WorldWideScience

Sample records for abc transporter-encoding gene

  1. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  2. Genome-wide identification, characterization and phylogenetic analysis of 50 catfish ATP-binding cassette (ABC) transporter genes.

    Science.gov (United States)

    Liu, Shikai; Li, Qi; Liu, Zhanjiang

    2013-01-01

    Although a large set of full-length transcripts was recently assembled in catfish, annotation of large gene families, especially those with duplications, is still a great challenge. Most often, complexities in annotation cause mis-identification and thereby much confusion in the scientific literature. As such, detailed phylogenetic analysis and/or orthology analysis are required for annotation of genes involved in gene families. The ATP-binding cassette (ABC) transporter gene superfamily is a large gene family that encodes membrane proteins that transport a diverse set of substrates across membranes, playing important roles in protecting organisms from diverse environment. In this work, we identified a set of 50 ABC transporters in catfish genome. Phylogenetic analysis allowed their identification and annotation into seven subfamilies, including 9 ABCA genes, 12 ABCB genes, 12 ABCC genes, 5 ABCD genes, 2 ABCE genes, 4 ABCF genes and 6 ABCG genes. Most ABC transporters are conserved among vertebrates, though cases of recent gene duplications and gene losses do exist. Gene duplications in catfish were found for ABCA1, ABCB3, ABCB6, ABCC5, ABCD3, ABCE1, ABCF2 and ABCG2. The whole set of catfish ABC transporters provide the essential genomic resources for future biochemical, toxicological and physiological studies of ABC drug efflux transporters. The establishment of orthologies should allow functional inferences with the information from model species, though the function of lineage-specific genes can be distinct because of specific living environment with different selection pressure.

  3. Polymorphism in ABC transporter genes of Dirofilaria immitis

    Directory of Open Access Journals (Sweden)

    Thangadurai Mani

    2017-08-01

    Full Text Available Dirofilaria immitis, a filarial nematode, causes dirofilariasis in dogs, cats and occasionally in humans. Prevention of the disease has been mainly by monthly use of the macrocyclic lactone (ML endectocides during the mosquito transmission season. Recently, ML resistance has been confirmed in D. immitis and therefore, there is a need to find new classes of anthelmintics. One of the mechanisms associated with ML resistance in nematodes has been the possible role of ATP binding cassette (ABC transporters in reducing drug concentrations at receptor sites. ABC transporters, mainly from sub-families B, C and G, may contribute to multidrug resistance (MDR by active efflux of drugs out of the cell. Gene products of ABC transporters may thus serve as the targets for agents that may modulate susceptibility to drugs, by inhibiting drug transport. ABC transporters are believed to be involved in a variety of physiological functions critical to the parasite, such as sterol transport, and therefore may also serve as the target for drugs that can act as anthelmintics on their own. Knowledge of polymorphism in these ABC transporter genes in nematode parasites could provide useful information for the process of drug design. We have identified 15 ABC transporter genes from sub-families A, B, C and G, in D. immitis, by comparative genomic approaches and analyzed them for polymorphism. Whole genome sequencing data from four ML susceptible (SUS and four loss of efficacy (LOE pooled populations were used for single nucleotide polymorphism (SNP genotyping. Out of 231 SNPs identified in those 15 ABC transporter genes, 89 and 75 of them were specific to the SUS or LOE populations, respectively. A few of the SNPs identified may affect gene expression, protein function, substrate specificity or resistance development and may be useful for transporter inhibitor/anthelmintic drug design, or in order to anticipate resistance development. Keywords: Dirofilaria immitis

  4. ABC transporters in Arthropods: genomic comparison and role in insecticide transport and resistance

    NARCIS (Netherlands)

    Dermauw, W.; Van Leeuwen, T.

    2014-01-01

    About a 100 years ago, the Drosophila white mutant marked the birth of Drosophila genetics. The white gene turned out to encode the first well studied ABC transporter in arthropods. The ABC gene family is now recognized as one of the largest transporter families in all kingdoms of life. The majority

  5. The ABC gene family in arthropods: comparative genomics and role in insecticide transport and resistance.

    Science.gov (United States)

    Dermauw, Wannes; Van Leeuwen, Thomas

    2014-02-01

    About a 100 years ago, the Drosophila white mutant marked the birth of Drosophila genetics. The white gene turned out to encode the first well studied ABC transporter in arthropods. The ABC gene family is now recognized as one of the largest transporter families in all kingdoms of life. The majority of ABC proteins function as primary-active transporters that bind and hydrolyze ATP while transporting a large diversity of substrates across lipid membranes. Although extremely well studied in vertebrates for their role in drug resistance, less is known about the role of this family in the transport of endogenous and exogenous substances in arthropods. The ABC families of five insect species, a crustacean and a chelicerate have been annotated in some detail. We conducted a thorough phylogenetic analysis of the seven arthropod and human ABC protein subfamilies, to infer orthologous relationships that might suggest conserved function. Most orthologous relationships were found in the ABCB half transporter, ABCD, ABCE and ABCF subfamilies, but specific expansions within species and lineages are frequently observed and discussed. We next surveyed the role of ABC transporters in the transport of xenobiotics/plant allelochemicals and their involvement in insecticide resistance. The involvement of ABC transporters in xenobiotic resistance in arthropods is historically not well documented, but an increasing number of studies using unbiased differential gene expression analysis now points to their importance. We give an overview of methods that can be used to link ABC transporters to resistance. ABC proteins have also recently been implicated in the mode of action and resistance to Bt toxins in Lepidoptera. Given the enormous interest in Bt toxicology in transgenic crops, such findings will provide an impetus to further reveal the role of ABC transporters in arthropods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. A burst of ABC genes in the genome of the polyphagous spider mite Tetranychus urticae

    NARCIS (Netherlands)

    Dermauw, W.; Osborne, E.J.; Clark, R.M.; Grbić, M.; Tirry, L.; Van Leeuwen, T.

    2013-01-01

    Background: The ABC (ATP-binding cassette) gene superfamily is widespread across all living species. The majority of ABC genes encode ABC transporters, which are membrane-spanning proteins capable of transferring substrates across biological membranes by hydrolyzing ATP. Although ABC transporters

  7. Frequent down-regulation of ABC transporter genes in prostate cancer.

    Science.gov (United States)

    Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata

    2015-10-12

    ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors.

  8. Frequent down-regulation of ABC transporter genes in prostate cancer

    International Nuclear Information System (INIS)

    Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata

    2015-01-01

    ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p < 0.001). The study suggests frequent down-regulation of the ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors. The online version of this article (doi:10.1186/s12885-015-1689-8) contains supplementary material, which is available to authorized users

  9. Transportomics: screening for substrates of ABC transporters in body fluids using vesicular transport assays.

    NARCIS (Netherlands)

    Krumpochova, P; Sapthu, S.; Brouwers, J.F.H.M.; de Haas, M.; de Vos, R.; Borst, P.; van de Wetering, K.

    2013-01-01

    ABSTRACT The ATP-binding cassette (ABC) genes encode the largest family of transmembrane proteins. ABC transporters translocate a wide variety of substrates across membranes, but their physiological function is often incompletely understood. We describe a new method to study the substrate spectrum

  10. ABC transporters from Aspergillus nidulans are involved in protection against cytotoxic agents and antibiotic production

    NARCIS (Netherlands)

    Andrade, A.C.; Nistelrooy, van J.G.M.; Peery, R.B.; Skatrud, P.L.; Waard, de M.A.

    2000-01-01

    This paper describes the characterization of atrC and atrD (ABC transporters C and D), two novel ABC transporter-encoding genes from the filamentous fungus Aspergillus nidulans, and provides evidence for the involvement of atrD in multidrug transport and antibiotic production. BLAST analysis of the

  11. Isolation and Characterization of the Colletotrichum acutatum ABC Transporter CaABC1

    Directory of Open Access Journals (Sweden)

    Suyoung Kim

    2014-12-01

    Full Text Available Fungi tolerate exposure to various abiotic stresses, including cytotoxic compounds and fungicides, via their ATP-driven efflux pumps belonging to ATP-binding cassette (ABC transporters. To clarify the molecular basis of interaction between the fungus and various abiotic stresses including fungicides, we constructed a cDNA library from germinated conidia of Colletotrichum acutatum, a major anthracnose pathogen of pepper (Capsicum annum L.. Over 1,000 cDNA clones were sequenced, of which single clone exhibited significant nucleotide sequence homology to ABC transporter genes. We isolated three fosmid clones containing the C. acutatum ABC1 (CaABC1 gene in full-length from genomic DNA library screening. The CaABC1 gene consists of 4,059 bp transcript, predicting a 1,353-aa protein. The gene contains the typical ABC signature and Walker A and B motifs. The 5′-flanking region contains a CAAT motif, a TATA box, and a Kozak region. Phylogenetic and structural analysis suggested that the CaABC1 is a typical ABC transporter gene highly conserved in various fungal species, as well as in Chromista, Metazoans, and Viridiplantae. We also found that CaABC1 was up-regulated during conidiation and a minimal medium condition. Moreover, CaABC1 was induced in iprobenfos, kresoxim-methyl, thiophanate-methyl, and hygromycin B. These results demonstrate that CaABC1 is necessary for conidiation, abiotic stress, and various fungicide resistances. These results will provide the basis for further study on the function of ABC transporter genes in C. acutatum.

  12. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum.

    Science.gov (United States)

    Broehan, Gunnar; Kroeger, Tobias; Lorenzen, Marcé; Merzendorfer, Hans

    2013-01-16

    The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control.

  13. Bioinformatic survey of ABC transporters in dermatophytes.

    Science.gov (United States)

    Gadzalski, Marek; Ciesielska, Anita; Stączek, Paweł

    2016-01-15

    ATP binding cassette (ABC) transporters constitute a very large and ubiquitous superfamily of membrane proteins. They are responsible for ATP hydrolysis driven translocation of countless substrates. Being a very old and diverse group of proteins present in all organisms they share a common feature, which is the presence of an evolutionary conservative nucleotide binding domain (NBD)--the engine that drives the transport. Another common domain is a transmembrane domain (TMD) which consists of several membrane-spanning helices. This part of protein is substrate-specific, thus it is much more variable. ABC transporters are known for driving drug efflux in many pathogens and cancer cells, therefore they are the subject of extensive studies. There are many examples of conferring a drug resistance phenotype in fungal pathogens by ABC transporters, however, little is known about these proteins in dermatophytes--a group of fungi causing superficial mycoses. So far only a single ABC transporter has been extensively studied in this group of pathogens. We analyzed available genomic sequences of seven dermatophyte species in order to provide an insight into dermatophyte ABC protein inventory. Phylogenetic studies of ABC transporter genes and their products were conducted and included ABC transporters of other fungi. Our results show that each dermatophyte genome studied possesses a great variety of ABC transporter genes. Detailed analysis of selected genes and their products indicates that relatively recent duplication of ABC transporter genes could lead to novel substrate specificity. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. The ABC transporter Tba of Amycolatopsis balhimycina is required for efficient export of the glycopeptide antibiotic balhimycin.

    Science.gov (United States)

    Menges, R; Muth, G; Wohlleben, W; Stegmann, E

    2007-11-01

    All known gene clusters for glycopeptide antibiotic biosynthesis contain a conserved gene supposed to encode an ABC-transporter. In the balhimycin-producer Amycolatopsis balhimycina this gene (tba) is localised between the prephenate dehydrogenase gene pdh and the peptide synthetase gene bpsA. Inactivation of tba in A. balhimycina by gene replacement did not interfere with growth and did not affect balhimycin resistance. However, in the supernatant of the tba mutant RM43 less balhimycin was accumulated compared to the wild type; and the intra-cellular balhimycin concentration was ten times higher in the tba mutant RM43 than in the wild type. These data suggest that the ABC transporter encoded in the balhimycin biosynthesis gene cluster is not involved in resistance but is required for the efficient export of the antibiotic. To elucidate the activity of Tba it was heterologously expressed in Escherichia coli with an N-terminal His-tag and purified by nickel chromatography. A photometric assay revealed that His(6)-Tba solubilised in dodecylmaltoside possesses ATPase activity, characteristic for ABC-transporters.

  15. Diversity and evolution of ABC proteins in mycorrhiza-forming fungi.

    Science.gov (United States)

    Kovalchuk, Andriy; Kohler, Annegret; Martin, Francis; Asiegbu, Fred O

    2015-12-28

    Transporter proteins are predicted to have an important role in the mycorrhizal symbiosis, due to the fact that this type of an interaction between plants and fungi requires a continuous nutrient and signalling exchange. ABC transporters are one of the large groups of transporter proteins found both in plants and in fungi. The crucial role of plant ABC transporters in the formation of the mycorrhizal symbiosis has been demonstrated recently. Some of the fungal ABC transporter-encoding genes are also induced during the mycorrhiza formation. However, no experimental evidences of the direct involvement of fungal ABC transporters in this process are available so far. To facilitate the identification of fungal ABC proteins with a potential role in the establishment of the mycorrhizal symbiosis, we have performed an inventory of the ABC protein-encoding genes in the genomes of 25 species of mycorrhiza-forming fungi. We have identified, manually annotated and curated more than 1300 gene models of putative ABC protein-encoding genes. Out of those, more than 1000 models are predicted to encode functional proteins, whereas about 300 models represent gene fragments or putative pseudogenes. We have also performed the phylogenetic analysis of the identified sequences. The sets of ABC proteins in the mycorrhiza-forming species were compared to the related saprotrophic or plant-pathogenic fungal species. Our results demonstrate the high diversity of ABC genes in the genomes of mycorrhiza-forming fungi. Via comparison of transcriptomics data from different species, we have identified candidate groups of ABC transporters that might have a role in the process of the mycorrhiza formation. Results of our inventory will facilitate the identification of fungal transporters with a role in the mycorrhiza formation. We also provide the first data on ABC protein-coding genes for the phylum Glomeromycota and for orders Pezizales, Atheliales, Cantharellales and Sebacinales, contributing to

  16. The AbcA Transporter of Staphylococcus aureus Affects Cell Autolysis

    Science.gov (United States)

    Schrader-Fischer, Gesine; Berger-Bächi, Brigitte

    2001-01-01

    Increased production of penicillin-binding protein PBP 4 is known to increase peptidoglycan cross-linking and contributes to methicillin resistance in Staphylococcus aureus. The pbp4 gene shares a 400-nucleotide intercistronic region with the divergently transcribed abcA gene, encoding an ATP-binding cassette transporter of unknown function. Our study revealed that methicillin stimulated abcA transcription but had no effects on pbp4 transcription. Analysis of abcA expression in mutants defective for global regulators showed that abcA is under the control of agr. Insertional inactivation of abcA by an erythromycin resistance determinant did not influence pbp4 transcription, nor did it alter resistance to methicillin and other cell wall-directed antibiotics. However, abcA mutants showed spontaneous partial lysis on plates containing subinhibitory concentrations of methicillin due to increased spontaneous autolysis. Since the autolytic zymograms of cell extracts were identical in mutants and parental strains, we postulate an indirect role of AbcA in control of autolytic activities and in protection of the cells against methicillin. PMID:11158733

  17. Genome-Wide Identification, Characterization and Phylogenetic Analysis of ATP-Binding Cassette (ABC) Transporter Genes in Common Carp (Cyprinus carpio).

    Science.gov (United States)

    Liu, Xiang; Li, Shangqi; Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A; Xu, Peng

    2016-01-01

    The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.

  18. Genome-Wide Identification, Characterization and Phylogenetic Analysis of ATP-Binding Cassette (ABC) Transporter Genes in Common Carp (Cyprinus carpio)

    Science.gov (United States)

    Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A.

    2016-01-01

    The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp. PMID:27058731

  19. Genome-Wide Identification, Characterization and Phylogenetic Analysis of ATP-Binding Cassette (ABC Transporter Genes in Common Carp (Cyprinus carpio.

    Directory of Open Access Journals (Sweden)

    Xiang Liu

    Full Text Available The ATP-binding cassette (ABC gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.

  20. A burst of ABC genes in the genome of the polyphagous spider mite Tetranychus urticae.

    Science.gov (United States)

    Dermauw, Wannes; Osborne, Edward John; Clark, Richard M; Grbić, Miodrag; Tirry, Luc; Van Leeuwen, Thomas

    2013-05-10

    The ABC (ATP-binding cassette) gene superfamily is widespread across all living species. The majority of ABC genes encode ABC transporters, which are membrane-spanning proteins capable of transferring substrates across biological membranes by hydrolyzing ATP. Although ABC transporters have often been associated with resistance to drugs and toxic compounds, within the Arthropoda ABC gene families have only been characterized in detail in several insects and a crustacean. In this study, we report a genome-wide survey and expression analysis of the ABC gene superfamily in the spider mite, Tetranychus urticae, a chelicerate ~ 450 million years diverged from other Arthropod lineages. T. urticae is a major agricultural pest, and is among of the most polyphagous arthropod herbivores known. The species resists a staggering array of toxic plant secondary metabolites, and has developed resistance to all major classes of pesticides in use for its control. We identified 103 ABC genes in the T. urticae genome, the highest number discovered in a metazoan species to date. Within the T. urticae ABC gene set, all members of the eight currently described subfamilies (A to H) were detected. A phylogenetic analysis revealed that the high number of ABC genes in T. urticae is due primarily to lineage-specific expansions of ABC genes within the ABCC, ABCG and ABCH subfamilies. In particular, the ABCC subfamily harbors the highest number of T. urticae ABC genes (39). In a comparative genomic analysis, we found clear orthologous relationships between a subset of T. urticae ABC proteins and ABC proteins in both vertebrates and invertebrates known to be involved in fundamental cellular processes. These included members of the ABCB-half transporters, and the ABCD, ABCE and ABCF families. Furthermore, one-to-one orthologues could be distinguished between T. urticae proteins and human ABCC10, ABCG5 and ABCG8, the Drosophila melanogaster sulfonylurea receptor and ecdysone-regulated transporter E

  1. Abc1: a new ABC transporter from the fission yeast Schizosaccharomyces pombe

    DEFF Research Database (Denmark)

    Christensen, P U; Davis, K; Nielsen, O

    1997-01-01

    We have isolated the abc1 gene from the fission yeast Schizosaccharomyces pombe. Sequence analysis suggests that the Abc1 protein is a member of the ABC superfamily of transporters and is composed of two structurally homologous halves, each consisting of a hydrophobic region of six transmembrane...

  2. An operon from Lactobacillus helveticus composed of a proline iminopeptidase gene (pepI) and two genes coding for putative members of the ABC transporter family of proteins.

    Science.gov (United States)

    Varmanen, P; Rantanen, T; Palva, A

    1996-12-01

    A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.

  3. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in sea lamprey and Japanese lamprey.

    Science.gov (United States)

    Ren, Jianfeng; Chung-Davidson, Yu-Wen; Yeh, Chu-Yin; Scott, Camille; Brown, Titus; Li, Weiming

    2015-06-06

    Lampreys are extant representatives of the jawless vertebrate lineage that diverged from jawed vertebrates around 500 million years ago. Lamprey genomes contain information crucial for understanding the evolution of gene families in vertebrates. The ATP-binding cassette (ABC) gene family is found from prokaryotes to eukaryotes. The recent availability of two lamprey draft genomes from sea lamprey Petromyzon marinus and Japanese lamprey Lethenteron japonicum presents an opportunity to infer early evolutionary events of ABC genes in vertebrates. We conducted a genome-wide survey of the ABC gene family in two lamprey draft genomes. A total of 37 ABC transporters were identified and classified into seven subfamilies; namely seven ABCA genes, 10 ABCB genes, 10 ABCC genes, three ABCD genes, one ABCE gene, three ABCF genes, and three ABCG genes. The ABCA subfamily has expanded from three genes in sea squirts, seven and nine in lampreys and zebrafish, to 13 and 16 in human and mouse. Conversely, the multiple copies of ABCB1-, ABCG1-, and ABCG2-like genes found in sea squirts have contracted in the other species examined. ABCB2 and ABCB3 seem to be new additions in gnathostomes (not in sea squirts or lampreys), which coincides with the emergence of the gnathostome-specific adaptive immune system. All the genes in the ABCD, ABCE and ABCF subfamilies were conserved and had undergone limited duplication and loss events. In the sea lamprey transcriptomes, the ABCE and ABCF gene subfamilies were ubiquitously and highly expressed in all tissues while the members in other gene subfamilies were differentially expressed. Thirteen more lamprey ABC transporter genes were identified in this study compared with a previous study. By concatenating the same gene sequences from the two lampreys, more full length sequences were obtained, which significantly improved both the assignment of gene names and the phylogenetic trees compared with a previous analysis using partial sequences. The ABC

  4. The product of the ABC half-transporter gene ABCG2 (BCRP/MXR/ABCP) is expressed in the plasma membrane

    DEFF Research Database (Denmark)

    Rocchi, E; Khodjakov, A; Volk, E L

    2000-01-01

    by Western blot and immunohistochemistry. This protein is highly overexpressed in several drug-resistant cell lines and localizes predominantly to the plasma membrane, instead of to intracellular membranes as seen with all other known half-transporters. Therefore, BCRP/MXR is unique among the ABC half......The products of the ABC gene family can be generally classified as either full-transporters of half-transporters. Full-transporters are expressed in the plasma membrane, whereas half-transporters are usually found in intracellular membranes. Recently, an ABC half-transporter, the ABCG2 gene product......-transporters by being localized to the plasma membrane....

  5. Transcriptomic insights on the ABC transporter gene family in the salmon louse Caligus rogercresseyi.

    Science.gov (United States)

    Valenzuela-Muñoz, Valentina; Sturm, Armin; Gallardo-Escárate, Cristian

    2015-04-09

    ATP-binding cassette (ABC) protein family encode for membrane proteins involved in the transport of various biomolecules through the cellular membrane. These proteins have been identified in all taxa and present important physiological functions, including the process of insecticide detoxification in arthropods. For that reason the ectoparasite Caligus rogercresseyi represents a model species for understanding the molecular underpinnings involved in insecticide drug resistance. llumina sequencing was performed using sea lice exposed to 2 and 3 ppb of deltamethrin and azamethiphos. Contigs obtained from de novo assembly were annotated by Blastx. RNA-Seq analysis was performed and validated by qPCR analysis. From the transcriptome database of C. rogercresseyi, 57 putative members of ABC protein sequences were identified and phylogenetically classified into the eight subfamilies described for ABC transporters in arthropods. Transcriptomic profiles for ABC proteins subfamilies were evaluated throughout C. rogercresseyi development. Moreover, RNA-Seq analysis was performed for adult male and female salmon lice exposed to the delousing drugs azamethiphos and deltamethrin. High transcript levels of the ABCB and ABCC subfamilies were evidenced. Furthermore, SNPs mining was carried out for the ABC proteins sequences, revealing pivotal genomic information. The present study gives a comprehensive transcriptome analysis of ABC proteins from C. rogercresseyi, providing relevant information about transporter roles during ontogeny and in relation to delousing drug responses in salmon lice. This genomic information represents a valuable tool for pest management in the Chilean salmon aquaculture industry.

  6. Functional analysis of ABC transporter genes from Botrytis cinerea identifies BcatrB as a transporter of eugenol

    NARCIS (Netherlands)

    Schoonbeek, H.; Nistelrooy, van J.G.M.; Waard, de M.A.

    2003-01-01

    The role of multiple ATP-binding cassette (ABC) and major facilitator superfamily (MFS) transporter genes from the plant pathogenic fungus Botrytis cinerea in protection against natural fungitoxic compounds was studied by expression analysis and phenotyping of gene-replacement mutants. The

  7. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in the silkworm, Bombyx mori.

    Science.gov (United States)

    Xie, Xiaodong; Cheng, Tingcai; Wang, Genhong; Duan, Jun; Niu, Weihuan; Xia, Qingyou

    2012-07-01

    The ATP-binding cassette (ABC) superfamily is a larger protein family with diverse physiological functions in all kingdoms of life. We identified 53 ABC transporters in the silkworm genome, and classified them into eight subfamilies (A-H). Comparative genome analysis revealed that the silkworm has an expanded ABCC subfamily with more members than Drosophila melanogaster, Caenorhabditis elegans, or Homo sapiens. Phylogenetic analysis showed that the ABCE and ABCF genes were highly conserved in the silkworm, indicating possible involvement in fundamental biological processes. Five multidrug resistance-related genes in the ABCB subfamily and two multidrug resistance-associated-related genes in the ABCC subfamily indicated involvement in biochemical defense. Genetic variation analysis revealed four ABC genes that might be evolving under positive selection. Moreover, the silkworm ABCC4 gene might be important for silkworm domestication. Microarray analysis showed that the silkworm ABC genes had distinct expression patterns in different tissues on day 3 of the fifth instar. These results might provide new insights for further functional studies on the ABC genes in the silkworm genome.

  8. Studying of the function of expected ABC transporter Rv1458c-Rv1457c-Rv1456c in mycobacteria; Studium funkcie predpokladaneho ABC transportera Rv1458c-Rv1457c-Rv1456c v mykobakteriach

    Energy Technology Data Exchange (ETDEWEB)

    Sarkan, M; Mikusova, K; Kordulakova, J [Univerzita Komenskeho v Bratislave, Prirodovedecka fakulta, Katedra biochemie, 84215 Bratislava (Slovakia)

    2012-04-25

    The bacterium Mycobacterium tuberculosis - the originator of tuberculosis in humans - is characterized by a complex cell wall, which is responsible for a high bacteria resistant to adverse external environmental conditions, as well as to the common antibiotics. The structure of the cell wall components and enzymes involved into its biosynthesis are relatively well described, but there is no information on the transfer of intermediate products of its biosynthetic across the plasmatic membrane. Orthologues of genes rv1459c-rv1458c-rv1457c-rv1456c of M. tuberculosis are in the same configuration in genomes of all previously sequenced mycobacterial strains. Rv1459c gene encodes a probable glycosyltransferases and genes rv1458c, rv1457c rv1456c code nucleotide binding and transmembrane subunits of expected ABC transporter. In our work we focused on the study of the function of expected ABC transporter Rv1458c-Rv1457c-Rv1456c, through analysis of phenotypes of strains M. Smegmatis. They have orthologues of genes encoding the transmembrane subunits of this transporter suspended by fragment encoding resistance to kanamycin. (authors)

  9. Mouse ATP-Binding Cassette (ABC) Transporters Conferring Multi-Drug Resistance

    Science.gov (United States)

    Shuaizhang, L I; Zhang, Wen; Yin, Xuejiao; Xing, Shilai; Xie, Qunhui; Cao, Zhengyu; Zhao, Bin

    2015-04-28

    The ABC (ATP-binding cassette) transporter is one of the largest and most ancient protein families with members functioning from protozoa to human. The resistance of cancer and tumor cells to anticancer drugs is due to the over-expression of some ABC transporters, which may finally lead to chemotherapy failure. The mouse ABC transporters are classified into seven subfamilies by phylogenetic analysis. The mouse ABC transporter gene, alias, chromosomal location and function have been determined. Within the ABC super-family, the MDR transporters (Abcb1, Abcc1, Abcg2) in mouse models have been proved to be valuable to investigate the biochemistry and physiological functions. This review concentrates on the multidrug resistance of mouse ABC transporters in cancer and tumor cells.

  10. The ABC transporters in Candidatus Liberibacter asiaticus.

    Science.gov (United States)

    Li, Wenlin; Cong, Qian; Pei, Jimin; Kinch, Lisa N; Grishin, Nick V

    2012-11-01

    Candidatus Liberibacter asiaticus (Ca. L. asiaticus) is a Gram-negative bacterium and the pathogen of Citrus Greening disease (Huanglongbing, HLB). As a parasitic bacterium, Ca. L. asiaticus harbors ABC transporters that play important roles in exchanging chemical compounds between Ca. L. asiaticus and its host. Here, we analyzed all the ABC transporter-related proteins in Ca. L. asiaticus. We identified 14 ABC transporter systems and predicted their structures and substrate specificities. In-depth sequence and structure analysis including multiple sequence alignment, phylogenetic tree reconstruction, and structure comparison further support their function predictions. Our study shows that this bacterium could use these ABC transporters to import metabolites (amino acids and phosphates) and enzyme cofactors (choline, thiamine, iron, manganese, and zinc), resist to organic solvent, heavy metal, and lipid-like drugs, maintain the composition of the outer membrane (OM), and secrete virulence factors. Although the features of most ABC systems could be deduced from the abundant experimental data on their orthologs, we reported several novel observations within ABC system proteins. Moreover, we identified seven nontransport ABC systems that are likely involved in virulence gene expression regulation, transposon excision regulation, and DNA repair. Our analysis reveals several candidates for further studies to understand and control the disease, including the type I virulence factor secretion system and its substrate that are likely related to Ca. L. asiaticus pathogenicity and the ABC transporter systems responsible for bacterial OM biosynthesis that are good drug targets. Copyright © 2012 Wiley Periodicals, Inc.

  11. Effect of the deletion of qmoABC and the promoter distal gene encoding a hypothetical protein on sulfate-reduction in Desulfovibrio vulgaris Hildenborough

    Energy Technology Data Exchange (ETDEWEB)

    Zane, Grant M.; Yen, Huei-chi Bill; Wall, Judy D.

    2010-03-18

    The pathway of electrons required for the reduction of sulfate in sulfate-reducing bacteria (SRB) is not yet fully characterized. In order to determine the role of a transmembrane protein complex suggested to be involved in this process, a deletion of Desulfovibrio vulgaris Hildenborough was created by marker exchange mutagenesis that eliminated four genes putatively encoding the QmoABC complex and a hypothetical protein (DVU0851). The Qmo complex (quinone-interacting membrane-bound oxidoreductase) is proposed to be responsible for transporting electrons to the dissimilatory adenosine-5?phosphosulfate (APS) reductase in SRB. In support of the predicted role of this complex, the deletion mutant was unable to grow using sulfate as its sole electron acceptor with a range of electron donors. To explore a possible role for the hypothetical protein in sulfate reduction, a second mutant was constructed that had lost only the gene that codes for DVU0851. The second constructed mutant grew with sulfate as the sole electron acceptor; however, there was a lag that was not present with the wild-type or complemented strain. Neither deletion strain was significantly impaired for growth with sulfite or thiosulfate as terminal electron acceptor. Complementation of the D(qmoABC-DVU0851) mutant with all four genes or only the qmoABC genes restored its ability to grow by sulfate respiration. These results confirmed the prediction that the Qmo complex is in the electron pathway for sulfate-reduction and revealed that no other transmembrane complex could compensate when Qmo was lacking.

  12. Genome-wide identification of whole ATP-binding cassette (ABC) transporters in the intertidal copepod Tigriopus japonicus.

    Science.gov (United States)

    Jeong, Chang-Bum; Kim, Bo-Mi; Lee, Jae-Seong; Rhee, Jae-Sung

    2014-08-05

    The ATP-binding cassette (ABC) transporter superfamily is one of the largest transporter gene families and is observed in all animal taxa. Although a large set of transcriptomic data was recently assembled for several species of crustaceans, identification and annotation of the large ABC transporter gene family have been very challenging. In the intertidal copepod Tigriopus japonicus, 46 putative ABC transporters were identified using in silico analysis, and their full-length cDNA sequences were characterized. Phylogenetic analysis revealed that the 46 T. japonicus ABC transporters are classified into eight subfamilies (A-H) that include all the members of all ABC subfamilies, consisting of five ABCA, five ABCB, 17 ABCC, three ABCD, one ABCE, three ABCF, seven ABCG, and five ABCH subfamilies. Of them, unique isotypic expansion of two clades of ABCC1 proteins was observed. Real-time RT-PCR-based heatmap analysis revealed that most T. japonicus ABC genes showed temporal transcriptional expression during copepod development. The overall transcriptional profile demonstrated that half of all T. japonicus ABC genes were strongly associated with at least one developmental stage. Of them, transcripts TJ-ABCH_88708 and TJ-ABCE1 were highly expressed during all developmental stages. The whole set of T. japonicus ABC genes and their phylogenetic relationships will provide a better understanding of the comparative evolution of essential gene family resources in arthropods, including the crustacean copepods.

  13. Molecular cloning and expression profile of an ATP-binding cassette (ABC) transporter gene from the hemipteran insect Nilaparvata lugens.

    Science.gov (United States)

    Zha, W J; Li, S H; Zhou, L; Chen, Z J; Liu, K; Yang, G C; Hu, G; He, G C; You, A Q

    2015-03-30

    The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. In insects, ABC transporters have important functions in the transport of molecules, and are also involved in insecticide resistance, metabolism, and development. In this study, the Nilaparvata lugens Stal (Hemiptera: Delphacidae) ABCG (NlABCG) gene was identified and characterized. The complete mRNA sequence of NlABCG was 2608-bp long, with an open reading frame of 2064 bp encoding a protein comprised of 687 amino acids. The conserved regions include three N-glycosylation and 34 phosphorylation sites, as well as seven transmembrane domains. The amino acid identity with the closely related species Acyrthosiphon pisum was 42.8%. Developmental expression analysis using quantitative real-time reverse transcriptase PCR suggested that the NlABCG transcript was expressed at all developmental stages of N. lugens. The lowest expression of NlABCG was in the 1st instar, and levels increased with larval growth. The transcript profiles of NlABCG were analyzed in various tissues from a 5th instar nymph, and the highest expression was observed in the midgut. These results suggest that the sequence, characteristics, and expression of NlABCG are highly conserved, and basic information is provided for its functional analysis.

  14. The ABC of Biofilm Drug Tolerance: the MerR-Like Regulator BrlR Is an Activator of ABC Transport Systems, with PA1874-77 Contributing to the Tolerance of Pseudomonas aeruginosa Biofilms to Tobramycin.

    Science.gov (United States)

    Poudyal, Bandita; Sauer, Karin

    2018-02-01

    A hallmark of biofilms is their tolerance to killing by antimicrobial agents. In Pseudomonas aeruginosa , biofilm drug tolerance requires the c-di-GMP-responsive MerR transcriptional regulator BrlR. However, the mechanism by which BrlR mediates biofilm drug tolerance has not been elucidated. Here, we demonstrate that BrlR activates the expression of at least 7 ABC transport systems, including the PA1874-PA1875-PA1876-PA1877 (PA1874-77) operon, with chromatin immunoprecipitation and DNA binding assays confirming BrlR binding to the promoter region of PA1874-77. Insertional inactivation of the 7 ABC transport systems rendered P. aeruginosa PAO1 biofilms susceptible to tobramycin or norfloxacin. Susceptibility was linked to drug accumulation, with BrlR contributing to norfloxacin accumulation in a manner dependent on multidrug efflux pumps and the PA1874-77 ABC transport system. Inactivation of the respective ABC transport system, furthermore, eliminated the recalcitrance of biofilms to killing by tobramycin but not norfloxacin, indicating that drug accumulation is not linked to biofilm drug tolerance. Our findings indicate for the first time that BrlR, a MerR-type transcriptional activator, activates genes encoding several ABC transport systems, in addition to multiple multidrug efflux pump genes. Moreover, our data confirm a BrlR target contributing to drug tolerance, likely countering the prevailing dogma that biofilm tolerance arises from a multiplicity of factors. Copyright © 2018 American Society for Microbiology.

  15. Molybdate transporter ModABC is important for Pseudomonas aeruginosa chronic lung infection.

    Science.gov (United States)

    Périnet, Simone; Jeukens, Julie; Kukavica-Ibrulj, Irena; Ouellet, Myriam M; Charette, Steve J; Levesque, Roger C

    2016-01-12

    Mechanisms underlying the success of Pseudomonas aeruginosa in chronic lung infection among cystic fibrosis (CF) patients are poorly defined. The modA gene was previously linked to in vivo competitiveness of P. aeruginosa by a genetic screening in the rat lung. This gene encodes a subunit of transporter ModABC, which is responsible for extracellular uptake of molybdate. This compound is essential for molybdoenzymes, including nitrate reductases. Since anaerobic growth conditions are known to occur during CF chronic lung infection, inactivation of a molybdate transporter could inhibit proliferation through the inactivation of denitrification enzymes. Hence, we performed phenotypic characterization of a modA mutant strain obtained by signature-tagged mutagenesis (STM_modA) and assessed its virulence in vivo with two host models. The STM_modA mutant was in fact defective for anaerobic growth and unable to use nitrates in the growth medium for anaerobic respiration. Bacterial growth and nitrate usage were restored when the medium was supplemented with molybdate. Most significantly, the mutant strain showed reduced virulence compared to wild-type strain PAO1 according to a competitive index in the rat model of chronic lung infection and a predation assay with Dictyostelium discoideum amoebae. As the latter took place in aerobic conditions, the in vivo impact of the mutation in modA appears to extend beyond its effect on anaerobic growth. These results support the modABC-encoded transporter as important for the pathogenesis of P. aeruginosa, and suggest that enzymatic machinery implicated in anaerobic growth during chronic lung infection in CF merits further investigation as a potential target for therapeutic intervention.

  16. Identification of ABC transporters acting in vitamin B12 metabolism in Caenorhabditis elegans.

    Science.gov (United States)

    McDonald, Megan K; Fritz, Julie-Anne; Jia, Dongxin; Scheuchner, Deborah; Snyder, Floyd F; Stanislaus, Avalyn; Curle, Jared; Li, Liang; Stabler, Sally P; Allen, Robert H; Mains, Paul E; Gravel, Roy A

    2017-12-01

    Vitamin B 12 (cobalamin, Cbl) is a micronutrient essential to human health. Cbl is not utilized as is but must go through complex subcellular and metabolic processing to generate two cofactor forms: methyl-Cbl for methionine synthase, a cytosolic enzyme; and adenosyl-Cbl for methylmalonyl-CoA mutase, a mitochondrial enzyme. Some 10-12 human genes have been identified responsible for the intracellular conversion of Cbl to cofactor forms, including genes that code for ATP-binding cassette (ABC) transporters acting at the lysosomal and plasma membranes. However, the gene for mitochondrial uptake is not known. We hypothesized that ABC transporters should be candidates for other uptake and efflux functions, including mitochondrial transport, and set out to screen ABC transporter mutants for blocks in Cbl utilization using the nematode roundworm Caenorhabditis elegans. Thirty-seven mutant ABC transporters were screened for the excretion of methylmalonic acid (MMA), which should result from loss of Cbl transport into the mitochondria. One mutant, wht-6, showed elevated MMA excretion and reduced [ 14 C]-propionate incorporation, pointing to a functional block in methylmalonyl-CoA mutase. In contrast, the wht-6 mutant appeared to have a normal cytosolic pathway based on analysis of cystathionine excretion, suggesting that cytosolic methionine synthase was functioning properly. Further, the MMA excretion in wht-6 could be partially reversed by including vitamin B 12 in the assay medium. The human ortholog of wht-6 is a member of the G family of ABC transporters. We propose wht-6 as a candidate for the transport of Cbl into mitochondria and suggest that a member of the corresponding ABCG family of ABC transporters has this role in humans. Our ABC transporter screen also revealed that mrp-1 and mrp-2 mutants excreted lower MMA than wild type, suggesting they were concentrating intracellular Cbl, consistent with the cellular efflux defect proposed for the mammalian MRP1 ABC

  17. A Survey of the ATP-Binding Cassette (ABC) Gene Superfamily in the Salmon Louse (Lepeophtheirus salmonis).

    Science.gov (United States)

    Carmona-Antoñanzas, Greta; Carmichael, Stephen N; Heumann, Jan; Taggart, John B; Gharbi, Karim; Bron, James E; Bekaert, Michaël; Sturm, Armin

    2015-01-01

    Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance.

  18. Whole-transcriptome survey of the putative ATP-binding cassette (ABC) transporter family genes in the latex-producing laticifers of Hevea brasiliensis.

    Science.gov (United States)

    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng

    2015-01-01

    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.

  19. Plant ABC transporters enable many unique aspects of a terrestrial plant's lifestyle

    DEFF Research Database (Denmark)

    Hwang, Jae-Ung; Song, Won-Yong; Hong, Daewoong

    2016-01-01

    Terrestrial plants have two to four times more ATP-binding cassette (ABC) transporter genes than other organisms, including their ancestral microalgae. Recent studies found that plants harboring mutations in these transporters exhibit dramatic phenotypes, many of which are related to developmental...... to propose that diverse ABC transporters enabled many unique and essential aspects of a terrestrial plant's lifestyle, by transporting various compounds across specific membranes of the plant....

  20. Transcriptional expression analysis of ABC efflux transporters and xenobiotic-metabolizing enzymes in the Chinese rare minnow.

    Science.gov (United States)

    Yuan, Lilai; Lv, Biping; Zha, Jinmiao; Wang, Zijian

    2014-05-01

    In the present study, the cDNA fragments of five ABC transporter genes (ABCB1, ABCB11, ABCC1, ABCC2, and ABCG2) in the rare minnow were cloned, and their tissue-specific expression patterns were evaluated across eight rare minnow tissues (liver, gill, intestine, kidney, spleen, brain, skin, and muscle). Furthermore, the transcriptional effects on these ABC transporter genes and five xenobiotic-metabolizing enzyme genes (CYP1A, GSTm, GSTp1, GCLC, and UGT1a) were determined in the rare minnow liver after 12 days of pyrene exposure. Basal expression analysis showed that the tissues with high expression of the ABC transporters included the liver, kidney, and intestine. Moreover, the most highly expressed of the ABC genes were ABCB1 and ABCC2 in all eight of the tissues tested. The ABCB11 gene was almost exclusively expressed in the liver of the rare minnow, whereas ABCC1 and ABCG2 showed weak expression in all eight tissues compared to ABCB1 and ABCC2. Our results provide the first thorough examination of the expression patterns of toxicologically relevant ABC transporters in the rare minnow and serve as a necessary basis for further studies of these ABC transporters in fish. Furthermore, synergistic up-regulation of CYP1A, GSTp1, GCLC, UGT1a, and ABCC2 was observed in the rare minnow liver following pyrene exposure, while GSTm, ABCB1, ABCB11, ABCC1, and ABCG2 were not significantly affected (p ABC transporters by pyrene suggests a possible involvement and cooperation of these genes in the detoxification process in rare minnows. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Evidence for an ABC-Type Riboflavin Transporter System in Pathogenic Spirochetes

    Science.gov (United States)

    Deka, Ranjit K.; Brautigam, Chad A.; Biddy, Brent A.; Liu, Wei Z.; Norgard, Michael V.

    2013-01-01

    ABSTRACT Bacterial transporter proteins are involved in the translocation of many essential nutrients and metabolites. However, many of these key bacterial transport systems remain to be identified, including those involved in the transport of riboflavin (vitamin B2). Pathogenic spirochetes lack riboflavin biosynthetic pathways, implying reliance on obtaining riboflavin from their hosts. Using structural and functional characterizations of possible ligand-binding components, we have identified an ABC-type riboflavin transport system within pathogenic spirochetes. The putative lipoprotein ligand-binding components of these systems from three different spirochetes were cloned, hyperexpressed in Escherichia coli, and purified to homogeneity. Solutions of all three of the purified recombinant proteins were bright yellow. UV-visible spectra demonstrated that these proteins were likely flavoproteins; electrospray ionization mass spectrometry and thin-layer chromatography confirmed that they contained riboflavin. A 1.3-Å crystal structure of the protein (TP0298) encoded by Treponema pallidum, the syphilis spirochete, demonstrated that the protein’s fold is similar to the ligand-binding components of ABC-type transporters. The structure also revealed other salient details of the riboflavin binding site. Comparative bioinformatics analyses of spirochetal genomes, coupled with experimental validation, facilitated the discovery of this new ABC-type riboflavin transport system(s). We denote the ligand-binding component as riboflavin uptake transporter A (RfuA). Taken together, it appears that pathogenic spirochetes have evolved an ABC-type transport system (RfuABCD) for survival in their host environments, particularly that of the human host. PMID:23404400

  2. Functional Analysis of an ATP-Binding Cassette Transporter Gene in Botrytis cinerea by Gene Disruption

    OpenAIRE

    Masami, NAKAJIMA; Junko, SUZUKI; Takehiko, HOSAKA; Tadaaki, HIBI; Katsumi, AKUTSU; School of Agriculture, Ibaraki University; School of Agriculture, Ibaraki University; School of Agriculture, Ibaraki University; Department of Agriculture and Environmental Biology, The University of Tokyo; School of Agriculture, Ibaraki University

    2001-01-01

    The BMR1 gene encoding an ABC transporter was cloned from Botrytis cinerea. To examine the function of BMR1 in B.cinerea, we isolated BMR1-deficient mutants after gene disruption. Disruption vector pBcDF4 was constructed by replacing the BMR1-coding region with a hygromycin B phosphotransferase gene(hph)cassette. The BMR1 disruptants had an increased sensitivity to polyoxin and iprobenfos. Polyoxin and iprobenfos, structurally unrelated compounds, may therefore be substrates of BMR1.

  3. ABC- and SLC-Transporters in Murine and Bovine Mammary Epithelium

    DEFF Research Database (Denmark)

    Yagdiran, Yagmur; Oskarsson, Agneta; Knight, Christopher H.

    2016-01-01

    Some chemicals are ligands to efflux transporters which may result in high concentrations in milk. Limited knowledge is available on the influence of maternal exposure to chemicals on the expression and function of transporters in the lactating mammary gland. We determined gene expression of ABC ...

  4. Export of recombinant proteins in Escherichia coli using ABC transporter with an attached lipase ABC transporter recognition domain (LARD

    Directory of Open Access Journals (Sweden)

    Moon Yuseok

    2009-01-01

    Full Text Available Abstract Background ATP binding cassette (ABC transporter secretes the protein through inner and outer membranes simultaneously in gram negative bacteria. Thermostable lipase (TliA of Pseudomonas fluorescens SIK W1 is secreted through the ABC transporter. TliA has four glycine-rich repeats (GGXGXD in its C-terminus, which appear in many ABC transporter-secreted proteins. From a homology model of TliA derived from the structure of P. aeruginosa alkaline protease (AprA, lipase ABC transporter domains (LARDs were designed for the secretion of fusion proteins. Results The LARDs included four glycine-rich repeats comprising a β-roll structure, and were added to the C-terminus of test proteins. Either Pro-Gly linker or Factor Xa site was added between fusion proteins and LARDs. We attached different length of LARDs such as LARD0, LARD1 or whole TliA (the longest LARD to three types of proteins; green fluorescent protein (GFP, epidermal growth factor (EGF and cytoplasmic transduction peptide (CTP. These fusion proteins were expressed in Escherichia coli together with ABC transporter of either P. fluorescens or Erwinia chrysanthemi. Export of fusion proteins with the whole TliA through the ABC transporter was evident on the basis of lipase enzymatic activity. Upon supplementation of E. coli with ABC transporter, GFP-LARDs and EGF-LARDs were excreted into the culture supernatant. Conclusion The LARDs or whole TliA were attached to C-termini of model proteins and enabled the export of the model proteins such as GFP and EGF in E. coli supplemented with ABC transporter. These results open the possibility for the extracellular production of recombinant proteins in Pseudomonas using LARDs or TliA as a C-terminal signal sequence.

  5. A putative ABC transporter is involved in negative regulation of biofilm formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Zhu, Xinna; Long, Fei; Chen, Yonghui

    2008-01-01

    Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC...... the same amount of biofilm biomass as the wild-type strain. Furthermore, transcription of the downstream lm.G_1770 was not influenced by the upstream Tn917 insertion, and the presence of Tn917 has no effect on biofilm formation. These results suggest that lm.G_1771 was solely responsible for the negative...

  6. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  7. Cloning, characterization and tissue distribution of the rat ATP-binding cassette (ABC) transporter ABC2/ABCA2.

    OpenAIRE

    Zhao, L X; Zhou, C J; Tanaka, A; Nakata, M; Hirabayashi, T; Amachi, T; Shioda, S; Ueda, K; Inagaki, N

    2000-01-01

    The ABC1 (ABCA) subfamily of the ATP-binding cassette (ABC) transporter superfamily has a structural feature that distinguishes it from other ABC transporters. Here we report the cloning, molecular characterization and tissue distribution of ABC2/ABCA2, which belongs to the ABC1 subfamily. Rat ABC2 is a protein of 2434 amino acids that has 44.5%, 40.0% and 40.8% identity with mouse ABC1/ABCA1, human ABC3/ABCA3 and human ABCR/ABCA4 respectively. Immunoblot analysis showed that proteins of 260 ...

  8. Glycolysis inhibition inactivates ABC transporters to restore drug sensitivity in malignant cells.

    Directory of Open Access Journals (Sweden)

    Ayako Nakano

    Full Text Available Cancer cells eventually acquire drug resistance largely via the aberrant expression of ATP-binding cassette (ABC transporters, ATP-dependent efflux pumps. Because cancer cells produce ATP mostly through glycolysis, in the present study we explored the effects of inhibiting glycolysis on the ABC transporter function and drug sensitivity of malignant cells. Inhibition of glycolysis by 3-bromopyruvate (3BrPA suppressed ATP production in malignant cells, and restored the retention of daunorubicin or mitoxantrone in ABC transporter-expressing, RPMI8226 (ABCG2, KG-1 (ABCB1 and HepG2 cells (ABCB1 and ABCG2. Interestingly, although side population (SP cells isolated from RPMI8226 cells exhibited higher levels of glycolysis with an increased expression of genes involved in the glycolytic pathway, 3BrPA abolished Hoechst 33342 exclusion in SP cells. 3BrPA also disrupted clonogenic capacity in malignant cell lines including RPMI8226, KG-1, and HepG2. Furthermore, 3BrPA restored cytotoxic effects of daunorubicin and doxorubicin on KG-1 and RPMI8226 cells, and markedly suppressed subcutaneous tumor growth in combination with doxorubicin in RPMI8226-implanted mice. These results collectively suggest that the inhibition of glycolysis is able to overcome drug resistance in ABC transporter-expressing malignant cells through the inactivation of ABC transporters and impairment of SP cells with enhanced glycolysis as well as clonogenic cells.

  9. Functional characterization of the Bradyrhizobium japonicum modA and modB genes involved in molybdenum transport.

    Science.gov (United States)

    Delgado, María J; Tresierra-Ayala, Alvaro; Talbi, Chouhra; Bedmar, Eulogio J

    2006-01-01

    A modABC gene cluster that encodes an ABC-type, high-affinity molybdate transporter from Bradyrhizobium japonicum has been isolated and characterized. B. japonicum modA and modB mutant strains were unable to grow aerobically or anaerobically with nitrate as nitrogen source or as respiratory substrate, respectively, and lacked nitrate reductase activity. The nitrogen-fixing ability of the mod mutants in symbiotic association with soybean plants grown in a Mo-deficient mineral solution was severely impaired. Addition of molybdate to the bacterial growth medium or to the plant mineral solution fully restored the wild-type phenotype. Because the amount of molybdate required for suppression of the mutant phenotype either under free-living or under symbiotic conditions was dependent on sulphate concentration, it is likely that a sulphate transporter is also involved in Mo uptake in B. japonicum. The promoter region of the modABC genes has been characterized by primer extension. Reverse transcription and expression of a transcriptional fusion, P(modA)-lacZ, was detected only in a B. japonicum modA mutant grown in a medium without molybdate supplementation. These findings indicate that transcription of the B. japonicum modABC genes is repressed by molybdate.

  10. Polymorphisms in ABC transporter genes and concentrations of mercury in newborns--evidence from two Mediterranean birth cohorts.

    Directory of Open Access Journals (Sweden)

    Sabrina Llop

    Full Text Available The genetic background may influence methylmercury (MeHg metabolism and neurotoxicity. ATP binding cassette (ABC transporters actively transport various xenobiotics across biological membranes.To investigate the role of ABC polymorphisms as modifiers of prenatal exposure to MeHg.The study population consisted of participants (n = 1651 in two birth cohorts, one in Italy and Greece (PHIME and the other in Spain (INMA. Women were recruited during pregnancy in Italy and Spain, and during the perinatal period in Greece. Total mercury concentrations were measured in cord blood samples by atomic absorption spectrometry. Maternal fish intake during pregnancy was determined from questionnaires. Polymorphisms (n = 5 in the ABC genes ABCA1, ABCB1, ABCC1 and ABCC2 were analysed in both cohorts.ABCB1 rs2032582, ABCC1 rs11075290, and ABCC2 rs2273697 modified the associations between maternal fish intake and cord blood mercury concentrations. The overall interaction coefficient between rs2032582 and log2-transformed fish intake was negative for carriers of GT (β = -0.29, 95%CI -0.47, -0.12 and TT (β = -0.49, 95%CI -0.71, -0.26 versus GG, meaning that for a doubling in fish intake of the mothers, children with the rs2032582 GG genotype accumulated 35% more mercury than children with TT. For rs11075290, the interaction coefficient was negative for carriers of TC (β = -0.12, 95%CI -0.33, 0.09, and TT (β = -0.28, 95%CI -0.51, -0.06 versus CC. For rs2273697, the interaction coefficient was positive when combining GA+AA (β = 0.16, 95%CI 0.01, 0.32 versus GG.The ABC transporters appear to play a role in accumulation of MeHg during early development.

  11. Molecular characterization of ABC transporters in marine ciliate, Euplotes crassus: Identification and response to cadmium and benzo[a]pyrene.

    Science.gov (United States)

    Kim, Hokyun; Yim, Bora; Kim, Jisoo; Kim, Haeyeon; Lee, Young-Mi

    2017-11-30

    ATP-binding cassette (ABC) transporters participate in transporting various substances, including xenobiotics, in or out of cells. However, their genetic information and function in ciliates remain still unclear. In this study, we sequenced and characterized two ABC transporter genes (EcABCB and EcABCC), and investigated the effect of cadmium (Cd) and benzo[a]pyrene (B[a]P) on their function and gene expression, using efflux assay and real-time reverse transcription-polymerase chain reaction (qRT-PCR), respectively, in the marine ciliate, Euplotes crassus. Sequencing analysis and efflux assay showed that EcABCB and EcABCC are typical ABC transporters, possessing conserved function. Exposure to Cd (≥5mg/L) and B[a]P (≥50.5μg/L) enhanced accumulation of a substrate. A significant increase in the expression of EcABCB and EcABC mRNA was observed at lower concentration in response to Cd and B[a]P. Our findings indicate that Cd and B[a]P could inhibit the efflux function of ABC transporters, leading to cellular toxicity in the ciliate. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Evolutionary Trajectories of Entomopathogenic Fungi ABC Transporters.

    Science.gov (United States)

    Baral, Bikash

    2017-01-01

    The ABC protein superfamily-also called traffic ATPases-are energy-dependent ubiquitous proteins, representing one of the crucial and the largest family in the fungal genomes. The ATP-binding cassette endows a characteristic 200-250 amino acids and is omnipresent in all organisms ranging from prokaryotes to eukaryotes. Unlike in bacteria with nutrient import functions, ABC transporters in fungal entomopathogens serve as effective efflux pumps that are largely involved in the shuttle of metabolites across the biological membranes. Thus, the search for ABC proteins may prove of immense importance in elucidating the functional and molecular mechanism at the host-pathogen (insect-fungus) interface. Their sequence homology, domain topology, and functional traits led to the actual identification of nine different families in fungal entomopathogens. Evolutionary relationships within the ABC superfamily are discussed, concentrating on computational approaches for comparative identification of ABC transporters in insect-pathogenic fungi (entomopathogens) with those of animals, plants, and their bacterial orthologs. Ancestors of some fungal candidates have duplicated extensively in some phyla, while others were lost in one lineage or the other, and predictions for the cause of their duplications and/or loss in some phyla are made. ABC transporters of fungal insect-pathogens serve both defensive and offensive functions effective against land-dwelling and ground foraging voracious insects. This study may help to unravel the molecular cascades of ABC proteins to illuminate the means through which insects cope with fungal infection and fungal-related diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. ABC transporters in fish species: a review

    Directory of Open Access Journals (Sweden)

    Marta eFerreira

    2014-07-01

    Full Text Available ATP-binding cassette (ABC proteins were first recognized for their role in multidrug resistance (MDR in chemotherapeutic treatments, which is a major impediment for the successful treatment of many forms of malignant tumors in humans. These proteins, highly conserved throughout vertebrate species, were later related to cellular detoxification and accounted as responsible for protecting aquatic organisms from xenobiotic insults in the so-called multixenobiotic resistance mechanism (MXR. In recent years, research on these proteins in aquatic species has highlighted their importance in the detoxification mechanisms in fish thus it is of extreme added value to continue these studies. Several transporters have been pointed out as relevant in the ecotoxicological context associated to the transport of xenobiotics, such as P-glycoproteins (Pgps, multidrug-resistance-associated proteins (MRPs 1-5 and breast resistance associated protein (BCRP. In mammals, several nuclear receptors have been identified as mediators of phase I and II metabolizing enzymes and ABC transporters. In aquatic species, knowledge on co-regulation of detoxification mechanism is scarce and needs to be addressed. The interaction of emergent contaminants, with chemosensitizer potential, with ABC transporters in aquatic organisms can compromise detoxification processes and have population effects and should be studied in more detail. This review intends to summarize the recent advances in research on MXR mechanisms in fish species, focusing in 1 regulation and functioning of ABC proteins; 2 cooperation with phase I and II biotransformation enzymes; and 3 ecotoxicological relevance and information on emergent pollutants with ability to modulate ABC transporters expression and activity. Several lines of evidence are clear suggesting the important role of these transporters in detoxification mechanisms and must be further investigated in fish.

  14. Phylogenetic analysis of fungal ABC transporters.

    Science.gov (United States)

    Kovalchuk, Andriy; Driessen, Arnold J M

    2010-03-16

    The superfamily of ABC proteins is among the largest known in nature. Its members are mainly, but not exclusively, involved in the transport of a broad range of substrates across biological membranes. Many contribute to multidrug resistance in microbial pathogens and cancer cells. The diversity of ABC proteins in fungi is comparable with those in multicellular animals, but so far fungal ABC proteins have barely been studied. We performed a phylogenetic analysis of the ABC proteins extracted from the genomes of 27 fungal species from 18 orders representing 5 fungal phyla thereby covering the most important groups. Our analysis demonstrated that some of the subfamilies of ABC proteins remained highly conserved in fungi, while others have undergone a remarkable group-specific diversification. Members of the various fungal phyla also differed significantly in the number of ABC proteins found in their genomes, which is especially reduced in the yeast S. cerevisiae and S. pombe. Data obtained during our analysis should contribute to a better understanding of the diversity of the fungal ABC proteins and provide important clues about their possible biological functions.

  15. ABC Transporter for Corrinoids in Halobacterium sp. Strain NRC-1†

    OpenAIRE

    Woodson, Jesse D.; Reynolds, April A.; Escalante-Semerena, Jorge C.

    2005-01-01

    We report evidence for the existence of a putative ABC transporter for corrinoid utilization in the extremely halophilic archaeon Halobacterium sp. strain NRC-1. Results from genetic and nutritional analyses of Halobacterium showed that mutants with lesions in open reading frames (ORFs) Vng1370G, Vng1371Gm, and Vng1369G required a 105-fold higher concentration of cobalamin for growth than the wild-type or parent strain. The data support the conclusion that these ORFs encode orthologs of the b...

  16. ABC transporters affect the elimination and toxicity of CdTe quantum dots in liver and kidney cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Mingli; Yin, Huancai; Bai, Pengli [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); Miao, Peng [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Deng, Xudong [Department of Chemical Engineering, McMaster University, Hamilton, Ontario, L8S 4L7 (Canada); Xu, Yingxue [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Hu, Jun [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); Yin, Jian, E-mail: yinj@sibet.ac.cn [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China)

    2016-07-15

    This paper aimed to investigate the role of adenosine triphosphate-binding cassette (ABC) transporters on the efflux and the toxicity of nanoparticles in liver and kidney cells. In this study, we synthesized CdTe quantum dots (QDs) that were monodispersed and emitted green fluorescence (maximum peak at 530 nm). Such QDs tended to accumulate in human hepatocellular carcinoma cells (HepG2), human kidney cells 2 (HK-2), and Madin-Darby canine kidney (MDCK) cells, and cause significant toxicity in all the three cell lines. Using specific inhibitors and inducers of P-glycoprotein (Pgp) and multidrug resistance associated proteins (Mrps), the cellular accumulation and subsequent toxicity of QDs in HepG2 and HK-2 cells were significantly affected, while only slight changes appeared in MDCK cells, corresponding well with the functional expressions of ABC transporters in cells. Moreover, treatment of QDs caused concentration- and time- dependent induction of ABC transporters in HepG2 and HK-2 cells, but such phenomenon was barely found in MDCK cells. Furthermore, the effects of CdTe QDs on ABC transporters were found to be greater than those of CdCl{sub 2} at equivalent concentrations of cadmium, indicating that the effects of QDs should be a combination of free Cd{sup 2+} and specific properties of QDs. Overall, these results indicated a strong dependence between the functional expressions of ABC transporters and the efflux of QDs, which could be an important reason for the modulation of QDs toxicity by ABC transporters. - Highlights: • ABC transporters contributed actively to the cellular efflux of CdTe quantum dots. • ABC transporters affected the cellular toxicity of CdTe quantum dots. • Treatment of CdTe quantum dots induced the gene expression of ABC transporters. • Free Cd{sup 2+} should be partially involved in the effects of QDs on ABC transporters. • Cellular efflux of quantum dots could be an important modulator for its toxicity.

  17. Characterization of SiaA, a streptococcal heme-binding protein associated with a heme ABC transport system.

    Science.gov (United States)

    Sook, Brian R; Block, Darci R; Sumithran, Suganya; Montañez, Griselle E; Rodgers, Kenton R; Dawson, John H; Eichenbaum, Zehava; Dixon, Dabney W

    2008-02-26

    Many pathogenic bacteria require heme and obtain it from their environment. Heme transverses the cytoplasmic membrane via an ATP binding cassette (ABC) pathway. Although a number of heme ABC transport systems have been described in pathogenic bacteria, there is as yet little biophysical characterization of the proteins in these systems. The sia (hts) gene cluster encodes a heme ABC transporter in the Gram positive Streptococcus pyogenes. The lipoprotein-anchored heme binding protein (HBP) of this transporter is SiaA (HtsA). In the current study, resonance Raman (rR), magnetic circular dichroism (MCD), and nuclear magnetic resonance (NMR) spectroscopies were used to determine the coordination state and spin state of both the ferric and ferrous forms of this protein. Identifiers from these techniques suggest that the heme is six-coordinate and low-spin in both oxidation states of the protein, with methionine and histidine as axial ligands. SiaA has a pKa of 9.7 +/- 0.1, attributed to deprotonation of the axial histidine. Guanidinium titration studies show that the ferric state is less stable than the ferrous state, with DeltaG(H2O) values for the oxidized and reduced proteins of 7.3 +/- 0.8 and 16.0 +/- 3.6 kcal mol-1, respectively. The reductive and oxidative midpoint potentials determined via spectroelectrochemistry are 83 +/- 3 and 64 +/- 3 mV, respectively; the irreversibility of heme reduction suggests that redox cycling of the heme is coupled to a kinetically sluggish change in structure or conformation. The biophysical characterization described herein will significantly advance our understanding of structure-function relationships in HBP.

  18. The maize glossy13 gene, cloned via BSR-Seq and Seq-walking encodes a putative ABC transporter required for the normal accumulation of epicuticular waxes.

    Directory of Open Access Journals (Sweden)

    Li Li

    Full Text Available Aerial plant surfaces are covered by epicuticular waxes that among other purposes serve to control water loss. Maize glossy mutants originally identified by their "glossy" phenotypes exhibit alterations in the accumulation of epicuticular waxes. By combining data from a BSR-Seq experiment and the newly developed Seq-Walking technology, GRMZM2G118243 was identified as a strong candidate for being the glossy13 gene. The finding that multiple EMS-induced alleles contain premature stop codons in GRMZM2G118243, and the one knockout allele of gl13, validates the hypothesis that gene GRMZM2G118243 is gl13. Consistent with this, GRMZM2G118243 is an ortholog of AtABCG32 (Arabidopsis thaliana, HvABCG31 (barley and OsABCG31 (rice, which encode ABCG subfamily transporters involved in the trans-membrane transport of various secondary metabolites. We therefore hypothesize that gl13 is involved in the transport of epicuticular waxes onto the surfaces of seedling leaves.

  19. Inventory and general analysis of the ATP-binding cassette (ABC) gene superfamily in maize (Zea mays L.).

    Science.gov (United States)

    Pang, Kaiyuan; Li, Yanjiao; Liu, Menghan; Meng, Zhaodong; Yu, Yanli

    2013-09-10

    The metabolic functions of ATP-binding cassette (or ABC) proteins, one of the largest families of proteins presented in all organisms, have been investigated in many protozoan, animal and plant species. To facilitate more systematic and complicated studies on maize ABC proteins in the future, we present the first complete inventory of these proteins, including 130 open reading frames (ORFs), and provide general descriptions of their classifications, basic structures, typical functions, evolution track analysis and expression profiles. The 130 ORFs were assigned to eight subfamilies based on their structures and homological features. Five of these subfamilies consist of 109 proteins, containing transmembrane domains (TM) performing as transporters. The rest three subfamilies contain 21 soluble proteins involved in various functions other than molecular transport. A comparison of ABC proteins among nine selected species revealed either convergence or divergence in each of the ABC subfamilies. Generally, plant genomes contain far more ABC genes than animal genomes. The expression profiles and evolution track of each maize ABC gene were further investigated, the results of which could provide clues for analyzing their functions. Quantitative real-time polymerase chain reaction experiments (PCR) were conducted to detect induced expression in select ABC genes under several common stresses. This investigation provides valuable information for future research on stress tolerance in plants and potential strategies for enhancing maize production under stressful conditions. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Differential contributions of five ABC transporters to mutidrug resistance, antioxidion and virulence of Beauveria bassiana, an entomopathogenic fungus.

    Directory of Open Access Journals (Sweden)

    Ting-Ting Song

    Full Text Available Multidrug resistance (MDR confers agrochemical compatibility to fungal cells-based mycoinsecticdes but mechanisms involved in MDR remain poorly understood for entomopathogenic fungi, which have been widely applied as biocontrol agents against arthropod pests. Here we characterized the functions of five ATP-binding cassette (ABC transporters, which were classified to the subfamilies ABC-B (Mdr1, ABC-C (Mrp1 and ABC-G (Pdr1, Pdr2 and Pdr5 and selected from 54 full-size ABC proteins of Beauveria bassiana based on their main domain architecture, membrane topology and transcriptional responses to three antifungal inducers. Disruption of each transporter gene resulted in significant reduction in resistance to four to six of eight fungicides or antifungal drugs tested due to their differences in structure and function. Compared with wild-type and complemented (control strains, disruption mutants of all the five transporter genes became significantly less tolerant to the oxidants menadione and H₂O₂ based on 22-41% and 10-31% reductions of their effective concentrations required for the suppression of 50% colony growth at 25°C. Under a standardized spray, the killing actions of ΔPdr5 and ΔMrp1 mutants against Spodoptera litura second-instar larvae were delayed by 59% and 33% respectively. However, no significant virulence change was observed in three other delta mutants. Taken together, the examined five ABC transporters contribute differentially to not only the fungal MDR but antioxidant capability, a phenotype rarely associated with ABC efflux pumps in previous reports; at least some of them are required for the full virulence of B. bassiana, thereby affecting the fungal biocontrol potential. Our results indicate that ABC pump-dependent MDR mechanisms exist in entomopathogenic fungi as do in yeasts and human and plant pathogenic fungi.

  1. ATP-binding cassette (ABC) transporters in normal and pathological lung

    NARCIS (Netherlands)

    van der Deen, M; de Vries, EGE; Timens, W; Scheper, RJ; Timmer-Bosscha, H; Postma, DS

    2005-01-01

    ATP-binding cassette ( ABC) transporters are a family of transmembrane proteins that can transport a wide variety of substrates across biological membranes in an energy-dependent manner. Many ABC transporters such as P-glycoprotein ( P-gp), multidrug resistance-associated protein 1 ( MRP1) and

  2. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Directory of Open Access Journals (Sweden)

    Gogarten J Peter

    2008-01-01

    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  3. Describing the role of Drosophila melanogaster ABC transporters in insecticide biology using CRISPR-Cas9 knockouts.

    Science.gov (United States)

    Denecke, Shane; Fusetto, Roberto; Batterham, Philip

    2017-12-01

    ABC transporters have a well-established role in drug resistance, effluxing xenobiotics from cells and tissues within the organism. More recently, research has been dedicated to understanding the role insect ABC transporters play in insecticide toxicity, but progress in understanding the contribution of specific transporters has been hampered by the lack of functional genetic tools. Here, we report knockouts of three Drosophila melanogaster ABC transporter genes, Mdr49, Mdr50, and Mdr65, that are homologous to the well-studied mammalian ABCB1 (P-glycoprotein). Each knockout mutant was created in the same wild type background and tested against a panel of insecticides representing different chemical classes. Mdr65 knockouts were more susceptible to all neuroactive insecticides tested, but Mdr49 and Mdr50 knockouts showed increased susceptibility or resistance depending on the insecticide used. Mdr65 was chosen for further analysis. Calculation of LC 50 values for the Mdr65 knockout allowed the substrate specificity of this transporter to be examined. No obvious distinguishing structural features were shared among MDR65 substrates. A role for Mdr65 in insecticide transport was confirmed by testing the capacity of the knockout to synergize with the ABC inhibitor verapamil and by measuring the levels of insecticide retained in the body of knockout flies. These data unambiguously establish the influence of ABC transporters on the capacity of wild type D. melanogaster to tolerate insecticide exposure and suggest that both tissue and substrate specificity underpin this capacity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Energy Coupling Factor-Type ABC Transporters for Vitamin Uptake in Prokaryotes

    NARCIS (Netherlands)

    Erkens, Guus B.; Dosz-Majsnerowska, Maria; ter Beek, Josy; Slotboom, Dirk Jan

    2012-01-01

    Energy coupling factor (ECF) transporters are a subgroup of ATP-binding cassette (ABC) transporters involved in the uptake of vitamins and micronutrients in prokaryotes. In contrast to classical ABC importers, ECF transporters do not make use of water-soluble substrate binding proteins or domains

  5. Single liposome analysis of peptide translocation by the ABC transporter TAPL.

    Science.gov (United States)

    Zollmann, Tina; Moiset, Gemma; Tumulka, Franz; Tampé, Robert; Poolman, Bert; Abele, Rupert

    2015-02-17

    ATP-binding cassette (ABC) transporters use ATP to drive solute transport across biological membranes. Members of this superfamily have crucial roles in cell physiology, and some of the transporters are linked to severe diseases. However, understanding of the transport mechanism, especially of human ABC exporters, is scarce. We reconstituted the human lysosomal polypeptide ABC transporter TAPL, expressed in Pichia pastoris, into lipid vesicles (liposomes) and performed explicit transport measurements. We analyzed solute transport at the single liposome level by monitoring the coincident fluorescence of solutes and proteoliposomes in the focal volume of a confocal microscope. We determined a turnover number of eight peptides per minute, which is two orders of magnitude higher than previously estimated from macroscopic measurements. Moreover, we show that TAPL translocates peptides against a large concentration gradient. Maximal filling is not limited by an electrochemical gradient but by trans-inhibition. Countertransport and reversibility studies demonstrate that peptide translocation is a strictly unidirectional process. Altogether, these data are included in a refined model of solute transport by ABC exporters.

  6. mRMR-ABC: A Hybrid Gene Selection Algorithm for Cancer Classification Using Microarray Gene Expression Profiling

    Directory of Open Access Journals (Sweden)

    Hala Alshamlan

    2015-01-01

    Full Text Available An artificial bee colony (ABC is a relatively recent swarm intelligence optimization approach. In this paper, we propose the first attempt at applying ABC algorithm in analyzing a microarray gene expression profile. In addition, we propose an innovative feature selection algorithm, minimum redundancy maximum relevance (mRMR, and combine it with an ABC algorithm, mRMR-ABC, to select informative genes from microarray profile. The new approach is based on a support vector machine (SVM algorithm to measure the classification accuracy for selected genes. We evaluate the performance of the proposed mRMR-ABC algorithm by conducting extensive experiments on six binary and multiclass gene expression microarray datasets. Furthermore, we compare our proposed mRMR-ABC algorithm with previously known techniques. We reimplemented two of these techniques for the sake of a fair comparison using the same parameters. These two techniques are mRMR when combined with a genetic algorithm (mRMR-GA and mRMR when combined with a particle swarm optimization algorithm (mRMR-PSO. The experimental results prove that the proposed mRMR-ABC algorithm achieves accurate classification performance using small number of predictive genes when tested using both datasets and compared to previously suggested methods. This shows that mRMR-ABC is a promising approach for solving gene selection and cancer classification problems.

  7. mRMR-ABC: A Hybrid Gene Selection Algorithm for Cancer Classification Using Microarray Gene Expression Profiling.

    Science.gov (United States)

    Alshamlan, Hala; Badr, Ghada; Alohali, Yousef

    2015-01-01

    An artificial bee colony (ABC) is a relatively recent swarm intelligence optimization approach. In this paper, we propose the first attempt at applying ABC algorithm in analyzing a microarray gene expression profile. In addition, we propose an innovative feature selection algorithm, minimum redundancy maximum relevance (mRMR), and combine it with an ABC algorithm, mRMR-ABC, to select informative genes from microarray profile. The new approach is based on a support vector machine (SVM) algorithm to measure the classification accuracy for selected genes. We evaluate the performance of the proposed mRMR-ABC algorithm by conducting extensive experiments on six binary and multiclass gene expression microarray datasets. Furthermore, we compare our proposed mRMR-ABC algorithm with previously known techniques. We reimplemented two of these techniques for the sake of a fair comparison using the same parameters. These two techniques are mRMR when combined with a genetic algorithm (mRMR-GA) and mRMR when combined with a particle swarm optimization algorithm (mRMR-PSO). The experimental results prove that the proposed mRMR-ABC algorithm achieves accurate classification performance using small number of predictive genes when tested using both datasets and compared to previously suggested methods. This shows that mRMR-ABC is a promising approach for solving gene selection and cancer classification problems.

  8. Genome-wide comparative analysis of ABC systems in the Bdellovibrio-and-like organisms.

    Science.gov (United States)

    Li, Nan; Chen, Huan; Williams, Henry N

    2015-05-10

    Bdellovibrio-and-like organisms (BALOs) are gram-negative, predatory bacteria with wide variations in genome sizes and GC content and ecological habitats. The ATP-binding cassette (ABC) systems have been identified in several prokaryotes, fungi and plants and have a role in transport of materials in and out of cells and in cellular processes. However, knowledge of the ABC systems of BALOs remains obscure. A total of 269 putative ABC proteins were identified in BALOs. The genes encoding these ABC systems occupy nearly 1.3% of the gene content in freshwater Bdellovibrio strains and about 0.7% in their saltwater counterparts. The proteins found belong to 25 ABC system families based on their structural characteristics and functions. Among these, 16 families function as importers, 6 as exporters and 3 are involved in various cellular processes. Eight of these 25 ABC system families were deduced to be the core set of ABC systems conserved in all BALOs. All Bacteriovorax strains have 28 or less ABC systems. On the contrary, the freshwater Bdellovibrio strains have more ABC systems, typically around 51. In the genome of Bdellovibrio exovorus JSS (CP003537.1), 53 putative ABC systems were detected, representing the highest number among all the BALO genomes examined in this study. Unexpected high numbers of ABC systems involved in cellular processes were found in all BALOs. Phylogenetic analysis suggests that the majority of ABC proteins can be assigned into many separate families with high bootstrap supports (>50%). In this study, a general framework of sequence-structure-function connections for the ABC systems in BALOs was revealed providing novel insights for future investigations. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Specificity of the second binding protein of the peptide ABC-transporter (Dpp) of Lactococcus lactis IL1403

    NARCIS (Netherlands)

    Sanz, Y; Toldra, F; Renault, P; Poolman, B

    2003-01-01

    The genome sequence of Lactococcus lactis IL1403 revealed the presence of a putative peptide-binding protein-dependent ABC-transporter (Dpp). The genes for two peptide-binding proteins (dppA and dppP) precede the membrane components, which include two transmembrane protein genes (dppB and dppC) and

  10. Increased expression of the yeast multidrug resistance ABC transporter Pdr18 leads to increased ethanol tolerance and ethanol production in high gravity alcoholic fermentation

    Directory of Open Access Journals (Sweden)

    Teixeira Miguel C

    2012-07-01

    Full Text Available Abstract Background The understanding of the molecular basis of yeast tolerance to ethanol may guide the design of rational strategies to increase process performance in industrial alcoholic fermentations. A set of 21 genes encoding multidrug transporters from the ATP-Binding Cassette (ABC Superfamily and Major Facilitator Superfamily (MFS in S. cerevisiae were scrutinized for a role in ethanol stress resistance. Results A yeast multidrug resistance ABC transporter encoded by the PDR18 gene, proposed to play a role in the incorporation of ergosterol in the yeast plasma membrane, was found to confer resistance to growth inhibitory concentrations of ethanol. PDR18 expression was seen to contribute to decreased 3 H-ethanol intracellular concentrations and decreased plasma membrane permeabilization of yeast cells challenged with inhibitory ethanol concentrations. Given the increased tolerance to ethanol of cells expressing PDR18, the final concentration of ethanol produced during high gravity alcoholic fermentation by yeast cells devoid of PDR18 was lower than the final ethanol concentration produced by the corresponding parental strain. Moreover, an engineered yeast strain in which the PDR18 promoter was replaced in the genome by the stronger PDR5 promoter, leading to increased PDR18 mRNA levels during alcoholic fermentation, was able to attain a 6 % higher ethanol concentration and a 17 % higher ethanol production yield than the parental strain. The improved fermentative performance of yeast cells over-expressing PDR18 was found to correlate with their increased ethanol tolerance and ability to restrain plasma membrane permeabilization induced throughout high gravity fermentation. Conclusions PDR18 gene over-expression increases yeast ethanol tolerance and fermentation performance leading to the production of highly inhibitory concentrations of ethanol. PDR18 overexpression in industrial yeast strains appears to be a promising approach to

  11. IMG-ABC: new features for bacterial secondary metabolism analysis and targeted biosynthetic gene cluster discovery in thousands of microbial genomes.

    Science.gov (United States)

    Hadjithomas, Michalis; Chen, I-Min A; Chu, Ken; Huang, Jinghua; Ratner, Anna; Palaniappan, Krishna; Andersen, Evan; Markowitz, Victor; Kyrpides, Nikos C; Ivanova, Natalia N

    2017-01-04

    Secondary metabolites produced by microbes have diverse biological functions, which makes them a great potential source of biotechnologically relevant compounds with antimicrobial, anti-cancer and other activities. The proteins needed to synthesize these natural products are often encoded by clusters of co-located genes called biosynthetic gene clusters (BCs). In order to advance the exploration of microbial secondary metabolism, we developed the largest publically available database of experimentally verified and predicted BCs, the Integrated Microbial Genomes Atlas of Biosynthetic gene Clusters (IMG-ABC) (https://img.jgi.doe.gov/abc/). Here, we describe an update of IMG-ABC, which includes ClusterScout, a tool for targeted identification of custom biosynthetic gene clusters across 40 000 isolate microbial genomes, and a new search capability to query more than 700 000 BCs from isolate genomes for clusters with similar Pfam composition. Additional features enable fast exploration and analysis of BCs through two new interactive visualization features, a BC function heatmap and a BC similarity network graph. These new tools and features add to the value of IMG-ABC's vast body of BC data, facilitating their in-depth analysis and accelerating secondary metabolite discovery. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. A 6-Nucleotide Regulatory Motif within the AbcR Small RNAs of Brucella abortus Mediates Host-Pathogen Interactions.

    Science.gov (United States)

    Sheehan, Lauren M; Caswell, Clayton C

    2017-06-06

    In Brucella abortus , two small RNAs (sRNAs), AbcR1 and AbcR2, are responsible for regulating transcripts encoding ABC-type transport systems. AbcR1 and AbcR2 are required for Brucella virulence, as a double chromosomal deletion of both sRNAs results in attenuation in mice. Although these sRNAs are responsible for targeting transcripts for degradation, the mechanism utilized by the AbcR sRNAs to regulate mRNA in Brucella has not been described. Here, two motifs (M1 and M2) were identified in AbcR1 and AbcR2, and complementary motif sequences were defined in AbcR-regulated transcripts. Site-directed mutagenesis of M1 or M2 or of both M1 and M2 in the sRNAs revealed transcripts to be targeted by one or both motifs. Electrophoretic mobility shift assays revealed direct, concentration-dependent binding of both AbcR sRNAs to a target mRNA sequence. These experiments genetically and biochemically characterized two indispensable motifs within the AbcR sRNAs that bind to and regulate transcripts. Additionally, cellular and animal models of infection demonstrated that only M2 in the AbcR sRNAs is required for Brucella virulence. Furthermore, one of the M2-regulated targets, BAB2_0612, was found to be critical for the virulence of B. abortus in a mouse model of infection. Although these sRNAs are highly conserved among Alphaproteobacteria , the present report displays how gene regulation mediated by the AbcR sRNAs has diverged to meet the intricate regulatory requirements of each particular organism and its unique biological niche. IMPORTANCE Small RNAs (sRNAs) are important components of bacterial regulation, allowing organisms to quickly adapt to changes in their environments. The AbcR sRNAs are highly conserved throughout the Alphaproteobacteria and negatively regulate myriad transcripts, many encoding ABC-type transport systems. In Brucella abortus , AbcR1 and AbcR2 are functionally redundant, as only a double abcR1 abcR2 ( abcR1 / 2 ) deletion results in attenuation in

  13. Insight into Two ABC Transporter Families Involved in Lantibiotic Resistance

    Directory of Open Access Journals (Sweden)

    Rebecca Clemens

    2018-01-01

    Full Text Available Antimicrobial peptides, which contain (methyl-lanthionine-rings are called lantibiotics. They are produced by several Gram-positive bacteria and are mainly active against these bacteria. Although these are highly potent antimicrobials, some human pathogenic bacteria express specific ABC transporters that confer resistance and counteract their antimicrobial activity. Two distinct ABC transporter families are known to be involved in this process. These are the Cpr- and Bce-type ABC transporter families, named after their involvement in cationic peptide resistance in Clostridium difficile, and bacitracin efflux in Bacillus subtilis, respectively. Both resistance systems differentiate to each other in terms of the proteins involved. Here, we summarize the current knowledge and describe the divergence as well as the common features present in both the systems to confer lantibiotic resistance.

  14. ABC transporters in Mycoplasma hyopneumoniae and Mycoplasma synoviae: insights into evolution and pathogenicity

    Directory of Open Access Journals (Sweden)

    Marisa Fabiana Nicolás

    2007-01-01

    Full Text Available ABC transporters represent one of the largest superfamilies of active membrane transport proteins (MTPs with a highly conserved ATPase domain that binds and hydrolyzes ATP, supplying energy for the uptake of a variety of nutrients and for the extrusion of drugs and metabolic wastes. The complete genomes of a non-pathogenic (J and pathogenic (7448 strain of Mycoplasma hyopneumoniae, as well as of a pathogenic (53 strain of Mycoplasma synoviae have been recently sequenced. A detailed study revealed a high percentage of CDSs encoding MTPs in M. hyopneumoniae strains J (13.4%, 7448 (13.8%, and in M. synoviae 53 (11.2%, and the ABC systems represented from 85.0 to 88.6% of those CDSs. Uptake systems are mainly involved in cell nutrition and some might be associated with virulence. Exporter systems include both drug and multidrug resistant systems (MDR, which may represent mechanisms of resistance to toxic molecules. No relation was found between the phylogeny of the ATPase domains and the lifestyle or pathogenicity of Mycoplasma, but several proteins, potentially useful as targets for the control of infections, were identified.

  15. Genome-wide expression analysis of rice ABC transporter family across spatio-temporal samples and in response to abiotic stresses.

    Science.gov (United States)

    Nguyen, Van Ngoc Tuyet; Moon, Sunok; Jung, Ki-Hong

    2014-09-01

    Although the super family of ATP-binding cassette (ABC) proteins plays key roles in the physiology and development of plants, the functions of members of this interesting family mostly remain to be clarified, especially in crop plants. Thus, systematic analysis of this family in rice (Oryza sativa), a major model crop plant, will be helpful in the design of effective strategies for functional analysis. Phylogenomic analysis that integrates anatomy and stress meta-profiling data based on a large collection of rice Affymetrix array data into the phylogenic context provides useful clues into the functions for each of the ABC transporter family members in rice. Using anatomy data, we identified 17 root-preferred and 16-shoot preferred genes at the vegetative stage, and 3 pollen, 2 embryo, 2 ovary, 2 endosperm, and 1 anther-preferred gene at the reproductive stage. The stress data revealed significant up-regulation or down-regulation of 47 genes under heavy metal treatment, 16 genes under nutrient deficient conditions, and 51 genes under abiotic stress conditions. Of these, we confirmed the differential expression patterns of 14 genes in root samples exposed to drought stress using quantitative real-time PCR. Network analysis using RiceNet suggests a functional gene network involving nine rice ABC transporters that are differentially regulated by drought stress in root, further enhancing the prediction of biological function. Our analysis provides a molecular basis for the study of diverse biological phenomena mediated by the ABC family in rice and will contribute to the enhancement of crop yield and stress tolerance. Copyright © 2014 Elsevier GmbH. All rights reserved.

  16. Characterization and expression profiling of ATP-binding cassette transporter genes in the diamondback moth, Plutella xylostella (L.).

    Science.gov (United States)

    Qi, Weiping; Ma, Xiaoli; He, Weiyi; Chen, Wei; Zou, Mingmin; Gurr, Geoff M; Vasseur, Liette; You, Minsheng

    2016-09-27

    ATP-binding cassette (ABC) transporters are one of the major transmembrane protein families found in all organisms and play important roles in transporting a variety of compounds across intra and extra cellular membranes. In some species, ABC transporters may be involved in the detoxification of substances such as insecticides. The diamondback moth, Plutella xylostella (L.), a destructive pest of cruciferous crops worldwide, is an important species to study as it is resistant to many types of insecticides as well as biological control Bacillus thuringiensis toxins. A total of 82 ABC genes were identified from our published P. xylostella genome, and grouped into eight subfamilies (ABCA-H) based on phylogenetic analysis. Genes of subfamilies ABCA, ABCC and ABCH were found to be expanded in P. xylostella compared with those in Bombyx mori, Manduca sexta, Heliconius melpomene, Danaus plexippus, Drosophila melanogaster, Tetranychus urticae and Homo sapiens. Phylogenetic analysis indicated that many of the ABC transporters in P. xylostella are orthologous to the well-studied ABC transporter genes in the seven other species. Transcriptome- and qRT-PCR-based analysis elucidated physiological effects of ABC gene expressions of P. xylostella which were developmental stage- and tissue-specific as well as being affected by whether or not the insects were from an insecticide-resistant strain. Two ABCC and one ABCA genes were preferentially expressed in midgut of the 4th-instar larvae of a susceptible strain (Fuzhou-S) suggesting their potential roles in metabolizing plant defensive chemicals. Most of the highly expressed genes in insecticide-resistant strains were also predominantly expressed in the tissues of Malpighian tubules and midgut. This is the most comprehensive study on identification, characterization and expression profiling of ABC transporter genes in P. xylostella to date. The diversified features and expression patterns of this gene family may be associated with

  17. Asymmetric switching in a homodimeric ABC transporter: a simulation study.

    Directory of Open Access Journals (Sweden)

    Jussi Aittoniemi

    2010-04-01

    Full Text Available ABC transporters are a large family of membrane proteins involved in a variety of cellular processes, including multidrug and tumor resistance and ion channel regulation. Advances in the structural and functional understanding of ABC transporters have revealed that hydrolysis at the two canonical nucleotide-binding sites (NBSs is co-operative and non-simultaneous. A conserved core architecture of bacterial and eukaryotic ABC exporters has been established, as exemplified by the crystal structure of the homodimeric multidrug exporter Sav1866. Currently, it is unclear how sequential ATP hydrolysis arises in a symmetric homodimeric transporter, since it implies at least transient asymmetry at the NBSs. We show by molecular dynamics simulation that the initially symmetric structure of Sav1866 readily undergoes asymmetric transitions at its NBSs in a pre-hydrolytic nucleotide configuration. MgATP-binding residues and a network of charged residues at the dimer interface are shown to form a sequence of putative molecular switches that allow ATP hydrolysis only at one NBS. We extend our findings to eukaryotic ABC exporters which often consist of two non-identical half-transporters, frequently with degeneracy substitutions at one of their two NBSs. Interestingly, many residues involved in asymmetric conformational switching in Sav1866 are substituted in degenerate eukaryotic NBS. This finding strengthens recent suggestions that the interplay of a consensus and a degenerate NBS in eukaroytic ABC proteins pre-determines the sequence of hydrolysis at the two NBSs.

  18. Phylogenetic analysis of fungal ABC transporters

    NARCIS (Netherlands)

    Kovalchuk, A.; Driessen, A.J.M.

    2010-01-01

    Background: The superfamily of ABC proteins is among the largest known in nature. Its members are mainly, but not exclusively, involved in the transport of a broad range of substrates across biological membranes. Many contribute to multidrug resistance in microbial pathogens and cancer cells. The

  19. Genome-wide analysis of ATP-binding cassette (ABC) transporters in the sweetpotato whitefly, Bemisia tabaci.

    Science.gov (United States)

    Tian, Lixia; Song, Tianxue; He, Rongjun; Zeng, Yang; Xie, Wen; Wu, Qingjun; Wang, Shaoli; Zhou, Xuguo; Zhang, Youjun

    2017-04-26

    ABC transporter superfamily is one of the largest and ubiquitous groups of proteins. Because of their role in detoxification, insect ABC transporters have gained more attention in recent years. In this study, we annotated ABC transporters from a newly sequenced sweetpotato whitefly genome. Bemisia tabaci Q biotype is an emerging global invasive species that has caused extensive damages to field crops as well as ornamental plants. A total of 55 ABC transporters containing all eight described subfamilies (A to H) were identified in the B. tabaci Q genome, including 8 ABCAs, 3 ABCBs, 6 ABCCs, 2 ABCDs, 1 ABCE, 3 ABCFs, 23 ABCGs and 9 ABCHs. In comparison to other species, subfamilies G and H in both phloem- and blood-sucking arthropods are expanded. The temporal expression profiles of these 55 ABC transporters throughout B. tabaci developmental stages and their responses to imidacloprid, a neonicotinoid insecticide, were investigated using RNA-seq analysis. Furthermore, the mRNA expression of 24 ABC transporters (44% of the total) representing all eight subfamilies was confirmed by the quantitative real-time PCR (RT-qPCR). Furthermore, mRNA expression levels estimated by RT-qPCR and RNA-seq analyses were significantly correlated (r = 0.684, p analysis of the entire repertoire of ABC transporters in B. tabaci. The identification of these ABC transporters, their temporal expression profiles during B. tabaci development, and their response to a neonicotinoid insecticide lay the foundation for functional genomic understanding of their contribution to the invasiveness of B. tabaci.

  20. Lipid dependence of ABC transporter localization and function

    NARCIS (Netherlands)

    Klappe, Karin; Hummel, Ina; Hoekstra, Dick; Kok, Jan Willem

    2009-01-01

    Lipid rafts have been implicated in many cellular functions, including protein and lipid transport and signal transduction. ATP-binding cassette (ABC) transporters have also been localized in these membrane domains. In this review the evidence for this specific localization will be evaluated and

  1. Using mass spectrometry for identification of ABC transporters from Xanthomonas citri and mutants expressed in different growth conditions

    International Nuclear Information System (INIS)

    Faria, J.N.; Balan, A.; Paes Leme, A.F.

    2012-01-01

    Full text: Xanthomonas citri is a phytopathogenic bacterium that infects citrus plants causing significant losses for the economy. In our group, we have focused on the identification and characterization of ABC transport proteins of this bacterium, in order to determinate their function for growth in vitro and in vivo, during infection. ABC transporters represent one of the largest families of proteins, which transport since small molecules as ions up to oligopeptides and sugars. In prokaryotic cells many works have reported the ABC transport function in pathogenesis, resistance, biofilm formation, infectivity and DNA repair, but until our knowledge, there is no data related to these transporters and X. citri. So, In order to determinate which transporters are expressed in X. citri, we started a proteomic analysis based on mono and bi-dimensional gels associated to mass spectrometry analyses. After growing X. citri and two different mutants deleted for ssuA and nitA genes in LB and minimum media, cellular extracts were obtained and used for preparation of mono and bi-dimensional gels. Seven bands covering the expected mass of ABC transporter components (20 kDa to 50 kDa) in SDS-PAGE were cut off the gel, treated with trypsin and submitted to the MS for protein identification. The results of 2D gels were good enough and will serve as a standard for development of similar experiments in large scale. (author)

  2. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  3. Classification of a Haemophilus influenzae ABC Transporter HI1470/71 through Its Cognate Molybdate Periplasmic Binding Protein, MolA

    Energy Technology Data Exchange (ETDEWEB)

    Tirado-Lee, Leidamarie; Lee, Allen; Rees, Douglas C.; Pinkett, Heather W. (CIT); (NWU)

    2014-10-02

    molA (HI1472) from H. influenzae encodes a periplasmic binding protein (PBP) that delivers substrate to the ABC transporter MolB{sub 2}C{sub 2} (formerly HI1470/71). The structures of MolA with molybdate and tungstate in the binding pocket were solved to 1.6 and 1.7 {angstrom} resolution, respectively. The MolA-binding protein binds molybdate and tungstate, but not other oxyanions such as sulfate and phosphate, making it the first class III molybdate-binding protein structurally solved. The {approx}100 {mu}M binding affinity for tungstate and molybdate is significantly lower than observed for the class II ModA molybdate-binding proteins that have nanomolar to low micromolar affinity for molybdate. The presence of two molybdate loci in H. influenzae suggests multiple transport systems for one substrate, with molABC constituting a low-affinity molybdate locus.

  4. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  5. Inventory and analysis of ATP-binding cassette (ABC) systems in Brugia malayi.

    Science.gov (United States)

    Ardelli, B F; Stitt, L E; Tompkins, J B

    2010-07-01

    ABC systems are one of the largest described protein superfamilies. These systems have a domain organization that may contain 1 or more transmembrane domains (ABC_TM1F) and 1 or 2 ATP-binding domains (ABC_2). The functions (e.g., import, export and DNA repair) of these proteins distinguish the 3 classes of ABC systems. Mining and PCR-based cloning were used to identify 33 putative ABC systems from the Brugia malayi genome. There were 31 class 2 genes, commonly called ABC transporters, and 2 class 3 genes. The ABC transporters were divided into subfamilies. Three belonged to subfamily A, 16 to subfamily B, 5 to subfamily C, 1 to subfamily E and 3 to subfamilies F and G, respectively. None were placed in subfamilies D and H. Similar to other ABC systems, the ABC_2 domain of B. malayi genes was conserved and contained the Walker A and B motifs, the signature sequence/linker region and the switch region with the conserved histidine. The ABC_TM1F domain was less conserved. The relative abundance of ABC systems was quantified using real-time reverse transcription PCR and was significantly higher in female adults of B. malayi than in males and microfilaria, particularly those in subfamilies B and C, which are associated with drug resistance.

  6. ABC transporters and xenobiotic defense systems in early life stages of rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Kropf, Christian; Segner, Helmut; Fent, Karl

    2016-01-01

    Embryos of oviparous fish, in contrast to (ovo) viviparous species, develop in the aquatic environment, and therefore need solute transport systems at their body surfaces for maintaining internal homeostasis and defending against potentially harmful substances. We hypothesized that solute transporters undergo changes in tissue distribution from the embryo to the larval stage. We therefore studied the mRNA profiles of eight ABC transporters (abcb1a, abcb1b, abcc1, abcc2, abcc3, abcc4, abcc5, abcg2) and three solute carriers (oatp1d, putative oatp2 putative, mate1) in different body regions (head, yolk sac epithelium, abdominal viscera, skin/muscles) of developing rainbow trout. Additionally, we investigated mRNA levels of phase I (cyp1a, cyp3a) and phase II (gstp, putative ugt1, putative ugt2) biotransformation enzymes. The study covered the developmental period from the eleuthero-embryo stage to the first-feeding larval stage (1-20days post-hatch, dph). At 1dph, transcripts of abcc2, abcc4, abcg2, cyp3a, gstp, putative mate1, and putative oatp2 occurred primarily in the yolk sac epithelium, whereas at later stages expression of these genes was predominantly observed in the abdominal viscera. The functional activity of ABC transporters in fish early life stages was assessed by rhodamine B accumulation assays. Finally, we investigated the potential impact of xenobiotics (clotrimazole, clofibric acid) on the ABC and biotransformation systems of trout early life stages. While clofibric acid had no effect, clotrimazole lead to an increased rhodamine B accumulation. The results provide evidence that the transition from the eleuthero-embryo to the larval stage is accompanied by a major alteration in tissue expression of ABC transporters. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Genome-wide identification of ATP-binding cassette (ABC) transporters and their roles in response to polycyclic aromatic hydrocarbons (PAHs) in the copepod Paracyclopina nana.

    Science.gov (United States)

    Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Lee, Young Hwan; Kim, Hui-Su; Kim, Il-Chan; Lee, Jae-Seong

    2017-02-01

    The ATP-binding cassette (ABC) protein superfamily is one of the largest gene families and is highly conserved in all domains. The ABC proteins play roles in several biological processes, including multi-xenobiotic resistance (MXR), by functioning as transporters in the cellular membrane. They also mediate the cellular efflux of a wide range of substrates against concentration gradients. In this study, 37 ABC genes belonging to eight distinct subfamilies were identified in the marine copepod Paracyclopina nana and annotated based on a phylogenetic analysis. Also, the functions of P-glycoproteins (P-gp) and multidrug resistance-associated proteins (MRPs), conferring MXR, were verified using fluorescent substrates and specific inhibitors. The activities of MXR-mediated ABC proteins and their transcriptional level were examined in response to polyaromatic hydrocarbons (PAHs), main components of the water-accommodated fraction. This study increases the understanding of the protective role of MXR in response to PAHs over the comparative evolution of ABC gene families. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Down-regulation of a novel ABC transporter gene (Pxwhite) is associated with Cry1Ac resistance in the diamondback moth, Plutella xylostella (L.).

    Science.gov (United States)

    Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

    2015-04-01

    Biopesticides or transgenic crops based on Cry toxins from the soil bacterium Bacillus thuringiensis (Bt) effectively control agricultural insect pests. The sustainable use of Bt biopesticides and Bt crops is threatened, however, by the development of Cry resistance in the target pests. The diamondback moth, Plutella xylostella (L.), is the first pest that developed resistance to a Bt biopesticide in the field, and a recent study has shown that the resistance of P. xylostella to Cry1Ac is caused by a mutation in an ATP-binding cassette (ABC) transporter gene (ABCC2). In this study, we report that down-regulation of a novel ABC transporter gene from ABCG subfamily (Pxwhite) is associated with Cry1Ac resistance in P. xylostella. The full-length cDNA sequence of Pxwhite was cloned and analyzed. Spatial-temporal expression detection revealed that Pxwhite was expressed in all tissues and developmental stages, and highest expressed in Malpighian tubule tissue and in egg stage. Sequence variation analysis of Pxwhite indicated the absence of constant non-synonymous mutations between susceptible and resistant strains, whereas midgut transcript analysis showed that Pxwhite was remarkably reduced in all resistant strains and further reduced when larvae of the moderately resistant SZ-R strain were subjected to selection with Cry1Ac toxin. Furthermore, RNA interference (RNAi)-mediated suppression of Pxwhite gene expression significantly reduced larval susceptibility to Cry1Ac toxin, and genetic linkage analysis confirmed that down-regulation of Pxwhite gene is tightly linked to Cry1Ac resistance in P. xylostella. To our knowledge, this is the first report indicating that Pxwhite gene is involved in Cry1Ac resistance in P. xylostella. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Characterization of a lactose-responsive promoter of ATP-binding cassette (ABC) transporter gene from Lactobacillus acidophilus 05-172.

    Science.gov (United States)

    Zeng, Zhu; Zuo, Fanglei; Yu, Rui; Zhang, Bo; Ma, Huiqin; Chen, Shangwu

    2017-09-01

    A novel lactose-responsive promoter of the ATP-binding cassette (ABC) transporter gene Lba1680 of Lactobacillus acidophilus strain 05-172 isolated from a traditionally fermented dairy product koumiss was characterized. In L. acidophilus 05-172, expression of Lba1680 was induced by lactose, with lactose-induced transcription of Lba1680 being 6.1-fold higher than that induced by glucose. This is in contrast to L. acidophilus NCFM, a strain isolated from human feces, in which expression of Lba1680 and Lba1679 is induced by glucose. Both gene expression and enzyme activity assays in L. paracasei transformed with a vector containing the inducible Lba1680 promoter (PLba1680) of strain 05-172 and a heme-dependent catalase gene as reporter confirmed that PLba1680 is specifically induced by lactose. Its regulatory expression could not be repressed by glucose, and was independent of cAMP receptor protein. This lactose-responsive promoter might be used in the expression of functional genes in L. paracasei incorporated into a lactose-rich environment, such as dairy products. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Sensitive and specific fluorescent probes for functional analysis of the three major types of mammalian ABC transporters.

    Science.gov (United States)

    Lebedeva, Irina V; Pande, Praveen; Patton, Wayne F

    2011-01-01

    An underlying mechanism for multi drug resistance (MDR) is up-regulation of the transmembrane ATP-binding cassette (ABC) transporter proteins. ABC transporters also determine the general fate and effect of pharmaceutical agents in the body. The three major types of ABC transporters are MDR1 (P-gp, P-glycoprotein, ABCB1), MRP1/2 (ABCC1/2) and BCRP/MXR (ABCG2) proteins. Flow cytometry (FCM) allows determination of the functional expression levels of ABC transporters in live cells, but most dyes used as indicators (rhodamine 123, DiOC(2)(3), calcein-AM) have limited applicability as they do not detect all three major types of ABC transporters. Dyes with broad coverage (such as doxorubicin, daunorubicin and mitoxantrone) lack sensitivity due to overall dimness and thus may yield a significant percentage of false negative results. We describe two novel fluorescent probes that are substrates for all three common types of ABC transporters and can serve as indicators of MDR in flow cytometry assays using live cells. The probes exhibit fast internalization, favorable uptake/efflux kinetics and high sensitivity of MDR detection, as established by multidrug resistance activity factor (MAF) values and Kolmogorov-Smirnov statistical analysis. Used in combination with general or specific inhibitors of ABC transporters, both dyes readily identify functional efflux and are capable of detecting small levels of efflux as well as defining the type of multidrug resistance. The assay can be applied to the screening of putative modulators of ABC transporters, facilitating rapid, reproducible, specific and relatively simple functional detection of ABC transporter activity, and ready implementation on widely available instruments.

  11. Survey of ABC transporter and metallothionein genes expressions in tall fescue inoculated with Funneliformis intraradices under Nickel toxicity

    Directory of Open Access Journals (Sweden)

    Massomeh Rafiei-Demneh

    2016-09-01

    Full Text Available In plants, there are complex network of transport, chelation, and sequestration processes that functions in maintaining concentrations of essential metal ions in different cellular compartments, thus minimizing the damage caused by entry of non-essential metal ions into the cytosol. In the presence of toxic ones, arbuscular mycorrhizal (AM fungi are able to alleviate metal toxicity in the plant. In this study the effect of an arbuscular mycorrhizal fungi Funneliformis intraradices on growth, Nickel tolerance, and ABC transporter and metallothionein expression in leaves and roots of tall fescue (Festuca arundinacea plants cultivated in Ni polluted soil were evaluated. The fungi infected (M+ and uninfected (M- fescue plants were cultivated in soil under different Ni concentrations (0, 30, 90 and 180 ppm for 3 months. Results demonstrated the positive effect of fungi colonization on the increase in growth and reduction in Ni uptake (90 and 180 ppm and Ni translocation from roots to shoot of tall fescue under Ni stress. The results also demonstrated that the level of ABC transporterand metallothionein transcripts accumulation in roots was considerably higher for both M- and M+ plants compared to the control. Also, M+ plants showed less ABC and MET expression compared to the M- plants. These results demonstrated the importance of mycorrhizal colonization of F. intraradices in reduction of Ni transport from root to shoot of tall fescue which alleviates Ni-induced stress.

  12. ABC transporters as multidrug resistance mechanisms and the development of chemosensitizers for their reversal

    Directory of Open Access Journals (Sweden)

    Choi Cheol-Hee

    2005-10-01

    Full Text Available Abstract One of the major problems related with anticancer chemotherapy is resistance against anticancer drugs. The ATP-binding cassette (ABC transporters are a family of transporter proteins that are responsible for drug resistance and a low bioavailability of drugs by pumping a variety of drugs out cells at the expense of ATP hydrolysis. One strategy for reversal of the resistance of tumor cells expressing ABC transporters is combined use of anticancer drugs with chemosensitizers. In this review, the physiological functions and structures of ABC transporters, and the development of chemosensitizers are described focusing on well-known proteins including P-glycoprotein, multidrug resistance associated protein, and breast cancer resistance protein.

  13. Single liposome analysis of peptide translocation by the ABC transporter TAPL

    NARCIS (Netherlands)

    Zollmann, Tina; Moiset Coll, Gemma; Tumulka, Franz; Tampé, Robert; Poolman, Bert; Abele, Rupert

    2015-01-01

    ATP-binding cassette (ABC) transporters use ATP to drive solute transport across biological membranes. Members of this superfamily have crucial roles in cell physiology, and some of the transporters are linked to severe diseases. However, understanding of the transport mechanism, especially of human

  14. Phytoplasma adapt to the diverse environments of their plant and insect hosts by altering gene expression

    DEFF Research Database (Denmark)

    Makarova, Olga; MacLean, Allyson M.; Nicolaisen, Mogens

    2015-01-01

    a role in host adaptation. 74 genes were up-regulated in insects and included genes involved in stress response, phospholipid synthesis, malate and pyruvate metabolism, hemolysin and transporter genes, multiple copies of thymidylate kinase, sigma factor and Zn-proteases genes. In plants, 34 genes...... encoding an immune dominant membrane protein, membrane-associated proteins, and multidrug resistance ABC-type transporters, were up-regulated. Differential regulation of gene expression thus appears to play an important role in host adaptation of phytoplasmas....

  15. ABC transporters of the wheat pathogen Mycosphaerella graminicola

    NARCIS (Netherlands)

    Zwiers, L.H.

    2002-01-01

    A TP- b inding c assette (ABC) transporters belong to one of the largest protein families known. They play a role in numerous vital processes in the cell and are characterised by their

  16. Tissue-specific transcript profiling for ABC transporters in the sequestering larvae of the phytophagous leaf beetle Chrysomela populi.

    Directory of Open Access Journals (Sweden)

    Anja S Strauss

    Full Text Available Insects evolved ingenious adaptations to use extraordinary food sources. Particularly, the diet of herbivores enriched with noxious plant secondary metabolites requires detoxification mechanisms. Sequestration, which involves the uptake, transfer, and concentration of occasionally modified phytochemicals into specialized tissues or hemolymph, is one of the most successful detoxification strategies found in most insect orders. Due to the ability of ATP-binding cassette (ABC carriers to transport a wide range of molecules including phytochemicals and xenobiotics, it is highly likely that they play a role in this sequestration process. To shed light on the role of ABC proteins in sequestration, we describe an inventory of putative ABC transporters in various tissues in the sequestering juvenile poplar leaf beetle, Chrysomela populi.In the transcriptome of C. populi, we predicted 65 ABC transporters. To link the proteins with a possible function, we performed comparative phylogenetic analyses with ABC transporters of other insects and of humans. While tissue-specific profiling of each ABC transporter subfamily suggests that ABCB, C and G influence the plant metabolite absorption in the gut, ABCC with 14 members is the preferred subfamily responsible for the excretion of these metabolites via Malpighian tubules. Moreover, salicin, which is sequestered from poplar plants, is translocated into the defensive glands for further deterrent production. In these glands and among all identified ABC transporters, an exceptionally high transcript level was observed only for Cpabc35 (Cpmrp. RNAi revealed the deficiency of other ABC pumps to compensate the function of CpABC35, demonstrating its key role during sequestration.We provide the first comprehensive phylogenetic study of the ABC family in a phytophagous beetle species. RNA-seq data from different larval tissues propose the importance of ABC pumps to achieve a homeostasis of plant-derived compounds and

  17. ABC transporter content diversity in Streptococcus pneumoniae impacts competence regulation and bacteriocin production.

    Science.gov (United States)

    Wang, Charles Y; Patel, Nisha; Wholey, Wei-Yun; Dawid, Suzanne

    2018-06-19

    The opportunistic pathogen Streptococcus pneumoniae (pneumococcus) uses natural genetic competence to increase its adaptability through horizontal gene transfer. One method of acquiring DNA is through predation of neighboring strains with antimicrobial peptides called "bacteriocins." Competence and production of the major family of pneumococcal bacteriocins, pneumocins, are regulated by the quorum-sensing systems com and blp , respectively. In the classical paradigm, the ABC transporters ComAB and BlpAB each secretes its own system's signaling pheromone and in the case of BlpAB also secretes the pneumocins. While ComAB is found in all pneumococci, only 25% of strains encode an intact version of BlpAB [BlpAB(+)] while the rest do not [BlpAB(-)]. Contrary to the classical paradigm, it was previously shown that BlpAB(-) strains can activate blp through ComAB-mediated secretion of the blp pheromone during brief periods of competence. To better understand the full extent of com - blp crosstalk, we examined the contribution of each transporter to competence development and pneumocin secretion. We found that BlpAB(+) strains have a greater capacity for competence activation through BlpAB-mediated secretion of the com pheromone. Similarly, we show that ComAB and BlpAB are promiscuous and both can secrete pneumocins. Consequently, differences in pneumocin secretion between BlpAB(+) and BlpAB(-) strains derive from the regulation and kinetics of transporter expression rather than substrate specificity. We speculate that BlpAB(-) strains (opportunists) use pneumocins mainly in a narrowly tailored role for DNA acquisition and defense during competence while BlpAB(+) strains (aggressors) expand their use for the general inhibition of rival strains. Copyright © 2018 the Author(s). Published by PNAS.

  18. Purification and biochemical characterisation of the yeast ABC transporter Pdr11p

    DEFF Research Database (Denmark)

    Laub, Katrine Rude

    Sterols constitute an essential lipid class in eukaryotic membranes where intracellular distributions are highly regulated. In the yeast Saccharomyces cerevisiae sterol uptake has been attributed to the two plasma membrane-localised ATP-binding cassette (ABC) transporters, Aus1p and Pdr11p...... of the yeast ABC transporter Pdr11p. This includes optimising its overexpression utilising the galactose induction system in S. cerevisiae, screening for the best detergent to extract the protein from the membrane, and establishing purification and reconstitution protocols. By providing a purification...

  19. Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters

    Directory of Open Access Journals (Sweden)

    Markus Grube

    2018-04-01

    Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.

  20. Brain barriers and functional interfaces with sequential appearance of ABC efflux transporters during human development

    DEFF Research Database (Denmark)

    Møllgård, Kjeld; Dziegielewska, Katarzyna M.; Holst, Camilla B.

    2017-01-01

    Adult brain is protected from entry of drugs and toxins by specific mechanisms such as ABC (ATP-binding Cassette) efflux transporters. Little is known when these appear in human brain during development. Cellular distribution of three main ABC transporters (ABCC1, ABCG2, ABCB1) was determined...... at blood-brain barriers and interfaces in human embryos and fetuses in first half of gestation. Antibodies against claudin-5 and-11 and antibodies to α-fetoprotein were used to describe morphological and functional aspects of brain barriers. First exchange interfaces to be established, probably at 4...... three transporters. Results provide evidence for sequential establishment of brain exchange interfaces and spatial and temporal timetable for three main ABC transporters in early human brain....

  1. Membrane porters of ATP-binding cassette transport systems are polyphyletic.

    Science.gov (United States)

    Wang, Bin; Dukarevich, Maxim; Sun, Eric I; Yen, Ming Ren; Saier, Milton H

    2009-09-01

    The ATP-binding cassette (ABC) superfamily consists of both importers and exporters. These transporters have, by tradition, been classified according to the ATP hydrolyzing constituents, which are monophyletic. The evolutionary origins of the transmembrane porter proteins/domains are not known. Using five distinct computer programs, we here provide convincing statistical data suggesting that the transmembrane domains of ABC exporters are polyphyletic, having arisen at least three times independently. ABC1 porters arose by intragenic triplication of a primordial two-transmembrane segment (TMS)-encoding genetic element, yielding six TMS proteins. ABC2 porters arose by intragenic duplication of a dissimilar primordial three-TMS-encoding genetic element, yielding a distinctive protein family, nonhomologous to the ABC1 proteins. ABC3 porters arose by duplication of a primordial four-TMS-encoding genetic element, yielding either eight- or 10-TMS proteins. We assign each of 48 of the 50 currently recognized families of ABC exporters to one of the three evolutionarily distinct ABC types. Currently available high-resolution structural data for ABC porters are fully consistent with our findings. These results provide guides for future structural and mechanistic studies of these important transport systems.

  2. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  3. Inhibition or knockdown of ABC transporters enhances susceptibility of adult and juvenile schistosomes to Praziquantel.

    Directory of Open Access Journals (Sweden)

    Ravi S Kasinathan

    2014-10-01

    Full Text Available Parasitic flatworms of the genus Schistosoma cause schistosomiasis, a neglected tropical disease that affects hundreds of millions. Treatment of schistosomiasis depends almost entirely on the drug praziquantel (PZQ. Though essential to treating and controlling schistosomiasis, a major limitation of PZQ is that it is not active against immature mammalian-stage schistosomes. Furthermore, there are reports of field isolates with heritable reductions in PZQ susceptibility, and researchers have selected for PZQ-resistant schistosomes in the laboratory. P-glycoprotein (Pgp; ABCB1 and other ATP binding cassette (ABC transporters remove a wide variety of toxins and xenobiotics from cells, and have been implicated in multidrug resistance (MDR. Changes in ABC transporter structure or expression levels are also associated with reduced drug susceptibility in parasitic helminths, including schistosomes. Here, we show that the activity of PZQ against schistosome adults and juveniles ex vivo is potentiated by co-administration of either the highly potent Pgp inhibitor tariquidar or combinations of inhibitors targeting multiple ABC multidrug transporters. Adult worms exposed to sublethal PZQ concentrations remain active, but co-administration of ABC transporter inhibitors results in complete loss of motility and disruption of the tegument. Notably, juvenile schistosomes (3-4 weeks post infection, normally refractory to 2 µM PZQ, become paralyzed when transporter inhibitors are added in combination with the PZQ. Experiments using the fluorescent PZQ derivative (R-PZQ-BODIPY are consistent with the transporter inhibitors increasing effective intraworm concentrations of PZQ. Adult worms in which expression of ABC transporters has been suppressed by RNA interference show increased responsiveness to PZQ and increased retention of (R-PZQ-BODIPY consistent with an important role for these proteins in setting levels of PZQ susceptibility. These results indicate that

  4. Antibiotic Resistance Mediated by the MacB ABC Transporter Family: A Structural and Functional Perspective

    Directory of Open Access Journals (Sweden)

    Nicholas P. Greene

    2018-05-01

    Full Text Available The MacB ABC transporter forms a tripartite efflux pump with the MacA adaptor protein and TolC outer membrane exit duct to expel antibiotics and export virulence factors from Gram-negative bacteria. Here, we review recent structural and functional data on MacB and its homologs. MacB has a fold that is distinct from other structurally characterized ABC transporters and uses a unique molecular mechanism termed mechanotransmission. Unlike other bacterial ABC transporters, MacB does not transport substrates across the inner membrane in which it is based, but instead couples cytoplasmic ATP hydrolysis with transmembrane conformational changes that are used to perform work in the extra-cytoplasmic space. In the MacAB-TolC tripartite pump, mechanotransmission drives efflux of antibiotics and export of a protein toxin from the periplasmic space via the TolC exit duct. Homologous tripartite systems from pathogenic bacteria similarly export protein-like signaling molecules, virulence factors and siderophores. In addition, many MacB-like ABC transporters do not form tripartite pumps, but instead operate in diverse cellular processes including antibiotic sensing, cell division and lipoprotein trafficking.

  5. Antibiotic Resistance Mediated by the MacB ABC Transporter Family: A Structural and Functional Perspective

    Science.gov (United States)

    Greene, Nicholas P.; Kaplan, Elise; Crow, Allister; Koronakis, Vassilis

    2018-01-01

    The MacB ABC transporter forms a tripartite efflux pump with the MacA adaptor protein and TolC outer membrane exit duct to expel antibiotics and export virulence factors from Gram-negative bacteria. Here, we review recent structural and functional data on MacB and its homologs. MacB has a fold that is distinct from other structurally characterized ABC transporters and uses a unique molecular mechanism termed mechanotransmission. Unlike other bacterial ABC transporters, MacB does not transport substrates across the inner membrane in which it is based, but instead couples cytoplasmic ATP hydrolysis with transmembrane conformational changes that are used to perform work in the extra-cytoplasmic space. In the MacAB-TolC tripartite pump, mechanotransmission drives efflux of antibiotics and export of a protein toxin from the periplasmic space via the TolC exit duct. Homologous tripartite systems from pathogenic bacteria similarly export protein-like signaling molecules, virulence factors and siderophores. In addition, many MacB-like ABC transporters do not form tripartite pumps, but instead operate in diverse cellular processes including antibiotic sensing, cell division and lipoprotein trafficking. PMID:29892271

  6. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  7. Structure of the nucleotide-binding domain of a dipeptide ABC transporter reveals a novel iron-sulfur cluster-binding domain.

    Science.gov (United States)

    Li, Xiaolu; Zhuo, Wei; Yu, Jie; Ge, Jingpeng; Gu, Jinke; Feng, Yue; Yang, Maojun; Wang, Linfang; Wang, Na

    2013-02-01

    Dipeptide permease (Dpp), which belongs to an ABC transport system, imports peptides consisting of two or three L-amino acids from the matrix to the cytoplasm in microbes. Previous studies have indicated that haem competes with dipeptides to bind DppA in vitro and in vivo and that the Dpp system can also translocate haem. Here, the crystal structure of DppD, the nucleotide-binding domain (NBD) of the ABC-type dipeptide/oligopeptide/nickel-transport system from Thermoanaerobacter tengcongensis, bound with ATP, Mg(2+) and a [4Fe-4S] iron-sulfur cluster is reported. The N-terminal domain of DppD shares a similar structural fold with the NBDs of other ABC transporters. Interestingly, the C-terminal domain of DppD contains a [4Fe-4S] cluster. The UV-visible absorbance spectrum of DppD was consistent with the presence of a [4Fe-4S] cluster. A search with DALI revealed that the [4Fe-4S] cluster-binding domain is a novel structural fold. Structural analysis and comparisons with other ABC transporters revealed that this iron-sulfur cluster may act as a mediator in substrate (dipeptide or haem) binding by electron transfer and may regulate the transport process in Dpp ABC transport systems. The crystal structure provides a basis for understanding the properties of ABC transporters and will be helpful in investigating the functions of NBDs in the regulation of ABC transporter activity.

  8. The ABC transporter Rv1272c of Mycobacterium tuberculosis enhances the import of long-chain fatty acids in Escherichia coli.

    Science.gov (United States)

    Martin, Audrey; Daniel, Jaiyanth

    2018-02-05

    Mycobacterium tuberculosis (Mtb), which causes tuberculosis, is capable of accumulating triacylglycerol (TAG) by utilizing fatty acids from host cells. ATP-binding cassette (ABC) transporters are involved in transport processes in all organisms. Among the classical ABC transporters in Mtb none have been implicated in fatty acid import. Since the transport of fatty acids from the host cell is important for dormancy-associated TAG synthesis in the pathogen, mycobacterial ABC transporter(s) could potentially be involved in this process. Based on sequence identities with a bacterial ABC transporter that mediates fatty acid import for TAG synthesis, we identified Rv1272c, a hitherto uncharacterized ABC-transporter in Mtb that also shows sequence identities with a plant ABC transporter involved in fatty acid transport. We expressed Rv1272c in E. coli and show that it enhances the import of radiolabeled fatty acids. We also show that Rv1272c causes a significant increase in the metabolic incorporation of radiolabeled long-chain fatty acids into cardiolipin, a tetra-acylated phospholipid, and phosphatidylglycerol in E. coli. This is the first report on the function of Rv1272c showing that it displays a long-chain fatty acid transport function. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Genome-Wide Identification and Expression Profiling of ATP-Binding Cassette (ABC) Transporter Gene Family in Pineapple (Ananas comosus (L.) Merr.) Reveal the Role of AcABCG38 in Pollen Development.

    Science.gov (United States)

    Chen, Piaojuan; Li, Yi; Zhao, Lihua; Hou, Zhimin; Yan, Maokai; Hu, Bingyan; Liu, Yanhui; Azam, Syed Muhammad; Zhang, Ziyan; Rahman, Zia Ur; Liu, Liping; Qin, Yuan

    2017-01-01

    Pineapple ( Ananas comosus L .) cultivation commonly relies on asexual reproduction which is easily impeded by many factors in agriculture production. Sexual reproduction might be a novel approach to improve the pineapple planting. However, genes controlling pineapple sexual reproduction are still remain elusive. In different organisms a conserved superfamily proteins known as ATP binding cassette (ABC) participate in various biological processes. Whereas, till today the ABC gene family has not been identified in pineapple. Here 100 ABC genes were identified in the pineapple genome and grouped into eight subfamilies (5 ABCAs , 20 ABCB s, 16 ABCCs , 2 ABCDs , one ABCEs , 5 ABCFs , 42 ABCGs and 9 ABCIs ). Gene expression profiling revealed the dynamic expression pattern of ABC gene family in various tissues and different developmental stages. AcABCA5, AcABCB6, AcABCC4 , AcABCC7 , AcABCC9 , AcABCG26 , AcABCG38 and AcABCG42 exhibited preferential expression in ovule and stamen. Over-expression of AcABCG38 in the Arabidopsis double mutant abcg1-2abcg16-2 partially restored its pollen abortion defects, indicating that AcABCG38 plays important roles in pollen development. Our study on ABC gene family in pineapple provides useful information for developing sexual pineapple plantation which could be utilized to improve pineapple agricultural production.

  10. Effects of deletion of the Streptococcus pneumoniae lipoprotein diacylglyceryl transferase gene lgt on ABC transporter function and on growth in vivo.

    Directory of Open Access Journals (Sweden)

    Suneeta Chimalapati

    Full Text Available Lipoproteins are an important class of surface associated proteins that have diverse roles and frequently are involved in the virulence of bacterial pathogens. As prolipoproteins are attached to the cell membrane by a single enzyme, prolipoprotein diacylglyceryl transferase (Lgt, deletion of the corresponding gene potentially allows the characterisation of the overall importance of lipoproteins for specific bacterial functions. We have used a Δlgt mutant strain of Streptococcus pneumoniae to investigate the effects of loss of lipoprotein attachment on cation acquisition, growth in media containing specific carbon sources, and virulence in different infection models. Immunoblots of triton X-114 extracts, flow cytometry and immuno-fluorescence microscopy confirmed the Δlgt mutant had markedly reduced lipoprotein expression on the cell surface. The Δlgt mutant had reduced growth in cation depleted medium, increased sensitivity to oxidative stress, reduced zinc uptake, and reduced intracellular levels of several cations. Doubling time of the Δlgt mutant was also increased slightly when grown in medium with glucose, raffinose and maltotriose as sole carbon sources. These multiple defects in cation and sugar ABC transporter function for the Δlgt mutant were associated with only slightly delayed growth in complete medium. However the Δlgt mutant had significantly reduced growth in blood or bronchoalveolar lavage fluid and a marked impairment in virulence in mouse models of nasopharyngeal colonisation, sepsis and pneumonia. These data suggest that for S. pneumoniae loss of surface localisation of lipoproteins has widespread effects on ABC transporter functions that collectively prevent the Δlgt mutant from establishing invasive infection.

  11. A Cluster of Five Genes Essential for the Utilization of Dihydroxamate Xenosiderophores in Synechocystis sp. PCC 6803.

    Science.gov (United States)

    Obando S, Tobias A; Babykin, Michael M; Zinchenko, Vladislav V

    2018-05-21

    The unicellular freshwater cyanobacterium Synechocystis sp. PCC 6803 is capable of using dihydroxamate xenosiderophores, either ferric schizokinen (FeSK) or a siderophore of the filamentous cyanobacterium Anabaena variabilis ATCC 29413 (SAV), as the sole source of iron in the TonB-dependent manner. The fecCDEB1-schT gene cluster encoding a siderophore transport system that is involved in the utilization of FeSK and SAV in Synechocystis sp. PCC 6803 was identified. The gene schT encodes TonB-dependent outer membrane transporter, whereas the remaining four genes encode the ABC-type transporter FecB1CDE formed by the periplasmic binding protein FecB1, the transmembrane permease proteins FecC and FecD, and the ATPase FecE. Inactivation of any of these genes resulted in the inability of cells to utilize FeSK and SAV. Our data strongly suggest that Synechocystis sp. PCC 6803 can readily internalize Fe-siderophores via the classic TonB-dependent transport system.

  12. Identification of five partial ABC genes in the liver of the Antarctic fish Trematomus bernacchii and sensitivity of ABCB1 and ABCC2 to Cd exposure

    Energy Technology Data Exchange (ETDEWEB)

    Zucchi, Sara, E-mail: zucchi2@unisi.i [Department of Environmental Sciences ' G. Sarfatti' , University of Siena, Via Mattioli 4, 53100 Siena (Italy); Corsi, Ilaria [Department of Environmental Sciences ' G. Sarfatti' , University of Siena, Via Mattioli 4, 53100 Siena (Italy); Luckenbach, Till [UFZ - Helmholtz Centre for Environmental Research, Permoserstr. 15, D-04318 Leipzig (Germany); Bard, Shannon Mala [Environmental Programmes, Dalhousie University, 1355 Oxford Street, Life Science Centre, Room 820, Halifax, Nova Scotia, Canada B3H 4J1 (Canada); Regoli, Francesco [Department of Biochemistry, Biology and Genetics, Polytechnic University of Marches, Ancona (Italy); Focardi, Silvano [Department of Environmental Sciences ' G. Sarfatti' , University of Siena, Via Mattioli 4, 53100 Siena (Italy)

    2010-08-15

    Several ABC transporters have been characterized from many aquatic organisms, but no information is yet available for Antarctic fish. The aim of this work was to identify the expression of genes for ABC proteins in Trematomus bernacchii, a bioindicator species of the Southern Ocean. Partial cDNA sequences of ABCB1, ABCC1, ABCC2, ABCC4 and ABCC9 were cloned from liver. Using RACE technology, 3.5 and 2.2 kb contigs were obtained for ABCB1 and ABCC2. Considering the elevated natural bioavailability of cadmium at Terra Nova Bay, responsiveness of ABCB1 and ABCC2 to this element was investigated under laboratory conditions. ABCB1 and ABCC2 mRNA levels were approximately four-fold higher in Cd-exposed fish compared to the controls. Induction of ABCB1 protein was also found by western blot. This study provides the first identification of five ABC genes in the liver of an Antarctic key species, some of which may be involved in cellular detoxification. - The presence of five partial sequences showing homology with ABC transporters and the sensitivity of ABCB1 and ABCC2 toward cadmium were determined in the liver of T. bernacchii.

  13. The Yeast Plasma Membrane ATP Binding Cassette (ABC) Transporter Aus1

    Science.gov (United States)

    Marek, Magdalena; Milles, Sigrid; Schreiber, Gabriele; Daleke, David L.; Dittmar, Gunnar; Herrmann, Andreas; Müller, Peter; Pomorski, Thomas Günther

    2011-01-01

    The ATP binding cassette (ABC) transporter Aus1 is expressed under anaerobic growth conditions at the plasma membrane of the yeast Saccharomyces cerevisiae and is required for sterol uptake. These observations suggest that Aus1 promotes the translocation of sterols across membranes, but the precise transport mechanism has yet to be identified. In this study, an extraction and purification procedure was developed to characterize the Aus1 transporter. The detergent-solubilized protein was able to bind and hydrolyze ATP. Mutagenesis of the conserved lysine to methionine in the Walker A motif abolished ATP hydrolysis. Likewise, ATP hydrolysis was inhibited by classical inhibitors of ABC transporters. Upon reconstitution into proteoliposomes, the ATPase activity of Aus1 was specifically stimulated by phosphatidylserine (PS) in a stereoselective manner. We also found that Aus1-dependent sterol uptake, but not Aus1 expression and trafficking to the plasma membrane, was affected by changes in cellular PS levels. These results suggest a direct interaction between Aus1 and PS that is critical for the activity of the transporter. PMID:21521689

  14. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharjee, Sourav, E-mail: sourav.bhattacharjee@wur.nl [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Opstal, Edward J. van; Alink, Gerrit M. [Wageningen University, Division of Toxicology (Netherlands); Marcelis, Antonius T. M.; Zuilhof, Han [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Rietjens, Ivonne M. C. M. [Wageningen University, Division of Toxicology (Netherlands)

    2013-06-15

    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size {approx}45 nm) and polystyrene nanoparticles (PSNPs/size {approx}50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  15. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    Science.gov (United States)

    Bhattacharjee, Sourav; van Opstal, Edward J.; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.

    2013-06-01

    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size 45 nm) and polystyrene nanoparticles (PSNPs/size 50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  16. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    International Nuclear Information System (INIS)

    Bhattacharjee, Sourav; Opstal, Edward J. van; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.

    2013-01-01

    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size ∼45 nm) and polystyrene nanoparticles (PSNPs/size ∼50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  17. Involvement of the carboxyl-terminal region of the yeast peroxisomal half ABC transporter Pxa2p in its interaction with Pxa1p and in transporter function.

    Directory of Open Access Journals (Sweden)

    Cheng-Yi Chuang

    Full Text Available The peroxisome is a single membrane-bound organelle in eukaryotic cells involved in lipid metabolism, including β-oxidation of fatty acids. The human genetic disorder X-linked adrenoleukodystrophy (X-ALD is caused by mutations in the ABCD1 gene (encoding ALDP, a peroxisomal half ATP-binding cassette [ABC] transporter. This disease is characterized by defective peroxisomal β-oxidation and a large accumulation of very long-chain fatty acids in brain white matter, adrenal cortex, and testis. ALDP forms a homodimer proposed to be the functional transporter, whereas the peroxisomal transporter in yeast is a heterodimer comprising two half ABC transporters, Pxa1p and Pxa2p, both orthologs of human ALDP. While the carboxyl-terminal domain of ALDP is engaged in dimerization, it remains unknown whether the same region is involved in the interaction between Pxa1p and Pxa2p.Using a yeast two-hybrid assay, we found that the carboxyl-terminal region (CT of Pxa2p, but not of Pxa1p, is required for their interaction. Further analysis indicated that the central part of the CT (designated CT2 of Pxa2p was indispensable for its interaction with the carboxyl terminally truncated Pxa1_NBD. An interaction between the CT of Pxa2p and Pxa1_NBD was not detected, but could be identified in the presence of Pxa2_NBD-CT1. A single mutation of two conserved residues (aligned with X-ALD-associated mutations at the same positions in ALDP in the CT2 of the Pxa2_NBD-CT protein impaired its interaction with Pxa1_NBD or Pxa1_NBD-CT, resulting in a mutant protein that exhibited a proteinase K digestion profile different from that of the wild-type protein. Functional analysis of these mutant proteins on oleate plates indicated that they were defective in transporter function.The CT of Pxa2p is involved in its interaction with Pxa1p and in transporter function. This concept may be applied to human ALDP studies, helping to establish the pathological mechanism for CT-related X

  18. Alzheimer's and ABC transporters--new opportunities for diagnostics and treatment.

    Science.gov (United States)

    Pahnke, Jens; Langer, Oliver; Krohn, Markus

    2014-12-01

    Much has been said about the increasing number of demented patients and the main risk factor 'age'. Frustratingly, we do not know the precise pattern and all modulating factors that provoke the pathologic changes in the brains of affected elderly. We have to diagnose early to be able to stop the progression of diseases that irreversibly destroy brain substance. Familiar AD cases have mislead some researchers for almost 20 years, which has unfortunately narrowed the scientific understanding and has, thus, lead to insufficient funding of independent approaches. Therefore, basic researchers hardly have been able to develop causative treatments and clinicians still do not have access to prognostic and early diagnostic tools. During the recent years it became clear that insufficient Aβ export, physiologically facilitated by the ABC transporter superfamily at the brain's barriers, plays a fundamental role in disease initiation and progression. Furthermore, export mechanisms that are deficient in affected elderly are new targets for activation and, thus, treatment, but ideally also for prevention. In sporadic AD disturbed clearance of β-amyloid from the brain is so far the most important factor for its accumulation in the parenchyma and vessel walls. Here, we review findings about the contribution of ABC transporters and of the perivascular drainage/glymphatic system on β-amyloid clearance. We highlight their potential value for innovative early diagnostics using PET and describe recently described, effective ABC transporter-targeting agents as potential causative treatment for neurodegenerative proteopathies/dementias. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. ABC transporters from Botrytis cinerea in biotic and abiotic interactions

    NARCIS (Netherlands)

    Schoonbeek, H.

    2004-01-01

    Botrytis cinereais the causal agent of grey mould disease on a wide variety of crop plants. It is relatively insensitive to natural and synthetic fungitoxic compounds. This thesis describes how ABC (ATP-binding cassette) transporters contribute to protection by actively

  20. NFκBP65 transcription factor modulates resistance to doxorubicin through ABC transporters in breast cancer.

    Science.gov (United States)

    Velaei, Kobra; Samadi, Nasser; Soltani, Sina; Barazvan, Balal; Soleimani Rad, Jafar

    2017-07-01

    Shedding light on chemoresistance biology of breast cancer could contribute to enhance the clinical outcome. Intrinsic or acquired resistance to chemotherapy is a major problem in breast cancer treatment. The NFκB pathway by siRNAP65 and JSH-23 as a translocational inhibitor of NFκBP65 in the doxorubicin-resistant MCF-7 (MCF-7/Dox) and MCF-7 cells was blocked. Then, the ABC transporter expression and function were assessed by real-time qRT-PCR and flow cytometry, respectively. Induction of apoptosis was evaluated after inhibition of the NFΚB pathway as well. Our study underlined the upregulation of NFκBP65 and anti-apoptotic Bcl-2 and downregulation of pro-apoptotic Bax in the MCF-7/Dox cells compared with control MCF-7 cells. Here, we showed that interplay between nuclear factor kappa B P65 (NFkBP65) as a transcriptional regulator and ABC transporters in the MCF-7/Dox cancer cells. We found that inhibition of the elevated expression of NFκBP65 in the resistant breast cancer, whether translocational inhibition or silencing by siRNA, decreased the expression and function of MDR1 and MRP1 efflux pumps. Furthermore, the blockade of NFκBP65 promoted apoptosis via modulating Bcl-2 and BAX expression. After inhibition of the NFκBP65 signaling pathway, elevated baseline expression of survival Bcl-2 gene in the resistant breast cells significantly decreased. Suppression of the NFκB pathway has a profound dual impact on promoting the intrinsic apoptotic pathway and reducing ABC transporter function and expression, which are some of the chemoresistance features. It was speculated that the NFκB pathway directly acts on doxorubicin-induced MDR1 and MRP1 expression in MCF-7/Dox cells.

  1. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.

    2017-01-01

    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  2. IMG-ABC: A Knowledge Base To Fuel Discovery of Biosynthetic Gene Clusters and Novel Secondary Metabolites.

    Science.gov (United States)

    Hadjithomas, Michalis; Chen, I-Min Amy; Chu, Ken; Ratner, Anna; Palaniappan, Krishna; Szeto, Ernest; Huang, Jinghua; Reddy, T B K; Cimermančič, Peter; Fischbach, Michael A; Ivanova, Natalia N; Markowitz, Victor M; Kyrpides, Nikos C; Pati, Amrita

    2015-07-14

    In the discovery of secondary metabolites, analysis of sequence data is a promising exploration path that remains largely underutilized due to the lack of computational platforms that enable such a systematic approach on a large scale. In this work, we present IMG-ABC (https://img.jgi.doe.gov/abc), an atlas of biosynthetic gene clusters within the Integrated Microbial Genomes (IMG) system, which is aimed at harnessing the power of "big" genomic data for discovering small molecules. IMG-ABC relies on IMG's comprehensive integrated structural and functional genomic data for the analysis of biosynthetic gene clusters (BCs) and associated secondary metabolites (SMs). SMs and BCs serve as the two main classes of objects in IMG-ABC, each with a rich collection of attributes. A unique feature of IMG-ABC is the incorporation of both experimentally validated and computationally predicted BCs in genomes as well as metagenomes, thus identifying BCs in uncultured populations and rare taxa. We demonstrate the strength of IMG-ABC's focused integrated analysis tools in enabling the exploration of microbial secondary metabolism on a global scale, through the discovery of phenazine-producing clusters for the first time in Alphaproteobacteria. IMG-ABC strives to fill the long-existent void of resources for computational exploration of the secondary metabolism universe; its underlying scalable framework enables traversal of uncovered phylogenetic and chemical structure space, serving as a doorway to a new era in the discovery of novel molecules. IMG-ABC is the largest publicly available database of predicted and experimental biosynthetic gene clusters and the secondary metabolites they produce. The system also includes powerful search and analysis tools that are integrated with IMG's extensive genomic/metagenomic data and analysis tool kits. As new research on biosynthetic gene clusters and secondary metabolites is published and more genomes are sequenced, IMG-ABC will continue to

  3. The arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier

    Science.gov (United States)

    Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.

    1998-01-01

    Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.

  4. Production, regulation and transportation of bacillibactin in bacillus subtilis

    International Nuclear Information System (INIS)

    Raza, W.; Hussain, Q.; Shen, Q.

    2012-01-01

    Bacillus subtilis produces a catecholate type siderophore 'Bacillibactin'. This review focuses on the non-ribosomal synthesis, transport and regulation of bacillibactin. Bacillibactin biosynthetic operon contains five genes (dhbACEBF). The uptake of bacillibactin requires the FeuABC transporter, inner-membrane permease, FepDG and YusV ATPase and an esterase encoding gene, besA and while export required YmfE major facilitator super-family (MFS)-type transporter. Fur is the major iron-controlled transcriptional regulator in B. subtilis, which acts as an iron-dependent repressor of the dhb operon in vivo while an iron-independent repressor in vitro. Knowledge of the Fur regulon will be useful in interpreting other global analysis of transcriptional responses. (author)

  5. ABC transporters P-gp and Bcrp do not limit the brain uptake of the novel antipsychotic and anticonvulsant drug cannabidiol in mice

    Directory of Open Access Journals (Sweden)

    Natalia Brzozowska

    2016-05-01

    Full Text Available Cannabidiol (CBD is currently being investigated as a novel therapeutic for the treatment of CNS disorders like schizophrenia and epilepsy. ABC transporters such as P-glycoprotein (P-gp and breast cancer resistance protein (Bcrp mediate pharmacoresistance in these disorders. P-gp and Bcrp are expressed at the blood brain barrier (BBB and reduce the brain uptake of substrate drugs including various antipsychotics and anticonvulsants. It is therefore important to assess whether CBD is prone to treatment resistance mediated by P-gp and Bcrp. Moreover, it has become common practice in the drug development of CNS agents to screen against ABC transporters to help isolate lead compounds with optimal pharmacokinetic properties. The current study aimed to assess whether P-gp and Bcrp impacts the brain transport of CBD by comparing CBD tissue concentrations in wild-type (WT mice versus mice devoid of ABC transporter genes. P-gp knockout (Abcb1a/b−∕−, Bcrp knockout (Abcg2−∕−, combined P-gp/Bcrp knockout (Abcb1a/b−∕−Abcg2−∕− and WT mice were injected with CBD, before brain and plasma samples were collected at various time-points. CBD results were compared with the positive control risperidone and 9-hydroxy risperidone, antipsychotic drugs that are established ABC transporter substrates. Brain and plasma concentrations of CBD were not greater in P-gp, Bcrp or P-gp/Bcrp knockout mice than WT mice. In comparison, the brain/plasma concentration ratios of risperidone and 9-hydroxy risperidone were profoundly higher in P-gp knockout mice than WT mice. These results suggest that CBD is not a substrate of P-gp or Bcrp and may be free from the complication of reduced brain uptake by these transporters. Such findings provide favorable evidence for the therapeutic development of CBD in the treatment of various CNS disorders.

  6. An ABC transporter mutation is correlated with insect resistance to Bacillus thuringiensis Cry1Ac toxin.

    Directory of Open Access Journals (Sweden)

    Linda J Gahan

    2010-12-01

    Full Text Available Transgenic crops producing insecticidal toxins from Bacillus thuringiensis (Bt are commercially successful in reducing pest damage, yet knowledge of resistance mechanisms that threaten their sustainability is incomplete. Insect resistance to the pore-forming Cry1Ac toxin is correlated with the loss of high-affinity, irreversible binding to the mid-gut membrane, but the genetic factors responsible for this change have been elusive. Mutations in a 12-cadherin-domain protein confer some Cry1Ac resistance but do not block this toxin binding in in vitro assays. We sought to identify mutations in other genes that might be responsible for the loss of binding. We employed a map-based cloning approach using a series of backcrosses with 1,060 progeny to identify a resistance gene in the cotton pest Heliothis virescens that segregated independently from the cadherin mutation. We found an inactivating mutation of the ABC transporter ABCC2 that is genetically linked to Cry1Ac resistance and is correlated with loss of Cry1Ac binding to membrane vesicles. ABC proteins are integral membrane proteins with many functions, including export of toxic molecules from the cell, but have not been implicated in the mode of action of Bt toxins before. The reduction in toxin binding due to the inactivating mutation suggests that ABCC2 is involved in membrane integration of the toxin pore. Our findings suggest that ABC proteins may play a key role in the mode of action of Bt toxins and that ABC protein mutations can confer high levels of resistance that could threaten the continued utilization of Bt-expressing crops. However, such mutations may impose a physiological cost on resistant insects, by reducing export of other toxins such as plant secondary compounds from the cell. This weakness could be exploited to manage this mechanism of Bt resistance in the field.

  7. An ABC transporter mutation is correlated with insect resistance to Bacillus thuringiensis Cry1Ac toxin.

    Science.gov (United States)

    Gahan, Linda J; Pauchet, Yannick; Vogel, Heiko; Heckel, David G

    2010-12-16

    Transgenic crops producing insecticidal toxins from Bacillus thuringiensis (Bt) are commercially successful in reducing pest damage, yet knowledge of resistance mechanisms that threaten their sustainability is incomplete. Insect resistance to the pore-forming Cry1Ac toxin is correlated with the loss of high-affinity, irreversible binding to the mid-gut membrane, but the genetic factors responsible for this change have been elusive. Mutations in a 12-cadherin-domain protein confer some Cry1Ac resistance but do not block this toxin binding in in vitro assays. We sought to identify mutations in other genes that might be responsible for the loss of binding. We employed a map-based cloning approach using a series of backcrosses with 1,060 progeny to identify a resistance gene in the cotton pest Heliothis virescens that segregated independently from the cadherin mutation. We found an inactivating mutation of the ABC transporter ABCC2 that is genetically linked to Cry1Ac resistance and is correlated with loss of Cry1Ac binding to membrane vesicles. ABC proteins are integral membrane proteins with many functions, including export of toxic molecules from the cell, but have not been implicated in the mode of action of Bt toxins before. The reduction in toxin binding due to the inactivating mutation suggests that ABCC2 is involved in membrane integration of the toxin pore. Our findings suggest that ABC proteins may play a key role in the mode of action of Bt toxins and that ABC protein mutations can confer high levels of resistance that could threaten the continued utilization of Bt-expressing crops. However, such mutations may impose a physiological cost on resistant insects, by reducing export of other toxins such as plant secondary compounds from the cell. This weakness could be exploited to manage this mechanism of Bt resistance in the field.

  8. Role of the Fur regulon in iron transport in Bacillus subtilis.

    Science.gov (United States)

    Ollinger, Juliane; Song, Kyung-Bok; Antelmann, Haike; Hecker, Michael; Helmann, John D

    2006-05-01

    The Bacillus subtilis ferric uptake regulator (Fur) protein mediates the iron-dependent repression of at least 20 operons encoding approximately 40 genes. We investigated the physiological roles of Fur-regulated genes by the construction of null mutations in 14 transcription units known or predicted to function in siderophore biosynthesis or iron uptake. We demonstrate that ywbLMN, encoding an elemental iron uptake system orthologous to the copper oxidase-dependent Fe(III) uptake system of Saccharomyces cerevisiae, is essential for growth in low iron minimal medium lacking citric acid. 2,3-Dihydroxybenzoyl-glycine (Itoic acid), the siderophore precursor produced by laboratory strains of B. subtilis, is of secondary importance. In the presence of citrate, the YfmCDEF ABC transporter is required for optimal growth. B. subtilis is unable to grow in minimal medium containing the iron chelator EDDHA unless the ability to synthesize the intact bacillibactin siderophore is restored (by the introduction of a functional sfp gene) or exogenous siderophores are provided. Utilization of the catecholate siderophores bacillibactin and enterobactin requires the FeuABC importer and the YusV ATPase. Utilization of hydroxamate siderophores requires the FhuBGC ABC transporter together with the FhuD (ferrichrome) or YxeB (ferrioxamine) substrate-binding proteins. Growth with schizokinen or arthrobactin is at least partially dependent on the YfhA YfiYZ importer and the YusV ATPase. We have also investigated the effects of a fur mutation on the proteome and documented the derepression of 11 Fur-regulated proteins, including a newly identified thioredoxin reductase homolog, YcgT.

  9. ABC transporters van Botrytis cinerea in biotische en abiotische interacties

    NARCIS (Netherlands)

    Schoonbeek, H.

    2005-01-01

    Op 29 november 2004 promoveerde Henk-jan Schoonbeek aan Wageningen Universiteit op het proefschrift getiteld 'ABC transporters from Botrytis cinerea in biotic and abiotic interactions'. Promotor was Prof. dr. ir. P.J.G.M. de Wit en co-promotor was dr.ir. M.A. de Waard, leerstoelgroep Fytopathologie,

  10. Are lipid rafts involved in ABC transporter-mediated drug resistance of tumor cells?

    NARCIS (Netherlands)

    Kok, Jan Willem; Klappe, Karin; Hummel, Ina; Kroesen, Bart-Jan; Sietsma, Hannie; Meszaros, Peter

    2008-01-01

    Since their discovery, lipid rafts have been implicated in several cellular functions, including protein transport in polarized cells and signal transduction. Also in multidrug resistance lipid rafts may be important with regard to the localization of ATP-binding cassette (ABC) transporters in these

  11. Effects of in vitro exposure to ivermectin and levamisole on the expression patterns of ABC transporters in Haemonchus contortus larvae

    Directory of Open Access Journals (Sweden)

    Ali Raza

    2016-08-01

    Full Text Available This study investigated the interaction of ATP binding cassette (ABC transport proteins with ivermectin (IVM and levamisole (LEV in larvae of susceptible and resistant isolates of Haemonchus contortus in vitro by measuring transcription patterns following exposure to these anthelmintics. Furthermore, we studied the consequences of drug exposure by measuring the sensitivity of L3 to subsequent exposure to higher drug concentrations using larval migration assays. The most highly transcribed transporter genes in both susceptible and resistant L3 were pgp-9.3, abcf-1, mrp-5, abcf-2, pgp-3, and pgp-10. The resistant isolate showed significantly higher transcription of pgp-1, pgp-9.1 and pgp-9.2 compared to the susceptible isolate. Five P-gp genes and the haf-6 gene showed significantly higher transcription (up to 12.6-fold after 3 h exposure to IVM in the resistant isolate. Similarly, five P-gp genes, haf-6 and abcf-1 were transcribed at significantly higher levels (up to 10.3-fold following 3 h exposure to LEV in this isolate. On the other hand, there were no significant changes in transcriptional patterns of all transporter genes in the susceptible isolate following 3 and 6 h exposure to IVM or LEV. In contrast to these isolate-specific transcription changes, both isolates showed an increase in R-123 efflux following exposure to the drugs, suggesting that the drugs stimulated activity of existing transporter proteins in both isolates. Exposure of resistant larvae to IVM or LEV resulted, in some instances, in an increase in the proportion of the population able to migrate at the highest IVM concentrations in subsequent migration assays. The significant increase in transcription of some ABC transporter genes following 3 h exposure to both IVM and LEV in the resistant isolate only, suggests that an ability to rapidly upregulate protective pathways in response to drugs may be a component of the resistance displayed by this isolate.

  12. Gangliosides do not affect ABC transporter function in human neuroblastoma cells

    NARCIS (Netherlands)

    Dijkhuis, Anne-Jan; Klappe, Karin; Kamps, Willem; Sietsma, Hannie; Kok, Jan Willem

    Previous studies have indicated a role for glucosylceramide synthase (GCS) in multidrug resistance (MDR), either related to turnover of ceramide (Cer) or generation of gangliosides, which modulate apoptosis and/or the activity of ABC transporters. This study challenges the hypothesis that

  13. ABC gene-ranking for prediction of drug-induced cholestasis in rats

    Directory of Open Access Journals (Sweden)

    Yauheniya Cherkas

    Full Text Available As legacy toxicogenomics databases have become available, improved data mining approaches are now key to extracting and visualizing subtle relationships between toxicants and gene expression. In the present study, a novel “aggregating bundles of clusters” (ABC procedure was applied to separate cholestatic from non-cholestatic drugs and model toxicants in the Johnson & Johnson (Janssen rat liver toxicogenomics database [3]. Drug-induced cholestasis is an important issue, particularly when a new compound enters the market with this liability, with standard preclinical models often mispredicting this toxicity. Three well-characterized cholestasis-responsive genes (Cyp7a1, Mrp3 and Bsep were chosen from a previous in-house Janssen gene expression signature; these three genes show differing, non-redundant responses across the 90+ paradigm compounds in our database. Using the ABC procedure, extraneous contributions were minimized in comparisons of compound gene responses. All genes were assigned weights proportional to their correlations with Cyp7a1, Mrp3 and Bsep, and a resampling technique was used to derive a stable measure of compound similarity. The compounds that were known to be associated with rat cholestasis generally had small values of this measure relative to each other but also had large values of this measure relative to non-cholestatic compounds. Visualization of the data with the ABC-derived signature showed a very tight, essentially identically behaving cluster of robust human cholestatic drugs and experimental cholestatic toxicants (ethinyl estradiol, LPS, ANIT and methylene dianiline, disulfiram, naltrexone, methapyrilene, phenacetin, alpha-methyl dopa, flutamide, the NSAIDs–—indomethacin, flurbiprofen, diclofenac, flufenamic acid, sulindac, and nimesulide, butylated hydroxytoluene, piperonyl butoxide, and bromobenzene, some slightly less active compounds (3′-acetamidofluorene, amsacrine, hydralazine, tannic acid, some

  14. Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.

    Science.gov (United States)

    Sundaram, Prema; Han, Wang; Cohen, Nancy; Echalier, Benjamin; Albin, John; Timmons, Lisa

    2008-02-01

    RNA interference (RNAi) mechanisms are conserved and consist of an interrelated network of activities that not only respond to exogenous dsRNA, but also perform endogenous functions required in the fine tuning of gene expression and in maintaining genome integrity. Not surprisingly, RNAi functions have widespread influences on cellular function and organismal development. Previously, we observed a reduced capacity to mount an RNAi response in nine Caenorhabditis elegans mutants that are defective in ABC transporter genes (ABC(RNAi) mutants). Here, we report an exhaustive study of mutants, collectively defective in 49 different ABC transporter genes, that allowed for the categorization of one additional transporter into the ABC(RNAi) gene class. Genetic complementation tests reveal functions for ABC(RNAi) transporters in the mut-7/rde-2 branch of the RNAi pathway. These second-site noncomplementation interactions suggest that ABC(RNAi) proteins and MUT-7/RDE-2 function together in parallel pathways and/or as multiprotein complexes. Like mut-7 and rde-2, some ABC(RNAi) mutants display transposon silencing defects. Finally, our analyses reveal a genetic interaction network of ABC(RNAi) gene function with respect to this part of the RNAi pathway. From our results, we speculate that the coordinated activities of ABC(RNAi) transporters, through their effects on endogenous RNAi-related mechanisms, ultimately affect chromosome function and integrity.

  15. Functional Diversity of Tandem Substrate-Binding Domains in ABC Transporters from Pathogenic Bacteria

    NARCIS (Netherlands)

    Fulyani, Faizah; Schuurman-Wolters, Gea K.; Vujicic - Zagar, Andreja; Guskov, Albert; Slotboom, Dirk-Jan; Poolman, Bert

    2013-01-01

    The ATP-binding cassette (ABC) transporter GInPQ is an essential uptake system for amino acids in gram-positive pathogens and related nonpathogenic bacteria. The transporter has tandem substrate-binding domains (SBDs) fused to each transmembrane domain, giving rise to four SBDs per functional

  16. AtMRP6/AtABCC6, an ATP-Binding Cassette transporter gene expressed during early steps of seedling development and up-regulated by cadmium in Arabidopsis thaliana

    Science.gov (United States)

    Gaillard, Stéphane; Jacquet, Hélène; Vavasseur, Alain; Leonhardt, Nathalie; Forestier, Cyrille

    2008-01-01

    Background ABC proteins constitute one of the largest families of transporters found in all living organisms. In Arabidopsis thaliana, 120 genes encoding ABC transporters have been identified. Here, the characterization of one member of the MRP subclass, AtMRP6, is described. Results This gene, located on chromosome 3, is bordered by AtMRP3 and AtMRP7. Using real-time quantitative PCR (RT-Q-PCR) and the GUS reporter gene, we found that this gene is essentially expressed during early seedling development, in the apical meristem and at initiation point of secondary roots, especially in xylem-opposite pericycle cells where lateral roots initiate. The level of expression of AtMRP6 in response to various stresses was explored and a significant up-regulation after cadmium (Cd) treatment was detected. Among the three T-DNA insertion lines available from the Salk Institute library, two knock-out mutants, Atmrp6.1 and Atmrp6.2 were invalidated for the AtMRP6 gene. In the presence of Cd, development of leaves was more affected in the mutants than wild-type plants, whereas root elongation and ramification was comparable. Conclusion The position of AtMRP6 on chromosome 3, flanked by two other MRP genes, (all of which being induced by Cd) suggests that AtMRP6 is part of a cluster involved in metal tolerance, although additional functions in planta cannot be discarded. PMID:18307782

  17. Gene expression of membrane transporters: Importance for prognosis and progression of ovarian carcinoma

    Czech Academy of Sciences Publication Activity Database

    Elsnerová, K.; Mohelniková; Duchonová, B.; Čeřovská, E.; Ehrlichová, M.; Gut, I.; Rob, L.; Skapa, P.; Hruda, M.; Bartáková, A.; Bouda, J.; Vodička, Pavel; Souček, P.; Václavíková, R.

    2016-01-01

    Roč. 35, č. 4 (2016), s. 2159-2170 ISSN 1021-335X R&D Projects: GA MZd(CZ) NT14056; GA MŠk(CZ) LD14050 Institutional support: RVO:68378041 Keywords : epithelial ovarian cancer * ABC transporters * SLC transporters * gene expression * prognosis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.662, year: 2016

  18. Obstacles to Brain Tumor Therapy: Key ABC Transporters

    Directory of Open Access Journals (Sweden)

    Juwina Wijaya

    2017-11-01

    Full Text Available The delivery of cancer chemotherapy to treat brain tumors remains a challenge, in part, because of the inherent biological barrier, the blood–brain barrier. While its presence and role as a protector of the normal brain parenchyma has been acknowledged for decades, it is only recently that the important transporter components, expressed in the tightly knit capillary endothelial cells, have been deciphered. These transporters are ATP-binding cassette (ABC transporters and, so far, the major clinically important ones that functionally contribute to the blood–brain barrier are ABCG2 and ABCB1. A further limitation to cancer therapy of brain tumors or brain metastases is the blood–tumor barrier, where tumors erect a barrier of transporters that further impede drug entry. The expression and regulation of these two transporters at these barriers, as well as tumor derived alteration in expression and/or mutation, are likely obstacles to effective therapy.

  19. Class B Gene Expression and the Modified ABC Model in Nongrass Monocots

    Directory of Open Access Journals (Sweden)

    Akira Kanno

    2007-01-01

    Full Text Available The discovery of the MADS-box genes and the study of model plants such as Arabidopsis thaliana and Antirrhinum majus have greatly improved our understanding of the molecular mechanisms driving the diversity in floral development. The class B genes, which belong to the MADS-box gene family, are important regulators of the development of petals and stamens in flowering plants. Many nongrass monocot flowers have two whorls of petaloid organs, which are called tepals. To explain this floral morphology, the modified ABC model was proposed. This model was exemplified by the tulip, in which expansion and restriction of class B gene expression is linked to the transition of floral morphologies in whorl 1. The expression patterns of class B genes from many monocot species nicely fit this model; however, those from some species, such as asparagus, do not. In this review, we summarize the relationship between class B gene expression and floral morphology in nongrass monocots, such as Liliales (Liliaceae and Asparagales species, and discuss the applicability of the modified ABC model to monocot flowers.

  20. Multidrug ATP-binding cassette transporters are essential for hepatic development of Plasmodium sporozoites

    NARCIS (Netherlands)

    Rijpma, S.R.; Velden, M. van der; Gonzalez-Pons, M.; Annoura, T.; Schaijk, B.C.L. van; Gemert, G.J.A. van; Heuvel, J.M.W. van den; Ramesar, J.; Chevalley-Maurel, S.; Ploemen, I.H.; Khan, S.M.; Franetich, J.F.; Mazier, D.; Wilt, J.H.W. de; Serrano, A.E.; Russel, F.G.; Janse, C.J.; Sauerwein, R.W.; Koenderink, J.B.; Franke-Fayard, B.M.

    2016-01-01

    Multidrug resistance-associated proteins (MRPs) belong to the C-family of ATP-binding cassette (ABC) transport proteins and are known to transport a variety of physiologically important compounds and to be involved in the extrusion of pharmaceuticals. Rodent malaria parasites encode a single ABC

  1. Nucleotide-induced conformational dynamics in ABC transporters from structure-based coarse grained modelling.

    Science.gov (United States)

    Flechsig, Holger

    2016-02-01

    ATP-binding cassette (ABC) transporters are integral membrane proteins which mediate the exchange of diverse substrates across membranes powered by ATP molecules. Our understanding of their activity is still hampered since the conformational dynamics underlying the operation of such proteins cannot yet be resolved in detailed molecular dynamics studies. Here a coarse grained model which allows to mimic binding of nucleotides and follow subsequent conformational motions of full-length transporter structures in computer simulations is proposed and implemented. To justify its explanatory quality, the model is first applied to the maltose transporter system for which multiple conformations are known and we find that the model predictions agree remarkably well with the experimental data. For the MalK subunit the switching from open to the closed dimer configuration upon ATP binding is reproduced and, moreover, for the full-length maltose transporter, progression from inward-facing to the outward-facing state is correctly obtained. For the heme transporter HmuUV, for which only the free structure could yet be determined, the model was then applied to predict nucleotide-induced conformational motions. Upon binding of ATP-mimicking ligands the structure changed from a conformation in which the nucleotide-binding domains formed an open shape, to a conformation in which they were found in tight contact, while, at the same time, a pronounced rotation of the transmembrane domains was observed. This finding is supported by normal mode analysis, and, comparison with structural data of the homologous vitamin B12 transporter BtuCD suggests that the observed rotation mechanism may contribute a common functional aspect for this class of ABC transporters. Although in HmuuV noticeable rearrangement of essential transmembrane helices was detected, there are no indications from our simulations that ATP binding alone may facilitate propagation of substrate molecules in this transporter

  2. Lack of biliary lipid excretion in the little skate, Raja erinacea, indicates the absence of functional Mdr2, Abcg5, and Abcg8 transporters

    NARCIS (Netherlands)

    Elferink, Ronald P. J. Oude; Ottenhoff, Roelof; Fricker, Gert; Seward, David J.; Ballatori, Nazzareno; Boyer, James

    2004-01-01

    The ABC transporters bile salt export pump ( BSEP; encoded by the ABCB11 gene), MDR3 P-glycoprotein (ABCB4), and sterolin 1 and 2 (ABCG5 and ABCG8) are crucial for the excretion of bile salt, phospholipid, and cholesterol, respectively, into the bile of mammals. The current paradigm is that

  3. The multidrug ABC transporter BmrC/BmrD of Bacillus subtilis is regulated via a ribosome-mediated transcriptional attenuation mechanism.

    Science.gov (United States)

    Reilman, Ewoud; Mars, Ruben A T; van Dijl, Jan Maarten; Denham, Emma L

    2014-10-01

    Expression of particular drug transporters in response to antibiotic pressure is a critical element in the development of bacterial multidrug resistance, and represents a serious concern for human health. To obtain a better understanding of underlying regulatory mechanisms, we have dissected the transcriptional activation of the ATP-binding cassette (ABC) transporter BmrC/BmrD of the Gram-positive model bacterium Bacillus subtilis. By using promoter-GFP fusions and live cell array technology, we demonstrate a temporally controlled transcriptional activation of the bmrCD genes in response to antibiotics that target protein synthesis. Intriguingly, bmrCD expression only occurs during the late-exponential and stationary growth stages, irrespective of the timing of the antibiotic challenge. We show that this is due to tight transcriptional control by the transition state regulator AbrB. Moreover, our results show that the bmrCD genes are co-transcribed with bmrB (yheJ), a small open reading frame immediately upstream of bmrC that harbors three alternative stem-loop structures. These stem-loops are apparently crucial for antibiotic-induced bmrCD transcription. Importantly, the antibiotic-induced bmrCD expression requires translation of bmrB, which implies that BmrB serves as a regulatory leader peptide. Altogether, we demonstrate for the first time that a ribosome-mediated transcriptional attenuation mechanism can control the expression of a multidrug ABC transporter. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Influence of detergents on the activity of the ABC transporter LmrA

    NARCIS (Netherlands)

    Infed, Nacera; Hanekop, Nils; Driessen, Arnold J. M.; Smits, Sander H. J.; Schmitt, Lutz

    The ABC transporter LmrA from Lactococcus lactis has been intensively studied and a role in multidrug resistance was proposed. Here, we performed a comprehensive detergent screen to analyze the impact of detergents for a successful solubilization, purification and retention of functional properties

  5. [Cloning and expression analysis of a zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein encoding gene in Dendrobium officinale].

    Science.gov (United States)

    Zhang, Gang; Li, Yi-Min; Li, Biao; Zhang, Da-Wei; Guo, Shun-Xing

    2015-01-01

    The zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein (ZIP) plays an important role in the growth and development of plant. In this study, a full length cDNA of ZIP encoding gene, designed as DoZIP1 (GenBank accession KJ946203), was identified from Dendrobium officinale using RT-PCR and RACE. Bioinformatics analysis showed that DoZIP1 consisted of a 1,056 bp open reading frame (ORF) encoded a 351-aa protein with a molecular weight of 37.57 kDa and an isoelectric point (pI) of 6.09. The deduced DoZIP1 protein contained the conserved ZIP domain, and its secondary structure was composed of 50.71% alpha helix, 11.11% extended strand, 36.18% random coil, and beta turn 1.99%. DoZIP1 protein exhibited a signal peptide and eight transmembrane domains, presumably locating in cell membrane. The amino acid sequence had high homology with ZIP proteins from Arabidopsis, alfalfa and rice. A phylogenetic tree analysis demonstrated that DoZIP1 was closely related to AtZIP10 and OsZIP3, and they were clustered into one clade. Real time quantitative PCR analysis demonstrated that the transcription level of DoZIP1 in D. officinale roots was the highest (4.19 fold higher than that of stems), followed by that of leaves (1.12 fold). Molecular characters of DoZIP1 will be useful for further functional determination of the gene involving in the growth and development of D. officinale.

  6. Transcriptomic profiling to identify genes involved in Fusarium mycotoxin Deoxynivalenol and Zearalenone tolerance in the mycoparasitic fungus Clonostachys rosea

    DEFF Research Database (Denmark)

    Kosawang, Chatchai; Karlsson, Magnus; Jensen, Dan Funck

    2014-01-01

    a number of ATP-Binding Cassette (ABC) transporter transcripts were highly frequent in the ZEA-induced library. Subsequent bioinformatics analysis predicted that all transcripts with similarity to ABC transporters could be ascribed to only 2 ABC transporters genes, and phylogenetic analysis...... of the predicted ABC transporters suggested that they belong to group G (pleiotropic drug transporters) of the fungal ABC transporter gene family. This is the first report suggesting involvement of ABC transporters in ZEA tolerance. Expression patterns of a selected set of DON- and ZEA-induced genes were validated...... and ZEA in the mycoparasitic fungus C. rosea. Whilst metabolic readjustment is potentially the key to withstanding DON, the fungus produces ZHD101 to detoxify ZEA and ABC transporters to transport ZEA or its degradation products out from the fungal cell....

  7. Purification, crystallization and preliminary X-ray diffraction analysis of the putative ABC transporter ATP-binding protein from Thermotoga maritima

    International Nuclear Information System (INIS)

    Ethayathulla, Abdul S.; Bessho, Yoshitaka; Shinkai, Akeo; Padmanabhan, Balasundaram; Singh, Tej P.; Kaur, Punit; Yokoyama, Shigeyuki

    2008-01-01

    The putative ABC transporter ATP-binding protein TM0222 from T. maritima was cloned, overproduced, purified and crystallized. A complete MAD diffraction data set has been collected to 2.3 Å resolution. Adenosine triphosphate (ATP) binding cassette transporters (ABC transporters) are ATP hydrolysis-dependent transmembrane transporters. Here, the overproduction, purification and crystallization of the putative ABC transporter ATP-binding protein TM0222 from Thermotoga maritima are reported. The protein was crystallized in the hexagonal space group P6 4 22, with unit-cell parameters a = b = 148.49, c = 106.96 Å, γ = 120.0°. Assuming the presence of two molecules in the asymmetric unit, the calculated V M is 2.84 Å 3 Da −1 , which corresponds to a solvent content of 56.6%. A three-wavelength MAD data set was collected to 2.3 Å resolution from SeMet-substituted TM0222 crystals. Data sets were collected on the BL38B1 beamline at SPring-8, Japan

  8. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  9. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  10. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  11. Pharmacotherapy in pregnancy; effect of ABC and SLC transporters on drug transport across the placenta and fetal drug exposure.

    Science.gov (United States)

    Staud, Frantisek; Cerveny, Lukas; Ceckova, Martina

    2012-11-01

    Pharmacotherapy during pregnancy is often inevitable for medical treatment of the mother, the fetus or both. The knowledge of drug transport across placenta is, therefore, an important topic to bear in mind when deciding treatment in pregnant women. Several drug transporters of the ABC and SLC families have been discovered in the placenta, such as P-glycoprotein, breast cancer resistance protein, or organic anion/cation transporters. It is thus evident that the passage of drugs across the placenta can no longer be predicted simply on the basis of their physical-chemical properties. Functional expression of placental drug transporters in the trophoblast and the possibility of drug-drug interactions must be considered to optimize pharmacotherapy during pregnancy. In this review we summarize current knowledge on the expression and function of ABC and SLC transporters in the trophoblast. Furthermore, we put this data into context with medical conditions that require maternal and/or fetal treatment during pregnancy, such as gestational diabetes, HIV infection, fetal arrhythmias and epilepsy. Proper understanding of the role of placental transporters should be of great interest not only to clinicians but also to pharmaceutical industry for future drug design and development to control the degree of fetal exposure.

  12. Profiling of ABC transporters ABCB5, ABCF2 and nestin-positive stem cells in nevi, in situ and invasive melanoma.

    Science.gov (United States)

    Setia, Namrata; Abbas, Ossama; Sousa, Yessica; Garb, Jane L; Mahalingam, Meera

    2012-08-01

    Distinct ABCB5 forms and ABCF2, members of the ATP-binding cassette (ABC) superfamily of transporters, are normally expressed in various tissues and cells, and enhanced expression of both has been demonstrated in select cancers. In melanoma cell lines, gene expression profiling of ABC transporters has revealed enhanced expression of melanocyte-specific ABCB5 and ABCF2 proteins. Given this, our primary aim was to ascertain immunohistochemical expression of the ABC transporters ABCB5 and ABCF2 and, the stem cell marker, nestin in a spectrum of benign and malignant nevomelanocytic proliferations, including nevi (n=30), in situ (n=31) and invasive (n=24) primary cutaneous melanomas to assess their role in the stepwise development of malignancy. In addition, their expression was compared with established melanoma prognosticators to ascertain their utility as independent prognosticators. A semiquantitative scoring system was utilized by deriving a cumulative score (based on percentage positivity cells and intensity of expression) and statistical analyses was carried out using analysis of variance with linear contrasts. Mean cumulative score in nevi, in situ and invasive melanoma were as follows: 3.8, 4.4 and 5.3 for ABCB5, respectively (P1, after controlling for the presence of ulceration and mitotic activity, the expression of both proteins did not significantly correlate with known melanoma prognosticators. The gradual increase in the expression of ABCB5 from benign nevus to in situ to invasive melanoma suggests that it plays a role in melanomagenesis. On the basis of our findings, a prospective study with follow-up data is required to ascertain the utility of ABCB5 as a therapeutic target.

  13. A Comprehensive Survey of Sequence Variation in the ABCA4 (ABCR) Gene in Stargardt Disease and Age-Related Macular Degeneration

    OpenAIRE

    Rivera, Andrea; White, Karen; Stöhr, Heidi; Steiner, Klaus; Hemmrich, Nadine; Grimm, Timo; Jurklies, Bernhard; Lorenz, Birgit; Scholl, Hendrik P. N.; Apfelstedt-Sylla, Eckhart; Weber, Bernhard H. F.

    2000-01-01

    Stargardt disease (STGD) is a common autosomal recessive maculopathy of early and young-adult onset and is caused by alterations in the gene encoding the photoreceptor-specific ATP-binding cassette (ABC) transporter (ABCA4). We have studied 144 patients with STGD and 220 unaffected individuals ascertained from the German population, to complete a comprehensive, population-specific survey of the sequence variation in the ABCA4 gene. In addition, we have assessed the proposed role for ABCA4 in ...

  14. Functional expression and characterization of plant ABC transporters in Xenopus laevis oocytes for transport engineering purposes

    DEFF Research Database (Denmark)

    Xu, Deyang; Veres, Dorottya; Belew, Zeinu Mussa

    2016-01-01

    the question whether the oocytes system is suitable to express and characterize ABC transporters. Thus we have selected AtABCG25, previously characterized in insect cells as the exporter of commercially valuable abscisic acid—as case study for optimizing of characterization in Xenopus oocytes. The tools...

  15. Human proton/oligopeptide transporter (POT) genes

    DEFF Research Database (Denmark)

    Botka, C. W.; Wittig, T. W.; Graul, R. C.

    2000-01-01

    The proton-dependent oligopeptide transporters (POT) gene family currently consists of approximately 70 cloned cDNAs derived from diverse organisms. In mammals, two genes encoding peptide transporters, PepT1 and PepT2 have been cloned in several species including humans, in addition to a rat...... histidine/peptide transporter (rPHT1). Because the Candida elegans genome contains five putative POT genes, we searched the available protein and nucleic acid databases for additional mammalian/human POT genes, using iterative BLAST runs and the human expressed sequence tags (EST) database. The apparent...... and introns of the likely human orthologue (termed hPHT2). Northern analyses with EST clones indicated that hPHT1 is primarily expressed in skeletal muscle and spleen, whereas hPHT2 is found in spleen, placenta, lung, leukocytes, and heart. These results suggest considerable complexity of the human POT gene...

  16. The Down regulated in Adenoma (dra) gene encodes an intestine-specific membrane sulfate transport protein.

    Science.gov (United States)

    Silberg, D G; Wang, W; Moseley, R H; Traber, P G

    1995-05-19

    A gene has been described, Down Regulated in Adenoma (dra), which is expressed in normal colon but is absent in the majority of colon adenomas and adenocarcinomas. However, the function of this protein is unknown. Because of sequence similarity to a recently cloned membrane sulfate transporter in rat liver, the transport function of Dra was examined. We established that dra encodes for a Na(+)-independent transporter for both sulfate and oxalate using microinjected Xenopus oocytes as an assay system. Sulfate transport was sensitive to the anion exchange inhibitor DIDS (4,4'-diisothiocyano-2,2' disulfonic acid stilbene). Using an RNase protection assay, we found that dra mRNA expression is limited to the small intestine and colon in mouse, therefore identifying Dra as an intestine-specific sulfate transporter. dra also had a unique pattern of expression during intestinal development. Northern blot analysis revealed a low level of expression in colon at birth with a marked increase in the first 2 postnatal weeks. In contrast, there was a lower, constant level of expression in small intestine in the postnatal period. Caco-2 cells, a colon carcinoma cell line that differentiates over time in culture, demonstrated a marked induction of dra mRNA as cells progressed from the preconfluent (undifferentiated) to the postconfluent (differentiated) state. These results show that Dra is an intestine-specific Na(+)-independent sulfate transporter that has differential expression during colonic development. This functional characterization provides the foundation for investigation of the role of Dra in intestinal sulfate transport and in the malignant phenotype.

  17. Heterotopic expression of class B floral homeotic genes supports a modified ABC model for tulip (Tulipa gesneriana).

    Science.gov (United States)

    Kanno, Akira; Saeki, Hiroshi; Kameya, Toshiaki; Saedler, Heinz; Theissen, Günter

    2003-07-01

    In higher eudicotyledonous angiosperms the floral organs are typically arranged in four different whorls, containing sepals, petals, stamens and carpels. According to the ABC model, the identity of these organs is specified by floral homeotic genes of class A, A+B, B+C and C, respectively. In contrast to the sepal and petal whorls of eudicots, the perianths of many plants from the Liliaceae family have two outer whorls of almost identical petaloid organs, called tepals. To explain the Liliaceae flower morphology, van Tunen et al. (1993) proposed a modified ABC model, exemplified with tulip. According to this model, class B genes are not only expressed in whorls 2 and 3, but also in whorl 1. Thus the organs of both whorls 1 and 2 express class A plus class B genes and, therefore, get the same petaloid identity. To test this modified ABC model we have cloned and characterized putative class B genes from tulip. Two DEF- and one GLO-like gene were identified, named TGDEFA, TGDEFB and TGGLO. Northern hybridization analysis showed that all of these genes are expressed in whorls 1, 2 and 3 (outer and inner tepals and stamens), thus corroborating the modified ABC model. In addition, these experiments demonstrated that TGGLO is also weakly expressed in carpels, leaves, stems and bracts. Gel retardation assays revealed that TGGLO alone binds to DNA as a homodimer. In contrast, TGDEFA and TGDEFB cannot homodimerize, but make heterodimers with PI. Homodimerization of GLO-like protein has also been reported for lily, suggesting that this phenomenon is conserved within Liliaceae plants or even monocot species.

  18. Ligand Binding and Crystal Structures of the Substrate-Binding Domain of the ABC Transporter OpuA

    NARCIS (Netherlands)

    Wolters, Justina C.; Berntsson, Ronnie P-A.; Gul, Nadia; Karasawa, Akira; Thunnissen, Andy-Mark W. H.; Slotboom, Dirk-Jan; Poolman, Bert

    2010-01-01

    The ABC transporter OpuA from Lactococcus lactis transports glycine betaine upon activation by threshold values of ionic strength. In this study, the ligand binding characteristics of purified OpuA in a detergent-solubilized state and of its substrate-binding domain produced as soluble protein

  19. Insect Resistance to Bacillus thuringiensis Toxin Cry2Ab Is Conferred by Mutations in an ABC Transporter Subfamily A Protein.

    Directory of Open Access Journals (Sweden)

    Wee Tek Tay

    2015-11-01

    Full Text Available The use of conventional chemical insecticides and bacterial toxins to control lepidopteran pests of global agriculture has imposed significant selection pressure leading to the rapid evolution of insecticide resistance. Transgenic crops (e.g., cotton expressing the Bt Cry toxins are now used world wide to control these pests, including the highly polyphagous and invasive cotton bollworm Helicoverpa armigera. Since 2004, the Cry2Ab toxin has become widely used for controlling H. armigera, often used in combination with Cry1Ac to delay resistance evolution. Isolation of H. armigera and H. punctigera individuals heterozygous for Cry2Ab resistance in 2002 and 2004, respectively, allowed aspects of Cry2Ab resistance (level, fitness costs, genetic dominance, complementation tests to be characterised in both species. However, the gene identity and genetic changes conferring this resistance were unknown, as was the detailed Cry2Ab mode of action. No cross-resistance to Cry1Ac was observed in mutant lines. Biphasic linkage analysis of a Cry2Ab-resistant H. armigera family followed by exon-primed intron-crossing (EPIC marker mapping and candidate gene sequencing identified three independent resistance-associated INDEL mutations in an ATP-Binding Cassette (ABC transporter gene we named HaABCA2. A deletion mutation was also identified in the H. punctigera homolog from the resistant line. All mutations truncate the ABCA2 protein. Isolation of further Cry2Ab resistance alleles in the same gene from field H. armigera populations indicates unequal resistance allele frequencies and the potential for Bt resistance evolution. Identification of the gene involved in resistance as an ABC transporter of the A subfamily adds to the body of evidence on the crucial role this gene family plays in the mode of action of the Bt Cry toxins. The structural differences between the ABCA2, and that of the C subfamily required for Cry1Ac toxicity, indicate differences in the

  20. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

    Science.gov (United States)

    Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

    2015-04-01

    Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

  1. Salinomycin overcomes ABC transporter-mediated multidrug and apoptosis resistance in human leukemia stem cell-like KG-1a cells

    International Nuclear Information System (INIS)

    Fuchs, Dominik; Daniel, Volker; Sadeghi, Mahmoud; Opelz, Gerhard; Naujokat, Cord

    2010-01-01

    Leukemia stem cells are known to exhibit multidrug resistance by expression of ATP-binding cassette (ABC) transporters which constitute transmembrane proteins capable of exporting a wide variety of chemotherapeutic drugs from the cytosol. We show here that human promyeloblastic leukemia KG-1a cells exposed to the histone deacetylase inhibitor phenylbutyrate resemble many characteristics of leukemia stem cells, including expression of functional ABC transporters such as P-glycoprotein, BCRP and MRP8. Consequently, KG-1a cells display resistance to the induction of apoptosis by various chemotherapeutic drugs. Resistance to apoptosis induction by chemotherapeutic drugs can be reversed by cyclosporine A, which effectively inhibits the activity of P-glycoprotein and BCRP, thus demonstrating ABC transporter-mediated drug resistance in KG-1a cells. However, KG-1a are highly sensitive to apoptosis induction by salinomycin, a polyether ionophore antibiotic that has recently been shown to kill human breast cancer stem cell-like cells and to induce apoptosis in human cancer cells displaying multiple mechanisms of drug and apoptosis resistance. Whereas KG-1a cells can be adapted to proliferate in the presence of apoptosis-inducing concentrations of bortezomib and doxorubicin, salinomycin does not permit long-term adaptation of the cells to apoptosis-inducing concentrations. Thus, salinomycin should be regarded as a novel and effective agent for the elimination of leukemia stem cells and other tumor cells exhibiting ABC transporter-mediated multidrug resistance.

  2. Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme.

    Science.gov (United States)

    Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M

    1999-07-01

    The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.

  3. IMG-ABC: An Atlas of Biosynthetic Gene Clusters to Fuel the Discovery of Novel Secondary Metabolites

    Energy Technology Data Exchange (ETDEWEB)

    Chen, I-Min; Chu, Ken; Ratner, Anna; Palaniappan, Krishna; Huang, Jinghua; Reddy, T. B.K.; Cimermancic, Peter; Fischbach, Michael; Ivanova, Natalia; Markowitz, Victor; Kyrpides, Nikos; Pati, Amrita

    2014-10-28

    In the discovery of secondary metabolites (SMs), large-scale analysis of sequence data is a promising exploration path that remains largely underutilized due to the lack of relevant computational resources. We present IMG-ABC (https://img.jgi.doe.gov/abc/) -- An Atlas of Biosynthetic gene Clusters within the Integrated Microbial Genomes (IMG) system1. IMG-ABC is a rich repository of both validated and predicted biosynthetic clusters (BCs) in cultured isolates, single-cells and metagenomes linked with the SM chemicals they produce and enhanced with focused analysis tools within IMG. The underlying scalable framework enables traversal of phylogenetic dark matter and chemical structure space -- serving as a doorway to a new era in the discovery of novel molecules.

  4. Novel Mutation in the ATP-Binding Cassette Transporter A3 (ABCA3) Encoding Gene Causes Respiratory Distress Syndrome in A Term Newborn in Southwest Iran

    Science.gov (United States)

    Rezaei, Farideh; Shafiei, Mohammad; Shariati, Gholamreza; Dehdashtian, Ali; Mohebbi, Maryam; Galehdari, Hamid

    2016-01-01

    Introduction ABCA3 glycoprotein belongs to the ATP-binding cassette (ABC) superfamily of transporters, which utilize the energy derived from hydrolysis of ATP for the translocation of a wide variety of substrates across the plasma membrane. Mutations in the ABCA3 gene are knowingly causative for fatal surfactant deficiency, particularly respiratory distress syndrome (RDS) in term babies. Case Presentation In this study, Sanger sequencing of the whole ABCA3 gene (NCBI NM_001089) was performed in a neonatal boy with severe RDS. A homozygous mutation has been identified in the patient. Parents were heterozygous for the same missense mutation GGA > AGA at position 202 in exon 6 of the ABCA3 gene (c.604G > A; p.G202R). Furthermore, 70 normal individuals have been analyzed for the mentioned change with negative results. Conclusions Regarding Human Genome Mutation Database (HGMD) and other literature recherche, the detected change is a novel mutation and has not been reported before. Bioinformatics mutation predicting tools prefer it as pathogenic. PMID:27437095

  5. ATP-induced conformational changes of nucleotide-binding domains in an ABC transporter. Importance of the water-mediated entropic force.

    Science.gov (United States)

    Hayashi, Tomohiko; Chiba, Shuntaro; Kaneta, Yusuke; Furuta, Tadaomi; Sakurai, Minoru

    2014-11-06

    ATP binding cassette (ABC) proteins belong to a superfamily of active transporters. Recent experimental and computational studies have shown that binding of ATP to the nucleotide binding domains (NBDs) of ABC proteins drives the dimerization of NBDs, which, in turn, causes large conformational changes within the transmembrane domains (TMDs). To elucidate the active substrate transport mechanism of ABC proteins, it is first necessary to understand how the NBD dimerization is driven by ATP binding. In this study, we selected MalKs (NBDs of a maltose transporter) as a representative NBD and calculated the free-energy change upon dimerization using molecular mechanics calculations combined with a statistical thermodynamic theory of liquids, as well as a method to calculate the translational, rotational, and vibrational entropy change. This combined method is applied to a large number of snapshot structures obtained from molecular dynamics simulations containing explicit water molecules. The results suggest that the NBD dimerization proceeds with a large gain of water entropy when ATP molecules bind to the NBDs. The energetic gain arising from direct NBD-NBD interactions is canceled by the dehydration penalty and the configurational-entropy loss. ATP hydrolysis induces a loss of the shape complementarity between the NBDs, which leads to the dissociation of the dimer, due to a decrease in the water-entropy gain and an increase in the configurational-entropy loss. This interpretation of the NBD dimerization mechanism in concert with ATP, especially focused on the water-mediated entropy force, is potentially applicable to a wide variety of the ABC transporters.

  6. Gene Cluster Responsible for Secretion of and Immunity to Multiple Bacteriocins, the NKR-5-3 Enterocins

    Science.gov (United States)

    Ishibashi, Naoki; Himeno, Kohei; Masuda, Yoshimitsu; Perez, Rodney Honrada; Iwatani, Shun; Wilaipun, Pongtep; Leelawatcharamas, Vichien; Nakayama, Jiro; Sonomoto, Kenji

    2014-01-01

    Enterococcus faecium NKR-5-3, isolated from Thai fermented fish, is characterized by the unique ability to produce five bacteriocins, namely, enterocins NKR-5-3A, -B, -C, -D, and -Z (Ent53A, Ent53B, Ent53C, Ent53D, and Ent53Z). Genetic analysis with a genome library revealed that the bacteriocin structural genes (enkA [ent53A], enkC [ent53C], enkD [ent53D], and enkZ [ent53Z]) that encode these peptides (except for Ent53B) are located in close proximity to each other. This NKR-5-3ACDZ (Ent53ACDZ) enterocin gene cluster (approximately 13 kb long) includes certain bacteriocin biosynthetic genes such as an ABC transporter gene (enkT), two immunity genes (enkIaz and enkIc), a response regulator (enkR), and a histidine protein kinase (enkK). Heterologous-expression studies of enkT and ΔenkT mutant strains showed that enkT is responsible for the secretion of Ent53A, Ent53C, Ent53D, and Ent53Z, suggesting that EnkT is a wide-range ABC transporter that contributes to the effective production of these bacteriocins. In addition, EnkIaz and EnkIc were found to confer self-immunity to the respective bacteriocins. Furthermore, bacteriocin induction assays performed with the ΔenkRK mutant strain showed that EnkR and EnkK are regulatory proteins responsible for bacteriocin production and that, together with Ent53D, they constitute a three-component regulatory system. Thus, the Ent53ACDZ gene cluster is essential for the biosynthesis and regulation of NKR-5-3 enterocins, and this is, to our knowledge, the first report that demonstrates the secretion of multiple bacteriocins by an ABC transporter. PMID:25149515

  7. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

    Science.gov (United States)

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

    1999-01-01

    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

  8. Alternative protein secretion: The Mam1 ABC transporter supports secretion of M-factor linked GFP in fission yeast

    International Nuclear Information System (INIS)

    Kjaerulff, Soren; Mueller, Sven; Jensen, Martin Roland

    2005-01-01

    To examine whether the fission yeast Mam1 ABC transporter can be used for secretion of heterologous proteins, thereby bypassing the classical secretion pathway, we have analyzed chimeric forms of the M-factor precursor. It was demonstrated that GFP can be exported when fused to both the amino-terminal prosequence from mfm1 and a CaaX motif. This secretion was dependent on the Mam1 transporter and not the classical secretion pathway. The secretion efficiency of GFP, however, was relatively low and most of the reporter protein was trapped in the vacuolar membranes. Our findings suggest that the Mam1 ABC protein is a promiscuous peptide transporter that can accommodate globular proteins of a relatively large size. Furthermore, our results help in defining the sequences required for processing and secretion of natural M-factor

  9. Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120

    Directory of Open Access Journals (Sweden)

    Rafael Pernil

    2015-04-01

    Full Text Available Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion.

  10. Active transmembrane drug transport in microgravity: a validation study using an ABC transporter model [v1; ref status: indexed, http://f1000r.es/41n

    Directory of Open Access Journals (Sweden)

    Sergi Vaquer

    2014-08-01

    Full Text Available Abstract Microgravity has been shown to influence the expression of ABC (ATP-Binding Cassette transporters in bacteria, fungi and mammals, but also to modify the activity of certain cellular components with structural and functional similarities to ABC transporters. Changes in activity of ABC transporters could lead to important metabolic disorders and undesired pharmacological effects during spaceflights. However, no current means exist to study the functionality of these transporters in microgravity. To this end, a Vesicular Transport Assay® (Solvo Biotechnology, Hungary was adapted to evaluate multi-drug resistance-associated protein 2 (MRP2 trans-membrane estradiol-17-β-glucuronide (E17βG transport activity, when activated by adenosine-tri-phosphate (ATP during parabolic flights. Simple diffusion, ATP-independent transport and benzbromarone inhibition were also evaluated. A high accuracy engineering system was designed to perform, monitor and synchronize all procedures. Samples were analysed using a validated high sensitivity drug detection protocol. Experiments were performed in microgravity during parabolic flights, and compared to 1g on ground results using identical equipment and procedures in all cases. Our results revealed that sufficient equipment accuracy and analytical sensitivity were reached to detect transport activity in both gravitational conditions. Additionally, transport activity levels of on ground samples were within commercial transport standards, proving the validity of the methods and equipment used. MRP2 net transport activity was significantly reduced in microgravity, so was signal detected in simple diffusion samples. Ultra-structural changes induced by gravitational stress upon vesicle membranes or transporters could explain the current results, although alternative explanations are possible. Further research is needed to provide a conclusive answer in this regard. Nevertheless, the present validated technology

  11. Lateral gene transfer of an ABC transporter complex between major constituents of the human gut microbiome

    Directory of Open Access Journals (Sweden)

    Meehan Conor J

    2012-11-01

    Full Text Available Abstract Background Several links have been established between the human gut microbiome and conditions such as obesity and inflammatory bowel syndrome. This highlights the importance of understanding what properties of the gut microbiome can affect the health of the human host. Studies have been undertaken to determine the species composition of this microbiome and infer functional profiles associated with such host properties. However, lateral gene transfer (LGT between community members may result in misleading taxonomic attributions for the recipient organisms, thus making species-function links difficult to establish. Results We identified a peptides/nickel transport complex whose components differed in abundance based upon levels of host obesity, and assigned the encoded proteins to members of the microbial community. Each protein was assigned to several distinct taxonomic groups, with moderate levels of agreement observed among different proteins in the complex. Phylogenetic trees of these proteins produced clusters that differed greatly from taxonomic attributions and indicated that habitat-directed LGT of this complex is likely to have occurred, though not always between the same partners. Conclusions These findings demonstrate that certain membrane transport systems may be an important factor within an obese-associated gut microbiome and that such complexes may be acquired several times by different strains of the same species. Additionally, an example of individual proteins from different organisms being transferred into one operon was observed, potentially demonstrating a functional complex despite the donors of the subunits being taxonomically disparate. Our results also highlight the potential impact of habitat-directed LGT on the resident microbiota.

  12. Trafficking and processing of bacterial proteins by mammalian cells: Insights from chondroitinase ABC.

    Science.gov (United States)

    Muir, Elizabeth; Raza, Mansoor; Ellis, Clare; Burnside, Emily; Love, Fiona; Heller, Simon; Elliot, Matthew; Daniell, Esther; Dasgupta, Debayan; Alves, Nuno; Day, Priscilla; Fawcett, James; Keynes, Roger

    2017-01-01

    There is very little reported in the literature about the relationship between modifications of bacterial proteins and their secretion by mammalian cells that synthesize them. We previously reported that the secretion of the bacterial enzyme Chondroitinase ABC by mammalian cells requires the strategic removal of at least three N-glycosylation sites. The aim of this study was to determine if it is possible to enhance the efficacy of the enzyme as a treatment for spinal cord injury by increasing the quantity of enzyme secreted or by altering its cellular location. To determine if the efficiency of enzyme secretion could be further increased, cells were transfected with constructs encoding the gene for chondroitinase ABC modified for expression by mammalian cells; these contained additional modifications of strategic N-glycosylation sites or alternative signal sequences to direct secretion of the enzyme from the cells. We show that while removal of certain specific N-glycosylation sites enhances enzyme secretion, N-glycosylation of at least two other sites, N-856 and N-773, is essential for both production and secretion of active enzyme. Furthermore, we find that the signal sequence directing secretion also influences the quantity of enzyme secreted, and that this varies widely amongst the cell types tested. Last, we find that replacing the 3'UTR on the cDNA encoding Chondroitinase ABC with that of β-actin is sufficient to target the enzyme to the neuronal growth cone when transfected into neurons. This also enhances neurite outgrowth on an inhibitory substrate. Some intracellular trafficking pathways are adversely affected by cryptic signals present in the bacterial gene sequence, whilst unexpectedly others are required for efficient secretion of the enzyme. Furthermore, targeting chondroitinase to the neuronal growth cone promotes its ability to increase neurite outgrowth on an inhibitory substrate. These findings are timely in view of the renewed prospects for

  13. Trafficking and processing of bacterial proteins by mammalian cells: Insights from chondroitinase ABC.

    Directory of Open Access Journals (Sweden)

    Elizabeth Muir

    Full Text Available There is very little reported in the literature about the relationship between modifications of bacterial proteins and their secretion by mammalian cells that synthesize them. We previously reported that the secretion of the bacterial enzyme Chondroitinase ABC by mammalian cells requires the strategic removal of at least three N-glycosylation sites. The aim of this study was to determine if it is possible to enhance the efficacy of the enzyme as a treatment for spinal cord injury by increasing the quantity of enzyme secreted or by altering its cellular location.To determine if the efficiency of enzyme secretion could be further increased, cells were transfected with constructs encoding the gene for chondroitinase ABC modified for expression by mammalian cells; these contained additional modifications of strategic N-glycosylation sites or alternative signal sequences to direct secretion of the enzyme from the cells. We show that while removal of certain specific N-glycosylation sites enhances enzyme secretion, N-glycosylation of at least two other sites, N-856 and N-773, is essential for both production and secretion of active enzyme. Furthermore, we find that the signal sequence directing secretion also influences the quantity of enzyme secreted, and that this varies widely amongst the cell types tested. Last, we find that replacing the 3'UTR on the cDNA encoding Chondroitinase ABC with that of β-actin is sufficient to target the enzyme to the neuronal growth cone when transfected into neurons. This also enhances neurite outgrowth on an inhibitory substrate.Some intracellular trafficking pathways are adversely affected by cryptic signals present in the bacterial gene sequence, whilst unexpectedly others are required for efficient secretion of the enzyme. Furthermore, targeting chondroitinase to the neuronal growth cone promotes its ability to increase neurite outgrowth on an inhibitory substrate. These findings are timely in view of the renewed

  14. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  15. Expression Profile of Drug and Nutrient Absorption Related Genes in Madin-Darby Canine Kidney (MDCK Cells Grown under Differentiation Conditions

    Directory of Open Access Journals (Sweden)

    Balvinder S. Vig

    2012-06-01

    Full Text Available The expression levels of genes involved in drug and nutrient absorption were evaluated in the Madin-Darby Canine Kidney (MDCK in vitro drug absorption model. MDCK cells were grown on plastic surfaces (for 3 days or on Transwell® membranes (for 3, 5, 7, and 9 days. The expression profile of genes including ABC transporters, SLC transporters, and cytochrome P450 (CYP enzymes was determined using the Affymetrix® Canine GeneChip®. Expression of genes whose probe sets passed a stringent confirmation process was examined. Expression of a few transporter (MDR1, PEPT1 and PEPT2 genes in MDCK cells was confirmed by RT-PCR. The overall gene expression profile was strongly influenced by the type of support the cells were grown on. After 3 days of growth, expression of 28% of the genes was statistically different (1.5-fold cutoff, p < 0.05 between the cells grown on plastic and Transwell® membranes. When cells were differentiated on Transwell® membranes, large changes in gene expression profile were observed during the early stages, which then stabilized after 5–7 days. Only a small number of genes encoding drug absorption related SLC, ABC, and CYP were detected in MDCK cells, and most of them exhibited low hybridization signals. Results from this study provide valuable reference information on endogenous gene expression in MDCK cells that could assist in design of drug-transporter and/or drug-enzyme interaction studies, and help interpret the contributions of various transporters and metabolic enzymes in studies with MDCK cells.

  16. Global regulation of gene expression by the MafR protein of Enterococcus faecalis

    Directory of Open Access Journals (Sweden)

    Sofía eRuiz-Cruz

    2016-01-01

    Full Text Available Enterococcus faecalis is a natural inhabitant of the human gastrointestinal tract. However, as an opportunistic pathogen, it is able to colonize other host niches and cause life-threatening infections. Its adaptation to new environments involves global changes in gene expression. The EF3013 gene (here named mafR of E. faecalis strain V583 encodes a protein (MafR, 482 residues that has sequence similarity to global response regulators of the Mga/AtxA family. The enterococcal OG1RF genome also encodes the MafR protein (gene OG1RF_12293. In this work, we have identified the promoter of the mafR gene using several in vivo approaches. Moreover, we show that MafR influences positively the transcription of many genes on a genome-wide scale. The most significant target genes encode components of PTS-type membrane transporters, components of ABC-type membrane transporters, and proteins involved in the metabolism of carbon sources. Some of these genes were previously reported to be up-regulated during the growth of E. faecalis in blood and/or in human urine. Furthermore, we show that a mafR deletion mutant strain induces a significant lower degree of inflammation in the peritoneal cavity of mice, suggesting that enterococcal cells deficient in MafR are less virulent. Our work indicates that MafR is a global transcriptional regulator. It might facilitate the adaptation of E. faecalis to particular host niches and, therefore, contribute to its potential virulence.

  17. ABCA Transporter Gene Expression and Poor Outcome in Epithelial Ovarian Cancer

    DEFF Research Database (Denmark)

    Hedditch, Ellen L; Gao, Bo; Russell, Amanda J

    2014-01-01

    -wide association study. Impact of short interfering RNA-mediated gene suppression was determined by colony forming and migration assays. Association with survival was assessed with Kaplan-Meier analysis and log-rank tests. All statistical tests were two-sided. RESULTS: Associations with outcome were observed...... with ABC transporters of the "A" subfamily, but not with multidrug transporters. High-level expression of ABCA1, ABCA6, ABCA8, and ABCA9 in primary tumors was statistically significantly associated with reduced survival in serous ovarian cancer patients. Low levels of ABCA5 and the C-allele of rs536009...... ABCA1, ABCA5 and ABCA9 gene expression = 33.2 months, 95% CI = 26.4 to 40.1; vs 55.3 months in the group with favorable ABCA gene expression, 95% CI = 49.8 to 60.8; P = .001), independently of tumor stage or surgical debulking status. Suppression of cholesterol transporter ABCA1 inhibited ovarian...

  18. Simulation of the coupling between nucleotide binding and transmembrane domains in the ABC transporter BtuCD

    DEFF Research Database (Denmark)

    Sonne, Jacob; Kandt, C.; Peters, Günther H.j.

    2007-01-01

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B12 importer BtuCD using perturbed elastic network calculations and biased molecular...

  19. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  20. Polymorphisms in ATP-binding cassette transporter genes and interaction with diet and life style factors in relation to colorectal cancer in a Danish prospective case-cohort study

    DEFF Research Database (Denmark)

    Kopp, Tine Iskov; Andersen, Vibeke; Tjonneland, Anne

    2015-01-01

    to assess whether polymorphisms in ABCB1, ABCC2 and ABCG2 were associated with risk of colorectal cancer (CRC) and to investigate gene-environment (dietary factors, smoking and use of non-steroidal anti-inflammatory drugs) and gene-gene interactions between previously studied polymorphisms in IL1B and IL10......The ATP-binding cassette (ABC) transporter family transports various molecules across the enterocytes in the gut protecting the intestine against potentially harmful substances. Moreover, ABC transporters are involved in mucosal immune defence through interaction with cytokines. The study aimed...... of the polymorphisms were associated with CRC, but ABCB1 and ABCG2 haplotypes were associated with risk of CRC. ABCB1/rs1045642 interacted with intake of cereals and fiber (p-Value for interaction (Pint) = 0.001 and 0.01, respectively). In a three-way analysis, both ABCB1/rs1045642 and ABCG2/rs2231137 in combination...

  1. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    Science.gov (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

    1996-01-01

    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  2. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  3. Chromosomal localization of the human vesicular amine transporter genes

    Energy Technology Data Exchange (ETDEWEB)

    Peter, D.; Finn, P.; Liu, Y.; Roghani, A.; Edwards, R.H.; Klisak, I.; Kojis, T.; Heinzmann, C.; Sparkes, R.S. (UCLA School of Medicine, Los Angeles, CA (United States))

    1993-12-01

    The physiologic and behavioral effects of pharmacologic agents that interfere with the transport of monoamine neurotransmitters into vesicles suggest that vesicular amine transport may contribute to human neuropsychiatric disease. To determine whether an alteration in the genes that encode vesicular amine transport contributes to the inherited component of these disorders, the authors have isolated a human cDNA for the brain transporter and localized the human vesciular amine transporter genes. The human brain synaptic vesicle amine transporter (SVAT) shows unexpected conservation with rat SVAT in the regions that diverge extensively between rat SVAT and the rat adrenal chromaffin granule amine transporter (CGAT). Using the cloned sequences with a panel of mouse-human hybrids and in situ hybridization for regional localization, the adrenal CGAT gene (or VAT1) maps to human chromosome 8p21.3 and the brain SVAT gene (or VAT2) maps to chromosome 10q25. Both of these sites occur very close to if not within previously described deletions that produce severe but viable phenotypes. 26 refs., 3 figs., 1 tab.

  4. Structural Diversification of Lyngbyatoxin A by Host-Dependent Heterologous Expression of the tleABC Biosynthetic Gene Cluster.

    Science.gov (United States)

    Zhang, Lihan; Hoshino, Shotaro; Awakawa, Takayoshi; Wakimoto, Toshiyuki; Abe, Ikuro

    2016-08-03

    Natural products have enormous structural diversity, yet little is known about how such diversity is achieved in nature. Here we report the structural diversification of a cyanotoxin-lyngbyatoxin A-and its biosynthetic intermediates by heterologous expression of the Streptomyces-derived tleABC biosynthetic gene cluster in three different Streptomyces hosts: S. lividans, S. albus, and S. avermitilis. Notably, the isolated lyngbyatoxin derivatives, including four new natural products, were biosynthesized by crosstalk between the heterologous tleABC gene cluster and the endogenous host enzymes. The simple strategy described here has expanded the structural diversity of lyngbyatoxin A and its biosynthetic intermediates, and provides opportunities for investigation of the currently underestimated hidden biosynthetic crosstalk. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Mutations in sit B and sit D genes affect manganese-growth requirements in Sinorhizobium meliloti.

    Science.gov (United States)

    Platero, Raúl A; Jaureguy, Melina; Battistoni, Federico J; Fabiano, Elena R

    2003-01-21

    Two transposon-induced mutants of Sinorhizobium meliloti 242 were isolated based on their inability to grow on rich medium supplemented with the metal chelator ethylenediamine di-o-hydroxyphenylacetic acid (EDDHA) and either heme-compounds or siderophores as iron sources. Tagged loci of these mutants were identified as sit B and sit D genes. These genes encode components of an ABC (ATP-binding cassette) metal-type permease in several Gram-negative bacteria. In this work, the phenotypes of these two mutants were compared with those of two siderophore-mediated iron transport mutants. The results strongly implicate a role of the sit genes in manganese acquisition when this metal is limiting in S. meliloti.

  6. Staggering in the cleavage pattern of E. coli ABC-excinuclease

    International Nuclear Information System (INIS)

    Myles, G.M.; Van Houten, B.; Sancar, A.

    1986-01-01

    E. coli ABC excinuclease is a complex of three proteins encoded by the uvrA, uvrB, and uvrC genes. The enzyme repairs DNA mono and diadducts by the single strand cleavage of DNA eight phosphodiester bond 5' and four or five phosphodiester bonds 3' to a DNA lesion and facilitates the removal of the resulting twelve or thirteen nucleotide fragment. In this study, the authors have investigated the excision pattern for ultraviolet (UV) induced diadducts, i.e. cyclobutane pyrimidine dimers and pyrimidine-pyrimidone (6-4) photoproducts. Terminally (5' or 3') labeled DNA was irradiated with 254nm UV and treated with ABC excinuclease before and after photoreactivation of cyclobutane dimers by E. coli DNA photolyase. In this way, the authors were able to differentiate between the cleavage pattern of pyrimidine dimers and of (6-4) photoproducts. Their results show that certain TT cyclobutane dimers and rare TT (6-4) photoproducts are excised by cleavage seven and, less frequently, six phosphodiester bonds to the 5' side of the DNA lesion in addition to the primary cutting site at the eight 5' phosphodiester bond. The 3' cleavage sites are maintained at the fourth and fifth phosphodiester bonds for the these UV induced lesions. These data indicate that the cleavage pattern of the ABC excinuclease may be dependent upon both the type of DNA lesion as well as it surrounding nucleotide sequence. In addition, the authors analysis shows that (6-4) photoproducts are much better substrates for ABC excinuclease than are pyrimidine dimers

  7. ABC-Transporter Expression Does Not Correlate with Response to Irinotecan in Patients with Metastatic Colorectal Cancer

    NARCIS (Netherlands)

    Trumpi, K.; Emmink, B. L.; Prins, A. M.; van Oijen, M. G. H.; van Diest, P. J.; Punt, C. J. A.; Koopman, M.; Kranenburg, O.; Borel Rinkes, I. H. M.

    2015-01-01

    Background: Active efflux of irinotecan by ATP-binding cassette (ABC)-transporters, in particular ABCB1 and ABCG2, is a well-established drug resistance mechanism in vitro and in pre-clinical mouse models, but its relevance in colorectal cancer (CRC) patients is unknown. Therefore, we assessed the

  8. Diversity and evolution of ABC proteins in basidiomycetes.

    Science.gov (United States)

    Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O

    2013-01-01

    ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.

  9. Osabc1k8, an abc1-like kinase gene, mediates abscisic acid sensitivity and dehydration tolerance response in rice seedlings

    International Nuclear Information System (INIS)

    Liu, Y.; Li, T.; Yang, C.

    2015-01-01

    The activity of bc1 complex kinase (ABC1K) protein family, which widely exists in prokaryotes and eukaryotes, consists of 15 members in rice, and the role of this family in plants has not yet been studied in details. In this study, a novel function of OsABC1K8 (LOC-Os06g48770), a member of rice ABC1K family, was characterized. The transcript level of OsABC1K8 changes in response to salt, dehydration, cold, PEG, oxidative (H/sub 2/O/sub 2/) stresses, or abscisic acid (ABA) treatment. Overexpression of OsABC1K8 significantly increased sensitivity to dehydration and reduced sensitivity to ABA. In the contrast, RNAi transgenic lines displayed significantly reduced sensitivity to dehydration stress and increased sensitivity to ABA. Furthermore, the transcriptional levels of several ABA/stress-regulated responsive genes were suppressed in OsABC1K8 over-expressing plants under dehydration stress. In conclusion, our results suggested that OsABC1K8 is a negative regulator in response to dehydration stress through an ABA-dependent pathway. (author)

  10. Transcriptome Analysis to Identify the Putative Biosynthesis and Transport Genes Associated with the Medicinal Components of Achyranthes bidentata Bl.

    Directory of Open Access Journals (Sweden)

    Jinting Li

    2016-12-01

    Full Text Available Achyranthes bidentata is a popular perennial medicine herb used for thousands of years in China to treat various diseases. Although this herb has multiple pharmaceutical purposes in China, no transcriptomic information has been reported for this species. In addition, the understanding of several key pathways and enzymes involved in the biosynthesis of oleanolic acid and ecdysterone, two pharmacologically active classes of metabolites and major chemical constituents of A. bidentata root extracts, is limited. The aim of the present study was to characterize the transcriptome profile of the roots and leaves of A. bidentata to uncover the biosynthetic and transport mechanisms of the active components. In this study, we identified 100,987 transcripts, with an average length of 973.64 base pairs. A total of 31,634 (31.33% unigenes were annotated, and 12,762 unigenes were mapped to 303 pathways according to the Kyoto Encyclopedia of Genes and Genomes (KEGG pathway database. Moreover, we identified a total of 260 oleanolic acid and ecdysterone genes encoding biosynthetic enzymes. Furthermore, the key enzymes involved in the oleanolic acid and ecdysterone synthesis pathways were analyzed using quantitative real-time polymerase chain reaction (qRT-PCR, revealing that the roots expressed these enzymes to a greater extent than the leaves. In addition, we identified 85 ATP-binding cassette (ABC transporters, some of which might be involved in the translocation of secondary metabolites.

  11. Engineering of Ion Sensing by the Cystathionine beta-Synthase Module of the ABC Transporter OpuA

    NARCIS (Netherlands)

    Mahmood, Nik A. B. N.; Biemans-Oldehinkel, Esther; Poolman, Bert

    2009-01-01

    We have previously shown that the C-terminal cystathionine beta-synthase (CBS) domains of the nucleotide-binding domains of the ABC transporter OpuA, in conjunction with an anionic membrane surface function, act as sensor of internal ionic strength (I(in)). Here, we show that a surface-exposed

  12. Multidrug ATP-binding cassette transporters are essential for hepatic development of Plasmodium sporozoites.

    Science.gov (United States)

    Rijpma, Sanna R; van der Velden, Maarten; González-Pons, Maria; Annoura, Takeshi; van Schaijk, Ben C L; van Gemert, Geert-Jan; van den Heuvel, Jeroen J M W; Ramesar, Jai; Chevalley-Maurel, Severine; Ploemen, Ivo H; Khan, Shahid M; Franetich, Jean-Francois; Mazier, Dominique; de Wilt, Johannes H W; Serrano, Adelfa E; Russel, Frans G M; Janse, Chris J; Sauerwein, Robert W; Koenderink, Jan B; Franke-Fayard, Blandine M

    2016-03-01

    Multidrug resistance-associated proteins (MRPs) belong to the C-family of ATP-binding cassette (ABC) transport proteins and are known to transport a variety of physiologically important compounds and to be involved in the extrusion of pharmaceuticals. Rodent malaria parasites encode a single ABC transporter subfamily C protein, whereas human parasites encode two: MRP1 and MRP2. Although associated with drug resistance, their biological function and substrates remain unknown. To elucidate the role of MRP throughout the parasite life cycle, Plasmodium berghei and Plasmodium falciparum mutants lacking MRP expression were generated. P. berghei mutants lacking expression of the single MRP as well as P. falciparum mutants lacking MRP1, MRP2 or both proteins have similar blood stage growth kinetics and drug-sensitivity profiles as wild type parasites. We show that MRP1-deficient parasites readily invade primary human hepatocytes and develop into mature liver stages. In contrast, both P. falciparum MRP2-deficient parasites and P. berghei mutants lacking MRP protein expression abort in mid to late liver stage development, failing to produce mature liver stages. The combined P. berghei and P. falciparum data are the first demonstration of a critical role of an ABC transporter during Plasmodium liver stage development. © 2015 John Wiley & Sons Ltd.

  13. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  14. The capacity of Listeria monocytogenes mutants with in-frame deletions in putative ATP-binding cassette transporters to form biofilms and comparison with the wild type

    Directory of Open Access Journals (Sweden)

    Marina Ceruso

    2014-02-01

    Full Text Available Listeria monocytogenes (Lm is a food-borne pathogen responsible for human listeriosis, an invasive infection with high mortality rates. Lm has developed efficient strategies for survival under stress conditions such as starvation and wide variations in temperature, pH, and osmolarity. Therefore, Lm can survive in food under multiple stress conditions. Detailed studies to determine the mode of action of this pathogen for survival under stress conditions are important to control Lm in food. It has been shown that genes encoding for ATP-binding cassette (ABC transporters are induced in Lm in food, in particular under stress conditions. Previous studies showed that these genes are involved in sensitivity to nisin, acids, and salt. The aim of this study was to determine the involvement of some ABC transporters in biofilm formation. Therefore, deletion mutants of ABC transporter genes (LMOf2365_1875 and LMOf2365_1877 were created in Lm F2365, and then were compared to the wild type for their capacity to form biofilms. Lm strain F2365 was chosen as reference since the genome is fully sequenced and furthermore this strain is particularly involved in food-borne outbreaks of listeriosis. Our results showed that DLMOf2365_1875 had an increased capacity to form biofilms compared to the wild type, indicating that LMOf2365_1875 negatively regulates biofilm formation. A deeper knowledge on the ability to form biofilms in these mutants may help in the development of intervention strategies to control Lm in food and in the environment.

  15. Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design

    Science.gov (United States)

    Ishikawa, Toshihisa; Tamura, Ai; Saito, Hikaru; Wakabayashi, Kanako; Nakagawa, Hiroshi

    2005-10-01

    In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.

  16. The role of the atypical kinases ABC1K7 and ABC1K8 in abscisic acid responses

    Directory of Open Access Journals (Sweden)

    Anna eManara

    2016-03-01

    Full Text Available The ABC1K family of atypical kinases (activity of bc1 complex kinase is represented in bacteria, archaea and eukaryotes. In plants they regulate diverse physiological processes in the chloroplasts and mitochondria, but their precise functions are poorly defined. ABC1K7 and ABC1K8 are probably involved in oxidative stress responses, isoprenyl lipid synthesis and distribution of iron within chloroplasts. Because reactive oxygen species take part in abscisic acid (ABA-mediated processes, we investigated the functions of ABC1K7 and ABC1K8 during germination, stomatal movement and leaf senescence. Both genes were upregulated by ABA treatment and some ABA-responsive physiological processes were affected in abc1k7 and abc1k8 mutants. Germination was more severely affected by ABA, osmotic stress and salt stress in the single and double mutants; the stomatal aperture was smaller in the mutants under standard growth conditions and was not further reduced by exogenous ABA application; ABA-induced senescence symptoms were more severe in the leaves of the single and double mutants compared to wild type leaves. Taken together, our results suggest that ABC1K7 and ABC1K8 might be involved in the cross-talk between ABA and ROS signaling.

  17. Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Svenningsen, Katrine; Almind Knudsen, Lina

    2015-01-01

    AIM: To evaluate ATP-binding cassette (ABC) transporters in colonic pathophysiology as they had recently been related to colorectal cancer (CRC) development. METHODS: Literature search was conducted on PubMed using combinations of the following terms: ABC transporters, ATP binding cassette...... with glucocorticoids. The evidence for the involvement of ABCC2 and ABCG2 in colonic pathophysiology was weak. CONCLUSION: ABCB1, diet, and gut microbes mutually interact in colonic inflammation, a well-known risk factor for CRC. Further insight may be translated into preventive and treatment strategies....... transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1...

  18. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  19. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  20. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  1. A Neisseria meningitidis fbpABC mutant is incapable of using nonheme iron for growth.

    Science.gov (United States)

    Khun, H H; Kirby, S D; Lee, B C

    1998-05-01

    The neisserial fbpABC locus has been proposed to act as an iron-specific ABC transporter system. To confirm this assigned function, we constructed an fbpABC mutant in Neisseria meningitidis by insertional inactivation of fbpABC with a selectable antibiotic marker. The mutant was unable to use iron supplied from human transferrin, human lactoferrin, or iron chelates. However, the use of iron from heme and human hemoglobin was unimpaired. These results support the obligatory participation of fbpABC in neisserial periplasmic iron transport and do not indicate a role for this genetic locus in the heme iron pathway.

  2. Investigating the effects of ABC transporter-based acquired drug resistance mechanisms at the cellular and tissue scale.

    Science.gov (United States)

    Liu, Cong; Krishnan, J; Xu, Xiao Yun

    2013-03-01

    In this paper we systematically investigate the effects of acquired drug resistance at the cellular and tissue scale, with a specific focus on ATP-binding cassette (ABC) transporter-based mechanisms and contrast this with other representative intracellular resistance mechanisms. This is done by developing in silico models wherein the drug resistance mechanism is overlaid on a coarse-grained description of apoptosis; these cellular models are coupled with interstitial drug transport, allowing for a transparent examination of the effect of acquired drug resistances at the tissue level. While ABC transporter-mediated resistance mechanisms counteract drug effect at the cellular level, its tissue-level effect is more complicated, revealing unexpected trends in tissue response as drug stimuli are systematically varied. Qualitatively different behaviour is observed in other drug resistance mechanisms. Overall the paper (i) provides insight into the tissue level functioning of a particular resistance mechanism, (ii) shows that this is very different from other resistance mechanisms of an apparently similar type, and (iii) demonstrates a concrete instance of how the functioning of a negative feedback based cellular adaptive mechanism can have unexpected higher scale effects.

  3. 75 FR 49549 - ABC & D Recycling, Inc.-Lease and Operation Exemption-a Line of Railroad in Ware, MA

    Science.gov (United States)

    2010-08-13

    ... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [Docket No. FD 35397] ABC & D Recycling, Inc.--Lease and Operation Exemption--a Line of Railroad in Ware, MA ABC & D Recycling, Inc. (ABC & D..., ABC & D Recycling, Inc.--Lease and Operation Exemption--a Line of Railroad in Ware, Massachusetts (STB...

  4. Investigating the dynamic nature of the ABC transporters: ABCB1 and MsbA as examples for the potential synergies of MD theory and EPR applications.

    Science.gov (United States)

    Stockner, Thomas; Mullen, Anna; MacMillan, Fraser

    2015-10-01

    ABC transporters are primary active transporters found in all kingdoms of life. Human multidrug resistance transporter ABCB1, or P-glycoprotein, has an extremely broad substrate spectrum and confers resistance against chemotherapy drug treatment in cancer cells. The bacterial ABC transporter MsbA is a lipid A flippase and a homolog to the human ABCB1 transporter, with which it partially shares its substrate spectrum. Crystal structures of MsbA and ABCB1 have been solved in multiple conformations, providing a glimpse into the possible conformational changes the transporter could be going through during the transport cycle. Crystal structures are inherently static, while a dynamic picture of the transporter in motion is needed for a complete understanding of transporter function. Molecular dynamics (MD) simulations and electron paramagnetic resonance (EPR) spectroscopy can provide structural information on ABC transporters, but the strength of these two methods lies in the potential to characterise the dynamic regime of these transporters. Information from the two methods is quite complementary. MD simulations provide an all atom dynamic picture of the time evolution of the molecular system, though with a narrow time window. EPR spectroscopy can probe structural, environmental and dynamic properties of the transporter in several time regimes, but only through the attachment sites of an exogenous spin label. In this review the synergistic effects that can be achieved by combining the two methods are highlighted, and a brief methodological background is also presented. © 2015 Authors; published by Portland Press Limited.

  5. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Translocation of the ABC transporter ABCD4 from the endoplasmic reticulum to lysosomes requires the escort protein LMBD1.

    Science.gov (United States)

    Kawaguchi, Kosuke; Okamoto, Takumi; Morita, Masashi; Imanaka, Tsuneo

    2016-07-26

    We previously demonstrated that ABCD4 does not localize to peroxisomes but rather, the endoplasmic reticulum (ER), because it lacks the NH2-terminal hydrophilic region required for peroxisomal targeting. It was recently reported that mutations in ABCD4 result in a failure to release vitamin B12 from lysosomes. A similar phenotype is caused by mutations in LMBRD1, which encodes the lysosomal membrane protein LMBD1. These findings suggested to us that ABCD4 translocated from the ER to lysosomes in association with LMBD1. In this report, it is demonstrated that ABCD4 interacts with LMBD1 and then localizes to lysosomes, and this translocation depends on the lysosomal targeting ability of LMBD1. Furthermore, endogenous ABCD4 was localized to both lysosomes and the ER, and its lysosomal localization was disturbed by knockout of LMBRD1. To the best of our knowledge, this is the first report demonstrating that the subcellular localization of the ABC transporter is determined by its association with an adaptor protein.

  7. The liver transcriptome of suckermouth armoured catfish (Pterygoplichthys anisitsi, Loricariidae): Identification of expansions in defensome gene families

    International Nuclear Information System (INIS)

    Parente, Thiago E.; Moreira, Daniel A.; Magalhães, Maithê G.P.; Andrade, Paula C.C. de; Furtado, Carolina; Haas, Brian J.; Stegeman, John J.; Hahn, Mark E.

    2017-01-01

    Pterygoplichthys is a genus of related suckermouth armoured catfishes native to South America, which have invaded tropical and subtropical regions worldwide. Physiological features, including an augmented resistance to organic xenobiotics, may have aided their settlement in foreign habitats. The liver transcriptome of Pterygoplichthys anisitsi was sequenced and used to characterize the diversity of mRNAs potentially involved in the responses to natural and anthropogenic chemicals. In total, 66,642 transcripts were assembled. Among the identified defensome genes, cytochromes P450 (CYP) were the most abundant, followed by sulfotransferases (SULT), nuclear receptors (NR) and ATP binding cassette transporters (ABC). A novel expansion in the CYP2Y subfamily was identified, as well as an independent expansion of the CYP2AAs. Two expansions were also observed among SULT1. Thirty-two transcripts were classified into twelve subfamilies of NR, while 21 encoded ABC transporters. The diversity of defensome transcripts sequenced herein could contribute to this species' resistance to organic xenobiotics. - Highlights: • Resistance of P. anisitsi to organic pollutants (e.g. Diesel oil) is elevated. • > 60 thousand transcripts were assembled at high sequencing depth. • > 20 thousand transcripts were annotated using UniProt and GO databases. • Complete coding sequence for 183 defensome transcripts were identified. • Most abundant defensome families were P450 followed by SULT, NR and ABC transporters.

  8. Inactivation of the Ecs ABC Transporter of Staphylococcus aureus Attenuates Virulence by Altering Composition and Function of Bacterial Wall

    NARCIS (Netherlands)

    Jonsson, Ing-Marie; Juuti, Jarmo T.; Francois, Patrice; AlMajidi, Rana; Pietiainen, Milla; Girard, Myriam; Lindholm, Catharina; Saller, Manfred J.; Driessen, Arnold J. M.; Kuusela, Pentti; Bokarewa, Maria; Schrenzel, Jacques; Kontinen, Vesa P.

    2010-01-01

    Background: Ecs is an ATP-binding cassette (ABC) transporter present in aerobic and facultative anaerobic Gram-positive Firmicutes. Inactivation of Bacillus subtilis Ecs causes pleiotropic changes in the bacterial phenotype including inhibition of intramembrane proteolysis. The molecule(s)

  9. The yeast plasma membrane ATP binding cassette (ABC) transporter Aus1: purification, characterization, and the effect of lipids on its activity.

    Science.gov (United States)

    Marek, Magdalena; Milles, Sigrid; Schreiber, Gabriele; Daleke, David L; Dittmar, Gunnar; Herrmann, Andreas; Müller, Peter; Pomorski, Thomas Günther

    2011-06-17

    The ATP binding cassette (ABC) transporter Aus1 is expressed under anaerobic growth conditions at the plasma membrane of the yeast Saccharomyces cerevisiae and is required for sterol uptake. These observations suggest that Aus1 promotes the translocation of sterols across membranes, but the precise transport mechanism has yet to be identified. In this study, an extraction and purification procedure was developed to characterize the Aus1 transporter. The detergent-solubilized protein was able to bind and hydrolyze ATP. Mutagenesis of the conserved lysine to methionine in the Walker A motif abolished ATP hydrolysis. Likewise, ATP hydrolysis was inhibited by classical inhibitors of ABC transporters. Upon reconstitution into proteoliposomes, the ATPase activity of Aus1 was specifically stimulated by phosphatidylserine (PS) in a stereoselective manner. We also found that Aus1-dependent sterol uptake, but not Aus1 expression and trafficking to the plasma membrane, was affected by changes in cellular PS levels. These results suggest a direct interaction between Aus1 and PS that is critical for the activity of the transporter.

  10. ABC Technology Development Program

    International Nuclear Information System (INIS)

    1994-01-01

    The Accelerator-Based Conversion (ABC) facility will be designed to accomplish the following mission: 'Provide a weapon's grade plutonium disposition capability in a safe, economical, and environmentally sound manner on a prudent schedule for [50] tons of weapon's grade plutonium to be disposed on in [20] years.' This mission is supported by four major objectives: provide a reliable plutonium disposition capability within the next [15] years; provide a level of safety and of safety assurance that meets or exceeds that afforded to the public by modern commercial nuclear power plants; meet or exceed all applicable federal, state, and local regulations or standards for environmental compliance; manage the program in a cost effective manner. The ABC Technology Development Program defines the technology development activities that are required to accomplish this mission. The technology development tasks are related to the following topics: blanket system; vessel systems; reactivity control systems; heat transport system components; energy conversion systems; shutdown heat transport systems components; auxiliary systems; technology demonstrations - large scale experiments

  11. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  12. Effect of praziquantel on the differential expression of mouse hepatic genes and parasite ATP binding cassette transporter gene family members during Schistosoma mansoni infection.

    Directory of Open Access Journals (Sweden)

    Melissa C Sanchez

    2017-06-01

    Full Text Available Schistosomiasis is a chronic parasitic disease caused by sexually dimorphic blood flukes of the genus Schistosoma. Praziquantel (PZQ is the only drug widely available to treat the disease but does not kill juvenile parasites. Here we report the use of next generation sequencing to study the transcriptional effect of PZQ on murine hepatic inflammatory, immune and fibrotic responses to Schistosoma mansoni worms and eggs. An initial T helper cell 1 (Th1 response is induced against schistosomes in mice treated with drug vehicle (Vh around the time egg laying begins, followed by a T helper cell 2 (Th2 response and the induction of genes whose action leads to granuloma formation and fibrosis. When PZQ is administered at this time, there is a significant reduction in egg burden yet the hepatic Th1, Th2 and fibrotic responses are still observed in the absence of granuloma formation suggesting some degree of gene regulation may be induced by antigens released from the dying adult worms. Quantitative real-time PCR was used to examine the relative expression of 16 juvenile and adult S. mansoni genes during infection and their response to Vh and PZQ treatment in vivo. While the response of stress genes in adult parasites suggests the worms were alive immediately following exposure to PZQ, they were unable to induce transcription of any of the 9 genes encoding ATP-binding cassette (ABC transporters tested. In contrast, juvenile schistosomes were able to significantly induce the activities of ABCB, C and G family members, underscoring the possibility that these efflux systems play a major role in drug resistance.

  13. A solute-binding protein for iron transport in Streptococcus iniae

    Directory of Open Access Journals (Sweden)

    Li Anxing

    2010-12-01

    Full Text Available Abstract Background Streptococcus iniae (S. iniae is a major pathogen that causes considerable morbidity and mortality in cultured fish worldwide. The pathogen's ability to adapt to the host affects the extent of infection, hence understanding the mechanisms by which S. iniae overcomes physiological stresses during infection will help to identify potential virulence determinants of streptococcal infection. Grow S. iniae under iron-restricted conditions is one approach for identifying host-specific protein expression. Iron plays an important role in many biological processes but it has low solubility under physiological condition. Many microorganisms have been shown to be able to circumvent this nutritional limitation by forming direct contacts with iron-containing proteins through ATP-binding cassette (ABC transporters. The ABC transporter superfamilies constitute many different systems that are widespread among living organisms with different functions, such as ligands translocation, mRNA translation, and DNA repair. Results An ABC transporter system, named as mtsABC (metal transport system was cloned from S. iniae HD-1, and was found to be involved in heme utilization. mtsABC is cotranscribed by three downstream genes, i.e., mtsA, mtsB, and mtsC. In this study, we cloned the first gene of the mtsABC transporter system (mtsA, and purified the corresponding recombinant protein MtsA. The analysis indicated that MtsA is a putative lipoprotein which binds to heme that can serve as an iron source for the microorganism, and is expressed in vivo during Kunming mice infection by S. iniae HD-1. Conclusions This is believed to be the first report on the cloning the ABC transporter lipoprotein from S. iniae genomic DNA. Together, our data suggested that MtsA is associated with heme, and is expressed in vivo during Kunming mice infection by S. iniae HD-1 which indicated that it can be a potential candidate for S. iniae subunit vaccine.

  14. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  15. Choroid plexus transport: gene deletion studies

    Directory of Open Access Journals (Sweden)

    Keep Richard F

    2011-11-01

    Full Text Available Abstract This review examines the use of transporter knockout (KO animals to evaluate transporter function at the choroid plexus (the blood-CSF barrier; BCSFB. Compared to the blood-brain barrier, there have been few such studies on choroid plexus (CP function. These have primarily focused on Pept2 (an oligopeptide transporter, ATP-binding cassette (ABC transporters, Oat3 (an organic anion transporter, Svct2 (an ascorbic acid transporter, transthyretin, ion transporters, and ion and water channels. This review focuses on the knowledge gained from such studies, both with respect to specific transporters and in general to the role of the CP and its impact on brain parenchyma. It also discusses the pros and cons of using KO animals in such studies and the technical approaches that can be used.

  16. Purification, crystallization and preliminary X-ray diffraction analysis of an archaeal ABC-ATPase

    NARCIS (Netherlands)

    Verdon, Grégory; Albers, Sonja-V.; Dijkstra, Bauke W.; Driessen, Arnold J.M.; Thunnissen, Andy-Mark W.H.

    2002-01-01

    In the archaeon Sulfolobus solfataricus glucose uptake is mediated by an ABC transport system. The ABC-ATPase of this transporter (GlcV) has been overproduced in Escherichia coli and purified. Crystals of GlcV suitable for data collection were obtained in the absence of nucleotide by microseeding

  17. Increased expression of electron transport chain genes in uterine leiomyoma.

    Science.gov (United States)

    Tuncal, Akile; Aydin, Hikmet Hakan; Askar, Niyazi; Ozkaya, Ali Burak; Ergenoglu, Ahmet Mete; Yeniel, Ahmet Ozgur; Akdemir, Ali; Ak, Handan

    2014-01-01

    The etiology and pathophysiology of uterine leiomyomas, benign smooth muscle tumors of the uterus, are not well understood. To evaluate the role of mitochondria in uterine leiomyoma, we compared electron transport gene expressions of uterine leiomyoma tissue with myometrium tissue in six uterine leiomyoma patients by RT-PCR array. Our results showed an average of 1.562 (±0.445) fold increase in nuclear-encoded electron transport genes. These results might suggest an increase in size, number, or activity of mitochondria in uterine leiomyoma that, to our knowledge, has not been previously reported. © 2014 by the Association of Clinical Scientists, Inc.

  18. A new highly conserved antibiotic sensing/resistance pathway in firmicutes involves an ABC transporter interplaying with a signal transduction system.

    Directory of Open Access Journals (Sweden)

    Stéphanie Coumes-Florens

    2011-01-01

    Full Text Available Signal transduction systems and ABC transporters often contribute jointly to adaptive bacterial responses to environmental changes. In Bacillus subtilis, three such pairs are involved in responses to antibiotics: BceRSAB, YvcPQRS and YxdJKLM. They are characterized by a histidine kinase belonging to the intramembrane sensing kinase family and by a translocator possessing an unusually large extracytoplasmic loop. It was established here using a phylogenomic approach that systems of this kind are specific but widespread in Firmicutes, where they originated. The present phylogenetic analyses brought to light a highly dynamic evolutionary history involving numerous horizontal gene transfers, duplications and lost events, leading to a great variety of Bce-like repertories in members of this bacterial phylum. Based on these phylogenetic analyses, it was proposed to subdivide the Bce-like modules into six well-defined subfamilies. Functional studies were performed on members of subfamily IV comprising BceRSAB from B. subtilis, the expression of which was found to require the signal transduction system as well as the ABC transporter itself. The present results suggest, for the members of this subfamily, the occurrence of interactions between one component of each partner, the kinase and the corresponding translocator. At functional and/or structural levels, bacitracin dependent expression of bceAB and bacitracin resistance processes require the presence of the BceB translocator loop. Some other members of subfamily IV were also found to participate in bacitracin resistance processes. Taken together our study suggests that this regulatory mechanism might constitute an important common antibiotic resistance mechanism in Firmicutes. [Supplemental material is available online at http://www.genome.org.].

  19. [Functional activity of the modA, gene in Methylobacterium dichloromethanicum DM4].

    Science.gov (United States)

    Firsova, Y E; Trotsenko, Y A

    2014-01-01

    The putative METDI2644 (modA2) gene of Methylobacterium dichloromethanicum DM4, present in the 126-kbp chromosomal fragment associated with dichloromethane (DCM) degradation was investigated. While this gene is presumed to encode the periplasmic substrate-binding subunit of the molybdate ABC transporter, its conceptual translation also exhibits similarity to the proteins containing the ostA conservative domain and responsible for resistance of gram-negative bacteria to organic solvents. Reverse transcription polymerase chain reaction (RT-PCR) revealed the RNA transcripts of this gene in the cells grown on either DCM or methanol. The mobilizable suicide vector pK18mob was used to obtain a knockout mutant with the METDI2644 gene inactivated by insertion of the gentamycin cassette. The mutant pregrown on methanol exhibited lower growth rate on DCM than the wild-type strain DM4. The difference was not alleviated by addition of sodium molybdate. Our results suggest that the METDI2644 gene product plays a role in cell adaptation to DCM degradation.

  20. Use of peptide antibodies to probe for the mitoxantrone resistance-associated protein MXR/BCRP/ABCP/ABCG2

    DEFF Research Database (Denmark)

    Litman, Thomas; Jensen, Ulla; Hansen, Alastair

    2002-01-01

    Recent studies have characterized the ABC half-transporter associated with mitoxantrone resistance in human cancer cell lines. Encoded by the ABCG2 gene, overexpression confers resistance to camptothecins, as well as to mitoxantrone. We developed four polyclonal antibodies against peptides corres...

  1. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  2. The Nucleotide-Free State of the Multidrug Resistance ABC Transporter LmrA: Sulfhydryl Cross-Linking Supports a Constant Contact, Head-to-Tail Configuration of the Nucleotide-Binding Domains.

    Directory of Open Access Journals (Sweden)

    Peter M Jones

    Full Text Available ABC transporters are integral membrane pumps that are responsible for the import or export of a diverse range of molecules across cell membranes. ABC transporters have been implicated in many phenomena of medical importance, including cystic fibrosis and multidrug resistance in humans. The molecular architecture of ABC transporters comprises two transmembrane domains and two ATP-binding cassettes, or nucleotide-binding domains (NBDs, which are highly conserved and contain motifs that are crucial to ATP binding and hydrolysis. Despite the improved clarity of recent structural, biophysical, and biochemical data, the seemingly simple process of ATP binding and hydrolysis remains controversial, with a major unresolved issue being whether the NBD protomers separate during the catalytic cycle. Here chemical cross-linking data is presented for the bacterial ABC multidrug resistance (MDR transporter LmrA. These indicate that in the absence of nucleotide or substrate, the NBDs come into contact to a significant extent, even at 4°C, where ATPase activity is abrogated. The data are clearly not in accord with an inward-closed conformation akin to that observed in a crystal structure of V. cholerae MsbA. Rather, they suggest a head-to-tail configuration 'sandwich' dimer similar to that observed in crystal structures of nucleotide-bound ABC NBDs. We argue the data are more readily reconciled with the notion that the NBDs are in proximity while undergoing intra-domain motions, than with an NBD 'Switch' mechanism in which the NBD monomers separate in between ATP hydrolysis cycles.

  3. Heteronuclear multidimensional NMR and homology modelling studies of the C-terminal nucleotide-binding domain of the human mitochondrial ABC transporter ABCB6

    Energy Technology Data Exchange (ETDEWEB)

    Kurashima-Ito, Kaori [RIKEN, Cellular and Molecular Biology Laboratory (Japan); Ikeya, Teppei [National Institute of Advanced Industrial Science and Technology (AIST), (Japan); Senbongi, Hiroshi [Mitochondrial Diseases Group, MRC Dunn Human NutritionUnit (United Kingdom); Tochio, Hidehito [International Graduate School of Arts and Sciences, Supramolecular Biology, Yokohama City University, Molecular Biophysics Laboratory (Japan); Mikawa, Tsutomu [RIKEN, Cellular and Molecular Biology Laboratory (Japan); Shibata, Takehiko [RIKEN, Shibata Distinguished Senior Scientist Laboratory (Japan); Ito, Yutaka [RIKEN, Cellular and Molecular Biology Laboratory (Japan)], E-mail: ito-yutaka@center.tmu.ac.jp

    2006-05-15

    Human ATP-binding cassette, sub-family B, member 6 (ABCB6) is a mitochondrial ABC transporter, and presumably contributes to iron homeostasis. Aimed at understanding the structural basis for the conformational changes accompanying the substrate-transportation cycle, we have studied the C-terminal nucleotide-binding domain of ABCB6 (ABCB6-C) in both the nucleotide-free and ADP-bound states by heteronuclear multidimensional NMR and homology modelling. A non-linear sampling scheme was utilised for indirectly acquired {sup 13}C and {sup 15}N dimensions of all 3D triple-resonance NMR experiments, in order to overcome the instability and the low solubility of ABCB6-C. The backbone resonances for approximately 25% of non-proline residues, which are mostly distributed around the functionally important loops and in the Helical domain, were not observed for nucleotide-free form of ABCB6-C. From the pH, temperature and magnetic field strength dependencies of the resonance intensities, we concluded that this incompleteness in the assignments is mainly due to the exchange between multiple conformations at an intermediate rate on the NMR timescale. These localised conformational dynamics remained in ADP-bound ABCB6-C except for the loops responsible for adenine base and {alpha}/{beta}-phosphate binding. These results revealed that the localised dynamic cooperativity, which was recently proposed for a prokaryotic ABC MJ1267, also exists in a higher eukaryotic ABC, and is presumably shared by all members of the ABC family. Since the Helical domain is the putative interface to the transmembrane domain, this cooperativity may explain the coupled functions between domains in the substrate-transportation cycle.

  4. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  5. Solitary BioY Proteins Mediate Biotin Transport into Recombinant Escherichia coli

    Science.gov (United States)

    Finkenwirth, Friedrich; Kirsch, Franziska

    2013-01-01

    Energy-coupling factor (ECF) transporters form a large group of vitamin uptake systems in prokaryotes. They are composed of highly diverse, substrate-specific, transmembrane proteins (S units), a ubiquitous transmembrane protein (T unit), and homo- or hetero-oligomeric ABC ATPases. Biotin transporters represent a special case of ECF-type systems. The majority of the biotin-specific S units (BioY) is known or predicted to interact with T units and ABC ATPases. About one-third of BioY proteins, however, are encoded in organisms lacking any recognizable T unit. This finding raises the question of whether these BioYs function as transporters in a solitary state, a feature ascribed to certain BioYs in the past. To address this question in living cells, an Escherichia coli K-12 derivative deficient in biotin synthesis and devoid of its endogenous high-affinity biotin transporter was constructed as a reference strain. This organism is particularly suited for this purpose because components of ECF transporters do not naturally occur in E. coli K-12. The double mutant was viable in media containing either high levels of biotin or a precursor of the downstream biosynthetic path. Importantly, it was nonviable on trace levels of biotin. Eight solitary bioY genes of proteobacterial origin were individually expressed in the reference strain. Each of the BioYs conferred biotin uptake activity on the recombinants, which was inferred from uptake assays with [3H]biotin and growth of the cells on trace levels of biotin. The results underscore that solitary BioY transports biotin across the cytoplasmic membrane. PMID:23836870

  6. Conservation of targeting but divergence in function and quality control of peroxisomal ABC transporters: an analysis using cross-kingdom expression

    NARCIS (Netherlands)

    Zhang, Xuebin; de Marcos Lousa, Carine; Schutte-Lensink, Nellie; Ofman, Rob; Wanders, Ronald J.; Baldwin, Stephen A.; Baker, Alison; Kemp, Stephan; Theodoulou, Frederica L.

    2011-01-01

    ABC (ATP-binding cassette) subfamily D transporters are found in all eukaryotic kingdoms and are known to play essential roles in mammals and plants; however, their number, organization and physiological contexts differ. Via cross-kingdom expression experiments, we have explored the conservation of

  7. 75 FR 11991 - ABC & D Recycling, Inc.-Lease and Operation Exemption-a Line of Railroad in Ware, MA

    Science.gov (United States)

    2010-03-12

    ... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [STB Finance Docket No. 35356] ABC & D Recycling, Inc.--Lease and Operation Exemption--a Line of Railroad in Ware, MA ABC & D Recycling, Inc. (ABC & D), a noncarrier, has filed a verified notice of exemption under 49 CFR 1150.31 to lease from O...

  8. Evolutionary relationships of ATP-Binding Cassette (ABC) uptake porters.

    Science.gov (United States)

    Zheng, Wei Hao; Västermark, Åke; Shlykov, Maksim A; Reddy, Vamsee; Sun, Eric I; Saier, Milton H

    2013-05-06

    The ATP-Binding Cassette (ABC) functional superfamily includes integral transmembrane exporters that have evolved three times independently, forming three families termed ABC1, ABC2 and ABC3, upon which monophyletic ATPases have been superimposed for energy-coupling purposes [e.g., J Membr Biol 231(1):1-10, 2009]. The goal of the work reported in this communication was to understand how the integral membrane constituents of ABC uptake transporters with different numbers of predicted or established transmembrane segments (TMSs) evolved. In a few cases, high resolution 3-dimensional structures were available, and in these cases, their structures plus primary sequence analyses allowed us to predict evolutionary pathways of origin. All of the 35 currently recognized families of ABC uptake proteins except for one (family 21) were shown to be homologous using quantitative statistical methods. These methods involved using established programs that compare native protein sequences with each other, after having compared each sequence with thousands of its own shuffled sequences, to gain evidence for homology. Topological analyses suggested that these porters contain numbers of TMSs ranging from four or five to twenty. Intragenic duplication events occurred multiple times during the evolution of these porters. They originated from a simple primordial protein containing 3 TMSs which duplicated to 6 TMSs, and then produced porters of the various topologies via insertions, deletions and further duplications. Except for family 21 which proved to be related to ABC1 exporters, they are all related to members of the previously identified ABC2 exporter family. Duplications that occurred in addition to the primordial 3 → 6 duplication included 5 → 10, 6 → 12 and 10 → 20 TMSs. In one case, protein topologies were uncertain as different programs gave discrepant predictions. It could not be concluded with certainty whether a 4 TMS ancestral protein or a 5 TMS ancestral protein

  9. fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

    Science.gov (United States)

    Khun, H H; Deved, V; Wong, H; Lee, B C

    2000-12-01

    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

  10. Hamiltonian ABC

    NARCIS (Netherlands)

    Meeds, E.; Leenders, R.; Welling, M.; Meila, M.; Heskes, T.

    2015-01-01

    Approximate Bayesian computation (ABC) is a powerful and elegant framework for performing inference in simulation-based models. However, due to the difficulty in scaling likelihood estimates, ABC remains useful for relatively lowdimensional problems. We introduce Hamiltonian ABC (HABC), a set of

  11. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  12. ABC transporter Cdr1p harbors charged residues in the intracellular loop and nucleotide-binding domain critical for protein trafficking and drug resistance.

    Science.gov (United States)

    Shah, Abdul Haseeb; Banerjee, Atanu; Rawal, Manpreet Kaur; Saxena, Ajay Kumar; Mondal, Alok Kumar; Prasad, Rajendra

    2015-08-01

    The ABC transporter Cdr1 protein of Candida albicans, which plays a major role in antifungal resistance, has two transmembrane domains (TMDs) and two nucleotide-binding domains (NBDs). The 12 transmembrane helices of TMDs that are interconnected by extracellular and intracellular loops (ICLs) mainly harbor substrate recognition sites where drugs bind while cytoplasmic NBDs hydrolyze ATP which powers drug efflux. The coupling of ATP hydrolysis to drug transport requires proper communication between NBDs and TMDs typically accomplished by ICLs. This study examines the role of cytoplasmic ICLs of Cdr1p by rationally predicting the critical residues on the basis of their interatomic distances. Among nine pairs that fall within a proximity of trafficking. These results point to a new role for ICL/NBD interacting residues in PDR ABC transporters in protein folding and trafficking. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Identification of Residues in the Lipopolysaccharide ABC Transporter That Coordinate ATPase Activity with Extractor Function.

    Science.gov (United States)

    Simpson, Brent W; Owens, Tristan W; Orabella, Matthew J; Davis, Rebecca M; May, Janine M; Trauger, Sunia A; Kahne, Daniel; Ruiz, Natividad

    2016-10-18

    The surface of most Gram-negative bacteria is covered with lipopolysaccharide (LPS), creating a permeability barrier against toxic molecules, including many antimicrobials. To assemble LPS on their surface, Gram-negative bacteria must extract newly synthesized LPS from the inner membrane, transport it across the aqueous periplasm, and translocate it across the outer membrane. The LptA to -G proteins assemble into a transenvelope complex that transports LPS from the inner membrane to the cell surface. The Lpt system powers LPS transport from the inner membrane by using a poorly characterized ATP-binding cassette system composed of the ATPase LptB and the transmembrane domains LptFG. Here, we characterize a cluster of residues in the groove region of LptB that is important for controlling LPS transport. We also provide the first functional characterization of LptFG and identify their coupling helices that interact with the LptB groove. Substitutions at conserved residues in these coupling helices compromise both the assembly and function of the LptB 2 FG complex. Defects in LPS transport conferred by alterations in the LptFG coupling helices can be rescued by changing a residue in LptB that is adjacent to functionally important residues in the groove region. This suppression is achieved by increasing the ATPase activity of the LptB 2 FG complex. Taken together, these data identify a specific binding site in LptB for the coupling helices of LptFG that is responsible for coupling of ATP hydrolysis by LptB with LptFG function to achieve LPS extraction. Lipopolysaccharide (LPS) is synthesized at the cytoplasmic membrane of Gram-negative bacteria and transported across several compartments to the cell surface, where it forms a barrier that protects these organisms from antibiotics. The LptB 2 FG proteins form an ATP-binding cassette (ABC) transporter that uses energy from ATP hydrolysis in the cytoplasm to facilitate extraction of LPS from the outer face of the

  14. [Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

    Science.gov (United States)

    Shpakovskiĭ, G V; Lebedenko, E N

    1997-05-01

    The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

  15. Analysis of an ATP-induced conformational transition of ABC transporter MsbA using a coarse-grained model.

    Science.gov (United States)

    Arai, Naoki; Furuta, Tadaomi; Sakurai, Minoru

    2017-01-01

    Upon the binding of ATP molecules to nucleotide binding domains (NBDs), ATP-binding cassette (ABC) exporters undergo a conformational transition from an inward-facing (IF) to an outward-facing (OF) state. This molecular event is a typical example of chemo-mechanical coupling. However, the underlying mechanism remains unclear. In this study, we analyzed the IF→OF transition of a representative ABC exporter, MsbA, by solving the equation of motion under an elastic network model (ENM). ATP was represented as a single node in ENM or replaced by external forces. When two ATP nodes were added to the ENM of the IF state protein, the two NBDs dimerized; subsequently, the two transmembrane domains opened toward the extracellular side, resulting in the formation of the OF structure. Such a conformational transition was also reproduced by applying external forces, which caused the rotational motion of the NBDs instead of the addition of ATP nodes. The process of the conformational transition was analyzed in detail using cross-correlation maps for node-node interactions. More importantly, it was revealed that the ATP binding energy is converted into distortion energy of several transmembrane helices. These results are useful for understanding the chemo-mechanical coupling in ABC transporters.

  16. Inactivation of the Ecs ABC transporter of Staphylococcus aureus attenuates virulence by altering composition and function of bacterial wall.

    Directory of Open Access Journals (Sweden)

    Ing-Marie Jonsson

    2010-12-01

    Full Text Available Ecs is an ATP-binding cassette (ABC transporter present in aerobic and facultative anaerobic gram-positive Firmicutes. Inactivation of Bacillus subtilis Ecs causes pleiotropic changes in the bacterial phenotype including inhibition of intramembrane proteolysis. The molecule(s transported by Ecs is (are still unknown.In this study we mutated the ecsAB operon in two Staphylococcus aureus strains, Newman and LS-1. Phenotypic and functional characterization of these Ecs deficient mutants revealed a defect in growth, increased autolysis and lysostaphin sensitivity, altered composition of cell wall proteins including the precursor form of staphylokinase and an altered bacterial surface texture. DNA microarray analysis indicated that the Ecs deficiency changed expression of the virulence factor regulator protein Rot accompanied by differential expression of membrane transport proteins, particularly ABC transporters and phosphate-specific transport systems, protein A, adhesins and capsular polysaccharide biosynthesis proteins. Virulence of the ecs mutants was studied in a mouse model of hematogenous S. aureus infection. Mice inoculated with the ecs mutant strains developed markedly milder infections than those inoculated with the wild-type strains and had consequently lower mortality, less weight loss, milder arthritis and decreased persistence of staphylococci in the kidneys. The ecs mutants had higher susceptibility to ribosomal antibiotics and plant alkaloids chelerythrine and sanguinarine.Our results show that Ecs is essential for staphylococcal virulence and antimicrobial resistance probably since the transport function of Ecs is essential for the normal structure and function of the cell wall. Thus targeting Ecs may be a new approach in combating staphylococcal infection.

  17. Inactivation of the Ecs ABC transporter of Staphylococcus aureus attenuates virulence by altering composition and function of bacterial wall.

    Science.gov (United States)

    Jonsson, Ing-Marie; Juuti, Jarmo T; François, Patrice; AlMajidi, Rana; Pietiäinen, Milla; Girard, Myriam; Lindholm, Catharina; Saller, Manfred J; Driessen, Arnold J M; Kuusela, Pentti; Bokarewa, Maria; Schrenzel, Jacques; Kontinen, Vesa P

    2010-12-02

    Ecs is an ATP-binding cassette (ABC) transporter present in aerobic and facultative anaerobic gram-positive Firmicutes. Inactivation of Bacillus subtilis Ecs causes pleiotropic changes in the bacterial phenotype including inhibition of intramembrane proteolysis. The molecule(s) transported by Ecs is (are) still unknown. In this study we mutated the ecsAB operon in two Staphylococcus aureus strains, Newman and LS-1. Phenotypic and functional characterization of these Ecs deficient mutants revealed a defect in growth, increased autolysis and lysostaphin sensitivity, altered composition of cell wall proteins including the precursor form of staphylokinase and an altered bacterial surface texture. DNA microarray analysis indicated that the Ecs deficiency changed expression of the virulence factor regulator protein Rot accompanied by differential expression of membrane transport proteins, particularly ABC transporters and phosphate-specific transport systems, protein A, adhesins and capsular polysaccharide biosynthesis proteins. Virulence of the ecs mutants was studied in a mouse model of hematogenous S. aureus infection. Mice inoculated with the ecs mutant strains developed markedly milder infections than those inoculated with the wild-type strains and had consequently lower mortality, less weight loss, milder arthritis and decreased persistence of staphylococci in the kidneys. The ecs mutants had higher susceptibility to ribosomal antibiotics and plant alkaloids chelerythrine and sanguinarine. Our results show that Ecs is essential for staphylococcal virulence and antimicrobial resistance probably since the transport function of Ecs is essential for the normal structure and function of the cell wall. Thus targeting Ecs may be a new approach in combating staphylococcal infection.

  18. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  19. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  20. The multidrug ABC transporter BmrC/BmrD of Bacillus subtilis is regulated via a ribosome-mediated transcriptional attenuation mechanism

    OpenAIRE

    Reilman, E.; Mars, R. A. T.; van Dijl, J. M.; Denham, Emma

    2014-01-01

    Expression of particular drug transporters in response to antibiotic pressure is a critical element in the development of bacterial multidrug resistance, and represents a serious concern for human health. To obtain a better understanding of underlying regulatory mechanisms, we have dissected the transcriptional activation of the ATP-binding cassette (ABC) transporter BmrC/BmrD of the Gram-positive model bacterium Bacillus subtilis. By using promoter-GFP fusions and live cell array technology,...

  1. Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

    DEFF Research Database (Denmark)

    Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

    2018-01-01

    The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

  2. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  3. Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

    Science.gov (United States)

    García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

    2017-09-01

    Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  4. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  5. Role of the Caenorhabditis elegans multidrug resistance gene, mrp-4, in gut granule differentiation.

    Science.gov (United States)

    Currie, Erin; King, Brian; Lawrenson, Andrea L; Schroeder, Lena K; Kershner, Aaron M; Hermann, Greg J

    2007-11-01

    Caenorhabditis elegans gut granules are lysosome-related organelles with birefringent contents. mrp-4, which encodes an ATP-binding cassette (ABC) transporter homologous to mammalian multidrug resistance proteins, functions in the formation of gut granule birefringence. mrp-4(-) embryos show a delayed appearance of birefringent material in the gut granule but otherwise appear to form gut granules properly. mrp-4(+) activity is required for the extracellular mislocalization of birefringent material, body-length retraction, and NaCl sensitivity, phenotypes associated with defective gut granule biogenesis exhibited by embryos lacking the activity of GLO-1/Rab38, a putative GLO-1 guanine nucleotide exchange factor GLO-4, and the AP-3 complex. Multidrug resistance protein (MRP)-4 localizes to the gut granule membrane, consistent with it playing a direct role in the transport of molecules that compose and/or facilitate the formation of birefringent crystals within the gut granule. However, MRP-4 is also present in oocytes and early embryos, and our genetic analyses indicate that its site of action in the formation of birefringent material may not be limited to just the gut granule in embryos. In a search for genes that function similarly to mrp-4(+), we identified WHT-2, another ABC transporter that acts in parallel to MRP-4 for the formation of birefringent material in the gut granule.

  6. Involvement of the VDE homing endonuclease and rapamycin in regulation of the Saccharomyces cerevisiae GSH11 gene encoding the high affinity glutathione transporter.

    Science.gov (United States)

    Miyake, Tsuyoshi; Hiraishi, Hiroyuki; Sammoto, Hiroyuki; Ono, Bun-Ichiro

    2003-10-10

    The Saccharomyces cerevisiae gene HGT1/GSH11 encodes the high affinity glutathione transporter and is repressed by cysteine added to the culture medium. It has been found previously that a 5'-upstream cis-element, CCGCCACAC, is responsible for regulating GSH11 expression and that several proteins bind to this element (Miyake, T., Kanayama, M., Sammoto, H., and Ono, B. (2002) Mol. Genet. Genomics 266, 1004-1011). In this report we present evidence that the most prominent of these proteins is VDE, known previously as the homing endonuclease encoded by VMA1. We show also that GSH11 is not expressed in a VDE-deleted strain and that inability to express the GSH11 of this strain is overcome by introduction of the coding region of VDE or the entire VMA1 gene. It is also found that VDE does not cut DNA in the vicinity of the GSH11 cis-element. Rapamycin, an inhibitor of the target of rapamycin (TOR) signal-transduction system, is found to enhance expression of GSH11 in a VDE-dependent manner under conditions of sulfur starvation. These results indicate that GSH11 is regulated by a system sensitive to sulfur starvation (presumably via cysteine depletion) and a more general system involving the nutritional starvation signal mediated by the TOR system. Both systems need to be operational (inhibition of TOR and sulfur starvation) for full expression of GSH11.

  7. Cloning and expression analysis of a novel ammonium transporter gene from eichhornia

    International Nuclear Information System (INIS)

    Li, Y.; Yan, G.; Zheng, L.

    2014-01-01

    In order to explore the molecular mechanism for Eichhornia crassipes to transport ammonium from outside, we cloned a novel ammonium transporter (EcAMT) gene from E. crassipes and identified its function by using yeast complementation experiment. The full-length cDNA of EcAMT contains a 1506 nucletide-long open reading frame which encodes a protein of 501 amino acids. Bioinformatics analysis predicted that EcAMT had 8 transmembrane regions. The expressions of EcAMT gene under three different nitrogen conditions were evaluated by quantitative reverse transcriptase PCR (qRT-PCR) and the results showed that the expression of EcAMT gene was up-regulated under nitrogen starvation. Our study results revealed some molecular mechanism of E. crassipes to absorb the ammonium in eutrophic water. (author)

  8. Disruption of a cystine transporter downregulates expression of genes involved in sulfur regulation and cellular respiration

    Directory of Open Access Journals (Sweden)

    Jessica A. Simpkins

    2016-06-01

    Full Text Available Cystine and cysteine are important molecules for pathways such as redox signaling and regulation, and thus identifying cellular deficits upon deletion of the Saccharomyces cerevisiae cystine transporter Ers1p allows for a further understanding of cystine homeostasis. Previous complementation studies using the human ortholog suggest yeast Ers1p is a cystine transporter. Human CTNS encodes the protein Cystinosin, a cystine transporter that is embedded in the lysosomal membrane and facilitates the export of cystine from the lysosome. When CTNS is mutated, cystine transport is disrupted, leading to cystine accumulation, the diagnostic hallmark of the lysosomal storage disorder cystinosis. Here, we provide biochemical evidence for Ers1p-dependent cystine transport. However, the accumulation of intracellular cystine is not observed when the ERS1 gene is deleted from ers1-Δ yeast, supporting the existence of modifier genes that provide a mechanism in ers1-Δ yeast that prevents or corrects cystine accumulation. Upon comparison of the transcriptomes of isogenic ERS1+ and ers1-Δ strains of S. cerevisiae by DNA microarray followed by targeted qPCR, sixteen genes were identified as being differentially expressed between the two genotypes. Genes that encode proteins functioning in sulfur regulation, cellular respiration, and general transport were enriched in our screen, demonstrating pleiotropic effects of ers1-Δ. These results give insight into yeast cystine regulation and the multiple, seemingly distal, pathways that involve proper cystine recycling.

  9. Emission of volatile organic compounds from petunia flowers is facilitated by an ABC transporter.

    Science.gov (United States)

    Adebesin, Funmilayo; Widhalm, Joshua R; Boachon, Benoît; Lefèvre, François; Pierman, Baptiste; Lynch, Joseph H; Alam, Iftekhar; Junqueira, Bruna; Benke, Ryan; Ray, Shaunak; Porter, Justin A; Yanagisawa, Makoto; Wetzstein, Hazel Y; Morgan, John A; Boutry, Marc; Schuurink, Robert C; Dudareva, Natalia

    2017-06-30

    Plants synthesize a diversity of volatile molecules that are important for reproduction and defense, serve as practical products for humans, and influence atmospheric chemistry and climate. Despite progress in deciphering plant volatile biosynthesis, their release from the cell has been poorly understood. The default assumption has been that volatiles passively diffuse out of cells. By characterization of a Petunia hybrida adenosine triphosphate-binding cassette (ABC) transporter, PhABCG1, we demonstrate that passage of volatiles across the plasma membrane relies on active transport. PhABCG1 down-regulation by RNA interference results in decreased emission of volatiles, which accumulate to toxic levels in the plasma membrane. This study provides direct proof of a biologically mediated mechanism of volatile emission. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  10. The ABC-Type Multidrug Resistance Transporter LmrCD Is Responsible for an Extrusion-Based Mechanism of Bile Acid Resistance in Lactococcus lactis

    NARCIS (Netherlands)

    Zaidi, Arsalan Haseeb; Bakkes, Patrick J.; Lubelski, Jacek; Agustiandari, Herfita; Kuipers, Oscar P.; Driessen, Arnold J. M.

    2008-01-01

    Upon prolonged exposure to cholate and other toxic compounds, Lactococcus lactis develops a multidrug resistance phenotype that has been attributed to an elevated expression of the heterodimeric ABC-type multidrug transporter LmrCD. To investigate the molecular basis of bile acid resistance in L.

  11. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  12. Identification of rare high-risk copy number variants affecting the dopamine transporter gene in mental disorders

    DEFF Research Database (Denmark)

    Hoeffding, Louise Kristine Enggaard; Duong, Linh T T; Ingason, Andres

    2016-01-01

    BACKGROUND: The dopamine transporter, also known as solute carrier 6A3 (SLC6A3), plays an important role in synaptic transmission by regulating the reuptake of dopamine in the synapses. In line with this, variations in the gene encoding this transporter have been linked to both schizophrenia and ...

  13. The SlZRT1 Gene Encodes a Plasma Membrane-Located ZIP (Zrt-, Irt-Like Protein Transporter in the Ectomycorrhizal Fungus Suillus luteus

    Directory of Open Access Journals (Sweden)

    Laura Coninx

    2017-11-01

    Full Text Available Zinc (Zn is an essential micronutrient but may become toxic when present in excess. In Zn-contaminated environments, trees can be protected from Zn toxicity by their root-associated micro-organisms, in particular ectomycorrhizal fungi. The mechanisms of cellular Zn homeostasis in ectomycorrhizal fungi and their contribution to the host tree’s Zn status are however not yet fully understood. The aim of this study was to identify and characterize transporters involved in Zn uptake in the ectomycorrhizal fungus Suillus luteus, a cosmopolitan pine mycobiont. Zn uptake in fungi is known to be predominantly governed by members of the ZIP (Zrt/IrtT-like protein family of Zn transporters. Four ZIP transporter encoding genes were identified in the S. luteus genome. By in silico and phylogenetic analysis, one of these proteins, SlZRT1, was predicted to be a plasma membrane located Zn importer. Heterologous expression in yeast confirmed the predicted function and localization of the protein. A gene expression analysis via RT-qPCR was performed in S. luteus to establish whether SlZRT1 expression is affected by external Zn concentrations. SlZRT1 transcripts accumulated almost immediately, though transiently upon growth in the absence of Zn. Exposure to elevated concentrations of Zn resulted in a significant reduction of SlZRT1 transcripts within the first hour after initiation of the exposure. Altogether, the data support a role as cellular Zn importer for SlZRT1 and indicate a key role in cellular Zn uptake of S. luteus. Further research is needed to understand the eventual contribution of SlZRT1 to the Zn status of the host plant.

  14. The SlZRT1 Gene Encodes a Plasma Membrane-Located ZIP (Zrt-, Irt-Like Protein) Transporter in the Ectomycorrhizal Fungus Suillus luteus.

    Science.gov (United States)

    Coninx, Laura; Thoonen, Anneleen; Slenders, Eli; Morin, Emmanuelle; Arnauts, Natascha; Op De Beeck, Michiel; Kohler, Annegret; Ruytinx, Joske; Colpaert, Jan V

    2017-01-01

    Zinc (Zn) is an essential micronutrient but may become toxic when present in excess. In Zn-contaminated environments, trees can be protected from Zn toxicity by their root-associated micro-organisms, in particular ectomycorrhizal fungi. The mechanisms of cellular Zn homeostasis in ectomycorrhizal fungi and their contribution to the host tree's Zn status are however not yet fully understood. The aim of this study was to identify and characterize transporters involved in Zn uptake in the ectomycorrhizal fungus Suillus luteus , a cosmopolitan pine mycobiont. Zn uptake in fungi is known to be predominantly governed by members of the ZIP (Zrt/IrtT-like protein) family of Zn transporters. Four ZIP transporter encoding genes were identified in the S. luteus genome. By in silico and phylogenetic analysis, one of these proteins, SlZRT1, was predicted to be a plasma membrane located Zn importer. Heterologous expression in yeast confirmed the predicted function and localization of the protein. A gene expression analysis via RT-qPCR was performed in S. luteus to establish whether SlZRT1 expression is affected by external Zn concentrations. SlZRT1 transcripts accumulated almost immediately, though transiently upon growth in the absence of Zn. Exposure to elevated concentrations of Zn resulted in a significant reduction of SlZRT1 transcripts within the first hour after initiation of the exposure. Altogether, the data support a role as cellular Zn importer for SlZRT1 and indicate a key role in cellular Zn uptake of S. luteus . Further research is needed to understand the eventual contribution of SlZRT1 to the Zn status of the host plant.

  15. Effect of SOS-induced levels of imuABC on spontaneous and damage-induced mutagenesis in Caulobacter crescentus.

    Science.gov (United States)

    Alves, Ingrid R; Lima-Noronha, Marco A; Silva, Larissa G; Fernández-Silva, Frank S; Freitas, Aline Luiza D; Marques, Marilis V; Galhardo, Rodrigo S

    2017-11-01

    imuABC (imuAB dnaE2) genes are responsible for SOS-mutagenesis in Caulobacter crescentus and other bacterial species devoid of umuDC. In this work, we have constructed operator-constitutive mutants of the imuABC operon. We used this genetic tool to investigate the effect of SOS-induced levels of these genes upon both spontaneous and damage-induced mutagenesis. We showed that constitutive expression of imuABC does not increase spontaneous or damage-induced mutagenesis, nor increases cellular resistance to DNA-damaging agents. Nevertheless, the presence of the operator-constitutive mutation rescues mutagenesis in a recA background, indicating that imuABC are the only genes required at SOS-induced levels for translesion synthesis (TLS) in C. crescentus. Furthermore, these data also show that TLS mediated by ImuABC does not require RecA, unlike umuDC-dependent mutagenesis in E. coli. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  17. Improved fermentation performance of a lager yeast after repair of its AGT1 maltose and maltotriose transporter genes.

    Science.gov (United States)

    Vidgren, Virve; Huuskonen, Anne; Virtanen, Hannele; Ruohonen, Laura; Londesborough, John

    2009-04-01

    The use of more concentrated, so-called high-gravity and very-high-gravity (VHG) brewer's worts for the manufacture of beer has economic and environmental advantages. However, many current strains of brewer's yeasts ferment VHG worts slowly and incompletely, leaving undesirably large amounts of maltose and especially maltotriose in the final beers. alpha-Glucosides are transported into Saccharomyces yeasts by several transporters, including Agt1, which is a good carrier of both maltose and maltotriose. The AGT1 genes of brewer's ale yeast strains encode functional transporters, but the AGT1 genes of the lager strains studied contain a premature stop codon and do not encode functional transporters. In the present work, one or more copies of the AGT1 gene of a lager strain were repaired with DNA sequence from an ale strain and put under the control of a constitutive promoter. Compared to the untransformed strain, the transformants with repaired AGT1 had higher maltose transport activity, especially after growth on glucose (which represses endogenous alpha-glucoside transporter genes) and higher ratios of maltotriose transport activity to maltose transport activity. They fermented VHG (24 degrees Plato) wort faster and more completely, producing beers containing more ethanol and less residual maltose and maltotriose. The growth and sedimentation behaviors of the transformants were similar to those of the untransformed strain, as were the profiles of yeast-derived volatile aroma compounds in the beers.

  18. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  19. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhaojing [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, 430030 Wuhan (China); Xu, Yonghong [Institute of Ophthalmological Research, Department of Ophthalmology, Renmin Hospital of Wuhan University, 430060 Wuhan (China); Meng, Xiangning [School of Materials and Metallurgy, Northeastern University, Shenyang 110819 (China); Watari, Fumio [Department of Biomedical, Dental Materials and Engineering, Graduate School of Dental Medicine, Hokkaido University, Sapporo 060-8586 (Japan); Liu, Hudan, E-mail: hudanliu@hust.edu.cn [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, 430030 Wuhan (China); Chen, Xiao, E-mail: mornsmile@yahoo.com [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, 430030 Wuhan (China)

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  20. Proteomic strategy for the analysis of the polychlorobiphenyl-degrading cyanobacterium Anabaena PD-1 exposed to Aroclor 1254.

    Directory of Open Access Journals (Sweden)

    Hangjun Zhang

    Full Text Available The cyanobacterium Anabaena PD-1, which was originally isolated from polychlorobiphenyl (PCB-contaminated paddy soils, has capabilities for dechlorinatin and for degrading the commercial PCB mixture Aroclor 1254. In this study, 25 upregulated proteins were identified using 2D electrophoresis (2-DE coupled with matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS. These proteins were involved in (i PCB degradation (i.e., 3-chlorobenzoate-3,4-dioxygenase; (ii transport processes [e.g., ATP-binding cassette (ABC transporter substrate-binding protein, amino acid ABC transporter substrate-binding protein, peptide ABC transporter substrate-binding protein, putrescine-binding protein, periplasmic solute-binding protein, branched-chain amino acid uptake periplasmic solute-binding protein, periplasmic phosphate-binding protein, phosphonate ABC transporter substrate-binding protein, and xylose ABC transporter substrate-binding protein]; (iii energetic metabolism (e.g., methanol/ethanol family pyrroloquinoline quinone (PQQ-dependent dehydrogenase, malate-CoA ligase subunit beta, enolase, ATP synthase β subunit, FOF1 ATP synthase subunit beta, ATP synthase α subunit, and IMP cyclohydrolase; (iv electron transport (cytochrome b6f complex Fe-S protein; (v general stress response (e.g., molecular chaperone DnaK, elongation factor G, and translation elongation factor thermostable; (vi carbon metabolism (methanol dehydrogenase and malate-CoA ligase subunit beta; and (vii nitrogen reductase (nitrous oxide reductase. The results of real-time polymerase chain reaction showed that the genes encoding for dioxygenase, ABC transporters, transmembrane proteins, electron transporter, and energetic metabolism proteins were significantly upregulated during PCB degradation. These genes upregulated by 1.26- to 8.98-fold. These findings reveal the resistance and adaptation of cyanobacterium to the presence of PCBs, shedding light on the

  1. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  2. Implementation of the ABC Model in a Company Dealing with Extraction of Raw Materials

    Directory of Open Access Journals (Sweden)

    Radoslav Bajus

    2014-06-01

    Full Text Available ABC method is a new system for accurate product pricing, cost analysis of the causes of individual products and their optimization. The prices of products are accurately taken into account according to all relevant overhead costs in their actual context and relationships. Except of product costs, ABC method follows costs regarding customers, suppliers, distribution, transport, manufacturing, operational and security processes, management processes and other business activities. ABC method sees the company as a complex of interrelated activities and processes. ABC method represents more precise cost calculation for the product. The aim of the present article is to highlight the introduction of the ABC method to the enterprise and compare it with the traditional method. The result is to reduce costs by introducing ABC method to the enterprise.

  3. Microarray analysis of genes affected by salt stress in tomato

    African Journals Online (AJOL)

    LANDA

    isoforms of cytochrome P450, genes for polyamine biosynthesis (putrescine and proline) ..... CAB97048 mitochondrial half-ABC transporter [Arabidopsis thaliana] up .... AAC72194 pyruvate dehydrogenase E1 beta subunit isoform 3 [Zea mays].

  4. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  5. ABC transporter genes and risk of type 2 diabetes

    DEFF Research Database (Denmark)

    Schou, Jesper; Tybjærg-Hansen, Anne; Møller, Holger J

    2012-01-01

    of both genes, were genotyped in the Copenhagen City Heart Study (CCHS) (n = 10,185). Two loss-of-function mutations (ABCA1 N1800H and ABCG1 g.-376C>T) (n = 322) and a common variant (ABCG1 g.-530A>G) were further genotyped in the Copenhagen General Population Study (CGPS) (n = 30,415). RESULTS: Only one...

  6. Identification of a new biocontrol gene in Trichoderma atroviride: the role of an ABC transporter membrane pump in the interaction with different plant-pathogenic fungi.

    Science.gov (United States)

    Ruocco, Michelina; Lanzuise, Stefania; Vinale, Francesco; Marra, Roberta; Turrà, David; Woo, Sheridan Lois; Lorito, Matteo

    2009-03-01

    Successful biocontrol interactions often require that the beneficial microbes involved are resistant or tolerant to a variety of toxicants, including antibiotics produced by themselves or phytopathogens, plant antimicrobial compounds, and synthetic chemicals or contaminants. The ability of Trichoderma spp., the most widely applied biocontrol fungi, to withstand different chemical stresses, including those associated with mycoparasitism, is well known. In this work, we identified an ATP-binding cassette transporter cell membrane pump as an important component of the above indicated resistance mechanisms that appears to be supported by an extensive and powerful cell detoxification system. The encoding gene, named Taabc2, was cloned from a strain of Trichoderma atroviride and characterized. Its expression was found to be upregulated in the presence of pathogen-secreted metabolites, specific mycotoxins and some fungicides, and in conditions that stimulate the production in Trichoderma spp. of antagonism-related factors (toxins and enzymes). The key role of this gene in antagonism and biocontrol was demonstrated by the characterization of the obtained deletion mutants. They suffered an increased susceptibility to inhibitory compounds either secreted by pathogenic fungi or possibly produced by the biocontrol microbe itself and lost, partially or entirely, the ability to protect tomato plants from Pythium ultimum and Rhizoctonia solani attack.

  7. The Absence of the Transcription Factor Yrr1p, Identified from Comparative Genome Profiling, Increased Vanillin Tolerance Due to Enhancements of ABC Transporters Expressing, rRNA Processing and Ribosome Biogenesis in Saccharomyces cerevisiae.

    Science.gov (United States)

    Wang, Xinning; Liang, Zhenzhen; Hou, Jin; Shen, Yu; Bao, Xiaoming

    2017-01-01

    Enhancing the tolerance of Saccharomyces cerevisiae to inhibitors derived from lignocellulose is conducive to producing biofuel and chemicals using abundant lignocellulosic materials. Vanillin is a major type of phenolic inhibitor in lignocellulose hydrolysates for S. cerevisiae . In the present work, the factors beneficial to vanillin resistance in yeast were identified from the vanillin-resistant strain EMV-8, which was derived from strain NAN-27 by adaptive evolution. We found 450 SNPs and 44 genes with InDels in the vanillin-tolerant strain EMV-8 by comparing the genome sequences of EMV-8 and NAN-27. To investigate the effects of InDels, InDels were deleted in BY4741, respectively. We demonstrated that the deletion of YRR1 improved vanillin tolerance of strain. In the presence of 6 mM vanillin, deleting YRR1 increase the maximum specific growth rate and the vanillin consumption rate by 142 and 51%, respectively. The subsequent transcriptome analysis revealed that deleting YRR1 resulted in changed expression of over 200 genes in the presence of 5 mM vanillin. The most marked changes were the significant up-regulation of the dehydrogenase ADH7 , several ATP-binding cassette (ABC) transporters, and dozens of genes involved in ribosome biogenesis and rRNA processing. Coincidently, the crude enzyme solution of BY4741( yrr1 Δ) exhibited higher NADPH-dependent vanillin reduction activity than control. In addition, overexpressing the ABC transporter genes PDR5, YOR1 , and SNQ2 , as well as the RNA helicase gene DBP2 , increased the vanillin tolerance of strain. Interestingly, unlike the marked changes we mentioned above, under vanillin-free conditions, there are only limited transcriptional differences between wildtype and yrr1 Δ. This indicated that vanillin might act as an effector in Yrr1p-related regulatory processes. The new findings of the relationship between YRR1 and vanillin tolerance, as well as the contribution of rRNA processing and ribosome biogenesis to

  8. Transport proteins promoting Escherichia coli pathogenesis

    Science.gov (United States)

    Tang, Fengyi; Saier, Milton H.

    2014-01-01

    Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex receptors and high-affinity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, different from those of extracellular pathogens. The results presented in this report provide information about transport systems relevant to various types of E. coli pathogenesis that can be exploited in future basic and applied studies. PMID:24747185

  9. Transport proteins promoting Escherichia coli pathogenesis.

    Science.gov (United States)

    Tang, Fengyi; Saier, Milton H

    2014-01-01

    Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex receptors and high-affinity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, different from those of extracellular pathogens. The results presented in this report provide information about transport systems relevant to various types of E. coli pathogenesis that can be exploited in future basic and applied studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  11. Downregulation of eIF4G by microRNA-503 enhances drug sensitivity of MCF-7/ADR cells through suppressing the expression of ABC transport proteins.

    Science.gov (United States)

    Pan, Xia; Yang, Xiaoyan; Zang, Jinglei; Zhang, Si; Huang, Nan; Guan, Xinxin; Zhang, Jianhua; Wang, Zhihui; Li, Xi; Lei, Xiaoyong

    2017-06-01

    Overexpression of adenosine triphosphate-binding cassette (ABC) transport protein is emerging as a critical contributor to anticancer drug resistance. The eukaryotic translation initiation factor (eIF) 4F complex, the key modulator of mRNA translation, is regulated by the phosphoinositide 3-kinase-AKT-mammalian target of rapamycin pathway in anticancer drug-resistant tumors. The present study demonstrated the roles of ABC translation protein alterations in the acquisition of the Adriamycin (ADM)-resistant phenotype of MCF-7 human breast cells. Quantitative polymerase chain reaction and western blot analysis were applied to examine the differences in mRNA and protein levels, respectively. It was found that the expression of the ABC sub-family B member 1, ABC sub-family C member 1 and ABC sub-family G member 2 transport proteins were upregulated in MCF-7/ADR cells. An MTT assay was used to detect the cell viability, from the results MCF-7/ADR cells were less sensitive to ADM, tamoxifen (TAM) and taxol (TAX) treatment compared with MCF-7 cells. We predicted that the 3'-untranslated region of eukaryotic translation initiation factor 4-γ 1 (eIF4G) contains a potential miRNA binding site for microRNA (miR)-503 through using computational programs. These binding sites were confirmed by luciferase reporter assays. eIF4G mRNA degradation was accelerated in cells transfected with miR-503 mimics. Furthermore, it was demonstrated that eIF4G and ABC translation proteins were significantly downregulated in MCF-7/ADR cells after transfection with miR-503. It was found that miR-503 mimics could sensitize the cells to treatment with ADM, TAM and TAX. These findings demonstrated for the first time that eIF4G acted as a key factor in MCF-7/ADR cells, and may be an efficient agent for preventing and reversing multi-drug resistance in breast cancer.

  12. Combined phylogeny and neighborhood analysis of the evolution of the ABC transporters conferring multiple drug resistance in hemiascomycete yeasts

    Directory of Open Access Journals (Sweden)

    Goffeau André

    2009-10-01

    Full Text Available Abstract Background Pleiotropic Drug Resistant transporters (PDR are members of the ATP-Binding Cassette (ABC subfamily which export antifungals and other xenobiotics in fungi and plants. This subfamily of transmembrane transporters has nine known members in Saccharomyces cerevisiae. We have analyzed the complex evolution of the pleiotropic drug resistance proteins (Pdrp subfamily where gene duplications and deletions occur independently in individual genomes. This study was carried out on 62 Pdrp from nine hemiascomycetous species, seven of which span 6 of the 14 clades of the Saccharomyces complex while the two others species, Debaryomyces hansenii and Yarrowia lipolytica, are further apart from an evolutive point of view. Results Combined phylogenetic and neighborhood analyses enabled us to identify five Pdrp clusters in the Saccharomyces complex. Three of them comprise orthologs of the Pdrp sensu stricto, Pdr5p, Pdr10p, Pdr12p, Pdr15p, Snq2p and YNR070wp. The evolutive pathway of the orthologs of Snq2 and YNR070w is particularly complex due to a tandem gene array in Eremothecium gossypii, Kluyveromyces lactis and Saccharomyces (Lachancea kluyveri. This pathway and different cases of duplications and deletions were clarified by using a neighborhood analysis based on synteny. For the two distant species, Yarrowia lipolytica and Debaryomyces hansenii, no neighborhood evidence is available for these clusters and many homologs of Pdr5 and Pdr15 are phylogenetically assigned to species-based clusters. Two other clusters comprise the orthologs of the sensu lato Pdrp, Aus1p/Pdr11p and YOL075cp respectively. The evolutionary pathway of these clusters is simpler. Nevertheless, orthologs of these genes are missing in some species. Conclusion Numerous duplications were traced among the Hemiascomycetous Pdrp studied. The role of the Whole Genome Duplication (WGD is sorted out and our analyses confirm the common ancestrality of Pdr5p and Pdr15p. A tandem

  13. Combined phylogeny and neighborhood analysis of the evolution of the ABC transporters conferring multiple drug resistance in hemiascomycete yeasts.

    Science.gov (United States)

    Seret, Marie-Line; Diffels, Julie F; Goffeau, André; Baret, Philippe V

    2009-10-01

    Pleiotropic Drug Resistant transporters (PDR) are members of the ATP-Binding Cassette (ABC) subfamily which export antifungals and other xenobiotics in fungi and plants. This subfamily of transmembrane transporters has nine known members in Saccharomyces cerevisiae. We have analyzed the complex evolution of the pleiotropic drug resistance proteins (Pdrp) subfamily where gene duplications and deletions occur independently in individual genomes. This study was carried out on 62 Pdrp from nine hemiascomycetous species, seven of which span 6 of the 14 clades of the Saccharomyces complex while the two others species, Debaryomyces hansenii and Yarrowia lipolytica, are further apart from an evolutive point of view. Combined phylogenetic and neighborhood analyses enabled us to identify five Pdrp clusters in the Saccharomyces complex. Three of them comprise orthologs of the Pdrp sensu stricto, Pdr5p, Pdr10p, Pdr12p, Pdr15p, Snq2p and YNR070wp. The evolutive pathway of the orthologs of Snq2 and YNR070w is particularly complex due to a tandem gene array in Eremothecium gossypii, Kluyveromyces lactis and Saccharomyces (Lachancea) kluyveri. This pathway and different cases of duplications and deletions were clarified by using a neighborhood analysis based on synteny. For the two distant species, Yarrowia lipolytica and Debaryomyces hansenii, no neighborhood evidence is available for these clusters and many homologs of Pdr5 and Pdr15 are phylogenetically assigned to species-based clusters. Two other clusters comprise the orthologs of the sensu lato Pdrp, Aus1p/Pdr11p and YOL075cp respectively. The evolutionary pathway of these clusters is simpler. Nevertheless, orthologs of these genes are missing in some species. Numerous duplications were traced among the Hemiascomycetous Pdrp studied. The role of the Whole Genome Duplication (WGD) is sorted out and our analyses confirm the common ancestrality of Pdr5p and Pdr15p. A tandem gene array is observed in Eremothecium gossypii. One

  14. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  15. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  16. Characterization of acquired paclitaxel resistance of breast cancer cells and involvement of ABC transporters

    International Nuclear Information System (INIS)

    Němcová-Fürstová, Vlasta; Kopperová, Dana; Balušíková, Kamila; Ehrlichová, Marie; Brynychová, Veronika; Václavíková, Radka; Daniel, Petr; Souček, Pavel; Kovář, Jan

    2016-01-01

    Development of taxane resistance has become clinically very important issue. The molecular mechanisms underlying the resistance are still unclear. To address this issue, we established paclitaxel-resistant sublines of the SK-BR-3 and MCF-7 breast cancer cell lines that are capable of long-term proliferation in 100 nM and 300 nM paclitaxel, respectively. Application of these concentrations leads to cell death in the original counterpart cells. Both sublines are cross-resistant to doxorubicin, indicating the presence of the MDR phenotype. Interestingly, resistance in both paclitaxel-resistant sublines is circumvented by the second-generation taxane SB-T-1216. Moreover, we demonstrated that it was not possible to establish sublines of SK-BR-3 and MCF-7 cells resistant to this taxane. It means that at least the tested breast cancer cells are unable to develop resistance to some taxanes. Employing mRNA expression profiling of all known human ABC transporters and subsequent Western blot analysis of the expression of selected transporters, we demonstrated that only the ABCB1/PgP and ABCC3/MRP3 proteins were up-regulated in both paclitaxel-resistant sublines. We found up-regulation of ABCG2/BCRP and ABCC4 proteins only in paclitaxel-resistant SK-BR-3 cells. In paclitaxel-resistant MCF-7 cells, ABCB4/MDR3 and ABCC2/MRP2 proteins were up-regulated. Silencing of ABCB1 expression using specific siRNA increased significantly, but did not completely restore full sensitivity to both paclitaxel and doxorubicin. Thus we showed a key, but not exclusive, role for ABCB1 in mechanisms of paclitaxel resistance. It suggests the involvement of multiple mechanisms in paclitaxel resistance in tested breast cancer cells. - Highlights: • Expression of all ABC transporters in paclitaxel-resistant sublines of SK-BR-3 and MCF-7 cells was analyzed. • SK-BR-3 and MCF-7 cells are unable to develop resistance to some taxanes. • Some taxanes are able to overcome developed resistance to

  17. Characterization of acquired paclitaxel resistance of breast cancer cells and involvement of ABC transporters

    Energy Technology Data Exchange (ETDEWEB)

    Němcová-Fürstová, Vlasta, E-mail: vlasta.furstova@lf3.cuni.cz [Division of Cell and Molecular Biology, Third Faculty of Medicine, Charles University, Prague (Czech Republic); Kopperová, Dana; Balušíková, Kamila [Division of Cell and Molecular Biology, Third Faculty of Medicine, Charles University, Prague (Czech Republic); Ehrlichová, Marie; Brynychová, Veronika; Václavíková, Radka [Toxicogenomics Unit, National Institute of Public Health, Prague (Czech Republic); Daniel, Petr [Division of Cell and Molecular Biology, Third Faculty of Medicine, Charles University, Prague (Czech Republic); Souček, Pavel [Toxicogenomics Unit, National Institute of Public Health, Prague (Czech Republic); Kovář, Jan [Division of Cell and Molecular Biology, Third Faculty of Medicine, Charles University, Prague (Czech Republic)

    2016-11-01

    Development of taxane resistance has become clinically very important issue. The molecular mechanisms underlying the resistance are still unclear. To address this issue, we established paclitaxel-resistant sublines of the SK-BR-3 and MCF-7 breast cancer cell lines that are capable of long-term proliferation in 100 nM and 300 nM paclitaxel, respectively. Application of these concentrations leads to cell death in the original counterpart cells. Both sublines are cross-resistant to doxorubicin, indicating the presence of the MDR phenotype. Interestingly, resistance in both paclitaxel-resistant sublines is circumvented by the second-generation taxane SB-T-1216. Moreover, we demonstrated that it was not possible to establish sublines of SK-BR-3 and MCF-7 cells resistant to this taxane. It means that at least the tested breast cancer cells are unable to develop resistance to some taxanes. Employing mRNA expression profiling of all known human ABC transporters and subsequent Western blot analysis of the expression of selected transporters, we demonstrated that only the ABCB1/PgP and ABCC3/MRP3 proteins were up-regulated in both paclitaxel-resistant sublines. We found up-regulation of ABCG2/BCRP and ABCC4 proteins only in paclitaxel-resistant SK-BR-3 cells. In paclitaxel-resistant MCF-7 cells, ABCB4/MDR3 and ABCC2/MRP2 proteins were up-regulated. Silencing of ABCB1 expression using specific siRNA increased significantly, but did not completely restore full sensitivity to both paclitaxel and doxorubicin. Thus we showed a key, but not exclusive, role for ABCB1 in mechanisms of paclitaxel resistance. It suggests the involvement of multiple mechanisms in paclitaxel resistance in tested breast cancer cells. - Highlights: • Expression of all ABC transporters in paclitaxel-resistant sublines of SK-BR-3 and MCF-7 cells was analyzed. • SK-BR-3 and MCF-7 cells are unable to develop resistance to some taxanes. • Some taxanes are able to overcome developed resistance to

  18. ATP Binding cassette transporter gene expression in rat liver progenitor cells

    NARCIS (Netherlands)

    Ros, J.E.; Roskams, T.A.D.; Geuken, M.; Havinga, R.; Splinter, P.L.; Petersen, B.E.; LaRusso, N.F.; Kolk, van der D.M.; Kuipers, F.; Faber, K.N.; Müller, M.R.; Jansen, P.L.M.

    2003-01-01

    Background and aim: Liver regeneration after severe liver damage depends in part on proliferation and differentiation of hepatic progenitor cells (HPCs). Under these conditions they must be able to withstand the toxic milieu of the damaged liver. ATP binding cassette (ABC) transporters are

  19. ATP binding cassette transporter gene expression in rat liver progenitor cells

    NARCIS (Netherlands)

    Ros, J. E.; Roskams, T. A. D.; Geuken, M.; Havinga, R.; Splinter, P. L.; Petersen, B. E.; LaRusso, N. F.; van der Kolk, D. M.; Kuipers, F.; Faber, K. N.; Müller, M.; Jansen, P. L. M.

    2003-01-01

    BACKGROUND AND AIM: Liver regeneration after severe liver damage depends in part on proliferation and differentiation of hepatic progenitor cells (HPCs). Under these conditions they must be able to withstand the toxic milieu of the damaged liver. ATP binding cassette (ABC) transporters are

  20. ATP binding cassette transporter gene expression in rat liver progenitor cells

    NARCIS (Netherlands)

    Ros, J.E.; Roskams, TAD; Geuken, M; Havinga, R; Splinter, PL; Petersen, BE; LaRusso, NF; van der Kolk, D.M.; Kuipers, F; Faber, KN; Muller, M; Jansen, PLM

    Background and aim: Liver regeneration after severe liver damage depends in part on proliferation and differentiation of hepatic progenitor cells (HPCs). Under these conditions they must be able to withstand the toxic milieu of the damaged liver. ATP binding cassette (ABC) transporters are

  1. An ATP-binding cassette subfamily G full transporter is essential for the retention of leaf water in both wild barley and rice.

    Science.gov (United States)

    Chen, Guoxiong; Komatsuda, Takao; Ma, Jian Feng; Nawrath, Christiane; Pourkheirandish, Mohammad; Tagiri, Akemi; Hu, Yin-Gang; Sameri, Mohammad; Li, Xinrong; Zhao, Xin; Liu, Yubing; Li, Chao; Ma, Xiaoying; Wang, Aidong; Nair, Sudha; Wang, Ning; Miyao, Akio; Sakuma, Shun; Yamaji, Naoki; Zheng, Xiuting; Nevo, Eviatar

    2011-07-26

    Land plants have developed a cuticle preventing uncontrolled water loss. Here we report that an ATP-binding cassette (ABC) subfamily G (ABCG) full transporter is required for leaf water conservation in both wild barley and rice. A spontaneous mutation, eibi1.b, in wild barley has a low capacity to retain leaf water, a phenotype associated with reduced cutin deposition and a thin cuticle. Map-based cloning revealed that Eibi1 encodes an HvABCG31 full transporter. The gene was highly expressed in the elongation zone of a growing leaf (the site of cutin synthesis), and its gene product also was localized in developing, but not in mature tissue. A de novo wild barley mutant named "eibi1.c," along with two transposon insertion lines of rice mutated in the ortholog of HvABCG31 also were unable to restrict water loss from detached leaves. HvABCG31 is hypothesized to function as a transporter involved in cutin formation. Homologs of HvABCG31 were found in green algae, moss, and lycopods, indicating that this full transporter is highly conserved in the evolution of land plants.

  2. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  3. Sulfate Transporters in Dissimilatory Sulfate Reducing Microorganisms: A Comparative Genomics Analysis

    Directory of Open Access Journals (Sweden)

    Angeliki Marietou

    2018-03-01

    Full Text Available The first step in the sulfate reduction pathway is the transport of sulfate across the cell membrane. This uptake has a major effect on sulfate reduction rates. Much of the information available on sulfate transport was obtained by studies on assimilatory sulfate reduction, where sulfate transporters were identified among several types of protein families. Despite our growing knowledge on the physiology of dissimilatory sulfate-reducing microorganisms (SRM there are no studies identifying the proteins involved in sulfate uptake in members of this ecologically important group of anaerobes. We surveyed the complete genomes of 44 sulfate-reducing bacteria and archaea across six phyla and identified putative sulfate transporter encoding genes from four out of the five surveyed protein families based on homology. We did not find evidence that ABC-type transporters (SulT are involved in the uptake of sulfate in SRM. We speculate that members of the CysP sulfate transporters could play a key role in the uptake of sulfate in thermophilic SRM. Putative CysZ-type sulfate transporters were present in all genomes examined suggesting that this overlooked group of sulfate transporters might play a role in sulfate transport in dissimilatory sulfate reducers alongside SulP. Our in silico analysis highlights several targets for further molecular studies in order to understand this key step in the metabolism of SRMs.

  4. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  5. Candidate genes for performance in horses, including monocarboxylate transporters

    Directory of Open Access Journals (Sweden)

    Inaê Cristina Regatieri

    Full Text Available ABSTRACT: Some horse breeds are highly selected for athletic activities. The athletic potential of each animal can be measured by its performance in sports. High athletic performance depends on the animal capacity to produce energy through aerobic and anaerobic metabolic pathways, among other factors. Transmembrane proteins called monocarboxylate transporters, mainly the isoform 1 (MCT1 and its ancillary protein CD147, can help the organism to adapt to physiological stress caused by physical exercise, transporting lactate and H+ ions. Horse breeds are selected for different purposes so we might expect differences in the amount of those proteins and in the genotypic frequencies for genes that play a significant role in the performance of the animals. The study of MCT1 and CD147 gene polymorphisms, which can affect the formation of the proteins and transport of lactate and H+, can provide enough information to be used for selection of athletic horses increasingly resistant to intense exercise. Two other candidate genes, the PDK4 and DMRT3, have been associated with athletic potential and indicated as possible markers for performance in horses. The oxidation of fatty acids is highly effective in generating ATP and is controlled by the expression of PDK4 (pyruvate dehydrogenase kinase, isozyme 4 in skeletal muscle during and after exercise. The doublesex and mab-3 related transcription factor 3 (DMRT3 gene encodes an important transcription factor in the setting of spinal cord circuits controlling movement in vertebrates and may be associated with gait performance in horses. This review describes how the monocarboxylate transporters work during physical exercise in athletic horses and the influence of polymorphisms in candidate genes for athletic performance in horses.

  6. Effect of iron on expression of efflux pump (adeABC) and quorum sensing (luxI, luxR) genes in clinical isolates of Acinetobacter baumannii.

    Science.gov (United States)

    Modarresi, Farzan; Azizi, Omid; Shakibaie, Mohammad Reza; Motamedifar, Mohammad; Valibeigi, Behnaz; Mansouri, Shahla

    2015-11-01

    Resistance-nodulation-division efflux system (RND) adeABC contributes to intrinsic resistance to various drug classes in Acinetobacter baumannii. Similarly, quorum sensing (QS) plays an important role in the biofilm formation and pathogenicity of this bacterium. The aims of this study were to evaluate the influence of iron limitation on the expression of efflux pump (adeABC) genes and QS (luxI, luxR) system by relative quantitative real-time polymerase chain reaction (qRT-PCR). In addition, DNA sequence and phylogenetic relatedness of biofilm-associated protein (Bap) gene was also investigated. Sixty-five multidrug-resistant isolates of A. baumannii were recovered from ICU patients of three hospitals in Kerman, Iran. The isolates were highly resistant to at least 11 antibiotics (MIC ≥64 μg/mL); however, 87% and 89% were susceptible to colistin and tigecycline, respectively (MIC 0.05 μg/mL) (p ≤ 0.05). We detected the presence of RND efflux pump, QS, and bap genes with the frequencies of 92% (adeA), 61.5% (adeB), 84.6% (adeC), 80% (luxI), 61% (luxR), and 66% (bap), respectively. qRT-PCR analysis showed that in some isolates, expression of both adeABC and luxI/R was increased more than fourfold in the presence of low iron (20 μm), suggesting the additional regulatory role of iron on both efflux pump and QS system. Alignment and phylogenetic analysis on the strong biofilm forming isolates confirmed that the fragments amplified were indeed part of bap gene and deduced sequence was similar to A. baumannii K9B410. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  7. Purification and biochemical characterization of NpABCG5/NpPDR5, a plant pleiotropic drug resistance transporter expressed in Nicotiana tabacum BY-2 suspension cells.

    Science.gov (United States)

    Toussaint, Frédéric; Pierman, Baptiste; Bertin, Aurélie; Lévy, Daniel; Boutry, Marc

    2017-05-04

    Pleiotropic drug resistance (PDR) transporters belong to the ABCG subfamily of ATP-binding cassette (ABC) transporters and are involved in the transport of various molecules across plasma membranes. During evolution, PDR genes appeared independently in fungi and in plants from a duplication of a half-size ABC gene. The enzymatic properties of purified PDR transporters from yeast have been characterized. This is not the case for any plant PDR transporter, or, incidentally, for any purified plant ABC transporter. Yet, plant PDR transporters play important roles in plant physiology such as hormone signaling or resistance to pathogens or herbivores. Here, we describe the expression, purification, enzymatic characterization and 2D analysis by electron microscopy of NpABCG5/NpPDR5 from Nicotiana plumbaginifolia , which has been shown to be involved in the plant defense against herbivores. We constitutively expressed NpABCG5/NpPDR5, provided with a His-tag in a homologous system: suspension cells from Nicotiana tabacum (Bright Yellow 2 line). NpABCG5/NpPDR5 was targeted to the plasma membrane and was solubilized by dodecyl maltoside and purified by Ni-affinity chromatography. The ATP-hydrolyzing specific activity (27 nmol min -1  mg -1 ) was stimulated seven-fold in the presence of 0.1% asolectin. Electron microscopy analysis indicated that NpABCG5/NpPDR5 is monomeric and with dimensions shorter than those of known ABC transporters. Enzymatic data (optimal pH and sensitivity to inhibitors) confirmed that plant and fungal PDR transporters have different properties. These data also show that N. tabacum suspension cells are a convenient host for the purification and biochemical characterization of ABC transporters. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  8. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  9. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  10. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  11. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  12. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  13. The cabABC Operon Essential for Biofilm and Rugose Colony Development in Vibrio vulnificus.

    Directory of Open Access Journals (Sweden)

    Jin Hwan Park

    2015-09-01

    Full Text Available A transcriptome analysis identified Vibrio vulnificus cabABC genes which were preferentially expressed in biofilms. The cabABC genes were transcribed as a single operon. The cabA gene was induced by elevated 3',5'-cyclic diguanylic acid (c-di-GMP and encoded a calcium-binding protein CabA. Comparison of the biofilms produced by the cabA mutant and its parent strain JN111 in microtiter plates using crystal-violet staining demonstrated that CabA contributed to biofilm formation in a calcium-dependent manner under elevated c-di-GMP conditions. Genetic and biochemical analyses revealed that CabA was secreted to the cell exterior through functional CabB and CabC, distributed throughout the biofilm matrix, and produced as the biofilm matured. These results, together with the observation that CabA also contributes to the development of rugose colony morphology, indicated that CabA is a matrix-associated protein required for maturation, rather than adhesion involved in the initial attachment, of biofilms. Microscopic comparison of the structure of biofilms produced by JN111 and the cabA mutant demonstrated that CabA is an extracellular matrix component essential for the development of the mature biofilm structures in flow cells and on oyster shells. Exogenously providing purified CabA restored the biofilm- and rugose colony-forming abilities of the cabA mutant when calcium was available. Circular dichroism and size exclusion analyses revealed that calcium binding induces CabA conformational changes which may lead to multimerization. Extracellular complementation experiments revealed that CabA can assemble a functional matrix only when exopolysaccharides coexist. Consequently, the combined results suggested that CabA is a structural protein of the extracellular matrix and multimerizes to a conformation functional in building robust biofilms, which may render V. vulnificus to survive in hostile environments and reach a concentrated infective dose.

  14. Point mutations in a nucleoside transporter gene from Leishmania donovani confer drug resistance and alter substrate selectivity

    OpenAIRE

    Vasudevan, Gayatri; Ullman, Buddy; Landfear, Scott M.

    2001-01-01

    Leishmania parasites lack a purine biosynthetic pathway and depend on surface nucleoside and nucleobase transporters to provide them with host purines. Leishmania donovani possess two closely related genes that encode high affinity adenosine-pyrimidine nucleoside transporters LdNT1.1 and LdNT1.2 and that transport the toxic adenosine analog tubercidin in addition to the natural substrates. In this study, we have characterized a drug-resistant clonal mutant of L. do...

  15. Identification and Characterization of EctR1, a New Transcriptional Regulator of the Ectoine Biosynthesis Genes in the Halotolerant Methanotroph Methylomicrobium alcaliphilum 20Z▿ †

    OpenAIRE

    Mustakhimov, Ildar I.; Reshetnikov, Alexander S.; Glukhov, Anatoly S.; Khmelenina, Valentina N.; Kalyuzhnaya, Marina G.; Trotsenko, Yuri A.

    2009-01-01

    Genes encoding key enzymes of the ectoine biosynthesis pathway in the halotolerant obligate methanotroph Methylomicrobium alcaliphilum 20Z have been shown to be organized into an ectABC-ask operon. Transcription of the ect operon is initiated from two promoters, ectAp1 and ectAp2 (ectAp1p2), similar to the σ70-dependent promoters of Escherichia coli. Upstream of the gene cluster, an open reading frame (ectR1) encoding a MarR-like transcriptional regulator was identified. Investigation of the ...

  16. aprABC: A Mycobacterium tuberculosis complex-specific locus that modulates pH-driven adaptation to the macrophage phagosome

    Science.gov (United States)

    Abramovitch, Robert B.; Rohde, Kyle H.; Hsu, Fong-Fu; Russell, David G.

    2011-01-01

    Summary Following phagocytosis by macrophages, Mycobacterium tuberculosis (Mtb) senses the intracellular environment and remodels its gene expression for growth in the phagosome. We have identified an Acid and Phagosome Regulated (aprABC) locus that is unique to the Mtb complex and whose gene expression is induced during growth in acidic environments in vitro and in macrophages. Using the aprA promoter, we generated a strain that exhibits high levels of inducible fluorescence in response to growth in acidic medium in vitro and in macrophages. aprABC expression is dependent on the two-component regulator phoPR, linking phoPR signaling to pH sensing. Deletion of the aprABC locus causes defects in gene expression that impact aggregation, intracellular growth, and the relative levels of storage and cell wall lipids. We propose a model where phoPR senses the acidic pH of the phagosome and induces aprABC expression to fine-tune processes unique for intracellular adaptation of Mtb complex bacteria. PMID:21401735

  17. Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind

    2015-01-01

    transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...

  18. Structural elucidation of transmembrane domain zero (TMD0) of EcdL: A multidrug resistance-associated protein (MRP) family of ATP-binding cassette transporter protein revealed by atomistic simulation.

    Science.gov (United States)

    Bera, Krishnendu; Rani, Priyanka; Kishor, Gaurav; Agarwal, Shikha; Kumar, Antresh; Singh, Durg Vijay

    2017-09-20

    ATP-Binding cassette (ABC) transporters play an extensive role in the translocation of diverse sets of biologically important molecules across membrane. EchnocandinB (antifungal) and EcdL protein of Aspergillus rugulosus are encoded by the same cluster of genes. Co-expression of EcdL and echinocandinB reflects tightly linked biological functions. EcdL belongs to Multidrug Resistance associated Protein (MRP) subfamily of ABC transporters with an extra transmembrane domain zero (TMD0). Complete structure of MRP subfamily comprising of TMD0 domain, at atomic resolution is not known. We hypothesized that the transportation of echonocandinB is mediated via EcdL protein. Henceforth, it is pertinent to know the topological arrangement of TMD0, with other domains of protein and its possible role in transportation of echinocandinB. Absence of effective template for TMD0 domain lead us to model by I-TASSER, further structure has been refined by multiple template modelling using homologous templates of remaining domains (TMD1, NBD1, TMD2, NBD2). The modelled structure has been validated for packing, folding and stereochemical properties. MD simulation for 0.1 μs has been carried out in the biphasic environment for refinement of modelled protein. Non-redundant structures have been excavated by clustering of MD trajectory. The structural alignment of modelled structure has shown Z-score -37.9; 31.6, 31.5 with RMSD; 2.4, 4.2, 4.8 with ABC transporters; PDB ID 4F4C, 4M1 M, 4M2T, respectively, reflecting the correctness of structure. EchinocandinB has been docked to the modelled as well as to the clustered structures, which reveals interaction of echinocandinB with TMD0 and other TM helices in the translocation path build of TMDs.

  19. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  20. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    Science.gov (United States)

    Lu, C.; Fedoroff, N.

    2000-01-01

    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  1. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  2. Hepatic ABC transporters and triglyceride metabolism.

    Science.gov (United States)

    Parks, John S; Chung, Soonkyu; Shelness, Gregory S

    2012-06-01

    Elevated plasma triglyceride and reduced HDL concentrations are prominent features of metabolic syndrome and type 2 diabetes. Individuals with Tangier disease also have elevated plasma triglyceride concentrations and very low HDL, resulting from mutations in ATP-binding cassette transporter A1 (ABCA1), an integral membrane protein that facilitates nascent HDL particle assembly. Past studies attributed the inverse relationship between plasma HDL and triglyceride to intravascular lipid exchange and catabolic events. However, recent studies also suggest that hepatic signaling and lipid mobilization and secretion may explain how HDL affects plasma triglyceride concentrations. Hepatocyte-specific ABCA1 knockout mice have markedly reduced plasma HDL and a two-fold increase in triglyceride due to failure to assemble nascent HDL particles by hepatocytes, causing increased catabolism of HDL apolipoprotein A-I and increased hepatic production of triglyceride-enriched VLDL. In-vitro studies suggest that nascent HDL particles may induce signaling to decrease triglyceride secretion. Inhibition of microRNA 33 expression in nonhuman primates augments hepatic ABCA1, genes involved in fatty acid oxidation, and decreases expression of lipogenic genes, causing increased plasma HDL and decreased triglyceride levels. New evidence suggests potential mechanisms by which hepatic ABCA1-mediated nascent HDL formation regulates VLDL-triglyceride production and contributes to the inverse relationship between plasma HDL and triglyceride.

  3. Constitutive synthesis of a transport function encoded by the Thiobacillus ferrooxidans merC gene cloned in Escherichia coli

    International Nuclear Information System (INIS)

    Kusano, Tomonobu; Ji, Guangyong; Silver, S.; Inoue, Chihiro

    1990-01-01

    Mercuric reductase activity determined by the Thiobacillus ferrooxidans merA gene (cloned and expressed constitutively in Escherichia coli) was measured by volatilization of 203 Hg 2+ . (The absence of a merR regulatory gene in the cloned Thiobacillus mer determinant provides a basis for the constitutive synthesis of this system.) In the absence of the Thiobacillus merC transport gene, the mercury volatilization activity was cryptic and was not seen with whole cells but only with sonication-disrupted cells. The Thiobacillus merC transport function was compared with transport via the merT-merP system of plasmid pDU1358. Both systems, cloned and expressed in E. coli, governed enhanced uptake of 203 Hg 2+ in a temperature- and concentration-dependent fashion. Uptake via MerT-MerP was greater and conferred greater hypersensitivity to Hg 2+ than did uptake with MerC. Mercury uptake was inhibited by N-ethylmaleimide but not by EDTA. Ag + salts inhibited mercury uptake by the MerT-MerP system but did not inhibit uptake via MerC. Radioactive mercury accumulated by the MerT-MerP and by the MerC systems was exchangeable with nonradioactive Hg 2+

  4. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  5. Screening for impact of popular herbs improving mental abilities on the transcriptional level of brain transporters

    Directory of Open Access Journals (Sweden)

    Mrozikiewicz Przemyslaw M.

    2014-06-01

    Full Text Available There are a number of compounds that can modify the activity of ABC (ATP-binding cassette and SLC (solute carrier transporters in the blood-brain barrier (BBB. The aim of this study was to investigate the effect of natural and synthetic substances on the expression level of genes encoding transporters present in the BBB (mdr1a, mdr1b, mrp1, mrp2, oatp1a4, oatp1a5 and oatp1c1. Our results showed that verapamil caused the greatest reduction in the mRNA level while other synthetic (piracetam, phenobarbital and natural (codeine, cyclosporine A, quercetin substances showed a selective inhibitory effect. Further, the extract from the roots of Panax ginseng C. A. Meyer exhibited a decrease of transcription against selected transporters whereas the extract from Ginkgo biloba L. leaves resulted in an increase of the expression level of tested genes, except for mrp2. Extract from the aerial parts of Hypericum perforatum L. was the only one to cause an increased mRNA level for mdr1 and oatp1c1. These findings suggest that herbs can play an important role in overcoming the BBB and multidrug resistance to pharmacotherapy of brain cancer and mental disorders, based on the activity of selected drug-metabolizing enzymes and transporters located in the BBB

  6. Knock-down of ABCE1 gene induces G1/S arrest in human oral cancer cells

    OpenAIRE

    Wang, Lei; Zhang, Mei; Liu, Dong-Xu

    2014-01-01

    Purpose: This study aims to explore the clinical characteristics of ATP binding cassette E1 (ABCE1) in oral squamous cell carcinomas (OSCC) and its roles in the proliferation, invasiveness, migration and apoptosis of the human oral squamous cell carcinoma cells CAL-27. Methods: The expression of ABCE1 and its target protein-RNase L, were first studied in tumor tissues of OSCC and adjacent non-tumor tissues. Moreover, CAL-27cells were transfected by ABCE1-specific shRNA, then MTT assay, the tr...

  7. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  8. Characterization of the sulfate uptake and assimilation pathway from Xanthomonas citri - targets for bacterial growth inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Tambascia, C.; Balan, A. [Laboratorio Nacional de Biociencias - LNBIO, Campinas, SP (Brazil)

    2012-07-01

    Full text: Microorganisms require sulfur for growth and obtain it either for inorganic sulfate or organosulfur compounds. ATP-Binding Cassete (SulT family) or major facilitator superfamily-type (SulP) transporters are responsible for the sulfate transport into the cell. In Xanthomonas citri, the phytopathogenic bacterium that causes the canker citrus disease, there are no reports related to the importance of these transporters during in vitro or in vivo infection. We identified in X. citri genome all the genes that belong to the well-characterized cys regulon from Escherichia coli and Salmonella typhimurium, which includes three ABC transporters and all the enzymes necessary for sulfate oxide reduction to sulfide and cysteine. Once these genes have been shown to be extremely important for bacteria growth and development in different environments, we chose the sbpcysWUA and cysDNCHIJG operons, which encodes the ABC inorganic sulfate ABC transporter and all the enzymes necessary for conversion of sulfate in cysteine, respectively. As a step for crystallization trials and resolution of their tridimensional structures, the referred genes were amplified and cloned into the cloning vector pGEM T-easy. In addition, using bioinformatics tools and molecular modeling we characterized all the protein functions as well as built tridimensional models of their structure for determination of the active sites. The importance of each protein is discussed aiming the discovery of a good target for development of inhibitors that could block the bacterium growth. (author)

  9. Characterization of the sulfate uptake and assimilation pathway from Xanthomonas citri - targets for bacterial growth inhibitors

    International Nuclear Information System (INIS)

    Tambascia, C.; Balan, A.

    2012-01-01

    Full text: Microorganisms require sulfur for growth and obtain it either for inorganic sulfate or organosulfur compounds. ATP-Binding Cassete (SulT family) or major facilitator superfamily-type (SulP) transporters are responsible for the sulfate transport into the cell. In Xanthomonas citri, the phytopathogenic bacterium that causes the canker citrus disease, there are no reports related to the importance of these transporters during in vitro or in vivo infection. We identified in X. citri genome all the genes that belong to the well-characterized cys regulon from Escherichia coli and Salmonella typhimurium, which includes three ABC transporters and all the enzymes necessary for sulfate oxide reduction to sulfide and cysteine. Once these genes have been shown to be extremely important for bacteria growth and development in different environments, we chose the sbpcysWUA and cysDNCHIJG operons, which encodes the ABC inorganic sulfate ABC transporter and all the enzymes necessary for conversion of sulfate in cysteine, respectively. As a step for crystallization trials and resolution of their tridimensional structures, the referred genes were amplified and cloned into the cloning vector pGEM T-easy. In addition, using bioinformatics tools and molecular modeling we characterized all the protein functions as well as built tridimensional models of their structure for determination of the active sites. The importance of each protein is discussed aiming the discovery of a good target for development of inhibitors that could block the bacterium growth. (author)

  10. Accelerated bridge construction (ABC) decision making and economic modeling tool.

    Science.gov (United States)

    2011-12-01

    In this FHWA-sponsored pool funded study, a set of decision making tools, based on the Analytic Hierarchy Process (AHP) was developed. This tool set is prepared for transportation specialists and decision-makers to determine if ABC is more effective ...

  11. Enhancing the ABC Cross

    OpenAIRE

    Euske, K.J.; Vercio, Alan

    2007-01-01

    The purpose of the ABC Cross was to portray both a cost and process view of an organization as simply as possible. Unfortunately, the model’s simplified form does not capture the real value of activity-based costing (ABC) for cost accounting that emerged in the mid-1980s. Here we present several ABC models that can help functional and process managers make better decisions.

  12. ATP-binding cassette transporters in reproduction: a new frontier

    Science.gov (United States)

    Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.

    2016-01-01

    BACKGROUND The transmembrane ATP-binding cassette (ABC) transporters actively efflux an array of clinically relevant compounds across biological barriers, and modulate biodistribution of many physiological and pharmacological factors. To date, over 48 ABC transporters have been identified and shown to be directly and indirectly involved in peri-implantation events and fetal/placental development. They efflux cholesterol, steroid hormones, vitamins, cytokines, chemokines, prostaglandins, diverse xenobiotics and environmental toxins, playing a critical role in regulating drug disposition, immunological responses and lipid trafficking, as well as preventing fetal accumulation of drugs and environmental toxins. METHODS This review examines ABC transporters as important mediators of placental barrier functions and key reproductive processes. Expression, localization and function of all identified ABC transporters were systematically reviewed using PubMed and Google Scholar websites to identify relevant studies examining ABC transporters in reproductive tissues in physiological and pathophysiological states. Only reports written in English were incorporated with no restriction on year of publication. While a major focus has been placed on the human, extensive evidence from animal studies is utilized to describe current understanding of the regulation and function of ABC transporters relevant to human reproduction. RESULTS ABC transporters are modulators of steroidogenesis, fertilization, implantation, nutrient transport and immunological responses, and function as ‘gatekeepers’ at various barrier sites (i.e. blood-testes barrier and placenta) against potentially harmful xenobiotic factors, including drugs and environmental toxins. These roles appear to be species dependent and change as a function of gestation and development. The best-described ABC transporters in reproductive tissues (primarily in the placenta) are the multidrug transporters p-glycoprotein and

  13. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  14. Expression of a human gene for polyamine transport in Chinese-hamster ovary cells.

    Science.gov (United States)

    Byers, T L; Wechter, R; Nuttall, M E; Pegg, A E

    1989-01-01

    A molecular-genetic approach towards isolating mammalian polyamine-transport genes and their encoded proteins was devised involving the production of Chinese-hamster ovary (CHO) cells expressing a human polyamine-transport protein. CHO cells and a polyamine-transport-deficient CHO mutant cell line (CHOMG) were equally sensitive to the antiproliferative effects of alpha-difluoromethylornithine (DFMO), which blocked endogenous polyamine synthesis. Exposure to exogenous polyamines increased intracellular polyamine levels and reversed this DFMO-induced cytostasis in the CHO cells, but not in the CHOMG cells. CHOMG cells were therefore transfected with human DNA (isolated from HT-29 colon carcinoma cells) and cells expressing the human polyamine-transport system were identified by the ability of these cells to grow in a medium containing DFMO and polyamines. A number of different positive clones were identified and shown to have the capacity for polyamine uptake and an increased sensitivity to the toxic effects of the polyamine analogue methylglyoxal bis(guanylhydrazone). Differences in these properties between the clones are consistent with a multiplicity of polyamine-transport systems. Some clones also showed a change in growth characteristics, which may indicate a relationship between genes involved in the polyamine-transport system and in cell proliferation. PMID:2512913

  15. Constitutive mRNA expression and protein activity levels of nine ABC efflux transporters in seven permanent cell lines derived from different tissues of rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Fischer, Stephan; Loncar, Jovica; Zaja, Roko; Schnell, Sabine; Schirmer, Kristin; Smital, Tvrtko; Luckenbach, Till

    2011-01-25

    Permanent fish cell lines have become common model systems for determining ecotoxicological effects of pollutants. For these cell lines little is known on the cellular active transport mechanisms that control the amount of a compound entering the cell, such as the MXR (multixenobiotic resistance) system mediated by ATP binding cassette (ABC) transport proteins. Therefore, for toxic evaluation of chemicals with those cells information on MXR is important. We here present data on constitutive mRNA expression and protein activity levels of a series of ABC efflux transporters in seven permanent cell lines derived from liver (RTL-W1; R1) and liver hepatoma (RTH-149), gill (RTgill-W1), gonad (RTG-2), gut (RTgutGC) and brain (RTbrain) of rainbow trout (Oncorhynchus mykiss). In addition to known transporters abcb1 (designated here abcb1a), abcb11, abcc1-3, abcc5 and abcg2, we quantified expression levels of a newly identified abcb1 isoform (abcb1b) and abcc4, previously unknown in trout. Quantitative real time PCR (qPCR) indicated that mRNA of the examined ABC transporters was constitutively expressed in all cell lines. Transporter mRNA expression patterns were similar in all cell lines, with expression levels of abcc transporters being 80 to over 1000 fold higher than for abcg2, abcb1a/b and abcb11 (abcc1-5>abcg2>abcb1a/b, 11). Transporter activity in the cell lines was determined by measuring uptake of transporter type specific fluorescent substrates in the presence of activity inhibitors. The combination of the ABCB1 and ABCC transporter substrate calcein-AM with inhibitors cyclosporine A, PSC833 and MK571 resulted in a concentration-dependent fluorescence increase of up to 3-fold, whereas reversin 205 caused a slight, but not concentration-dependent fluorescence increase. Accumulation of the dyes Hoechst 33342 and 2',7'-dichlorodihydrofluorescein diacetate was basically unchanged in the presence of Ko134 and taurocholate, respectively, indicating low Abcg2 and Abcb11

  16. Membrane Transporters for Bilirubin and Its Conjugates: A Systematic Review

    Directory of Open Access Journals (Sweden)

    Jovana Čvorović

    2017-12-01

    Full Text Available Background: Bilirubin is a highly-hydrophobic tetrapyrrole which binds to plasma albumin. It is conjugated in the liver to glucuronic acid, and the water-soluble glucuronides are excreted in urine and bile. The membrane transporters of bilirubin diglucuronide are well-known. Still undefined are however the transporters performing the uptake of bilirubin from the blood into the liver, a process known to be fast and not rate-limited. The biological importance of this process may be appraised by considering that in normal adults 200–300 mg of bilirubin are produced daily, as a result of the physiologic turnover of hemoglobin and cellular cytochromes. Nevertheless, research in this field has yielded controversial and contradicting results. We have undertaken a systematic review of the literature, believing in its utility to improve the existing knowledge and promote further advancements.Methods: We have sourced the PubMed database until 30 June 2017 by applying 5 sequential searches. Screening and eligibility criteria were applied to retain research articles reporting results obtained by using bilirubin molecules in membrane transport assays in vitro or by assessing serum bilirubin levels in in vivo experiments.Results: We have identified 311 articles, retaining 44, reporting data on experimental models having 6 incremental increases of complexity (isolated proteins, membrane vesicles, cells, organ fragments, in vivo rodents, and human studies, demonstrating the function of 19 membrane transporters, encoded by either SLCO or ABC genes. Three other bilirubin transporters have no gene, though one, i.e., bilitranslocase, is annotated in the Transporter Classification Database.Conclusions: This is the first review that has systematically examined the membrane transporters for bilirubin and its conjugates. Paradoxically, the remarkable advancements in the field of membrane transport of bilirubin have pointed to the elusive mechanism(s enabling

  17. Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

    Science.gov (United States)

    Kim, K S; Farrand, S K

    1996-06-01

    Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

  18. Study of formation of green eggshell color in ducks through global gene expression.

    Science.gov (United States)

    Xu, Fa Qiong; Li, Ang; Lan, Jing Jing; Wang, Yue Ming; Yan, Mei Jiao; Lian, Sen Yang; Wu, Xu

    2018-01-01

    The green eggshell color produced by ducks is a threshold trait that can be influenced by various factors, such as hereditary, environment and nutrition. The aim of this study was to investigate the genetic regulation of the formation of eggs with green shells in Youxian ducks. We performed integrative analysis of mRNAs and miRNAs expression profiling in the shell gland samples from ducks by RNA-Seq. We found 124 differentially expressed genes that were associated with various pathways, such as the ATP-binding cassette (ABC) transporter and solute carrier supper family pathways. A total of 31 differentially expressed miRNAs were found between ducks laying green eggs and white eggs. KEGG pathway analysis of the predicted miRNA target genes also indicated the functional characteristics of these miRNAs; they were involved in the ABC transporter pathway and the solute carrier (SLC) supper family. Analysis with qRT-PCR was applied to validate the results of global gene expression, which showed a correlation between results obtained by RNA-seq and RT-qPCR. Moreover, a miRNA-mRNA interaction network was established using correlation analysis of differentially expressed mRNA and miRNA. Compared to ducks that lay white eggs, ducks that lay green eggs include six up-regulated miRNAs that had regulatory effects on 35 down-regulated genes, and seven down-regulated miRNAs which influenced 46 up-regulated genes. For example, the ABC transporter pathway could be regulated by expressing gga-miR-144-3p (up-regulated) with ABCG2 (up-regulated) and other miRNAs and genes. This study provides valuable information about mRNA and miRNA regulation in duck shell gland tissues, and provides foundational information for further study on the eggshell color formation and marker-assisted selection for Youxian duck breeding.

  19. Study of formation of green eggshell color in ducks through global gene expression.

    Directory of Open Access Journals (Sweden)

    Fa Qiong Xu

    Full Text Available The green eggshell color produced by ducks is a threshold trait that can be influenced by various factors, such as hereditary, environment and nutrition. The aim of this study was to investigate the genetic regulation of the formation of eggs with green shells in Youxian ducks. We performed integrative analysis of mRNAs and miRNAs expression profiling in the shell gland samples from ducks by RNA-Seq. We found 124 differentially expressed genes that were associated with various pathways, such as the ATP-binding cassette (ABC transporter and solute carrier supper family pathways. A total of 31 differentially expressed miRNAs were found between ducks laying green eggs and white eggs. KEGG pathway analysis of the predicted miRNA target genes also indicated the functional characteristics of these miRNAs; they were involved in the ABC transporter pathway and the solute carrier (SLC supper family. Analysis with qRT-PCR was applied to validate the results of global gene expression, which showed a correlation between results obtained by RNA-seq and RT-qPCR. Moreover, a miRNA-mRNA interaction network was established using correlation analysis of differentially expressed mRNA and miRNA. Compared to ducks that lay white eggs, ducks that lay green eggs include six up-regulated miRNAs that had regulatory effects on 35 down-regulated genes, and seven down-regulated miRNAs which influenced 46 up-regulated genes. For example, the ABC transporter pathway could be regulated by expressing gga-miR-144-3p (up-regulated with ABCG2 (up-regulated and other miRNAs and genes. This study provides valuable information about mRNA and miRNA regulation in duck shell gland tissues, and provides foundational information for further study on the eggshell color formation and marker-assisted selection for Youxian duck breeding.

  20. The involvement of the nif-associated ferredoxin-like genes fdxA and fdxN of Herbaspirillum seropedicae in nitrogen fixation.

    Science.gov (United States)

    Souza, André L F; Invitti, Adriana L; Rego, Fabiane G M; Monteiro, Rose A; Klassen, Giseli; Souza, Emanuel M; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

    2010-02-01

    The pathway of electron transport to nitrogenase in the endophytic beta-Proteobacterium Herbaspirillum seropedicae has not been characterized. We have generated mutants in two nif-associated genes encoding putative ferredoxins, fdxA and fdxN. The fdxA gene is part of the operon nifHDKENXorf1orf2fdxAnifQmodABC and is transcribed from the nifH promoter, as revealed by lacZ gene fusion. The fdxN gene is probably cotranscribed with the nifB gene. Mutational analysis suggests that the FdxA protein is essential for maximum nitrogenase activity, since the nitrogenase activity of the fdxA mutant strain was reduced to about 30% of that of the wild-type strain. In addition, the fdxA mutation had no effect on the nitrogenase switch-off in response to ammonium. Nitrogenase activity of a mutant strain lacking the fdxN gene was completely abolished. This phenotype was reverted by complementation with fdxN expressed under lacZ promoter control. The results suggest that the products of both the fdxA and fdxN genes are probably involved in electron transfer during nitrogen fixation.

  1. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride.

    Science.gov (United States)

    Tamburro, Manuela; Ripabelli, Giancarlo; Vitullo, Monia; Dallman, Timothy James; Pontello, Mirella; Amar, Corinne Francoise Laurence; Sammarco, Michela Lucia

    2015-06-01

    In this study, tolerance at sublethal concentration of benzalkonium chloride and transcription levels of mdrL, ladR, lde, sigB and bcrABC genes in Listeria monocytogenes strains were evaluated. Viable cells reduction occurred in 45% of strains and clinical isolates showed lower sensitivity than isolates from foods. An increased transcription of an efflux system encoding gene was found in 60% of strains, and simultaneous mdrL overexpression and ladR underexpression occurred in 30% of isolates. A significant association between reduced benzalkonium chloride activity and both mdrL and sigB overexpression was observed; sigB expression also correlated with both mdrL and ladR genes. The bcrABC gene was only found in six strains, all isolated from foods and sensitive to benzalkonium chloride, and in four strains an underexpression was observed. Disinfection at sublethal concentration was less effective in clinical isolates, and mdrL and sigB expression was significantly affected by disinfection. Further insights are needed to understand the adaptation to benzalkonium chloride and to evaluate whether changes in gene expression could affect the L. monocytogenes virulence traits and persistence in the environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  3. MADS-box gene evolution - structure and transcription patterns

    DEFF Research Database (Denmark)

    Johansen, Bo; Pedersen, Louise Buchholt; Skipper, Martin

    2002-01-01

    Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs......Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs...

  4. Targeted inactivation of the murine Abca3 gene leads to respiratory failure in newborns with defective lamellar bodies

    International Nuclear Information System (INIS)

    Hammel, Markus; Michel, Geert; Hoefer, Christina; Klaften, Matthias; Mueller-Hoecker, Josef; Angelis, Martin Hrabe de; Holzinger, Andreas

    2007-01-01

    Mutations in the human ABCA3 gene, encoding an ABC-transporter, are associated with respiratory failure in newborns and pediatric interstitial lung disease. In order to study disease mechanisms, a transgenic mouse model with a disrupted Abca3 gene was generated by targeting embryonic stem cells. While heterozygous animals developed normally and were fertile, individuals homozygous for the altered allele (Abca3-/-) died within one hour after birth from respiratory failure, ABCA3 protein being undetectable. Abca3-/- newborns showed atelectasis of the lung in comparison to a normal gas content in unaffected or heterozygous littermates. Electron microscopy demonstrated the absence of normal lamellar bodies in type II pneumocytes. Instead, condensed structures with apparent absence of lipid content were found. We conclude that ABCA3 is required for the formation of lamellar bodies and lung surfactant function. The phenotype of respiratory failure immediately after birth corresponds to the clinical course of severe ABCA3 mutations in human newborns

  5. Sustaining an Effective ABC-ABM System

    Directory of Open Access Journals (Sweden)

    Gary COKINS

    2011-02-01

    Full Text Available The purpose of this paper is to describe the Activity- Based Costing (ABC and Activity-Based Management (ABM system and techniques to sustain them as a permanent and repeatable production reporting system, not just for one-off analysis. A comparison is made between ABC/ABM modeling software that extracts source data and business systems that include ABC/ABM modeling features. There are presented the stages of updating, running and rerunning the ABC/ABM system. The resulting information calculated and provided by the ABC/ABM system are analyzed and interpreted in terms of a multidimensional data analysis. The article ends with the authors' conclusions about the benefits of continued operation of sustaining the ABC/ABM system.

  6. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  7. Defective canalicular transport and toxicity of dietary ursodeoxycholic acid in the abcb11-/- mouse: transport and gene expression studies.

    Science.gov (United States)

    Wang, Renxue; Liu, Lin; Sheps, Jonathan A; Forrest, Dana; Hofmann, Alan F; Hagey, Lee R; Ling, Victor

    2013-08-15

    The bile salt export pump (BSEP), encoded by the abcb11 gene, is the major canalicular transporter of bile acids from the hepatocyte. BSEP malfunction in humans causes bile acid retention and progressive liver injury, ultimately leading to end-stage liver failure. The natural, hydrophilic, bile acid ursodeoxycholic acid (UDCA) is efficacious in the treatment of cholestatic conditions, such as primary biliary cirrhosis and cholestasis of pregnancy. The beneficial effects of UDCA include promoting bile flow, reducing hepatic inflammation, preventing apoptosis, and maintaining mitochondrial integrity in hepatocytes. However, the role of BSEP in mediating UDCA efficacy is not known. Here, we used abcb11 knockout mice (abcb11-/-) to test the effects of acute and chronic UDCA administration on biliary secretion, bile acid composition, liver histology, and liver gene expression. Acutely infused UDCA, or its taurine conjugate (TUDC), was taken up by the liver but retained, with negligible biliary output, in abcb11-/- mice. Feeding UDCA to abcb11-/- mice led to weight loss, retention of bile acids, elevated liver enzymes, and histological damage to the liver. Semiquantitative RT-PCR showed that genes encoding Mdr1a and Mdr1b (canalicular) as well as Mrp4 (basolateral) transporters were upregulated in abcb11-/- mice. We concluded that infusion of UDCA and TUDC failed to induce bile flow in abcb11-/- mice. UDCA fed to abcb11-/- mice caused liver damage and the appearance of biliary tetra- and penta-hydroxy bile acids. Supplementation with UDCA in the absence of Bsep caused adverse effects in abcb11-/- mice.

  8. ABC at Insteel Industries

    OpenAIRE

    V.G. Narayanan; Ratna G. Sarkar

    1999-01-01

    In this paper, we seek to provide empirical documentation of the effect of Activity-Based Costing (ABC) information on product and customer-related decisions made by managers in a company. Proponents of ABC argue that when an entity implements ABC, it reaps at least two important benefits: process improvements that promote more efficient use of resources and hence reduce costs, and a set of overhead cost numbers that, relative to traditional volume-based methods of costing, better represent t...

  9. Comparing the accuracy of ABC and time-driven ABC in complex and dynamic environments: a simulation analysis

    OpenAIRE

    S. HOOZÉE; M. VANHOUCKE; W. BRUGGEMAN; -

    2010-01-01

    This paper compares the accuracy of traditional ABC and time-driven ABC in complex and dynamic environments through simulation analysis. First, when unit times in time-driven ABC are known or can be flawlessly estimated, time-driven ABC coincides with the benchmark system and in this case our results show that the overall accuracy of traditional ABC depends on (1) existing capacity utilization, (2) diversity in the actual mix of productive work, and (3) error in the estimated percentage mix. ...

  10. Forkhead-associated (FHA) Domain Containing ABC Transporter Rv1747 Is Positively Regulated by Ser/Thr Phosphorylation in Mycobacterium tuberculosis*

    Science.gov (United States)

    Spivey, Vicky L.; Molle, Virginie; Whalan, Rachael H.; Rodgers, Angela; Leiba, Jade; Stach, Lasse; Walker, K. Barry; Smerdon, Stephen J.; Buxton, Roger S.

    2011-01-01

    One major signaling method employed by Mycobacterium tuberculosis, the causative agent of tuberculosis, is through reversible phosphorylation of proteins mediated by protein kinases and phosphatases. This study concerns one of these enzymes, the serine/threonine protein kinase PknF, that is encoded in an operon with Rv1747, an ABC transporter that is necessary for growth of M. tuberculosis in vivo and contains two forkhead-associated (FHA) domains. FHA domains are phosphopeptide recognition motifs that specifically recognize phosphothreonine-containing epitopes. Experiments to determine how PknF regulates the function of Rv1747 demonstrated that phosphorylation occurs on two specific threonine residues, Thr-150 and Thr-208. To determine the in vivo consequences of phosphorylation, infection experiments were performed in bone marrow-derived macrophages and in mice using threonine-to-alanine mutants of Rv1747 that prevent specific phosphorylation and revealed that phosphorylation positively modulates Rv1747 function in vivo. The role of the FHA domains in this regulation was further demonstrated by isothermal titration calorimetry, using peptides containing both phosphothreonine residues. FHA-1 domain mutation resulted in attenuation in macrophages highlighting the critical role of this domain in Rv1747 function. A mutant deleted for pknF did not, however, have a growth phenotype in an infection, suggesting that other kinases can fulfill its role when it is absent. This study provides the first information on the molecular mechanism(s) regulating Rv1747 through PknF-dependent phosphorylation but also indicates that phosphorylation activates Rv1747, which may have important consequences in regulating growth of M. tuberculosis. PMID:21622570

  11. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  12. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  13. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  14. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  15. Opioid transport by ATP-binding cassette transporters at the blood-brain barrier: implications for neuropsychopharmacology.

    Science.gov (United States)

    Tournier, Nicolas; Declèves, Xavier; Saubaméa, Bruno; Scherrmann, Jean-Michel; Cisternino, Salvatore

    2011-01-01

    Some of the ATP-binding cassette (ABC) transporters like P-glycoprotein (P-gp; ABCB1, MDR1), BCRP (ABCG2) and MRPs (ABCCs) that are present at the blood-brain barrier (BBB) influence the brain pharmacokinetics (PK) of their substrates by restricting their uptake or enhancing their clearance from the brain into the blood, which has consequences for their CNS pharmacodynamics (PD). Opioid drugs have been invaluable tools for understanding the PK-PD relationships of these ABC-transporters. The effects of morphine, methadone and loperamide on the CNS are modulated by P-gp. This review examines the ways in which other opioid drugs and some of their active metabolites interact with ABC transporters and suggests new mechanisms that may be involved in the variability of the response of the CNS to these drugs like carrier-mediated system belonging to the solute carrier (SLC) superfamily. Exposure to opioids may also alter the expression of ABC transporters. P-gp can be overproduced during morphine treatment, suggesting that the drug has a direct or, more likely, an indirect action. Variations in cerebral neurotransmitters during exposure to opioids and the release of cytokines during pain could be new endogenous stimuli affecting transporter synthesis. This review concludes with an analysis of the pharmacotherapeutic and clinical impacts of the interactions between ABC transporters and opioids.

  16. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  17. Molecular responses and expression analysis of genes in a ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... Molecular responses and expression analysis of genes in a xerophytic desert shrub Haloxylon ammodendron .... physiological determination and cDNA-AFLP analysis, three groups of seeds were sowed in pots with sand and .... HaDR27. U. 234. PDR-like ABC transporter. AT1G59870. HaDR28. U. 135.

  18. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  19. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  20. Fluconazole Resistance Associated with Drug Efflux and Increased Transcription of a Drug Transporter Gene, PDH1, in Candida glabrata

    Science.gov (United States)

    Miyazaki, Haruko; Miyazaki, Yoshitsugu; Geber, Antonia; Parkinson, Tanya; Hitchcock, Christopher; Falconer, Derek J.; Ward, Douglas J.; Marsden, Katherine; Bennett, John E.

    1998-01-01

    Sequential Candida glabrata isolates were obtained from the mouth of a patient infected with human immunodeficiency virus type 1 who was receiving high doses of fluconazole for oropharyngeal thrush. Fluconazole-susceptible colonies were replaced by resistant colonies that exhibited both increased fluconazole efflux and increased transcripts of a gene which codes for a protein with 72.5% identity to Pdr5p, an ABC multidrug transporter in Saccharomyces cerevisiae. The deduced protein had a molecular mass of 175 kDa and was composed of two homologous halves, each with six putative transmembrane domains and highly conserved sequences of ATP-binding domains. When the earliest and most azole-susceptible isolate of C. glabrata from this patient was exposed to fluconazole, increased transcripts of the PDR5 homolog appeared, linking azole exposure to regulation of this gene. PMID:9661006

  1. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  2. The naphthoquinones, vitamin K3 and its structural analog plumbagin, are substrates of the multidrug resistance-linked ABC drug transporter ABCG2

    OpenAIRE

    Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V.

    2007-01-01

    Vitamin K3 (Menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2 which are essential for blood clotting. The naturally occurring structural analog of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We, here, report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette (ABC) drug transporter, ABCG2. Vitamin K3 and plu...

  3. Ligand binding and crystal structures of the substrate-binding domain of the ABC transporter OpuA.

    Directory of Open Access Journals (Sweden)

    Justina C Wolters

    2010-04-01

    Full Text Available The ABC transporter OpuA from Lactococcus lactis transports glycine betaine upon activation by threshold values of ionic strength. In this study, the ligand binding characteristics of purified OpuA in a detergent-solubilized state and of its substrate-binding domain produced as soluble protein (OpuAC was characterized.The binding of glycine betaine to purified OpuA and OpuAC (K(D = 4-6 microM did not show any salt dependence or cooperative effects, in contrast to the transport activity. OpuAC is highly specific for glycine betaine and the related proline betaine. Other compatible solutes like proline and carnitine bound with affinities that were 3 to 4 orders of magnitude lower. The low affinity substrates were not noticeably transported by membrane-reconstituted OpuA. OpuAC was crystallized in an open (1.9 A and closed-liganded (2.3 A conformation. The binding pocket is formed by three tryptophans (Trp-prism coordinating the quaternary ammonium group of glycine betaine in the closed-liganded structure. Even though the binding site of OpuAC is identical to that of its B. subtilis homolog, the affinity for glycine betaine is 4-fold higher.Ionic strength did not affect substrate binding to OpuA, indicating that regulation of transport is not at the level of substrate binding, but rather at the level of translocation. The overlap between the crystal structures of OpuAC from L.lactis and B.subtilis, comprising the classical Trp-prism, show that the differences observed in the binding affinities originate from outside of the ligand binding site.

  4. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  5. Sustaining an Effective ABC-ABM System

    OpenAIRE

    Gary COKINS; Sorinel CĂPUŞNEANU

    2011-01-01

    The purpose of this paper is to describe the Activity- Based Costing (ABC) and Activity-Based Management (ABM) system and techniques to sustain them as a permanent and repeatable production reporting system, not just for one-off analysis. A comparison is made between ABC/ABM modeling software that extracts source data and business systems that include ABC/ABM modeling features. There are presented the stages of updating, running and rerunning the ABC/ABM system. The resul...

  6. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  7. The ABC and AUSSAT.

    Science.gov (United States)

    McGarritty, Ian

    1985-01-01

    Discusses the Australian Broadcasting Corporation's (ABC) utilization of the AUSSAT telecommunications satellite to extend its television and radio transmission range to reach remote Australian audiences; the satellite's program gathering and interchange capabilities; and ABC's generation of other benefits to offset cost of satellite services.…

  8. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  9. Gene : CBRC-CREM-01-1327 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-CREM-01-1327 Novel UN C UNKNOWN BCH2_RHOCA 0.12 27% ref|YP_705999.1| possible ABC antibiotics... transporter [Rhodococcus sp. RHA1] gb|ABG97841.1| possible ABC antibiotics transporter [Rhod

  10. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  11. Single gold nanoparticle plasmonic spectroscopy for study of chemical-dependent efflux function of single ABC transporters of single live Bacillus subtilis cells.

    Science.gov (United States)

    Browning, Lauren M; Lee, Kerry J; Cherukuri, Pavan K; Huang, Tao; Songkiatisak, Preeyaporn; Warren, Seth; Xu, Xiao-Hong Nancy

    2018-03-26

    ATP-binding cassette (ABC) membrane transporters serve as self-defense transport apparatus in many living organisms and they can selectively extrude a wide variety of substrates, leading to multidrug resistance (MDR). The detailed molecular mechanisms remain elusive. Single nanoparticle plasmonic spectroscopy highly depends upon their sizes, shapes, chemical and surface properties. In our previous studies, we have used the size-dependent plasmonic spectra of single silver nanoparticles (Ag NPs) to study the real-time efflux kinetics of the ABC (BmrA) transporter and MexAB-OprM transporter in single live cells (Gram-positive and Gram-negative bacterium), respectively. In this study, we prepared and used purified, biocompatible and stable (non-aggregated) gold nanoparticles (Au NPs) (12.4 ± 0.9 nm) to study the efflux kinetics of single BmrA membrane transporters of single live Bacillus subtillis cells, aiming to probe chemical dependent efflux functions of BmrA transporters and their potential chemical sensing capability. Similar to those observed using Ag NPs, accumulation of the intracellular Au NPs in single live cells (WT and ΔBmrA) highly depends upon the cellular expression of BmrA and the NP concentration (0.7 and 1.4 nM). The lower accumulation of intracellular Au NPs in WT (normal expression of BmrA) than ΔBmrA (deletion of bmrA) indicates that BmrA extrudes the Au NPs out of the WT cells. The accumulation of Au NPs in the cells increases with NP concentration, suggesting that the Au NPs most likely passively diffuse into the cells, similar to antibiotics. The result demonstrates that such small Au NPs can serve as imaging probes to study the efflux function of the BmrA membrane transporter in single live cells. Furthermore, the dependence of the accumulation rate of intracellular Au NPs in single live cells upon the expression of BmrA and the concentration of the NPs is about twice higher than that of the same sized Ag NPs. This interesting finding

  12. ABC Kinga kauplused = ABC King shoe stores

    Index Scriptorium Estoniae

    2011-01-01

    Tallinnas Kristiine keskuses, Tartu Kaubamajas ja Pärnus Port Artur 2 asuvate ABC Kinga kaupluste sisekujundusest. Sisearhitekid Andres Labi ja Janno Roos (Ruumilabor OÜ), loetletud nende ühiselt tehtud töid

  13. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  14. YehZYXW of Escherichia coli Is a Low-Affinity, Non-Osmoregulatory Betaine-Specific ABC Transporter.

    Science.gov (United States)

    Lang, Shenhui; Cressatti, Marisa; Mendoza, Kris E; Coumoundouros, Chelsea N; Plater, Samantha M; Culham, Doreen E; Kimber, Matthew S; Wood, Janet M

    2015-09-22

    Transporter-mediated osmolyte accumulation stimulates the growth of Escherichia coli in high-osmolality environments. YehZYXW was predicted to be an osmoregulatory transporter because (1) osmotic and stationary phase induction of yehZYXW is mediated by RpoS, (2) the Yeh proteins are homologous to the components of known osmoregulatory ABC transporters (e.g., ProU of E. coli), and (3) YehZ models based on the structures of periplasmic betaine-binding proteins suggested that YehZ retains key betaine-binding residues. The betaines choline-O-sulfate, glycine betaine, and dimethylsulfoniopropionate bound YehZ and ProX with millimolar and micromolar affinities, respectively, as determined by equilibrium dialysis and isothermal titration calorimetry. The crystal structure of the YehZ apoprotein, determined at 1.5 Å resolution (PDB ID: 4WEP ), confirmed its similarity to other betaine-binding proteins. Small and nonpolar residues in the hinge region of YehZ (e.g., Gly223) pack more closely than the corresponding residues in ProX, stabilizing the apoprotein. Betaines bound YehZ-Gly223Ser an order of magnitude more tightly than YehZ, suggesting that weak substrate binding in YehZ is at least partially due to apo state stabilization. Neither ProX nor YehZ bound proline. Assays based on osmoprotection or proline auxotrophy failed to detect YehZYXW-mediated uptake of proline, betaines, or other osmolytes. However, transport assays revealed low-affinity glycine betaine uptake, mediated by YehZYXW, that was inhibited at high salinity. Thus, YehZYXW is a betaine transporter that shares substrate specificity, but not an osmoregulatory function, with homologues like E. coli ProU. Other work suggests that yehZYXW may be an antivirulence locus whose expression promotes persistent, asymptomatic bacterial infection.

  15. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  16. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  17. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  18. The structure of the human ABC transporter ABCG2 reveals a novel mechanism for drug extrusion.

    Science.gov (United States)

    Khunweeraphong, Narakorn; Stockner, Thomas; Kuchler, Karl

    2017-10-23

    The human ABC transporter ABCG2 (Breast Cancer Resistance Protein, BCRP) is implicated in anticancer resistance, in detoxification across barriers and linked to gout. Here, we generate a novel atomic model of ABCG2 using the crystal structure of ABCG5/G8. Extensive mutagenesis verifies the structure, disclosing hitherto unrecognized essential residues and domains in the homodimeric ABCG2 transporter. The elbow helix, the first intracellular loop (ICL1) and the nucleotide-binding domain (NBD) constitute pivotal elements of the architecture building the transmission interface that borders a central cavity which acts as a drug trap. The transmission interface is stabilized by salt-bridge interactions between the elbow helix and ICL1, as well as within ICL1, which is essential to control the conformational switch of ABCG2 to the outward-open drug-releasing conformation. Importantly, we propose that ICL1 operates like a molecular spring that holds the NBD dimer close to the membrane, thereby enabling efficient coupling of ATP hydrolysis during the catalytic cycle. These novel mechanistic data open new opportunities to therapeutically target ABCG2 in the context of related diseases.

  19. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  20. Gene Expression Response of Trichophyton rubrum during Coculture on Keratinocytes Exposed to Antifungal Agents

    Directory of Open Access Journals (Sweden)

    Tatiana Takahasi Komoto

    2015-01-01

    Full Text Available Trichophyton rubrum is the most common causative agent of dermatomycoses worldwide, causing infection in the stratum corneum, nails, and hair. Despite the high prevalence of these infections, little is known about the molecular mechanisms involved in the fungal-host interaction, particularly during antifungal treatment. The aim of this work was to evaluate the gene expression of T. rubrum cocultured with keratinocytes and treated with the flavonoid trans-chalcone and the glycoalkaloid α-solanine. Both substances showed a marked antifungal activity against T. rubrum strain CBS (MIC = 1.15 and 17.8 µg/mL, resp.. Cytotoxicity assay against HaCaT cells produced IC50 values of 44.18 to trans-chalcone and 61.60 µM to α-solanine. The interaction of keratinocytes with T. rubrum conidia upregulated the expression of genes involved in the glyoxylate cycle, ergosterol synthesis, and genes encoding proteases but downregulated the ABC transporter TruMDR2 gene. However, both antifungals downregulated the ERG1 and ERG11, metalloprotease 4, serine proteinase, and TruMDR2 genes. Furthermore, the trans-chalcone downregulated the genes involved in the glyoxylate pathway, isocitrate lyase, and citrate synthase. Considering the urgent need for more efficient and safer antifungals, these results contribute to a better understanding of fungal-host interactions and to the discovery of new antifungal targets.

  1. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  2. Therapeutic potential of inhibiting ABCE1 and eRF3 genes via siRNA strategy using chitosan nanoparticles in breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Cengiz, Bagdat Burcu; Asik, Mehmet Dogan [Hacettepe University, Nanotechnology and Nanomedicine Division (Turkey); Kara, Goknur [Hacettepe University, Biochemistry Division, Chemistry Department (Turkey); Turk, Mustafa [Kirikkale University, Bioengineering Department (Turkey); Denkbas, Emir Baki, E-mail: denkbas@hacettepe.edu.tr [Hacettepe University, Biochemistry Division, Chemistry Department (Turkey)

    2015-04-15

    In recent years, targeted cancer therapy strategies have begun to take the place of the conventional treatments. Inhibition of the specific genes, involved in cancer progress, via small interfering RNA (siRNA) has become one of the promising therapeutic approaches for cancer therapy. However, due to rapid nuclease degradation and poor cellular uptake of siRNA, a suitable carrier for siRNA penetration inside the cells is required. We used chitosan nanoparticles (CS-NPs) to efficiently deliver ATP-binding casette E1 (ABCE1) and eukaryotic release factor 3 (eRF3)-targeting siRNAs, individually and together, to reduce the proliferation and induce the apoptosis of breast cancer cells. The CS-NPs were generated by ionic gelation method using tripolyphosphate (TPP) as a crosslinker. Nanoparticles (NPs) were obtained with diameters ranging between 110 and 230 nm and the zeta potential of approximately 27 mV optimizing the solution pH to 4.5 and CS/TPP mass ratio to 3:1. Loading efficiencies of 98.69 % ± 0.051 and 98.83 % ± 0.047 were achieved when ABCE1 siRNA and eRF3 siRNA were entrapped into the NPs, respectively. Cell proliferation assay demonstrated that siRNA-loaded CS-NPs were more effective on cancer cells when compared to siRNAs without CS-NPs. Parallel results were also obtained by apoptosis/necrosis, double-staining analysis. Within our study, the potency of ABCE1 and eRF3 siRNAs were shown for the first time with this kind of polymeric delivery system. The results also indicated that ABCE1 and eRF3, important molecules in protein synthesis, could serve as effective targets to inhibit the cancer cells.

  3. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  4. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  5. Genes Important for Catalase Activity in Enterococcus faecalis

    Science.gov (United States)

    Baureder, Michael; Hederstedt, Lars

    2012-01-01

    Little in general is known about how heme proteins are assembled from their constituents in cells. The Gram-positive bacterium Enterococcus faecalis cannot synthesize heme and does not depend on it for growth. However, when supplied with heme in the growth medium the cells can synthesize two heme proteins; catalase (KatA) and cytochrome bd (CydAB). To identify novel factors important for catalase biogenesis libraries of E. faecalis gene insertion mutants were generated using two different types of transposons. The libraries of mutants were screened for clones deficient in catalase activity using a colony zymogram staining procedure. Analysis of obtained clones identified, in addition to katA (encoding the catalase enzyme protein), nine genes distributed over five different chromosomal loci. No factors with a dedicated essential role in catalase biogenesis or heme trafficking were revealed, but the results indicate the RNA degradosome (srmB, rnjA), an ABC-type oligopeptide transporter (oppBC), a two-component signal transducer (etaR), and NADH peroxidase (npr) as being important for expression of catalase activity in E. faecalis. It is demonstrated that catalase biogenesis in E. faecalis is independent of the CydABCD proteins and that a conserved proline residue in the N-terminal region of KatA is important for catalase assembly. PMID:22590595

  6. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  7. Sulfur source-mediated transcriptional regulation of the rhlABC genes involved in biosurfactants production by Pseudomonas sp. strain AK6U.

    Science.gov (United States)

    Ismail, Wael; El Nayal, Ashraf M; Ramadan, Ahmed R; Abotalib, Nasser

    2014-01-01

    Despite the nutritional significance of sulfur, its influence on biosurfactants production has not been sufficiently studied. We investigated the expression of key biosurfactants production genes, rhlABC, in cultures of Pseudomonas sp. AK6U grown with inorganic or organic sulfur sources. AK6U grew with either inorganic sulfate (MgSO4), dibenzothiophene (DBT), or DBT-sulfone as a sole sulfur source in the presence of glucose as a carbon source. The AK6U cultures produced variable amounts of biosurfactants depending on the utilized sulfur source. Biosurfactants production profile of the DBT cultures was significantly different from that of the DBT-sulfone and inorganic sulfate cultures. The last two cultures were very similar in terms of biosurfactants productivity. Biosurfactants yield in the DBT cultures (1.3 g/L) was higher than that produced by the DBT-sulfone (0.5 g/L) and the inorganic sulfate (0.44 g/L) cultures. Moreover, the surface tension reduction in the DBT cultures (33 mN/m) was much stronger than that measured in the DBT-sulfone (58 mN/m) or inorganic sulfate (54 mN/m) cultures. RT-qPCR revealed variations in the expression levels of the rhlABC genes depending on the sulfur source. The DBT cultures had higher expression levels for the three genes as compared to the DBT-sulfone and inorganic sulfate cultures. There was no significant difference in the expression profiles between the DBT-sulfone and the MgSO4 cultures. The increased expression of rhlC in the DBT cultures is indicative for production of higher amounts of dirhamnolipids compared to the DBT-sulfone and inorganic sulfate cultures. The gene expression results were in good agreement with the biosurfactants production yields and surface tension measurements. The sulfur source mediates a fine-tuned mechanism of transcriptional regulation of biosurfactants production genes. Our findings can have an impact on industrial production of biosurfactants and other biotechnological processes like

  8. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  9. Quantitative Assessment of the Association between ABC Polymorphisms and Osteosarcoma Response: a Meta-analysis.

    Science.gov (United States)

    Chen, Xu; Jiang, Min; Zhao, Rui-Ke; Gu, Guo-Hao

    2015-01-01

    ABC proteins are one key type of transport superfamilies which undertake majority of drug transport, which affect the osteosarcoma response to chemotherapeutics. Previous studies have suggested the association between ABC polymorphisms and osteosarcoma response. However, the results of previous studies remain controversial. Therefore, we perform a meta-analysis to get a more precise estimation of this association. The association between ABC polymorphisms and osteosarcoma response was assessed by odds ratios (ORs) together with their 95% confidence intervals (CIs). Three polymorphisms of ABC including ABCB1 rs1128503, ABCC3 rs4148416 and ABCC2 rs717620 polymorphism were investigated. Overall, significant association was observed between ABCC3 rs4148416 polymorphism and osteosarcoma response under allele contrast (T vs. C: OR=1.73, 95%CI=1.09-2.74, P=0.019), homozygote comparison (TT vs. CC: OR=2.00, 95%CI=1.25-3.23, P=0.004), recessive genetic model (TT vs. OR=1.80, 95%CI=1.14-2.84, P=0.011) and dominant genetic model (TT/TC vs. CC: OR=1.70, 95%CI=1.20-2.42, P=0.003). Moreover, significant association was also observed in Caucasian population rather than Asian population for ABCB1 rs1128503 polymorphism. We conclude that ABCC3 rs4148416 polymorphism was significantly associated with poor osteosarcoma response and ABCB1 rs1128503 polymorphism was significantly associated with good osteosarcoma response in Caucasian population rather than Asian population.

  10. Genetic variation in ABC transporter A1 contributes to HDL cholesterol in the general population

    DEFF Research Database (Denmark)

    Frikke-Schmidt, Ruth; Nordestgaard, Børge G; Jensen, Gorm B

    2004-01-01

    Homozygosity for mutations in ABC transporter A1 (ABCA1) causes Tangier disease, a rare HDL-deficiency syndrome. Whether heterozygosity for genetic variation in ABCA1 also contributes to HDL cholesterol (HDL-C) levels in the general population is presently unclear. We determined whether mutations...... or single-nucleotide polymorphisms (SNPs) in ABCA1 were overrepresented in individuals with the lowest 1% (n=95) or highest 1% (n=95) HDL-C levels in the general population by screening the core promoter and coding region of ABCA1. For all nonsynonymous SNPs identified, we determined the effect of genotype...... on lipid traits in 9,259 individuals from the general population. Heterozygosity for ABCA1 mutations was identified in 10% of individuals with low HDL-C only. Three of 6 nonsynonymous SNPs (V771M, V825I, and R1587K) were associated with increases or decreases in HDL-C in women in the general population...

  11. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  12. Conserved ABC Transport System Regulated by the General Stress Response Pathways of Alpha- and Gammaproteobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Herrou, Julien; Willett, Jonathan W.; Czy; #380; , Daniel M.; Babnigg, Gyorgy; Kim, Youngchang; Crosson, Sean (UC)

    2016-12-19

    ABSTRACT

    Brucella abortusσE1is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon,bab1_0223-bab1_0226, is among the most highly activated gene sets in the σE1regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription ofyehZYXWis activated by the general stress sigma factor σSinEnterobacteriaceae, which suggests a functional role for this transport system in bacterial stress response across the classesAlphaproteobacteriaandGammaproteobacteria. We present evidence thatB. abortusYehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σE1-null strain. The solein vitrophenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li+ion concentrations. A crystal structure ofB. abortusYehZ revealed a class II periplasmic binding protein fold with significant structural homology toArchaeoglobus fulgidusProX, which binds glycine betaine. However, the structure

  13. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  14. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  15. The metabolically active subpopulation in Pseudomonas aeruginosa biofilms survives exposure to membrane-targeting antimicrobials via distinct molecular mechanisms

    DEFF Research Database (Denmark)

    Chiang, Wen-Chi; Pamp, Sünje Johanna; Nilsson, Martin

    2012-01-01

    encoding lipopolysaccharide modification enzymes, as well as on the mexAB-oprM, mexCD-oprJ, and muxABC-opmB genes encoding antimicrobial efflux pumps, but does not depend on the mexPQ-opmE efflux pump genes. Development of chlorhexidine-tolerant subpopulations was found to depend on the mexCD-oprJ genes......, but does not depend on the pmr, mexAB-oprM, mexPQ-opmE, or muxABC-opmB genes. Tolerance to SDS and EDTA in P. aeruginosa biofilms is linked to metabolically active cells, but does not depend on the pmr, mexAB, mexCD, mexPQ, or muxABC genes. Our data suggest that the active subpopulation in P. aeruginosa......-targeting compounds colistin, EDTA, SDS, and chlorhexidine resulted in the same spatial distribution of live and dead bacteria, we investigated whether tolerance to these compounds originated from the same molecular mechanisms. Development of colistin-tolerant subpopulations was found to depend on the pmr genes...

  16. Overexpression of the ATP-binding cassette half-transporter, ABCG2 (Mxr/BCrp/ABCP1), in flavopiridol-resistant human breast cancer cells

    DEFF Research Database (Denmark)

    Robey, R W; Medina-Pérez, W Y; Nishiyama, K

    2001-01-01

    We sought to characterize the interactions of flavopiridol with members of the ATP-binding cassette (ABC) transporter family. Cells overexpressing multidrug resistance-1 (MDR-1) and multidrug resistance-associated protein (MRP) did not exhibit appreciable flavopiridol resistance, whereas cell lines...... overexpressing the ABC half-transporter, ABCG2 (MXR/BCRP/ABCP1), were found to be resistant to flavopiridol. Flavopiridol at a concentration of 10 microM was able to prevent MRP-mediated calcein efflux, whereas Pgp-mediated transport of rhodamine 123 was unaffected at flavopiridol concentrations of up to 100...... analysis revealed overexpression of the ABCG2 gene. Western blot confirmed overexpression of ABCG2; neither P-glycoprotein nor MRP overexpression was detected. These results suggest that ABCG2 plays a role in resistance to flavopiridol....

  17. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  18. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  19. Drug trafficking in mice: In vivo functions of OATP uptake and ABC efflux transporters

    NARCIS (Netherlands)

    Iusuf, D.

    2013-01-01

    In recent years, there has been increasing attention for drug uptake transporters of the Organic Anion-Transporting Polypeptide (human OATP, mouse Oatp, gene names SLCO, Slco) superfamily. Especially the OATP1A and OATP1B subfamilies turn out to have important physiological and pharmacological

  20. The Acinetobacter baumannii Two-Component System AdeRS Regulates Genes Required for Multidrug Efflux, Biofilm Formation, and Virulence in a Strain-Specific Manner

    Directory of Open Access Journals (Sweden)

    Grace E. Richmond

    2016-04-01

    Full Text Available The opportunistic pathogen Acinetobacter baumannii is able to persist in the environment and is often multidrug resistant (MDR, causing difficulties in the treatment of infections. Here, we show that the two-component system AdeRS, which regulates the production of the AdeABC multidrug resistance efflux pump, is required for the formation of a protective biofilm in an ex vivo porcine mucosal model, which mimics a natural infection of the human epithelium. Interestingly, deletion of adeB impacted only on the ability of strain AYE to form a biofilm on plastic and only on the virulence of strain Singapore 1 for Galleria mellonella. RNA-Seq revealed that loss of AdeRS or AdeB significantly altered the transcriptional landscape, resulting in the changed expression of many genes, notably those associated with antimicrobial resistance and virulence interactions. For example, A. baumannii lacking AdeRS displayed decreased expression of adeABC, pil genes, com genes, and a pgaC-like gene, whereas loss of AdeB resulted in increased expression of pil and com genes and decreased expression of ferric acinetobactin transport system genes. These data define the scope of AdeRS-mediated regulation, show that changes in the production of AdeABC mediate important phenotypes controlled by AdeRS, and suggest that AdeABC is a viable target for antimicrobial drug and antibiofilm discovery.

  1. Identification and characterization of calcium transporter gene family in finger millet in relation to grain calcium content.

    Science.gov (United States)

    Singh, Uma M; Metwal, Mamta; Singh, Manoj; Taj, Gohar; Kumar, Anil

    2015-07-15

    Calcium (Ca) is an essential mineral for proper growth and development of plants as well as animals. In plants including cereals, calcium is deposited in seed during its development which is mediated by specialized Ca transporters. Common cereal seeds contain very low amounts of Ca while the finger millet (Eleusine coracana) contains exceptionally high amounts of Ca in seed. In order to understand the role of Ca transporters in grain Ca accumulation, developing seed transcriptome of two finger millet genotypes (GP-1, low Ca and GP-45 high Ca) differing in seed Ca content was sequenced using Illumina paired-end sequencing technology and members of Ca transporter gene family were identified. Out of 109,218 and 120,130 contigs, 86 and 81 contigs encoding Ca transporters were identified in GP-1 and GP-45, respectively. After removal of redundant sequences, a total of 19 sequences were confirmed as Ca transporter genes, which includes 11 Ca(2+) ATPases, 07 Ca(2+)/cation exchangers and 01 Ca(2+) channel. The differential expressions of all genes were analyzed from transcriptome data and it was observed that 9 and 3 genes were highly expressed in GP-45 and GP-1 genotypes respectively. Validation of transcriptome expression data of selected Ca transporter genes was performed on different stages of developing spikes of both genotypes grown under different concentrations of exogenous Ca. In both genotypes, significant correlation was observed between the expression of these genes, especially EcCaX3, and on the amount of Ca accumulated in seed. The positive correlation of seed mass with the amount of Ca concentration was also observed. The efficient Ca transport property and responsiveness of EcCAX3 towards exogenous Ca could be utilized in future biofortification program. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Expression, purification and DNA-binding activities of two putative ModE proteins of Herbaspirillum seropedicae (Burkholderiales, Oxalobacteraceae

    Directory of Open Access Journals (Sweden)

    André L.F. Souza

    2008-01-01

    Full Text Available In prokaryotes molybdenum is taken up by a high-affinity ABC-type transporter system encoded by the modABC genes. The endophyte β-Proteobacterium Herbaspirillum seropedicae has two modABC gene clusters and two genes encoding putative Mo-dependent regulator proteins (ModE1 and ModE2. Analysis of the amino acid sequence of the ModE1 protein of H. seropedicae revealed the presence of an N-terminal domain containing a DNA-binding helix-turn-helix motif (HTH and a C-terminal domain with a molybdate-binding motif. The second putative regulator protein, ModE2, contains only the helix-turn-helix motif, similar to that observed in some sequenced genomes. We cloned the modE1 (810 bp and modE2 (372 bp genes and expressed them in Escherichia coli as His-tagged fusion proteins, which we subsequently purified. The over-expressed recombinant His-ModE1 was insoluble and was purified after solubilization with urea and then on-column refolded during affinity chromatography. The His-ModE2 was expressed as a soluble protein and purified by affinity chromatography. These purified proteins were analyzed by DNA band-shift assays using the modA2 promoter region as probe. Our results indicate that His-ModE1 and His-ModE2 are able to bind to the modA2 promoter region, suggesting that both proteins may play a role in the regulation of molybdenum uptake and metabolism in H. seropedicae.

  3. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  4. Identification of a New Antimicrobial Resistance Gene Provides Fresh Insights Into Pleuromutilin Resistance in Brachyspira hyodysenteriae, Aetiological Agent of Swine Dysentery

    Directory of Open Access Journals (Sweden)

    Roderick M. Card

    2018-06-01

    Full Text Available Brachyspira hyodysenteriae is the aetiological agent of swine dysentery, a globally distributed disease that causes profound economic loss, impedes the free trade and movement of animals, and has significant impact on pig health. Infection is generally treated with antibiotics of which pleuromutilins, such as tiamulin, are widely used for this purpose, but reports of resistance worldwide threaten continued effective control. In Brachyspira hyodysenteriae pleuromutilin resistance has been associated with mutations in chromosomal genes encoding ribosome-associated functions, however the dynamics of resistance acquisition are poorly understood, compromising stewardship efforts to preserve pleuromutilin effectiveness. In this study we undertook whole genome sequencing (WGS and phenotypic susceptibility testing of 34 UK field isolates and 3 control strains to investigate pleuromutilin resistance in Brachyspira hyodysenteriae. Genome-wide association studies identified a new pleuromutilin resistance gene, tva(A (tiamulin valnemulin antibiotic resistance, encoding a predicted ABC-F transporter. In vitro culture of isolates in the presence of inhibitory or sub-inhibitory concentrations of tiamulin showed that tva(A confers reduced pleuromutilin susceptibility that does not lead to clinical resistance but facilitates the development of higher-level resistance via mutations in genes encoding ribosome-associated functions. Genome sequencing of antibiotic-exposed isolates identified both new and previously described mutations in chromosomal genes associated with reduced pleuromutilin susceptibility, including the 23S rRNA gene and rplC, which encodes the L3 ribosomal protein. Interesting three antibiotic-exposed isolates harboured mutations in fusA, encoding Elongation Factor G, a gene not previously associated with pleuromutilin resistance. A longitudinal molecular epidemiological examination of two episodes of swine dysentery at the same farm indicated

  5. Learning the ABCs: Activity based costing in waste operations

    International Nuclear Information System (INIS)

    Zocher, Marc A.

    1992-01-01

    The United States Department of Energy (DOE) is facing a challenging new national role based on current world events, changing public perception and awareness, and a legacy of wastes generated in the past. Clearly, the DOE must put mechanisms in place to comply with environmental rules, regulations, and good management practices so that public health risk is minimized while programmatic costs are controlled. DOE has begun this process and has developed a Five-Year Plan to describe the activities necessary to comply with both cleanup, or environmental restoration, and waste management of existing waste streams. The focus of this paper is how to best manage the treatment, storage, disposal, and transportation of waste throughout the DOE weapons complex by using Activity Based Costing (ABC) to both plan and control expenditures in DOE Waste Management (WM). The basics of ABC, along with an example, will be detailed. (author)

  6. A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

    Science.gov (United States)

    Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

    2014-06-01

    Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

  7. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  8. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  9. Marketing Research of Construction Sites based on ABC-XYZ Analysis and Relational Data

    Directory of Open Access Journals (Sweden)

    Konikov Aleksandr

    2017-01-01

    Full Text Available ABC-XYZ analysis is well known in marketing. It allows identifying sites that yield maximum profits when sold, sites that enjoy stable demand, or sites have both qualities specified above. However, the methods are quite abstract and are not designed to study specific factors that impact the results of ABC-XYZ analysis. Meanwhile, for some applications, particularly for marketing research of construction sites, it is critical not only to identify high-profit and stable sites but also to find out what combination of technical parameters, factors related to their location, transport accessibility, etc. are typical of them. This work suggests an approach to address the issue.

  10. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  11. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  12. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  13. The ASK1 gene regulates B function gene expression in cooperation with UFO and LEAFY in Arabidopsis.

    Science.gov (United States)

    Zhao, D; Yu, Q; Chen, M; Ma, H

    2001-07-01

    The Arabidopsis floral regulatory genes APETALA3 (AP3) and PISTILLATA (PI) are required for the B function according to the ABC model for floral organ identity. AP3 and PI expression are positively regulated by the LEAFY (LFY) and UNUSUAL FLORAL ORGANS (UFO) genes. UFO encodes an F-box protein, and we have shown previously that UFO genetically interacts with the ASK1 gene encoding a SKP1 homologue; both the F-box containing protein and SKP1 are subunits of ubiquitin ligases. We show here that the ask1-1 mutation can enhance the floral phenotypes of weak lfy and ap3 mutants; therefore, like UFO, ASK1 also interacts with LFY and AP3 genetically. Furthermore, our results from RNA in situ hybridizations indicate that ASK1 regulates early AP3 and PI expression. These results support the idea that UFO and ASK1 together positively regulate AP3 and PI expression. We propose that the UFO and ASK1 proteins are components of a ubiquitin ligase that mediates the proteolysis of a repressor of AP3 and PI expression. Our genetic studies also indicate that ASK1 and UFO play a role in regulating the number of floral organ primordia, and we discuss possible mechanisms for such a regulation.

  14. Enterprise Architecture Data Pada Hotel ABC

    OpenAIRE

    Soesatyo, Stephanie; Wibowo, Adi; Handojo, Andreas

    2015-01-01

    Hotel ABC is a company engaged in hospitality management, i.e. room rental, rental of meeting rooms and coffee shop. Hotel ABC has a branch that has the same specifications of the hotel. In business process, Hotel ABC has information systems to support existing business processes. However, existing information systems have not been integrated as a whole. Based on the condition stated above, analysis and design of enterprise architecture information system is created for the company. The proce...

  15. Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

    Science.gov (United States)

    Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

    2018-04-18

    This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

  16. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  17. N-retinylidene-phosphatidylethanolamine is the preferred retinoid substrate for the photoreceptor-specific ABC transporter ABCA4 (ABCR).

    Science.gov (United States)

    Beharry, Seelochan; Zhong, Ming; Molday, Robert S

    2004-12-24

    ABCA4, a member of the family of ATP binding cassette (ABC) proteins found in rod and cone photoreceptors, has been implicated in the transport of retinoid compounds across the outer segment disk membrane following the photoactivation of rhodopsin. Mutations in the ABCA4 gene are responsible for Stargardt macular dystrophy and related retinal degenerative diseases that cause a loss in vision. To identify the retinoid substrate that interacts with ABCA4, we have isolated ABCA4 from rod outer segment disk membranes on an immunoaffinity matrix and analyzed retinoid compounds that bind to ABCA4 using high performance liquid chromatography and radiolabeling methods. When all-trans-retinal was added to ABCA4 in the presence of phosphatidylethanolamine, approximately 0.9 mol of N-retinylidene-phosphatidylethanolamine and 0.3 mol of all-trans-retinal were bound per mol of ABCA4 with an apparent K(d) of 2-5 microm. ATP and GTP released these retinoids from ABCA4, whereas ADP, GDP, and nonhydrolyzable derivatives, adenosine 5'-(beta,gamma-imido)triphosphate and guanosine 5'-(beta,gamma-imido)triphosphate, were ineffective. One mole of N-retinyl-phosphatidylethanolamine, the reduced form of N-retinylidene-phosphatidylethanolamine, bound per mol of ABCA4, whereas 0.3 mol of all-trans-retinal were bound in the absence of phosphatidylethanolamine. No binding of all-trans-retinol to ABCA4 was observed. Our results indicate that ABCA4 preferentially binds N-retinylidene-phosphatidylethanolamine with high affinity in the absence of ATP. Our studies further suggest that ATP binding and hydrolysis induces a protein conformational change that causes N-retinylidene-phosphatidylethanolamine to dissociate from ABCA4.

  18. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  19. The ABC-paradox: is Time Driven ABC relevant for small and Medium sized enterprises (SME)?

    DEFF Research Database (Denmark)

    Fladkjær, Henrik Find; Jensen, Erling

    Several articles suggest that Activity Based Costing (ABC) has failed to succeed in practical use. It is even argued that we have an ABC-paradox. Activity Based Costing has won theoretically in nu-merous articles in journals, through books, being included in all major Business Accounting text-books...

  20. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  1. Tungsten transport protein A (WtpA) in Pyrococcus furiosus: the first member of a new class of tungstate and molybdate transporters.

    Science.gov (United States)

    Bevers, Loes E; Hagedoorn, Peter-Leon; Krijger, Gerard C; Hagen, Wilfred R

    2006-09-01

    A novel tungstate and molybdate binding protein has been discovered from the hyperthermophilic archaeon Pyrococcus furiosus. This tungstate transport protein A (WtpA) is part of a new ABC transporter system selective for tungstate and molybdate. WtpA has very low sequence similarity with the earlier-characterized transport proteins ModA for molybdate and TupA for tungstate. Its structural gene is present in the genome of numerous archaea and some bacteria. The identification of this new tungstate and molybdate binding protein clarifies the mechanism of tungstate and molybdate transport in organisms that lack the known uptake systems associated with the ModA and TupA proteins, like many archaea. The periplasmic protein of this ABC transporter, WtpA (PF0080), was cloned and expressed in Escherichia coli. Using isothermal titration calorimetry, WtpA was observed to bind tungstate (dissociation constant [K(D)] of 17 +/- 7 pM) and molybdate (K(D) of 11 +/- 5 nM) with a stoichiometry of 1.0 mol oxoanion per mole of protein. These low K(D) values indicate that WtpA has a higher affinity for tungstate than do ModA and TupA and an affinity for molybdate similar to that of ModA. A displacement titration of molybdate-saturated WtpA with tungstate showed that the tungstate effectively replaced the molybdate in the binding site of the protein.

  2. Mercury toxicokinetics of the healthy human term placenta involve amino acid transporters and ABC transporters

    International Nuclear Information System (INIS)

    Straka, Elisabeth; Ellinger, Isabella; Balthasar, Christina; Scheinast, Matthias; Schatz, Jasmin; Szattler, Tamara; Bleichert, Sonja; Saleh, Leila; Knöfler, Martin; Zeisler, Harald; Hengstschläger, Markus; Rosner, Margit; Salzer, Hans; Gundacker, Claudia

    2016-01-01

    Highlights: • It is known that MeHg is able to pass the placenta and to affect fetal brain development. • Uptake and efflux transporters were examined in human primary trophoblast cells and BeWo cells. • Involvement in mercury transfer was assessed by measurement of cellular mercury content upon siRNA mediated gene knockdown. • Localization of transporters was determined by immunofluorescence microscopy. • LAT1 and rBAT at the apical membrane of the syncytiotrophoblast (STB) are involved in MeHg uptake. • MRP1 located at basal membrane of STB mediates mercury efflux. - Abstract: Background: The capacity of the human placenta to handle exogenous stressors is poorly understood. The heavy metal mercury is well-known to pass the placenta and to affect brain development. An active transport across the placenta has been assumed. The underlying mechanisms however are virtually unknown. Objectives: Uptake and efflux transporters (17 candidate proteins) assumed to play a key role in placental mercury transfer were examined for expression, localization and function in human primary trophoblast cells and the trophoblast-derived choriocarcinoma cell line BeWo. Methods: To prove involvement of the transporters, we used small interfering RNA (siRNA) and exposed cells to methylmercury (MeHg). Total mercury contents of cells were analyzed by Cold vapor-atomic fluorescence spectrometry (CV-AFS). Localization of the proteins in human term placenta sections was determined via immunofluorescence microscopy. Results: We found the amino acid transporter subunits L-type amino acid transporter (LAT)1 and rBAT (related to b 0,+ type amino acid transporter) as well as the efflux transporter multidrug resistance associated protein (MRP)1 to be involved in mercury kinetics of trophoblast cells (t-test P < 0.05). Conclusion: The amino acid transporters located at the apical side of the syncytiotrophoblast (STB) manage uptake of MeHg. Mercury conjugated to glutathione (GSH) is

  3. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  4. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  5. Pharmacogenetics of taxanes: impact of gene polymorphisms of drug transporters on pharmacokinetics and toxicity.

    Science.gov (United States)

    Jabir, Rafid Salim; Naidu, Rakesh; Annuar, Muhammad Azrif Bin Ahmad; Ho, Gwo Fuang; Munisamy, Murali; Stanslas, Johnson

    2012-12-01

    Interindividual variability in drug response and the emergence of adverse drug effects are the main causes of treatment failure in cancer therapy. Functional membrane drug transporters play important roles in altering pharmacokinetic profile, resistance to treatment, toxicity and patient survival. Pharmacogenetic studies of these transporters are expected to provide new approaches for optimizing therapy. Taxanes are approved for the treatment of various cancers. Circulating taxanes are taken up by SLCO1B3 into hepatocytes. The CYP450 enzymes CYP3A4, CYP3A5 and CYP2C8 are responsible for the conversion of taxanes into their metabolites. Ultimately, ABCB1 and ABCC2 will dispose the metabolites into bile canaliculi. Polymorphisms of genes encoding for proteins involved in the transport and clearance of taxanes reduce excretion of the drugs, leading to development of toxicity in patients. This review addresses current knowledge on genetic variations of transporters affecting taxanes pharmacokinetics and toxicity, and provides insights into future direction for personalized medicine.

  6. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  7. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  8. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  9. Transcriptional analysis of prebiotic uptake and catabolism by Lactobacillus acidophilus NCFM.

    Directory of Open Access Journals (Sweden)

    Joakim Mark Andersen

    Full Text Available The human gastrointestinal tract can be positively modulated by dietary supplementation of probiotic bacteria in combination with prebiotic carbohydrates. Here differential transcriptomics and functional genomics were used to identify genes in Lactobacillus acidophilus NCFM involved in the uptake and catabolism of 11 potential prebiotic compounds consisting of α- and β-linked galactosides and glucosides. These oligosaccharides induced genes encoding phosphoenolpyruvate-dependent sugar phosphotransferase systems (PTS, galactoside pentose hexuronide (GPH permease, and ATP-binding cassette (ABC transporters. PTS systems were upregulated primarily by di- and tri-saccharides such as cellobiose, isomaltose, isomaltulose, panose and gentiobiose, while ABC transporters were upregulated by raffinose, Polydextrose, and stachyose. A single GPH transporter was induced by lactitol and galactooligosaccharides (GOS. The various transporters were associated with a number of glycoside hydrolases from families 1, 2, 4, 13, 32, 36, 42, and 65, involved in the catabolism of various α- and β-linked glucosides and galactosides. Further subfamily specialization was also observed for different PTS-associated GH1 6-phospho-β-glucosidases implicated in the catabolism of gentiobiose and cellobiose. These findings highlight the broad oligosaccharide metabolic repertoire of L. acidophilus NCFM and establish a platform for selection and screening of both probiotic bacteria and prebiotic compounds that may positively influence the gastrointestinal microbiota.

  10. Amino acid transporter genes are essential for FLO11-dependent and FLO11-independent biofilm formation and invasive growth in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Rasmus Torbensen

    Full Text Available Amino acids can induce yeast cell adhesion but how amino acids are sensed and signal the modulation of the FLO adhesion genes is not clear. We discovered that the budding yeast Saccharomyces cerevisiae CEN.PK evolved invasive growth ability under prolonged nitrogen limitation. Such invasive mutants were used to identify amino acid transporters as regulators of FLO11 and invasive growth. One invasive mutant had elevated levels of FLO11 mRNA and a Q320STOP mutation in the SFL1 gene that encodes a protein kinase A pathway regulated repressor of FLO11. Glutamine-transporter genes DIP5 and GNP1 were essential for FLO11 expression, invasive growth and biofilm formation in this mutant. Invasive growth relied on known regulators of FLO11 and the Ssy1-Ptr3-Ssy5 complex that controls DIP5 and GNP1, suggesting that Dip5 and Gnp1 operates downstream of the Ssy1-Ptr3-Ssy5 complex for regulation of FLO11 expression in a protein kinase A dependent manner. The role of Dip5 and Gnp1 appears to be conserved in the S. cerevisiae strain ∑1278b since the dip5 gnp1 ∑1278b mutant showed no invasive phenotype. Secondly, the amino acid transporter gene GAP1 was found to influence invasive growth through FLO11 as well as other FLO genes. Cells carrying a dominant loss-of-function PTR3(647::CWNKNPLSSIN allele had increased transcription of the adhesion genes FLO1, 5, 9, 10, 11 and the amino acid transporter gene GAP1. Deletion of GAP1 caused loss of FLO11 expression and invasive growth. However, deletions of FLO11 and genes encoding components of the mitogen-activated protein kinase pathway or the protein kinase A pathway were not sufficient to abolish invasive growth, suggesting involvement of other FLO genes and alternative pathways. Increased intracellular amino acid pools in the PTR3(647::CWNKNPLSSIN-containing strain opens the possibility that Gap1 regulates the FLO genes through alteration of the amino acid pool sizes.

  11. Cell organisation, sulphur metabolism and ion transport-related genes are differentially expressed in Paracoccidioides brasiliensis mycelium and yeast cells

    Directory of Open Access Journals (Sweden)

    Passos Geraldo AS

    2006-08-01

    Full Text Available Abstract Background Mycelium-to-yeast transition in the human host is essential for pathogenicity by the fungus Paracoccidioides brasiliensis and both cell types are therefore critical to the establishment of paracoccidioidomycosis (PCM, a systemic mycosis endemic to Latin America. The infected population is of about 10 million individuals, 2% of whom will eventually develop the disease. Previously, transcriptome analysis of mycelium and yeast cells resulted in the assembly of 6,022 sequence groups. Gene expression analysis, using both in silico EST subtraction and cDNA microarray, revealed genes that were differential to yeast or mycelium, and we discussed those involved in sugar metabolism. To advance our understanding of molecular mechanisms of dimorphic transition, we performed an extended analysis of gene expression profiles using the methods mentioned above. Results In this work, continuous data mining revealed 66 new differentially expressed sequences that were MIPS(Munich Information Center for Protein Sequences-categorised according to the cellular process in which they are presumably involved. Two well represented classes were chosen for further analysis: (i control of cell organisation – cell wall, membrane and cytoskeleton, whose representatives were hex (encoding for a hexagonal peroxisome protein, bgl (encoding for a 1,3-β-glucosidase in mycelium cells; and ags (an α-1,3-glucan synthase, cda (a chitin deacetylase and vrp (a verprolin in yeast cells; (ii ion metabolism and transport – two genes putatively implicated in ion transport were confirmed to be highly expressed in mycelium cells – isc and ktp, respectively an iron-sulphur cluster-like protein and a cation transporter; and a putative P-type cation pump (pct in yeast. Also, several enzymes from the cysteine de novo biosynthesis pathway were shown to be up regulated in the yeast form, including ATP sulphurylase, APS kinase and also PAPS reductase. Conclusion Taken

  12. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  13. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  14. Activity-Based Costing Application in an Urban Mass Transport Company

    Directory of Open Access Journals (Sweden)

    Popesko Boris

    2011-12-01

    Full Text Available The purpose of this paper is to provide a basic overview of the application of Activity-Based Costing in an urban mass transport company which operates land public transport via buses and trolleys within the city. The case study was conducted using the Activity-Based Methodology in order to calculate the true cost of individual operations and to measure the profitability of particular transport lines. The case study analysis showed the possible effects of the application of the Activity-Based Costing for an urban mass transport company as well as the limitations of using the ABC methodology in the service industry. With regards to the application of the ABC methodology, the primary limitation of the accuracy of the conclusions is the quality of the non-financial information which had to be gathered throughout the implementation process. A basic limitation of the accurate data acquisition is the nature of the fare system of the transport company which does not allow the identification of the route that is taken by an individual passenger. The study illustrates the technique of ABC in urban mass transport and provides a real company example of information outputs of the ABC system. The users indicated that, the ABC model is very useful for profitability reporting and profit management. Also, the paper shows specific application of the Activity-Based Methodology in conditions of urban mass transport companies with regional specifics.

  15. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  16. Molecular cloning and characterization of a gene encoding the proline transporter protein in common bean(Phaseolus vulgaris L.)

    Institute of Scientific and Technical Information of China (English)

    Jibao; Chen; Jing; Wu; Yunfeng; Lu; Yuannan; Cao; Hui; Zeng; Zhaoyuan; Zhang; Lanfen; Wang; Shumin; Wang

    2016-01-01

    As a typical compatible solute, proline is accumulated in plants under environmental stresses. Proline transporter(Pro T) plays an important role in proline distribution between plant organs. Using a candidate gene approach, we cloned a c DNA sequence for Pro T from common bean(Phaseolus vulgaris L.) and designated the gene Pv Pro T. The deduced amino acid sequence of Pv Pro T showed high similarity to Bet/Pro T proteins from other leguminous plants, and the highest similarity was observed with mothbean(Vigna aconitifolia L.) Vu Pro T.Relative quantification of the m RNA level of Pv Pro T using real-time PCR analysis showed that the Pv Pro T transcript level was higher in leaves than in stems and roots of common bean plants subjected to drought and salt stress. Under 20%(w/w) PEG-6000 treatment,drought-resistant plants expressed a higher level of Pv Pro T transcripts than droughtsensitive plants. Although heterologous expression of Pv Pro T in the Escherichia coli mutant mkh13 showed that Pv Pro T exhibited uptake activities for proline and betaine, no betaine content was detected in the common bean. These findings suggest that Pv Pro T plays an important role in the transportation of proline in common bean plants exposed to drought and salt stress.

  17. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  18. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  19. Human transporter database: comprehensive knowledge and discovery tools in the human transporter genes.

    Directory of Open Access Journals (Sweden)

    Adam Y Ye

    Full Text Available Transporters are essential in homeostatic exchange of endogenous and exogenous substances at the systematic, organic, cellular, and subcellular levels. Gene mutations of transporters are often related to pharmacogenetics traits. Recent developments in high throughput technologies on genomics, transcriptomics and proteomics allow in depth studies of transporter genes in normal cellular processes and diverse disease conditions. The flood of high throughput data have resulted in urgent need for an updated knowledgebase with curated, organized, and annotated human transporters in an easily accessible way. Using a pipeline with the combination of automated keywords query, sequence similarity search and manual curation on transporters, we collected 1,555 human non-redundant transporter genes to develop the Human Transporter Database (HTD (http://htd.cbi.pku.edu.cn. Based on the extensive annotations, global properties of the transporter genes were illustrated, such as expression patterns and polymorphisms in relationships with their ligands. We noted that the human transporters were enriched in many fundamental biological processes such as oxidative phosphorylation and cardiac muscle contraction, and significantly associated with Mendelian and complex diseases such as epilepsy and sudden infant death syndrome. Overall, HTD provides a well-organized interface to facilitate research communities to search detailed molecular and genetic information of transporters for development of personalized medicine.

  20. Piperlongumine selectively suppresses ABC-DLBCL through inhibition of NF-κB p65 subunit nuclear import

    Energy Technology Data Exchange (ETDEWEB)

    Niu, Mingshan [Blood Diseases Institute, Xuzhou Medical College, Xuzhou, Jiangsu (China); Jiangsu Key Laboratory of Bone Marrow Stem Cell, Xuzhou Medical College, Xuzhou, Jiangsu (China); Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Shen, Yangling; Xu, Xiaoyu [Blood Diseases Institute, Xuzhou Medical College, Xuzhou, Jiangsu (China); Jiangsu Key Laboratory of Bone Marrow Stem Cell, Xuzhou Medical College, Xuzhou, Jiangsu (China); Yao, Yao; Fu, Chunling [Blood Diseases Institute, Xuzhou Medical College, Xuzhou, Jiangsu (China); Jiangsu Key Laboratory of Bone Marrow Stem Cell, Xuzhou Medical College, Xuzhou, Jiangsu (China); Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Yan, Zhiling [Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Wu, Qingyun [Blood Diseases Institute, Xuzhou Medical College, Xuzhou, Jiangsu (China); Jiangsu Key Laboratory of Bone Marrow Stem Cell, Xuzhou Medical College, Xuzhou, Jiangsu (China); Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Cao, Jiang; Sang, Wei [Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Zeng, Lingyu [Blood Diseases Institute, Xuzhou Medical College, Xuzhou, Jiangsu (China); Jiangsu Key Laboratory of Bone Marrow Stem Cell, Xuzhou Medical College, Xuzhou, Jiangsu (China); Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Li, Zhenyu [Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Liu, Xuejiao, E-mail: liuxuejiao0923@126.com [Insititute of Nervous System Diseases, Xuzhou Medical College, Xuzhou, Jiangsu (China); and others

    2015-07-10

    Constitutive NF-κB activation is required for survival of activated B cell-like subtype of diffuse large B cell lymphoma (ABC-DLBCL). However, current NF-κB targeting strategies lack cancer cell specificity. Here, we identified a novel inhibitor, piperlongumine, features direct binding to NF-κB p65 subunit and suppression of p65 nuclear import. This was accompanied by NF-κB reporter activity suppression and NF-κB target gene downregulation. Moreover, mutation of Cys{sup 38} to Ser in p65 abolished this effect of piperlongumine on inhibition of p65 nuclear import. Furthermore, we show that piperlongumine selectively inhibited proliferation and induced apoptosis of ABC-DLBCL cells. Most notably, it has been reported that piperlongumine did not affect normal cells even at high doses and was nontoxic to animals. Hence, our current study provides new insight into piperlongumine's mechanism of action and novel approach to ABC-DLBCL target therapy. - Highlights: • Current NF-κB targeting strategies lack cancer cell specificity. • Piperlongumine inhibits NF-κB p65 subunit nuclear import via directly binding to p65. • Piperlongumine selectively inhibits proliferation of ABC-DLBCL cells. • This study provides a novel approach to ABC-DLBCL target therapy.

  1. Piperlongumine selectively suppresses ABC-DLBCL through inhibition of NF-κB p65 subunit nuclear import

    International Nuclear Information System (INIS)

    Niu, Mingshan; Shen, Yangling; Xu, Xiaoyu; Yao, Yao; Fu, Chunling; Yan, Zhiling; Wu, Qingyun; Cao, Jiang; Sang, Wei; Zeng, Lingyu; Li, Zhenyu; Liu, Xuejiao

    2015-01-01

    Constitutive NF-κB activation is required for survival of activated B cell-like subtype of diffuse large B cell lymphoma (ABC-DLBCL). However, current NF-κB targeting strategies lack cancer cell specificity. Here, we identified a novel inhibitor, piperlongumine, features direct binding to NF-κB p65 subunit and suppression of p65 nuclear import. This was accompanied by NF-κB reporter activity suppression and NF-κB target gene downregulation. Moreover, mutation of Cys 38 to Ser in p65 abolished this effect of piperlongumine on inhibition of p65 nuclear import. Furthermore, we show that piperlongumine selectively inhibited proliferation and induced apoptosis of ABC-DLBCL cells. Most notably, it has been reported that piperlongumine did not affect normal cells even at high doses and was nontoxic to animals. Hence, our current study provides new insight into piperlongumine's mechanism of action and novel approach to ABC-DLBCL target therapy. - Highlights: • Current NF-κB targeting strategies lack cancer cell specificity. • Piperlongumine inhibits NF-κB p65 subunit nuclear import via directly binding to p65. • Piperlongumine selectively inhibits proliferation of ABC-DLBCL cells. • This study provides a novel approach to ABC-DLBCL target therapy

  2. abc: An extensible AspectJ compiler

    DEFF Research Database (Denmark)

    Avgustinov, Pavel; Christensen, Aske Simon; Hendren, Laurie

    2005-01-01

    checking and code generation, as well as data flow and control flow analyses. The AspectBench Compiler (abc) is an implementation of such a workbench. The base version of abc implements the full AspectJ language. Its frontend is built, using the Polyglot framework, as a modular extension of the Java...... language. The use of Polyglot gives flexibility of syntax and type checking. The backend is built using the Soot framework, to give modular code generation and analyses. In this paper, we outline the design of abc, focusing mostly on how the design supports extensibility. We then provide a general overview...

  3. Implementation of ABC method in real company

    OpenAIRE

    Kazhimova, Dina

    2014-01-01

    The aim of this Bachelor thesis is a thorough analysis of the modern calculation method Activity-based costing (ABC), that identifies the activities that a firm performs, and then assigns indirect costs to products. An ABC system recognizes the relationship between costs, activities and products, and through this relationship assigns indirect costs to products less arbitrarily than traditional methods. Comparison ABC method with traditional methods of cost allocation. Basing on the knowledge ...

  4. Effects of fasting and refeeding on gene expression of slc15a1a, a gene encoding an oligopeptide transporter (PepT1), in the intestine of Mozambique tilapia.

    Science.gov (United States)

    Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi

    2017-01-01

    The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.

  5. Enhancement of antibiotic productions by engineered nitrate utilization in actinomycetes.

    Science.gov (United States)

    Meng, Sitong; Wu, Hang; Wang, Lei; Zhang, Buchang; Bai, Linquan

    2017-07-01

    Nitrate is necessary for primary and secondary metabolism of actinomycetes and stimulates the production of a few antibiotics, such as lincomycin and rifamycin. However, the mechanism of this nitrate-stimulating effect was not fully understood. Two putative ABC-type nitrate transporters were identified in Streptomyces lincolnensis NRRL2936 and verified to be involved in lincomycin biosynthesis. With nitrate supplementation, the transcription of nitrogen assimilation genes, nitrate-specific ABC1 transporter genes, and lincomycin exporter gene lmrA was found to be enhanced and positively regulated by the global regulator GlnR, whose expression was also improved. Moreover, heterologous expression of ABC2 transporter genes in Streptomyces coelicolor M145 resulted in an increased actinorhodin production. Further incorporation of a nitrite-specific transporter gene nirC, as in nirC-ABC2 cassette, led to an even higher actinorhodin production. Similarly, the titers of salinomycin, ansamitocin, lincomycin, and geldanamycin were increased with the integration of this cassette to Streptomyces albus BK3-25, Actinosynnema pretiosum ATCC31280, S. lincolnensis LC-G, and Streptomyces hygroscopicus XM201, respectively. Our work expanded the nitrate-stimulating effect to many antibiotic producers by utilizing the nirC-ABC2 cassette for enhanced nitrate utilization, which could become a general tool for titer increase of antibiotics in actinomycetes.

  6. Polymorphisms in ATP-binding cassette transporters associated with maternal methylmercury disposition and infant neurodevelopment in mother-infant pairs in the Seychelles Child Development Study.

    Science.gov (United States)

    Engström, Karin; Love, Tanzy M; Watson, Gene E; Zareba, Grazyna; Yeates, Alison; Wahlberg, Karin; Alhamdow, Ayman; Thurston, Sally W; Mulhern, Maria; McSorley, Emeir M; Strain, J J; Davidson, Philip W; Shamlaye, Conrad F; Myers, G J; Rand, Matthew D; van Wijngaarden, Edwin; Broberg, Karin

    2016-09-01

    ATP-binding cassette (ABC) transporters have been associated with methylmercury (MeHg) toxicity in experimental animal models. To evaluate the association of single nucleotide polymorphisms (SNPs) in maternal ABC transporter genes with 1) maternal hair MeHg concentrations during pregnancy and 2) child neurodevelopmental outcomes. Nutrition Cohort 2 (NC2) is an observational mother-child cohort recruited in the Republic of Seychelles from 2008-2011. Total mercury (Hg) was measured in maternal hair growing during pregnancy as a biomarker for prenatal MeHg exposure (N=1313) (mean 3.9ppm). Infants completed developmental assessments by Bayley Scales of Infant Development II (BSID-II) at 20months of age (N=1331). Genotyping for fifteen SNPs in ABCC1, ABCC2 and ABCB1 was performed for the mothers. Seven of fifteen ABC SNPs (ABCC1 rs11075290, rs212093, and rs215088; ABCC2 rs717620; ABCB1 rs10276499, rs1202169, and rs2032582) were associated with concentrations of maternal hair Hg (pmothers with rs11075290 CC genotype (mean hair Hg 3.6ppm) scored on average 2 points lower on the Mental Development Index (MDI) and 3 points lower on the Psychomotor Development Index (PDI) than children born to mothers with TT genotype (mean hair Hg 4.7ppm) while children with the CT genotype (mean hair Hg 4.0ppm) had intermediate BSID scores. Genetic variation in ABC transporter genes was associated with maternal hair Hg concentrations. The implications for MeHg dose in the developing child and neurodevelopmental outcomes need to be further investigated. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Playware ABC: Engineering Play for Everybody

    DEFF Research Database (Denmark)

    Lund, Henrik Hautop

    2017-01-01

    This paper describes the Playware ABC concept, and how it allows anybody, anywhere, anytime to be building bodies and brains, which facilitates users to construct, combine and create. The Playware ABC concept focuses engineering and IT system development on creating solutions that are usable by a...

  8. A genetic association study of the FXYD domain containing ion transport regulator 6 (FXYD6) gene, encoding phosphohippolin, in susceptibility to schizophrenia in a Japanese population.

    Science.gov (United States)

    Ito, Yoshihito; Nakamura, Yukako; Takahashi, Nagahide; Saito, Shinichi; Aleksic, Branko; Iwata, Nakao; Inada, Toshiya; Ozaki, Norio

    2008-06-13

    The FXYD domain containing ion transport regulator 6 (FXYD6) gene is located within a region of chromosome 11 (11q23.3) that has been shown by a number of genome scans to be one of the most well-established linkages to schizophrenia. FXYD6 encodes the protein phosphohippolin, which is primarily expressed in the brain. Phosphohippolin modulates the kinetic activity of Na,K-ATPase and has long-term physiological importance in maintaining cation homeostasis. A recent study reported that FXYD6 was associated with schizophrenia in the United Kingdom samples. Applying the gene-based association concept, we carried out an association study regarding FXYD6 and schizophrenia in a Japanese population, with a sample consisting of 2026 subjects (906 schizophrenics and 1120 controls). After linkage disequilibrium analysis, 23 single nucleotide polymorphisms (SNPs) were genotyped using 5'-exonuclease allelic discrimination assay. We found a significant association of two SNPs (rs11216573; genotypic P value: 0.022 and rs555577; genotypic P value: 0.026, allelic P value: 0.011, uncorrected). Nominal P values did not survive correction for multiple testing (rs11216573; genotypic P value: 0.47 and rs555577; genotypic P value: 0.55, allelic P value: 0.24, after SNPSpD correction). No association was observed between schizophrenia patients and controls in allelic, genotypic and haplotypic analyses. Our findings suggest that FXYD6 is unlikely to be related to the development of schizophrenia in a Japanese population.

  9. Comparative symbiotic plasmid analysis indicates that symbiosis gene ancestor type affects plasmid genetic evolution.

    Science.gov (United States)

    Wang, X; Zhao, L; Zhang, L; Wu, Y; Chou, M; Wei, G

    2018-07-01

    Rhizobial symbiotic plasmids play vital roles in mutualistic symbiosis with legume plants by executing the functions of nodulation and nitrogen fixation. To explore the gene composition and genetic constitution of rhizobial symbiotic plasmids, comparison analyses of 24 rhizobial symbiotic plasmids derived from four rhizobial genera was carried out. Results illustrated that rhizobial symbiotic plasmids had higher proportion of functional genes participating in amino acid transport and metabolism, replication; recombination and repair; carbohydrate transport and metabolism; energy production and conversion and transcription. Mesorhizobium amorphae CCNWGS0123 symbiotic plasmid - pM0123d had similar gene composition with pR899b and pSNGR234a. All symbiotic plasmids shared 13 orthologous genes, including five nod and eight nif/fix genes which participate in the rhizobia-legume symbiosis process. These plasmids contained nod genes from four ancestors and fix genes from six ancestors. The ancestral type of pM0123d nod genes was similar with that of Rhizobium etli plasmids, while the ancestral type of pM0123d fix genes was same as that of pM7653Rb. The phylogenetic trees constructed based on nodCIJ and fixABC displayed different topological structures mainly due to nodCIJ and fixABC ancestral type discordance. The study presents valuable insights into mosaic structures and the evolution of rhizobial symbiotic plasmids. This study compared 24 rhizobial symbiotic plasmids that included four genera and 11 species, illuminating the functional gene composition and symbiosis gene ancestor types of symbiotic plasmids from higher taxonomy. It provides valuable insights into mosaic structures and the evolution of symbiotic plasmids. © 2018 The Society for Applied Microbiology.

  10. An ABC analysis for power generation project

    OpenAIRE

    Batool Hasani; Younos Vakilalroaia

    2013-01-01

    One of the primary concerns on performance measurement is to know how much a particular project cost. However, using traditional method on project-based products often leads to inappropriate results. In this paper, we re-examine this issue by comparing the cost of a power station construction project using ABC versus traditional method. The results of survey show that ABC method is capable of providing better estimates for overhead costs compared with traditional method. In other words, ABC m...

  11. Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

    Science.gov (United States)

    Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

    2017-10-01

    ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. The Arabidopsis GASA10 gene encodes a cell wall protein strongly expressed in developing anthers and seeds.

    Science.gov (United States)

    Trapalis, Menelaos; Li, Song Feng; Parish, Roger W

    2017-07-01

    The Arabidopsis GASA10 gene encodes a GAST1-like (Gibberellic Acid-Stimulated) protein. Reporter gene analysis identified consistent expression in anthers and seeds. In anthers expression was developmentally regulated, first appearing at stage 7 of anther development and reaching a maximum at stage 11. Strongest expression was in the tapetum and developing microspores. GASA10 expression also occurred throughout the seed and in root vasculature. GASA10 was shown to be transported to the cell wall. Using GASA1 and GASA6 as positive controls, gibberellic acid was found not to induce GASA10 expression in Arabidopsis suspension cells. Overexpression of GASA10 (35S promoter-driven) resulted in a reduction in silique elongation. GASA10 shares structural similarities to the antimicrobial peptide snakin1, however, purified GASA10 failed to influence the growth of a variety of bacterial and fungal species tested. We propose cell wall associated GASA proteins are involved in regulating the hydroxyl radical levels at specific sites in the cell wall to facilitate wall growth (regulating cell wall elongation). Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. Tritium Suicide Selection Identifies Proteins Involved in the Uptake and Intracellular Transport of Sterols in Saccharomyces cerevisiae▿

    Science.gov (United States)

    Sullivan, David P.; Georgiev, Alexander; Menon, Anant K.

    2009-01-01

    Sterol transport between the plasma membrane (PM) and the endoplasmic reticulum (ER) occurs by a nonvesicular mechanism that is poorly understood. To identify proteins required for this process, we isolated Saccharomyces cerevisiae mutants with defects in sterol transport. We used Upc2-1 cells that have the ability to take up sterols under aerobic conditions and exploited the observation that intracellular accumulation of exogenously supplied [3H]cholesterol in the form of [3H]cholesteryl ester requires an intact PM-ER sterol transport pathway. Upc2-1 cells were mutagenized using a transposon library, incubated with [3H]cholesterol, and subjected to tritium suicide selection to isolate mutants with a decreased ability to accumulate [3H]cholesterol. Many of the mutants had defects in the expression and trafficking of Aus1 and Pdr11, PM-localized ABC transporters that are required for sterol uptake. Through characterization of one of the mutants, a new role was uncovered for the transcription factor Mot3 in controlling expression of Aus1 and Pdr11. A number of mutants had transposon insertions in the uncharacterized Ydr051c gene, which we now refer to as DET1 (decreased ergosterol transport). These mutants expressed Aus1 and Pdr11 normally but were severely defective in the ability to accumulate exogenously supplied cholesterol. The transport of newly synthesized sterols from the ER to the PM was also defective in det1Δ cells. These data indicate that the cytoplasmic protein encoded by DET1 is involved in intracellular sterol transport. PMID:19060182

  15. Molecular evidence for the coordination of nitrogen and carbon metabolisms, revealed by a study on the transcriptional regulation of the agl3EFG operon that encodes a putative carbohydrate transporter in Streptomyces coelicolor.

    Science.gov (United States)

    Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin

    2016-03-18

    In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  17. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  18. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  19. Molecular cloning and characterization of a gene encoding the proline transporter protein in common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Jibao Chen

    2016-10-01

    Full Text Available As a typical compatible solute, proline is accumulated in plants under environmental stresses. Proline transporter (ProT plays an important role in proline distribution between plant organs. Using a candidate gene approach, we cloned a cDNA sequence for ProT from common bean (Phaseolus vulgaris L. and designated the gene PvProT. The deduced amino acid sequence of PvProT showed high similarity to Bet/ProT proteins from other leguminous plants, and the highest similarity was observed with mothbean (Vigna aconitifolia L. VuProT. Relative quantification of the mRNA level of PvProT using real-time PCR analysis showed that the PvProT transcript level was higher in leaves than in stems and roots of common bean plants subjected to drought and salt stress. Under 20% (w/w PEG-6000 treatment, drought-resistant plants expressed a higher level of PvProT transcripts than drought-sensitive plants. Although heterologous expression of PvProT in the Escherichia coli mutant mkh13 showed that PvProT exhibited uptake activities for proline and betaine, no betaine content was detected in the common bean. These findings suggest that PvProT plays an important role in the transportation of proline in common bean plants exposed to drought and salt stress.

  20. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  1. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  2. Functional characterisation of three zinc transporters in Thlaspi caerulescens

    NARCIS (Netherlands)

    Talukdar, S.

    2007-01-01

    Heavy metal hyperaccumulation in plants is a poorly understood phenomenon. Transmembrane metal transporters are assumed to play a key role in this process. In the research described in this thesis, genes encoding Zn transporters of Thlaspi

  3. Costeo ABC - Gestión ABM

    OpenAIRE

    Cuevas Villegas, Carlos Fernando

    2010-01-01

    El presente artículo pretende mostrar en forma práctica la problemática de los sistemas actuales de costeo y plantear la alternativa conocida como costeo ABC, sus fundamentos, dificultades y utilidad. Así mismo se enfatiza el uso de la llamada Gerencia ABM, como complemento del costeo ABC.

  4. The 380 kb pCMU01 plasmid encodes chloromethane utilization genes and redundant genes for vitamin B12- and tetrahydrofolate-dependent chloromethane metabolism in Methylobacterium extorquens CM4: a proteomic and bioinformatics study.

    Directory of Open Access Journals (Sweden)

    Sandro Roselli

    Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of

  5. Molecular docking simulations provide insights in the substrate binding sites and possible substrates of the ABCC6 transporter.

    Directory of Open Access Journals (Sweden)

    Mohammad Jakir Hosen

    Full Text Available The human ATP-binding cassette family C member 6 (ABCC6 gene encodes an ABC transporter protein (ABCC6, primarily expressed in liver and kidney. Mutations in the ABCC6 gene cause pseudoxanthoma elasticum (PXE, an autosomal recessive connective tissue disease characterized by ectopic mineralization of the elastic fibers. The pathophysiology underlying PXE is incompletely understood, which can at least partly be explained by the undetermined nature of the ABCC6 substrates as well as the unknown substrate recognition and binding sites. Several compounds, including anionic glutathione conjugates (N-ethylmaleimide; NEM-GS and leukotriene C4 (LTC4 were shown to be modestly transported in vitro; conversely, vitamin K3 (VK3 was demonstrated not to be transported by ABCC6. To predict the possible substrate binding pockets of the ABCC6 transporter, we generated a 3D homology model of ABCC6 in both open and closed conformation, qualified for molecular docking and virtual screening approaches. By docking 10 reported in vitro substrates in our ABCC6 3D homology models, we were able to predict the substrate binding residues of ABCC6. Further, virtual screening of 4651 metabolites from the Human Serum Metabolome Database against our open conformation model disclosed possible substrates for ABCC6, which are mostly lipid and biliary secretion compounds, some of which are found to be involved in mineralization. Docking of these possible substrates in the closed conformation model also showed high affinity. Virtual screening expands this possibility to explore more compounds that can interact with ABCC6, and may aid in understanding the mechanisms leading to PXE.

  6. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

    Science.gov (United States)

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-02-20

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Paenibacillus polymyxa PKB1 produces variants of polymyxin B-type antibiotics.

    Science.gov (United States)

    Shaheen, Mohamed; Li, Jingru; Ross, Avena C; Vederas, John C; Jensen, Susan E

    2011-12-23

    Polymyxins are cationic lipopeptide antibiotics active against many species of Gram-negative bacteria. We sequenced the gene cluster for polymyxin biosynthesis from Paenibacillus polymyxa PKB1. The 40.8 kb gene cluster comprises three nonribosomal peptide synthetase-encoding genes and two ABC transporter-like genes. Disruption of a peptide synthetase gene abolished all antibiotic production, whereas deletion of one or both transporter genes only reduced antibiotic production. Computational analysis of the peptide synthetase modules suggested that the enzyme system produces variant forms of polymyxin B (1 and 2), with D-2,4-diaminobutyrate instead of L-2,4-diaminobutyrate in amino acid position 3. Two antibacterial metabolites were resolved by HPLC and identified by high-resolution mass spectrometry and MS/MS sequencing as the expected variants 3 and 4 of polymyxin B(1) (1) and B(2) (2). Stereochemical analysis confirmed the presence of both D-2,4-diaminobutyrate and L-2,4-diaminobutyrate residues. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. IPEC-J2 MDR1, a Novel High-Resistance Cell Line with Functional Expression of Human P-glycoprotein (ABCB1) for Drug Screening Studies

    DEFF Research Database (Denmark)

    Saaby, Lasse; Helms, Hans Christian Cederberg; Brodin, Birger

    2016-01-01

    The P-glycoprotein (P-gp) efflux pump has been shown to affect drug distribution and absorption in various organs and to cause drug resistance in cancer therapy. The aim of this work was to develop a cell line to serve as a screening system for potential substrates of P-gp. This requires a cell...... line with high paracellular tightness, low expression of nonhuman ABC transporters, and high expression of functional human P-gp (ABCB1). The porcine intestinal epithelial cell line, IPEC-J2, was selected as a transfection host, due to its ability to form extremely high-resistance monolayers (>10,000 Ω......·cm(2)) and its low endogenous expression of ABC-type efflux transporters. The IPEC-J2 cells were transfected with a plasmid that contained the sequence of the human MDR1 gene, which encodes P-gp, followed by a selection of successfully transfected cells with geneticin and puromycin. The resulting cell...

  9. The molybdate-binding protein (ModA) of the plant pathogen Xanthomonas axonopodis pv. citri.

    Science.gov (United States)

    Balan, Andrea; Santacruz, Carolina P; Moutran, Alexandre; Ferreira, Rita C C; Medrano, Francisco J; Pérez, Carlos A; Ramos, Carlos H I; Ferreira, Luís C S

    2006-12-01

    The modABC operon of phytopathogen Xanthomonas axonopodis pv. citri (X. citri) encodes a putative ABC transporter involved in the uptake of the molybdate and tungstate anions. Sequence analyses showed high similarity values of ModA orthologs found in X. campestris pv. campestris (X. campestris) and Escherichia coli. The X. citri modA gene was cloned in pET28a and the recombinant protein, expressed in the E. coli BL21 (DE3) strain, purified by immobilized metal affinity chromatography. The purified protein remained soluble and specifically bound molybdate and tungstate with K(d) 0.29+/-0.12 microM and 0.58+/-0.14 microM, respectively. Additionally binding of molybdate drastically enhanced the thermal stability of the recombinant ModA as compared to the apoprotein. This is the first characterization of a ModA ortholog expressed by a phytopathogen and represents an important tool for functional, biochemical and structural analyses of molybdate transport in Xanthomonas species.

  10. RiArsB and RiMT-11: Two novel genes induced by arsenate in arbuscular mycorrhiza.

    Science.gov (United States)

    Maldonado-Mendoza, Ignacio E; Harrison, Maria J

    Plants associated with arbuscular mycorrhizal fungi (AMF) increase their tolerance to arsenic-polluted soils. This study aims to investigate the genes involved in the AMF molecular response to arsenic pollution. Genes encoding proteins involved in arsenic metabolism were identified and their expression assessed by PCR or RT-qPCR. The As-inducible gene GiArsA (R. irregularis ABC ATPase component of the ArsAB arsenite efflux pump) and two new genes, an arsenate/arsenite permease component of ArsAB (RiArsB) and a methyltransferase type 11 (RiMT-11) were induced when arsenate was added to two-compartment in vitro monoxenic cultures of R. irregularis-transformed carrot roots. RiArsB and RiMT-11 expression in extraradical hyphae in response to arsenate displayed maximum induction 4-6 h after addition of 350 μM arsenate. Their expression was also detected in colonized root tissues grown in pots, or in the root-fungus compartment of two-compartment in vitro systems. We used a Medicago truncatula double mutant (mtpt4/mtpt8) to demonstrate that RiMT-11 and RiArsB transcripts accumulate in response to the addition of arsenate but not in response to phosphate. These results suggest that these genes respond to arsenate addition regardless of non-functional Pi symbiotic transport, and that RiMT-11 may be involved in arsenate detoxification by methylation in AMF-colonized tissues. Copyright © 2017 British Mycological Society. All rights reserved.

  11. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  12. The fixABCX genes in Rhodospirillum rubrum encode a putative membrane complex participating in electron transfer to nitrogenase.

    Science.gov (United States)

    Edgren, Tomas; Nordlund, Stefan

    2004-04-01

    In our efforts to identify the components participating in electron transport to nitrogenase in Rhodospirillum rubrum, we used mini-Tn5 mutagenesis followed by metronidazole selection. One of the mutants isolated, SNT-1, exhibited a decreased growth rate and about 25% of the in vivo nitrogenase activity compared to the wild-type values. The in vitro nitrogenase activity was essentially wild type, indicating that the mutation affects electron transport to nitrogenase. Sequencing showed that the Tn5 insertion is located in a region with a high level of similarity to fixC, and extended sequencing revealed additional putative fix genes, in the order fixABCX. Complementation of SNT-1 with the whole fix gene cluster in trans restored wild-type nitrogenase activity and growth. Using Western blotting, we demonstrated that expression of fixA and fixB occurs only under conditions under which nitrogenase also is expressed. SNT-1 was further shown to produce larger amounts of both ribulose 1,5-bisphosphate carboxylase/oxygenase and polyhydroxy alkanoates than the wild type, indicating that the redox status is affected in this mutant. Using Western blotting, we found that FixA and FixB are soluble proteins, whereas FixC most likely is a transmembrane protein. We propose that the fixABCX genes encode a membrane protein complex that plays a central role in electron transfer to nitrogenase in R. rubrum. Furthermore, we suggest that FixC is the link between nitrogen fixation and the proton motive force generated in the photosynthetic reactions.

  13. Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192.

    Science.gov (United States)

    Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan

    2017-04-01

    Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable

  14. Gravistimulation changes expression of genes encoding putative carrier proteins of auxin polar transport in etiolated pea epicotyls

    Science.gov (United States)

    Hoshino, T.; Hitotsubashi, R.; Miyamoto, K.; Tanimoto, E.; Ueda, J.

    STS-95 space experiment has showed that auxin polar transport in etiolated epicotyls of pea (Pisum sativum L. cv. Alaska) seedlings is controlled by gravistimulation. In Arabidopsis thaliana auxin polar transport has considered to be regulated by efflux and influx carrier proteins in plasma membranes, AtPIN1 and AtAUX1, respectively. In order to know how gravistimuli control auxin polar transport in etiolated pea epicotyls at molecular levels, strenuous efforts have been made, resulting in successful isolation of full-length cDNAs of a putative auxin efflux and influx carriers, PsPIN2 and PsAUX1, respectively. Significantly high levels in homology were found on nucleotide and deduced amino acid sequences among PsPIN2, PsPIN1 (accession no. AY222857, Chawla and DeMason, 2003) and AtPINs, and also among PsAUX1, AtAUX1 and their related genes. Phylogenetic analyses based on the deduced amino acid sequences revealed that PsPIN2 belonged to a subclade including AtPIN3, AtPIN4 relating to lateral transport of auxin, while PsPIN1 belonged to the same clade as AtPIN1 relating to auxin polar transport. In the present study, we examined the effects of gravistimuli on the expression of PsPINs and PsAUX1 in etiolated pea seedlings by northern blot analysis. Expression of PsPIN1, PsPIN2 and PsAUX1 in hook region of 3.5-d-old etiolated pea seedlings grown under simulated microgravity conditions on a 3-D clinostat increased as compared with that of the seedlings grown under 1 g conditions. On the other hand, that of PsPIN1 and PsAUX1 in the 1st internode region under simulated microgravity conditions on a 3-D clinostat also increased, while that of PsPIN2 was affected little. These results suggest that expression of PsPIN1, PsPIN2 and PsAUX1 regulating polar/lateral transport of auxin is substantially under the control of gravity. A possible role of PsPINs and PsAUX1 of auxin polar transport in etiolated pea seedlings will also be discussed.

  15. Discovering Novel Bile Protection Systems in Bifidobacterium breve UCC2003 through Functional Genomics

    Science.gov (United States)

    Ruiz, Lorena; Zomer, Aldert; O'Connell-Motherway, Mary; van Sinderen, Douwe

    2012-01-01

    Tolerance of gut commensals to bile salt exposure is an important feature for their survival in and colonization of the intestinal environment. A transcriptomic approach was employed to study the response of Bifidobacterium breve UCC2003 to bile, allowing the identification of a number of bile-induced genes with a range of predicted functions. The potential roles of a selection of these bile-inducible genes in bile protection were analyzed following heterologous expression in Lactococcus lactis. Genes encoding three transport systems belonging to the major facilitator superfamily (MFS), Bbr_0838, Bbr_0832, and Bbr_1756, and three ABC-type transporters, Bbr_0406-0407, Bbr_1804-1805, and Bbr_1826-1827, were thus investigated and shown to provide enhanced resistance and survival to bile exposure. This work significantly improves our understanding as to how bifidobacteria respond to and survive bile exposure. PMID:22156415

  16. Hijacking membrane transporters for arsenic phytoextraction

    Science.gov (United States)

    LeBlanc, Melissa S.; McKinney, Elizabeth C.; Meagher, Richard B.; Smith, Aaron P.

    2012-01-01

    Arsenic is a toxic metalloid and recognized carcinogen. Arsenate and arsenite are the most common arsenic species available for uptake by plants. As an inorganic phosphate (Pi) analog, arsenate is acquired by plant roots through endogenous Pi transport systems. Inside the cell, arsenate is reduced to the thiol-reactive form arsenite. Glutathione (GSH)-conjugates of arsenite may be extruded from the cell or sequestered in vacuoles by members of the ATP-binding cassette (ABC) family of transporters. In the present study we sought to enhance both plant arsenic uptake through Pi transporter overexpression, and plant arsenic tolerance through ABC transporter overexpression. We demonstrate that Arabidopsis thaliana plants overexpressing the high-affinity Pi transporter family members, AtPht1;1 or AtPht1;7, are hypersensitive to arsenate due to increased arsenate uptake. These plants do not exhibit increased sensitivity to arsenite. Co-overexpression of the yeast ABC transporter YCF1 in combination with AtPht1;1 or AtPht1;7 suppresses the arsenate-sensitive phenotype while further enhancing arsenic uptake. Taken together, our results support an arsenic transport mechanism in which arsenate uptake is increased through Pi transporter overexpression, and arsenic tolerance is enhanced through YCF1-mediated vacuolar sequestration. This work substantiates the viability of coupling enhanced uptake and vacuolar sequestration as a means for developing a prototypical engineered arsenic hyperaccumulator. PMID:23108027

  17. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  18. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  19. Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

    Science.gov (United States)

    Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

    2016-01-01

    Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  20. Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

    Directory of Open Access Journals (Sweden)

    Huanqiang Zhao

    2016-08-01

    Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  1. Redefining C and D in the petunia ABC.

    Science.gov (United States)

    Heijmans, Klaas; Ament, Kai; Rijpkema, Anneke S; Zethof, Jan; Wolters-Arts, Mieke; Gerats, Tom; Vandenbussche, Michiel

    2012-06-01

    According to the ABC(DE) model for flower development, C-genes are required for stamen and carpel development and floral determinacy, and D-genes were proposed to play a unique role in ovule development. Both C- and D-genes belong to the AGAMOUS (AG) subfamily of MADS box transcription factors. We show that the petunia (Petunia hybrida) C-clade genes PETUNIA MADS BOX GENE3 and FLORAL BINDING PROTEIN6 (FBP6) largely overlap in function, both in floral organ identity specification and floral determinacy, unlike the pronounced subfunctionalization observed in Arabidopsis thaliana and snapdragon (Antirrhinum majus). Some specialization has also evolved, since FBP6 plays a unique role in the development of the style and stigma. Furthermore, we show that the D-genes FBP7 and FBP11 are not essential to confer ovule identity. Instead, this function is redundantly shared among all AG members. In turn, the D-genes also participate in floral determinacy. Gain-of-function analyses suggest the presence of a posttranscriptional C-repression mechanism in petunia, most likely not existing in Arabidopsis. Finally, we show that expression maintenance of the paleoAPETALA3-type B-gene TOMATO MADS BOX GENE6 depends on the activity of C-genes. Taken together, this demonstrates considerable variation in the molecular control of floral development between eudicot species.

  2. Transcriptome sequencing of Mycosphaerella fijiensis during association with Musa acuminata reveals candidate pathogenicity genes.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-08-30

    Mycosphaerella fijiensis, causative agent of the black Sigatoka disease of banana, is considered the most economically damaging banana disease. Despite its importance, the genetics of pathogenicity are poorly understood. Previous studies have characterized polyketide pathways with possible roles in pathogenicity. To identify additional candidate pathogenicity genes, we compared the transcriptome of this fungus during the necrotrophic phase of infection with that during saprophytic growth in medium. Transcriptome analysis was conducted, and the functions of differentially expressed genes were predicted by identifying conserved domains, Gene Ontology (GO) annotation and GO enrichment analysis, Carbohydrate-Active EnZymes (CAZy) annotation, and identification of genes encoding effector-like proteins. The analysis showed that genes commonly involved in secondary metabolism have higher expression in infected leaf tissue, including genes encoding cytochrome P450s, short-chain dehydrogenases, and oxidoreductases in the 2-oxoglutarate and Fe(II)-dependent oxygenase superfamily. Other pathogenicity-related genes with higher expression in infected leaf tissue include genes encoding salicylate hydroxylase-like proteins, hydrophobic surface binding proteins, CFEM domain-containing proteins, and genes encoding secreted cysteine-rich proteins characteristic of effectors. More genes encoding amino acid transporters, oligopeptide transporters, peptidases, proteases, proteinases, sugar transporters, and proteins containing Domain of Unknown Function (DUF) 3328 had higher expression in infected leaf tissue, while more genes encoding inhibitors of peptidases and proteinases had higher expression in medium. Sixteen gene clusters with higher expression in leaf tissue were identified including clusters for the synthesis of a non-ribosomal peptide. A cluster encoding a novel fusicoccane was also identified. Two putative dispensable scaffolds were identified with a large proportion of

  3. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  4. Cinnamon extract regulates glucose transporter and insulin-signaling gene expression in mouse adipocytes.

    Science.gov (United States)

    Cao, Heping; Graves, Donald J; Anderson, Richard A

    2010-11-01

    Cinnamon extracts (CE) are reported to have beneficial effects on people with normal and impaired glucose tolerance, the metabolic syndrome, type 2 diabetes, and insulin resistance. However, clinical results are controversial. Molecular characterization of CE effects is limited. This study investigated the effects of CE on gene expression in cultured mouse adipocytes. Water-soluble CE was prepared from ground cinnamon (Cinnamomum burmannii). Quantitative real-time PCR was used to investigate CE effects on the expression of genes coding for adipokines, glucose transporter (GLUT) family, and insulin-signaling components in mouse 3T3-L1 adipocytes. CE (100 μg/ml) increased GLUT1 mRNA levels 1.91±0.15, 4.39±0.78, and 6.98±2.18-fold of the control after 2-, 4-, and 16-h treatments, respectively. CE decreased the expression of further genes encoding insulin-signaling pathway proteins including GSK3B, IGF1R, IGF2R, and PIK3R1. This study indicates that CE regulates the expression of multiple genes in adipocytes and this regulation could contribute to the potential health benefits of CE. Published by Elsevier GmbH.

  5. The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

    Science.gov (United States)

    Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

    1994-05-03

    Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

  6. Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

    Science.gov (United States)

    Chowdhury, Nilkanta; Bagchi, Angshuman

    2017-07-01

    Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

  7. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  8. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  9. The ABC of ABC : An analysis of attribute-based credentials in the light of data protection, privacy and identity.

    NARCIS (Netherlands)

    Korenhof, P.E.I.; Koning, Merel; Alpár, Gergely; Hoepman, J.H.; Padullés, Joan Balcells; i Martínez, Agustí Cerrillo; Poch, Miquel Peguera; López, Ismael Peña; de Moner, María José Pifarré; Solana, Mònica Vilasau

    2014-01-01

    Our networked society increasingly needs secure identity sys- tems. The Attribute-based credential (ABC) technology is designed to be privacy-friendlier than contemporary authentication methods, which often suffer from information leakage. So far, however, some of the wider implications of ABC have

  10. [Detection of putative polysaccharide biosynthesis genes in Azospirillum brasilense strains from serogroups I and II].

    Science.gov (United States)

    Petrova, L P; Prilipov, A G; Katsy, E I

    2017-01-01

    It is known that in Azospirillum brasilense strains Sp245 and SR75 included in serogroup I, the repeat units of their O-polysaccharides consist of five residues of D-rhamnose, and in strain SR15, of four; and the heteropolymeric O-polysaccharide of A. brasilense type strain Sp7 from serogroup II contains not less than five types of repeat units. In the present work, a complex of nondegenerate primers to the genes of A. brasilense Sp245 plasmids AZOBR_p6, AZOBR_p3, and AZOBR_p2, which encode putative enzymes for the biosynthesis of core oligosaccharide and O-polysaccharide of lipopolysaccharide, capsular polysaccharides, and exopolysaccharides, was proposed. By using the designed primers, products of the expected sizes were synthesized in polymerase chain reactions on genomic DNA of A. brasilense Sp245, SR75, SR15, and Sp7 in 36, 29, 23, and 12 cases, respectively. As a result of sequencing of a number of amplicons, a high (86–99%) level of identity of the corresponding putative polysaccharide biosynthesis genes in three A. brasilense strains from serogroup I was detected. In a blotting-hybridization reaction with the biotin-labeled DNA of the A. brasilense gene AZOBR_p60122 coding for putative permease of the ABC transporter of polysaccharides, localization of the homologous gene in ~120-MDa plasmids of the bacteria A. brasilense SR15 and SR75 was revealed.

  11. Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Muscariello Lidia

    2006-05-01

    Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

  12. ABCE1 is a highly conserved RNA silencing suppressor.

    Directory of Open Access Journals (Sweden)

    Kairi Kärblane

    Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

  13. Regulatory domain or CpG site variation in SLC12A5, encoding the chloride transporter KCC2, in human autism and schizophrenia

    Directory of Open Access Journals (Sweden)

    Nancy D Merner

    2015-10-01

    Full Text Available Many encoded gene products responsible for neurodevelopmental disorders (NDs like autism spectrum disorders (ASD, schizophrenia (SCZ, intellectual disability (ID, and idiopathic generalized epilepsy (IGE converge on networks controlling synaptic function. An increase in KCC2 (SLC12A5 Cl- transporter activity drives the developmental GABA excitatory-inhibitory sequence, but the role of KCC2 in human NDs is essentially unknown. Here, we report two rare, non-synonymous (NS, functionally-impairing variants in the KCC2 C-terminal regulatory domain (CTRD in human ASD (R952H and R1049C and SCZ (R952H previously linked with IGE and familial febrile seizures, and another novel NS KCC2 variant in ASD (R1048W with highly-predicted pathogenicity. Exome data from 2517 simplex families in the ASD Simon Simplex Collection revealed significantly more KCC2 CTRD variants in ASD cases than controls, and interestingly, these were more often synonymous and predicted to disrupt or introduce a CpG site. Furthermore, full gene analysis showed ASD cases are more likely to contain rare KCC2 variants affecting CpG sites than controls. These data suggest genetically-encoded dysregulation of KCC2-dependent GABA signaling may contribute to multiple human NDs.

  14. A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

    Science.gov (United States)

    Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

    2014-01-01

    The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

  15. The Mimivirus Genome Encodes a Mitochondrial Carrier That Transports dATP and dTTP▿

    Science.gov (United States)

    Monné, Magnus; Robinson, Alan J.; Boes, Christoph; Harbour, Michael E.; Fearnley, Ian M.; Kunji, Edmund R. S.

    2007-01-01

    Members of the mitochondrial carrier family have been reported in eukaryotes only, where they transport metabolites and cofactors across the mitochondrial inner membrane to link the metabolic pathways of the cytosol and the matrix. The genome of the giant virus Mimiviridae mimivirus encodes a member of the mitochondrial carrier family of transport proteins. This viral protein has been expressed in Lactococcus lactis and is shown to transport dATP and dTTP. As the 1.2-Mb double-stranded DNA mimivirus genome is rich in A and T residues, we speculate that the virus is using this protein to target the host mitochondria as a source of deoxynucleotides for its replication. PMID:17229695

  16. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  17. Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

    Science.gov (United States)

    Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

    2013-07-01

    Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  18. Deficiency of Functional Iron-Sulfur Domains in ABCE1 Inhibits the Proliferation and Migration of Lung Adenocarcinomas By Regulating the Biogenesis of Beta-Actin In Vitro

    Directory of Open Access Journals (Sweden)

    Qian Yu

    2017-11-01

    Full Text Available Background/Aims: ATP-binding cassette transporter E1 (ABCE1, a unique ABC superfamily member that bears two Fe-S clusters, is essential for metastatic progression in lung cancer. Fe-S clusters within ABCE1 are crucial for ribosome dissociation and translation reinitiation; however, whether these clusters promote tumor proliferation and migration is unclear. Methods: The interaction between ABCE1 and β-actin was confirmed using GST pull-down. The lung adenocarcinoma (LUAD cell line A549 was transduced with lentiviral packaging vectors overexpressing either wild-type ABCE1 or ABCE1 with Fe-S cluster deletions (ΔABCE1. The role of Fe-S clusters in the viability and migration of cancer cells was evaluated using clonogenic, MTT, Transwell and wound healing assays. Cytoskeletal rearrangement was determined using immunofluorescent techniques. Results: Fe-S clusters were the key domains in ABCE1 involved in binding to β-actin. The proliferative and migratory capacity increased in cells overexpressing ABCE1. However, the absence of Fe-S clusters reversed these effects. A549 cells overexpressing ABCE1 exhibited irregular morphology and increased levels of cytoskeletal polymerization as indicated by the immunofluorescence images. In contrast, cells expressing the Fe-S cluster deletion mutant presented opposing effects. Conclusion: These results demonstrate the indispensable role of Fe-S clusters when ABCE1 participates in the proliferation and migration of LUADs by interacting with β-actin. The Fe-S clusters of ABCE1 may be potential targets for the prevention of lung cancer metastasis.

  19. DNA methylation of amino acid transporter genes in the human placenta.

    Science.gov (United States)

    Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K

    2017-12-01

    Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.

  20. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  1. Genetic variation in the serotonin transporter gene influences ERP old/new effects during recognition memory.

    Science.gov (United States)

    Ross, Robert S; Medrano, Paolo; Boyle, Kaitlin; Smolen, Andrew; Curran, Tim; Nyhus, Erika

    2015-11-01

    Recognition memory is defined as the ability to recognize a previously encountered stimulus and has been associated with spatially and temporally distinct event-related potentials (ERPs). Allelic variations of the serotonin transporter gene (SLC6A4) have recently been shown to impact memory performance. Common variants of the serotonin transporter-linked polymorphic region (5HTTLPR) of the SLC6A4 gene result in long (l) and short (s) allelic variants with carriers of the s allele having lowered transcriptional efficiency. Thus, the current study examines the effects polymorphisms of the SLC6A4 gene have on performance and ERP amplitudes commonly associated with recognition memory. Electroencephalogram (EEG), genetic, and behavioral data were collected from sixty participants as they performed an item and source memory recognition task. In both tasks, participants studied and encoded 200 words, which were then mixed with 200 new words during retrieval. Participants were monitored with EEG during the retrieval portion of each memory task. EEG electrodes were grouped into four ROIs, left anterior superior, right anterior superior, left posterior superior, and right posterior superior. ERP mean amplitudes during hits in the item and source memory task were compared to correctly recognizing new items (correct rejections). Results show that s-carriers have decreased mean hit amplitudes in both the right anterior superior ROI 1000-1500ms post stimulus during the source memory task and the left anterior superior ROI 300-500ms post stimulus during the item memory task. These results suggest that individual differences due to genetic variation of the serotonin transporter gene influences recognition memory. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  3. Peptide Selectivity of the Proton-Coupled Oligopeptide Transporter from Neisseria meningitidis

    DEFF Research Database (Denmark)

    Sharma, Neha; Aduri, Nanda G; Iqbal, Anna

    2016-01-01

    POT). It has been shown that the gene encoding this transporter is upregulated during infection. NmPOT conformed to the typical chain length preference as observed in prototypical transporters of this family. In contrast to prototypical transporters, it was unable to accommodate a positively charged peptide...

  4. Sustained Delivery of Chondroitinase ABC from Hydrogel System

    Directory of Open Access Journals (Sweden)

    Filippo Rossi

    2012-03-01

    Full Text Available In the injured spinal cord, chondroitin sulfate proteoglycans (CSPGs are the principal responsible of axon growth inhibition and they contribute to regenerative failure, promoting glial scar formation. Chondroitinase ABC (chABC is known for being able to digest proteoglycans, thus degrading glial scar and favoring axonal regrowth. However, its classic administration is invasive, infection-prone and clinically problematic. An agarose-carbomer (AC1 hydrogel, already used in SCI repair strategies, was here investigated as a delivery system capable of an effective chABC administration: the material ability to include chABC within its pores and the possibility to be injected into the target tissue were firstly proved. Subsequently, release kinetic and the maintenance of enzymatic activity were positively assessed: AC1 hydrogel was thus confirmed to be a feasible tool for chABC delivery and a promising device for spinal cord injury topic repair strategies.

  5. Expression of Genes for Drug Transporters in the Human Female Genital Tract and Modulatory Effect of Antiretroviral Drugs.

    Directory of Open Access Journals (Sweden)

    Karolin Hijazi

    Full Text Available Anti-retroviral (ARV -based microbicides are one of the strategies pursued to prevent HIV-1 transmission. Delivery of ARV drugs to subepithelial CD4+ T cells at concentrations for protection is likely determined by drug transporters expressed in the cervicovaginal epithelium. To define the role of drug transporters in mucosal disposition of topically applied ARV-based microbicides, these must be tested in epithelial cell line-based biopharmaceutical assays factoring the effect of relevant drug transporters. We have characterised gene expression of influx and efflux drug transporters in a panel of cervicovaginal cell lines and compared this to expression in cervicovaginal tissue. We also investigated the effect of dapivirine, darunavir and tenofovir, currently at advanced stages of microbicides development, on expression of drug transporters in cell lines. Expression of efflux ABC transporters in cervical tissue was best represented in HeLa, Ect1/E6E7 and End1/E6E7 cell lines. Expression of influx OCT and ENT transporters in ectocervix matched expression in Hela while expression of influx SLCO transporters in vagina was best reflected in VK2/E6E7 cell line. Stimulation with darunavir and dapivirine upregulated MRP transporters, including MRP5 involved in transport of tenofovir. Dapivirine also significantly downregulated tenofovir substrate MRP4 in cervical cell lines. Treatment with darunavir and dapivirine showed no significant effect on expression of BCRP, MRP2 and P-glycoprotein implicated in efflux of different ARV drugs. Darunavir strongly induced expression in most cell lines of CNT3 involved in cell uptake of nucleotide/nucleoside analogue reverse transcriptase inhibitors and SLCO drug transporters involved in cell uptake of protease inhibitors. This study provides insight into the suitability of cervicovaginal cell lines for assessment of ARV drugs in transport kinetics studies. The modulatory effect of darunavir and dapivirine on

  6. Expression of Genes for Drug Transporters in the Human Female Genital Tract and Modulatory Effect of Antiretroviral Drugs.

    Science.gov (United States)

    Hijazi, Karolin; Cuppone, Anna M; Smith, Kieron; Stincarelli, Maria A; Ekeruche-Makinde, Julia; De Falco, Giulia; Hold, Georgina L; Shattock, Robin; Kelly, Charles G; Pozzi, Gianni; Iannelli, Francesco

    2015-01-01

    Anti-retroviral (ARV) -based microbicides are one of the strategies pursued to prevent HIV-1 transmission. Delivery of ARV drugs to subepithelial CD4+ T cells at concentrations for protection is likely determined by drug transporters expressed in the cervicovaginal epithelium. To define the role of drug transporters in mucosal disposition of topically applied ARV-based microbicides, these must be tested in epithelial cell line-based biopharmaceutical assays factoring the effect of relevant drug transporters. We have characterised gene expression of influx and efflux drug transporters in a panel of cervicovaginal cell lines and compared this to expression in cervicovaginal tissue. We also investigated the effect of dapivirine, darunavir and tenofovir, currently at advanced stages of microbicides development, on expression of drug transporters in cell lines. Expression of efflux ABC transporters in cervical tissue was best represented in HeLa, Ect1/E6E7 and End1/E6E7 cell lines. Expression of influx OCT and ENT transporters in ectocervix matched expression in Hela while expression of influx SLCO transporters in vagina was best reflected in VK2/E6E7 cell line. Stimulation with darunavir and dapivirine upregulated MRP transporters, including MRP5 involved in transport of tenofovir. Dapivirine also significantly downregulated tenofovir substrate MRP4 in cervical cell lines. Treatment with darunavir and dapivirine showed no significant effect on expression of BCRP, MRP2 and P-glycoprotein implicated in efflux of different ARV drugs. Darunavir strongly induced expression in most cell lines of CNT3 involved in cell uptake of nucleotide/nucleoside analogue reverse transcriptase inhibitors and SLCO drug transporters involved in cell uptake of protease inhibitors. This study provides insight into the suitability of cervicovaginal cell lines for assessment of ARV drugs in transport kinetics studies. The modulatory effect of darunavir and dapivirine on expression of drug

  7. Sequence- and Structure-Based Functional Annotation and Assessment of Metabolic Transporters in Aspergillus oryzae: A Representative Case Study

    Directory of Open Access Journals (Sweden)

    Nachon Raethong

    2016-01-01

    Full Text Available Aspergillus oryzae is widely used for the industrial production of enzymes. In A. oryzae metabolism, transporters appear to play crucial roles in controlling the flux of molecules for energy generation, nutrients delivery, and waste elimination in the cell. While the A. oryzae genome sequence is available, transporter annotation remains limited and thus the connectivity of metabolic networks is incomplete. In this study, we developed a metabolic annotation strategy to understand the relationship between the sequence, structure, and function for annotation of A. oryzae metabolic transporters. Sequence-based analysis with manual curation showed that 58 genes of 12,096 total genes in the A. oryzae genome encoded metabolic transporters. Under consensus integrative databases, 55 unambiguous metabolic transporter genes were distributed into channels and pores (7 genes, electrochemical potential-driven transporters (33 genes, and primary active transporters (15 genes. To reveal the transporter functional role, a combination of homology modeling and molecular dynamics simulation was implemented to assess the relationship between sequence to structure and structure to function. As in the energy metabolism of A. oryzae, the H+-ATPase encoded by the AO090005000842 gene was selected as a representative case study of multilevel linkage annotation. Our developed strategy can be used for enhancing metabolic network reconstruction.

  8. Sequence- and Structure-Based Functional Annotation and Assessment of Metabolic Transporters in Aspergillus oryzae: A Representative Case Study.

    Science.gov (United States)

    Raethong, Nachon; Wong-Ekkabut, Jirasak; Laoteng, Kobkul; Vongsangnak, Wanwipa

    2016-01-01

    Aspergillus oryzae is widely used for the industrial production of enzymes. In A. oryzae metabolism, transporters appear to play crucial roles in controlling the flux of molecules for energy generation, nutrients delivery, and waste elimination in the cell. While the A. oryzae genome sequence is available, transporter annotation remains limited and thus the connectivity of metabolic networks is incomplete. In this study, we developed a metabolic annotation strategy to understand the relationship between the sequence, structure, and function for annotation of A. oryzae metabolic transporters. Sequence-based analysis with manual curation showed that 58 genes of 12,096 total genes in the A. oryzae genome encoded metabolic transporters. Under consensus integrative databases, 55 unambiguous metabolic transporter genes were distributed into channels and pores (7 genes), electrochemical potential-driven transporters (33 genes), and primary active transporters (15 genes). To reveal the transporter functional role, a combination of homology modeling and molecular dynamics simulation was implemented to assess the relationship between sequence to structure and structure to function. As in the energy metabolism of A. oryzae, the H(+)-ATPase encoded by the AO090005000842 gene was selected as a representative case study of multilevel linkage annotation. Our developed strategy can be used for enhancing metabolic network reconstruction.

  9. MRP3, an organic anion transporter able to transport anti-cancer drugs

    OpenAIRE

    Kool, Marcel; van der Linden, Marcel; de Haas, Marcel; Scheffer, George L.; de Vree, J. Marleen L.; Smith, Alexander J.; Jansen, Gerrit; Peters, Godefridus J.; Ponne, Nico; Scheper, Rik J.; Elferink, Ronald P. J. Oude; Baas, Frank; Borst, Piet

    1999-01-01

    The human multidrug-resistance protein (MRP) gene family contains at least six members: MRP1, encoding the multidrug-resistance protein; MRP2 or cMOAT, encoding the canalicular multispecific organic anion transporter; and four homologs, called MRP3, MRP4, MRP5, and MRP6. In this report, we characterize MRP3, the closest homolog of MRP1. Cell lines were retrovirally transduced with MRP3 cDNA, and new monoclonal antibodies specific for MRP3 were generated. We show that MRP3 is an organic anion ...

  10. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  11. Functional analysis of candidate ABC transporter proteins for sitosterol transport

    DEFF Research Database (Denmark)

    Albrecht, C; Elliott, J I; Sardini, A

    2002-01-01

    implicated in lipid movement and expressed in tissues with a role in sterol synthesis and absorption, might also be involved in sitosterol transport. Transport by the multidrug resistance P-glycoprotein (P-gp; Abcb1), the multidrug resistance-associated protein (Mrp1; Abcc1), the breast cancer resistance...

  12. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  13. Dashboard Auditing of Activity-Based Costing (ABC)

    OpenAIRE

    Sorinel Capusneanu

    2009-01-01

    This article aims to define the dashboard auditing according to the specifics of Activity-Based Costing method (ABC). It describes the main objectives of dashboard auditing, the criteria that a dashboard auditor should meet and the step-by-step stages of the entire dashboard auditing process according to the Activity-Based Costing method (ABC).

  14. [Process and mechanism of plants in overcoming acid soil aluminum stress].

    Science.gov (United States)

    Zhao, Tian-Long; Xie, Guang-Ning; Zhang, Xiao-Xia; Qiu, Lin-Quan; Wang, Na; Zhang, Su-Zhi

    2013-10-01

    Aluminum (Al) stress is one of the most important factors affecting the plant growth on acid soil. Currently, global soil acidification further intensifies the Al stress. Plants can detoxify Al via the chelation of ionic Al and organic acids to store the ionic Al in vacuoles and extrude it from roots. The Al extrusion is mainly performed by the membrane-localized anion channel proteins Al(3+)-activated malate transporter (ALMT) and multi-drug and toxin extrusion (MATE). The genes encoding ABC transporter and zinc-finger protein conferred plant Al tolerance have also been found. The identification of these Al-resistant genes makes it possible to increase the Al resistance of crop plants and enhance their production by the biological methods such as gene transformation and mark-associated breeding. The key problems needed to be solved and the possible directions in the researches of plant Al stress resistance were proposed.

  15. An ABC analysis for power generation project

    Directory of Open Access Journals (Sweden)

    Batool Hasani

    2013-07-01

    Full Text Available One of the primary concerns on performance measurement is to know how much a particular project cost. However, using traditional method on project-based products often leads to inappropriate results. In this paper, we re-examine this issue by comparing the cost of a power station construction project using ABC versus traditional method. The results of survey show that ABC method is capable of providing better estimates for overhead costs compared with traditional method. In other words, ABC method helps reduce some of the unnecessary overhead cost items and increase on some other cost components. This helps increase the relative efficiency of the system by reducing total cost of project.

  16. Redefining C and D in the Petunia ABC[W

    Science.gov (United States)

    Heijmans, Klaas; Ament, Kai; Rijpkema, Anneke S.; Zethof, Jan; Wolters-Arts, Mieke; Gerats, Tom; Vandenbussche, Michiel

    2012-01-01

    According to the ABC(DE) model for flower development, C-genes are required for stamen and carpel development and floral determinacy, and D-genes were proposed to play a unique role in ovule development. Both C- and D-genes belong to the AGAMOUS (AG) subfamily of MADS box transcription factors. We show that the petunia (Petunia hybrida) C-clade genes PETUNIA MADS BOX GENE3 and FLORAL BINDING PROTEIN6 (FBP6) largely overlap in function, both in floral organ identity specification and floral determinacy, unlike the pronounced subfunctionalization observed in Arabidopsis thaliana and snapdragon (Antirrhinum majus). Some specialization has also evolved, since FBP6 plays a unique role in the development of the style and stigma. Furthermore, we show that the D-genes FBP7 and FBP11 are not essential to confer ovule identity. Instead, this function is redundantly shared among all AG members. In turn, the D-genes also participate in floral determinacy. Gain-of-function analyses suggest the presence of a posttranscriptional C-repression mechanism in petunia, most likely not existing in Arabidopsis. Finally, we show that expression maintenance of the paleoAPETALA3-type B-gene TOMATO MADS BOX GENE6 depends on the activity of C-genes. Taken together, this demonstrates considerable variation in the molecular control of floral development between eudicot species. PMID:22706285

  17. Transport processes of the legume symbiosome membrane

    Directory of Open Access Journals (Sweden)

    Victoria C Clarke

    2014-12-01

    Full Text Available The symbiosome membrane (SM is a physical barrier between the host plant and nitrogen-fixing bacteria in the legume-rhizobium symbiosis, and represents a regulated interface for the movement of solutes between the symbionts that is under plant control. The primary nutrient exchange across the SM is the transport of a carbon energy source from plant to bacteroid in exchange for fixed nitrogen. At a biochemical level two channels have been implicated in movement of fixed nitrogen across the SM and a uniporter that transports monovalent dicarboxylate ions has been characterized that would transport fixed carbon. The aquaporin NOD26 may provide a channel for ammonia, but the genes encoding the other transporters have not been identified. Transport of several other solutes, including calcium and potassium, have been demonstrated in isolated symbiosomes, and genes encoding transport systems for the movement of iron, nitrate, sulfate and zinc in nodules have been identified. However, definitively matching transport activities with these genes has proved difficult and many further transport processes are expected on the SM to facilitate the movement of nutrients between the symbionts. Recently, work detailing the SM proteome in soybean has been completed, contributing significantly to the database of known SM proteins. This represents a valuable resource for the identification of transporter protein candidates, some of which may correspond to transport processes previously described, or to novel transport systems in the symbiosis. Putative transporters identified from the proteome include homologues of transporters of sulfate, calcium, peptides and various metal ions. Here we review current knowledge of transport processes of the SM and discuss the requirements for additional transport routes of other nutrients exchanged in the symbiosis, with a focus on transport systems identified through the soybean SM proteome.

  18. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  19. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  20. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.