van der Velde, Nathalie; van den Bemt, Patricia M. L. A.; van Schaik, Ron H. N.; van der Cammen, Tischa J. M.

    2010-01-01

    The objective of this study is to investigate the association between CYP2D6*4, CYP3A5*3 and ABCB1 3435T polymorphisms and drug-related falls. Multivariate logistic regression was performed in an existing database in order to study the association between falls history and CYP2D6*4, CYP3A5*3, ABCB1

  5. The role of SLC2A1 in early onset and childhood absence epilepsies

    DEFF Research Database (Denmark)

    Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg

    2013-01-01

    Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...

  6. Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.

    Science.gov (United States)

    Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David

    2014-04-01

    Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.

  7. Study of the serotonin transporter (SLC6A4 and BDNF genes in French patients with non syndromic mental deficiency

    Directory of Open Access Journals (Sweden)

    Mignon Laurence

    2010-02-01

    Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.

  8. Decreased miR-106a inhibits glioma cell glucose uptake and proliferation by targeting SLC2A3 in GBM.

    Science.gov (United States)

    Dai, Dong-Wei; Lu, Qiong; Wang, Lai-Xing; Zhao, Wen-Yuan; Cao, Yi-Qun; Li, Ya-Nan; Han, Guo-Sheng; Liu, Jian-Min; Yue, Zhi-Jian

    2013-10-14

    MiR-106a is frequently down-regulated in various types of human cancer. However the underlying mechanism of miR-106a involved in glioma remains elusive. The association of miR-106a with glioma grade and patient survival was analyzed. The biological function and target of miR-106a were determined by bioinformatic analysis and cell experiments (Western blot, luciferase reporter, cell cycle, ntracellular ATP production and glucose uptake assay). Finally, rescue expression of its target SLC2A3 was used to test the role of SLC2A3 in miR-106a-mediated cell glycolysis and proliferation. Here we showed that miR-106a was a tumor suppressor miRNA was involved in GBM cell glucose uptake and proliferation. Decreased miR-106a in GBM tissues and conferred a poor survival of GBM patients. SLC2A3 was identified as a core target of miR-106a in GBM cells. Inhibition of SLC2A3 by miR-106a attenuated cell proliferation and inhibited glucose uptake. In addition, for each biological process we identified ontology-associated transcripts that significantly correlated with SLC2A3 expression. Finally, the expression of SLC2A3 largely abrogated miR-106a-mediated cell proliferation and glucose uptake in GBM cells. Taken together, miR-106a and SLC2A3 could be potential therapeutic approaches for GBM.

  9. Peripheral SLC6A4 DNA methylation is associated with in vivo measures of human brain serotonin synthesis and childhood physical aggression.

    Directory of Open Access Journals (Sweden)

    Dongsha Wang

    Full Text Available The main challenge in addressing the role of DNA methylation in human behaviour is the fact that the brain is inaccessible to epigenetic analysis in living humans. Using positron emission tomography (PET measures of brain serotonin (5-HT synthesis, we found in a longitudinal sample that adult males with high childhood-limited aggression (C-LHPA had lower in vivo 5-HT synthesis in the orbitofrontal cortex (OBFC. Here we hypothesized that 5-HT alterations associated with childhood aggression were linked to differential DNA methylation of critical genes in the 5-HT pathway and these changes were also detectable in peripheral white blood cells. Using pyrosequencing, we determined the state of DNA methylation of SLC6A4 promoter in T cells and monocytes isolated from blood of cohort members (N = 25 who underwent a PET scan, and we examined whether methylation status in the blood is associated with in vivo brain 5-HT synthesis. Higher levels of methylation were observed in both T cells and monocytes at specific CpG sites in the C-LHPA group. DNA methylation of SLC6A4 in monocytes appears to be associated more reliably with group membership than T cells. In both cell types the methylation state of these CpGs was associated with lower in vivo measures of brain 5-HT synthesis in the left and right lateral OBFC (N = 20 where lower 5-HT synthesis in C-LHPA group was observed. Furthermore, in vitro methylation of the SLC6A4 promoter in a luciferase reporter construct suppresses its transcriptional activity supporting a functional role of DNA methylation in SLC6A4 promoter regulation. These findings indicate that state of SLC6A4 promoter methylation is altered in peripheral white blood cells of individuals with physical aggression during childhood. This supports the relevance of peripheral DNA methylation for brain function and suggests that peripheral SLC6A4 DNA methylation could be a marker of central 5-HT function.

  10. Inhibitors of GLUT/SLC2A Enhance the Action of BCNU and Temozolomide against High-Grade Gliomas

    Directory of Open Access Journals (Sweden)

    Alberto Azzalin

    2017-04-01

    Full Text Available Glucose transport across glioblastoma membranes plays a crucial role in maintaining the enhanced glycolysis typical of high-grade gliomas and glioblastoma. We tested the ability of two inhibitors of the glucose transporters GLUT/SLC2A superfamily, indinavir (IDV and ritonavir (RTV, and of one inhibitor of the Na/glucose antiporter type 2 (SGLT2/SLC5A2 superfamily, phlorizin (PHZ, in decreasing glucose consumption and cell proliferation of human and murine glioblastoma cells. We found in vitro that RTV, active on at least three different GLUT/SLC2A transporters, was more effective than IDV, a specific inhibitor of GLUT4/SLC2A4, both in decreasing glucose consumption and lactate production and in inhibiting growth of U87MG and Hu197 human glioblastoma cell lines and primary cultures of human glioblastoma. PHZ was inactive on the same cells. Similar results were obtained when cells were grown in adherence or as 3D multicellular tumor spheroids. RTV treatment but not IDV treatment induced AMP-activated protein kinase (AMPKα phosphorylation that paralleled the decrease in glycolytic activity and cell growth. IDV, but not RTV, induced an increase in GLUT1/SLC2A1 whose activity could compensate for the inhibition of GLUT4/SLC2A4 by IDV. RTV and IDV pass poorly the blood brain barrier and are unlikely to reach sufficient liquoral concentrations in vivo to inhibit glioblastoma growth as single agents. Isobologram analysis of the association of RTV or IDV and 1,3-bis(2-chloroethyl-1-nitrosourea (BCNU or 4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide (TMZ indicated synergy only with RTV on inhibition of glioblastoma cells. Finally, we tested in vivo the combination of RTV and BCNU on established GL261 tumors. This drug combination increased the overall survival and allowed a five-fold reduction in the dose of BCNU.

  11. Impaired nutrient signaling and body weight control in a Na+ neutral amino acid cotransporter (Slc6a19)-deficient mouse.

    Science.gov (United States)

    Bröer, Angelika; Juelich, Torsten; Vanslambrouck, Jessica M; Tietze, Nadine; Solomon, Peter S; Holst, Jeff; Bailey, Charles G; Rasko, John E J; Bröer, Stefan

    2011-07-29

    Amino acid uptake in the intestine and kidney is mediated by a variety of amino acid transporters. To understand the role of epithelial neutral amino acid uptake in whole body homeostasis, we analyzed mice lacking the apical broad-spectrum neutral (0) amino acid transporter B(0)AT1 (Slc6a19). A general neutral aminoaciduria was observed similar to human Hartnup disorder which is caused by mutations in SLC6A19. Na(+)-dependent uptake of neutral amino acids into the intestine and renal brush-border membrane vesicles was abolished. No compensatory increase of peptide transport or other neutral amino acid transporters was detected. Mice lacking B(0)AT1 showed a reduced body weight. When adapted to a standard 20% protein diet, B(0)AT1-deficient mice lost body weight rapidly on diets containing 6 or 40% protein. Secretion of insulin in response to food ingestion after fasting was blunted. In the intestine, amino acid signaling to the mammalian target of rapamycin (mTOR) pathway was reduced, whereas the GCN2/ATF4 stress response pathway was activated, indicating amino acid deprivation in epithelial cells. The results demonstrate that epithelial amino acid uptake is essential for optimal growth and body weight regulation.

  12. SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters.

    Science.gov (United States)

    Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

    2016-11-01

    Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Characterization of SLC transporters in human skin

    Directory of Open Access Journals (Sweden)

    Marion Alriquet

    2015-03-01

    Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

  14. Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.

  15. Fructose Synthesis and Transport at the Uterine-Placental Interface of Pigs: Cell-Specific Localization of SLC2A5, SLC2A8, and Components of the Polyol Pathway.

    Science.gov (United States)

    Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A

    2016-11-01

    The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.

  16. Evidencia de asociación entre el gen SLC6A4 y efectos epistáticos con variantes en HTR2A en la etiología del autismo en la población antioqueña

    Directory of Open Access Journals (Sweden)

    Ana Victoria Valencia

    2012-12-01

    Full Text Available Introducción. El espectro autista constituye un grupo de trastornos graves del neurodesarrollo, conun fuerte componente genético. Se ha sugerido un papel importante del sistema serotoninérgico en el desarrollo de este grupo de trastornos, con base en los estudios de respuesta a medicamentos y la hiperserotoninemia, característica común en el autismo. Se han implicado múltiples moléculas en el metabolismo y la neurotransmisión de la serotonina; sin embargo, los resultados de los estudios hantenido poca congruencia entre diferentes poblaciones. Objetivos. Evaluar la relación entre el autismo y el polimorfismo de nucleótido simple (SingleNucleotide Polymorphism, SNP en los genes SLC6A4, HTR2A e ITGB3, en una muestra de la población antioqueña. Materiales y métodos. Se genotipificaron 42 núcleos familiares con autismo para 10 variantes enlos genes SLC6A4, ITGB3 y HTR2A. Se evaluó la asociación utilizando la prueba de desequilibrio enla transmisión. Se exploró el impacto de la interacción entre estos genes y el autismo, utilizando la reducción multidimensional. Resultados. Se encontró asociación de las variantes rs4583306 (OR=2,6, p=0,004 y rs2066713(OR=2,2 p=0,03, en el gen SLC6A4, y asociación de combinaciones genotípicas entre los genes SLC6A4 y HTR2A y el riesgo de autismo (p=0,0001. Conclusiones. Se encontró asociación significativa con variantes en el gen transportador de serotoninacon el autismo, al igual que interacción entre variantes en los genes HTR2A con SLC6A4. Estos resultados concuerdan con los de estudios previos en otras poblaciones y son pruebas a favor delpapel del sistema serotoninérgico en la etiología del espectro autista.   doi: http://dx.doi.org/10.7705/biomedica.v32i4.593

  17. The Role of Na:K:2Cl Cotransporter 1 (NKCC1/SLC12A2) in Dental Epithelium during Enamel Formation in Mice

    Science.gov (United States)

    Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius

    2017-01-01

    Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227

  18. MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

    Science.gov (United States)

    Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

    2016-11-01

    A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).

  19. Genome-wide association analysis confirms and extends the association of SLC2A9 with serum uric acid levels to Mexican Americans

    Directory of Open Access Journals (Sweden)

    Venkata Saroja eVoruganti

    2013-12-01

    Full Text Available Increased serum uric acid (SUA is a risk factor for gout and renal and cardiovascular disease. The purpose of this study was to identify genetic factors that affect the variation in SUA in 632 Mexican Americans participants of the San Antonio Family Heart Study (SAFHS. A genome-wide association analysis was performed using the Illumina Human Hap 550K single nucleotide polymorphism (SNP microarray. We used a linear regression-based association test under an additive model of allelic effect, while accounting for non-independence among family members via a kinship variance component. All analyses were performed in the software package SOLAR. SNPs rs6832439, rs13131257 and rs737267 in solute carrier protein 2 family, member 9 (SLC2A9 were associated with SUA at genome-wide significance (p <1.3×10-7. The minor alleles of these SNPs had frequencies of 36.2%, 36.2%, and 38.2 %, respectively, and were associated with decreasing SUA levels. All of these SNPs were located in introns 3-7 of SLC2A9, the location of the previously reported associations in European populations. When analyzed for association with cardiovascular-renal disease risk factors, conditional on SLC2A9 SNPs strongly associated with SUA, significant associations were found for SLC2A9 SNPs with BMI, body weight and waist circumference (p < 1.4 x 10-3 and suggestive associations with albumin-creatinine ratio and total antioxidant status. The SLC2A9 gene encodes an urate transporter that has considerable influence on variation in SUA. In addition to the primary association locus, suggestive evidence (p<1.9×10-6 for joint linkage/association was found at a previously-reported urate quantitative trait locus (Logarithm of odds score = 3.6 on 3p26.3. In summary, our GWAS extends and confirms the association of SLC2A9 with SUA for the first time in a Mexican American cohort and also shows for the first time its association with cardiovascular-renal disease risk factors.

  20. A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.

    Science.gov (United States)

    Caduff, M; Bauer, A; Jagannathan, V; Leeb, T

    2017-10-01

    Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.

  1. Recent SLC developments

    International Nuclear Information System (INIS)

    Ross, M.

    1993-04-01

    The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines

  2. Dicty_cDB: SLC403 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

  3. SLC-2000: A luminosity upgrade for the SLC

    International Nuclear Information System (INIS)

    Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

    1996-01-01

    We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

  4. Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome

    NARCIS (Netherlands)

    O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.

    2016-01-01

    Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter

  5. Dicty_cDB: SLC494 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

  6. Dicty_cDB: SLC832 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

  7. SLC2A3 single-nucleotide polymorphism and duplication influence cognitive processing and population-specific risk for attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter

    2017-07-01

    Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.

  8. Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    DEFF Research Database (Denmark)

    Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

  9. Meta-analysis of the association of the SLC6A3 3'-UTR VNTR with cognition.

    Science.gov (United States)

    Ettinger, Ulrich; Merten, Natascha; Kambeitz, Joseph

    2016-01-01

    The gene coding for the dopamine transporter (DAT), SLC6A3, contains a 40-base pair variable number of tandem repeats (VNTR) polymorphism (rs28363170) in its 3' untranslated region. This VNTR has been associated with attention deficit hyperactivity disorder (ADHD) and has been investigated in relation to cognition and brain function. Here, we report the results of a comprehensive meta-analysis with meta-regression examining the association of the VNTR with different domains of cognition in healthy adults. We extracted data from 28 independent studies and carried out meta-analyses for associations with working memory (k=10 samples, N=1193 subjects), inhibition (k=8 samples, N=829 subjects), executive functions including inhibition (k=10 samples, N=984 subjects), attention (k=6 samples, N=742 subjects) and declarative long-term memory (k=5 samples, N=251 subjects). None of the investigated dimensions showed significant associations with the VNTR (all p>0.26). Meta-regression including year of publication, gender, age, ethnicity and percentage of 10R-homozygotes similarly did not attain significance. We conclude that there is no evidence that rs28363170 may be a significant predictor of cognitive function in healthy adults. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.

    Science.gov (United States)

    Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun

    2018-06-15

    Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.

  11. Dicty_cDB: SLC461 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

  12. Dicty_cDB: SLC487 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

  13. Genome-wide association analysis identifies a mutation in the thiamine transporter 2 (SLC19A3 gene associated with Alaskan Husky encephalopathy.

    Directory of Open Access Journals (Sweden)

    Karen M Vernau

    Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.

  14. Dicty_cDB: SLC433 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

  15. Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR-2 (SLC19A3).

    Science.gov (United States)

    Liang, Xiaomin; Chien, Huan-Chieh; Yee, Sook Wah; Giacomini, Marilyn M; Chen, Eugene C; Piao, Meiling; Hao, Jia; Twelves, Jolyn; Lepist, Eve-Irene; Ray, Adrian S; Giacomini, Kathleen M

    2015-12-07

    The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH's, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP(+) and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed. Taken together, our data suggest that hTHTR-2 may play a role in the intestinal absorption and tissue distribution of metformin and other organic cations and that the transporter may be a target for drug-drug and drug-nutrient interactions.

  16. Riboflavin uptake transporter Slc52a2 (RFVT2) is upregulated in the mouse mammary gland during lactation.

    Science.gov (United States)

    Wu, Alex Man Lai; Dedina, Liana; Dalvi, Pooja; Yang, Mingdong; Leon-Cheon, John; Earl, Brian; Harper, Patricia A; Ito, Shinya

    2016-04-01

    While it is well recognized that riboflavin accumulates in breast milk as an essential vitamin for neonates, transport mechanisms for its milk excretion are not well characterized. The multidrug efflux transporter ABCG2 in the apical membrane of milk-producing mammary epithelial cells (MECs) is involved with riboflavin excretion. However, it is not clear whether MECs possess other riboflavin transport systems, which may facilitate its basolateral uptake into MECs. We report here that transcripts encoding the second (SLC52A2) and third (SLC52A3) member of the recently discovered family of SLC52A riboflavin uptake transporters are expressed in milk fat globules from human breast milk. Furthermore, Slc52a2 and Slc52a3 mRNA are upregulated in the mouse mammary gland during lactation. Importantly, the induction ofSlc52a2, which was the major Slc52a riboflavin transporter in the lactating mammary gland, was also observed at the protein level. Subcellular localization studies showed that green fluorescent protein-tagged mouse SLC52A2 mainly localized to the cell membrane, with no preferential distribution to the apical or basolateral membrane in polarized kidney MDCK cells. These results strongly implicate a potential role for SLC52A2 in riboflavin uptake by milk-producing MECs, a critical step in the transfer of riboflavin into breast milk. Copyright © 2016 the American Physiological Society.

  17. Dicty_cDB: SLC489 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

  18. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct.

    Science.gov (United States)

    Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

    2011-09-30

    Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and

  19. Dicty_cDB: SLC441 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

  20. Dicty_cDB: SLC473 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

  1. ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production

    Directory of Open Access Journals (Sweden)

    Etienne Masle-Farquhar

    2017-05-01

    Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.

  2. Dicty_cDB: SLC483 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

  3. Dicty_cDB: SLC455 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

  4. Maternal DRD2, SLC6A3, and OXTR genotypes as potential moderators of the relation between maternal history of care and maternal cortisol secretion in the context of mother-infant separation.

    Science.gov (United States)

    Ludmer, Jaclyn A; Jamieson, Brittany; Gonzalez, Andrea; Levitan, Robert; Kennedy, James; Villani, Vanessa; Masellis, Mario; Basile, Vincenzo S; Atkinson, Leslie

    2017-10-01

    A mother's cortisol secretion is importantly associated with her own mental health and her infant's cortisol secretion. This study investigated the influences of maternal history of care and maternal DRD2, SLC6A3, and OXTR genotypes on maternal cortisol in the context of infant stress. A community sample of 296 mother-infant dyads completed a maternal separation at infant age 17 months. Maternal salivary cortisol, buccal cells, and self-reported history of care were collected. Multilevel models revealed that history of care had a greater influence on maternal baseline cortisol (but not cortisol trajectory) for mothers with more plasticity alleles of SLC6A3 (10R) and OXTR (G), relative to mothers with fewer or no plasticity alleles. Findings indicate that a mother's history of care is related to her cortisol secretion in anticipation of infant stress, but that this relation depends on her genetic characteristics. Findings are discussed in relation to the maternal protective system and anticipatory cortisol secretion. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Dicty_cDB: SLC480 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

  6. Dicty_cDB: SLC442 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

  7. Interaction of GABA-mimetics with the taurine transporter (TauT, Slc6a6) in hyperosmotic treated Caco-2, LLC-PK1 and rat renal SKPT cells.

    Science.gov (United States)

    Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob; Holm, René; Nielsen, Carsten Uhd

    2016-01-20

    The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells, porcine LLC-PK1 cells, and rat SKPT cells using radiolabelled taurine. Hyperosmotic conditions were obtained by incubation with raffinose (final osmolality of 500mOsm) for 24h prior to the uptake experiments. Expression of the taurine transporter, TauT, was investigated at the mRNA level by real-time PCR. Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2.02, 4.19, 4.94, 31.4 and 39.9mM, respectively. In conclusion, GABA mimetics inhibited taurine uptake in hyperosmotic rat renal SKPT cells. SKPT cells, which seem to be a useful model for investigating taurine transport in the short-term presence of high concentrations of osmolytes. Furthermore, analogues of β-alanine appear to have higher affinities for TauT than GABA-analogues. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Dicty_cDB: SLC405 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

  9. Dicty_cDB: SLC470 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

  10. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Yan Xiaofei

    2011-09-01

    Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was

  11. Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice

    OpenAIRE

    Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo

    2016-01-01

    Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...

  12. Comprehensive phenotype/genotype analyses of the norepinephrine transporter gene (SLC6A2 in ADHD: relation to maternal smoking during pregnancy.

    Directory of Open Access Journals (Sweden)

    Geeta A Thakur

    Full Text Available Despite strong pharmacological evidence implicating the norepinephrine transporter in ADHD, genetic studies have yielded largely insignificant results. We tested the association between 30 tag SNPs within the SLC6A2 gene and ADHD, with stratification based on maternal smoking during pregnancy, an environmental factor strongly associated with ADHD.Children (6-12 years old diagnosed with ADHD according to DSM-IV criteria were comprehensively evaluated with regard to several behavioral and cognitive dimensions of ADHD as well as response to a fixed dose of methylphenidate (MPH using a double-blind placebo controlled crossover trial. Family-based association tests (FBAT, including categorical and quantitative trait analyses, were conducted in 377 nuclear families.A highly significant association was observed with rs36021 (and linked SNPs in the group where mothers smoked during pregnancy. Association was noted with categorical DSM-IV ADHD diagnosis (Z=3.74, P=0.0002, behavioral assessments by parents (CBCL, P=0.00008, as well as restless-impulsive subscale scores on Conners'-teachers (P=0.006 and parents (P=0.006. In this subgroup, significant association was also observed with cognitive deficits, more specifically sustained attention, spatial working memory, planning, and response inhibition. The risk allele was associated with significant improvement of behavior as measured by research staff (Z=3.28, P=0.001, parents (Z=2.62, P=0.009, as well as evaluation in the simulated academic environment (Z=3.58, P=0.0003.By using maternal smoking during pregnancy to index a putatively more homogeneous group of ADHD, highly significant associations were observed between tag SNPs within SLC6A2 and ADHD diagnosis, behavioral and cognitive measures relevant to ADHD and response to MPH. This comprehensive phenotype/genotype analysis may help to further understand this complex disorder and improve its treatment. Clinical trial registration information - Clinical

  13. Prenatal exposure to maternal depressed mood and the MTHFR C677T variant affect SLC6A4 methylation in infants at birth.

    Directory of Open Access Journals (Sweden)

    Angela M Devlin

    2010-08-01

    Full Text Available Prenatal and early postnatal exposure to maternal depression may "program" childhood behavior via epigenetic processes such as DNA methylation. Methylenetetrahydro-folate reductase (MTHFR is an important enzyme in the generation of methyl groups for DNA methylation. The common MTHFR C677T variant is associated with depression in men and non-pregnant women, and with global changes in DNA methylation. This study investigated the effect of maternal MTHFR C677T genotype on antenatal maternal mood, and their impact on the gene-specific methylation in pregnant women and their newborn infants. The methylation status of SLC6A4, which encodes the transmembrane serotonin transporter, and BDNF, which encodes brain derived neurotrophic factor, were assessed because of their potential role in behaviour.Depressed mood was assessed by the Edinburgh Postnatal Depression Scale (EPDS and the Hamilton Rating Scale for Depression (HAM-D in women (n = 82, all taking folate during the 2(nd and 3(rd trimesters of pregnancy. The methylation status of SLC6A4 and BDNF were assessed in 3rd trimester maternal peripheral leukocytes and in umbilical cord leukocytes collected from their infants at birth. Women with the MTHFR 677TT genotype had greater 2(nd trimester depressed mood (p<0.05. Increased 2(nd trimester maternal depressed mood (EPDS scores was associated with decreased maternal and infant SLC6A4 promoter methylation (p<0.05, but had no effect on BDNF promoter methylation.These findings show that the MTHFR C677T variant is associated with greater depressed mood during pregnancy. We further showed that prenatal exposure to maternal depressed mood affects gene-specific DNA methylation patterns. These findings support the concept that alterations in epigenetic processes may contribute to developmental programming of behaviour by maternal depression.

  14. Genetic analysis of the GLUT10 glucose transporter (SLC2A10 polymorphisms in Caucasian American type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Mychaleckyj Josyf C

    2005-12-01

    Full Text Available Abstract Background GLUT10 (gene symbol SLC2A10 is a facilitative glucose transporter within the type 2 diabetes (T2DM-linked region on chromosome 20q12-13.1. Therefore, we evaluated GLUT10 as a positional candidate gene for T2DM in Caucasian Americans. Methods Twenty SNPs including 4 coding, 10 intronic and 6 5' and 3' to the coding sequence were genotyped across a 100 kb region containing the SLC2A10 gene in DNAs from 300 T2DM cases and 310 controls using the Sequenom MassArray Genotyping System. Allelic association was evaluated, and linkage disequilibrium (LD and haplotype structure of SLC2A10 were also determined to assess whether any specific haplotypes were associated with T2DM. Results Of these variants, fifteen had heterozygosities greater than 0.80 and were analyzed further for association with T2DM. No evidence of significant association was observed for any variant with T2DM (all P ≥ 0.05, including Ala206Thr (rs2235491 which was previously reported to be associated with fasting insulin. Linkage disequilibrium analysis suggests that the SLC2A10 gene is contained in a single haplotype block of 14 kb. Haplotype association analysis with T2DM did not reveal any significant differences between haplotype frequencies in T2DM cases and controls. Conclusion From our findings, we can conclude that sequence variants in or near GLUT10 are unlikely to contribute significantly to T2DM in Caucasian Americans.

  15. Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

    Science.gov (United States)

    Lean, Choo Bee; Lee, Edmund Jon Deoon

    2009-01-01

    MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

  16. Intramolecular cross-linking in a bacterial homolog of mammalian SLC6 neurotransmitter transporters suggests an evolutionary conserved role of transmembrane segments 7 and 8

    DEFF Research Database (Denmark)

    Kniazeff, Julie; Loland, Claus Juul; Goldberg, Naomi

    2005-01-01

    The extracellular concentration of the neurotransmitters dopamine, serotonin, norepinephrine, GABA and glycine is tightly controlled by plasma membrane transporters belonging to the SLC6 gene family. A very large number of putative transport proteins with a remarkable homology to the SLC6...... proximity between TM 7 and 8 in the tertiary structure of TnaT as previously suggested for the mammalian counterparts. Furthermore, the inhibition of uptake upon cross-linking the two cysteines provides indirect support for a conserved conformational role of these transmembrane domains in the transport...

  17. Dicty_cDB: SLC481 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

  18. Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration

    Science.gov (United States)

    Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.

    2012-01-01

    Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

  19. Dicty_cDB: SLC424 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

  20. Dicty_cDB: SLC411 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

  1. Deletion of the betaine-GABA transporter (BGT1; slc6a12) gene does not affect seizure thresholds of adult mice

    DEFF Research Database (Denmark)

    Lehre, A C; Rowley, N M; Zhou, Y

    2011-01-01

    of the GAT1 by the clinically available anti-epileptic drug tiagabine has been an effective strategy for the treatment of some patients with partial seizures. Recently, the investigational drug EF1502, which inhibits both GAT1 and BGT1, was found to exert an anti-convulsant action synergistic...... to that of tiagabine, supposedly due to inhibition of BGT1. The present study addresses the role of BGT1 in seizure control and the effect of EF1502 by developing and exploring a new mouse line lacking exons 3-5 of the BGT1 (slc6a12) gene. The deletion of this sequence abolishes the expression of BGT1 mRNA. However......, homozygous BGT1-deficient mice have normal development and show seizure susceptibility indistinguishable from that in wild-type mice in a variety of seizure threshold models including: corneal kindling, the minimal clonic and minimal tonic extension seizure threshold tests, the 6Hz seizure threshold test...

  2. Dicty_cDB: SLC420 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

  3. The gene expression of the neuronal protein, SLC38A9, changes in mouse brain after in vivo starvation and high-fat diet.

    Directory of Open Access Journals (Sweden)

    Sofie V Hellsten

    Full Text Available SLC38A9 is characterized as a lysosomal component of the amino acid sensing Ragulator-RAG GTPase complex, controlling the mechanistic target of rapamycin complex 1 (mTORC1. Here, immunohistochemistry was used to map SLC38A9 in mouse brain and staining was detected throughout the brain, in cortex, hypothalamus, thalamus, hippocampus, brainstem and cerebellum. More specifically, immunostaining was found in areas known to be involved in amino acid sensing and signaling pathways e.g. piriform cortex and hypothalamus. SLC38A9 immunoreactivity co-localized with both GABAergic and glutamatergic neurons, but not with astrocytes. SLC38A9 play a key role in the mTORC1 pathway, and therefore we performed in vivo starvation and high-fat diet studies, to measure gene expression alterations in specific brain tissues and in larger brain regions. Following starvation, Slc38a9 was upregulated in brainstem and cortex, and in anterior parts of the brain (Bregma 3.2 to -2.1mm. After high-fat diet, Slc38a9 was specifically upregulated in hypothalamus, while overall downregulation was noticed throughout the brain (Bregma 3.2 to -8.6mm.

  4. Dicty_cDB: SLC409 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

  5. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  6. Dicty_cDB: SLC413 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

  7. Association between a genetic variant in the serotonin transporter gene (SLC6A4) and suicidal behavior in patients with schizophrenia

    DEFF Research Database (Denmark)

    Lindholm Carlstrom, Eva; Saetre, Peter; Rosengren, Anders

    2012-01-01

    ABSTRACT: BACKGROUND: The serotonin (5-hydroxytryptamin; 5-HT) system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT) is associated with schizophrenia and suicidal behavior. ...

  8. Association of serotonin transporter (SLC6A4 & receptor (5HTR1A, 5HTR2A polymorphisms with response to treatment with escitalopram in patients with major depressive disorder : A preliminary study

    Directory of Open Access Journals (Sweden)

    Aniruddha Basu

    2015-01-01

    Full Text Available Background & objectives: Genetic factors have potential of predicting response to antidepressants in patients with major depressive disorder (MDD. In this study, an attempt was made to find an association between response to escitalopram in patients with MDD, and serotonin transporter (SLC6A4 and receptor (5HTR1A, 5HTR2A polymorphisms. Methods: Fifty five patients diagnosed as suffering from MDD, were selected for the study. The patients were treated with escitalopram over a period of 6-8 wk. Severity of depression, response to treatment and side effects were assessed using standardised instruments. Genetic variations from HTR1A (rs6295, HTR2A (rs6311 and rs6313 and SLC6A4 (44 base-pair insertion/deletion at 5-HTTLPR were genotyped. The genetic data of the responders and non-responders were compared to assess the role of genetic variants in therapeutic outcome. Results: Thirty six (65.5% patients responded to treatment, and 19 (34.5% had complete remission. No association was observed for genotype and allelic frequencies of single nucleotide polymorphisms (SNPs among remitter/non-remitter and responder/non-responder groups, and six most common side-effects, except memory loss which was significantly associated with rs6311 ( p0 =0.03. Interpretation & conclusions: No significant association was found between the SNPs analysed and response to escitalopram in patients with MDD though a significant association was seen between the side effect of memory loss and rs6311. Studies with larger sample are required to find out genetic basis of antidepressant response in Indian patients.

  9. Dicty_cDB: SLC404 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

  10. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    Science.gov (United States)

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905

  11. Dicty_cDB: SLC492 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

  12. Dicty_cDB: SLC432 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

  13. Dicty_cDB: SLC402 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

  14. Congenital Chloride-Losing Diarrhea in a Mexican child with the novel homozygous SLC26A3 mutation G393W

    Directory of Open Access Journals (Sweden)

    Fabian R. Reimold

    2015-06-01

    Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.

  15. Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) ortholog in the marine skate Leucoraja erinacea is not a physiological bile salt transporter.

    Science.gov (United States)

    Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying

    2017-04-01

    The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.

  16. Dicty_cDB: SLC418 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

  17. The mammalian phosphate carrier SLC25A3 is a mitochondrial copper transporter required for cytochrome c oxidase biogenesis.

    Science.gov (United States)

    Boulet, Aren; Vest, Katherine E; Maynard, Margaret K; Gammon, Micah G; Russell, Antoinette C; Mathews, Alexander T; Cole, Shelbie E; Zhu, Xinyu; Phillips, Casey B; Kwong, Jennifer Q; Dodani, Sheel C; Leary, Scot C; Cobine, Paul A

    2018-02-09

    Copper is required for the activity of cytochrome c oxidase (COX), the terminal electron-accepting complex of the mitochondrial respiratory chain. The likely source of copper used for COX biogenesis is a labile pool found in the mitochondrial matrix. In mammals, the proteins that transport copper across the inner mitochondrial membrane remain unknown. We previously reported that the mitochondrial carrier family protein Pic2 in budding yeast is a copper importer. The closest Pic2 ortholog in mammalian cells is the mitochondrial phosphate carrier SLC25A3. Here, to investigate whether SLC25A3 also transports copper, we manipulated its expression in several murine and human cell lines. SLC25A3 knockdown or deletion consistently resulted in an isolated COX deficiency in these cells, and copper addition to the culture medium suppressed these biochemical defects. Consistent with a conserved role for SLC25A3 in copper transport, its heterologous expression in yeast complemented copper-specific defects observed upon deletion of PIC2 Additionally, assays in Lactococcus lactis and in reconstituted liposomes directly demonstrated that SLC25A3 functions as a copper transporter. Taken together, these data indicate that SLC25A3 can transport copper both in vitro and in vivo . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Dicty_cDB: SLC415 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

  19. Dicty_cDB: SLC407 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

  20. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Association analysis between a VNTR intron 8 polymorphism of the dopamine transporter gene (SLC6A3 and obsessive- compulsive disorder in a Brazilian sample Análise de associação entre um polimorfismo VNTR no intron 8 do gene do transportador de dopamina (SLC6A3 e transtorno obsessivo-compulsivo em uma amostra brasileira

    Directory of Open Access Journals (Sweden)

    Karen Miguita

    2007-12-01

    Full Text Available Family, twin and segregation analysis have provided evidences that genetic factors are implicated in the susceptibility for obsessive-compulsive disorder (OCD. Several lines of research suggest that the dopaminergic system may be involved in the pathophysiology of OCD. Thus, the aim of the present study was to investigate a possible association between a polymorphism located in intron 8 of the dopamine transporter gene (SLC6A3 and OCD in a Brazilian sample composed by 208 patients and 865 healthy controls. No statistically differences were observed in allelic and genotype distributions between cases and controls. No association was also observed when the sample was divided according to specific phenotypic features such as gender, presence of tic disorders co-morbidity and age at onset of obsessive-compulsive symptoms (OCS. Our results suggest that the intron 8 VNTR of the SLC6A3 investigated in this study is not related to the susceptibility for OCD in our Brazilian sample.Estudos de família, gêmeos e de segregação têm demonstrado que fatores genéticos estão envolvidos na susceptibilidade para o desenvolvimento do transtorno obsessivo-compulsivo (TOC. Várias linhas de pesquisa sugerem que o sistema dopaminérgico possa estar envolvido na fisiopatologia do TOC. Assim, o objetivo do presente estudo foi investigar uma possível associação entre o polimorfismo localizado no intron 8 do gene do transportador da dopamina (SLC6A3 e o TOC em uma amostra brasileira composta por 208 pacientes e 865 controles sadios. Nenhuma diferença estatisticamente significante foi observada nas distribuições alélicas e genotípicas entre os grupos de pacientes e controles. Nenhuma associação também foi observada quando as amostras foram divididas de acordo com características fenotípicas específicas, tais como gênero, presença de co-morbidade com tiques e idade de início dos sintomas obsessivo-compulsivo (SOC. Nossos resultados sugerem que o VNTR

  2. Dicty_cDB: SLC451 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

  3. Effects of dopamine D2 receptor (DRD2) and transporter (SLC6A3) polymorphisms on smoking cue-induced cigarette craving among African-American smokers.

    Science.gov (United States)

    Erblich, J; Lerman, C; Self, D W; Diaz, G A; Bovbjerg, D H

    2005-04-01

    Cue-induced craving for addictive substances has long been known to contribute to the problem of persistent addiction in humans. Research in animals over the past decade has solidly established the central role of dopamine in cue-induced craving for addictive substances, including nicotine. Analogous studies in humans, however, are lacking, especially among African-American smokers, who have lower quit rates than Caucasian smokers. Based on the animal literature, the study's objective was to test the hypothesis that smokers carrying specific variants in dopamine-related genes previously associated with risk for addictive behaviors would exhibit heightened levels of cigarette craving following laboratory exposure to cues. To this end, cigarette craving was induced in healthy African-American smokers (n=88) through laboratory exposure to smoking cues. Smokers carrying either the DRD2 (D2 dopamine receptor gene) TaqI A1 RFLP or the SLC6A3 (dopamine transporter gene) 9-repeat VNTR polymorphisms had stronger cue-induced cravings than noncarriers (Ps cue-induced craving in humans, and suggest a possible genetic risk factor for persistent smoking behavior in African-American smokers.

  4. Dicty_cDB: SLC435 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

  5. Significance of downregulation of renal organic cation transporter (SLC47A1 in cisplatin-induced proximal tubular injury

    Directory of Open Access Journals (Sweden)

    Mizuno T

    2015-07-01

    Full Text Available Tomohiro Mizuno,13 Waichi Sato,2,3 Kazuhiro Ishikawa,4 Yuki Terao,1 Kazuo Takahashi,2 Yukihiro Noda,5 Yukio Yuzawa,2 Tadashi Nagamatsu1 1Department of Analytical Pharmacology, Meijo University Faculty of Pharmacy, Nagoya, 2Department of Nephrology, School of Medicine, Fujita Health University, Toyoake, 3Department of Nephrology, Nagoya University School of Medicine, Nagoya, 4Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya, 5Division of Clinical Sciences and Neuropsychopharmacology, Meijo University Faculty of Pharmacy, Nagoya, Japan Background/aim: To elucidate the mechanism responsible for developing acute kidney injury in patients with diabetes mellitus, we also evaluated the issue of whether advanced glycation endproducts (AGEs influence the expressions of multi antimicrobial extrusion protein (MATE1/SLC47A1 in tubular cells. Materials and methods: To detect changing expression of MATE1/SLC47A1 in dose- and time-dependent manners, human proximal tubular epithelial cells were incubated with AGE-aggregated-human serum albumin. As a function assay for MATE1/SLC47A1, human proximal tubular epithelial cells were incubated with cisplatin or carboplatin. Results: On incubation with AGEs, the expressions of MATE1/SLC47A1 were decreased in tubular cells. In addition, the toxicities of cisplatin were increased in tubular cells that had been pretreated with AGEs. However, the toxicities of carboplatin were smaller than that of cisplatin in proximal tubular epithelial cells. Conclusion: The expression of the MATE1/SLC47A1 is decreased by AGEs, which increases the risk for proximal tubular injury. Keywords: advanced glycation endproducts, cisplatin, SLC47A1, diabetes mellitus, acute kidney injury

  6. Serotonin Transporter Gene ("SLC6A4") Methylation Associates with Neonatal Intensive Care Unit Stay and 3-month-old Temperament in Preterm Infants

    Science.gov (United States)

    Montirosso, Rosario; Provenzi, Livio; Fumagalli, Monica; Sirgiovanni, Ida; Giorda, Roberto; Pozzoli, Uberto; Beri, Silvana; Menozzi, Giorgia; Tronick, Ed; Morandi, Francesco; Mosca, Fabio; Borgatti, Renato

    2016-01-01

    Preterm birth and Neonatal Intensive Care Unit (NICU) stay are early adverse stressful experiences, which may result in an altered temperamental profile. The serotonin transporter gene ("SLC6A4"), which has been linked to infant temperament, is susceptible to epigenetic regulation associated with early stressful experience. This study…

  7. Response to crizotinib in a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant

    Science.gov (United States)

    Zhao, Zheng; Song, Zhangjun; Wang, Xuwei; Sun, Haifeng; Yang, Xiaomin; Yuan, Yong; Yu, Pan

    2017-01-01

    ROS1 fusion is a common genetic alteration in non-small-cell lung cancer. Crizotinib, an anaplastic lymphoma kinase inhibitor, shows efficacy in the treatment of lung cancer cases with ROS1 translocation. We report the response to crizotinib of a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant, which was different from the two common SLC34A2-ROS1 fusion types reported in the literature. After crizotinib administration, overall recovery was good in this patient; the primary lesion was successfully treated, the lymph node metastases had disappeared, and the metabolism was normal. PMID:28860822

  8. Dicty_cDB: SLC485 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

  9. Dicty_cDB: SLC431 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

  10. Dicty_cDB: SLC465 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

  11. Dicty_cDB: SLC426 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

  12. Wire breakage in SLC wire profile monitors

    International Nuclear Information System (INIS)

    Field, C.; McCormick, D.; Raimondi, P.; Ross, M.

    1998-05-01

    Wire scanning beam profile monitors are used at the Stanford Linear Collider (SLC) for emittance preservation control and beam optics optimization. Twenty such scanners have proven most useful for this purpose and have performed a total of 1.5 million scans in the 4 to 6 years since their installation. Most of the essential scanners are equipped with 20 to 40 microm tungsten wires. SLC bunch intensities and sizes often exceed 2 x 10 7 particles/microm 2 (3C/m 2 ). The authors believe that this has caused a number of tungsten wire failures that appear at the ends of the wire, near the wire support points, after a few hundred scans are accumulated. Carbon fibers, also widely used at SLAC, have been substituted in several scanners and have performed well. In this paper, the authors present theories for the wire failure mechanism and techniques learned in reducing the failures

  13. Dicty_cDB: SLC440 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

  14. Dicty_cDB: SLC437 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

  15. Dicty_cDB: SLC443 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

  16. Dicty_cDB: SLC429 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

  17. Dicty_cDB: SLC428 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

  18. Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome.

    Science.gov (United States)

    Haack, Tobias B; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M; Meitinger, Thomas; Yonezawa, Atsushi; Prokisch, Holger

    2012-11-01

    Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin transporter 3 (hRFT3), another member of the riboflavin transporter family, is also associated with BVVLS. Overexpression studies confirmed that the gene products of both mutant alleles have reduced riboflavin transport activities. While mutations in SLC52A3 cause decreased plasma riboflavin levels, concordant with a role of SLC52A3 in riboflavin uptake from food, the SLC52A2-mutant individual had normal plasma riboflavin concentrations, a finding in line with a postulated function of SLC52A2 in riboflavin uptake from blood into target cells. Our results contribute to the understanding of human riboflavin metabolism and underscore its role in the pathogenesis of BVVLS, thereby providing a rational basis for a high-dose riboflavin treatment.

  19. Dicty_cDB: SLC495 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

  20. Morphological study on dental caries induced in WBN/KobSlc rats (Rattus norvegicus) fed a standard laboratory diet.

    Science.gov (United States)

    Fukuzato, Yoko; Matsuura, Tetsuro; Ozaki, Kiyokazu; Matsuura, Masahiro; Sano, Tomoya; Nakahara, Yutaka; Kodama, Yasushi; Nakagawa, Akihito; Okamura, Sumie; Suido, Hirohisa; Torii, Kayo; Makino, Taketoshi; Narama, Isao

    2009-10-01

    In our previous studies, WBN/KobSlc was characterized as a rat strain in which only males began to develop pancreatitis, and then presented with diabetic symptoms. In the course of studying their pancreatic inflammation, we detected molar caries in prediabetic males feeding on a standard diet (CRF-1) widely used for experimental animals. The purpose of this study is to confirm whether the WBN/KobSlc strain is caries-susceptible to the diet reported to be non-cariogenic, and to examine the effect of a prediabetic condition on their dental caries. For a morphological study, 25 male WBN/KobSlc rats aged 3.2-7.8 months and 24 females of the same strain aged 3.3-6.6 months were used, along with 10 males and 10 females of 8.2-month-old F344 rats. Marked dental caries were detected in the mandibular molars of male and female WBN/KobSlc rats regardless of pancreatitis, although no similar changes were observed in any teeth of the F344 strain fed the same diet. Soft X-ray examination revealed that the caries began in the crown and progressed horizontally and vertically, and that a severe radiolucent lesion extensively expanded to the entire crown, corresponding to a macroscopically deleted molar. The caries had gradually developed mainly in the second mandibular molar from more than 3.5 months of age, while none were seen in any rats before that time. The WBN/KobSlc rats were caries-susceptible even to the standard laboratory diet, and pancreatitis was not directly associated with the onset of dental caries in this strain.

  1. Dicty_cDB: SLC458 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

  2. Dicty_cDB: SLC474 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

  3. Dicty_cDB: SLC425 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

  4. Prenatal serotonin reuptake inhibitor (SRI antidepressant exposure and serotonin transporter promoter genotype (SLC6A4 influence executive functions at 6 years of age

    Directory of Open Access Journals (Sweden)

    Whitney eWeikum

    2013-10-01

    Full Text Available Prenatal exposure to serotonin reuptake inhibitor (SRI antidepressants and maternal depression may affect prefrontal cognitive skills (executive functions; EFs including self-control, working memory and cognitive flexibility. We examined long-term effects of prenatal SRI exposure on EFs to determine whether effects are moderated by maternal mood and/or genetic variations in SLC6A4 (a gene that codes for the serotonin transporter [5-HTT] central to the regulation of synaptic serotonin levels and behavior. Children who were exposed to SRIs prenatally (SRI-exposed N=26 and non-exposed (N=38 were studied at age 6 years (M=6.3 SD=0.5 using the Hearts & Flowers task (H&F to assess EFs. Maternal mood was measured during pregnancy (3rd trimester and when the child was age 6 years (Hamilton Depression Scale. Parent reports of child behavior were also obtained (MacArthur Health & Behavior Questionnaire. Parents of prenatally SRI-exposed children reported fewer child externalizing and inattentive (ADHD behaviors. Generalized estimate equation modeling showed a significant 3-way interaction between prenatal SRI exposure, SLC6A4 variant, and maternal mood at the 6-year time-point on H&F accuracy. For prenatally SRI-exposed children, regardless of maternal mood, the H&F accuracy of children with reduced 5HTT expression (a short [S] allele remained stable. Even with increasing maternal depressive symptoms (though all below clinical threshold, EFs of children with at least one short allele were comparable to children with the same genotype whose mothers reported few if any depressive symptoms – in this sense they showed resilience. Children with two long (L alleles were more sensitive to context. When their mothers had few depressive symptoms, LL children showed extremely good EF performance – better than any other group. When their mothers reported more depressive symptoms, LL children’s EF performance was worse than that of any other group.

  5. Identification of E6-generated Z' from combined CHARM II, LEP 1, SLC high-precision measurements

    International Nuclear Information System (INIS)

    Lynn, B.W.; Renard, F.M.; Verzegnassi, C.

    1988-01-01

    We show that a combined analysis of three specific longitudinal polarization asymmetries in electron-positron annihilation on Z 0 resonance, of the mass ratio M w /M z and of the neutrino-electron neutral cross-section ratio, which could be measured in the near future at SLC, LEP, ACOL and CHARM II, would lead to a well-defined identification of a single new E 6 -generated Z'. In particular, it might be possible to disentangle a superstring-inspired model from other currently considered possibilities down to values of the mixing angle vertical strokeθ η vertical stroke = 0.02 and, at the same time, to fix the mass ratio ε = M Z 2 /Msub(Z') 2 with known accuracy. (orig.)

  6. Dicty_cDB: SLC434 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

  7. Dicty_cDB: SLC450 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

  8. Dicty_cDB: SLC469 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

  9. Dicty_cDB: SLC452 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

  10. Inorganic phosphorus (Pi) in CSF is a biomarker for SLC20A2-associated idiopathic basal ganglia calcification (IBGC1).

    Science.gov (United States)

    Hozumi, Isao; Kurita, Hisaka; Ozawa, Kazuhiro; Furuta, Nobuyuki; Inden, Masatoshi; Sekine, Shin-Ichiro; Yamada, Megumi; Hayashi, Yuichi; Kimura, Akio; Inuzuka, Takashi; Seishima, Mitsuru

    2018-05-15

    Idiopathic basal ganglia calcification (IBGC), also called Fahr's disease or recently primary familial brain calcification (PFBC), is characterized by abnormal deposits of minerals including calcium mainly and phosphate in the brain. Mutations in SLC20A2 (IBGC1 (merged with former IBGC2 and IBGC3)), which encodes PiT-2, a phosphate transporter, is the major cause of IBGC. Recently, Slc20a2-KO mice have been showed to have elevated levels of inorganic phosphorus (Pi) in cerebrospinal fluid (CSF); however, CSF Pi levels in patients with IBGC have not been fully examined. We investigated the cases of 29 patients with IBGC including six patients with SLC20A2 mutation and three patients with PDGFB mutation, and 13 controls. The levels of sodium (Na), potassium (K), chloride (Cl), calcium (Ca), and Pi in sera and CSF were determined by potentiometry and colorimetry. Moreover, clinical manifestations were investigated in the IBGC patients with high Pi levels in CSF. The study revealed that the average level of Pi in the CSF of the total group of patients with IBGC is significantly higher than that of the control group, and the levels of Pi in CSF of the IBGC patients with SLC20A2 mutations are significantly higher than those of the IBGC patients with PDGFB mutations, the other IBGC patients and controls. Results of this study suggest that the levels of CSF Pi will be a good biomarker for IBGC1. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. SLC energy spectrum monitor using synchrotron radiation

    International Nuclear Information System (INIS)

    Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.

    1986-04-01

    The SLAC Linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved Linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. the energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC Linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08%. The design considerations of this monitor are presented in this paper. A pair of these monitors is under construction with an installation date set for late summer 1986. 5 refs., 6 figs

  12. Transport by SLC5A8 with subsequent inhibition of histone deacetylase 1 (HDAC1) and HDAC3 underlies the antitumor activity of 3-bromopyruvate.

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel

    2009-10-15

    3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.

  13. Dicty_cDB: SLC464 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

  14. Dicty_cDB: SLC477 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

  15. Dicty_cDB: SLC478 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

  16. Dicty_cDB: SLC448 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  17. Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

    Science.gov (United States)

    Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

    2013-01-01

    To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

  18. A Combined Study of SLC6A15 Gene Polymorphism and the Resting-State Functional Magnetic Resonance Imaging in First-Episode Drug-Naive Major Depressive Disorder.

    Science.gov (United States)

    Wang, Lijuan; Liu, Zhifen; Cao, Xiaohua; Li, Jianying; Zhang, Aixia; Sun, Ning; Yang, Chunxia; Zhang, Kerang

    2017-09-01

    The SLC6A15 gene has been identified as a novel candidate gene for major depressive disorder (MDD). However, the mechanism underlying the effects of how the SLC6A15 gene affects functional brain activity of patients with MDD remains unknown. In the present study, we investigated the effect of the SLC6A15 gene polymorphism, rs1545843, on resting-state brain function in MDD with the imaging genomic technology and the regional homogeneity (ReHo) method. Sixty-seven MDD patients and 44 healthy controls underwent functional magnetic resonance imaging scans and genotyping. The differences in ReHo between genotypes were initially tested using the student's t test. We then performed a 2 × 2 (genotypes × disease status) analysis of variance to identify the main effects of genotypes, disease status, and their interactions in MDD. MDD patients with A+ genotypes showed decreased ReHo in the medial cingulum compared with MDD patients with the GG genotype. This was in contrast to normal controls with A+ genotypes who showed increased ReHo in the posterior cingulum and the frontal, temporal, and parietal lobes and decreased ReHo in the left corpus callosum, compared with controls with the GG genotypes. The main effect of disease was found in the frontal, parietal, and temporal lobes. The main effect of genotypes was found in the left corpus callosum and the frontal lobe. There was no interaction between rs1545843 genotypes and disease status. We found that the left corpus callosum ReHo was positively correlated with total scores of the Hamilton Depression Scale (HAMD) (p = 0.021), so as was the left inferior parietal gyrus ReHo with cognitive disorder (p = 0.02). In addition, the right middle temporal gyrus had a negative correlation with retardation (p = 0.049). We observed an association between the SLC6A15 rs1545843 and resting-state brain function of the corpus callosum, cingulum and the frontal, parietal, and temporal lobes in MDD patients, which may be

  19. Dicty_cDB: SLC438 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

  20. Dicty_cDB: SLC444 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

  1. Dicty_cDB: SLC490 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

  2. Dicty_cDB: SLC484 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  3. S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model

    Directory of Open Access Journals (Sweden)

    Pingting Liu

    2017-01-01

    Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.

  4. Feedback systems in the SLC

    International Nuclear Information System (INIS)

    Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.

    1987-02-01

    Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed

  5. Transcript levels of members of the SLC2 and SLC5 families of glucose transport proteins in eel swimbladder tissue: the influence of silvering and the influence of a nematode infection.

    Science.gov (United States)

    Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd

    2018-04-01

    The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.

  6. Identification of seven novel mutations including the first two genomic rearrangements in SLC26A3 mutated in congenital chloride diarrhea.

    Science.gov (United States)

    Höglund, P; Sormaala, M; Haila, S; Socha, J; Rajaram, U; Scheurlen, W; Sinaasappel, M; de Jonge, H; Holmberg, C; Yoshikawa, H; Kere, J

    2001-09-01

    Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by defective intestinal electrolyte absorption, resulting in voluminous osmotic diarrhea with high chloride content. A variety of mutations in the solute carrier family 26, member 3 gene (SLC26A3, previously known as CLD or DRA) are responsible for the disease. Since the identification of the SLC26A3 gene and the determination of its genomic structure, altogether three founder and 17 private mutations have been characterized within miscellaneous ethnic groups. We screened for mutations in seven unrelated families with CLD. The diagnoses were confirmed by fecal chloride measurements. The combined PCR-SSCP and sequencing analyses revealed altogether seven novel mutations including two missense mutations (S206P, D468V), two splicing defects (IVS12-1G>C, IVS13-2delA), one nonsense mutation (Q436X), one insertion/deletion mutation (2104-2105delGGins29-bp), and an intragenic deletion of SLC26A3 exons 7 and 8. Two previously identified mutations were also found. This is the first report of rearrangement mutations in SLC26A3. Molecular features predisposing SLC26A3 for the two rearrangements may include repetitive elements and palindromic-like sequences. The increasingly wide diversity of SLC26A3 mutations suggests that mutations in the SLC26A3 gene may not be rare events. Copyright 2001 Wiley-Liss, Inc.

  7. Urine screening for patients with developmental disabilities detected a patient with creatine transporter deficiency due to a novel missense mutation in SLC6A8.

    Science.gov (United States)

    Kato, Hidekazu; Miyake, Fuyu; Shimbo, Hiroko; Ohya, Makoto; Sugawara, Hidenori; Aida, Noriko; Anzai, Rie; Takagi, Mariko; Okuda, Mitsuko; Takano, Kyoko; Wada, Takahito; Iai, Mizue; Yamashita, Sumimasa; Osaka, Hitoshi

    2014-08-01

    Creatine transporter deficiency (CTD) is an example of X-linked intellectual disability syndromes, caused by mutations in SLC6A8 on Xq28. Although this is the second most frequent genetic cause of intellectual disabilities in Europe or America after Fragile X syndrome, information on the morbidity of this disease is limited in Japan. Using the HPLC screening method we have established recently, we examined samples of urine of 105 patients (73 males and 32 females) with developmental disabilities at our medical center. And we have found a family with three ID boys with a novel missense mutation in SLC6A8. This is the second report of a Japanese family case of CTD. A systematic diagnostic system of this syndrome should be established in Japan to enable us to estimate its frequency and treatment. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  8. Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

    Science.gov (United States)

    Rao, Suryadevara S; Hildebrand, David

    2009-10-01

    The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

  9. SLC2A9 and ZNF518B polymorphisms correlate with gout-related metabolic indices in Chinese Tibetan populations.

    Science.gov (United States)

    Zhang, X Y; Geng, T T; Liu, L J; Yuan, D Y; Feng, T; Kang, L L; Jin, T B; Chen, C

    2015-08-19

    Current evidence suggests that heredity and metabolic syndrome contribute to gout progression. SLC2A9 and ZNF518B may play a role in gout progression in different populations, but no studies have focused on the Tibetan Chinese population. In this study, we determined whether variations in these 2 genes were correlated with gout-related indices in Chinese-Tibetan gout patients. We detected 6 single nucleotide polymorphisms in SLC2A9 and ZNF518B in 319 Chinese Tibetan gout patients. One-way analysis of variance was used to evaluate the polymorphisms' effects on gout based on mean serum levels of metabolism indicators. Polymorphisms in SLC2A9 and ZNF518B affected multiple risk factors related to gout development. Significant differences in serum triglyceride levels and high-density lipoprotein-cholesterol level were detected between different genotypic groups with SLC2A9 polymorphisms rs13129697 (P = 0.022), rs4447863 (P = 0.018), and rs1014290 (P = 0.045). Similarly in ZNF518B, rs3217 (P = 0.016) and rs10016022 (P = 0.046) were associated with high creatinine and glucose levels, respectively. This study is the first to investigate and identify positive correlations between SLC2A9 and ZNF518B gene polymorphisms and metabolic indices in Tibetan gout patients. We found significant evidence indicating that genetic polymorphisms affect gout-related factors in Chinese Tibetan populations.

  10. Diversity in the glucose transporter-4 gene (SLC2A4 in humans reflects the action of natural selection along the old-world primates evolution.

    Directory of Open Access Journals (Sweden)

    Eduardo Tarazona-Santos

    Full Text Available BACKGROUND: Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs. Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13 is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. METHODOLOGY/PRINCIPAL FINDINGS: We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American, all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp, while the C-terminal region downstream of intron 6 ( approximately 2600 bp harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1 episodes of natural selection (likely a selective sweep predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2 the target of natural selection may not be in the SLC2A4 coding sequence. CONCLUSIONS: We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.

  11. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    OpenAIRE

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine cal...

  12. Effect of SLC34A2 gene mutation on extracellular phosphorus transport in PAM alveolar epithelial cells.

    Science.gov (United States)

    Ma, Tiangang; Qu, Danhua; Yan, Bingdi; Zhang, Qinghua; Ren, Jin; Hu, Yanbing

    2018-01-01

    A mutation in the IIb sodium phosphate transporter SLC34A2 gene has recently been described in pulmonary alveolar microlithiasis (PAM) patients. Experiments in this study were aimed at confirming the role of the gene product in PAM by comparing phosphorylated products in extracellular fluid of alveolar epithelial cells overexpressing the SLC34A2 gene or its mutated version. Eukaryotic expression vectors were constructed and transfected into A549 human alveolar epithelial cells. There were three groups of cells including those transfected with empty vector plasmid pcDNA3.1(+) (plasmid control group), those transfected with normal SLC34A2 gene expressed from pcDNA3.1 (normal control group), and those transfected with a version of the PAM SLC34A2 gene linked to the pcDNA3.1(+) (PAM group). Transfection efficiencies were detected by reverse transcription-polymerase chain reaction (RT-PCR). At 48 h after transfection, the concentration of inorganic phosphorus in the culture medium was detected using an automatic biochemical analyzer. Our results showed the concentration of inorganic phosphorus in the supernatant of the normal control group was significantly lower than that in the plasmid control and PAM groups (PPAM group was significantly lower than that in the plasmid control group (PPAM patients, given that the function of the phosphate transporter seems to be affected and it is conceivable that it would lead to extracellular fluid alterations in vivo .

  13. Determining mutations in G6PC and SLC37A4 genes in a sample of Brazilian patients with glycogen storage disease types Ia and Ib

    Directory of Open Access Journals (Sweden)

    Marcelo Paschoalete Carlin

    2013-01-01

    Full Text Available Glycogen storage disease (GSD comprises a group of autosomal recessive disorders characterized by deficiency of the enzymes that regulate the synthesis or degradation of glycogen. Types Ia and Ib are the most prevalent; while the former is caused by deficiency of glucose-6-phosphatase (G6Pase, the latter is associated with impaired glucose-6-phosphate transporter, where the catalytic unit of G6Pase is located. Over 85 mutations have been reported since the cloning of G6PC and SLC37A4 genes. In this study, twelve unrelated patients with clinical symptoms suggestive of GSDIa and Ib were investigated by using genetic sequencing of G6PC and SLC37A4 genes, being three confirmed as having GSD Ia, and two with GSD Ib. In seven of these patients no mutations were detected in any of the genes. Five changes were detected in G6PC, including three known point mutations (p.G68R, p.R83C and p.Q347X and two neutral mutations (c.432G > A and c.1176T > C. Four changes were found in SLC37A4: a known point mutation (p.G149E, a novel frameshift insertion (c.1338_1339insT, and two neutral mutations (c.1287G > A and c.1076-28C > T. The frequency of mutations in our population was similar to that observed in the literature, in which the mutation p.R83C is also the most frequent one. Analysis of both genes should be considered in the investigation of this condition. An alternative explanation to the negative results in this molecular study is the possibility of a misdiagnosis. Even with a careful evaluation based on laboratory and clinical findings, overlap with other types of GSD is possible, and further molecular studies should be indicated.

  14. Transport via SLC5A8 with Subsequent Inhibition of Histone Deacetylases HDAC1 and HDAC3 Underlies the Antitumor Activity of 3-Bromopyruvate

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel

    2009-01-01

    Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353

  15. Measurement of electron beam polarization at the SLC

    International Nuclear Information System (INIS)

    Steiner, H.; California Univ., Berkeley

    1988-01-01

    One of the unique features of the SLC is its capability to accelerate longitudinally polarized electrons. The SLC polarization group has been performed to implement the polarization program at the SLC. Technically the polarization project consists of three main parts: (1) a polarized source, (2) spin-rotating superconducting solenoid magnets to be used to manipulate the direction of the electron spin, and (3) the polarimeters needed to monitor and measure the electron beam polarization. It is this last topic that will concern us here. Two types of polarimeters will be used - Compton and Moeller. (orig./HSI)

  16. Function and expression of the proton-coupled amino acid transporter Slc36a1 along the rat gastrointestinal tract

    DEFF Research Database (Denmark)

    Broberg, M. L.; Holm, Rasmus Koldborg; Tønsberg, H

    2012-01-01

    BACKGROUND AND PURPOSE: Intestinal absorption via membrane transporters may determine the pharmacokinetics of drug compounds. The hypothesis is that oral absorption of gaboxadol (4, 5, 6, 7-tetrahydroisoxazolo [5,4-c] pyridine-3-ol) in rats occurs via the proton-coupled amino acid transporter, r....... The intestinal expression of rSlc36a1 mRNA was measured by quantitative real-time PCR (q-RT-PCR). Furthermore, the hPAT1-/rPAT1-mediated transport of gaboxadol or L-proline was studied in hPAT1-expressing X. laevis oocytes, Caco-2 cell monolayers and excised segments of the rat intestine. KEY RESULTS......). The in vitro carrier-mediated uptake rate of L-proline in the excised intestinal segments was highest in the mid jejunum and low in the colon. The in vitro uptake and the in vivo absorption correlated with the expression of rSlc36a1 mRNA along the rat intestine. CONCLUSIONS AND IMPLICATIONS: The results...

  17. Hypothesis: SLC12A3 Polymorphism modifies thiazide hypersensitivity of antenatal Bartter syndrome to thiazide resistance.

    Science.gov (United States)

    Mammen, Cherry; Rupps, Rosemarie; Trnka, Peter; Boerkoel, Cornelius F

    2012-02-01

    We report a 5-year-old boy with thiazide-resistant Bartter syndrome. This is highly unusual since thiazide hypersensitivity is a common diagnostic finding in Bartter syndrome patients. Subsequent molecular testing identified compound heterozygosity for two novel mutations in KCNJ1, (c.556A > G and c.683G > A) which is associated with Bartter syndrome, and a paternally inherited polymorphism in SLC12A3 (c.791G > C). Mutations in SLC12A3 cause the thiazide-resistant tubulopathy Gitelman syndrome. Based on published studies of this polymorphism in SLC12A3 and the features of the proband's father, we postulate that this polymorphism modifies the phenotype of Bartter syndrome in the proband to thiazide resistance. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  18. The role of SLC2A1 mutations in myoclonic astatic epilepsy and absence epilepsy, and the estimated frequency of GLUT1 deficiency syndrome

    DEFF Research Database (Denmark)

    Larsen, Jan; Johannesen, Katrine Marie; Ek, Jakob

    2015-01-01

    The first mutations identified in SLC2A1, encoding the glucose transporter type 1 (GLUT1) protein of the blood-brain barrier, were associated with severe epileptic encephalopathy. Recently, dominant SLC2A1 mutations were found in rare autosomal dominant families with various forms of epilepsy inc...

  19. A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

    Directory of Open Access Journals (Sweden)

    Paige A Winkler

    Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.

  20. Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families

    Directory of Open Access Journals (Sweden)

    Hemant Kulkarni

    2016-01-01

    Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.

  1. Common Genetic Variation and Haplotypes of the Anion Exchanger SLC4A2 in Primary Biliary Cirrhosis

    Science.gov (United States)

    Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Lazaridis, Konstantinos N.

    2010-01-01

    Objectives Deficiencies of the anion exchanger SLC4A2 are thought to play a pathogenic role in primary biliary cirrhosis (PBC), evidenced by decreased expression and activity in PBC patients and development of disease features in SLC4A2 knockout mice. We hypothesized that genetic variation in SLC4A2 might influence this pathogenic contribution. Thus, we aimed to perform a comprehensive assessment of SLC4A2 genetic variation in PBC using a linkage disequilibrium (LD)-based haplotype-tagging approach. Methods Twelve single nucleotide polymorphisms (SNPs) across SLC4A2 were genotyped in 409 PBC patients and 300 controls and evaluated for association with disease, as well as with prior orthotopic liver transplant and antimitochondrial antibody (AMA) status among the PBC patients, both individually and as inferred haplotypes, using logistic regression. Results All SNPs were in Hardy–Weinberg equilibrium. No associations with disease or liver transplantation were detected, but two variants, rs2303929 and rs3793336, were associated with negativity for antimitochondrial antibodies among the PBC patients. Conclusions The common genetic variation of SLC4A2 does not directly affect the risk of PBC or its clinical outcome. Whether the deficiency of SLC4A2 expression and activity observed earlier in PBC patients is an acquired epiphenomenon of underlying disease or is because of heritable factors in unappreciated regulatory regions remains uncertain. Of note, two SLC4A2 variants appear to influence AMA status among PBC patients. The mechanisms behind this finding are unclear. PMID:19491853

  2. Regulators of Slc4 bicarbonate transporter activity

    Directory of Open Access Journals (Sweden)

    Ian M. Thornell

    2015-06-01

    Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.

  3. Meta-Analysis Reveals Significant Association of the 3'-UTR VNTR in SLC6A3 with Alcohol Dependence.

    Science.gov (United States)

    Ma, Yunlong; Fan, Rongli; Li, Ming D

    2016-07-01

    Although many studies have analyzed the association of 3'-untranslated region variable-number tandem repeat (VNTR) polymorphism in SLC6A3 with alcohol dependence (AD), the results remain controversial. This study aimed to determine whether this variant indeed has any genetic effect on AD by integrating 17 reported studies with 5,929 participants included. The A9-dominant genetic model that considers A9-repeat and non-A9 repeat as 2 genotypes and compared their frequencies in alcoholics with that in controls was adopted. Considering the potential influence of ethnicity, differences in diagnostic criteria of AD, and alcoholic subgroups, stratified meta-analyses were conducted. There existed no evidence for the presence of heterogeneity among the studied samples, indicating the results under the fixed-effects model are acceptable. We found a significant association of VNTR A9 genotypes with AD in all ethnic populations (pooled odds ratio [OR] 1.12; 95% confidence interval [CI] 1.00, 1.25; p = 0.045) and the Caucasian population (pooled OR 1.15; 95% CI 1.01, 1.31; p = 0.036). We also found VNTR A9 genotypes to be significantly associated with alcoholism as defined by the DSM-IV criteria (pooled OR 1.18; 95% CI 1.03, 1.36; p = 0.02). Further, we found a significant association between VNTR A9 genotypes and alcoholism associated with alcohol withdrawal seizure or delirium tremens (pooled OR 1.55; 95% CI 1.24, 1.92; p = 1.0 × 10(-4) ). In all these meta-analyses, no evidence of publication bias was detected. We concluded that the VNTR polymorphism has an important role in the etiology of AD, and individuals with at least 1 A9 allele are more likely to be dependent on alcohol than persons carrying the non-A9 allele. Copyright © 2016 by the Research Society on Alcoholism.

  4. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  5. [Polymorphism in the Serotonin Transporter Gene (SLC6A4) and Emotional Bipolar Disorder in Two Regional Mental Health Centers from the Eje Cafetero (Colombia)].

    Science.gov (United States)

    Ramos, Lucero Rengifo; Arias, Duverney Gaviria; Salazar, Liliana Salazar; Vélez, Juan Pablo; Pardo, Stella Lozano

    2012-03-01

    The indel polymorphisms in the promoting region and the 2(nd) intron polymorphisms in the serotonin transporter gene (SLC6A4) have been associated to bipolar disorder 1 (BD1) in several population studies. The objective was to analyze the genotypic and allelic frequencies in both gene regions in a study of cases and controls with individuals from Risaralda and Quindío (Colombia) so as to establish possible associations to BD1, and compare results with previous and similar studies. 133 patients and 120 controls were studied. L and S indel polymorphisms in the promoting region were analyzed by PCR, together with VNTR STin2.10 and STin 2.12 VNTRs polymorphisms in the 2(nd) intron of the SL-C6A4 gene Genotypic and allelic frequencies for the S and L polymorphisms were similar both in cases and controls. However, the LL genotype was significantly increased both in BD1 population (OR=1.89; CI95%=1.1-3.68), and when discriminated by gender. This particular genotype in general population is OR=2.22; IC95%=1.04-5.66 for women, and OR=1.62; IC 95%=0.71-4.39 for men. No significant genotypic and allelic differences were found for VNTR STin2.10 and STin 2.12. polymorphisms. No association was found between polymorphisms of 5-HTTLPR polymorphisms and the 2(nd) intron of the serotonin transporting gene in general patients with BD1, nor when compared by gender. Our results are similar to those reported for Caucasian populations and differ from those of Asian and Brazilian populations. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  6. Family-Based Association Study Between SLC2A1, HK1, and LEPR Polymorphisms With Myelomeningocele in Chile

    Science.gov (United States)

    Suazo, José; Castillo, Silvia; Martin, Luz Maria; Rojas, Francisca; Santos, José Luis; Rotter, Karin; Solar, Margarita; Tapia, Eva

    2013-01-01

    Obese/diabetic mothers present a higher risk to develop offspring with myelomeningocele (MM), evidence supporting the role of energy homeostasis-related genes in neural tube defects. Using polymerase chain reaction–restriction fragment length polymorphism, we have genotyped SLC2A1, HK1, and LEPR single-nucleotide polymorphisms in 105 Chilean patients with MM and their parents in order to evaluate allele–phenotype associations by means of allele/haplotype transmission test (TDT) and parent-of-origin effects. We detected an undertransmission for the SLC2A1 haplotype T-A (rs710218-rs2229682; P = .040), which was not significant when only lower MM (90% of the cases) was analyzed. In addition, the leptin receptor rs1137100 G allele showed a significant increase in the risk of MM for maternal-derived alleles in the whole sample (2.43-fold; P = .038) and in lower MM (3.20-fold; P = .014). Our results support the role of genes involved in energy homeostasis in the risk of developing MM, thus sustaining the hypothesis of diverse pathways and genetic mechanisms acting in the expression of such birth defect. PMID:23427181

  7. Inhibition of intestinal bile acid transporter Slc10a2 improves triglyceride metabolism and normalizes elevated plasma glucose levels in mice.

    Directory of Open Access Journals (Sweden)

    Thomas Lundåsen

    Full Text Available Interruption of the enterohepatic circulation of bile acids increases cholesterol catabolism, thereby stimulating hepatic cholesterol synthesis from acetate. We hypothesized that such treatment should lower the hepatic acetate pool which may alter triglyceride and glucose metabolism. We explored this using mice deficient of the ileal sodium-dependent BA transporter (Slc10a2 and ob/ob mice treated with a specific inhibitor of Slc10a2. Plasma TG levels were reduced in Slc10a2-deficient mice, and when challenged with a sucrose-rich diet, they displayed a reduced response in hepatic TG production as observed from the mRNA levels of several key enzymes in fatty acid synthesis. This effect was paralleled by a diminished induction of mature sterol regulatory element-binding protein 1c (Srebp1c. Unexpectedly, the SR-diet induced intestinal fibroblast growth factor (FGF 15 mRNA and normalized bile acid synthesis in Slc10a2-/- mice. Pharmacologic inhibition of Slc10a2 in diabetic ob/ob mice reduced serum glucose, insulin and TGs, as well as hepatic mRNA levels of Srebp1c and its target genes. These responses are contrary to those reported following treatment of mice with a bile acid binding resin. Moreover, when key metabolic signal transduction pathways in the liver were investigated, those of Mek1/2-Erk1/2 and Akt were blunted after treatment of ob/ob mice with the Slc10a2 inhibitor. It is concluded that abrogation of Slc10a2 reduces hepatic Srebp1c activity and serum TGs, and in the diabetic ob/ob model it also reduces glucose and insulin levels. Hence, targeting of Slc10a2 may be a promising strategy to treat hypertriglyceridemia and diabetes.

  8. Distribution and expression of SLC45A2 in the skin of sheep with different coat colors.

    Science.gov (United States)

    Wang, Haidong; Xue, Linli; Li, Yanan; Zhao, Bingling; Chen, Tianzhi; Liu, Ying; Chang, Lucheng; Wang, Juan

    2016-01-01

    To investigate whether the membrane-associated transporter protein SLC45A2 is differentially expressed in the skin of sheep with different coat colors and to determine its correlation with coat color establishment in sheep. The expression of SLC45A2 in sheep skin samples with different coat colors was qualitatively and quantitatively analyzed by PCR amplification, RT-PCR, immunohistochemical staining and Western blotting. A 193-bp SLC45A2 CDS sequence was successfully amplified from sheep skin samples with diverse coat colors. RT-PCR analysis revealed that SLC45A2 mRNA was expressed in all sheep skin samples tested, with relative expression levels of 512.74 ± 121.51 in black skin, 143.38 ± 119.31 and 1.36 ± 0.09 in black dots and white dots of piebald skin, respectively, and 1.02 ± 0.23 in white skin (p coat colors. These patterns were quantified by optical density (OD) analysis, which yielded relative expression levels of 0.23 ± 0.11 in black skin, 0.19 ± 0.09 and 0.10 ± 0.03 in black dots and white dots of piebald skin, respectively, and 0.08 ± 0.01 in white skin (p coat colors, though at significantly different levels. SLC45A2 may participate in the establishment of coat color by regulating the synthesis and trafficking of melanin.

  9. Epigenetic regulation of the glucose transporter gene Slc2a1 by β-hydroxybutyrate underlies preferential glucose supply to the brain of fasted mice.

    Science.gov (United States)

    Tanegashima, Kosuke; Sato-Miyata, Yukiko; Funakoshi, Masabumi; Nishito, Yasumasa; Aigaki, Toshiro; Hara, Takahiko

    2017-01-01

    We carried out liquid chromatography-tandem mass spectrometry analysis of metabolites in mice. Those metabolome data showed that hepatic glucose content is reduced, but that brain glucose content is unaffected, during fasting, consistent with the priority given to brain glucose consumption during fasting. The molecular mechanisms for this preferential glucose supply to the brain are not fully understood. We also showed that the fasting-induced production of the ketone body β-hydroxybutyrate (β-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification. Upon β-OHB treatment, Slc2a1 expression was up-regulated, with a concomitant increase in H3K9 acetylation at the critical cis-regulatory region of the Slc2a1 gene in brain microvascular endothelial cells and NB2a neuronal cells, shown by quantitative PCR analysis and chromatin immunoprecipitation assay. CRISPR/Cas9-mediated disruption of the Hdac2 gene increased Slc2a1 expression, suggesting that it is one of the responsible histone deacetylases (HDACs). These results confirm that β-OHB is a HDAC inhibitor and show that β-OHB plays an important role in fasting-induced epigenetic activation of a glucose transporter gene in the brain. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  10. SLC45A2 mutation frequency in Oculocutaneous Albinism Italian patients doesn't differ from other European studies.

    Science.gov (United States)

    Mauri, Lucia; Barone, Luca; Al Oum, Muna; Del Longo, Alessandra; Piozzi, Elena; Manfredini, Emanuela; Stanzial, Franco; Benedicenti, Francesco; Penco, Silvana; Patrosso, Maria Cristina

    2014-01-01

    Oculocutaneous Albinism (OCA) is a heterogeneous group of inherited diseases involving hair, skin and eyes. To date, six forms are recognized on the effects of different melanogenesis genes. OCA4 is caused by mutations in SLC45A2 showing a heterogeneous phenotype ranging from white hair, blue irides and nystagmus to brown/black hair, brown irides and no nystagmus. The high clinic variety often leads to misdiagnosis. Our aim is to contribute to OCA4 diagnosis defining SLC45A2 genetic variants in Italian patients with OCA without any TYR, OCA2 and TYRP1 gene defects. After the clinical diagnosis of OCA, all patients received genetic counseling and genetic test. Automatic sequencing of TYR, OCA2, and TYRP1 genes was performed on DNA of 117 albino patients. Multiplex Ligation-dependent Probe Amplification (MLPA) was carried out on TYR and OCA2 genes to increase the mutation rate. SLC45A2 gene sequencing was then executed in the patients with a single mutation in one of the TYR, OCA2, TYRP1 genes and in the patients, which resulted negative at the screening of these genes. SLC45A2 gene analysis was performed in 41 patients and gene alterations were found in 5 patients. Four previously reported SLC45A2 mutations were found: p.G100S, p.W202C, p.A511E and c.986delC, and three novel variants were identified: p.M265L, p.H94D, and c.1156+1G>A. All the alterations have been detected in the group of patients without mutations in the other OCA genes. Three new variants were identified in OCA4 gene; the analysis allowed the classification of a patient previously misdiagnosed as OA1 because of skin and hair pigmentation presence. The molecular defects in SLC45A2 gene represent the 3.4% in this cohort of Italian patients, similar to other Caucasian populations; our data differ from those previously published by an Italian researcher group, obtained on a smaller cohort of patients. © 2013 Elsevier B.V. All rights reserved.

  11. Association of SLC11A1 gene polymorphism with caprine ...

    Indian Academy of Sciences (India)

    Navya

    2017-01-16

    Jan 16, 2017 ... RESEARCH ARTICLE. Evaluation of the ..... Nramp2 (Slc11a2) expressed at the plasma membrane. Blood, 102 ... Received 21 November 2016, in final revised form 11 January 2017; accepted 12 January 2017. Unedited ...

  12. Dicty_cDB: SLC460 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

  13. Dicty_cDB: SLC496 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

  14. Dicty_cDB: SLC449 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT

  15. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Science.gov (United States)

    Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka

    2014-01-01

    Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  16. Mutations in SLC20A2 are a major cause of familial idiopathic basal ganglia calcification

    Science.gov (United States)

    Hsu, Sandy Chan; Sears, Renee L.; Lemos, Roberta R.; Quintáns, Beatriz; Huang, Alden; Spiteri, Elizabeth; Nevarez, Lisette; Mamah, Catherine; Zatz, Mayana; Pierce, Kerrie D.; Fullerton, Janice M.; Adair, John C.; Berner, Jon E.; Bower, Matthew; Brodaty, Henry; Carmona, Olga; Dobricić, Valerija; Fogel, Brent L.; García-Estevez, Daniel; Goldman, Jill; Goudreau, John L.; Hopfer, Suellen; Janković, Milena; Jaumà, Serge; Jen, Joanna C.; Kirdlarp, Suppachok; Klepper, Joerg; Kostić, Vladimir; Lang, Anthony E.; Linglart, Agnès; Maisenbacher, Melissa K.; Manyam, Bala V.; Mazzoni, Pietro; Miedzybrodzka, Zofia; Mitarnun, Witoon; Mitchell, Philip B.; Mueller, Jennifer; Novaković, Ivana; Paucar, Martin; Paulson, Henry; Simpson, Sheila A.; Svenningsson, Per; Tuite, Paul; Vitek, Jerrold; Wetchaphanphesat, Suppachok; Williams, Charles; Yang, Michele; Schofield, Peter R.; de Oliveira, João R. M.; Sobrido, María-Jesús

    2014-01-01

    Familial idiopathic basal ganglia calcification (IBGC) or Fahr’s disease is a rare neurodegenerative disorder characterized by calcium deposits in the basal ganglia and other brain regions, which is associated with neuropsychiatric and motor symptoms. Familial IBGC is genetically heterogeneous and typically transmitted in an autosomal dominant fashion. We performed a mutational analysis of SLC20A2, the first gene found to cause IBGC, to assess its genetic contribution to familial IBGC. We recruited 218 subjects from 29 IBGC-affected families of varied ancestry and collected medical history, neurological exam, and head CT scans to characterize each patient’s disease status. We screened our patient cohort for mutations in SLC20A2. Twelve novel (nonsense, deletions, missense, and splice site) potentially pathogenic variants, one synonymous variant, and one previously reported mutation were identified in 13 families. Variants predicted to be deleterious cosegregated with disease in five families. Three families showed nonsegregation with clinical disease of such variants, but retrospective review of clinical and neuroimaging data strongly suggested previous misclassification. Overall, mutations in SLC20A2 account for as many as 41 % of our familial IBGC cases. Our screen in a large series expands the catalog of SLC20A2 mutations identified to date and demonstrates that mutations in SLC20A2 are a major cause of familial IBGC. Non-perfect segregation patterns of predicted deleterious variants highlight the challenges of phenotypic assessment in this condition with highly variable clinical presentation. PMID:23334463

  17. STANFORD: Highly polarized SLC electron beams

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    Full text: Using specialized photocathodes made with 'strained' gallium arsenide, physicists at the Stanford Linear Accelerator Center (SLAC) have generated electron beams with polarizations in excess of 60 percent a year ahead of schedule. Together with recent luminosity increases, this breakthrough will have a major impact on the physics output of the Stanford Linear Collider (SLC). Beam polarization was almost tripled using photocathodes in which a gallium arsenide layer was grown epitaxially over a substrate of gallium arsenide phosphide. The mismatch between these two layers deforms the crystal structure and removes a degeneracy in the valence band structure, permitting selective optical pumping of one unique spin state. Whereas conventional gallium arsenide photocathodes are limited to 50 percent polarization because of this degeneracy (and realistic cathodes fall substantially below this theoretical limit), such strained crystal lattices have the potential to yield polarizations close to 100 percent. Polarization enhancement with strained lattices was first demonstrated in 1991 by a SLAC/Wisconsin/ Berkeley group (May 1991, page 6) with a 71 percent polarization in a laboratory experiment. More recently this group has achieved polarization in excess of 90 percent, reported last November at the Nagoya Spin Symposium. (In a complementary development, a Japanese KEK/ Nagoya/KEK obtains polarized beams using a 'superlattice' - May 1991, page 4.) The 1993 SLC run, the strained gallium arsenide photocathode technique's debut in an operating particle accelerator, has proved to be a resounding, unqualified success - as have physics experiments on the Z particles produced by the highly polarized beam. A conservative approach was called for, due to concerns about possible charge saturation effects. A relatively thick (0.3 micron) gallium arsenide layer was used for the photocathode in the SLC polarized electron source. With a titanium

  18. SLC and SLD: Experimental experience with a linear collider

    International Nuclear Information System (INIS)

    Breidenbach, M.

    1993-08-01

    The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described

  19. Interaction between the SLC19A1 gene and maternal first trimester fever on offspring neural tube defects.

    Science.gov (United States)

    Pei, Lijun; Zhu, Huiping; Ye, Rongwei; Wu, Jilei; Liu, Jianmeng; Ren, Aiguo; Li, Zhiwen; Zheng, Xiaoying

    2015-01-01

    Many studies have indicated that the reduced folate carrier gene (SLC19A1) is associated with an increased risk of neural tube defects (NTDs). However, the interaction between the SLC19A1 gene variant and maternal fever exposure and NTD risk remains unknown. The aim of this study was to investigate whether the risk for NTDs was influenced by the interactions between the SLC19A1 (rs1051266) variant and maternal first trimester fever. We investigated the potential interaction between maternal first trimester fever and maternal or offspring SLC19A1 polymorphism through a population-based case-control study. One hundred and four nuclear families with NTDs and 100 control families with nonmal newborns were included in the study. SLC19A1 polymorphism was determined using polymerase chain reaction-restricted fragment length polymorphism. Mothers who had the GG/GA genotype and first trimester fever had an elevated risk of NTDs (adjusted odds ratio, 11.73; 95% confidence interval, 3.02-45.58) as compared to absence of maternal first trimester fever and AA genotype after adjusting for maternal education, paternal education, and age, and had a significant interactive coefficient (γ = 3.17) between maternal GG/GA genotype and first trimester fever. However, there was no interaction between offspring's GG/GA genotype and maternal first trimester fever (the interactive coefficient γ = 0.97) after adjusting for confounding factors. Our findings suggested that the risk of NTDs was potentially influenced by a gene-environment interaction between maternal SLC19A1 rs1051266 GG/GA genotype and first trimester fever. Maternal GG/GA genotype may strengthen the effect of maternal fever exposure on NTD risk in this Chinese population. © 2014 Wiley Periodicals, Inc.

  20. The effects and mechanisms of SLC34A2 on maintaining stem cell-like phenotypes in CD147+ breast cancer stem cells.

    Science.gov (United States)

    Lv, Yonggang; Wang, Ting; Fan, Jing; Zhang, Zhenzhen; Zhang, Juliang; Xu, Cheng; Li, Yongping; Zhao, Ge; He, Chenyang; Meng, Huimin; Yang, Hua; Wang, Zhen; Liu, Jiayun; Chen, Jianghao; Wang, Ling

    2017-04-01

    The cancer stem cell (CSC) hypothesis has gained significant recognition in describing tumorigenesis. Identification of the factors critical to development of breast cancer stem cells (BCSCs) may provide insight into the improvement of effective therapies against breast cancer. In this study, we aim to investigate the biological function of SLC34A2 in affecting the stem cell-like phenotypes in BCSCs and its underlying mechanisms. We demonstrated that CD147 + cells from breast cancer tissue samples and cell lines possessed BCSC-like features, including the ability of self-renewal in vitro, differentiation, and tumorigenic potential in vivo. Flow cytometry analysis showed the presence of a variable fraction of CD147 + cells in 9 of 10 tumor samples. Significantly, SLC34A2 expression in CD147 + BCSCs was enhanced compared with that in differentiated adherent progeny of CD147 + BCSCs and adherently cultured cell line cells. In breast cancer patient cohorts, SLC34A2 expression was found increased in 9 of 10 tumor samples. By using lentiviral-based approach, si-SLC34A2-transduced CD147 + BCSCs showed decreased ability of sphere formation, cell viability in vitro, and tumorigenicity in vivo, which suggested the essential role of SLC34A2 in CD147 + BCSCs. Furthermore, PI3K/AKT pathway and SOX2 were found necessary to maintain the stemness of CD147 + BCSCs by using LY294002 or lentiviral-si-SOX2. Finally, we indicated that SLC34A2 could regulate SOX2 to maintain the stem cell-like features in CD147 + BCSCs through PI3K/AKT pathway. Therefore, our report identifies a novel role of SLC34A2 in BCSCs' state regulation and establishes a rationale for targeting the SLC34A2/PI3K/AKT/SOX2 signaling pathway for breast cancer therapy.

  1. Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

    Science.gov (United States)

    Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

    2016-08-08

    Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Directory of Open Access Journals (Sweden)

    Wu Bailin

    2008-11-01

    Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the

  3. Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

    Science.gov (United States)

    Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C

    2008-01-01

    Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to

  4. Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

    Science.gov (United States)

    Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

    2014-04-01

    Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

  5. A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.

    Science.gov (United States)

    Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane

    2017-01-01

    Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  6. Three cysteine residues of SLC52A1, a receptor for the porcine endogenous retrovirus-A (PERV-A), play a critical role in cell surface expression and infectivity.

    Science.gov (United States)

    Colon-Moran, Winston; Argaw, Takele; Wilson, Carolyn A

    2017-07-01

    Porcine endogenous retrovirus-A (PERV-A), a gammaretrovirus, infects human cells in vitro, thus raising the potential risk of cross-species transmission in xenotransplantation. Two members of the solute carrier family 52 (SLC52A1 and SLC52A2) are PERV-A receptors. Site-directed mutagenesis of the cDNA encoding SLC52A1 identified that only one of two putative glycosylation signals is occupied by glycans. In addition, we showed that glycosylation of SLC52A1 is not necessary for PERV-A receptor function. We also identified that at a minimum, three cysteine residues are sufficient for SLC52A1 cell surface expression. Mutation of cysteine at position 365 and either of the two cysteine residues in the C-terminal tail at positions 442 or 446 reduced SLC52A1 surface expression and PERV-A infection suggesting that these residues may contribute to overall structural stability and receptor function. Understanding interactions between PERV-A and its cellular receptor may provide novel strategies to prevent zoonotic infection in the setting of xenotransplantation. Published by Elsevier Inc.

  7. Effects of fasting and refeeding on gene expression of slc15a1a, a gene encoding an oligopeptide transporter (PepT1), in the intestine of Mozambique tilapia.

    Science.gov (United States)

    Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi

    2017-01-01

    The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.

  8. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Directory of Open Access Journals (Sweden)

    Olha Hurba

    Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  9. Lessons from the SLC for future LC control systems

    International Nuclear Information System (INIS)

    Humphrey, R.

    1992-01-01

    The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: (1) Repetition rate, (2) Sensitivity to orbit distortion, (3) Stability/Automation, (4) Accelerator Development. (author)

  10. Two Variants in SLC24A5 Are Associated with “Tiger-Eye” Iris Pigmentation in Puerto Rican Paso Fino Horses

    Directory of Open Access Journals (Sweden)

    Maura Mack

    2017-08-01

    Full Text Available A unique eye color, called tiger-eye, segregates in the Puerto Rican Paso Fino (PRPF horse breed and is characterized by a bright yellow, amber, or orange iris. Pedigree analysis identified a simple autosomal recessive mode of inheritance for this trait. A genome-wide association study (GWAS with 24 individuals identified a locus on ECA 1 reaching genome-wide significance (Pcorrected = 1.32 × 10−5. This ECA1 locus harbors the candidate gene, Solute Carrier Family 24 (Sodium/Potassium/Calcium Exchanger, Member 5 (SLC24A5, with known roles in pigmentation in humans, mice, and zebrafish. Humans with compound heterozygous mutations in SLC24A5 have oculocutaneous albinism (OCA type 6 (OCA6, which is characterized by dilute skin, hair, and eye pigmentation, as well as ocular anomalies. Twenty tiger-eye horses were homozygous for a nonsynonymous mutation in exon 2 (p.Phe91Tyr of SLC24A5 (called here Tiger-eye 1, which is predicted to be deleterious to protein function. Additionally, eight of the remaining 12 tiger-eye horses heterozygous for the p.Phe91Tyr variant were also heterozygous for a 628 bp deletion encompassing all of exon 7 of SLC24A5 (c.875-340_1081+82del, which we will call here the Tiger-eye 2 allele. None of the 122 brown-eyed horses were homozygous for either tiger-eye-associated allele or were compound heterozygotes. Further, neither variant was detected in 196 horses from four related breeds not known to have the tiger-eye phenotype. Here, we propose that two mutations in SLC24A5 affect iris pigmentation in tiger-eye PRPF horses. Further, unlike OCA6 in humans, the Tiger-eye 1 mutation in its homozygous state or as a compound heterozygote (Tiger-eye 1/Tiger-eye 2 does not appear to cause ocular anomalies or a change in coat color in the PRPF horse.

  11. Association of a serotonin transporter gene (SLC6A4) 5-HTTLPR polymorphism with body mass index categories but not type 2 diabetes mellitus in Mexicans

    Science.gov (United States)

    Peralta-Leal, Valeria; Leal-Ugarte, Evelia; Meza-Espinoza, Juan P.; Dávalos-Rodríguez, Ingrid P.; Bocanegra-Alonso, Anabel; Acosta-González, Rosa I.; Gonzales, Enrique; Nair, Saraswathy; Durán-González, Jorge

    2012-01-01

    The serotonergic system has been hypothesized to contribute to the biological susceptibility to type 2 diabetes mellitus (T2DM) and body-mass index (BMI) categories. We investigate a possible association of 5-HTTLPR polymorphism (L and S alleles) in the promoter region of the serotonin transporter gene (SLC6A4) with the development of T2DM and/or higher BMI by analyzing a sample of 138 individuals diagnosed with T2DM and 172 unrelated controls from the Mexican general population. In the total sample genotypes were distributed according to Hardy-Weinberg equilibrium, and S allele frequency was 0.58. There was no statistical association between 5-HTTLPR polymorphism and the development of T2DM in this Mexican population sample (p = 0.12). Nevertheless, logistic regression analysis of the L allele and increased BMI disclosed an association, after adjusting for age, sex and T2DM (p = 0.02, OR 1.74, 95% CI: 1.079–2.808). PMID:23055796

  12. Role of the urate transporter SLC2A9 gene in susceptibility to gout in New Zealand Māori, Pacific Island, and Caucasian case-control sample sets.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Xu, Xin; Dalbeth, Nicola; Merriman, Marilyn E; Topless, Ruth; Waddell, Chloe; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B B; Stamp, Lisa K; Merriman, Tony R

    2009-11-01

    To examine the role of genetic variation in the renal urate transporter SLC2A9 in gout in New Zealand sample sets of Māori, Pacific Island, and Caucasian ancestry and to determine if the Māori and Pacific Island samples could be useful for fine-mapping. Patients (n= 56 Māori, 69 Pacific Island, and 131 Caucasian) were recruited from rheumatology outpatient clinics and satisfied the American College of Rheumatology criteria for gout. The control samples comprised 125 Māori subjects, 41 Pacific Island subjects, and 568 Caucasian subjects without arthritis. SLC2A9 single-nucleotide polymorphisms rs16890979 (V253I), rs5028843, rs11942223, and rs12510549 were genotyped (possible etiologic variants in Caucasians). Association of the major allele of rs16890979, rs11942223, and rs5028843 with gout was observed in all sample sets (P = 3.7 x 10(-7), 1.6 x 10(-6), and 7.6 x 10(-5) for rs11942223 in the Māori, Pacific Island, and Caucasian samples, respectively). One 4-marker haplotype (1/1/2/1; more prevalent in the Māori and Pacific Island control samples) was not observed in a single gout case. Our data confirm a role of SLC2A9 in gout susceptibility in a New Zealand Caucasian sample set, with the effect on risk (odds ratio >2.0) greater than previous estimates. We also demonstrate association of SLC2A9 with gout in samples of Māori and Pacific Island ancestry and a consistent pattern of haplotype association. The presence of both alleles of rs16890979 on susceptibility and protective haplotypes in the Māori and Pacific Island sample is evidence against a role for this nonsynonymous variant as the sole etiologic agent. More extensive linkage disequilibrium in Māori and Pacific Island samples suggests that Caucasian samples may be more useful for fine-mapping.

  13. mTORC1 Activator SLC38A9 Is Required to Efflux Essential Amino Acids from Lysosomes and Use Protein as a Nutrient.

    Science.gov (United States)

    Wyant, Gregory A; Abu-Remaileh, Monther; Wolfson, Rachel L; Chen, Walter W; Freinkman, Elizaveta; Danai, Laura V; Vander Heiden, Matthew G; Sabatini, David M

    2017-10-19

    The mTORC1 kinase is a master growth regulator that senses many environmental cues, including amino acids. Activation of mTORC1 by arginine requires SLC38A9, a poorly understood lysosomal membrane protein with homology to amino acid transporters. Here, we validate that SLC38A9 is an arginine sensor for the mTORC1 pathway, and we uncover an unexpectedly central role for SLC38A9 in amino acid homeostasis. SLC38A9 mediates the transport, in an arginine-regulated fashion, of many essential amino acids out of lysosomes, including leucine, which mTORC1 senses through the cytosolic Sestrin proteins. SLC38A9 is necessary for leucine generated via lysosomal proteolysis to exit lysosomes and activate mTORC1. Pancreatic cancer cells, which use macropinocytosed protein as a nutrient source, require SLC38A9 to form tumors. Thus, through SLC38A9, arginine serves as a lysosomal messenger that couples mTORC1 activation to the release from lysosomes of the essential amino acids needed to drive cell growth. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Polymorphism Study on SLC30A8 and Its Association with Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    M. Vignesh

    2016-11-01

    Full Text Available Type 2 diabetes mellitus (T2DM is one of the threatening disorders in the world. It affects people of all ages. Type 2 diabetes mellitus is a condition in which the glucose level in the blood is elevated due to improper function of the secretion of insulin from beta cells of the pancreas. It is a multifactorial disease because it is caused by both environmental and hereditary factors. One of the genes which play an important role in type 2 diabetes mellitus is SLC30A8 which encodes for zinc transporter ZnT8. The common polymorphic site for SLC30A8 is rs13266634. This single-nucleotide polymorphism leads to type 2 diabetes mellitus by replacing the arginine residue with tryptophan residue. This review mainly focuses on the polymorphic studies in the gene SLC30A8 and its association with type 2 diabetes mellitus.

  15. Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.

    Science.gov (United States)

    Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J

    2017-07-01

    To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

  16. Making electron beams for the SLC linac

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Ecklund, S.D.; James, M.B.; Miller, R.H.; Sheppard, J.C.; Sodja, J.; Truher, J.B.; Minten, A.

    1984-01-01

    A source of high-intensity, single-bunch electron beams has been developed at SLAC for the SLC. The properties of these beams have been studied extensively utilizing the first 100-m of the SLAC linac and the computer-based control system being developed for the SLC. The source is described and the properties of the beams are summarized. 9 references, 2 figures, 1 table

  17. Genetic variants of SLC11A1 are associated with both autoimmune and infectious diseases: systematic review and meta-analysis.

    Science.gov (United States)

    Archer, N S; Nassif, N T; O'Brien, B A

    2015-06-01

    A systematic review and meta-analyses were undertaken to investigate the association of SLC11A1 genetic variants with disease occurrence. Literature searching indentified 109 publications to include in the meta-analyses assessing the association of 11 SLC11A1 variants with autoimmune and infectious disease. The (GT)n promoter alleles 2 and 3 (rs534448891), which alter SLC11A1 expression, were significantly associated with tuberculosis (OR=1.47 (1.30-1.66), OR=0.76 (0.65-0.89), respectively) and infectious disease (OR=1.25 (1.10-1.42), OR=0.83 (0.74-0.93), respectively). However, although no association was observed with autoimmune disease, a modest significant association was observed with type 1 diabetes (allele 2 OR=0.94 (0.89-0.98)). On the basis of a stronger association of (GT)n allele 2 with tuberculosis, compared with the protective effect of allele 3, we hypothesise that allele 2 is likely the disease-causing variant influencing disease susceptibility. Significant associations were observed between the 469+14G/C polymorphism (rs3731865) and autoimmune disease (OR=1.30 (1.04-1.64)) and rheumatoid arthritis (OR=1.60 (1.20-2.13)) and between the -237C/T polymorphism (rs7573065) and inflammatory bowel disease (OR=0.60 (0.43-0.84)). Further, significant associations were identified between the 469+14G/C, 1730G/A and 1729+55del4 polymorphisms (rs3731865, rs17235409 and rs17235416, respectively) and both infectious disease per se and tuberculosis. These findings show a clear association between variants in the SLC11A1 locus and autoimmune and infectious disease susceptibility.

  18. Voruciclib, a Potent CDK4/6 Inhibitor, Antagonizes ABCB1 and ABCG2-Mediated Multi-Drug Resistance in Cancer Cells

    Directory of Open Access Journals (Sweden)

    Pranav Gupta

    2018-02-01

    Full Text Available Background/Aims: The overexpression of ATP-Binding Cassette (ABC transporters has known to be one of the major obstacles impeding the success of chemotherapy in drug resistant cancers. In this study, we evaluated voruciclib, a CDK 4/6 inhibitor, for its chemo-sensitizing activity in ABCB1- and ABCG2- overexpressing cells. Methods: Cytotoxicity and reversal effect of voruciclib was determined by MTT assay. The intracellular accumulation and efflux of ABCB1 and ABCG2 substrates were measured by scintillation counter. The effects on expression and intracellular localization of ABCB1 and ABCG2 proteins were determined by Western blotting and immunofluorescence, respectively. Vanadate-sensitive ATPase assay was done to determine the effect of voruciclib on the ATPase activity of ABCB1 and ABCG2. Flow cytometric analysis was done to determine the effect of voruciclib on apoptosis of ABCB1 and ABCG2-overexpressing cells and docking analysis was done to determine the interaction of voruciclib with ABCB1 and ACBG2 protein. Results: Voruciclib significantly potentiated the effect of paclitaxel and doxorubicin in ABCB1-overexpressing cells, as well as mitoxantrone and SN-38 in ABCG2-overexpressing cells. Voruciclib moderately sensitized ABCC10- overexpressing cells to paclitaxel, whereas it did not alter the cytotoxicity of substrates of ABCC1. Furthermore, voruciclib increased the intracellular accumulation and decreased the efflux of substrate anti-cancer drugs from ABCB1- or ABCG2-overexpressing cells. However, voruciclib did not alter the expression or the sub-cellular localization of ABCB1 or ABCG2. Voruciclib stimulated the ATPase activity of both ABCB1 and ABCG2 in a concentration-dependent manner. Lastly, voruciclib exhibited a drug-induced apoptotic effect in ABCB1- or ABCG2- overexpressing cells. Conclusion: Voruciclib is currently a phase I clinical trial drug. Our findings strongly support its potential use in combination with conventional anti

  19. [The association of polymorphisms in SLC18A1, TPH1 and RELN genes with risk of paranoid schizophrenia].

    Science.gov (United States)

    Galaktionova, D Iu; Gareeva, A E; Khusnutdinova, E K; Nasedkina, T V

    2014-01-01

    We have developed a biochip for the analysis of polymorphisms in candidate genes for schizophrenia: DISC1, RELN, ZNF804A, PLXNA2, COMT, SLC18A41, CACNA1C, ANK3, TPH1, PLAA and SNAP-25. Using biochip the allele and genotype frequencies in 198 patients with schizophrenia and 192 healthy individuals have been obtained. For SLC18A1 polymorphism rs2270641 A>C, the frequencies of A allele (p = 0.007) and AA genotype (p = 0.002) were lower in patients compared with healthy individuals. A significant association was found between AA genotype (p = 0.036) of the TPH1 polymorphism rs1800532 C>A and schizophrenia. The C allele (p = 0.039) of the RELNpolymorphism rs7341475 C>T were lower in patients with schizophrenia compared with healthy individuals in a tatar population. Genotype AA of the TPH1 polymorphism rs1800532 C>A were more frequent in patients with schizophrenia compared with healthy individuals. Ithas been shown that the C allele (p = 0.0001) and GC (p = = 0.0001) genotype of the PLXNA2 polymorphism rs1327175 G>C are associated with the family history in patients with paranoid schizophrenia. The obtained data suggest that SLC18A1, TPH1 and RELN gene polymorphisms are associated with the risk of paranoid schizophrenia.

  20. Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy

    Directory of Open Access Journals (Sweden)

    Yangzom D. Bhutia

    2017-02-01

    Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy

  1. Solute Carrier Family 26 Member a2 (slc26a2 Regulates Otic Development and Hair Cell Survival in Zebrafish.

    Directory of Open Access Journals (Sweden)

    Fei Liu

    Full Text Available Hearing loss is one of the most prevalent human birth defects. Genetic factors contribute to the pathogenesis of deafness. It is estimated that one-third of deafness genes have already been identified. The current work is an attempt to find novel genes relevant to hearing loss using guilt-by-profiling and guilt-by-association bioinformatics analyses of approximately 80 known non-syndromic hereditary hearing loss (NSHL genes. Among the 300 newly identified candidate deafness genes, slc26a2 were selected for functional studies in zebrafish. The slc26a2 gene was knocked down using an antisense morpholino (MO, and significant defects were observed in otolith patterns, semicircular canal morphology, and lateral neuromast distributions in morphants. Loss-of-function defects are caused primarily by apoptosis, and morphants are insensitive to sound stimulation and imbalanced swimming behaviours. Morphant defects were found to be partially rescued by co-injection of human SLC26A2 mRNA. All the results suggest that bioinformatics is capable of predicting new deafness genes and this showed slc26a2 is to be a critical otic gene whose dysfunction may induce hearing impairment.

  2. Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome

    OpenAIRE

    Haack, Tobias B.; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A.; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M.; Meitinger, Thomas; Yonezawa, Atsushi

    2012-01-01

    Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin tran...

  3. Hypotonic activation of the myo-inositol transporter SLC5A3 in HEK293 cells probed by cell volumetry, confocal and super-resolution microscopy.

    Directory of Open Access Journals (Sweden)

    Joseph Andronic

    Full Text Available Swelling-activated pathways for myo-inositol, one of the most abundant organic osmolytes in mammalian cells, have not yet been identified. The present study explores the SLC5A3 protein as a possible transporter of myo-inositol in hyponically swollen HEK293 cells. To address this issue, we examined the relationship between the hypotonicity-induced changes in plasma membrane permeability to myo-inositol P ino [m/s] and expression/localization of SLC5A3. P ino values were determined by cell volumetry over a wide tonicity range (100-275 mOsm in myo-inositol-substituted solutions. While being negligible under mild hypotonicity (200-275 mOsm, P ino grew rapidly at osmolalities below 200 mOsm to reach a maximum of ∼ 3 nm/s at 100-125 mOsm, as indicated by fast cell swelling due to myo-inositol influx. The increase in P ino resulted most likely from the hypotonicity-mediated incorporation of cytosolic SLC5A3 into the plasma membrane, as revealed by confocal fluorescence microscopy of cells expressing EGFP-tagged SLC5A3 and super-resolution imaging of immunostained SLC5A3 by direct stochastic optical reconstruction microscopy (dSTORM. dSTORM in hypotonic cells revealed a surface density of membrane-associated SLC5A3 proteins of 200-2000 localizations/μm2. Assuming SLC5A3 to be the major path for myo-inositol, a turnover rate of 80-800 myo-inositol molecules per second for a single transporter protein was estimated from combined volumetric and dSTORM data. Hypotonic stress also caused a significant upregulation of SLC5A3 gene expression as detected by semiquantitative RT-PCR and Western blot analysis. In summary, our data provide first evidence for swelling-mediated activation of SLC5A3 thus suggesting a functional role of this transporter in hypotonic volume regulation of mammalian cells.

  4. MicroRNA-129-5p Regulates Glycolysis and Cell Proliferation by Targeting the Glucose Transporter SLC2A3 in Gastric Cancer Cells

    Directory of Open Access Journals (Sweden)

    Di Chen

    2018-05-01

    Full Text Available Tumor cells increase their glucose consumption through aerobic glycolysis to manufacture the necessary biomass required for proliferation, commonly known as the Warburg effect. Accumulating evidences suggest that microRNAs (miRNAs interact with their target genes and contribute to metabolic reprogramming in cancer cells. By integrating high-throughput screening data and the existing miRNA expression datasets, we explored the roles of candidate glycometabolism-regulating miRNAs in gastric cancer (GC. Subsequent investigation of the characterized miRNAs indicated that miR-129-5p inhibits glucose metabolism in GC cells. miRNA-129-5p directly targets the 3′-UTR of SLC2A3, thereby suppressing glucose consumption, lactate production, cellular ATP levels, and glucose uptake of GC cells. In addition, the PI3K-Akt and MAPK signaling pathways are involved in the effects of the miR-129-5p/SLC2A3 axis, regulating GC glucose metabolism and growth. These results reveal a novel role of the miR-129-5p/SLC2A3 axis in reprogramming the glycometabolism process in GC cells and indicate a potential therapeutic target for the treatment of this disease.

  5. SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland

    Directory of Open Access Journals (Sweden)

    Hassen Hadj-Kacem

    2010-01-01

    Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.

  6. A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle

    Directory of Open Access Journals (Sweden)

    Beever Jonathan E

    2010-05-01

    Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and

  7. Hybridisation-based resequencing of 17 X-linked intellectual disability genes in 135 patients reveals novel mutations in ATRX, SLC6A8 and PQBP1

    Science.gov (United States)

    Jensen, Lars R; Chen, Wei; Moser, Bettina; Lipkowitz, Bettina; Schroeder, Christopher; Musante, Luciana; Tzschach, Andreas; Kalscheuer, Vera M; Meloni, Ilaria; Raynaud, Martine; van Esch, Hilde; Chelly, Jamel; de Brouwer, Arjan P M; Hackett, Anna; van der Haar, Sigrun; Henn, Wolfram; Gecz, Jozef; Riess, Olaf; Bonin, Michael; Reinhardt, Richard; Ropers, Hans-Hilger; Kuss, Andreas W

    2011-01-01

    X-linked intellectual disability (XLID), also known as X-linked mental retardation, is a highly genetically heterogeneous condition for which mutations in >90 different genes have been identified. In this study, we used a custom-made sequencing array based on the Affymetrix 50k platform for mutation screening in 17 known XLID genes in patients from 135 families and found eight single-nucleotide changes that were absent in controls. For four mutations affecting ATRX (p.1761M>T), PQBP1 (p.155R>X) and SLC6A8 (p.390P>L and p.477S>L), we provide evidence for a functional involvement of these changes in the aetiology of intellectual disability. PMID:21267006

  8. Variations in CCR5, but not HFE, ELMO1, or SLC12A3, are associated with susceptibility to kidney disease in north Indian individuals with type 2 diabetes.

    Science.gov (United States)

    Yadav, Ashok K; Kumar, Vinod; Dutta, Pinaki; Bhansali, Anil; Jha, Vivekanand

    2014-11-01

    Diabetic nephropathy (DN), the leading cause of end-stage renal disease worldwide, may have a genetic component. In the present study, we investigated variations in a set of genes with susceptibility to DN in a north Indian population. Four genes (HFE, ELMO1, SLC12A3, and CCR5) were selected on the basis of reported association with type 2 diabetes and nephropathy. In all, 417 diabetic subjects (215 without kidney disease [DM] and 202 with DN) and 197 healthy controls (HC) were evaluated for variations in HFE (845 G>A and 187G>C), SLC12A3 (g.34372G>A), CCR5 (59029A>G), and ELMO1 (+9170 G>A). Polymorphism analysis was performed by polymerase chain reaction-restriction fragment length polymorphism and Taqman allele discrimination assays. Significant differences were found in genotype and allelic frequency in SLC12A3 (g.34372G>A) between diabetic subjects and HC (P A (AA+GA) genotype between diabetic subjects with and without nephropathy. However, the CCR5 59029AA genotype and A allele were significantly more frequent in diabetics compared with the HC (P = 0.01 and 0.03, respectively) and subjects with DN versus DM (P = 0.002 and 0.01, respectively). For ELMO1 (+9170 G>A), the GG genotype frequency was higher in the diabetic versus HC group. There were no differences in the frequency of HFE-845 G>A and HFE-187G>C among the groups. This study shows that the CCR5 AA genotype is over-represented in subjects with kidney disease due to type 2 diabetes. The CCR5 59029G>A and ELMO1 (+9170 G>A) loci are more frequent, and the SLC12A3 34372 AA genotype is associated with a reduced risk of diabetes. © 2014 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

  9. Flat beams in the SLC

    International Nuclear Information System (INIS)

    Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.

    1993-01-01

    The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC

  10. Further characterisation of the recently described SLC26A4 c.918+2T>C mutation and reporting of a novel variant predicted to be damaging.

    Science.gov (United States)

    Gonçalves, A C; Santos, R; O'Neill, A; Escada, P; Fialho, G; Caria, H

    2016-06-01

    Pendred syndrome (PS) is the second most common type of autosomal recessive syndromic hearing loss (HL). It is characterised by sensorineural HL and goiter with occasional hypothyroidism. These features are generally accompanied by malformations of the inner ear, as enlarged vestibular aqueduct (EVA). In about 50% of probands, mutations in the SLC26A4 gene are the cause of the disease. Here we report the case of a Portuguese female, aged 47, presenting with severe to profound HL and hypothyroidism. Her mother and sister, both deceased, had suffered from HL and goiter. By MRI and CT, an enlarged vestibular aqueduct and endolymphatic sac were observed. Molecular study of the patient included screening for GJB2 coding mutations and GJB6 common deletions followed by screening of all SLC26A4 exons, as well as intronic regions 8 and 14. Mutation c.918+2T>C was found for the first time in homozygosity in the intronic region 7 of the SLC26A4 gene. Whilst sequencing the control samples, a novel mutation c.821C>G was found in heterozygosity in the exon 7 of SLC26A4 gene and was predicted to be damaging. This study thus led to the finding of two novel SLC26A4 genotypes and provides new insight on the phenotypic features associated with PS. © Copyright by Società Italiana di Otorinolaringologia e Chirurgia Cervico-Facciale, Rome, Italy.

  11. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  12. Partial deletion of the sulfate transporter SLC13A1 is associated with an osteochondrodysplasia in the Miniature Poodle breed.

    Directory of Open Access Journals (Sweden)

    Mark W Neff

    Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.

  13. DiffSLC: A graph centrality method to detect essential proteins of a protein-protein interaction network.

    Science.gov (United States)

    Mistry, Divya; Wise, Roger P; Dickerson, Julie A

    2017-01-01

    Identification of central genes and proteins in biomolecular networks provides credible candidates for pathway analysis, functional analysis, and essentiality prediction. The DiffSLC centrality measure predicts central and essential genes and proteins using a protein-protein interaction network. Network centrality measures prioritize nodes and edges based on their importance to the network topology. These measures helped identify critical genes and proteins in biomolecular networks. The proposed centrality measure, DiffSLC, combines the number of interactions of a protein and the gene coexpression values of genes from which those proteins were translated, as a weighting factor to bias the identification of essential proteins in a protein interaction network. Potentially essential proteins with low node degree are promoted through eigenvector centrality. Thus, the gene coexpression values are used in conjunction with the eigenvector of the network's adjacency matrix and edge clustering coefficient to improve essentiality prediction. The outcome of this prediction is shown using three variations: (1) inclusion or exclusion of gene co-expression data, (2) impact of different coexpression measures, and (3) impact of different gene expression data sets. For a total of seven networks, DiffSLC is compared to other centrality measures using Saccharomyces cerevisiae protein interaction networks and gene expression data. Comparisons are also performed for the top ranked proteins against the known essential genes from the Saccharomyces Gene Deletion Project, which show that DiffSLC detects more essential proteins and has a higher area under the ROC curve than other compared methods. This makes DiffSLC a stronger alternative to other centrality methods for detecting essential genes using a protein-protein interaction network that obeys centrality-lethality principle. DiffSLC is implemented using the igraph package in R, and networkx package in Python. The python package can be

  14. SLC25A13 gene analysis in citrin deficiency: sixteen novel mutations in East Asian patients, and the mutation distribution in a large pediatric cohort in China.

    Directory of Open Access Journals (Sweden)

    Yuan-Zong Song

    Full Text Available BACKGROUND: The human SLC25A13 gene encodes citrin, the liver-type mitochondrial aspartate/glutamate carrier isoform 2 (AGC2, and SLC25A13 mutations cause citrin deficiency (CD, a disease entity that encompasses different age-dependant clinical phenotypes such as Adult-onset Citrullinemia Type II (CTLN2 and Neonatal Intrahepatic Cholestasis caused by Citrin Deficiency (NICCD. The analyses of SLC25A13 gene and its protein/mRNA products remain reliable tools for the definitive diagnoses of CD patients, and so far, the SLC25A13 mutation spectrum in Chinese CD patients has not been well-characterized yet. METHODS AND RESULTS: By means of direct DNA sequencing, cDNA cloning and SNP analyses, 16 novel pathogenic mutations, including 9 missense, 4 nonsense, 1 splice-site, 1 deletion and 1 large transposal insertion IVS4ins6kb (GenBank accession number KF425758, were identified in CTLN2 or NICCD patients from China, Japan and Malaysia, respectively, making the SLC25A13 variations worldwide reach the total number of 81. A large NICCD cohort of 116 Chinese cases was also established, and the 4 high-frequency mutations contributed a much larger proportion of the mutated alleles in the patients from south China than in those from the north (χ(2 = 14.93, P<0.01, with the latitude of 30°N as the geographic dividing line in mainland China. CONCLUSIONS: This paper further enriched the SLC25A13 variation spectrum worldwide, and formed a substantial contribution to the in-depth understanding of the genotypic feature of Chinese CD patients.

  15. Adding PCs to SLC Control System

    International Nuclear Information System (INIS)

    Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.

    1993-05-01

    The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code

  16. Kicker thyratron experience from SLC

    International Nuclear Information System (INIS)

    Donaldson, A.R.; Cassel, R.L.; Mattison, T.S.; Reginato, L.L.

    1991-05-01

    The SLAC Linear Collider has five fast kickers for the damping ring injectors, extractors, and the electron extractor for the positron target that use multi-gap Deuterium-filled thyratrons. The thyratrons operate with 30 to 70 kV anode voltages and 1 to 5 kA currents, to deliver pulses to kicker magnets with ∼ 30 ns rise times, up to ∼ 150 ns pulse widths, at 120 Hz. Operating and lifetime experience with several types of thyratrons and support electronics are discussed. Floating driver and power supply electronics were replaced by a ferrite choke isolator to allow grounding of the cathode support electronics with a commensurate increase in operating reliability. The construction of a 100 ns Blumlein enabled detailed measurements of the switching times for all SLC thyratrons under similar conditions. In the final focus area, the kickers dump the SLC beams after the e + e - collisions. These thyratrons function with 15 kV anode voltages and up to 2 kA currents to produce 1/2 sine pulses with ∼ 300 ns rise times, ∼ 550 ns FWHM, at 120 Hz. Operating experience with these thyratrons will also be presented. 7 refs., 1 fig., 3 tabs

  17. Novel SLC19A3 Promoter Deletion and Allelic Silencing in Biotin-Thiamine-Responsive Basal Ganglia Encephalopathy.

    Directory of Open Access Journals (Sweden)

    Irene Flønes

    Full Text Available Biotin-thiamine responsive basal ganglia disease is a severe, but potentially treatable disorder caused by mutations in the SLC19A3 gene. Although the disease is inherited in an autosomal recessive manner, patients with typical phenotypes carrying single heterozygous mutations have been reported. This makes the diagnosis uncertain and may delay treatment.In two siblings with early-onset encephalopathy dystonia and epilepsy, whole-exome sequencing revealed a novel single heterozygous SLC19A3 mutation (c.337T>C. Although Sanger-sequencing and copy-number analysis revealed no other aberrations, RNA-sequencing in brain tissue suggested the second allele was silenced. Whole-genome sequencing resolved the genetic defect by revealing a novel 45,049 bp deletion in the 5'-UTR region of the gene abolishing the promoter. High dose thiamine and biotin therapy was started in the surviving sibling who remains stable. In another patient two novel compound heterozygous SLC19A3 mutations were found. He improved substantially on thiamine and biotin therapy.We show that large genomic deletions occur in the regulatory region of SLC19A3 and should be considered in genetic testing. Moreover, our study highlights the power of whole-genome sequencing as a diagnostic tool for rare genetic disorders across a wide spectrum of mutations including non-coding large genomic rearrangements.

  18. Contribution of SLC30A8 variants to the risk of type 2 diabetes in a multi-ethnic population: a case control study

    OpenAIRE

    Salem, Sameer D; Saif-Ali, Riyadh; Ismail, Ikram S; Al-Hamodi, Zaid; Muniandy, Sekaran

    2014-01-01

    Background Several studies have shown the association of solute carrier family 30 (zinc transporter) member 8 (SLC30A8) rs13266634 with type 2 diabetes (T2D). However, the association of alternative variants and haplotypes of SLC30A8 with T2D have not been studied in different populations. The aim of this study is to assess the association of the alternative SLC30A8 variants, rs7002176 and rs1995222 as well as the most common variant, rs13266634 and haplotypes with glutamic acid decarboxylase...

  19. Human Sodium Phosphate Transporter 4 (hNPT4/SLC17A3) as a Common Renal Secretory Pathway for Drugs and Urate*

    Science.gov (United States)

    Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki

    2010-01-01

    The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651

  20. Drift chamber vertex detectors for SLC/LEP

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, K G

    1988-03-01

    Factors influencing the design of drift chamber vertex detectors for SLC and LEP are discussed including global strategy, chamber gas, cell design, and signal processing. The designs of the vertex chambers for the L3 and OPAL experiments at LEP and the Mark II experiment at the SLC are described.

  1. Association between SLC2A9 (GLUT9) gene polymorphisms and gout susceptibility: an updated meta-analysis.

    Science.gov (United States)

    Zhang, Xu; Yang, Xiao; Wang, Mengmeng; Li, Xiaona; Xia, Qing; Xu, Shengqian; Xu, Jianhua; Cai, Guoqi; Wang, Li; Xin, Lihong; Zou, Yanfeng; Pan, Faming

    2016-08-01

    The relationship between the SLC2A9 (solute carrier family 2, member 9) gene polymorphisms and gout was still inconsistent among the individual genetic association studies. Therefore, this present research was aimed to systematically evaluate the association between SLC2A9 gene polymorphisms and gout susceptibility. Relevant studies were enrolled by searching databases systematically. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the associations. The heterogeneity between each of the studies was calculated by using the Q statistic methods, and Begg's funnel plot and Egger's tests were performed to evaluate publication bias. A total of 13 studies investigated four single nucleotide polymorphisms (SNPs) in SLC2A9 were included. In this study, we found that the allele C of rs3733591 was higher in patients than in controls in both all-pooled population [C vs. T: OR (95 % CI) = 1.432 (1.213-1.691)] and Asians-pooled population [C vs. T: OR (95 % CI) = 1.583 (1.365-1.835)]. The allele frequency C of s6449213 was lower in the gout patients than in controls in both all-pooled population and Caucasians-pooled population. Additionally, the allele frequency T of rs16890979 and the allele frequency C of rs1014290 were lower in gout patients than in controls. This study demonstrated that the genetic susceptibility for gout is associated with the SLC2A9 gene polymorphisms. Four of them except for the rs3733591 are protective SNPs in Caucasians, and rs16890979 and rs1014290 are protective SNPs in both Caucasians and Asians, while rs3733591 may be susceptibility SNP in Asians.

  2. Status of the SLC

    International Nuclear Information System (INIS)

    Moffeit, K.C.

    1987-01-01

    The status and research possibilities of the Stanford Linear Collider (SLC) are reviewed. The physics program concentrates on production of Z 0 's and their decay. The SLC systems include a new injector and booster, two damping rings to provide the small beam emittance, a new positron source, the existing LINAC structure upgraded for higher energy and better beam control, beam transport arcs, a final focus section, and experimental halls are detectors. Energy spectrometers with an accuracy of ± 50 MeV/c 2 for pulse-to-pulse center of mass energy measurement are to be installed. Longitudinal polarized electrons are expected, and will allow more precise tests of the standard model

  3. Neuropathological characteristics of the brain in two patients with SLC19A3 mutations related to the biotin-thiamine-responsive basal ganglia disease

    Directory of Open Access Journals (Sweden)

    Maciej Pronicki

    2017-06-01

    Full Text Available Biotin-thiamine-responsive basal ganglia disease is a severe form of a rare neurogenetic disorder caused by pathogenic molecular variants in the thiamine transporter gene. Nowadays, a potentially effective treatment is known, therefore the early diagnosis is mandatory. The aim of the paper was to assess the contribution of neuropathological and magnetic resonance imaging (MRI studies to a proper diagnosis. We present the brain study of two Polish patients with SLC19A3 mutations, including (1 an infant with an intriguing “walnut” appearance of the brain autopsied many years before the discovery of the SLC19A3 defect, and (2 a one-year-old patient with clinical features of Leigh syndrome. In patient 2, biotin/thiamine responsiveness was not tested at the time of diagnosis and causal treatment started with one-year delay. The central nervous system lesions found in the patients displayed almost clearly a specific pattern for SLC19A3 defect, as previously proposed in diagnostic criteria. Our study presents a detailed description of neuropathological and MRI findings of both patients. We confirm that the autopsy and/or MRI of the brain is sufficient to qualify a patient with an unknown neuropathological disorder directly for SLC19A3 mutations testing and a prompt trial of specific treatment.

  4. Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: the Viva La Familia Study.

    Science.gov (United States)

    Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

    2015-04-01

    Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. We conducted a genomewide association study with 1.1 million genetic markers in 815 children. We found serum uric acid to be significantly heritable [h(2) ± SD = 0.45 ± 0.08, P = 5.8 × 10(-11)] and associated with SLC2A9 variants (P values between 10(-16) and 10(-7)). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. © 2015 American Society for Nutrition.

  5. NBCe1 (SLC4A4) a potential pH regulator in enamel organ cells during enamel development in the mouse

    NARCIS (Netherlands)

    Jalali, R.; Guo, J.; Zandieh-Doulabi, B.; Bervoets, T.J.M.; Paine, M.L.; Boron, W.F.; Parker, M.D.; Bijvelds, M.J.C.; Medina, J.F.; DenBesten, P.K.; Bronckers, A.L.J.J.

    2014-01-01

    During the formation of dental enamel, maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by cotransporting HCO3 − with Na+. Mutation in SLC4A4 (coding for the sodium-bicarbonate

  6. A mild form of SLC29A3 disorder: a frameshift deletion leads to the paradoxical translation of an otherwise noncoding mRNA splice variant.

    Directory of Open Access Journals (Sweden)

    Alexandre Bolze

    Full Text Available We investigated two siblings with granulomatous histiocytosis prominent in the nasal area, mimicking rhinoscleroma and Rosai-Dorfman syndrome. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous frameshift deletion in SLC29A3, which encodes human equilibrative nucleoside transporter-3 (hENT3. Germline mutations in SLC29A3 have been reported in rare patients with a wide range of overlapping clinical features and inherited disorders including H syndrome, pigmented hypertrichosis with insulin-dependent diabetes, and Faisalabad histiocytosis. With the exception of insulin-dependent diabetes and mild finger and toe contractures in one sibling, the two patients with nasal granulomatous histiocytosis studied here displayed none of the many SLC29A3-associated phenotypes. This mild clinical phenotype probably results from a remarkable genetic mechanism. The SLC29A3 frameshift deletion prevents the expression of the normally coding transcripts. It instead leads to the translation, expression, and function of an otherwise noncoding, out-of-frame mRNA splice variant lacking exon 3 that is eliminated by nonsense-mediated mRNA decay (NMD in healthy individuals. The mutated isoform differs from the wild-type hENT3 by the modification of 20 residues in exon 2 and the removal of another 28 amino acids in exon 3, which include the second transmembrane domain. As a result, this new isoform displays some functional activity. This mechanism probably accounts for the narrow and mild clinical phenotype of the patients. This study highlights the 'rescue' role played by a normally noncoding mRNA splice variant of SLC29A3, uncovering a new mechanism by which frameshift mutations can be hypomorphic.

  7. SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.

    Science.gov (United States)

    Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S

    2017-04-01

    A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

  8. Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth

    Science.gov (United States)

    Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2012-01-01

    Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245

  9. Deletion of the γ-Aminobutyric Acid Transporter 2 (GAT2 and SLC6A13) Gene in Mice Leads to Changes in Liver and Brain Taurine Contents*

    Science.gov (United States)

    Zhou, Yun; Holmseth, Silvia; Guo, Caiying; Hassel, Bjørnar; Höfner, Georg; Huitfeldt, Henrik S.; Wanner, Klaus T.; Danbolt, Niels C.

    2012-01-01

    The GABA transporters (GAT1, GAT2, GAT3, and BGT1) have mostly been discussed in relation to their potential roles in controlling the action of transmitter GABA in the nervous system. We have generated the first mice lacking the GAT2 (slc6a13) gene. Deletion of GAT2 (both mRNA and protein) neither affected growth, fertility, nor life span under nonchallenging rearing conditions. Immunocytochemistry showed that the GAT2 protein was predominantly expressed in the plasma membranes of periportal hepatocytes and in the basolateral membranes of proximal tubules in the renal cortex. This was validated by processing tissue from wild-type and knockout mice in parallel. Deletion of GAT2 reduced liver taurine levels by 50%, without affecting the expression of the taurine transporter TAUT. These results suggest an important role for GAT2 in taurine uptake from portal blood into liver. In support of this notion, GAT2-transfected HEK293 cells transported [3H]taurine. Furthermore, most of the uptake of [3H]GABA by cultured rat hepatocytes was due to GAT2, and this uptake was inhibited by taurine. GAT2 was not detected in brain parenchyma proper, excluding a role in GABA inactivation. It was, however, expressed in the leptomeninges and in a subpopulation of brain blood vessels. Deletion of GAT2 increased brain taurine levels by 20%, suggesting a taurine-exporting role for GAT2 in the brain. PMID:22896705

  10. Synthesis and preclinical characterization of 1-(6'-deoxy-6'-[18F]fluoro-β-d-allofuranosyl)-2-nitroimidazole (β-6'-[18F]FAZAL) as a positron emission tomography radiotracer to assess tumor hypoxia.

    Science.gov (United States)

    Wanek, Thomas; Kreis, Katharina; Križková, Petra; Schweifer, Anna; Denk, Christoph; Stanek, Johann; Mairinger, Severin; Filip, Thomas; Sauberer, Michael; Edelhofer, Patricia; Traxl, Alexander; Muchitsch, Viktoria E; Mereiter, Kurt; Hammerschmidt, Friedrich; Cass, Carol E; Damaraju, Vijaya L; Langer, Oliver; Kuntner, Claudia

    2016-11-01

    Positron emission tomography (PET) using fluorine-18 ( 18 F)-labeled 2-nitroimidazole radiotracers has proven useful for assessment of tumor oxygenation. However, the passive diffusion-driven cellular uptake of currently available radiotracers results in slow kinetics and low tumor-to-background ratios. With the aim to develop a compound that is actively transported into cells, 1-(6'-deoxy-6'-[ 18 F]fluoro-β-d-allofuranosyl)-2-nitroimidazole (β-[ 18 F]1), a putative nucleoside transporter substrate, was synthetized by nucleophilic [ 18 F]fluoride substitution of an acetyl protected labeling precursor with a tosylate leaving group (β-6) in a final radiochemical yield of 12±8% (n=10, based on [ 18 F]fluoride starting activity) in a total synthesis time of 60min with a specific activity at end of synthesis of 218±58GBq/μmol (n=10). Both radiolabeling precursor β-6 and unlabeled reference compound β-1 were prepared in multistep syntheses starting from 1,2:5,6-di-O-isopropylidene-α-d-allofuranose. In vitro experiments demonstrated an interaction of β-1 with SLC29A1 and SLC28A1/2/3 nucleoside transporter as well as hypoxia specific retention of β-[ 18 F]1 in tumor cell lines. In biodistribution studies in healthy mice β-[ 18 F]1 showed homogenous tissue distribution and excellent metabolic stability, which was unaffected by tissue oxygenation. PET studies in tumor bearing mice showed tumor-to-muscle ratios of 2.13±0.22 (n=4) at 2h after administration of β-[ 18 F]1. In ex vivo autoradiography experiments β-[ 18 F]1 distribution closely matched staining with the hypoxia marker pimonidazole. In conclusion, β-[ 18 F]1 shows potential as PET hypoxia radiotracer which merits further investigation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss

    Directory of Open Access Journals (Sweden)

    Pereira Fred A

    2005-08-01

    Full Text Available Abstract Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45. The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330. Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5. Conclusion These data suggest that the IVS2-2A>G variant may not occur more frequently in hearing impaired subjects than in controls. The identification of five potential alternative splice acceptor sites in

  12. A Study of Single Nucleotide Polymorphisms of the SLC19A1/RFC1 Gene in Subjects with Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Naila Al Mahmuda

    2016-05-01

    Full Text Available Autism Spectrum Disorder (ASD is a group of neurodevelopmental disorders with complex genetic etiology. Recent studies have indicated that children with ASD may have altered folate or methionine metabolism, suggesting that the folate–methionine cycle may play a key role in the etiology of ASD. SLC19A1, also referred to as reduced folate carrier 1 (RFC1, is a member of the solute carrier group of transporters and is one of the key enzymes in the folate metabolism pathway. Findings from multiple genomic screens suggest the presence of an autism susceptibility locus on chromosome 21q22.3, which includes SLC19A1. Therefore, we performed a case-control study in a Japanese population. In this study, DNA samples obtained from 147 ASD patients at the Kanazawa University Hospital in Japan and 150 unrelated healthy Japanese volunteers were examined by the sequence-specific primer-polymerase chain reaction method pooled with fluorescence correlation spectroscopy. p < 0.05 was considered to represent a statistically significant outcome. Of 13 single nucleotide polymorphisms (SNPs examined, a significant p-value was obtained for AA genotype of one SNP (rs1023159, OR = 0.39, 95% CI = 0.16–0.91, p = 0.0394; Fisher’s exact test. Despite some conflicting results, our findings supported a role for the polymorphism rs1023159 of the SLC19A1 gene, alone or in combination, as a risk factor for ASD. However, the findings were not consistent after multiple testing corrections. In conclusion, although our results supported a role of the SLC19A1 gene in the etiology of ASD, it was not a significant risk factor for the ASD samples analyzed in this study.

  13. First results from SLD with polarized electron beam at SLC

    International Nuclear Information System (INIS)

    Fero, M.J.

    1992-12-01

    The SLAC Linear Collider (SLC) has been modified to collide a longitudinally polarized electron beam with the unpolarized positron beam. We review the beginning of polarized beam running at the SLC, and report on the measurement of the left-right cross section asymmetry (A LR ) made with a sample of 10,224 Z decays collected over the course of the 1992 run. The average beam polarization for this set of Z decays was 22.4 ± 0.6%(syst.). A LR was measured to be 0.100 ± 0.044(stat.) ± 0.004(syst.). From this measurement, the weak mixing angle defined at the Z boson pole is determined to be sin 2 θ eff W = 0.2378 ± 0.0056 ± 0.0005

  14. The mitochondrial citrate carrier, SLC25A1, drives stemness and therapy resistance in non-small cell lung cancer.

    Science.gov (United States)

    Fernandez, Harvey R; Gadre, Shreyas M; Tan, Mingjun; Graham, Garrett T; Mosaoa, Rami; Ongkeko, Martin S; Kim, Kyu Ah; Riggins, Rebecca B; Parasido, Erika; Petrini, Iacopo; Pacini, Simone; Cheema, Amrita; Varghese, Rency; Ressom, Habtom W; Zhang, Yuwen; Albanese, Christopher; Üren, Aykut; Paige, Mikell; Giaccone, Giuseppe; Avantaggiati, Maria Laura

    2018-04-12

    Therapy resistance represents a clinical challenge for advanced non-small cell lung cancer (NSCLC), which still remains an incurable disease. There is growing evidence that cancer-initiating or cancer stem cells (CSCs) provide a reservoir of slow-growing dormant populations of cells with tumor-initiating and unlimited self-renewal ability that are left behind by conventional therapies reigniting post-therapy relapse and metastatic dissemination. The metabolic pathways required for the expansion of CSCs are incompletely defined, but their understanding will likely open new therapeutic opportunities. We show here that lung CSCs rely upon oxidative phosphorylation for energy production and survival through the activity of the mitochondrial citrate transporter, SLC25A1. We demonstrate that SLC25A1 plays a key role in maintaining the mitochondrial pool of citrate and redox balance in CSCs, whereas its inhibition leads to reactive oxygen species build-up thereby inhibiting the self-renewal capability of CSCs. Moreover, in different patient-derived tumors, resistance to cisplatin or to epidermal growth factor receptor (EGFR) inhibitor treatment is acquired through SLC25A1-mediated implementation of mitochondrial activity and induction of a stemness phenotype. Hence, a newly identified specific SLC25A1 inhibitor is synthetic lethal with cisplatin or with EGFR inhibitor co-treatment and restores antitumor responses to these agents in vitro and in animal models. These data have potential clinical implications in that they unravel a metabolic vulnerability of drug-resistant lung CSCs, identify a novel SLC25A1 inhibitor and, lastly, provide the first line of evidence that drugs, which block SLC25A1 activity, when employed in combination with selected conventional antitumor agents, lead to a therapeutic benefit.

  15. SLC energy spectrum monitor using synchrotron radiation

    International Nuclear Information System (INIS)

    Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.

    1986-01-01

    The SLAC linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. The energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08 %. The design considerations of this monitor are presented. A pair of these monitors is under construction with an installation data set for late summer 1986

  16. SLC kicker magnet limitations

    International Nuclear Information System (INIS)

    Cassel, R.; Donaldson, A.; Mattison, T.; Bowden, G.; Weaver, J.; Bulos, F.; Fiander, D.

    1991-01-01

    The SLC Damping Ring kicker magnets requires a fast magnetic field rise time of 58 nsec, a peak field of 800 gauss, a pulse amplitude stability of 0.01%, and a reasonable operational lifetime. The original kicker magnets designed by SLAC and at Fermi were not able to fulfill the SLC kicker requirements. Extensive studies were conducted to determine the limitation in the magnets, response of the ferrite in kicker magnet, and the modifications needed to improve the kicker magnet performance. The paper details the SLAC and Fermi kicker magnets limitation of performance

  17. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability.

    Science.gov (United States)

    Dufay, J Noelia; Fernández-Murray, J Pedro; McMaster, Christopher R

    2017-06-07

    The SLC25 family member SLC25A38 (Hem25 in yeast) was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25 Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1 Δ hem25 Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components. Copyright © 2017 Dufay et al.

  18. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability

    Directory of Open Access Journals (Sweden)

    J. Noelia Dufay

    2017-06-01

    Full Text Available The SLC25 family member SLC25A38 (Hem25 in yeast was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25. Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1Δ hem25Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components.

  19. Brain calcification process and phenotypes according to age and sex: Lessons from SLC20A2, PDGFB, and PDGFRB mutation carriers.

    Science.gov (United States)

    Nicolas, Gaël; Charbonnier, Camille; de Lemos, Roberta Rodrigues; Richard, Anne-Claire; Guillin, Olivier; Wallon, David; Legati, Andrea; Geschwind, Daniel; Coppola, Giovanni; Frebourg, Thierry; Campion, Dominique; de Oliveira, João Ricardo Mendes; Hannequin, Didier

    2015-10-01

    Primary Familial Brain Calcification (PFBC) is a dominantly inherited cerebral microvascular calcifying disorder with diverse neuropsychiatric expression. Three causative genes have been identified: SLC20A2, PDGFRB and, recently, PDGFB, whose associated phenotype has not yet been extensively studied. We included in the largest published case series of genetically confirmed PFBC, 19 PDGFB (including three new mutations), 24 SLC20A2 (including 4 new mutations), and 14 PDGFRB mutation carriers, from two countries (France and Brazil). We studied clinical features and applied our visual rating scale on all 49 available CT scans. Among the symptomatic mutation carriers (33/57, 58%), the three most frequently observed categories of clinical features were psychiatric signs (72.7%, 76.5%, and 80% for PDGFB, SLC20A2, and PDGFRB, respectively), movement disorders (45.5%, 76.5%, and 40%), and cognitive impairment (54.6%, 64.7%, and 40%). The median age of clinical onset was 31 years, 25% had an early onset (before 18) and 25% a later onset (after 53). Patients with an early clinical onset exhibited mostly isolated psychiatric or cognitive signs, while patients with a later onset exhibited mostly movement disorders, especially in association with other clinical features. CT scans rating allowed identifying four patterns of calcification. The total calcification score was best predicted by the combined effects of gene (SLC20A2 > PDGFB > PDGFRB mutations), sex (male), and (increasing) age, defining three risk classes, which correlated with the four patterns of calcification. These calcification patterns could reflect the natural history of the calcifying process, with distinct risk classes characterized by different age at onset or rate of progression. © 2015 Wiley Periodicals, Inc.

  20. Filling Landsat ETM+ SLC-off gaps using a segmentation model approach

    Science.gov (United States)

    Maxwell, Susan

    2004-01-01

    The purpose of this article is to present a methodology for filling Landsat Scan Line Corrector (SLC)-off gaps with same-scene spectral data guided by a segmentation model. Failure of the SLC on the Landsat 7 Enhanced Thematic Mapper Plus (ETM+) instrument resulted in a loss of approximately 25 percent of the spectral data. The missing data span across most of the image with scan gaps varying in size from two pixels near the center of the image to 14 pixels along the east and west edges. Even with the scan gaps, the radiometric and geometric qualities of the remaining portions of the image still meet design specifications and therefore contain useful information (see http:// landsat7.usgs.gov for additional information). The U.S. Geological Survey EROS Data Center (EDC) is evaluating several techniques to fill the gaps in SLC-off data to enhance the usability of the imagery (Howard and Lacasse 2004) (PE&RS, August 2004). The method presented here uses a segmentation model approach that allows for same-scene spectral data to be used to fill the gaps. The segment model is generated from a complete satellite image with no missing spectral data (e.g., Landsat 5, Landsat 7 SLCon, SPOT). The model is overlaid on the Landsat SLC-off image, and the missing data within the gaps are then estimated using SLC-off spectral data that intersect the segment boundary. A major advantage of this approach is that the gaps are filled using spectral data derived from the same SLC-off satellite image.

  1. Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family.

    Science.gov (United States)

    Mackenzie, Bryan; Erickson, Jeffrey D

    2004-02-01

    The sodium-coupled neutral amino acid transporters (SNAT) of the SLC38 gene family resemble the classically-described System A and System N transport activities in terms of their functional properties and patterns of regulation. Transport of small, aliphatic amino acids by System A subtypes (SNAT1, SNAT2, and SNAT4) is rheogenic and pH sensitive. The System N subtypes SNAT3 and SNAT5 also countertransport H(+), which may be key to their operation in reverse, and have narrower substrate profiles than do the System A subtypes. Glutamine emerges as a favored substrate throughout the family, except for SNAT4. The SLC38 transporters undoubtedly play many physiological roles including the transfer of glutamine from astrocyte to neuron in the CNS, ammonia detoxification and gluconeogenesis in the liver, and the renal response to acidosis. Probing their regulation has revealed additional roles, and recent work has considered SLC38 transporters as therapeutic targets in neoplasia.

  2. Identification of novel mutations in HFE, HFE2, TfR2, and SLC40A1 genes in Chinese patients affected by hereditary hemochromatosis.

    Science.gov (United States)

    Wang, Yongwei; Du, Yali; Liu, Gang; Guo, Shanshan; Hou, Bo; Jiang, Xianyong; Han, Bing; Chang, Yanzhong; Nie, Guangjun

    2017-04-01

    Hereditary hemochromatosis (HH) is a group of inherited iron-overload disorders associated with pathogenic defects in the genes encoding hemochromatosis (HFE), hemojuvelin (HJV/HFE2), hepcidin (HAMP), transferrin receptor 2 (TfR2), and ferroportin (FPN1/SLC40A1) proteins, and the clinical features are well described. However, there have been only a few detailed reports of HH in Chinese populations. Thus, there is insufficient patient information for population-based analyses in Chinese populations or comparative studies among different ethical groups. In the current work, we describe eight Chinese cases of hereditary hemochromatosis. Gene sequencing results revealed eight mutations (five novel mutations) in HFE, HFE2, TfR2, and SLC40A1 genes in these Chinese HH patients. In addition, we used Polymorphism Phenotyping v2 (Polyphen), Sorting Intolerant From Tolerant (SIFT), and a sequence alignment program to predict the molecular consequences of missense mutations.

  3. Structure of Bor1 supports an elevator transport mechanism for SLC4 anion exchangers.

    Science.gov (United States)

    Thurtle-Schmidt, Bryan H; Stroud, Robert M

    2016-09-20

    Boron is essential for plant growth because of its incorporation into plant cell walls; however, in excess it is toxic to plants. Boron transport and homeostasis in plants is regulated in part by the borate efflux transporter Bor1, a member of the solute carrier (SLC) 4 transporter family with homology to the human bicarbonate transporter Band 3. Here, we present the 4.1-Å resolution crystal structure of Arabidopsis thaliana Bor1. The structure displays a dimeric architecture in which dimerization is mediated by centralized Gate domains. Comparisons with a structure of Band 3 in an outward-open state reveal that the Core domains of Bor1 have rotated inwards to achieve an occluded state. Further structural comparisons with UapA, a xanthine transporter from the nucleobase-ascorbate transporter family, show that the downward pivoting of the Core domains relative to the Gate domains may access an inward-open state. These results suggest that the SLC4, SLC26, and nucleobase-ascorbate transporter families all share an elevator transport mechanism in which alternating access is provided by Core domains that carry substrates across a membrane.

  4. Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: the Viva La Familia Study1234

    Science.gov (United States)

    Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

    2015-01-01

    Background: Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. Objective: The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. Design: We conducted a genomewide association study with 1.1 million genetic markers in 815 children. Results: We found serum uric acid to be significantly heritable [h2 ± SD = 0.45 ± 0.08, P = 5.8 × 10−11] and associated with SLC2A9 variants (P values between 10−16 and 10−7). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Conclusions: Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. PMID:25833971

  5. Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1 in the Xhosa population of South Africa

    Directory of Open Access Journals (Sweden)

    Clifford Jacobs

    2014-06-01

    Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

  6. Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2012-10-15

    Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype. Copyright © 2012. Published by Elsevier B.V.

  7. Modulation of sodium-bicarbonate co-transporter (SLC4A4/NBCe1) protein and mRNA expression in rat's uteri by sex-steroids and at different phases of the oestrous cycle.

    Science.gov (United States)

    Gholami, Khadijeh; Muniandy, Sekaran; Salleh, Naguib

    2014-02-01

    Oestrogen-induced uterine fluid sodium (Na(+)) and bicarbonate (HCO3(-)) secretion may involve SLC4A4. We hypothesized that uterine SLC4A4 expression changes under different sex-steroid influence, therefore may account for the fluctuation in uterine fluid Na(+) and HCO3(-) content throughout the oestrous cycle. The aim of this study is to investigate the differential effects of sex-steroids and oestrous cycle phases on uterine SLC4A4 expression. Adult female WKY rats were ovariectomised and treated with different doses of 17β-oestradiol (E2) (0.2, 2, 20 and 50 μg/ml/day) or progesterone (P4) (4 mg/ml/day) for three consecutive days and 3 days treatment with 0.2 μg/ml/day E2 followed by another 3 days with P4 to mimic the hormonal changes in early pregnancy. Oestrous cycle phases in intact, non-ovariectomised rats were determined by vaginal smear. The animals were then sacrificed and uteri were removed for protein and mRNA expression analyses by Western blotting and Real Time PCR, respectively. SLC4A4 distribution was observed by immunohistochemistry. Treatment with increasing E2 doses resulted in a dose-dependent increase in SLC4A4 protein expression. High SLC4A4 protein and mRNA expression can be seen at estrus. SLC4A4 is distributed mainly at the apical as well as basolateral membranes of the luminal and glandular epithelia following E2 treatment and at Es. Meanwhile, SLC4A4 expression was reduced following P4 treatment and was low at diestrus. High SLC4A4 expression under estrogen dominance may contribute to the increase in uterine fluid Na(+) and HCO3(-) content, while its low expression under P4 dominance may result in vice versa. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. SLC26A4 mutations are associated with a specific inner ear malformation.

    Science.gov (United States)

    Fitoz, Suat; Sennaroğlu, Levent; Incesulu, Armağan; Cengiz, Filiz Başak; Koç, Yasemin; Tekin, Mustafa

    2007-03-01

    Inner ear anomalies have been reported in approximately 30% of children with early onset deafness. Identification of causative genetic factors in a large proportion of these patients was not successful. Mutations in the SLC26A4 gene have been detected in individuals with enlarged vestibular aqueduct (EVA) or Mondini dysplasia. We aimed to characterize the inner ear anomalies associated with SLC26A4 mutations. The SLC26A4 gene has been screened for mutations in 16 subjects from 14 unrelated Turkish families with a variety of inner ear anomalies ranging from Michel aplasia to incomplete partition-II and EVA. None of the patients was diagnosed to have a recognizable genetic syndrome. Additional four patients with Pendred syndrome from three families were included. Only one patient with EVA was found to have a heterozygous mutation (c.1586delT) in SLC26A4. All patients with Pendred syndrome had homozygous mutations and were noted to have either EVA or EVA associated with incomplete partition-II on the computed tomography of the temporal bone. SLC26A4 mutations are not associated with a large spectrum of inner ear anomalies. They, instead, result in a specific morphological appearance consistent with EVA or incomplete partition-II.

  9. The D543N polymorphism of the SLC11A1/NRAMP1 gene is associated with treatment failure in male patients with pulmonary tuberculosis.

    Science.gov (United States)

    Salinas-Delgado, Yvain; Galaviz-Hernández, Carlos; Toral, René García; Ávila Rejón, Carmen A; Reyes-Lopez, Miguel A; Martínez, Antonio Rojas; Martínez-Aguilar, Gerardo; Sosa-Macías, Martha

    2015-09-01

    Polymorphisms in SLC11A1/NRAMP1 have shown an important association with susceptibility to tuberculosis and progression to active disease. However, whether there is an association of these polymorphisms with treatment failure is unknown. The aim of this study was to determine the association of SLC11A1 polymorphisms with treatment failure in Mexican subjects with pulmonary tuberculosis. Thirty-three subjects with treatment failure were paired by age and body mass index with 33 patients who successfully completed treatment and were considered cured. We assessed the polymorphisms of SLC11A1 in the regions of D543N and INT4 via polymerase chain reaction real-time TaqMan® single nucleotide polymorphism (SNP) genotyping. We found that D543N (G/A genotype) was associated with treatment failure in patients with pulmonary tuberculosis [odds ratio (OR) 11.61, 95% confidence interval (CI) 3.66-36.78]. When adjusted by gender, this association remained significant in males (OR 11.09, 95% CI 3.46-35.51). In our male population, the presence of the D543N polymorphism of SLC11A1 is a risk factor for treatment failure. This finding should be confirmed in other populations.

  10. Anticipation in a family with primary familial brain calcification caused by an SLC20A2 variant.

    Science.gov (United States)

    Konno, Takuya; Blackburn, Patrick R; Rozen, Todd D; van Gerpen, Jay A; Ross, Owen A; Atwal, Paldeep S; Wszolek, Zbigniew K

    2018-04-11

    To describe a family with primary familial brain calcification (PFBC) due to SLC20A2 variant showing possible genetic anticipation. We conducted historical, genealogical, clinical, and radiologic studies of a family with PFBC. Clinical evaluations including neurological examination and head computed tomography (CT) scans of a proband and her father were performed. They provided additional information regarding other family members. To identify a causative gene variant, we performed whole-exome sequencing for the proband followed by segregation analysis in other affected members using direct sequencing. In this family, nine affected members were identified over four generations. The proband suffered from chronic daily headache including thunderclap headache. We identified an SLC20A2 (c.509delT, p.(Leu170*)) variant in three affected members over three generations. Interestingly, the age of onset became younger as the disease passed through successive generations, suggestive of genetic anticipation. For clinical purpose, it is important to consider thunderclap headache and genetic anticipation in PFBC caused by SLC20A2 variants. Further investigation is required to validate our observation. Copyright © 2018 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  11. A customized pigmentation SNP array identifies a novel SNP associated with melanoma predisposition in the SLC45A2 gene.

    Directory of Open Access Journals (Sweden)

    Maider Ibarrola-Villava

    Full Text Available As the incidence of Malignant Melanoma (MM reflects an interaction between skin colour and UV exposure, variations in genes implicated in pigmentation and tanning response to UV may be associated with susceptibility to MM. In this study, 363 SNPs in 65 gene regions belonging to the pigmentation pathway have been successfully genotyped using a SNP array. Five hundred and ninety MM cases and 507 controls were analyzed in a discovery phase I. Ten candidate SNPs based on a p-value threshold of 0.01 were identified. Two of them, rs35414 (SLC45A2 and rs2069398 (SILV/CKD2, were statistically significant after conservative Bonferroni correction. The best six SNPs were further tested in an independent Spanish series (624 MM cases and 789 controls. A novel SNP located on the SLC45A2 gene (rs35414 was found to be significantly associated with melanoma in both phase I and phase II (P<0.0001. None of the other five SNPs were replicated in this second phase of the study. However, three SNPs in TYR, SILV/CDK2 and ADAMTS20 genes (rs17793678, rs2069398 and rs1510521 respectively had an overall p-value<0.05 when considering the whole DNA collection (1214 MM cases and 1296 controls. Both the SLC45A2 and the SILV/CDK2 variants behave as protective alleles, while the TYR and ADAMTS20 variants seem to function as risk alleles. Cumulative effects were detected when these four variants were considered together. Furthermore, individuals carrying two or more mutations in MC1R, a well-known low penetrance melanoma-predisposing gene, had a decreased MM risk if concurrently bearing the SLC45A2 protective variant. To our knowledge, this is the largest study on Spanish sporadic MM cases to date.

  12. [Analysis the relationship between SLC26A4 mutation and current diagnosis of inner ear malformation in children with sensorineural hearing loss].

    Science.gov (United States)

    Sun, Baochun; Zhou, Chengyong; Dai, Zhiyao

    2014-11-01

    Explore the relationship between the pathogenic mutations of SLC26A4 gene and inner ear malformation, and analyze the feasibility of genetic testing to help current diagnosis in part of children with sensorineural hearing loss. 2094 cases of children were detected by SLC26A4 with the method of DNA sequence. CT phenotypes of those children were classified according to the method proposed by Sennaroglu. We analyzed the relationship between the pathogenic mutations of gene and the CT phenotypes. (1) 685 cases of inner ear malformations were found in 2094 cases of children with sensorineural hearing loss by CT examination (371 cases of cochlea malformation were consisted of the follow types of malformation. Michel deformity was 6 cases, cochlea aplasia was 8 cases, common cavity deformity was 12 cases, incomplete partition type I was 27 cases, cochlea hypoplasia was 30 cases and Mondini malformation was 288 cases); Vestibular aqueduct was 265 cases; Vestibular/semicircular canal/internal auditory canal were 49 cases, normal was 1409 cases. (2) The DNA sequence results revealed that 465 cases carried pathogenic mutations (Bi-allelic mutations) of SLC26A4 gene, among which 135 cases were homozygous, 330 cases were compound heterozygous. (3) Pathogenic mutations of SLC26A4 gene detected 100% (465/465) in the group related to vestibular aqueduct malformation. The results suggest that pathogenic mutation of SLC26A4 gene is closely related to the CT phenotype of vestibular aqueduct malformation. Detecting of pathogenic mutations for hearing loss is binging the possibility to identify children with inner malformations at an early stage. As a consequence, it will improve the current diagnosis and therapeutical option.

  13. Linking chronic infection and autoimmune diseases: Mycobacterium avium subspecies paratuberculosis, SLC11A1 polymorphisms and type-1 diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Daniela Paccagnini

    2009-09-01

    Full Text Available The etiology of type 1 diabetes mellitus (T1DM is still unknown; numerous studies are performed to unravel the environmental factors involved in triggering the disease. SLC11A1 is a membrane transporter that is expressed in late endosomes of antigen presenting cells involved in the immunopathogenic events leading to T1DM. Mycobacterium avium subsp. paratuberculosis (MAP has been reported to be a possible trigger in the development of T1DM.Fifty nine T1DM patients and 79 healthy controls were genotyped for 9 polymorphisms of SLC11A1 gene, and screened for the presence of MAP by PCR. Differences in genotype frequency were evaluated for both T1DM patients and controls. We found a polymorphism in the SLC11A1 gene (274C/T associated to type 1 diabetic patients and not to controls. The presence of MAP DNA was also significantly associated with T1DM patients and not with controls.The 274C/T SCL11A1 polymorphism was found to be associated with T1DM as well as the presence of MAP DNA in blood. Since MAP persists within macrophages and it is also processed by dendritic cells, further studies are necessary to evaluate if mutant forms of SLC11A1 alter the processing or presentation of MAP antigens triggering thereby an autoimmune response in T1DM patients.

  14. Activation of lysosomal P2X4 by ATP transported into lysosomes via VNUT/SLC17A9 using V‐ATPase generated voltage gradient as the driving force

    Science.gov (United States)

    Zhong, Xi Zoë; Cao, Qi; Sun, Xue

    2016-01-01

    Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609

  15. SLC polarized beam source electron optics design

    International Nuclear Information System (INIS)

    Eppley, K.R.; Lavine, T.L.; Early, R.A.; Herrmannsfeldt, W.B.; Miller, R.H.; Schultz, D.C.; Spencer, C.M.; Yeremian, A.D.

    1991-05-01

    This paper describes the design of the beam-line from the polarized electron gun to the linac injector in the Stanford Linear Collider (SLC). The polarized electron source is a GaAs photocathode, requiring 10 -11 -Torr-range pressure for adequate quantum efficiency and longevity. The photocathode is illuminated by 3-nsec-long laser pulses. The quality of the optics for the 160-kV beam is crucial since electron-stimulated gas desorption from beam loss in excess of 0.1% of the 20-nC pulses may poison the photocathode. Our design for the transport line consists of a differential pumping region isolated by a pair of valves. Focusing is provided by a pair of Helmholtz coils and by several iron-encased solenoidal lenses. Our optics design is based on beam transport simulations using 2 1/2-D particle-in-cell codes to model the gun and to solve the fully-relativistic time-dependent equations of motion in three dimensions for electrons in the presence of azimuthally symmetric electromagnetic fields. 6 refs., 6 figs

  16. SLC39A8 Deficiency: A Disorder of Manganese Transport and Glycosylation.

    Science.gov (United States)

    Park, Julien H; Hogrebe, Max; Grüneberg, Marianne; DuChesne, Ingrid; von der Heiden, Ava L; Reunert, Janine; Schlingmann, Karl P; Boycott, Kym M; Beaulieu, Chandree L; Mhanni, Aziz A; Innes, A Micheil; Hörtnagel, Konstanze; Biskup, Saskia; Gleixner, Eva M; Kurlemann, Gerhard; Fiedler, Barbara; Omran, Heymut; Rutsch, Frank; Wada, Yoshinao; Tsiakas, Konstantinos; Santer, René; Nebert, Daniel W; Rust, Stephan; Marquardt, Thorsten

    2015-12-03

    SLC39A8 is a membrane transporter responsible for manganese uptake into the cell. Via whole-exome sequencing, we studied a child that presented with cranial asymmetry, severe infantile spasms with hypsarrhythmia, and dysproportionate dwarfism. Analysis of transferrin glycosylation revealed severe dysglycosylation corresponding to a type II congenital disorder of glycosylation (CDG) and the blood manganese levels were below the detection limit. The variants c.112G>C (p.Gly38Arg) and c.1019T>A (p.Ile340Asn) were identified in SLC39A8. A second individual with the variants c.97G>A (p.Val33Met) and c.1004G>C (p.Ser335Thr) on the paternal allele and c.610G>T (p.Gly204Cys) on the maternal allele was identified among a group of unresolved case subjects with CDG. These data demonstrate that variants in SLC39A8 impair the function of manganese-dependent enzymes, most notably β-1,4-galactosyltransferase, a Golgi enzyme essential for biosynthesis of the carbohydrate part of glycoproteins. Impaired galactosylation leads to a severe disorder with deformed skull, severe seizures, short limbs, profound psychomotor retardation, and hearing loss. Oral galactose supplementation is a treatment option and results in complete normalization of glycosylation. SLC39A8 deficiency links a trace element deficiency with inherited glycosylation disorders. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  17. Physics at the SLC [SLAC Linear Collider

    International Nuclear Information System (INIS)

    Swartz, M.L.

    1990-11-01

    The SLAC Linear Collider (SLC) was constructed in the years 1983--1987 for two principal reasons: to develop the accelerator physics and technology that are necessary for the construction of future linear electron-positron colliders; and to produce electron-positron collisions at the Z 0 pole and to study the physics of the weak neutral current. To date, the SLC program has been quite successful at achieving the first goal. The machine has produced and collided high energy electron and positron beams of three-micron transverse size. The problems of operating an open geometry detector in an environment that is more akin to those found in fixed-target experiments than in storage rings have largely been solved. As a physics producing venture, the SLC has been less successful than was originally hoped but more successful than is commonly believed. Some of the results that have been produced by the Mark II experiment with a very modest data sample are competitive with those that have been produced with much larger samples by the four LEP collaborations. At the current, time, SLAC is engaged in an ambitious program to upgrade the SLC luminosity and to exploit one of its unique features, a spin polarized electron beam. These lectures are therefore organized into three sections: a brief description of the SLC; a review of the physics results that have been achieved with the Mark II detector; a description of the SLC's future: the realization and use of a polarized electron beam

  18. The polarized electron gun for the SLC

    International Nuclear Information System (INIS)

    Schultz, D.C.; Clendenin, J.; Frisch, J.; Hoyt, E.; Klaisner, L.; Woods, M.; Wright, D.; Zolotorev, M.

    1992-03-01

    A new polarized electron gun for use on the SLC at SLAC has been built and tested. It is a diode gun with a laser driven GaAs photocathode. It is designed to provide short (2ns) pulses of 10 A at 160 kV at 120 Hz. The design features of the gun and results from a testing program on a new and dedicated beam line are presented. Early results from operation on the SLC will also be shown

  19. Polarized source performance in 1992 for SLC--SLD

    International Nuclear Information System (INIS)

    Schultz, D.; Alley, R.; Clendenin, J.; Frisch, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Kulikov, A.; Prescott, C.; Saez, P.; Tang, H.; Turner, J.; Wicks, M.; Woods, M.; Yeremian, D.; Zolotorev, M.

    1993-02-01

    In its initial operation, the SLC Polarized Electron Source successfully met the SLC goals for 1992 for intensity and efficiency. However, the stability of the beam at the source was marginal, and the polarization was only ∼28%. The SLC goal to provide > 10,000 Z events for the SLD from polarized electrons was met

  20. Examining the role of components of Slc11a1 (Nramp1 in the susceptibility of New Zealand sea lions (Phocarctos hookeri to disease.

    Directory of Open Access Journals (Sweden)

    Amy J Osborne

    Full Text Available The New Zealand sea lion (NZSL, Phocarctos hookeri is a Threatened marine mammal with a restricted distribution and a small, declining, population size. The species is susceptible to bacterial pathogens, having suffered three mass mortality events since 1998. Understanding the genetic factors linked to this susceptibility is important in mitigating population decline. The gene solute carrier family 11 member a1 (Slc11a1 plays an important role in mammalian resistance or susceptibility to a wide range of bacterial pathogens. At present, Slc11a1 has not been characterised in many taxa, and despite its known roles in mediating the effects of infectious disease agents, has not been examined as a candidate gene in susceptibility or resistance in any wild population of conservation concern. Here we examine components of Slc11a1 in NZSLs and identify: i a polymorphic nucleotide in the promoter region; ii putative shared transcription factor binding motifs between canids and NZSLs; and iii a conserved polymorphic microsatellite in the first intron of Slc11a1, which together suggest conservation of Slc11a1 gene structure in otariids. At the promoter polymorphism, we demonstrate a shift away from normal allele frequency distributions and an increased likelihood of death from infectious causes with one allelic variant. While this increased likelihood is not statistically significant, lack of significance is potentially due to the complexity of genetic susceptibility to disease in wild populations. Our preliminary data highlight the potential significance of this gene in disease resistance in wild populations; further exploration of Slc11a1 will aid the understanding of susceptibility to infection in mammalian species of conservation significance.

  1. Single nucleotide polymorphism rs13042395 in the SLC52A3 gene as a biomarker for regional lymph node metastasis and relapse-free survival of esophageal squamous cell carcinoma patients

    International Nuclear Information System (INIS)

    Tan, Hua-Zhen; Wu, Zhi-Yong; Wu, Jian-Yi; Long, Lin; Jiao, Ji-Wei; Peng, Yu-Hui; Xu, Yi-Wei; Li, Shan-Shan; Wang, Wei; Zhang, Jian-Jun; Li, En-Min; Xu, Li-Yan

    2016-01-01

    SLC52A3 was recently identified as a susceptibility gene for esophageal squamous cell carcinoma (ESCC). However, associations between the single nucleotide polymorphisms (SNPs) rs13042395 (C > T) and rs3746803 (G > A) in SLC52A3 and risk, tumor characteristics and survival of ESCC patients remain inconclusive and of unknown prognostic significance. Analyses of the association between SNPs in SLC52A3 and ESCC risk were performed on 479 ESCC cases, together with 479 controls, in a case-control study. Blood samples for cases and controls were collected and genotyped by real-time polymerase chain reaction (PCR) using TaqMan assays. Among the 479 ESCC cases, 343 cases with complete clinical data were used to investigate the association between SNPs and ESCC clinical characteristics; 288 cases with complete clinical data and 5-year follow-up data were used to analyze the association between SNPs and prognosis. Dual luciferase reporter assays and electrophoretic mobility shift assays (EMSAs) were used to investigate the biological function of rs13042395. No association was found between SLC52A3 rs3746803 and susceptibility, tumor characteristics or survival of ESCC patients. For rs13042395, TT genotype carriers were likely to have reduced lymph node metastasis (odds ratio (OR) = 0.55, 95 % confidence interval (CI), 0.31–0.98) and longer relapse-free survival time (P = 0.03) . Also, both rs13042395 (hazard ratio (HR) = 0.62, 95 % CI, 0.38–0.99) and regional lymph node metastasis (HR = 2.06, 95 % CI, 1.36–3.13 for N1 vs. N0; HR = 2.88, 95 % CI, 1.70–4.86 for N2 vs. N0; HR = 2.08, 95 % CI, 1.01–4.30 for N3 vs. N0) were independent factors affecting relapse-free survival for ESCC patients who underwent surgery. Dual luciferase reporter assays and EMSAs suggested that the CC genotype of rs13042395 enhanced SLC52A3 expression, probably via binding with specific transcription factors. The rs13042395 polymorphism in SLC52A3 is associated with regional lymph node

  2. Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters

    Directory of Open Access Journals (Sweden)

    Markus Grube

    2018-04-01

    Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.

  3. Estimated carrier frequency of creatine transporter deficiency in females in the general population using functional characterization of novel missense variants in the SLC6A8 gene.

    Science.gov (United States)

    DesRoches, Caro-Lyne; Patel, Jaina; Wang, Peixiang; Minassian, Berge; Salomons, Gajja S; Marshall, Christian R; Mercimek-Mahmutoglu, Saadet

    2015-07-10

    Creatine transporter deficiency (CRTR-D) is an X-linked inherited disorder of creatine transport. All males and about 50% of females have intellectual disability or cognitive dysfunction. Creatine deficiency on brain proton magnetic resonance spectroscopy and elevated urinary creatine to creatinine ratio are important biomarkers. Mutations in the SLC6A8 gene occur de novo in 30% of males. Despite reports of high prevalence of CRTR-D in males with intellectual disability, there are no true prevalence studies in the general population. To determine carrier frequency of CRTR-D in the general population we studied the variants in the SLC6A8 gene reported in the Exome Variant Server database and performed functional characterization of missense variants. We also analyzed synonymous and intronic variants for their predicted pathogenicity using in silico analysis tools. Nine missense variants were functionally analyzed using transient transfection by site-directed mutagenesis with In-Fusion HD Cloning in HeLa cells. Creatine uptake was measured by liquid chromatography tandem mass spectrometry for creatine measurement. The c.1654G>T (p.Val552Leu) variant showed low residual creatine uptake activity of 35% of wild type transfected HeLa cells and was classified as pathogenic. Three variants (c.808G>A; p.Val270Met, c.942C>G; p.Phe314Leu and c.952G>A; p.Ala318Thr) were predicted to be pathogenic based on in silico analysis, but proved to be non-pathogenic by our functional analysis. The estimated carrier frequency of CRTR-D was 0.024% in females in the general population. We recommend functional studies for all novel missense variants by transient transfection followed by creatine uptake measurement by liquid chromatography tandem mass spectrometry as fast and cost effective method for the functional analysis of missense variants in the SLC6A8 gene. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

  4. Triiodothyronine Acutely Stimulates Glucose Transport into L6 Muscle Cells Without Increasing Surface GLUT4, GLUT1, or GLUT3

    Science.gov (United States)

    Teixeira, Silvania Silva; Tamrakar, Akhilesh K.; Goulart-Silva, Francemilson; Serrano-Nascimento, Caroline; Klip, Amira

    2012-01-01

    Background Thyroid hormones (THs) act genomically to stimulate glucose transport by elevating glucose transporter (Slc2a) expression and glucose utilization by cells. However, nongenomic effects of THs are now emerging. Here, we assess how triiodothyronine (T3) acutely affects glucose transport and the content of GLUT4, GLUT1, and GLUT3 at the surface of muscle cells, and possible interactions between T3 and insulin action. Methods Differentiated L6 myotubes transfected with myc-tagged Slc2a4 (L6-GLUT4myc) or Slc2a1 (L6-GLUT1myc) and wild-type L6 myotubes were studied in the following conditions: control, hypothyroid (Tx), Tx plus T3, Tx plus insulin, and Tx plus insulin and T3. Results Glucose uptake and GLUT4 content at the cell surface decreased in the Tx group relative to controls. T3 treatment for 30 minutes increased glucose transport into L6-GLUT4myc cells without altering surface GLUT4 content, which increased only thereafter. The total amount of GLUT4 protein remained unchanged among the groups studied. The surface GLUT1 content of L6-GLUT1myc cells also remained unaltered after T3 treatment; however, in these cells glucose transport was not stimulated by T3. In wild-type L6 cells, although T3 treatment increased the total amount of GLUT3, it did not change the surface GLUT3 content. Moreover, within 30 minutes, T3 stimulation of glucose uptake was additive to that of insulin in L6-GLUT4myc cells. As expected, insulin elevated surface GLUT4 content and glucose uptake. However, interestingly, surface GLUT4 content remained unchanged or even dropped with T3 plus insulin. Conclusions These data reveal that T3 rapidly increases glucose uptake in L6-GLUT4myc cells, which, at least for 30 minutes, did not depend on an increment in GLUT4 at the cell surface yet potentiates insulin action. We propose that this rapid T3 effect involves activation of GLUT4 transporters at the cell surface, but cannot discount the involvement of an unknown GLUT. PMID:22663547

  5. Hypoxic Stress Upregulates the Expression of Slc38a1 in Brown Adipocytes via Hypoxia-Inducible Factor-1α.

    Science.gov (United States)

    Horie, Tetsuhiro; Fukasawa, Kazuya; Iezaki, Takashi; Park, Gyujin; Onishi, Yuki; Ozaki, Kakeru; Kanayama, Takashi; Hiraiwa, Manami; Kitaguchi, Yuka; Kaneda, Katsuyuki; Hinoi, Eiichi

    2018-01-01

    The availability of amino acid in the brown adipose tissue (BAT) has been shown to be altered under various conditions; however, little is known about the possible expression and pivotal role of amino acid transporters in BAT under physiological and pathological conditions. The present study comprehensively investigated whether amino acid transporters are regulated by obesogenic conditions in BAT in vivo. Moreover, we investigated the mechanism underlying the regulation of the expression of amino acid transporters by various stressors in brown adipocytes in vitro. The expression of solute carrier family 38 member 1 (Slc38a1; gene encoding sodium-coupled neutral amino acid transporter 1) was preferentially upregulated in the BAT of both genetic and acquired obesity mice in vivo. Moreover, the expression of Slc38a1 was induced by hypoxic stress through hypoxia-inducible factor-1α, which is a master transcription factor of the adaptive response to hypoxic stress, in brown adipocytes in vitro. These results indicate that Slc38a1 is an obesity-associated gene in BAT and a hypoxia-responsive gene in brown adipocytes. © 2017 S. Karger AG, Basel.

  6. SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*

    Science.gov (United States)

    Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas

    2010-01-01

    Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830

  7. Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.

    Science.gov (United States)

    Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang

    2017-07-01

    Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.

  8. Amino acid derivatives are substrates or non-transported inhibitors of the amino acid transporter PAT2 (slc36a2).

    Science.gov (United States)

    Edwards, Noel; Anderson, Catriona M H; Gatfield, Kelly M; Jevons, Mark P; Ganapathy, Vadivel; Thwaites, David T

    2011-01-01

    The H(+)-coupled amino acid transporter PAT2 (SLC36A2) transports the amino acids proline, glycine, alanine and hydroxyproline. A physiological role played by PAT2 in amino acid reabsorption in the renal proximal tubule is demonstrated by mutations in SLC36A2 that lead to an iminoglycinuric phenotype (imino acid and glycine uria) in humans. A number of proline, GABA and tryptophan derivatives were examined to determine if they function either as transported substrates or non-transported inhibitors of PAT2. The compounds were investigated following heterologous expression of rat PAT2 in Xenopus laevis oocytes. PAT2 function was characterised by: radiotracer uptake and competition (cis-inhibition) studies; radiotracer efflux and trans-stimulation; and measurement of substrate-induced positive inward current by two-electrode voltage-clamp. In general, the proline derivatives appeared to be transported substrates and the relative ability to induce current flow was closely related to the inhibitory effects on PAT2-mediated l-[(3)H]proline uptake. In contrast, certain heterocyclic GABA derivatives (e.g. l-pipecolic acid) were translocated only slowly. Finally, the tryptophan derivatives inhibited PAT2 function but did not undergo transport. l-Proline uptake was inhibited by 5-hydroxy-l-tryptophan (IC(50) 1.6±0.4mM), α-methyl-d,l-tryptophan (3.5±1.5mM), l-tryptophan, 1-methyl-l-tryptophan and indole-3-propionic acid. Although neither 5-hydroxy-l-tryptophan nor α-methyl-d,l-tryptophan were able to elicit inward current in PAT2-expressing oocytes both reduced the current evoked by l-proline. 5-Hydroxy-l-tryptophan and α-methyl-d,l-tryptophan were unable to trans-stimulate l-proline efflux from PAT2-expressing oocytes, confirming that the two compounds act as non-transported blockers of PAT2. These two tryptophan derivatives should prove valuable experimental tools in future investigations of the physiological roles of PAT2. Copyright © 2010 Elsevier B.V. All rights

  9. Progressive irreversible hearing loss is caused by stria vascularis degeneration in an Slc26a4-insufficient mouse model of large vestibular aqueduct syndrome.

    Science.gov (United States)

    Ito, T; Nishio, A; Wangemann, P; Griffith, A J

    2015-12-03

    Hearing loss of patients with enlargement of the vestibular aqueduct (EVA) can fluctuate or progress, with overall downward progression. The most common detectable cause of EVA is mutations of SLC26A4. We previously described a transgenic Slc26a4-insufficient mouse model of EVA in which Slc26a4 expression is controlled by doxycycline administration. Mice that received doxycycline from conception until embryonic day 17.5 (DE17.5; doxycycline discontinued at embryonic day 17.5) had fluctuating hearing loss between 1 and 6 months of age with an overall downward progression after 6 months of age. In this study, we characterized the cochlear functional and structural changes underlying irreversible hearing loss in DE17.5 mice at 12 months of age. The endocochlear potential was decreased and inversely correlated with auditory brainstem response thresholds. The stria vascularis was thickened and edematous in ears with less severe hearing loss, and thinned and atrophic in ears with more severe hearing loss. There were pathologic changes in marginal cell morphology and gene expression that were not observed at 3 months. We conclude that strial dysfunction and degeneration are the primary causes of irreversible progressive hearing loss in our Slc26a4-insufficient mouse model of EVA. This model of primary strial atrophy may be used to explore the mechanisms of progressive hearing loss due to strial dysfunction. Published by Elsevier Ltd.

  10. Defective enamel and bone development in sodium-dependent citrate transporter (NaCT Slc13a5 deficient mice.

    Directory of Open Access Journals (Sweden)

    Armando R Irizarry

    Full Text Available There has been growing recognition of the essential roles of citrate in biomechanical properties of mineralized tissues, including teeth and bone. However, the sources of citrate in these tissues have not been well defined, and the contribution of citrate to the regulation of odontogenesis and osteogenesis has not been examined. Here, tooth and bone phenotypes were examined in sodium-dependent citrate transporter (NaCT Slc13a5 deficient C57BL/6 mice at 13 and 32 weeks of age. Slc13a5 deficiency led to defective tooth development, characterized by absence of mature enamel, formation of aberrant enamel matrix, and dysplasia and hyperplasia of the enamel organ epithelium that progressed with age. These abnormalities were associated with fragile teeth with a possible predisposition to tooth abscesses. The lack of mature enamel was consistent with amelogenesis imperfecta. Furthermore, Slc13a5 deficiency led to decreased bone mineral density and impaired bone formation in 13-week-old mice but not in older mice. The findings revealed the potentially important role of citrate and Slc13a5 in the development and function of teeth and bone.

  11. Orbit monitoring in the SLC

    International Nuclear Information System (INIS)

    Sanchez-Chopitea, L.; Emma, P.; Van Olst, D.

    1991-05-01

    Beam orbits in the SLC are monitored in real time and the data is stored for future trend and correlation analysis. A background process acquires Beam Position Monitor (BPM) and Toroid data on a periodic basis and saves the general quantities such as orbit RMS and beam intensity in addition to the individual readings. Some of this data is archived by the SLC History Buffer facility and the rest is saved in files for later analysis. This has permitted the tracing of interaction point instabilities to specific devices as far away as the damping rings. In addition, the data is displayed for the operators both in summary and in full form. The different displays can be configured from the control consoles. 2 refs., 5 figs

  12. Solute carrier protein family 11 member 1 (Slc11a1) activation efficiently inhibits Leishmania donovani survival in host macrophages.

    Science.gov (United States)

    Singh, Nisha; Gedda, Mallikarjuna Rao; Tiwari, Neeraj; Singh, Suya P; Bajpai, Surabhi; Singh, Rakesh K

    2017-09-01

    Visceral leishmaniasis (kala-azar), a life threatening disease caused by L. donovani , is a latent threat to more than 147 million people living in disease endemic South East Asia region of the Indian subcontinent. The therapeutic option to control leishmanial infections are very limited, and at present comprise only two drugs, an antifungal amphotericin B and an antitumor miltefosine, which are also highly vulnerable for parasitic resistance. Therefore, identification and development of alternate control measures is an exigent requirement to control leishmanial infections. In this study, we report that functionally induced expression of solute carrier protein family 11 member 1 ( Slc11a1), a transmembrane divalent cationic transporter recruited on the surface of phagolysosomes after phagocytosis of parasites, effectively inhibits Leishmania donovani growth in host macrophages. Further, the increased Slc11a1 functionality also resulted in increased production of NOx, TNF-α and IL-12 by activated macrophages. The findings of this study signify the importance of interplay between Slc11a1 expression and macrophages activation that can be effectively used to control of Leishmania growth and survival.

  13. Review of SLC performance

    International Nuclear Information System (INIS)

    Phinney, N.

    1992-08-01

    The SLAC Linear Collider (SLC) has begun a new era of operation with the SLD detector. During 1991 there was a first engineering run for the SLD in parallel with machine improvements to increase luminosity and reliability. For the 1992 run, a polarized electron source was added and more than 10,000 Zs with an average of 23% polarization have been logged by the SLD. This paper will discuss the performance of the SLC in 1991 and 1992 and the technical advances that have produced higher luminosity. Emphasis will be placed on issues relevant to future linear colliders such as producing and maintaining high-current, low-emittance beams and focusing the beams to the micron scale for collisions

  14. Lessons learned from the SLC

    Energy Technology Data Exchange (ETDEWEB)

    Phinney, N. [Stanford Univ., CA (United States). Stanford Linear Accelerator Center

    1998-07-01

    The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider.

  15. Lessons learned from the SLC

    International Nuclear Information System (INIS)

    Phinney, N.

    1998-01-01

    The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider

  16. Two novel mutations in the SLC40A1 and HFE genes implicated in iron overload in a Spanish man.

    Science.gov (United States)

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Alvarez-Sala-Walther, Luis-Antonio; Cuadrado-Grande, Nuria; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2011-03-01

    The most common form of hemochromatosis is caused by mutations in the HFE gene. Rare forms of the disease are caused by mutations in other genes. We present a patient with hyperferritinemia and iron overload, and facial flushing. Magnetic resonance imaging was performed to measure hepatic iron overload, and a molecular study of the genes involved in iron metabolism was undertaken. The iron overload was similar to that observed in HFE hemochromatosis, and the patient was double heterozygous for two novel mutations, c.-20G>A and c.718A>G (p.K240E), in the HFE and ferroportin (FPN1 or SLC40A1) genes, respectively. Hyperferritinemia and facial flushing improved after phlebotomy. Two of the patient's children were also studied, and the daughter was heterozygous for the mutation in the SLC40A1 gene, although she did not have hyperferritinemia. The patient presented a mild iron overload phenotype probably because of the two novel mutations in the HFE and SLC40A1 genes. © 2011 John Wiley & Sons A/S.

  17. Multi-channel pulser for the SLC thermionic electron source

    International Nuclear Information System (INIS)

    Browne, M.J.; Clendenin, J.E.; Corredoura, P.L.; Jobe, R.K.; Koontz, R.F.; Sodja, J.

    1985-01-01

    A new pulser developed for the SLC thermionic gun has been operational since September 1984. It consists of two planar triode amplifiers with a common output triode driving the gun cathode to produce two independent pulses of up to 9A with a 3 nsec FWHM pulse width. Three long-pulse amplifiers are also connected to the cathode to produce pulses with widths controllable between 100 nsec and 1.6 μsec. Each amplifier has independent timing and amplitude control through a fiber optic link to the high voltage plane of the gun cathode-grid structure. The pulser and its operating characteristics are described. 15 refs., 3 figs

  18. Expression and Its Clinical Significance of SLC22A18 in Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Ming LEI

    2012-01-01

    Full Text Available Background and objective It has been proven that multidrug resistance (MDR is the main cause of chemotherapy failure in lung cancer. Research on emergence mechanisms of MDR has great clinical significance in improving the curative efficiency of lung cancer chemotherapy. Proteins encoded by the SLC22A18 gene, which is similar to the transmembrane transporter, may influence the sensitivity of chemotherapeutics as well as the metabolism and growth of cells. In addition, these proteins probably have some effect on the development of lung cancer MDR. The aim of the present study is to investigate the expression of SLC22A18 protein in non-small cell lung cancer (NSCLC as well as in corresponding normal lung tissue. Furthermore, the relationship between SLC22A18 expression and pathological grade and TNM stage is analyzed. Methods The expression of SLC22A18 was detected by EnVinsion in 96 cases with NSCLC and in corresponding normal lung tissue. Statistical analysis was performed using SPSS 17.0 statistical software. Results SLC22A18 was mainly located in cell membrane and cytoplasm. The expression level of SLC22A18 in NSCLC was significantly higher than that in normal tissue (P<0.01. The positive rates in squamous cell lung cancer and lung adenocarcinoma were 68% and 78.2%, respectively (P<0.05. Moreover, the higher expression of SLC22A18 was associated with lower histological grade and later TNM stage (P<0.05. Conclusion SLC22A18 protein is overexpressed in NSCLC, and its expression is correlated with pathological grade and TNM stage. These findings provide the experimental basis for investigating the role of tumor and chemoresistance.

  19. RF phase distribution systems at the SLC

    International Nuclear Information System (INIS)

    Jobe, R.K.; Schwarz, H.D.

    1989-04-01

    Modern large linear accelerators require RF distribution systems with minimal phase drifts and errors. Through the use of existing RF coaxial waveguides, and additional installation of phase reference cables and monitoring equipment, stable RF distribution for the SLC has been achieved. This paper discusses the design and performance of SLAC systems, and some design considerations for future colliders. 6 refs., 4 figs

  20. The cyanobacterial bicarbonate transporter BicA: its physiological role and the implications of structural similarities with human SLC26 transporters.

    Science.gov (United States)

    Price, G Dean; Howitt, Susan M

    2011-04-01

    The cyanobacterial Na+-dependent HCO3- transporter BicA is a member of the ubiquitous and important SulP/SLC26 family of anion transporters found in eukaryotes and prokaryotes. BicA is an important component of the cyanobacterial CO2 concentrating mechanism, an adaptation that contributes to cyanobacteria being able to achieve an estimated 25% of global primary productivity, largely in the oceans. The human SLC26 members are involved in a range of key cellular functions involving a diverse range of anion transport activities including Cl-/HCO3-, I-/HCO3-, and SO42-/HCO3- exchange; mutations in SLC26 members are known to be associated with debilitating diseases such as Pendred syndrome, chondrodysplasias, and congenital chloride diarrhoea. We have recently experimentally determined the membrane topology of BicA using the phoA-lacZ reporter system and here consider some of the extrapolated implications for topology of the human SLC26 family and the Sultr plant sulphate transporters.

  1. A novel flow cytometric HTS assay reveals functional modulators of ATP binding cassette transporter ABCB6.

    Science.gov (United States)

    Polireddy, Kishore; Khan, Mohiuddin Md Taimur; Chavan, Hemantkumar; Young, Susan; Ma, Xiaochao; Waller, Anna; Garcia, Matthew; Perez, Dominique; Chavez, Stephanie; Strouse, Jacob J; Haynes, Mark K; Bologa, Cristian G; Oprea, Tudor I; Tegos, George P; Sklar, Larry A; Krishnamurthy, Partha

    2012-01-01

    ABCB6 is a member of the adenosine triphosphate (ATP)-binding cassette family of transporter proteins that is increasingly recognized as a relevant physiological and therapeutic target. Evaluation of modulators of ABCB6 activity would pave the way toward a more complete understanding of the significance of this transport process in tumor cell growth, proliferation and therapy-related drug resistance. In addition, this effort would improve our understanding of the function of ABCB6 in normal physiology with respect to heme biosynthesis, and cellular adaptation to metabolic demand and stress responses. To search for modulators of ABCB6, we developed a novel cell-based approach that, in combination with flow cytometric high-throughput screening (HTS), can be used to identify functional modulators of ABCB6. Accumulation of protoporphyrin, a fluorescent molecule, in wild-type ABCB6 expressing K562 cells, forms the basis of the HTS assay. Screening the Prestwick Chemical Library employing the HTS assay identified four compounds, benzethonium chloride, verteporfin, tomatine hydrochloride and piperlongumine, that reduced ABCB6 mediated cellular porphyrin levels. Validation of the identified compounds employing the hemin-agarose affinity chromatography and mitochondrial transport assays demonstrated that three out of the four compounds were capable of inhibiting ABCB6 mediated hemin transport into isolated mitochondria. However, only verteporfin and tomatine hydrochloride inhibited ABCB6's ability to compete with hemin as an ABCB6 substrate. This assay is therefore sensitive, robust, and suitable for automation in a high-throughput environment as demonstrated by our identification of selective functional modulators of ABCB6. Application of this assay to other libraries of synthetic compounds and natural products is expected to identify novel modulators of ABCB6 activity.

  2. Multivariate analysis methods to tag b quark events at LEP/SLC

    International Nuclear Information System (INIS)

    Brandl, B.; Falvard, A.; Guicheney, C.; Henrard, P.; Jousset, J.; Proriol, J.

    1992-01-01

    Multivariate analyses are applied to tag Z → bb-bar events at LEP/SLC. They are based on the specific b-event shape caused by the large b-quark mass. Discriminant analyses, classification trees and neural networks are presented and their performances are compared. It is shown that the neural network approach, due to its non-linearity, copes best with the complexity of the problem. As an example for an application of the developed methods the measurement of Γ(Z → bb-bar) is discussed. The usefulness of methods based on the global event shape is limited by the uncertainties introduced by the necessity of event simulation. As solution a double tag method is presented which can be applied to many tasks of LEP/SLC heavy flavour physics. (author) 29 refs.; 6 figs.; 1 tab

  3. A Missense Mutation in SLC45A2 Is Associated with Albinism in Several Small Long Haired Dog Breeds.

    Science.gov (United States)

    Wijesena, Hiruni R; Schmutz, Sheila M

    2015-01-01

    Homozygosity for a large deletion in the solute carrier family 45, member 2 (SLC45A2) gene causes oculocutaneous albinism (OCA) in the Doberman Pinscher breed. An albino Lhasa Apso did not have this g.27141_31223del (CanFam2) deletion in her SLC45A2 sequence. Therefore, SLC45A2 was investigated in this female Lhasa Apso to search for other possible variants that caused her albinism. The albino Lhasa Apso was homozygous for a nonsynonymous substitution in the seventh exon, a c.1478G>A base change that resulted in a glycine to aspartic acid substitution (p.G493D). This mutation was not found in a wolf, a coyote, or any of the 15 other Lhasa Apso dogs or 32 other dogs of breeds related to the Lhasa Apso. However, an albino Pekingese, 2 albino Pomeranians, and an albino mixed breed dog that was small and long haired were also homozygous for the 493D allele. The colored puppies of the albino Lhasa Apso and the colored dam of the 2 albino Pomeranians were heterozygous for this allele. However, an albino Pug was homozygous for the 493G allele and therefore although we suggest the 493D allele causes albinism when homozygous in several small, long haired dog breeds, it does not explain all albinism in dogs. A variant effect prediction for the albino Lhasa Apso confirms that p.G493D is a deleterious substitution, and a topology prediction for SLC45A2 suggests that the 11th transmembrane domain where the 493rd amino acid was located, has an altered structure. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. A novel flow cytometric HTS assay reveals functional modulators of ATP binding cassette transporter ABCB6.

    Directory of Open Access Journals (Sweden)

    Kishore Polireddy

    Full Text Available ABCB6 is a member of the adenosine triphosphate (ATP-binding cassette family of transporter proteins that is increasingly recognized as a relevant physiological and therapeutic target. Evaluation of modulators of ABCB6 activity would pave the way toward a more complete understanding of the significance of this transport process in tumor cell growth, proliferation and therapy-related drug resistance. In addition, this effort would improve our understanding of the function of ABCB6 in normal physiology with respect to heme biosynthesis, and cellular adaptation to metabolic demand and stress responses. To search for modulators of ABCB6, we developed a novel cell-based approach that, in combination with flow cytometric high-throughput screening (HTS, can be used to identify functional modulators of ABCB6. Accumulation of protoporphyrin, a fluorescent molecule, in wild-type ABCB6 expressing K562 cells, forms the basis of the HTS assay. Screening the Prestwick Chemical Library employing the HTS assay identified four compounds, benzethonium chloride, verteporfin, tomatine hydrochloride and piperlongumine, that reduced ABCB6 mediated cellular porphyrin levels. Validation of the identified compounds employing the hemin-agarose affinity chromatography and mitochondrial transport assays demonstrated that three out of the four compounds were capable of inhibiting ABCB6 mediated hemin transport into isolated mitochondria. However, only verteporfin and tomatine hydrochloride inhibited ABCB6's ability to compete with hemin as an ABCB6 substrate. This assay is therefore sensitive, robust, and suitable for automation in a high-throughput environment as demonstrated by our identification of selective functional modulators of ABCB6. Application of this assay to other libraries of synthetic compounds and natural products is expected to identify novel modulators of ABCB6 activity.

  5. Stanford: SLC back in action

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1990-05-15

    During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)

  6. SLC26A4 gene copy number variations in Chinese patients with non-syndromic enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Zhao Jiandong

    2012-05-01

    Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.

  7. Stanford: SLC back in action

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)

  8. Performance of the SLC polarized electron source with high polarization

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Alley, R.K.; Aoyagi, H.

    1993-04-01

    For the 1992 operating cycle of the SLAC Linear Collider (SLC), the polarized electron source (PES) during its maiden run successfully met the pulse intensity and overall efficiency requirements of the SLC. However, the polarization of the bulk GaAs cathode was low (∼27%) and the pulse-to-pulse stability was marginal. We have shown that adequate charge for the SLC can be extracted from a strained layer cathode having P e ∼80% even though the quantum efficiency (QE) is - beam stability. The performance of the PES during the 1993 SLC operating cycle with these and other improvements is discussed

  9. Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

    Science.gov (United States)

    Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

    2017-03-15

    Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

  10. Efficient purification and reconstitution of ATP binding cassette transporter B6 (ABCB6) for functional and structural studies.

    Science.gov (United States)

    Chavan, Hemantkumar; Khan, Mohiuddin Md Taimur; Tegos, George; Krishnamurthy, Partha

    2013-08-02

    The mitochondrial ATP binding cassette transporter ABCB6 has been associated with a broad range of physiological functions, including growth and development, therapy-related drug resistance, and the new blood group system Langereis. ABCB6 has been proposed to regulate heme synthesis by shuttling coproporphyrinogen III from the cytoplasm into the mitochondria. However, direct functional information of the transport complex is not known. To understand the role of ABCB6 in mitochondrial transport, we developed an in vitro system with pure and active protein. ABCB6 overexpressed in HEK293 cells was solubilized from mitochondrial membranes and purified to homogeneity. Purified ABCB6 showed a high binding affinity for MgATP (Kd = 0.18 μM) and an ATPase activity with a Km of 0.99 mM. Reconstitution of ABCB6 into liposomes allowed biochemical characterization of the ATPase including (i) substrate-stimulated ATPase activity, (ii) transport kinetics of its proposed endogenous substrate coproporphyrinogen III, and (iii) transport kinetics of substrates identified using a high throughput screening assay. Mutagenesis of the conserved lysine to alanine (K629A) in the Walker A motif abolished ATP hydrolysis and substrate transport. These results suggest a direct interaction between mitochondrial ABCB6 and its transport substrates that is critical for the activity of the transporter. Furthermore, the simple immunoaffinity purification of ABCB6 to near homogeneity and efficient reconstitution of ABCB6 into liposomes might provide the basis for future studies on the structure/function of ABCB6.

  11. SLAC-Linac-Collider (SLC) Project

    International Nuclear Information System (INIS)

    Wiedemann, H.

    1981-02-01

    The proposed SLAC Linear Collider Project (SLC) and its features are described in this paper. In times of ever increasing costs for energy the electron storage ring principle is about to reach its practical limit. A new class of colliding beam beam facilities, the Linear Colliders, are getting more and more attractive and affordable at very high center-of-mass energies. The SLC is designed to be a poineer of this new class of colliding beam facilities and at the same time will serve as a valuable tool to explore the high energy physics at the level of 100 GeV in the center-of-mass system

  12. Kicker for the SLC electron damping ring

    International Nuclear Information System (INIS)

    Bartelson, L.; Crawford, C.; Dinkel, J.; Kerns, Q.; Howell, J.; Snowdon, S.; Walton, J.

    1987-01-01

    The SLC electron damping ring requires two kickers each providing a 5 mr kick at 1.2 GEV to pairs of electron bunches spaced 61.63 nsec apart. The exact shape of the kick is unimportant, but the specification applies to the field the bunches see

  13. Use of landsat ETM+ SLC-off segment-based gap-filled imagery for crop type mapping

    Science.gov (United States)

    Maxwell, S.K.; Craig, M.E.

    2008-01-01

    Failure of the Scan Line Corrector (SLC) on the Landsat ETM+ sensor has had a major impact on many applications that rely on continuous medium resolution imagery to meet their objectives. The United States Department of Agriculture (USDA) Cropland Data Layer (CDL) program uses Landsat imagery as the primary source of data to produce crop-specific maps for 20 states in the USA. A new method has been developed to fill the image gaps resulting from the SLC failure to support the needs of Landsat users who require coincident spectral data, such as for crop type mapping and monitoring. We tested the new gap-filled method for a CDL crop type mapping project in eastern Nebraska. Scan line gaps were simulated on two Landsat 5 images (spring and late summer 2003) and then gap-filled using landscape boundary models, or segment models, that were derived from 1992 and 2002 Landsat images (used in the gap-fill process). Various date combinations of original and gap-filled images were used to derive crop maps using a supervised classification process. Overall kappa values were slightly higher for crop maps derived from SLC-off gap-filled images compared to crop maps derived from the original imagery (0.31.3% higher). Although the age of the segment model used to derive the SLC-off gap-filled product did not negatively impact the overall agreement, differences in individual cover type agreement did increase (−0.8%–1.6% using the 2002 segment model to −5.0–5.1% using the 1992 segment model). Classification agreement also decreased for most of the classes as the size of the segment used in the gap-fill process increased.

  14. Functional Testing of SLC26A4 Variants—Clinical and Molecular Analysis of a Cohort with Enlarged Vestibular Aqueduct from Austria

    Science.gov (United States)

    Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia

    2018-01-01

    The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412

  15. Superconducting quadrupoles for the SLC final focus

    International Nuclear Information System (INIS)

    Erickson, R.; Fieguth, T.; Murray, J.J.

    1987-01-01

    The final focus system of the SLC will be upgraded by replacing the final quadrupoles with higher gradient superconducting magnets positioned closer to the interaction point. The parameters of the new system have been chosen to be compatible with the experimental detectors with a minimum of changes to other final focus components. These parameter choices are discussed along with the expected improvement in SLC performance

  16. Superconducting quadrupoles for the SLC final focus

    International Nuclear Information System (INIS)

    Erickson, R.; Fieguth, T.; Murray, J.J.

    1987-01-01

    The final focus system of the SLC will be upgraded by replacing the final quadrupoles with higher gradient supperconducting magnets positioned closer to the interaction point. The parameters of the new system have been chosen to be compatible with the experimental detectors with a minimum of changes to other final focus components. These parameter choices are discussed along with the expected improvement in SLC performance

  17. Downregulation of SLC7A7 Triggers an Inflammatory Phenotype in Human Macrophages and Airway Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Bianca Maria Rotoli

    2018-03-01

    Full Text Available Lysinuric protein intolerance (LPI is a recessively inherited aminoaciduria caused by mutations of SLC7A7, the gene encoding y+LAT1 light chain of system y+L for cationic amino acid transport. The pathogenesis of LPI is still unknown. In this study, we have utilized a gene silencing approach in macrophages and airway epithelial cells to investigate whether complications affecting lung and immune system are directly ascribable to the lack of SLC7A7 or, rather, mediated by an abnormal accumulation of arginine in mutated cells. When SLC7A7/y+LAT1 was silenced in human THP-1 macrophages and A549 airway epithelial cells by means of short interference RNA (siRNA, a significant induction of the expression and release of the inflammatory mediators IL1β and TNFα was observed, no matter the intracellular arginine availability. This effect was mainly regulated at transcriptional level through the activation of NFκB signaling pathway. Moreover, since respiratory epithelial cells are the important sources of chemokines in response to pro-inflammatory stimuli, the effect of IL1β has been addressed on SLC7A7 silenced A549 cells. Results obtained indicated that the downregulation of SLC7A7/y+LAT1 markedly strengthened the stimulatory effect of the cytokine on CCL5/RANTES expression and release without affecting the levels of CXCL8/IL8. Consistently, also the conditioned medium of silenced THP-1 macrophages activated airway epithelial cells in terms of CCL5/RANTES expression due to the presence of elevated amount of proinflammatory cytokines. In conclusion, our results point to a novel thus far unknown function of SLC7A7/y+LAT1, that, under physiological conditions, besides transporting arginine, may act as a brake to restrain inflammation.

  18. Association Between Human SLC6A4 Gene Promoter Polymorphism and the Chinese People with Antisocial Personality Disorder%中国汉族反社会人格障碍人群SLC6A基因启动子区基因多态性的分析

    Institute of Scientific and Technical Information of China (English)

    谭钊安; 张建平; 曾彦英; 茆正红; 朱晓静; 张慧林; 朱进

    2004-01-01

    目的:探讨中国汉族人群SLC6A4基因启动子区基因多态性与反社会人格障碍的关系.方法:反社会人格障碍人群来自江苏省少年劳教所的被劳教人员,经人格诊断问卷(PDQ-4)筛查,符合美国精神病协会精神疾病诊断方法(DSM-Ⅳ)关于反社会人格障碍的诊断标准;对照组来自健康体检人群,经PDQ-4排除反社会人格障碍和重型精神病.全部对象取血液标本提取DNA,用PCR方法扩增SLC6A4基因(5-羟色氨转移蛋白基因,5-HTT)启动子区序列片断,部分PCR产物行测序验证.对等位基因频率和基因型频率进行对比分析.结果:符合DSM-Ⅳ反社会人格障碍诊断标准者共90例,对照组140例,PCR产物电泳及测序比对,共获得3种等位基因条带L、S和XL,片断长度各相差44个碱基,分别组成4种基因型LL、LS、SS和XLL.反社会人格障碍人群S等位基因频率和SS基因型频率分别为61.80%和37.08%,与对照组比较,差异有极显著性意义(P<0.005).结论:S等位基因频率和SS基因型频率与中国汉族人群反社会人格障碍的遗传易感性相关.

  19. The histidine transporter SLC15A4 coordinates mTOR-dependent inflammatory responses and pathogenic antibody production.

    Science.gov (United States)

    Kobayashi, Toshihiko; Shimabukuro-Demoto, Shiho; Yoshida-Sugitani, Reiko; Furuyama-Tanaka, Kaori; Karyu, Hitomi; Sugiura, Yuki; Shimizu, Yukiko; Hosaka, Toshiaki; Goto, Motohito; Kato, Norihiro; Okamura, Tadashi; Suematsu, Makoto; Yokoyama, Shigeyuki; Toyama-Sorimachi, Noriko

    2014-09-18

    SLC15A4 is a lysosome-resident, proton-coupled amino-acid transporter that moves histidine and oligopeptides from inside the lysosome to the cytosol of eukaryotic cells. SLC15A4 is required for Toll-like receptor 7 (TLR7)- and TLR9-mediated type I interferon (IFN-I) productions in plasmacytoid dendritic cells (pDCs) and is involved in the pathogenesis of certain diseases including lupus-like autoimmunity. How SLC15A4 contributes to diseases is largely unknown. Here we have shown that B cell SLC15A4 was crucial for TLR7-triggered IFN-I and autoantibody productions in a mouse lupus model. SLC15A4 loss disturbed the endolysosomal pH regulation and probably the v-ATPase integrity, and these changes were associated with disruption of the mTOR pathway, leading to failure of the IFN regulatory factor 7 (IRF7)-IFN-I regulatory circuit. Importantly, SLC15A4's transporter activity was necessary for the TLR-triggered cytokine production. Our findings revealed that SLC15A4-mediated optimization of the endolysosomal state is integral to a TLR7-triggered, mTOR-dependent IRF7-IFN-I circuit that leads to autoantibody production. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. De Novo Mutations in SLC25A24 Cause a Craniosynostosis Syndrome with Hypertrichosis, Progeroid Appearance, and Mitochondrial Dysfunction.

    Science.gov (United States)

    Ehmke, Nadja; Graul-Neumann, Luitgard; Smorag, Lukasz; Koenig, Rainer; Segebrecht, Lara; Magoulas, Pilar; Scaglia, Fernando; Kilic, Esra; Hennig, Anna F; Adolphs, Nicolai; Saha, Namrata; Fauler, Beatrix; Kalscheuer, Vera M; Hennig, Friederike; Altmüller, Janine; Netzer, Christian; Thiele, Holger; Nürnberg, Peter; Yigit, Gökhan; Jäger, Marten; Hecht, Jochen; Krüger, Ulrike; Mielke, Thorsten; Krawitz, Peter M; Horn, Denise; Schuelke, Markus; Mundlos, Stefan; Bacino, Carlos A; Bonnen, Penelope E; Wollnik, Bernd; Fischer-Zirnsak, Björn; Kornak, Uwe

    2017-11-02

    Gorlin-Chaudhry-Moss syndrome (GCMS) is a dysmorphic syndrome characterized by coronal craniosynostosis and severe midface hypoplasia, body and facial hypertrichosis, microphthalmia, short stature, and short distal phalanges. Variable lipoatrophy and cutis laxa are the basis for a progeroid appearance. Using exome and genome sequencing, we identified the recurrent de novo mutations c.650G>A (p.Arg217His) and c.649C>T (p.Arg217Cys) in SLC25A24 in five unrelated girls diagnosed with GCMS. Two of the girls had pronounced neonatal progeroid features and were initially diagnosed with Wiedemann-Rautenstrauch syndrome. SLC25A24 encodes a mitochondrial inner membrane ATP-Mg/P i carrier. In fibroblasts from affected individuals, the mutated SLC25A24 showed normal stability. In contrast to control cells, the probands' cells showed mitochondrial swelling, which was exacerbated upon treatment with hydrogen peroxide (H 2 O 2 ). The same effect was observed after overexpression of the mutant cDNA. Under normal culture conditions, the mitochondrial membrane potential of the probands' fibroblasts was intact, whereas ATP content in the mitochondrial matrix was lower than that in control cells. However, upon H 2 O 2 exposure, the membrane potential was significantly elevated in cells harboring the mutated SLC25A24. No reduction of mitochondrial DNA copy number was observed. These findings demonstrate that mitochondrial dysfunction with increased sensitivity to oxidative stress is due to the SLC25A24 mutations. Our results suggest that the SLC25A24 mutations induce a gain of pathological function and link mitochondrial ATP-Mg/P i transport to the development of skeletal and connective tissue. Copyright © 2017 American Society of Human Genetics. All rights reserved.

  1. The SLC polarized electron source

    International Nuclear Information System (INIS)

    Clendenin, J.E.

    1990-10-01

    A polarized electron source consisting of a 3-electrode photocathode gun and a flashlamp-pumped dye laser has been designed and built for the SLC and is currently undergoing commissioning. The source is described, and the operating configuration is discussed. The present status of the source and future plans are briefly indicated. 7 refs., 4 figs

  2. Sodium/bicarbonate cotransporter NBCn1/slc4a7 increases cytotoxicity in magnesium depletion in primary cultures of hippocampal neurons

    Science.gov (United States)

    Cooper, Deborah S.; Yang, Han Soo; He, Peijian; Kim, Eunjin; Rajbhandari, Ira; Yun, Chris C.; Choi, Inyeong

    2009-01-01

    Growing evidence suggests that pharmacological inhibition of Na/H exchange and Na/HCO3 transport provides protection against damage or injury in cardiac ischemia. In this study, we examined the contribution of the sodium/bicarbonate cotransporter NBCn1 (slc4a7) to cytotoxicity in cultured hippocampal neurons of rats. In neurons exposed to extracellular pH (pHo) ranging from 6.2 to 8.3, NBCn1 protein expression increased by fivefold at pH < 6.5 compared to the expression at pHo 7.4. At pHo 6.5, the intracellular pH of neurons was ~1 unit lower than that at pH 7.4. Immunochemistry showed a marked increase in NBCn1 immunofluorescence in plasma membranes and cytosol of the soma as well as in dendrites, at pHo 6.5. NBCn1 expression also increased by 40% in a prolonged Mg2+-free incubation at normal pHo. Knockdown of NBCn1 in neurons had negligible effect on cell viability. The effect of NBCn1 knockdown on cytotoxicity was then determined by exposing neurons to 0.5 mM glutamate for 10 min and measuring lactate dehydrogenase (LDH) release from neurons. Compared to normal incubation (pHo 7.2 for 6 h) after glutamate exposure, acidic incubation (pHo 6.3 for 6 h) reduced cytotoxicity by 75% for control neurons and 78% for NBCn1-knockdown neurons. Thus, both controls and knockdown neurons showed acidic protection from cytotoxicity. However, in Mg2+-free incubation after glutamate exposure, NBCn1 knockdown progressively attenuated cytotoxicity. This attenuation was unaffected by acidic preincubation before glutamate exposure. We conclude that NBCn1 has a dynamic upregulation in low pHo and Mg2+ depletion. NBCn1 is not required for acidic protection, but increases cytotoxicity in Mg2+-free conditions. PMID:19170751

  3. The emerging physiological roles of the SLC14A family of urea transporters

    Science.gov (United States)

    Stewart, Gavin

    2011-01-01

    In mammals, urea is the main nitrogenous breakdown product of protein catabolism and is produced in the liver. In certain tissues, the movement of urea across cell membranes is specifically mediated by a group of proteins known as the SLC14A family of facilitative urea transporters. These proteins are derived from two distinct genes, UT-A (SLC14A2) and UT-B (SLC14A1). Facilitative urea transporters play an important role in two major physiological processes – urinary concentration and urea nitrogen salvaging. Although UT-A and UT-B transporters both have a similar basic structure and mediate the transport of urea in a facilitative manner, there are a number of significant differences between them. UT-A transporters are mainly found in the kidney, are highly specific for urea, have relatively lower transport rates and are highly regulated at both gene expression and cellular localization levels. In contrast, UT-B transporters are more widespread in their tissue location, transport both urea and water, have a relatively high transport rate, are inhibited by mercurial compounds and currently appear to be less acutely regulated. This review details the fundamental research that has so far been performed to investigate the function and physiological significance of these two types of urea transporters. PMID:21449978

  4. Impedance calculations for the improved SLC damping rings

    International Nuclear Information System (INIS)

    Bane, K.L.F.; Ng, C.K.

    1993-04-01

    A longitudinal, single bunch instability is observed in the damping rings of the Stanford Linear Collider (SLC). Beyond a threshold bunch population of 3 x 10 10 particles the bunch energy spread increases and a ''saw-tooth'' variation in bunch length and synchronous phase as functions of time is observed. Although the relative amplitude of the saw-tooth variation is small-only on the order of 10% -- the resulting unpredictability of the beam properties in the rest of the SLC accelerator makes it difficult, if not impossible, to operate the machine above the threshold current. An additional problem at higher currents is that the bunch length is greatly increased. When the bunch is very long in the ring it becomes difficult or impossible to properly compress it after extraction. We want to solve both of these problems so that the SLC can run at higher currents to increase the luminosity. In order to solve these problems the vacuum chambers of both damping rings are being rebuilt with the aim of reducing their impedance. According to previous calculations the impedance the SLC damping rings is dominated by the many small discontinuities that are located in the so-called QD and QF vacuum chamber segments -- elements such as transitions, masks, bellows-that are inductive to the beam, Since these earlier calculations were performed the bellows of the QD segments have been sleeved, yielding a factor of 2 increase in the instability threshold. In this paper we begin by discussing the gains that might be achieved if we can reduce the impedance of the rings even further. Then we estimate the effect on the total impedance of the actual design changes that are being proposed. Three important elements -- the bend-to-quad transitions, the distributed ion pump slots, and the beam position monitor (BPM) electrodes are fully 3-dimensional and will be studied using T3 of the MAFIA computer programs

  5. Precise system stabilization at SLC using dither techniques

    International Nuclear Information System (INIS)

    Ross, M.C.; Hendrickson, L.; Himel, T.; Miller, E.

    1993-01-01

    A data acquisition method has been developed at the SLAC Linear Collider (SLC) that provides accurate beam parameter information using sub-tolerance excitation and synchronized detection. This is being applied to several SLC sub-systems to provide high speed feedback on beam parameters such as linac output energy spread. The method has significantly improved control of the linac energy spread. The linac average phase offset (θ), used to compensate the effects of longitudinal wakefields, is adjusted ±l control bit (about 0.18 degree S-band or 20% of tolerance), in a continuous fashion. Properly coordinated beam energy measurements provide a measure of the derivative of the accelerating voltage (dE/dθ). The position of the beam on the RF wave can thus be determined to ± 0.3 degree in about 5 seconds. The dithering does not contribute significantly to the energy jitter of the SLC and therefore does not adversely affect routine operation. Future applications include control of the interaction region beam size and orientation

  6. An Integrated Enterprise Accelerator Database for the SLC Control System

    International Nuclear Information System (INIS)

    2002-01-01

    Since its inception in the early 1980's, the SLC Control System has been driven by a highly structured memory-resident real-time database. While efficient, its rigid structure and file-based sources makes it difficult to maintain and extract relevant information. The goal of transforming the sources for this database into a relational form is to enable it to be part of a Control System Enterprise Database that is an integrated central repository for SLC accelerator device and Control System data with links to other associated databases. We have taken the concepts developed for the NLC Enterprise Database and used them to create and load a relational model of the online SLC Control System database. This database contains data and structure to allow querying and reporting on beamline devices, their associations and parameters. In the future this will be extended to allow generation of EPICS and SLC database files, setup of applications and links to other databases such as accelerator maintenance, archive data, financial and personnel records, cabling information, documentation etc. The database is implemented using Oracle 8i. In the short term it will be updated daily in batch from the online SLC database. In the longer term, it will serve as the primary source for Control System static data, an R and D platform for the NLC, and contribute to SLC Control System operations

  7. A laser-based beam profile monitor for the SLC/SLD interaction region

    International Nuclear Information System (INIS)

    Alley, R.; Arnett, D.; Bong, E.; Colocho, W.; Frisch, J.; Horton-Smith, S.; Inman, W.; Jobe, K.; Kotseroglou, T.; McCormick, D.; Nelson, J.; Scheeff, M.; Wagner, S.; Ross, M.C.

    1996-01-01

    Beam size estimates made using beam-beam deflections are used for optimization of the Stanford linear collider (SLC) electron-positron beam sizes. Typical beam sizes and intensities expected for 1996 operations are 2.1 x 0.6 μm (x, y) at 4.0.10 10 particles per pulse. Conventional profile monitors, such as scanning wires, fail at charge densities well below this. The laser-based profile monitor uses a finely-focused 350-nm wavelength tripled YLF laser pulse that traverses the particle beam path about 29 cm away from the e + /e - IP. Compton scattered photons and degraded e + /e - are detected as the beam is steered across the laser pulse. The laser pulse has a transverse size of 380 nm and a Rayleigh range of about 5 μm. (orig.)

  8. Developmental expression of solute carrier family 26A member 4 (SLC26A4/pendrin) during amelogenesis in developing rodent teeth.

    Science.gov (United States)

    Bronckers, Antonius L J J; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2011-12-01

    Ameloblasts need to regulate pH during the formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine, and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear, and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues, including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts, and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as a pH regulator. SLC26A4 does not appear to be critical for ameloblast function and is probably compensated by other pH regulators. © 2011 Eur J Oral Sci.

  9. Survey of beam instrumentation used in SLC

    International Nuclear Information System (INIS)

    Ecklund, S.D.

    1991-03-01

    A survey of beam instruments used at SLAC in the SLC machine is presented. The basic utility and operation of each device is briefly described. The various beam instruments used at the Stanford Linear Collider (SLC), can be classified by the function they perform. Beam intensity, position and size are typical of the parameters of beam which are measured. Each type of parameter is important for adjusting or tuning the machine in order to achieve optimum performance. 39 refs

  10. Lack of SLC2A1 (glucose transporter 1) mutations in 30 Italian patients with alternating hemiplegia of childhood.

    Science.gov (United States)

    De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico

    2013-07-01

    Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.

  11. Beam-based alignment technique for the SLC [Stanford Linear Collider] linac

    International Nuclear Information System (INIS)

    Adolphsen, C.E.; Lavine, T.L.; Atwood, W.B.

    1989-03-01

    Misalignment of quadrupole magnets and beam position monitors (BPMs) in the linac of the SLAC Linear Collider (SLC) cause the electron and positron beams to be steered off-center in the disk-loaded waveguide accelerator structures. Off-center beams produce wakefields which limit the SLC performance at high beam intensities by causing emittance growth. Here, we present a general method for simultaneously determining quadrupole magnet and BPM offsets using beam trajectory measurements. Results from the application of the method to the SLC linac are described. The alignment precision achieved is approximately 100 μm, which is significantly better than that obtained using optical surveying techniques. 2 refs., 4 figs

  12. Vps35-deficiency impairs SLC4A11 trafficking and promotes corneal dystrophy.

    Directory of Open Access Journals (Sweden)

    Wei Liu

    Full Text Available Vps35 (vacuolar protein sorting 35 is a major component of retromer that selectively promotes endosome-to-Golgi retrieval of transmembrane proteins. Dysfunction of retromer is a risk factor for the pathogenesis of Parkinson's disease (PD and Alzheimer's disease (AD. However, Vps35/retromer's function in the eye or the contribution of Vps35-deficiency to eye degenerative disorders remains to be explored. Here we provide evidence for a critical role of Vps35 in mouse corneal dystrophy. Vps35 is expressed in mouse and human cornea. Mouse cornea from Vps35 heterozygotes (Vps35+/- show features of dystrophy, such as loss of both endothelial and epithelial cell densities, disorganizations of endothelial, stroma, and epithelial cells, excrescences in the Descemet membrane, and corneal edema. Additionally, corneal epithelial cell proliferation was reduced in Vps35-deficient mice. Intriguingly, cell surface targeting of SLC4A11, a membrane transport protein (OH- /H+ /NH3 /H2O of corneal endothelium, whose mutations have been identified in patients with corneal dystrophy, was impaired in Vps35-deficient cells and cornea. Taken together, these results suggest that SLC4A11 appears to be a Vps35/retromer cargo, and Vps35-regulation of SLC4A11 trafficking may underlie Vps35/retromer regulation of corneal dystrophy.

  13. Recessive mutations in SLC38A8 cause foveal hypoplasia and optic nerve misrouting without albinism.

    Science.gov (United States)

    Poulter, James A; Al-Araimi, Musallam; Conte, Ivan; van Genderen, Maria M; Sheridan, Eamonn; Carr, Ian M; Parry, David A; Shires, Mike; Carrella, Sabrina; Bradbury, John; Khan, Kamron; Lakeman, Phillis; Sergouniotis, Panagiotis I; Webster, Andrew R; Moore, Anthony T; Pal, Bishwanath; Mohamed, Moin D; Venkataramana, Anandula; Ramprasad, Vedam; Shetty, Rohit; Saktivel, Murugan; Kumaramanickavel, Govindasamy; Tan, Alex; Mackey, David A; Hewitt, Alex W; Banfi, Sandro; Ali, Manir; Inglehearn, Chris F; Toomes, Carmel

    2013-12-05

    Foveal hypoplasia and optic nerve misrouting are developmental defects of the visual pathway and only co-occur in connection with albinism; to date, they have only been associated with defects in the melanin-biosynthesis pathway. Here, we report that these defects can occur independently of albinism in people with recessive mutations in the putative glutamine transporter gene SLC38A8. Nine different mutations were identified in seven Asian and European families. Using morpholino-mediated ablation of Slc38a8 in medaka fish, we confirmed that pigmentation is unaffected by loss of SLC38A8. Furthermore, by undertaking an association study with SNPs at the SLC38A8 locus, we showed that common variants within this gene modestly affect foveal thickness in the general population. This study reveals a melanin-independent component underpinning the development of the visual pathway that requires a functional role for SLC38A8. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  14. Lessons from the SLC for future LC control systems

    International Nuclear Information System (INIS)

    Humphrey, R.

    1991-12-01

    The SLC control system is the dynamic result of a number of forces. The most obvious force is the functional requirements of the SLC itself, but other forces are history, budget, people, available technology, etc. The plan of this paper is to describe the critical functional requirements of the SLC which caused significant development of the control system. I have tried to focus on functional requirements as a driver, and I will describe some solutions which we have implemented to satisfy those requirements. The important functional requirements drivers for the control system discussed in this paper are: Repetition rate; Sensitivity to orbit distortion; Stability/Automation; and Accelerator Development

  15. Analyses of SLC13A5-epilepsy patients reveal perturbations of TCA cycle.

    Science.gov (United States)

    Bainbridge, Matthew N; Cooney, Erin; Miller, Marcus; Kennedy, Adam D; Wulff, Jacob E; Donti, Taraka; Jhangiani, Shalini N; Gibbs, Richard A; Elsea, Sarah H; Porter, Brenda E; Graham, Brett H

    2017-08-01

    To interrogate the metabolic profile of five subjects from three families with rare, nonsense and missense mutations in SLC13A5 and Early Infantile Epileptic Encephalopathies (EIEE) characterized by severe, neonatal onset seizures, psychomotor retardation and global developmental delay. Mass spectrometry of plasma, CSF and urine was used to identify consistently dysregulated analytes in our subjects. Distinctive elevations of citrate and dysregulation of citric acid cycle intermediates, supporting the hypothesis that loss of SLC13A5 function alters tricarboxylic acid cycle (TCA) metabolism and may disrupt metabolic compartmentation in the brain. Our results indicate that analysis of plasma citrate and other TCA analytes in SLC13A5 deficient patients define a diagnostic metabolic signature that can aid in diagnosing children with this disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. A calorimeter software trigger for the Mark II detector at SLC [Stanford Linear Collider

    International Nuclear Information System (INIS)

    Briggs, D.; Glanzman, T.; Grosse-Wiesmann, P.; Tinsman, J.; Holmgren, S.; Schaad, M.W.

    1989-04-01

    A new FASTBUS-based calorimeter software trigger for the upgraded Mark II at the Stanford Linear Collider (SLC) is presented. The trigger requirements for SLC and a short description of the hardware used for this purpose are given, followed by a detailed description of the software. Some preliminary results are presented. 9 refs., 4 figs

  17. Loss of function of Slc20a2 associated with familial idiopathic Basal Ganglia calcification in humans causes brain calcifications in mice

    DEFF Research Database (Denmark)

    Jensen, N.; Schroder, H. D.; Hejbol, E. K.

    2013-01-01

    Familial idiopathic basal ganglia calcification (FIBGC) is a neurodegenerative disorder with neuropsychiatric and motor symptoms. Deleterious mutations in SLC20A2, encoding the type III sodium-dependent phosphate transporter 2 (PiT2), were recently linked to FIBGC in almost 50% of the families...... reported worldwide. Here, we show that knockout of Slc20a2 in mice causes calcifications in the thalamus, basal ganglia, and cortex, demonstrating that reduced PiT2 expression alone can cause brain calcifications....

  18. Characterizing and evaluating the expression of the type IIb sodium-dependent phosphate cotransporter (slc34a2) gene and its potential influence on phosphorus utilization efficiency in yellow catfish (Pelteobagrus fulvidraco).

    Science.gov (United States)

    Chen, Pei; Tang, Qin; Wang, Chunfang

    2016-02-01

    A sodium-dependent phosphate cotransporter gene, NaPi-IIb (slc34a2), was isolated from yellow catfish (Pelteobagrus fulvidraco) intestine through homology cloning and the rapid amplification of cDNA ends. The full-length cDNA of slc34a2 consisted of 2326 bp with an open reading frame encoding 621 amino acids, a 160-bp 5' untranslated region, and a 300-bp 3' untranslated region. The deduced amino acid sequence showed 79.0 and 70.9% sequence identity to Astyanax mexicanus and Pundamilia nyererei, respectively. The membrane-spanning domains based on the hydrophilic and hydrophobic properties of the deduced amino acids were predicted, and results showed that the putative protein had eight transmembrane domains, with the intracellular NH2 and COOH termini. Two functional regions including first intracellular loop and third extracellular loop as well as the six N-glycosylation sites in second extracellular loop were found. The slc34a2 mRNA in the tested tissues was examined through semiquantitative reverse transcription polymerase chain reaction and quantitative real-time PCR, with the highest level found in the anterior intestine, followed by the posterior and middle intestines. The slc34a2 mRNA expression in the whole intestine under different dietary phosphorus (P) treatments was detected using qPCR. The results showed that the slc34a2 expression levels in the low-P groups (0.33 and 0.56%) were significantly higher (p < 0.05) than levels in the sufficient-P (0.81%) and high-P (1.15, 1.31, and 1.57%) groups. High expression of slc34a2 mRNA in low-P groups stimulated P utilization efficiency, indicating the close relationship between genotype and phenotype in yellow catfish. In contrast with conventional strategies (formula and feeding strategies), this study provided another possible approach by using molecular techniques to increase the P utilization in yellow catfish.

  19. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  20. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  1. ρ0 Cells Feature De-Ubiquitination of SLC Transporters and Increased Levels and Fluxes of Amino Acids

    Directory of Open Access Journals (Sweden)

    André Bordinassi Medina

    2017-04-01

    Full Text Available Solute carrier (SLC transporters are a diverse group of membrane transporter proteins that regulate the cellular flux and distribution of endogenous and xenobiotic compounds. Post-translational modifications (PTMs, such as ubiquitination, have recently emerged as one of the major regulatory mechanisms in protein function and localization. Previously, we showed that SLC amino acid transporters were on average 6-fold de-ubiquitinated and increased amino acid levels were detected in ρ0 cells (lacking mitochondrial DNA, mtDNA compared to parental cells. Here, we elucidated the altered functionality of SLC transporters and their dynamic ubiquitination status by measuring the uptake of several isotopically labeled amino acids in both human osteosarcoma 143B.TK- and ρ0 cells. Our pulse chase analysis indicated that de-ubiquitinated amino acid transporters in ρ0 cells were accompanied by an increased transport rate, which leads to higher levels of amino acids in the cell. Finding SLC transport enhancers is an aim of the pharmaceutical industry in order to compensate for loss of function mutations in these genes. Thus, the ubiquitination status of SLC transporters could be an indicator for their functionality, but evidence for a direct connection between de-ubiquitination and transporter activity has to be further elucidated.

  2. Beam determination of quadrupole misalignments and beam position monitor biases in the SLC linac

    International Nuclear Information System (INIS)

    Lavine, T.L.; Seeman, J.T.; Atwood, W.B.; Himel, T.M.; Petersen, A.; Adolphsen, C.E.

    1988-09-01

    Misalignments of magnetic quadrupoles and biases in beam position monitors (BPMs) in the Stanford Linear Collider (SLC) linac can lead to a situation in which the beam is off-center in the disk-loaded waveguide accelerator structure. The off-center beam produces wakefields which can limit SLC performance by causing unacceptably large emittance growth. We present a general method for determining quadrupole misalignments and BPM biases in the SLC linac by using beam trajectory measurements. The method utilizes both electron and positron beams on opposite rf cycles in the same linac lattice to determine simultaneously magnetic quadrupole misalignments and BPM biases. The two-beam trajectory data may be acquired without interrupting SLC colliding beam operations. 2 refs., 5 figs

  3. Mutations in SLC12A5 in epilepsy of infancy with migrating focal seizures

    Science.gov (United States)

    Stödberg, Tommy; McTague, Amy; Ruiz, Arnaud J.; Hirata, Hiromi; Zhen, Juan; Long, Philip; Farabella, Irene; Meyer, Esther; Kawahara, Atsuo; Vassallo, Grace; Stivaros, Stavros M.; Bjursell, Magnus K.; Stranneheim, Henrik; Tigerschiöld, Stephanie; Persson, Bengt; Bangash, Iftikhar; Das, Krishna; Hughes, Deborah; Lesko, Nicole; Lundeberg, Joakim; Scott, Rod C.; Poduri, Annapurna; Scheffer, Ingrid E.; Smith, Holly; Gissen, Paul; Schorge, Stephanie; Reith, Maarten E. A.; Topf, Maya; Kullmann, Dimitri M.; Harvey, Robert J.; Wedell, Anna; Kurian, Manju A.

    2015-01-01

    The potassium-chloride co-transporter KCC2, encoded by SLC12A5, plays a fundamental role in fast synaptic inhibition by maintaining a hyperpolarizing gradient for chloride ions. KCC2 dysfunction has been implicated in human epilepsy, but to date, no monogenic KCC2-related epilepsy disorders have been described. Here we show recessive loss-of-function SLC12A5 mutations in patients with a severe infantile-onset pharmacoresistant epilepsy syndrome, epilepsy of infancy with migrating focal seizures (EIMFS). Decreased KCC2 surface expression, reduced protein glycosylation and impaired chloride extrusion contribute to loss of KCC2 activity, thereby impairing normal synaptic inhibition and promoting neuronal excitability in this early-onset epileptic encephalopathy. PMID:26333769

  4. SLC ir conceptual design

    International Nuclear Information System (INIS)

    Keller, L.P.

    1982-01-01

    Work on a one interaction-region, push-pull conceptual design for the SLC is described. The concept which has received the most attention is described. It is a below-ground hall - a 15 m deep rectangular pit covered by a surface building which houses counting rooms, power supplies, cryogenics and other auxiliary equipment

  5. A 7666-bp genomic deletion is frequent in Chinese Han deaf patients with non-syndromic enlarged vestibular aqueduct but without bi-allelic SLC26A4 mutations.

    Science.gov (United States)

    Pang, Xiuhong; Chai, Yongchuan; He, Longxia; Chen, Penghui; Wang, Xiaowen; Li, Lei; Jia, Huan; Wu, Hao; Yang, Tao

    2015-12-01

    To investigate the genetic cause of the patients with non-syndromic enlarged vestibular aqueduct (EVA) but without bi-allelic SLC26A4 mutations. Presence of a homozygous genomic deletion was detected in a Chinese Han deaf patient (D1467-1) who failed to amplify the first three exons of SLC26A4. The breakpoints of the deletion were fine-mapped and revealed by PCR amplification and sequencing. This deletion was subsequently screened in 22 Chinese Han EVA probands with mono-allelic SLC26A4 mutations. The possible founder effect of the newly identified genomic deletion was evaluated by haplotype analysis. A homozygous c.-2071_307+3801del7666 deletion of SLC26A4 was identified in patient D1467-1. This novel genomic deletion was subsequently identified in 18% (4/22) of the Chinese Han EVA probands with mono-allelic SLC26A4 mutations. Haplotype analysis showed that this genomic deletion is likely a founder mutation in Chinese Hans. Our results suggested that the cryptic c.-2071_307+3801del7666 deletion of SLC26A4 is relatively frequent in Chinese Han non-syndromic EVA patients without bi-allelic SLC26A4 mutations. Screening of this genomic deletion should be incorporated into the routine DNA testing of SLC26A4 in Chinese Hans. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  6. Prostaglandin transporter (OATP2A1/SLCO2A1) contributes to local disposition of eicosapentaenoic acid-derived PGE3.

    Science.gov (United States)

    Gose, Tomoka; Nakanishi, Takeo; Kamo, Shunsuke; Shimada, Hiroaki; Otake, Katsumasa; Tamai, Ikumi

    2016-01-01

    Eicosapentaenoic acid (EPA)-derived prostaglandin E3 (PGE3) possesses an anti-inflammatory effect; however, information for transporters that regulate its peri-cellular concentration is limited. The present study, therefore, aimed to clarify transporters involved in local disposition of PGE3. PGE3 uptake was assessed in HEK293 cells transfected with OATP2A1/SLCO2A1, OATP1B1/SLCO1B1, OATP2B1/SLCO2B1, OAT1/SLC22A6, OCT1/SLC22A1 or OCT2/SLC22A2 genes, compared with HEK293 cells transfected with plasmid vector alone (Mock). PGE3 uptake by OATP2A1-expressing HEK293 cells (HEK/2A1) was the highest and followed by HEK/1B1, while no significantly higher uptake of PGE3 than Mock cells was detected by other transporters. Saturation kinetics in PGE3 uptake by HEK/2A1 estimated the Km as 7.202 ± 0.595 μM, which was 22 times higher than that of PGE2 (Km=0.331 ± 0.131 μM). Furthermore, tissue disposition of PGE3 was examined in wild-type (WT) and Slco2a1-deficient (Slco2a1(-/-)) mice after oral administration of EPA ethyl ester (EPA-E) when they underwent intraperitoneal injection of endotoxin (e.g., lipopolysaccharide). PGE3 concentration was significantly higher in the lung, and tended to increase in the colon, stomach, and kidney of Slco2a1(-/-), compared to WT mice. Ratio of PGE2 metabolite 15-keto PGE2 over PGE2 concentration was significantly lower in the lung and colon of Slco2a1(-/-) than that of WT mice, suggesting that PGE3 metabolism is downregulated in Slco2a1(-/-) mice. In conclusion, PGE3 was found to be a substrate of OATP2A1, and local disposition of PGE3 could be regulated by OATP2A1 at least in the lung. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Precision electroweak physics with the SLD/SLC: The left-right polarization asymmetry

    International Nuclear Information System (INIS)

    Rowson, P.C.

    1994-12-01

    Following a brief review of a commonly used general framework for the analysis of radiative corrections and possible new physics, the recent precision results from the SLD/SLC are discussed and used to test the standard electroweak model. In the 1993 SLD/SLC run, the SLD recorded 50,000 Z events produced by the collision of longitudinally polarized electrons on unpolarized positrons at a center-of-mass energy of 91.26 GeV. The luminosity-weighted average polarization of the SLC electron beam was (63.0 ± 1.1)%. We measure the left-right cross-section asymmetry in Z boson production, A LR , to be 0.1628 ± 0.0071 (stat) ± 0.0028 (syst) which determines the effective weak mixing angle to be sin 2 θ W eff = 0.2292 ± 0.0009 (stat) ± 0.0004 (syst). When averaged with our 1992 result, we obtain sin 2 θ W eff = 0.2294 ± 0. 0010. This result differs from analogous LEP results at the level of about 2.5 σ. The world averages of electroweak data are comfortably in agreement with the standard model

  8. Slc5a8, a Na+-coupled high-affinity transporter for short-chain fatty acids, is a conditional tumour suppressor in colon that protects against colitis and colon cancer under low-fibre dietary conditions.

    Science.gov (United States)

    Gurav, Ashish; Sivaprakasam, Sathish; Bhutia, Yangzom D; Boettger, Thomas; Singh, Nagendra; Ganapathy, Vadivel

    2015-07-15

    Mammalian colon harbours trillions of bacteria under physiological conditions; this symbiosis is made possible because of a tolerized response from the mucosal immune system. The mechanisms underlying this tolerogenic phenomenon remain poorly understood. In the present study we show that Slc5a8 (solute carrier gene family 5a, member 8), a Na(+)-coupled high-affinity transporter in colon for the bacterial fermentation product butyrate, plays a critical role in this process. Among various immune cells in colon, dendritic cells (DCs) are unique not only in their accessibility to luminal contents but also in their ability to induce tolerogenic phenotype in T-cells. We found that DCs exposed to butyrate express the immunosuppressive enzymes indoleamine 2,3-dioxygenase 1 (IDO1) and aldehyde dehydrogenase 1A2 (Aldh1A2), promote conversion of naive T-cells into immunosuppressive forkhead box P3(+) (FoxP3(+)) Tregs (regulatory T-cells) and suppress conversion of naive T-cells into pro-inflammatory interferon (IFN)-γ-producing cells. Slc5a8-null DCs do not induce IDO1 and Aldh1A2 and do not generate Tregs or suppress IFN-γ-producing T-cells in response to butyrate. We also provide in vivo evidence for an obligatory role for Slc5a8 in suppression of IFN-γ-producing T-cells. Furthermore, Slc5a8 protects against colitis and colon cancer under conditions of low-fibre intake but not when dietary fibre intake is optimal. This agrees with the high-affinity nature of the transporter to mediate butyrate entry into cells. We conclude that Slc5a8 is an obligatory link between dietary fibre and mucosal immune system via the bacterial metabolite butyrate and that this transporter is a conditional tumour suppressor in colon linked to dietary fibre content. © 2015 Authors; published by Portland Press Limited.

  9. Configuring the SLC linac for injection into PEP

    International Nuclear Information System (INIS)

    Bane, K.L.F.

    1989-01-01

    From time to time the normal SLC physics program is to be interrupted so that beam can be delivered to PEP. In order that the switch to PEP injection (and the switch back again) can be accomplished quickly and easily, the gun, the damping rings, the linac phase ramp, the energy profile of the linac klystrons for the scavenger bunch, and the entire positron production system are to be kept the same as in the SLC configuration. What mainly remains to be changed is the linac klystron profile for the leading two bunches - those going to PEP. The new klystron profile must be such that it leaves these two beams (1) with final energies that match that of the storage ring and (2) with final energy spectra that fit within the energy aperture of the PEP transfer line. The conditions that need to be met in order to achieve these two goals are discussed in this note. 1 ref., 2 figs

  10. Importance of ethnicity, CYP2B6 and ABCB1 genotype for efavirenz pharmacokinetics and treatment outcomes: a parallel-group prospective cohort study in two sub-Saharan Africa populations.

    Directory of Open Access Journals (Sweden)

    Eliford Ngaimisi

    Full Text Available We evaluated the importance of ethnicity and pharmacogenetic variations in determining efavirenz pharmacokinetics, auto-induction and immunological outcomes in two African populations.ART naïve HIV patients from Ethiopia (n = 285 and Tanzania (n = 209 were prospectively enrolled in parallel to start efavirenz based HAART. CD4+ cell counts were determined at baseline, 12, 24 and 48 weeks. Plasma and intracellular efavirenz and 8-hydroxyefvairenz concentrations were determined at week 4 and 16. Genotyping for common functional CYP2B6, CYP3A5, ABCB1, UGT2B7 and SLCO1B1 variant alleles were done.Patient country, CYP2B6*6 and ABCB1 c.4036A>G (rs3842A>G genotype were significant predictors of plasma and intracellular efavirenz concentration. CYP2B6*6 and ABCB1 c.4036A>G (rs3842 genotype were significantly associated with higher plasma efavirenz concentration and their allele frequencies were significantly higher in Tanzanians than Ethiopians. Tanzanians displayed significantly higher efavirenz plasma concentration at week 4 (pG genotype. Within country analyses indicated a significant decrease in the mean plasma efavirenz concentration by week 16 compared to week 4 in Tanzanians (p = 0.006, whereas no significant differences in plasma concentration over time was observed in Ethiopians (p = 0.84. Intracellular efavirenz concentration and patient country were significant predictors of CD4 gain during HAART.We report substantial differences in efavirenz pharmacokinetics, extent of auto-induction and immunologic recovery between Ethiopian and Tanzanian HIV patients, partly but not solely, due to pharmacogenetic variations. The observed inter-ethnic variations in efavirenz plasma exposure may possibly result in varying clinical treatment outcome or adverse event profiles between populations.

  11. SLC Final Performance and Lessons

    International Nuclear Information System (INIS)

    Phinney, Nan

    2000-01-01

    The Stanford Linear Collider (SLC) was the first prototype of a new type of accelerator, the electron-positron linear collider. Many years of dedicated effort were required to understand the physics of this new technology and to develop the techniques for maximizing performance. Key issues were emittance dilution, stability, final beam optimization and background control. Precision, non-invasive diagnostics were required to measure and monitor the beams throughout the machine. Beam-based feedback systems were needed to stabilize energy, trajectory, intensity and the final beam size at the interaction point. variety of new tuning techniques were developed to correct for residual optical or alignment errors. The final focus system underwent a series of refinements in order to deliver sub-micron size beams. It also took many iterations to understand the sources of backgrounds and develop the methods to control them. The benefit from this accumulated experience was seen in the performance of the SLC during its final run in 1997-98. The luminosity increased by a factor of three to 3*10 30 and the 350,000 Z data sample delivered was nearly double that from all previous runs combined

  12. The pulsed amplitude unit for the SLC

    International Nuclear Information System (INIS)

    Rolfe, J.; Browne, M.J.; Jobe, R.K.

    1987-02-01

    There is a recurring requirement in the SLC for the control of devices such as magnets, phase shifters, and attenuators on a beam-by-beam basis. The Pulsed Amplitude Unit (PAU) is a single width CAMAC module developed for this purpose. It provides digitally programmed analog output voltages on a beam-by-beam basis. Up to 32 preprogrammed values of output voltage are available from the single analog output of the module, and any of these values can be associated with any of the 256 possible SLC beam definitions. A 12-bit Analog-to-Digital Converter (ADC) digitizes an analog input signal at the appropriate beam time and stores it in a buffer memory. This feature is normally used to monitor the response of the device being controlled by the PAU at each beam time. Initial application of the PAU is a part of the system that controls the output of Klystrons in the SLC. The PAU combines several different functions in a single module. In order to accommodate these functions in a single width CAMAC module, field programmed logic is used extensively. Field Programmable Logic Arrays, Programmed Array Logic, and a Field Programmable Logic Sequencer are employed

  13. The pulsed amplitude unit for the SLC

    International Nuclear Information System (INIS)

    Rolfe, J.; Browne, M.J.; Jobe, R.K.

    1987-01-01

    There is a recurring requirement in the SLC for the control of devices such as magnets, phase shifters, and attenuators on a beam-by-beam basis. The Pulsed Amplitude Unit (PAU) is a single width CAMAC module developed for this purpose. It provides digitally programmed analog output voltages on a beam-by-beam basis. Up to 32 preprogrammed values of output voltage are available from the single analog output of the module, and any of these values can be associated with any of the 256 possible SLC beam definitions. A 12-bit Analog-to-Digital converter (ADC) digitizes an analog input signal at the appropriate beam time and stores it in a buffer memory. This feature is normally used to monitor the response of the device being controlled by the PAU at each beam time. Initial application of the PAU at is as part of the system that controls the output of Klystorns in the SLC. The PAU combines several different functions in a single module. In order to accommodate these functions in a single width CAMAC module, field programmed logic is used extensively. Field Programmable Logic Arrays, Programmed Array Logic, and a Field Programmable Logic Sequencer are employed

  14. In silico analysis of consequences of non-synonymous SNPs of Slc11a2 gene in Indian bovines

    Directory of Open Access Journals (Sweden)

    Shreya M. Patel

    2015-09-01

    Full Text Available The aim of our study was to analyze the consequences of non-synonymous SNPs in Slc11a2 gene using bioinformatic tools. There is a current need of efficient bioinformatic tools for in-depth analysis of data generated by the next generation sequencing technologies. SNPs are known to play an imperative role in understanding the genetic basis of many genetic diseases. Slc11a2 is one of the major metal transporter families in mammals and plays a critical role in host defenses. In this study, we performed a comprehensive analysis of the impact of all non-synonymous SNPs in this gene using multiple tools like SIFT, PROVEAN, I-Mutant and PANTHER. Among the total 124 SNPs obtained from amplicon sequencing of Slc11a2 gene by Ion Torrent PGM involving 10 individuals of Gir cattle and Murrah buffalo each, we found 22 non-synonymous. Comparing the prediction of these 4 methods, 5 nsSNPs (G369R, Y374C, A377V, Q385H and N492S were identified as deleterious. In addition, while tested out for polar interactions with other amino acids in the protein, from above 5, Y374C, Q385H and N492S showed a change in interaction pattern and further confirmed by an increase in total energy after energy minimizations in case of mutant protein compared to the native.

  15. The SLC control system - status and development

    International Nuclear Information System (INIS)

    Phinney, N.; Shoaee, H.

    1987-03-01

    The SLC control system is installed and operational in the full SLC through the Linac, Damping Rings, Positron Source, Arcs and Final Focus. The system now includes a host VAX 11/785, a development VAX 11/780, 4 VAX workstations, a distributed network of 70 microprocessors, and about 270 Camac crates with more than 4000 modules. The micros are used for control and monitoring of the hardware, for pulse-to-pulse feedback, and for consoles (COWs). High level model-driven host software provides a variety of tools for beam setup, optimization, diagnosis, and stabilization. This paper will summarize the current status and projects under development

  16. Thiamine responsive megaloblastic anemia: a novel SLC19A2 compound heterozygous mutation in two siblings.

    Science.gov (United States)

    Mozzillo, Enza; Melis, Daniela; Falco, Mariateresa; Fattorusso, Valentina; Taurisano, Roberta; Flanagan, Sarah E; Ellard, Sian; Franzese, Adriana

    2013-08-01

    Thiamine responsive megaloblastic anemia (TRMA) is an autosomal recessive disease caused by loss of function mutations in the SLC19A2 gene. TRMA is characterized by anemia, deafness, and diabetes. In some cases, optic atrophy or more rarely retinitis pigmentosa is noted. We now report two sisters, the eldest of which presented to a different hospital during childhood with sensorineural deafness, which was treated with a hearing prosthesis, insulin requiring diabetes, retinitis pigmentosa, optic atrophy, and macrocytic anemia. These features initially suggested a clinical diagnosis of Wolfram syndrome (WS). Therapy with thiamine was initiated which resulted in the resolution of the anemia. The younger sister, who was affected with sensorineural deafness, was referred to our hospital for non-autoimmune diabetes. She was found to have macrocytosis and ocular abnormalities. Because a diagnosis of TRMA was suspected, therapy with insulin and thiamine was started. Sequencing analysis of the SLC19A2 gene identified a compound heterozygous mutation p.Y81X/p.L457X (c.242insA/c.1370delT) in both sisters. Non-autoimmune diabetes associated with deafness and macrocytosis, without anemia, suggests a diagnosis of TRMA. Patients clinically diagnosed with WS with anemia and/or macrocytosis should be reevaluated for TRMA. © 2012 John Wiley & Sons A/S.

  17. Generalized fast feedback system in the SLC

    International Nuclear Information System (INIS)

    Hendrickson, L.; Allison, S.; Gromme, T.; Himel, T.; Krauter, K.; Rouse, F.; Sass, R.; Shoaee, H.

    1991-11-01

    A generalized fast feedback system has been developed to stabilize beams at various locations in the SLC. The system is designed to perform measurements and change actuator settings to control beam states such as position, angle and energy on a pulse to pulse basis. The software design is based on the state space formalism of digital control theory. The system is database-driven, facilitating the addition of new loops without requiring additional software. A communications system, KISNet, provides fast communications links between microprocessors for feedback loops which involve multiple micros. Feedback loops have been installed in seventeen locations throughout the SLC and have proven to be invaluable in stabilizing the machine

  18. High levels of the type III inorganic phosphate transporter PiT1 (SLC20A1) can confer faster cell adhesion

    OpenAIRE

    Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup; Pedersen, Lene

    2014-01-01

    The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expre...

  19. Three bunch energy stabilization for the SLC injector

    International Nuclear Information System (INIS)

    Sheppard, J.C.; Almog, I.; Bambade, P.S.; Clendenin, J.E.; Jobe, R.K.; Phinney, N.; Shoaee, H.; Stiening, R.F.; Thompson, K.A.

    1986-09-01

    Slow feedback has been developed to control the energy and energy spread of the beams which are injected into the SLC damping rings. Within a single RF pulse, two bunches of electrons and one bunch of positrons are accelerated to an energy of 1.21 GeV in the injector of the SLC. The two electron bunches are deflected into the north damping ring while the positrons are targeted into the south ring. In order to fit into the acceptance of the rings, the composite energy deviation and energy spread of the beams must be less than 2% full width. Control of the beam energy characteristics is accomplished with a set of computer controlled feedback loops which monitor the parameters of the three bunches and make adjustments to the available RF energy, RF phasing, and RF timing. This paper presents an overview of the feedback algorithms and of the special hardware developments, and reports on the operational status of the processes

  20. Synthesis/literature review for determining structural layer coefficients (SLC) of bases.

    Science.gov (United States)

    2014-12-01

    FDOTs current method of determining a base material structural layer coefficient (SLC) is detailed in the : Materials Manual, Chapter 2.1, Structural Layer Coefficients for Flexible Pavement Base Materials. : Currently, any new base material not a...

  1. Pathogenic substitution of IVS15 + 5G > A in SLC26A4 in patients of Okinawa Islands with enlarged vestibular aqueduct syndrome or Pendred syndrome.

    Science.gov (United States)

    Ganaha, Akira; Kaname, Tadashi; Yanagi, Kumiko; Naritomi, Kenji; Tono, Tetsuya; Usami, Shin-ichi; Suzuki, Mikio

    2013-05-24

    Pendred syndrome (PS) and nonsyndromic hearing loss associated with enlarged vestibular aqueduct (EVA) are caused by SLC26A4 mutations. The Okinawa Islands are the southwestern-most islands of the Japanese archipelago. And ancestral differences have been reported between people from Okinawa Island and those from the main islands of Japan. To confirm the ethnic variation of the spectrum of SLC26A4 mutations, we investigated the frequencies of SLC26A4 mutations and clinical manifestations of patients with EVA or PS living in the Okinawa Islands. We examined 22 patients with EVA or PS from 21 unrelated families in Okinawa Islands. The patient's clinical history, findings of physical and otoscopic examinations, hearing test, and computed tomography (CT) scan of the temporal bones were recorded. To detect mutations, all 21 exons and the exon-intron junctions of SLC26A4 were sequenced for all subjects. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) for SLC26A4 and calculations using the comparative CT (2(-ΔΔCT)) method were used to determine the pathogenicity associated with gene substitutions. SLC26A4 mutations were identified in 21 of the 22 patients. We found a compound heterozygous mutation for IVS15 + 5G > A/H723R in nine patients (41%), a homozygous substitution of IVS15 + 5G > A in six patients (27%), and homozygous mutation for H723R in five patients (23%). The most prevalent types of SLC26A4 alleles were IVS15 + 5G > A and H723R, which both accounted for 15/22 (68%) of the patients. There were no significant correlations between the types of SLC26A4 mutation and clinical manifestations. Based on qRT-PCR results, expression of SLC26A4 was not identified in patients with the homozygous substitution of IVS15 + 5G > A. The substitution of IVS15 + 5G > A in SLC26A4 was the most common mutation in uniquely found in patients with PS and EVA in Okinawa Islands. This suggested that the spectrum of SLC26A4 mutation differed

  2. Variation in the SLC23A1 gene does not influence cardiometabolic outcomes to the extent expected given its association with l-ascorbic acid 1 2 3 4

    OpenAIRE

    Wade, Kaitlin H; Forouhi, Nita G; Cook, Derek G; Johnson, Paul; McConnachie, Alex; Morris, Richard W; Rodriguez, Santiago; Ye, Zheng; Ebrahim, Shah; Padmanabhan, Sandosh; Watt, Graham; Bruckdorfer, K Richard; Wareham, Nick J; Whincup, Peter H; Chanock, Stephen

    2014-01-01

    Background: Observational studies showed that circulating l-ascorbic acid (vitamin C) is inversely associated with cardiometabolic traits. However, these studies were susceptible to confounding and reverse causation.\\ud \\ud Objectives:We assessed the relation between l-ascorbic acid and 10 cardiometabolic traits by using a single nucleotide polymorphism in the solute carrier family 23 member 1 (SLC23A1) gene (rs33972313) associated with circulating l-ascorbic acid concentrations. The observed...

  3. Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

    International Nuclear Information System (INIS)

    Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; Ishimoto, Kenji; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi

    2009-01-01

    Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial β-oxidation. The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor that plays an important role in the regulation of β-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPARα and found that PPARα induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPARα regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

  4. Dispersive effects of transverse displacements of SLC Arc magnets

    International Nuclear Information System (INIS)

    Murray, J.J.; Fieguth, T.; Kheifets, S.

    1986-01-01

    The SLC Arc magnets are subject to random displacements and field errors resulting in unpredictable transverse displacement of the central trajectory from that of the design. The chosen method of correcting this perturbed trajectory in the SLC Arcs utilizes mechanical movement of the combined function magnets which compose the Arc transport lines. Here we present the results of a recent investigation substantiating the earlier results which led to the adoption of this method

  5. Cathepsin D Specifically Cleaves the Chemokines Macrophage Inflammatory Protein-1α, Macrophage Inflammatory Protein-1β, and SLC That Are Expressed in Human Breast Cancer

    Science.gov (United States)

    Wolf, Marlene; Clark-Lewis, Ian; Buri, Caroline; Langen, Hanno; Lis, Maddalena; Mazzucchelli, Luca

    2003-01-01

    Cathepsin D (Cath-D) expression in human primary breast cancer has been associated with a poor prognosis. In search of a better understanding of the Cath-D substrates possibly involved in cancer invasiveness and metastasis, we investigated the potential interactions between this protease and chemokines. Here we report that purified Cath-D, as well as culture supernatants from the human breast carcinoma cell lines MCF-7 and T47D, selectively degrade macrophage inflammatory protein (MIP)-1α (CCL3), MIP-1β (CCL4), and SLC (CCL21). Proteolysis was totally blocked by the protease inhibitor pepstatin A, and specificity of Cath-D cleavage was demonstrated using a large chemokine panel. Whereas MIP-1α and MIP-1β degradation was rapid and complete, cleavage of SLC was slow and not complete. Mass spectrometry analysis showed that Cath-D cleaves the Leu58 to Trp59 bond of SLC producing two functionally inactive fragments. Analysis of Cath-D proteolysis of a series of monocyte chemoattractant protein-3/MIP-1β hybrids indicated that processing of MIP-1β might start by cleaving off amino acids located in the C-terminal domain. In situ hybridization studies revealed MIP-1α, MIP-1β, and Cath-D gene expression mainly in the stromal compartment of breast cancers whereas SLC transcripts were found in endothelial cells of capillaries and venules within the neoplastic tissues. Cath-D production in the breast carcinoma cell lines MCF-7 and T47D, as assessed by enzyme-linked immunosorbent assay of culture supernatants and cell lysates, was not affected by stimulation with chemokines such as interleukin-8 (CXCL8), SDF-1 (CXCL12), and SLC. These data suggest that inactivation of chemokines by Cath-D possibly influences regulatory mechanisms in the tumoral extracellular microenvironment that in turn may affect the generation of the antitumoral immune response, the migration of cancer cells, or both processes. PMID:12651610

  6. Correlation plot facility in the SLC control system

    International Nuclear Information System (INIS)

    Hendrickson, L.; Phinney, N.; Sanchez-Chopitea, L.

    1991-05-01

    The Correlation Plot facility is a powerful interactive tool for data acquisition and analysis throughout the SLC. A generalized interface allows the user to perform a wide variety of machine physics experiments without the need for specialized software. It has been used extensively during SLC commissioning and operation. The user may step one or two independent parameters such as magnet or feedback setpoints while measuring or calculating up to 160 others. Measured variables include all analog signals available to the control system as well as a variety of derived parameters such as beam size or emittance. Various fitting algorithms and display options are provided for data analysis. A software-callable interface is also provided. Applications based on this facility are used to phase klystrons, measure emittance and dispersion, minimize beam size at the interaction point and maintain beam collisions. 4 refs., 3 figs

  7. Genetic variants in the regulatory region of SLC10A1 are not associated with the risk of hepatitis B virus infection and clearance.

    Science.gov (United States)

    Chen, Xueqin; Wang, Ying; Chen, Xiaohua; Cheng, Kailiang; Li, Jiaoyuan; Lou, Jiao; Ke, Juntao; Yang, Yang; Gong, Yajie; Zhu, Ying; Wang, Li; Zhong, Rong

    2016-10-01

    The Na/taurocholate cotransporter NTCP (encoded by SLC10A1) was identified as a cellular entry receptor for the human hepatitis B virus (HBV), advancing our understanding of the molecular mechanism of HBV infection. An alternative hypothesis was put forward that regulatory variants in SLC10A1 might play an important role in HBV susceptibility by potentially influencing expression levels of NTCP. The three regulatory SNPs (rs8011311, rs7154439, rs111409076) were genotyped in 1023 HBV-persistent carriers, 735 subjects with HBV natural clearance and 732 HBV marker-negative subjects in a Han Chinese population. Real-time reverse transcription PCR analysis and luciferase assays have been performed to dissect the potential functionality. In logistic regression analysis, when subjects with HBV natural clearance were compared with HBV marker-negative subjects, no significant associations with the risk of HBV infection were observed for any of the three SNPs after adjusting for age, sex, smoking status and alcohol consumption (P>0.05). Similar negative results were also found for the three SNPs when HBV-persistent carriers were compared with HBV marker-negative subjects. Likewise, no significant associations with the risk of HBV clearance were observed when HBV-persistent carriers were compared with subjects with HBV natural clearance (P>0.05). Quantitative RT/PCR showed no significant difference in NTCP expression levels in normal liver tissue amongst individuals with different rs111409076 genotypes (P=0.317 for the general linear model). Moreover, no evident effect of the SLC10A1 rs111409076 AACA/- polymorphism on transcriptional activity was found by luciferase assay in either HepG2 (P=0.161) or Hep3b (P=0.129) cell lines. The present study indicated that the common variants in the regulatory region of SLC10A1 may not influence the expression of NTCP at the level of transcriptional regulation, and ultimately may not be associated with HBV susceptibility in this Chinese

  8. Defining the phenotypic spectrum of SLC6A1 mutations

    DEFF Research Database (Denmark)

    Johannesen, Katrine M.; Gardella, Elena; Linnankivi, Tarja

    2018-01-01

    /polyspikes-and-slow waves in 25/31. Two patients developed an EEG pattern resembling electrical status epilepticus during sleep. Ataxia was observed in 7/34 cases. We describe 7 truncating and 18 missense variants, including 4 recurrent variants (Gly232Val, Ala288Val, Val342Met, and Gly362Arg). Significance: Most patients...... members. Four previously published cases were included for further electroclinical description. In total, we reviewed the electroclinical data of 34 subjects. Results: Cognitive development was impaired in 33/34 (97%) subjects; 28/34 had mild to moderate ID, with language impairment being the most common...... feature. Epilepsy was diagnosed in 31/34 cases with mean onset at 3.7 years. Cognitive assessment before epilepsy onset was available in 24/31 subjects and was normal in 25% (6/24), and consistent with mild ID in 46% (11/24) or moderate ID in 17% (4/24). Two patients had speech delay only, and 1 had...

  9. Generalized fast feedback system in the SLC

    International Nuclear Information System (INIS)

    Hendrickson, L.; Allison, S.; Gromme, T.; Himel, T.; Krauter, K.; Rouse, F.; Sass, R.; Shoaee, H.

    1992-01-01

    A generalized fast feedback system has been developed to stabilize beams at various locations in the SLC. The system is designed to perform measurements and change actuator settings to control beam states such as position, angle and energy on a pulse to pulse basis. The software design is based on the state space formalism of digital control theory. The system is database-driven, facilitating the addition of new loops without requiring additional software. A communications system, KISNet, provides fast communications links between microprocessors for feedback loops which involve multiple micros. Feedback loops have been installed in seventeen locations throughout the SLC and have proven to be invaluable in stabilizing the machine. (author)

  10. A status report on the SLC program

    International Nuclear Information System (INIS)

    Prescott, C.Y.

    1985-09-01

    The SLC program is an accelerator experiment and a physics experiment. The progress in the accelerator experiment has been rapid, with injector and damping ring components working, conventional construction on schedule, and technical components in production. Accelerator studies will investigate beam-linac and beam-beam interactions, with application to the design of future linear colliders. The physics experiments start in 1987 to study Z 0 properties and to look for new physics effects. Detectors to fully exploit the potential physics are under construction

  11. Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2009-11-20

    Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

  12. Status of the SLC: Developments in Linear Collider physics

    International Nuclear Information System (INIS)

    Krejcik, P.

    1994-11-01

    This paper reviews the performance of the SLAC Linear Collider, both from the perspective of a machine delivering high luminosity polarized beams for physics, and as a test for future linear colliders. The development of the SLC taken place over a number of years and the steady improvements have been documented in previous review papers. As a review paper, the list references also serves as a bibliography, pointing to the work of the many people contributing to the upgrades and commissioning of the various SLC systems. The major upgrades for this present run have been an improved final focus optics, new low impedance vacuum chambers for the damping rings and improved polarization from the electron source. The performance of the SLC is driven to some extent by its unique 3-beam operation in which the linac accelerates both the electron and positron bunches for collision, as well as the electron bunch to produce the positrons. The special attention required to maintain stable operation in the face of the interactions caused by beam loading from the bunches will (fortunately exclamation point) not be an issue in future linear colliders. They will deal instead with the problems associated with handling long bunch trains

  13. Reliability and lifetime predictions of SLC klystrons

    International Nuclear Information System (INIS)

    Allen, M.A.; Callin, R.S.; Fowkes, W.R.; Lee, T.G.; Vlieks, A.E.

    1989-01-01

    The energy upgrade of SLAC, with the first of the new 67 MW SLAC Linear Collider (SLC) klystrons, began over four years ago. Today there are over 200 of these klystrons in operation. As a result, there is a wealth of klystron performance and failure information that enables reasonable predictions to be made on life expectancy and reliability. Data from initial tests, follow-up tests and daily operation monitoring on the accelerator is stored for analysis. Presented here are life expectancy predictions with particular emphasis on cathode life. Also, based on this data, the authors will discuss some of the principal modes of failure. 3 refs., 2 figs., 1 tab

  14. 3D numerical thermal stress analysis of the high power target for the SLC Positron Source

    International Nuclear Information System (INIS)

    Reuter, E.M.; Hodgson, J.A.

    1991-05-01

    The volumetrically nonuniform power deposition of the incident 33 GeV electron beam in the SLC Positron Source Target is hypothesized to be the most likely cause target failure. The resultant pulsed temperature distributions are known to generate complicated stress fields with no known closed-form analytical solution. 3D finite element analyses of these temperature distributions and associated thermal stress fields in the new High Power Target are described here. Operational guidelines based on the results of these analyses combined with assumptions made about the fatigue characteristics of the exotic target material are proposed. 6 refs., 4 figs

  15. Bunch length measurements in the SLC damping ring

    International Nuclear Information System (INIS)

    Decker, F.J.; Limberg, T.; Minty, M.; Ross, M.

    1993-05-01

    The synchrotron light of the SLC damping ring was used to measure the bunch length with a streak camera at different times in the damping cycle. There are bunch length oscillations after injection, different equilibrium length during the cycle due to rf manipulations to avoid microwave instability oscillations, and just before extraction there is a longitudinal phase space rotation (bunch muncher) to shorten the bunch length. Measurements under these different conditions are presented and compared with BPM pulse height signals. Calibration and adjustment issues and the connection of the streak camera to the SLC control system are also discussed

  16. Functional assessment of allelic variants in the SLC26A4 gene involved in Pendred syndrome and nonsyndromic EVA

    Science.gov (United States)

    Pera, Alejandra; Dossena, Silvia; Rodighiero, Simona; Gandía, Marta; Bottà, Guido; Meyer, Giuliano; Moreno, Felipe; Nofziger, Charity; Hernández-Chico, Concepción; Paulmichl, Markus

    2008-01-01

    Pendred syndrome is an autosomal recessive disorder characterized by sensorineural hearing loss, with malformations of the inner ear, ranging from enlarged vestibular aqueduct (EVA) to Mondini malformation, and deficient iodide organification in the thyroid gland. Nonsyndromic EVA (ns-EVA) is a separate type of sensorineural hearing loss showing normal thyroid function. Both Pendred syndrome and ns-EVA seem to be linked to the malfunction of pendrin (SLC26A4), a membrane transporter able to exchange anions between the cytosol and extracellular fluid. In the past, the pathogenicity of SLC26A4 missense mutations were assumed if the mutations fulfilled two criteria: low incidence of the mutation in the control population and substitution of evolutionary conserved amino acids. Here we show that these criteria are insufficient to make meaningful predictions about the effect of these SLC26A4 variants on the pendrin-induced ion transport. Furthermore, we functionally characterized 10 missense mutations within the SLC26A4 ORF, and consistently found that on the protein level, an addition or omission of a proline or a charged amino acid in the SLC26A4 sequence is detrimental to its function. These types of changes may be adequate for predicting SLC26A4 functionality in the absence of direct functional tests. PMID:19017801

  17. Genetic variant SLC2A2 [corrected] Is associated with risk of cardiovascular disease – assessing the individual and cumulative effect of 46 type 2 diabetes related genetic variants.

    Directory of Open Access Journals (Sweden)

    Anders Borglykke

    Full Text Available To assess the individual and combined effect of 46 type 2 diabetes related risk alleles on incidence of a composite CVD endpoint.Data from the first Danish MONICA study (N = 3523 and the Inter99 study (N = 6049 was used. Using Cox proportional hazard regression the individual effect of each risk allele on incident CVD was analyzed. Risk was presented as hazard ratios (HR per risk allele.During 80,859 person years 1441 incident cases of CVD (fatal and non-fatal occurred in the MONICA study. In Inter99 942 incident cases were observed during 61,239 person years. In the Danish MONICA study four gene variants were significantly associated with incident CVD independently of known diabetes status at baseline; SLC2A2 rs11920090 (HR 1.147, 95% CI 1.027-1.283 , P = 0.0154, C2CD4A rs7172432 (1.112, 1.027-1.205 , P = 0.0089, GCKR rs780094 (1.094, 1.007-1.188 , P = 0.0335 and C2CD4B rs11071657 (1.092, 1.007-1.183 , P = 0.0323. The genetic score was significantly associated with increased risk of CVD (1.025, 1.010-1.041, P = 0.0016. In Inter99 two gene variants were associated with risk of CVD independently of diabetes; SLC2A2 (HR 1.180, 95% CI 1.038-1.341 P = 0.0116 and FTO (0.909, 0.827-0.998, P = 0.0463. Analysing the two populations together we found SLC2A2 rs11920090 (HR 1.164, 95% CI 1.070-1.267, P = 0.0004 meeting the Bonferroni corrected threshold for significance. GCKR rs780094 (1.076, 1.010-1.146, P = 0.0229, C2CD4B rs11071657 (1.067, 1.003-1.135, P = 0.0385 and NOTCH2 rs10923931 (1.104 (1.001 ; 1.217 , P = 0.0481 were found associated with CVD without meeting the corrected threshold. The genetic score was significantly associated with increased risk of CVD (1.018, 1.006-1.031, P = 0.0043.This study showed that out of the 46 genetic variants examined only the minor risk allele of SLC2A2 rs11920090 was significantly (P = 0.0005 associated with a composite endpoint of incident CVD below the threshold for statistical significance corrected for

  18. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    Science.gov (United States)

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  19. SLC5A8 gene, a transporter of butyrate: a gut flora metabolite, is frequently methylated in African American colon adenomas.

    Directory of Open Access Journals (Sweden)

    Hassan Brim

    Full Text Available Colon cancer is one of the leading causes of cancer related deaths. Its impact on African Americans (AAs is higher than in the general population both in the incidence and mortality from the disease. Colon cancer aggressiveness in AAs as well as non-frequent check-ups and follow up in this population have been proposed as ways to explain the observed discrepancies. These facts made the detection of early carcinogenesis markers in this population a priority.Here, we analyzed 50 colon adenomas from AA patients for both microsatellite instability (MSI and the methylation status of SLC5A8 gene. This gene's product is involved in the transport of butyrate that has anti-proliferative properties through its effects on histone acetylation and gene expression. A proteomic analysis to check the expressed histones in adenoma and normal tissues was also performed.The analyzed samples displayed 82% (n = 41 methylation level of SLC5A8 gene in adenomas. The MSI-H (high adenoma were about 18% (n = 9 while the rest were mostly MSS (microsatellite stable with few MSI-L (Low. No association was found between SLC5A8 methylation and the MSI status. Also, there was no association between SLC5A8 methylation and the sex and age of the patients. However, there were more right sided adenomas with SLC5A8 methylation than the left sided ones. The proteomic analysis revealed distinct histone expression profiles between normal and adenoma tissues.SLC5A8 is highly methylated in AA colon adenomas which points to its potential use as a marker for early detection. The MSI rate is similar to that found in colon cancer tumors in AAs. These findings suggest that both processes stem from the same epigenetic and genetic events occurring at an early stage in colon carcinogenesis in AAs.

  20. Limitations of interaction-point spot-size tuning at the SLC

    International Nuclear Information System (INIS)

    Emma, P.; Hendrickson, L.J.; Zimmermann, F.; Raimondi, P.

    1997-05-01

    At the Stanford Linear Collider (SLC), the interaction-point spot size is minimized by repeatedly correcting, for both beams, various low-order optical aberrations, such as dispersion, waist position or coupling. These corrections are performed about every 8 hours, by minimizing the IP spot size while exciting different orthogonal combinations of final-focus magnets. The spot size itself is determined by measuring the beam deflection angle as a function of the beam-beam separation. Additional information is derived from the energy loss due to beamstrahlung and from luminosity-related signals. In the 1996 SLC run, the typical corrections were so large as to imply a 20-40% average luminosity loss due to residual uncompensated or fluctuating tunable aberrations. In this paper, the authors explore the origin of these large tuning corrections and study possible mitigations for the next SLC run

  1. SLC5A8-Mediated Switching of STAT3 from a Pro-Oncogenic Signal into a Pro-Apoptotic Signal in Breast Cancer

    Science.gov (United States)

    2011-06-01

    provokes lung metastasis. (5) Both STAT3 and SLC5A8 knockout showed the similar phenotype, like mammary gland involution delay, mastitis and...100 ng/ml cholera toxin, 0.01mg/ml bovine insulin and 500 ng/ml hydrocortisone. HBL100 cells was grown in McCoy 5A with 10% FBS. MCF7 and BT20

  2. Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: The Viva La Familia Study

    Science.gov (United States)

    Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it...

  3. An Effective Gap Filtering Method for Landsat ETM+ SLC-Off Data

    Directory of Open Access Journals (Sweden)

    Seulki Lee

    2016-01-01

    Full Text Available The Landsat 7 Enhanced Thematic Mapper Plus (ETM+ scan line corrector (SLC failed on 31 May 2003, causing the SLC to turn off. Many gap-filled products were developed and deployed to combat this situation. The majority of these products used a primary image taken by the SLC when functioning properly in an attempt to correct SLC-off images. However, temporal atmospheric elements could not be reliably reflected using a primary image, and therefore the corrected image was not viable for use by monitoring systems. To bypass this limitation, this study has developed the Gap Interpolation and Filtering (GIF method that relies on one-dimensional interpolation filtering to conveniently recover pixels within a single image at a high level of accuracy without borrowing from images acquired at a different time or by another sensor. The GIF method was compared to two other methods—Global Linear Histogram Match (GLHM, and the Local Linear Histogram Match (LLHM—both developed by National Aeronautics and Space Administration (NASA and United States Geological Survey (USGS to determine its accuracy. The GIF method accuracy was found superior in land, sea, and cloud imaging. In particular, its sea and cloud images returned Root Mean Square Error (RMSE values close to or less than 1. We expect the GIF method developed in this research to be of invaluable aid to monitoring systems that depend heavily on Landsat imagery.

  4. Physical activity modifies the effect of SNPs in the SLC2A2 (GLUT2) and ABCC8 (SUR1) genes on the risk of developing type 2 diabetes

    DEFF Research Database (Denmark)

    Oskari Kilpeläinen, Tuomas; Lakka, T A; Laaksonen, D E

    2007-01-01

    . The interaction of the SNPs with the change in PA on the conversion to T2D was assessed using Cox regression with adjustments for the other components of the intervention (dietary changes, weight reduction). The carriers of the common homozygous genotype of rs5393, rs5394, or rs5404 of SLC2A2 and rs3758947...

  5. Beam based alignment of the SLC final focus sextupoles

    International Nuclear Information System (INIS)

    Emma, P.; Irwin, J.; Phinney, N.; Raimondi, P.; Toge, N.; Walker, N.J.; Ziemann, V.

    1993-05-01

    The strong demagnification inherent in final focus systems requires local cancellation of the resulting chromaticty. Strong sextupole pair separated by a -I transform are positioned π/2 in the betatron phase away from the Interaction Point (IP) in order to cancel chromatic aberrations primarily due to the final quadrupoles. Sextupole alignment is critical in order to provide orthogonal tuning of the chromaticty and, in the case of the SLC, to limit the third and higher order optical aberrations generated from misaligned and 'nested' horizontal and vertical sextupole pairs. Reported here is a novel technique for aligning the beam centroid to the sextupole centers, which uses measurements of the criticality dependent parameter - the beam size at the IP. Results for the SLC final focus sextupoles are presented, where a resolution of <50 μm is achieved

  6. Polarization at SLC

    International Nuclear Information System (INIS)

    Swartz, M.L.

    1988-07-01

    The SLAC Linear Collider has been designed to readily accommodate polarized electron beams. Considerable effort has been made to implement a polarized source, a spin rotation system, and a system to monitor the beam polarization. Nearly all major components have been fabricated. At the current time, several source and polarimeter components have been installed. The installation and commissioning of the entire system will take place during available machine shutdown periods as the commissioning of SLC progresses. It is expected that a beam polarization of 45% will be achieved with no loss in luminosity. 13 refs., 15 figs

  7. Determination of electroweak parameters at the SLC

    International Nuclear Information System (INIS)

    Torrence, E.

    1996-09-01

    We present an improved measurement of the left-right cross section asymmetry (A LR ) for Z 0 boson production by e + e - collisions. The measurement was performed at a center-of-mass energy of 91.28 GeV with the SLD detector at the SLAC Linear Collider (SLC) during the 1994-95 running period. The luminosity-weighted average polarization of the SLC electron beam during this run was measured to be (77.23 ± 0.52)%. Using a sample of 93,644 hadronic Z 0 decays, we measure the pole asymmetry A LR 0 to be 0.1512 ± 0.0042(stat.) ± 0.0011(syst.) which is equivalent to an effective weak mixing angle of sin 2 θ W eff = 0.23100 ± 0.00054(stat.) ± 0.00014(syst.). We also present a preliminary direct measurement of the Z 0 -lepton coupling asymmetries A e , A μ , and A τ extracted from the differential cross section observed in leptonic Z 0 decays. We combine these results with our previous A LR measurement to obtain a combined determination of the weak mixing angle sin 2 θ W eff = 0.23061 ± 0.00047

  8. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

    OpenAIRE

    Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

    2011-01-01

    Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged ...

  9. Loss of Slc4a1b chloride/bicarbonate exchanger function protects mechanosensory hair cells from aminoglycoside damage in the zebrafish mutant persephone.

    Directory of Open Access Journals (Sweden)

    Dale W Hailey

    Full Text Available Mechanosensory hair cell death is a leading cause of hearing and balance disorders in the human population. Hair cells are remarkably sensitive to environmental insults such as excessive noise and exposure to some otherwise therapeutic drugs. However, individual responses to damaging agents can vary, in part due to genetic differences. We previously carried out a forward genetic screen using the zebrafish lateral line system to identify mutations that alter the response of larval hair cells to the antibiotic neomycin, one of a class of aminoglycoside compounds that cause hair cell death in humans. The persephone mutation confers resistance to aminoglycosides. 5 dpf homozygous persephone mutants are indistinguishable from wild-type siblings, but differ in their retention of lateral line hair cells upon exposure to neomycin. The mutation in persephone maps to the chloride/bicarbonate exchanger slc4a1b and introduces a single Ser-to-Phe substitution in zSlc4a1b. This mutation prevents delivery of the exchanger to the cell surface and abolishes the ability of the protein to import chloride across the plasma membrane. Loss of function of zSlc4a1b reduces hair cell death caused by exposure to the aminoglycosides neomycin, kanamycin, and gentamicin, and the chemotherapeutic drug cisplatin. Pharmacological block of anion transport with the disulfonic stilbene derivatives DIDS and SITS, or exposure to exogenous bicarbonate, also protects hair cells against damage. Both persephone mutant and DIDS-treated wild-type larvae show reduced uptake of labeled aminoglycosides. persephone mutants also show reduced FM1-43 uptake, indicating a potential impact on mechanotransduction-coupled activity in the mutant. We propose that tight regulation of the ionic environment of sensory hair cells, mediated by zSlc4a1b activity, is critical for their sensitivity to aminoglycoside antibiotics.

  10. Chromatic correction in the SLC bunch length compressors

    International Nuclear Information System (INIS)

    Adolphsen, C.E.; Emma, P.J.; Fieguth, T.H.; Spence, W.L.

    1991-06-01

    The SLC Ring to Linac (RTL) transport lines employ intense bending and strong transverse focusing to produce the momentum compaction needed for bunch length compression prior to S-band acceleration. In the presence of the large rf induced energy spread needed for compression the consequent chromatic effects -- viz. the variation with energy of residual output dispersion and of the RTL transfer matrix, threaten to destroy the small emittances produced by the damping rings. We report on the tuning methods that have been developed and used to implement the sextupole based chromatic correction scheme. 6 refs., 4 figs

  11. The zinc transporter SLC39A13/ZIP13 is required for connective tissue development; its involvement in BMP/TGF-beta signaling pathways.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Fukada

    Full Text Available BACKGROUND: Zinc (Zn is an essential trace element and it is abundant in connective tissues, however biological roles of Zn and its transporters in those tissues and cells remain unknown. METHODOLOGY/PRINCIPAL FINDINGS: Here we report that mice deficient in Zn transporter Slc39a13/Zip13 show changes in bone, teeth and connective tissue reminiscent of the clinical spectrum of human Ehlers-Danlos syndrome (EDS. The Slc39a13 knockout (Slc39a13-KO mice show defects in the maturation of osteoblasts, chondrocytes, odontoblasts, and fibroblasts. In the corresponding tissues and cells, impairment in bone morphogenic protein (BMP and TGF-beta signaling were observed. Homozygosity for a SLC39A13 loss of function mutation was detected in sibs affected by a unique variant of EDS that recapitulates the phenotype observed in Slc39a13-KO mice. CONCLUSIONS/SIGNIFICANCE: Hence, our results reveal a crucial role of SLC39A13/ZIP13 in connective tissue development at least in part due to its involvement in the BMP/TGF-beta signaling pathways. The Slc39a13-KO mouse represents a novel animal model linking zinc metabolism, BMP/TGF-beta signaling and connective tissue dysfunction.

  12. Verification of the SLC wake potentials

    International Nuclear Information System (INIS)

    Bane, K.; Weiland, T.

    1983-01-01

    The accurate knowledge of the monopole, dipole, and quadrupole wake potentials is essential for SLC. These wake potentials were previously computed by the modal method. The time domain code TBCI allows independent verification of these results. This comparison shows that the two methods agree to within 10% for bunch lengths down to 1 mm. TBCI results also indicate that rounding the irises gives at least a 10% reduction in the wake potentials

  13. Importance of high order momentum terms in SLC optics

    International Nuclear Information System (INIS)

    Kozanecki, W.

    1985-01-01

    The evaluation of background levels at the SLC relies, in several cases, on the proper representation of how low momentum electrons propagate through the Arcs and the Final Focus System (FFS). For example, beam - gas bremsstrahlung in the arcs causes electrons of up to 6% energy loss to be transported through to the IP; secondary showers on edges of masks and collimators yield debris with a very wide momentum spectrum. This note is a naive attempt at checking the validity of TRANSPORT and TURTLE calculations, by evaluating the contributions of the momentum terms to increasingly higher order, and checking the mutual consistency of the results produced by the two methods on a beam of wide momentum spread. 8 refs., 4 figs., 1 tab

  14. SLC6A3 coding variant Ala559Val found in two autism probands alters dopamine transporter function and trafficking.

    Science.gov (United States)

    Bowton, E; Saunders, C; Reddy, I A; Campbell, N G; Hamilton, P J; Henry, L K; Coon, H; Sakrikar, D; Veenstra-VanderWeele, J M; Blakely, R D; Sutcliffe, J; Matthies, H J G; Erreger, K; Galli, A

    2014-10-14

    Emerging evidence associates dysfunction in the dopamine (DA) transporter (DAT) with the pathophysiology of autism spectrum disorder (ASD). The human DAT (hDAT; SLC6A3) rare variant with an Ala to Val substitution at amino acid 559 (hDAT A559V) was previously reported in individuals with bipolar disorder or attention-deficit hyperactivity disorder (ADHD). We have demonstrated that this variant is hyper-phosphorylated at the amino (N)-terminal serine (Ser) residues and promotes an anomalous DA efflux phenotype. Here, we report the novel identification of hDAT A559V in two unrelated ASD subjects and provide the first mechanistic description of its impaired trafficking phenotype. DAT surface expression is dynamically regulated by DAT substrates including the psychostimulant amphetamine (AMPH), which causes hDAT trafficking away from the plasma membrane. The integrity of DAT trafficking directly impacts DA transport capacity and therefore dopaminergic neurotransmission. Here, we show that hDAT A559V is resistant to AMPH-induced cell surface redistribution. This unique trafficking phenotype is conferred by altered protein kinase C β (PKCβ) activity. Cells expressing hDAT A559V exhibit constitutively elevated PKCβ activity, inhibition of which restores the AMPH-induced hDAT A559V membrane redistribution. Mechanistically, we link the inability of hDAT A559V to traffic in response to AMPH to the phosphorylation of the five most distal DAT N-terminal Ser. Mutation of these N-terminal Ser to Ala restores AMPH-induced trafficking. Furthermore, hDAT A559V has a diminished ability to transport AMPH, and therefore lacks AMPH-induced DA efflux. Pharmacological inhibition of PKCβ or Ser to Ala substitution in the hDAT A559V background restores AMPH-induced DA efflux while promoting intracellular AMPH accumulation. Although hDAT A559V is a rare variant, it has been found in multiple probands with neuropsychiatric disorders associated with imbalances in DA neurotransmission

  15. Mask locations in the SLC final focus region

    International Nuclear Information System (INIS)

    Cence, R.J.

    1983-01-01

    The location of four sets of masks needed to shield against background in the final focus region of the SLC is shown. The main point of this note is to update the results of Miller and Sens taking into account the recent changes that have been made in the optics of the SLC beams. For the latest beam design we use the TRANSPORT output dated 5-13-83. This design assumes that the final bends will form an S about the interaction point and that the final quadrupoles will be superconducting and will be placed about 8 feet from the interaction point

  16. Systematic investigation of SLC final focus tolerances to errors

    International Nuclear Information System (INIS)

    Napoly, O.

    1996-10-01

    In this paper we review the tolerances of the SLC final focus system. To calculate these tolerances we used the error analysis routine of the program FFADA which has been written to aid the design and the analysis of final focus systems for the future linear colliders. This routine, complete by S. Fartoukh, systematically reviews the errors generated by the geometric 6-d Euclidean displacements of each magnet as well as by the field errors (normal and skew) up to the sextipolar order. It calculates their effects on the orbit and the transfer matrix at the second order in the errors, thus including cross-talk between errors originating from two different magnets. It also translates these effects in terms of tolerance derived from spot size growth and luminosity loss. We have run the routine for the following set of beam IP parameters: σ * x = 2.1 μm; σ * x' = 300 μrd; σ * x = 1 mm; σ * y = 0.55 μm; σ * y' = 200 μrd; σ * b = 2 x 10 -3 . The resulting errors and tolerances are displayed in a series of histograms which are reproduced in this paper. (author)

  17. An in-situ photocathode loading system for the SLC Polarized Electron Gun

    International Nuclear Information System (INIS)

    Kirby, R.E.; Collet, G.J.; Skarpaas, K.

    1992-12-01

    An ultra-high vacuum loadlock system capable of operating at high voltage has been added to the SLC Polarized Electron Gun. The unit incorporates facilities for heat cleaning, activating and measuring the quantum efficiency of photocathodes. A tray of up to four photocathodes can be exchanged without bringing the activation unit or gun up to atmosphere. Low voltage quantum efficiencies of 20% have been obtained for bulk GaAs at 633 nm and 6% for a 0.3 micron GaAs layer at 755 nm. Results for other cathodes as well as operational characteristics are discussed

  18. Mutations in SLC33A1 cause a lethal autosomal-recessive disorder with congenital cataracts, hearing loss, and low serum copper and ceruloplasmin

    DEFF Research Database (Denmark)

    Huppke, Peter; Brendel, Cornelia; Kalscheuer, Vera

    2012-01-01

    or compound heterozygous mutations for all affected subjects in SLC33A1 encoding a highly conserved acetylCoA transporter (AT-1) required for acetylation of multiple gangliosides and glycoproteins. The mutations were found to cause reduced or absent AT-1 expression and abnormal intracellular localization...

  19. Klystron control software in the SLC

    International Nuclear Information System (INIS)

    Jobe, R.K.; Thompson, K.; Phinney, N.

    1985-05-01

    Triggering, control, and monitoring of 240 high-power klystrons will be supported by the SLC control system this summer. The control software is distributed among a VAX host computer, a local microprocessor cluster, and a dedicated intelligent CAMAC module. The functions performed by these three components and the algorithms used are discussed

  20. TGF-β signaling directly regulates transcription and functional expression of the electrogenic sodium bicarbonate cotransporter 1, NBCe1 (SLC4A4), via Smad4 in mouse astrocytes.

    Science.gov (United States)

    Khakipoor, Shokoufeh; Ophoven, Christian; Schrödl-Häußel, Magdalena; Feuerstein, Melanie; Heimrich, Bernd; Deitmer, Joachim W; Roussa, Eleni

    2017-08-01

    The electrogenic sodium bicarbonate cotransporter NBCe1 (SLC4A4) expressed in astrocytes regulates intracellular and extracellular pH. Here, we introduce transforming growth factor beta (TGF-β) as a novel regulator of NBCe1 transcription and functional expression. Using hippocampal slices and primary hippocampal and cortical astrocyte cultures, we investigated regulation of NBCe1 and elucidated the underlying signaling pathways by RT-PCR, immunoblotting, immunofluorescence, intracellular H( + ) recording using the H( +