WorldWideScience

Sample records for abbreviations complete glossary

  1. JPRS Report, Latin America, Reference Aid Glossary of Spanish Military and General Acronyms and Abbreviations

    National Research Council Canada - National Science Library

    1988-01-01

    Glossary of Spanish Military and general acronyms and abbreviations. This Reference Aid is a first attempt at making a systematic compilation of Spanish acronyms and abbreviations, particularly in the military field...

  2. Glossary

    Science.gov (United States)

    ... Loss Resources Resources Resources Content Licensing and Co-branding Glossary Advance directive - A general term that describes ... options. The patient’s ability to understand other unrelated concepts is not relevant. The term is frequently used ...

  3. Glossary of Geology

    Science.gov (United States)

    Jackson, Julia A.

    The Glossary has expanded coverage particularly in such active fields as carbonate sedimentology, environmental geology and geophysics, GIS, GPS, hydrology and hydraulics, marine and coastal geology, organic geochemistry, paleoecology, seismology, stratigraphic nomenclature, speleology and karst, and structural geology and tectonics. Many definitions provide a syllabification guide and background information. Thus a reader will learn the difference between look-alike pairs, such as sylvanite (a mineral) and sylvinite (a rock); the origin of terms; the meaning of abbreviations and acronyms common in the geosciences vocabulary; the dates many terms were first used; the meaning of certain prefixes; and the preferred term of two or more synonyms.

  4. Oral Health Glossary

    Science.gov (United States)

    ... 2018 About | Contact InfoBites Quick Reference Learn more Oral Health and Overal Health Gum Disease and Cardiovascular Health ... news feeds delivered directly to your desktop! more... Oral Health Glossary Article Chapters Oral Health Glossary print full ...

  5. Nuclear Terms: a glossary

    Energy Technology Data Exchange (ETDEWEB)

    Freiwald, David A. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    1981-05-31

    This booklet is a revision of Nuclear Terms: A Glossary, published in 1967 by the United States Atomic Energy Commission. New fields, such as laser fusion and laser isotope separation, are included and nuclear weapons terms are deleted. Thus, it is a glossary for nuclear fission and fusion science and for commercial applications. David A. Freiwald, Frank C. DiLuzio, and Leslie M. Redman prepared this revised glossary. Contributions were made by other members of the Los Alamos National Laboratory staff.

  6. Nuclear Terms; A Brief Glossary; Second Edition

    Energy Technology Data Exchange (ETDEWEB)

    None

    1969-10-01

    Terms defined in this glossary are among those commonly used in nuclear science and its applications. Some also are in common usage or apply in other specialized areas of science and technology. When this is the case, the definitions given are those which have special meaning in nuclear fields, unless otherwise indicated. This glossary is intended for persons who are not specialists in the subject matter of atomic energy. Some definitions may for that reason fall short of technical precision or completeness.

  7. Haz-Map Glossary

    Science.gov (United States)

    ... PDF documents can be viewed with the free Adobe® Reader™ Home » Haz-Map Glossary Haz-Map Glossary ... PDF documents can be viewed with the free Adobe® Reader™ Customer Service: tehip@teh.nlm.nih.gov ...

  8. Interpares 3 multilingual glossary

    Directory of Open Access Journals (Sweden)

    Claudia Lacombe Rocha

    2011-01-01

    Full Text Available InterPARES Project (International Research on Permanent Authentic Records in Electronic Systems is a multidisciplinary international collaborative endeavor, which involves researchers from many countries. As one of the products of the project's second phase a Terminology Database was presented, containing two main instruments: a glossary and a dictionary. The terms and definitions presented in the glossary are the key to facilitate communication among the investigators as well to support the dissemination of InterPARES theory and methodology. Accordingly, InterPARES 3 investigators are translating the glossary.

  9. Radioactive waste management glossary

    International Nuclear Information System (INIS)

    1988-01-01

    The Waste Management Glossary defines over 300 terms in the English language that have special meanings when they are used in the context of radioactive waste management. The Glossary is intended to provide a consistent reference for these terms for specialists in this field. It also will assist non-specialists who read IAEA reports dealing with waste management. This is the second edition of the Glossary. It is intended to update and replace its predecessor, TECDOC-264, that was issued in 1982. (author)

  10. Antibiotics and Resistance: Glossary

    Science.gov (United States)

    ... Work Contact Us ABOUT THE ISSUE What is Antibiotic Resistance? General Background Science of Resistance Glossary References ... for Adaptation Genetics and Drug Resistance Reservoirs of Antibiotic Resistance Project (ROAR) INTERNATIONAL CHAPTERS APUA Chapter Network ...

  11. Bedwetting: Glossary for Kids

    Science.gov (United States)

    ... Us You are here Home » Glossary for Kids BEHAVIOR MODIFICATION: If you use a "moisture alarm", a small ... you start to pee is one example of BEHAVIOR MODIFICATION. BIOFEEDBACK: A device is attached to your body ...

  12. Radioactive waste management glossary

    International Nuclear Information System (INIS)

    1982-04-01

    Terminology used in documents published by the IAEA is frequently defined in glossaries in the separate documents so that understanding is enhanced, particularly for terms having unique meanings in the field of radioactive waste management. This has been found to be a good practice but frequently a burdensome one, too. In addition, terms in various documents occasionally were used differently. Thus, a common glossary of terms for radioactive waste management documents is believed to have merit. This glossary has been developed for use in IAEA documentation on radioactive waste management topics. The individual items have been compiled by selecting terms and definitions from thirty sources, listed on the next page, and numerous people. An effort has been made to use the definitions in internationally-accepted glossaries (e.g. ICRP, ICRU, ISO), with minimum modification; similarly, definitions in recently published IAEA documents have been respected. Nevertheless, when modifications were believed appropriate, they have been made. The glossary, stored on magnetic tape, is intended to be used as a standard for terminology for IAEA use; it is hoped that some benefits of common international terminology may result from its use in IAEA documentation

  13. Some Common Abbreviations

    Science.gov (United States)

    ... medlineplus.gov/appendixb.html Appendix B: Some Common Abbreviations To use the sharing features on this page, ... JavaScript. This is a list of some common abbreviations and acronyms. Abbreviation Stands for More information ABG ...

  14. Radiation protection glossary

    International Nuclear Information System (INIS)

    1986-01-01

    The glossary is intended to be used as a terminology standard for IAEA documentation on radiation protection. An effort has been made to use definitions contained in internationally accepted publications such as recommendations of the International Commission on Radiological Protection (ICRP), standards of the International Organization for Standardization (ISO) and of the International Electrotechnical Commission (IEC), reports of the International Commission on Radiation Units and Measurements (ICRU), with only slight modifications in order to tailor them more closely to IAEA needs. The glossary is restricted to ionizing radiation

  15. A Human Rights Glossary.

    Science.gov (United States)

    Flowers, Nancy

    1998-01-01

    Presents a human rights glossary that includes definitions of basic terms, treaties, charters, and groups/organizations that have been featured in previous articles in this edition of "Update on Law-Related Education"; the human rights terms have been compiled as part of the celebration of the Universal Declaration of Human Rights…

  16. Eating Disorders Glossary

    Science.gov (United States)

    ... us in our mission. F.E.A.S.T.'s Eating Disorders Glossary Welcome to our comprehensive quick-reference eating ... Conversion Weight Manipulation Weight restoration, weight restored Zinc Eating disorders biology & pharmacology Antidepressants BDNF - brain-derived neurotophic factor ...

  17. Glossary on agricultural landscapes.

    NARCIS (Netherlands)

    Kruse, A.; Centeri, C.; Renes, J.; Roth, M.; Printsman, A.; Palang, H.; Benito Jorda, M.-D.; Verlarde, M.D.; Kruckenberg, H.

    2010-01-01

    T he following glossary of terms related to the European agricultural landscape shall serve as a common basis for all parties, working in or on agricultural landscapes. Some of the terms are quite common and sometimes used in our every day language, but they often have different meanings in

  18. Parkinson's Disease Glossary

    Science.gov (United States)

    ... Bachmann-Strauss Prize Alpha-Synuclein Imaging Prize HOME › PARKINSON'S DISEASE GLOSSARY A | B | C | D | E | F | G | ... used to treat mild to moderate dementia in Parkinson's disease. These drugs increase brain levels of a neurotransmitter ...

  19. Allergy-immunology glossary

    African Journals Online (AJOL)

    ahmed

    Allergy-immunology glossary. Zeinab A. El-Sayed, Nesrine Radwan. Pediatric Allergy and Immunology Unit, Children's Hospital, Ain-Shams University. Towards a clear designation of some of the terms used in allergology and immunology. Natural killer (NK) cells. NK cells account for up to 15% of peripheral blood.

  20. Abbreviations in Maritime English

    Science.gov (United States)

    Yang, Zhirong

    2011-01-01

    Aiming at the phenomena that more and more abbreviations occur in maritime English correspondences, the composing laws of the abbreviations in maritime English correspondence are analyzed, and the correct methods to answer the abbreviations are pointed out, and the translation method of abbreviations are summarized in this article, and the…

  1. Glossary of nuclear energy

    International Nuclear Information System (INIS)

    1990-01-01

    TNC 90 focuses on nuclear energy technology. Some more basic or less central terms which were included in the previous glossary, TNC 55, have not been included in this version. About 1200 definitions in swedish included together with translations to english, german and french. The terms have been listed in alphabetical order. To make it easier to look up a certain term or terms that stand for related concepts the terms have been systematically arranged in a special index. (L.E.)

  2. Glossary of atomic terms

    International Nuclear Information System (INIS)

    1980-01-01

    This glossary (of about 400 terms) has been compiled to help people outside the atomic energy industry to understand what those inside it are saying. It is not intended to be a definitive dictionary of scientific or technical terms, nor does it aim to cover terms that are in general use in science and technology. A list of some initials and acronyms is appended. (author)

  3. Glossary of atomic terms

    International Nuclear Information System (INIS)

    1982-04-01

    This glossary, containing almost 400 terms, has been compiled to help people outside the atomic energy industry to understand what those inside it are saying. It is not intended to be a definitive dictionary of scientific or technical terms, nor does it aim to cover terms that are in general use in science and technology. A list of about 100 initials and acronyms will be found at the end. (author)

  4. IAEA spent fuel storage glossary

    International Nuclear Information System (INIS)

    1985-10-01

    The aim of this glossary is to provide a basis for improved international understanding of terms used in the important area of spent fuel storage technology. The glossary is the product of an IAEA Consultant Group with valuable input from a substantial list of reviewers. The glossary emphasizes fuel storage relevant to power reactors, but is also widely applicable to research reactors. The intention is to define terms from current technologies. Terms are limited to those directly related to spent fuel storage

  5. Glossary to ARCH (GARCH)

    DEFF Research Database (Denmark)

    Bollerslev, Tim

    The literature on modeling and forecasting time-varying volatility is ripe with acronyms and abbreviations used to describe the many different parametric models that have been put forth since the original linear ARCH model introduced in the seminal Nobel Prize winning paper by Engle (1982......).  The present paper provides an easy-to-use encyclopedic reference guide to this long list of ARCH acronyms.  In addition to the acronyms associated with specific parametric models, I have also included descriptions of various abbreviations associated with more general statistical procedures and ideas...

  6. FDA Acronyms and Abbreviations

    Data.gov (United States)

    U.S. Department of Health & Human Services — The FDA Acronyms and Abbreviations database provides a quick reference to acronyms and abbreviations related to Food and Drug Administration (FDA) activities

  7. NRC collection of abbreviations

    International Nuclear Information System (INIS)

    1992-03-01

    The US Nuclear Regulatory Commission (NRC) staff collected this list of abbreviations from NRC documents and nuclear industry documents, both foreign and domestic. Readers can use the collection, which is not all inclusive, to identify the terms from which the abbreviations are formed. The Editorial Section of the Division of Freedom of Information and Publications Services compiled this collection. In the introduction, the editorial staff offers suggestions for using abbreviations but does not recommend the use of one abbreviation over another

  8. Big data glossary

    CERN Document Server

    Warden, Pete

    2011-01-01

    To help you navigate the large number of new data tools available, this guide describes 60 of the most recent innovations, from NoSQL databases and MapReduce approaches to machine learning and visualization tools. Descriptions are based on first-hand experience with these tools in a production environment. This handy glossary also includes a chapter of key terms that help define many of these tool categories: NoSQL Databases-Document-oriented databases using a key/value interface rather than SQLMapReduce-Tools that support distributed computing on large datasetsStorage-Technologies for stori

  9. An LBGT/Queer Glossary

    Science.gov (United States)

    Chase, Becca; Ressler, Paula

    2009-01-01

    This article presents a glossary of LBGT (lesbian, bisexual, gay, transsexual). This glossary is based on definitions culled from a few different sources, including the Gay, Lesbian and Straight Education Network (GLSEN); the Illinois Safe Schools Alliance; and Wikipedia, which provides useful up-to-date information that people use when they…

  10. 40 CFR 86.1804-01 - Acronyms and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Acronyms and abbreviations. 86.1804-01..., and Complete Otto-Cycle Heavy-Duty Vehicles § 86.1804-01 Acronyms and abbreviations. The following abbreviations apply to this subpart: A/C—Air conditioning. AECD—Auxiliary emission control device. A/F—Air/Fuel...

  11. Glossary of Spatial Data Infrastructure

    Directory of Open Access Journals (Sweden)

    Nedjeljko Frančula

    2011-12-01

    Full Text Available All items are listed in the Glossary by alphabetical order. If an item consists of two or more words, the first is always a noun. For example: spatial data infrastructure is listed as infrastructure, saptial data.

  12. Glossary of Organization Development Terminology.

    Science.gov (United States)

    Krepner-Tregoe and Associates, Inc., Princeton, NJ.

    Ranging from Action Sequence to Zero Defects, this Kepner-Tregoe glossary defines 194 terms (including some specifically Kepner-Tregoe) relevant to the fields of management development, organization development, and industrial training. (LY)

  13. Glossary: Carbon dioxide and climate

    Energy Technology Data Exchange (ETDEWEB)

    1990-08-01

    This Glossary contains definitions of selected CO{sub 2}-related terms as well as tables containing information related to CO{sub 2} and climate. Each term is defined with an emphasis on its relationship to CO{sub 2} and climate. Many of the definitions are then followed by a more detailed description of the term and its use. References to the literature from which the definitions were taken are listed at the end of the Glossary.

  14. SNODOG Glossary: Part 1, Introduction

    Energy Technology Data Exchange (ETDEWEB)

    Watson, C.R.

    1993-04-15

    The SNODOG Glossary is used by the DOE-supported life-span beagle studies to describe medical observations in a standardized format. It is an adaptation of the human medical glossary, SNOMED, which lists 107,165 terms. Each of the five laboratories, Argonne National Laboratory, the Inhalation Toxicology Research Institute, the Pacific Northwest Laboratory, the University of California at Davis, and the University of Utah, has selected an appropriate subset from the published SNOMED glossary and added beagle and research-specific terms. The National Radiobiology Archives is the coordinator of these enhancements, and periodically distributes SNODOG to the respective laboratories. Information donated by Colorado State University and Oak Ridge National Laboratory has been related to SNODOG and is available in a standardized format. This document is designed for the database manager and the scientist who will be managing or coding medical observations. It is also designed for the scientist analyzing coded information. The document includes: an overview of the NRA and the SNODOG glossary, a discussion of hardware requirements, a review of the SNODOG code structure and printed lists of the 4,770 terms which have been used at least once. Instructions for obtaining electronic copies of the glossary and for nominating additional terms are provided. This document describes the origins and structure of the SNODOG codes, explains code usage at each participating institution, and presents a usage frequency tabulation of the terms for neoplasia. A diskette or magnetic tape containing 15,641 SNODOG codes and translations is available on request.

  15. Glossary of Foot and Ankle Terms

    Science.gov (United States)

    ... Glossary of Foot & Ankle Terms Glossary of Foot & Ankle Terms Page Content Achilles tendon - The Achilles tendon ... research grants, humanitarian outreach and public education initiatives. Ankle instability - Chronic, repetitive sprains of the ankle. This ...

  16. A glossary of Karst terminology

    Science.gov (United States)

    Monroe, Watson Hiner

    1970-01-01

    This glossary includes most terms used in describing karst geomorphologic features and processes. The terms are primarily those used in the literature of English-speaking countries, but a few of the more common terms in French, German, and Spanish are included, with references to the corresponding English terms where they are available. The glossary also includes simple definitions of the more common rocks and minerals found in karst terrain, common terms of hydrology, and a number of the descriptive terms used by speleologists. The glossary does not include definitions of most biospeleological terms, geologic structure terms, varieties of carbonate rock that require microscopic techniques for identification, or names describing tools and techniques of cave exploration.

  17. A Glossary of Indexing Terms.

    Science.gov (United States)

    Buchanan, Brian

    An expansion of a list developed at a British library school, this glossary contains terminology used in indexing work done by libraries and information scientists. Entries are arranged alphabetically and vary in length from one line to one page. There may be up to three parts in each entry. The first is a basic definition with examples where…

  18. Telecommunications glossary of telecommunications terms

    CERN Document Server

    1997-01-01

    This glossary contains more than 5,000 technical terms and definitions that were standardized by the federal government for use by international and U.S. government telecommunications specialists. It includes international and national terms drawn from the International Telecommunication Union, the International Organization for Standardization, the TIA, ANSI, and others.

  19. Glossary for econometrics and epidemiology.

    Science.gov (United States)

    Gunasekara, F Imlach; Carter, K; Blakely, T

    2008-10-01

    Epidemiologists and econometricians are often interested in similar topics-socioeconomic position and health outcomes-but the different languages that epidemiologists and economists use to interpret and discuss their results can create a barrier to mutual communication. This glossary defines key terms used in econometrics and epidemiology to assist in bridging this gap.

  20. IBE Glossary of Curriculum Terminology

    Science.gov (United States)

    UNESCO International Bureau of Education, 2013

    2013-01-01

    The International Bureau of Education (IBE) has compiled a "Glossary of Curriculum Terminology" offering definitions for over 180 terms related to the curriculum. It is also intended to be a working reference tool for specialists, educators and practitioners, and therefore feedback and suggestions are invited to help us to continue to…

  1. IAEA safeguards glossary. 2001 ed

    International Nuclear Information System (INIS)

    2002-01-01

    IAEA safeguards have evolved since their inception in the late 1960s. In 1980 the IAEA published the first IAEA Safeguards Glossary (IAEA/SG/INF/l) with the aim of facilitating understanding of the specialized safeguards terminology within the international community. In 1987 the IAEA published a revised edition of the Glossary (IAEA/SG/INF/l (Rev.l)) which took into account developments in the safeguards area as well as comments received since the first edition appeared. Since 1987, IAEA safeguards have become more effective and efficient, mainly through the series of strengthening measures approved by the IAEA Board of Governors during 1992-1997, the Board's approval, in 1997, of the Model Protocol Additional to the Agreement(s) between State(s) and the International Atomic Energy Agency for the Application of Safeguards (issued as INFCIRC/540 (Corrected)), and the work, begun in 1999, directed towards the development and implementation of integrated safeguards. The IAEA Safeguards Glossary 2001 Edition reflects these developments. Each of the 13 sections of the Glossary addresses a specific subject related to IAEA safeguards. To facilitate understanding. definitions and, where applicable, explanations have been given for each of the terms listed. The terms defined and explained intentionally have not been arranged in alphabetical order, but their sequence within each section corresponds to the internal relationships of the subject treated. The terms are numbered consecutively within each section and an index referring to these numbers has been provided for ease of reference. The terms used have been translated into the official languages of the IAEA, as well as into German and Japanese. The IAEA Safeguards Glossary 2001 Edition has no legal status and is not intended to serve as a basis for adjudicating on problems of definition such as might arise during the negotiation or in the interpretation of safeguards agreements or additional protocols. The IAEA

  2. IAEA safeguards glossary. 2001 ed

    International Nuclear Information System (INIS)

    2002-01-01

    IAEA safeguards have evolved since their inception in the late 1960s. In 1980 the IAEA published the first IAEA Safeguards Glossary (IAEA/SG/INF/l) with the aim of facilitating understanding of the specialized safeguards terminology within the international community. In 1987 the IAEA published a revised edition of the Glossary (IAEA/SG/INF/l (Rev.l)) which took into account developments in the safeguards area as well as comments received since the first edition appeared. Since 1987, IAEA safeguards have become more effective and efficient, mainly through the series of strengthening measures approved by the IAEA Board of Governors during 1992-1997, the Board's approval, in 1997, of the Model Protocol Additional to the Agreement(s) between State(s) and the International Atomic Energy Agency for the Application of Safeguards (issued as INFCIRC/540 (Corrected)), and the work, begun in 1999, directed towards the development and implementation of integrated safeguards. The IAEA Safeguards Glossary 2001 Edition reflects these developments. Each of the 13 sections of the Glossary addresses a specific subject related to IAEA safeguards. To facilitate understanding. definitions and, where applicable, explanations have been given for each of the terms listed. The terms defined and explained intentionally have not been arranged in alphabetical order, but their sequence within each section corresponds to the internal relationships of the subject treated. The terms are numbered consecutively within each section and an index referring to these numbers has been provided for ease of reference. The terms used have been translated into the official languages of the IAEA, as well as into German and Japanese. The IAEA Safeguards Glossary 2001 Edition has no legal status and is not intended to serve as a basis for adjudicating on problems of definition such as might arise during the negotiation or in the interpretation of safeguards agreements or additional protocols. The IAEA

  3. Alphabet Soup. Children's Services: Glossary of Terms.

    Science.gov (United States)

    California Child Development Programs Advisory Committee, Sacramento.

    This document provides a glossary of terms related to children's services in California and a list of state and local organizations and agencies. The glossary includes such terms as Alternative Payment, Child Health and Disability Prevention Program, Child Support Enforcement Program, Employer-Supported Child Care, Family Reunification Program,…

  4. A picture dictionary of electric glossary

    International Nuclear Information System (INIS)

    1974-01-01

    This book has a lot of explanations on electric glossary with picture, which include basic important glossaries like nuclear, current theory, measuring, electro genesis, power transmission, supply of electric power, a rotary machine, application of electromotive force, electronic engineering, automatic control, electronic calculator, T.V and communication, material of electricity, electrochemistry, traffic, electric work, lighting and electric heater, regulations and standard.

  5. Glossary

    Science.gov (United States)

    ... is highly susceptible to mutation because of some inherent instability, a tendency toward unequal crossing over , or ... associated with an abnormal phenotype or increased disease risk. A likely benign variant meets most, but not ...

  6. Glossary

    Science.gov (United States)

    ... blocks the cerebrospinal fluid which cushions the brain. Hypertension Technical term for “high blood pressure”; usually a ... lost of balance; blackouts. Translational Research The new definition of translational research is performed by clinician-scientists ...

  7. Glossary

    OpenAIRE

    Olorunyomi, Sola

    2013-01-01

    Afrika Shrine Fela’s place of worship and nightspot. The aspect of worship started at the Empire Hotel (Fela’s former shrine), but was given full expression when he moved to Pepple Street. During musical interludes, Fela breaks off to worship with band members and acolytes. Afrobeat This is the name by which Fela’s music came to be known starting in the late sixties. And though the name survives, in a 1992 interview I had with him, Fela denounced the nomenclature as “a meaningless commercial ...

  8. Glossary

    Science.gov (United States)

    ... mitochondrial enzymes (also known as complexes I, II, III and IV) that are needed to generate the electron and proton “gradient” that is utilized by complex V to generate ATP. ENCEPHALOPATHY : Any disease of the brain. ENZYME : A ...

  9. Glossary

    Science.gov (United States)

    ... gives results in terms of numbers. Example: Glucose meters indicate how much glucose is present in the ... Saliva Test) Ovulation (Urine Test) Pregnancy Prothrombin Vaginal pH Page Last Updated: 12/28/2017 Note: If ...

  10. Glossary

    International Nuclear Information System (INIS)

    Carr, S.

    1986-11-01

    This document lists definitions of the scientific and computing terms used in the documentation for the SYVAC A/C 1.03 computer program. SYVAC A/C 1.03 simulates the groundwater mediated movement of radionuclides from underground facilities for the disposal of low and intermediate level wastes to the accessible environment, and provides an estimate of the subsequent radiological risk to man. (author)

  11. Igneous Rocks: A Classification and Glossary of Terms

    Science.gov (United States)

    Le Maitre, R. W.; Streckeisen, A.; Zanettin, B.; Le Bas, M. J.; Bonin, B.; Bateman, P.

    2005-01-01

    Decades of field and microscope studies, and more recent quantitative geochemical analyses have resulted in a vast, and sometimes overwhelming, array of nomenclature and terminology associated with igneous rocks. This book presents a complete classification of igneous rocks based on all the recommendations of the International Union of Geological Sciences (IUGS) Subcommission on the Systematics of Igneous Rocks. The glossary of igneous terms has been fully updated since the first edition and now includes 1637 entries, of which 316 are recommended by the Subcommission. Incorporating a comprehensive bibliography of source references for all the terms included in the glossary, this book is an indispensable reference guide for all geologists studying igneous rocks, either in the field or the laboratory. It presents a standardised and widely accepted naming scheme that will allow geologists to interpret terminology in the primary literature and provide formal names for rock samples based on petrographic analyses. It is also supported by a website with downloadable code for chemical classifications.

  12. Glossary on peaceful nuclear explosions terms

    International Nuclear Information System (INIS)

    1980-01-01

    The report presents a glossary of terms in the area of peaceful nuclear explosions. The terms are in English, French, Russian and Spanish with cross-references for the corresponding terms of the other languages

  13. ALA glossary of library and information science

    CERN Document Server

    Levine-Clark, Michael

    2013-01-01

    This fourth edition of ALA Glossary of Library and Information Science presents a thorough yet concise guide to the specific words that describe the materials, processes and systems relevant to the field of librarianship.

  14. Glossary of natural resource; Glossar zum Ressourcenschutz

    Energy Technology Data Exchange (ETDEWEB)

    Kosmol, Jan; Kanthak, Judit; Herrmann, Friederike; Golde, Michael; Alsleben, Carsten; Penn-Bressel, Gertrude; Schmitz, Stefan; Gromke, Ulrich

    2012-01-15

    The contribution under consideration presents the most important terms in a logical context, and distinguishes clearly between these technical terms. Thus, this contribution raises the profile of the scientific, political and public debate. The glossary is being developed by an interdisciplinary working group of the Federal Environment Agency (Dessau-Rosslau, Federal Republic of Germany) since 2009. In 2010, the glossary was co-ordinated with parts of the German scientific community.

  15. State Energy Overview. [Contains glossary

    Energy Technology Data Exchange (ETDEWEB)

    1983-10-01

    An overview of selected energy-related data for the United States, for each state, and for the District of Columbia is presented. Included are the quantities of energy produced and consumed, estimates of fuel reserves, the value of nonrenewable fuels produced by type, energy expenditures, and consumer prices. Also provided for each state are selected demographic and energy-related information that have been ranked and expressed as a percent of the national total. This overview provides a ready reference and a quick access to selected state energy information and state rankings for various socioeconomic and energy items. The State Energy Overview is arranged in five sections. The first section presents United States totals and an overview of state rankings. The second depicts data for the 50 states and the District of Columbia. The glossary presents definitions germane to this publication and the fourth section describes methodology and includes remarks concerning the information and methods used to estimate 1982 consumption numbers. The fifth section presents sources of data and information for this publication. A summary of each section is included.

  16. 40 CFR 300.4 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Abbreviations. 300.4 Section 300.4... Introduction § 300.4 Abbreviations. (a) Department and Agency Title Abbreviations: ATSDR—Agency for Toxic... the abbreviation “NRC” only with respect to the National Response Center. (b) Operational...

  17. 49 CFR 172.308 - Authorized abbreviations.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Authorized abbreviations. 172.308 Section 172.308... SECURITY PLANS Marking § 172.308 Authorized abbreviations. (a) Abbreviations may not be used in a proper shipping name marking except as authorized in this section. (b) The abbreviation “ORM” may be used in place...

  18. 40 CFR 86.094-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.094-3 Section 86.094...-Fueled and Methanol-Fueled Heavy-Duty Vehicles § 86.094-3 Abbreviations. (a) The abbreviations in § 86.090-3 remain effective. The abbreviations in this section apply beginning with the 1994 model year. (b...

  19. 40 CFR 86.1703-99 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.1703-99 Section 86....1703-99 Abbreviations. (a) The abbreviations in subpart A of this part apply to this subpart. (b) In addition, the following abbreviations shall apply to this subpart: ASTR—All States Trading Region HEV...

  20. 40 CFR 86.090-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.090-3 Section 86.090...-Fueled and Methanol-Fueled Heavy-Duty Vehicles § 86.090-3 Abbreviations. (a) The abbreviations in § 86.078-3 remain effective. The abbreviations in this section apply beginning with the 1990 model year. (b...

  1. 40 CFR 88.103-94 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Abbreviations. 88.103-94 Section 88...) CLEAN-FUEL VEHICLES Emission Standards for Clean-Fuel Vehicles § 88.103-94 Abbreviations. The abbreviations of part 86 also apply to this subpart. The abbreviations in this section apply to all of part 88...

  2. 40 CFR 88.303-93 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Abbreviations. 88.303-93 Section 88...) CLEAN-FUEL VEHICLES Clean-Fuel Fleet Program § 88.303-93 Abbreviations. The abbreviations in subpart A of this part and in 40 CFR part 86 apply to this subpart. The abbreviations in this section apply to...

  3. 40 CFR 86.000-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.000-3 Section 86.000...-Fueled and Methanol-Fueled Heavy-Duty Vehicles § 86.000-3 Abbreviations. The abbreviations in § 86.098-3 continue to apply to 1998 and later model year vehicles. The abbreviations in this section apply beginning...

  4. 40 CFR 86.098-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.098-3 Section 86.098...-Fueled and Methanol-Fueled Heavy-Duty Vehicles § 86.098-3 Abbreviations. (a) The abbreviations in § 86.096-3 continue to apply. The abbreviations in this section apply beginning with the 1998 model year...

  5. 40 CFR 86.096-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.096-3 Section 86.096...-Fueled and Methanol-Fueled Heavy-Duty Vehicles § 86.096-3 Abbreviations. (a) The abbreviations in § 86.094-3 continue to apply. The abbreviation in this section applies beginning with the 1996 model year...

  6. National Child Abuse and Neglect Data System Glossary

    Science.gov (United States)

    ... Search « Back to Search National Child Abuse and Neglect Data System Glossary Published: March 31, 2000 Types: ... the glossary for the National Child Abuse and Neglect Data System (NCANDS), including terms from both the ...

  7. National Child Abuse and Neglect Data System Glossary

    Science.gov (United States)

    ... navigation Search form Search « Back to Search National Child Abuse and Neglect Data System Glossary Published: March 31, ... This document is the glossary for the National Child Abuse and Neglect Data System (NCANDS), including terms from ...

  8. Glossary of nuclear power plant ageing

    International Nuclear Information System (INIS)

    1999-01-01

    A glossary is presented of the terminology for understanding and managing the ageing of nuclear power plant systems, structures and components. This glossary has been published by NEA, in cooperation with CEC and IAEA, as a handy reference to facilitate and encourage use of common ageing terminology. The main benefits are improved reporting and interpretation of plant data on SSC degradation and failure, and improved interpretation and compliance with codes, regulations and standards related to nuclear plant ageing. The goal is to provide plant personnel with a common set of terms that have uniform, industry-wide meanings, and to facilitate discussion between experts from different countries. The glossary is in five languages: English, French, German, Spanish and Russian. In each language section terms are listed alphabetically, with sequential members which are repeated in the English section thus allowing cross-reference between al languages. (R.P.)

  9. JPRS Report, Reference Aid: Glossary of Acronyms and Abbreviations of Spain

    Science.gov (United States)

    1988-12-01

    Formaciön de Ciencias Ambientales International Environmental Science Education Center 12 CIFI Centro de Instrucciön de Formaciön de...Interministerial del Medio Ambiente 1. Aviation Research and Medicine Center 2. Interministerial Commission on the Environment CIMO [see CIDIMO] CIMSA...Electrical Finance Company FIPC Fondo Internacional para la Promociön de Cultura International Fund for the Promotion of Culture (of UNESCO) FJ

  10. 32 CFR Attachment 1 to Part 855 - Glossary of References, Abbreviations, Acronyms, and Terms

    Science.gov (United States)

    2010-07-01

    ... Secretary of the Air Force (Installations). SAF/PAC Secretary of the Air Force, Office of Public Affairs... for the accommodation (including any buildings, installations, and equipment), landing, and take-off... any national registry, including: Commercial Aviation. Civil aircraft that transport passengers or...

  11. Glossary of AWS Acrinabs. Acronyms, Initialisms, and Abbreviations Commonly Used in Air Weather Service

    Science.gov (United States)

    1991-01-01

    Generator ASM.......air-to- surface missile ARCO ..... automatic response to query ASM ......algebraic stress rmonitor ARRS .... Aerospace Res? ie and...Astrogeoptiyslcat Teletype Network. SRT.....air support radlar team ATNAGE.... Advanced TIROS -N Aerospace Giound Equipment ASSOTW ..Akrfield and...Management Board CONDIGS CON US Digital Graphics System CMBTCG... Combat Communications Group CONDORTM a relational databaseCMC~~COD ...... Canadiana

  12. JPRS Report, West Europe, Reference Aid, Glossary of Acronyms and Abbreviations of Italy

    Science.gov (United States)

    1989-01-27

    d’armata G.A. Giunta Amministrativa Gab. Gabinetto G.A.D. Gruppo d’Arte Drammatica G a F. guardia alia frontiera GAF guardia di finanza gall...comando) genio di divisione di fanteria G.d.F. Guardia di Finanza GDT heavy (caliber) coastal patrol boat corps engineer headquarters...velivoli aircraft efficiency group G.F. Gioventü Femminile Female Youth g.f. Guardia di Finanza Revenue Guards g. ferrovieri genio ferrovieri g.fot

  13. 32 CFR Appendix A to Part 989 - Glossary of References, Abbreviations, Acronyms, and Terms

    Science.gov (United States)

    2010-07-01

    ... of 1969 42 U.S.C. 7506(c), Clean Air Act Amendments of 1990 42 U.S.C. 13101(b), Pollution Prevention... Office of Public Affairs NOA Notice of Availability NOI Notice of Intent OSD Office of the Secretary of... through increased efficiency in the use of raw materials, energy, water, or other resources, or in the...

  14. A Glossary of Terms, Definitions, Acronyms, and Abbreviations Related to the National Airspace System (NAS)

    Science.gov (United States)

    1990-06-01

    Service WANS Weather and NOTAM System WAO Weapons Assignment Officer WAS WAShington, DC WATS Wide Area Telecommunications Service WATS Wide Area Telephone...Juliett K Kilo - - L Lima M Mike -- N November O Oscar --- P Papa Q Quebec --.- R Romeo S Sierra ... T Tango - U Uniform V Victor W Whiskey .-- X X-ray

  15. BEGINNING INDONESIAN. VOLUME 4 AND GLOSSARY.

    Science.gov (United States)

    DYEN, ISIDORE

    VOLUME 4 OF A 4-VOLUME WORK ON BEGINNING INDONESIAN CONTAINS LESSONS 19-24 OF A TOTAL OF 24. INCLUDED IN THIS FINAL VOLUME IS A GLOSSARY OF TERMS AND LESSONS WHICH PROVIDE DRILLS IN BASIC INDONESIAN SENTENCE PATTERNS INVOLVING THE USE OF FORMAL AND INFORMAL WORDS, ADJECTIVES, CLOSELY ASSOCIATED SECOND VERBS, COMPARATIVES, PREFIXES, AND SUFFIXES.…

  16. A Glossary of Grammar and Linguistics.

    Science.gov (United States)

    MacLeish, Andrew

    A guide to linguistic analysis and to the three co-existing grammars--conventional, structural, and transformational--this glossary, which is directed to the beginning student, provides descriptions of terms and topics as they are used in their most frequent and familiar senses. Encyclopedic descriptions and information about the referent are…

  17. BCS Glossary of Computing and ICT

    CERN Document Server

    Panel, BCS Education and Training Expert; Burkhardt, Diana; Cumming, Aline; Hunter, Alan; Hurvid, Frank; Jaworski, John; Ng, Thomas; Scheer, Marianne; Southall, John; Vella, Alfred

    2008-01-01

    A glossary of computing designed to support those taking computer courses or courses where computers are used, including GCSE, A-Level, ECDL and 14-19 Diplomas in Functional Skills, in schools and Further Education colleges. It helps the reader build up knowledge and understanding of computing.

  18. The health terminology project glossaries` structure

    Directory of Open Access Journals (Sweden)

    Sátia Marini

    2014-04-01

    Full Text Available Current paper was motivated by a Master´s degree in Translation Studies on one of the glossaries of the Health Terminology Project (PTS of the Ministry of Health (MS inBrazil, by which the products developed by the project were analyzed. The authors would like to forward their experience earned from the development of these instruments and from the evolution of the glossary´s layout and structure. Although within the same institution, each instrument is made suitable to the specific purpose of each area and the terminology project accumulates experience by the constant improvement of previously developed glossaries (adding new terms; providing the equivalent word in other languages for terms already defined and by the establishment of new ones. The evolution of the structure of the glossaries was qualitatively analyzed; remarks on the types of cross references were made; a quantitative survey of their main features was undertaken. Finally, the importance of this type of work should be underscored either within the government, or in the academy or in private companies, for the sharing of intellectual knowledge.

  19. [Abbreviations in daily language: stop it].

    Science.gov (United States)

    Girbes, A C; Girbes, A R J

    2017-01-01

    Abbreviations are used more and more in physician common parlance and it seems they are on the way to becoming a new jargon. However, identical abbreviations may have different meanings, especially in different medical specialties. Moreover, many physicians do not know the meaning of specific abbreviations or are attributing the wrong meaning to the abbreviation. This will lead to misunderstanding and therefore danger to the patient. The authors are calling for a stop on the use of spoken abbreviations and for minimising the use of abbreviations in clinical notes and medical prescriptions.

  20. Global change: Acronyms and abbreviations

    Energy Technology Data Exchange (ETDEWEB)

    Woodard, C.T. [Oak Ridge National Lab., TN (United States); Stoss, F.W. [Univ. of Tennessee, Knoxville, TN (United States). Energy, Environment and Resources Center

    1995-05-01

    This list of acronyms and abbreviations is compiled to provide the user with a ready reference to dicipher the linguistic initialisms and abridgements for the study of global change. The terms included in this first edition were selected from a wide variety of sources: technical reports, policy documents, global change program announcements, newsletters, and other periodicals. The disciplinary interests covered by this document include agriculture, atmospheric science, ecology, environmental science, oceanography, policy science, and other fields. In addition to its availability in hard copy, the list of acronyms and abbreviations is available in DOS-formatted diskettes and through CDIAC`s anonymous File Transfer Protocol (FTP) area on the Internet.

  1. MEDLARS Abbreviations for Medical Journal Titles

    Science.gov (United States)

    Charen, Thelma; Gillespie, Constantine J.

    1971-01-01

    The National Library of Medicine announces its adoption of the Anglo-American standard for the formulation of journal title abbreviations according to the American National Standard for the Abbreviation of Titles of Periodicals (1969), with individual words abbreviated, in turn, according to the International List of Periodical Title Word Abbreviations (1970). The history of the activity of the specific Z39 Committee of USASI (now ANSI) concerned with journal title abbreviations is reviewed, covering the period from 1962 to the present. A history of the National Clearinghouse for Periodical Title Word Abbreviations and of the International List is also given. Former NLM usage is compared with the forms of the present International List and examples show the major changes in NLM abbreviations. The NLM Rules for Abbreviation of Periodical Titles as derived from the new standard are appended. PMID:5146764

  2. 40 CFR 129.3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Abbreviations. 129.3 Section 129.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS TOXIC POLLUTANT EFFLUENT STANDARDS Toxic Pollutant Effluent Standards and Prohibitions § 129.3 Abbreviations. The abbreviations used...

  3. 40 CFR 86.503-78 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.503-78 Section 86.503-78 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Later New Motorcycles; Test Procedures § 86.503-78 Abbreviations. (a) The abbreviations in § 86.403-78...

  4. 7 CFR 1945.5 - Abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 13 2010-01-01 2009-01-01 true Abbreviations. 1945.5 Section 1945.5 Agriculture... REGULATIONS (CONTINUED) EMERGENCY Disaster Assistance-General § 1945.5 Abbreviations. The following abbreviations are used in this subpart. (a) ASCS—Agricultural Stabilization and Conservation Service. (b) DAR...

  5. 40 CFR 600.003-77 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Abbreviations. 600.003-77 Section 600.003-77 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL... Model Year Automobiles-General Provisions § 600.003-77 Abbreviations. (a) The abbreviations used in this...

  6. 40 CFR 600.503-78 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Abbreviations. 600.503-78 Section 600... Automobiles)-Procedures for Determining Manufacturer's Average Fuel Economy § 600.503-78 Abbreviations. The abbreviations in § 600.003 apply to this subpart. ...

  7. 40 CFR 94.3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Abbreviations. 94.3 Section 94.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Compression-Ignition Marine Engines § 94.3 Abbreviations. The abbreviations of this section apply to all...

  8. 40 CFR 600.203-77 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Abbreviations. 600.203-77 Section 600... Model Year Automobiles-Procedures for Calculating Fuel Economy Values § 600.203-77 Abbreviations. The abbreviations in § 600.003 apply to this subpart. ...

  9. 40 CFR 86.1503 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.1503 Section 86.1503 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Abbreviations. The abbreviations in § 86.084-3 or in § 86.1804-01, as applicable, apply to this subpart. [64 FR...

  10. 40 CFR 92.3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Abbreviations. 92.3 Section 92.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF AIR... Locomotives and Locomotive Engines § 92.3 Abbreviations. The abbreviations of this section apply to all...

  11. 16 CFR 500.22 - Abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Abbreviations. 500.22 Section 500.22 Commercial Practices FEDERAL TRADE COMMISSION RULES, REGULATIONS, STATEMENT OF GENERAL POLICY OR... PACKAGING AND LABELING ACT § 500.22 Abbreviations. The following abbreviations and none other may be...

  12. 40 CFR 86.884-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.884-3 Section 86.884... New Diesel Heavy-Duty Engines; Smoke Exhaust Test Procedure § 86.884-3 Abbreviations. The abbreviations in § 86.078-3 apply to this subpart. ...

  13. 40 CFR 86.703-94 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.703-94 Section 86.703-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... § 86.703-94 Abbreviations. The abbreviations in subparts A and B of this part apply to this subpart. ...

  14. 40 CFR 86.103 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.103 Section 86.103 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF...; Test Procedures § 86.103 Abbreviations. The abbreviations in subpart A apply to this subpart. [45 FR...

  15. 40 CFR 86.078-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.078-3 Section 86.078-3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED...-Fueled and Methanol-Fueled Heavy-Duty Vehicles § 86.078-3 Abbreviations. The abbreviations in this...

  16. 14 CFR 34.2 - Abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Abbreviations. 34.2 Section 34.2... EXHAUST EMISSION REQUIREMENTS FOR TURBINE ENGINE POWERED AIRPLANES General Provisions § 34.2 Abbreviations. The abbreviations used in this part have the following meanings in both upper and lower case: COCarbon...

  17. 48 CFR 3002.270 - Abbreviations.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Abbreviations. 3002.270 Section 3002.270 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND SECURITY ACQUISITION REGULATION (HSAR) GENERAL DEFINITIONS OF WORDS AND TERMS Abbreviations 3002.270 Abbreviations...

  18. 40 CFR 86.1303-84 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.1303-84 Section 86.1303-84 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED....1303-84 Abbreviations. The abbreviations in § 86.084-3 apply to this subpart. ...

  19. 40 CFR 600.103-78 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Abbreviations. 600.103-78 Section 600.103-78 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL... Model Year Automobiles-Test Procedures § 600.103-78 Abbreviations. The abbreviations in § 600.003 apply...

  20. 40 CFR 600.403-77 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Abbreviations. 600.403-77 Section 600... Model Year Automobiles-Dealer Availability of Fuel Economy Information § 600.403-77 Abbreviations. The abbreviations in § 600.003 apply to this subpart. ...

  1. 40 CFR 52.18 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Abbreviations. 52.18 Section 52.18 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS General Provisions § 52.18 Abbreviations. Abbreviations used in this part...

  2. 40 CFR 88.203-94 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Abbreviations. 88.203-94 Section 88.203-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CLEAN-FUEL VEHICLES California Pilot Test Program § 88.203-94 Abbreviations. The abbreviations in...

  3. 40 CFR 86.1203-85 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.1203-85 Section 86.1203-85 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Methanol-Fueled Heavy-Duty Vehicles § 86.1203-85 Abbreviations. The abbreviations in § 86.079-3 apply to...

  4. 40 CFR 86.403-78 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.403-78 Section 86.403-78 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Later New Motorcycles, General Provisions § 86.403-78 Abbreviations. The abbreviations used in this...

  5. 40 CFR 600.303-77 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Abbreviations. 600.303-77 Section 600.303-77 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL... Model Year Automobiles-Labeling § 600.303-77 Abbreviations. The abbreviations in § 600.003 apply to this...

  6. 40 CFR 86.303-79 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.303-79 Section 86.303-79 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Abbreviations. The abbreviations in § 86.078-3 apply to this subpart. ...

  7. 40 CFR 86.1403 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.1403 Section 86.1403 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Short Test Procedures § 86.1403 Abbreviations. The abbreviations in § 86.096-3 apply to this subpart. ...

  8. Annual resources report. [Glossary on technical terms

    Energy Technology Data Exchange (ETDEWEB)

    1982-01-01

    The report is separated into the following sections: acknowledgments; a table of contents; a list of tables and figures; a glossary; an introduction; an overview of the role of energy resources in New Mexico; separate sections on oil and gas, coal, electrical generation, uranium, and geothermal energy; a section on the geologic setting of oil and gas, coal, and uranium; an appendix of additional tables pertaining to oil and gas development; and a listing of selected references. The glossary is a brief listing of technical terms used in the report with simplified definitions for the reader's use. The overview contains highlights of data found in the report as well as comparisons of New Mexico's resources with those of other states and the nation. In general, each section covering a resource area describes reserves, production, prices, consumption, transportation, employment, and revenue statistics over the past ten or more years and projections to the year 2000.

  9. A glossary of terms for fast reactors

    International Nuclear Information System (INIS)

    Wheeler, R.C.

    1979-04-01

    The glossary aims to provide definitions of technical terms likely to be used in a fast reactor enquiry and to encourage the use of the same set of consistent terms in any documents intended for such an inquiry. In some cases definitions are formulated in the limited context of LMFBRS rather than applying to all types of reactors. A brief guide is presented to the different reactor types. (author)

  10. New Abbreviations in Colloquial French

    Directory of Open Access Journals (Sweden)

    Vladimir Pogačnik

    2015-12-01

    Full Text Available The author of the article treats the process of abbreviations, which he explored forty years ago in his master thesis. The article is based on the corpus created on the basis of Télématin broadcast on French television network TV5. According to the author, clipping is a widespread process that occurs primarily in various forms of oral communication.

  11. Knowledge of text message abbreviations as a predictor of spelling ability.

    Science.gov (United States)

    Kreiner, David S; Davis, Danielle L

    2011-02-01

    The relationships of self-reported text messaging frequency and knowledge of text message abbreviations with spelling ability were investigated. Two studies were conducted in which the college student participants provided self-reports of text messaging frequency, responded to a test of knowledge of text message abbreviations, and completed a standardized spelling test. In both studies, self-reported text messaging frequency was not predictive of scores on the spelling test. Knowledge of text message abbreviations was positively correlated with spelling scores. In the second study, spelling ability was positively correlated with processing time to identify abbreviations as real. The results were not consistent with the idea that better knowledge of text messaging is predictive of lower spelling ability. Instead, individuals with better knowledge of abbreviations tended to be better spellers.

  12. Electric Power Monthly, August 1990. [Glossary included

    Energy Technology Data Exchange (ETDEWEB)

    1990-11-29

    The Electric Power Monthly (EPM) presents monthly summaries of electric utility statistics at the national, Census division, and State level. The purpose of this publication is to provide energy decisionmakers with accurate and timely information that may be used in forming various perspectives on electric issues that lie ahead. Data includes generation by energy source (coal, oil, gas, hydroelectric, and nuclear); generation by region; consumption of fossil fuels for power generation; sales of electric power, cost data; and unusual occurrences. A glossary is included.

  13. List of abbreviation of nuclear energy term

    International Nuclear Information System (INIS)

    1986-06-01

    This book deals with abbreviation of nuclear energy terms, which are in alphabetical order. List of abbreviation of nuclear energy term can be used in various field like the medical world, power plant and research center of researchers and students. This book contains a lot of abbreviation of nuclear energy term like LWR, PWR, SG, MGE, MNE, MNF, AINS, AMS, ATWS, CARE, EOF, MCR, RIMS, SMS and TRF.

  14. Abbreviations

    OpenAIRE

    2013-01-01

    "AB" The official French logo for certified organic produce ("Agriculture Biologique") CF Conventional farming EF Ecological farming IFS Integrated farming systems LIF Low-input farming OF Organic farming OFgc Organic farming under group certification AFSAA Agence Française de Sécurité Sanitaire des Aliments (French food safety agency) AMAP Association pour le Maintien d'une Agriculture Paysanne (Association for the maintenance of small-scale farming – there is a network of such associations ...

  15. Abbreviations used in scientific and technical reports

    International Nuclear Information System (INIS)

    Sun Chang.

    1986-04-01

    Reports contain a large number of abbreviations which have not yet been included in the current specialized dictionaries or lists of abbreviations. It is therefore often time-consuming or even fruitless to search for such abbreviations. The present alphabetical list of more than 4,000 abbreviations gathered from the report inventory of the Central Library of the KFA Juelich in the period from 1982-1986, taking into consideration all the scientific and technical disciplines, is intended to remedy a deficiency and to offer assistance which will undoubtedly be welcomed by scientists and engineers. (orig./HP) [de

  16. Acronyms, initialisms, and abbreviations: Fourth Revision

    Energy Technology Data Exchange (ETDEWEB)

    Tolman, B.J. [comp.

    1994-04-01

    This document lists acronyms used in technical writing. The immense list is supplemented by an appendix containing chemical elements, classified information access, common abbreviations used for functions, conversion factors for selected SI units, a flowcharting template, greek alphabet, metrix terminology, proofreader`s marks, signs and symbols, and state abbreviations.

  17. 40 CFR 117.2 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Abbreviations. 117.2 Section 117.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS DETERMINATION OF REPORTABLE QUANTITIES FOR HAZARDOUS SUBSTANCES General Provisions § 117.2 Abbreviations. NPDES equals...

  18. 40 CFR 116.2 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Abbreviations. 116.2 Section 116.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS DESIGNATION OF HAZARDOUS SUBSTANCES § 116.2 Abbreviations. ppm=parts per million mg=milligram(s) kg=kilogram(s) mg/l=milligrams(s) per...

  19. 15 CFR 995.5 - Abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Abbreviations. 995.5 Section 995.5 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) NATIONAL OCEANIC... HYDROGRAPHIC PRODUCTS General § 995.5 Abbreviations. CEDCertified NOAA ENC Distributor CEVADCertified NOAA ENC...

  20. 32 CFR 552.162 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 3 2010-07-01 2010-07-01 true Abbreviations. 552.162 Section 552.162 National Defense Department of Defense (Continued) DEPARTMENT OF THE ARMY MILITARY RESERVATIONS AND NATIONAL..., and Camp Bonneville § 552.162 Abbreviations. See appendix F to this subpart. ...

  1. 48 CFR 1302.170 - Abbreviations

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Abbreviations 1302.170 Section 1302.170 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE GENERAL DEFINTIONS OF WORDS AND TERMS Definitions 1302.170 Abbreviations AIRAdditional Item Requirements BPOSenior Bureau...

  2. Glossary of scientific and technical terms in atomic energy

    International Nuclear Information System (INIS)

    1986-01-01

    In order to facilitate the task of Arabic speaking scientists in the field of nuclear energy, the Atomic Energy Commission of Syria assigned a committee constituted of leading physicists and chemists at Damascus University, the aim of the commission was to include the Arabic equivalent of the terms cited in English, French, Russian and Spanish in the glossary published by the United Nations, 1958 ''Atomic Energy Glossary of Technical Terms.'' The result of the committee's work was this glossary containing approximately 6000 terms in the field of nuclear energy which are given in Arabic, English, French, Russian and Spanish

  3. Learning Vocabulary through Paper and Online-Based Glossary

    Directory of Open Access Journals (Sweden)

    Ratih Novita Sari

    2017-08-01

    Full Text Available This study examined the effect of teaching glossary and personality traits on vocabulary learning. Two groups of students who had different personality (extroverted and introverted were exposed to two types of glosses: paper and online-based glossary. The two groups underwent two-month treatment. Prior to and after the treatment, each group was given pre and posttest. In calculating the data, two-way ANOVA was used. The results of the study showed that extroverted students learned vocabulary better through paper-based glossary, while introverted students learned vocabulary better through online-based. Further research needs to be conducted to determine whether age influences the use of teaching glossary or not

  4. 7 CFR 1951.852 - Definitions and abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 14 2010-01-01 2009-01-01 true Definitions and abbreviations. 1951.852 Section 1951....852 Definitions and abbreviations. (a) General definitions. The following definitions are applicable... business. (b) Abbreviations. The following abbreviations are applicable: B&I—Business and Industry CSA...

  5. 38 CFR 21.8010 - Definitions and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... abbreviations. 21.8010 Section 21.8010 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... abbreviations. (a) Program-specific definitions and abbreviations. For the purposes of this subpart: Covered.... (Authority: 38 U.S.C. 101, 1802, 1804, 1811-1812, 1814, 1821) (b) Other terms and abbreviations. The...

  6. 7 CFR 771.2 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 771.2 Section 771.2... AGRICULTURE SPECIAL PROGRAMS BOLL WEEVIL ERADICATION LOAN PROGRAM § 771.2 Abbreviations and definitions. The following abbreviations and definitions apply to this part: (a) Abbreviations: APHIS means the Animal and...

  7. Abbreviations in Swedish Clinical Text--use by three professions.

    Science.gov (United States)

    Lövestam, Elin; Velupillai, Sumithra; Kvist, Maria

    2014-01-01

    A list of 266 abbreviations from dieticians' notes in patient records was used to extract the same abbreviations from patient records written by three professions: dieticians, nurses and physicians. A context analysis of 40 of the abbreviations showed that ambiguous meanings were common. Abbreviations used by dieticians were found to be used by other professions, but not always with the same meaning. This ambiguity of abbreviations might cause misunderstandings and put patient safety at risk.

  8. Glossary developed for the participants in the BIOMOVS 2 study

    International Nuclear Information System (INIS)

    1993-08-01

    Terminology used in documents published within the BIOMOVS II study is defined in individual Technical and Progress reports and is the responsibility of the corresponding authors. However, as in other areas of scientific endeavour, there can be a tendency for terms to be used differently. This follows from the range of scientific disciplines involved. Therefore, this glossary of terms is offered to BIOMOVS II participants with a view to obtaining consistent usage and avoiding possible confusion. The definitions given have been provided and reviewed by BIOMOVS II participants. A list of other potentially relevant glossaries is also provided. It is acknowledged that some modifications to the definitions may be desirable when used for a specific task or document. Also additional terms may need to be added as time goes by. This document is itself an update of the glossary which was produced for use in BIOMOVS I . Thus, it is considered as a working document

  9. Reference Aid: Glossary of Acronyms, Abbreviations, and Special Terms Used in the Western Europe Romance-Language Press.

    Science.gov (United States)

    1977-11-25

    Internazionale Alliance (Ita) AAJEPT Associacao de Jornalistas e Escritores Portugueses do Turismo ABC Arme Blindee et Cavalerie Association...Orientacion de Orientation of SE Secretaria de Estado SEAT Sociedad Espanola de Automoviles de Turismo , S.A. SEC Systeme Europeen de

  10. Glossary of CERCLA-related terms and acronyms

    International Nuclear Information System (INIS)

    1991-10-01

    This glossary contains CERCLA-related terms that are most often encountered in the US Department of Energy (DOE) Environmental Restoration and Emergency Preparedness activities. Detailed definitions are included for key terms. The definitions included in this glossary are taken from the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA), as amended, related federal rulemakings (e.g., 40 CFR 300, National Oil and Hazardous Substances Pollution Contingency Plan), assorted guidance documents prepared by the US Environmental Protection Agency (EPA), and DOE Order 5400.4. The source of each term is noted after the term. Terms presented in this document reflect revised and new definitions published before June 1, 1991. 20 refs

  11. The use and abuse of abbreviations in orthopaedic literature.

    Science.gov (United States)

    Kilshaw, Michael J; Rooker, Jemma; Harding, Ian J

    2010-04-01

    Abbreviations are commonly used in medical literature. Their use has been associated with medical errors and they can be a source of irritation and misunderstanding. There are strict guidelines for their use. This study analysed the use of abbreviations in orthopaedic literature and compared adherence with guidelines in a general orthopaedic and spinal journal. It also examined orthopaedic professionals' understanding of abbreviations. The use of abbreviations in articles over a 3-month period in a general orthopaedic and spinal journal was analysed. The number of abbreviations and adherence with guidelines was recorded. A group of orthopaedic healthcare professionals were tested for their understanding of abbreviations. Almost half of all abbreviations were not properly used and 30% of abbreviations were never defined. Abbreviations were used significantly more often in the spinal journal. Only 40% of abbreviations were correctly defined by the orthopaedic professionals tested. Guidelines regarding the use of abbreviations are not being adhered to by authors or editors. The poor understanding of abbreviations underlines the importance of minimising their use and defining abbreviations when they are used.

  12. MBA: a literature mining system for extracting biomedical abbreviations.

    Science.gov (United States)

    Xu, Yun; Wang, ZhiHao; Lei, YiMing; Zhao, YuZhong; Xue, Yu

    2009-01-09

    The exploding growth of the biomedical literature presents many challenges for biological researchers. One such challenge is from the use of a great deal of abbreviations. Extracting abbreviations and their definitions accurately is very helpful to biologists and also facilitates biomedical text analysis. Existing approaches fall into four broad categories: rule based, machine learning based, text alignment based and statistically based. State of the art methods either focus exclusively on acronym-type abbreviations, or could not recognize rare abbreviations. We propose a systematic method to extract abbreviations effectively. At first a scoring method is used to classify the abbreviations into acronym-type and non-acronym-type abbreviations, and then their corresponding definitions are identified by two different methods: text alignment algorithm for the former, statistical method for the latter. A literature mining system MBA was constructed to extract both acronym-type and non-acronym-type abbreviations. An abbreviation-tagged literature corpus, called Medstract gold standard corpus, was used to evaluate the system. MBA achieved a recall of 88% at the precision of 91% on the Medstract gold-standard EVALUATION Corpus. We present a new literature mining system MBA for extracting biomedical abbreviations. Our evaluation demonstrates that the MBA system performs better than the others. It can identify the definition of not only acronym-type abbreviations including a little irregular acronym-type abbreviations (e.g., ), but also non-acronym-type abbreviations (e.g., ).

  13. Capturing Cultural Glossaries: Case-study I * | Madib | Lexikos

    African Journals Online (AJOL)

    The article seeks to explore ways of capturing cultural glossaries to feed into the national dictionary corpora by using a case-study approach to investigate the ... performance indicator, assessment criteria, range statement, traditional dishes, language val-orisation, simultaneous feedback, communicative approach, structural ...

  14. Solar Energy Education. Reader, Part II. Sun story. [Includes glossary

    Energy Technology Data Exchange (ETDEWEB)

    1981-05-01

    Magazine articles which focus on the subject of solar energy are presented. The booklet prepared is the second of a four part series of the Solar Energy Reader. Excerpts from the magazines include the history of solar energy, mythology and tales, and selected poetry on the sun. A glossary of energy related terms is included. (BCS)

  15. Glossary of terms used in ecotoxicology (IUPAC Recommendations 2009)

    DEFF Research Database (Denmark)

    Nordberg, Monika; Templeton, Douglas M.; Andersen, Ole

    2009-01-01

    The objective of the "Glossary of terms used in ecotoxicology" is to give clear definitions for those who contribute to studies relevant to ecotoxicology but are not themselves ecotoxicologists. This objective applies especially to chemists who need to understand the ecotoxicological literature w...

  16. The Compilation of Multilingual Concept Literacy Glossaries at the ...

    African Journals Online (AJOL)

    This article proposes a lexicographical approach to the compilation of multilingual concept literacy glossaries which may play a very important role in supporting students at institutions of higher education. In order to support concept literacy, especially for students for whom English is not the native language, a number of ...

  17. Glossary of CERCLA, RCRA and TSCA related terms and acronyms

    International Nuclear Information System (INIS)

    1993-10-01

    This glossary contains CERCLA, RCRA and TSCA related terms that are most often encountered in the US Department of Energy (DOE) Environmental Restoration and Emergency Preparedness activities. Detailed definitions are included for key terms. The CERCLA definitions included in this glossary are taken from the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA), as amended and related federal rulemakings. The RCRA definitions included in this glossary are taken from the Resource Conservation and Recovery Act (RCRA) and related federal rulemakings. The TSCA definitions included in this glossary are taken from the Toxic Substances and Control Act (TSCA) and related federal rulemakings. Definitions related to TSCA are limited to those sections in the statute and regulations concerning PCBs and asbestos.Other sources for definitions include additional federal rulemakings, assorted guidance documents prepared by the US Environmental Protection Agency (EPA), guidance and informational documents prepared by the US Department of Energy (DOE), and DOE Orders. The source of each term is noted beside the term. Terms presented in this document reflect revised and new definitions published before July 1, 1993

  18. Environmental Glossary with Metric Conversion Tables. Revised Edition.

    Science.gov (United States)

    Deason, Wayne O.

    This glossary of over 800 environmental terms was prepared specifically for Bureau of Reclamation personnel who write and review environmental assessments and environmental impact statements. The document is designed to ensure that the terminology of various disciplines is understood by all specialists and is used in a consistent manner. Included…

  19. The Compilation of Multilingual Concept Literacy Glossaries at the ...

    African Journals Online (AJOL)

    specialised knowledge is concerned, some of the glossaries fall short when it comes to the linguistic and communicative needs of the target users. 2.1.1 Glossography. According to the definitions from the Free Online Dictionary, Thesaurus and En- cyclopedia (accessed on 6 November 2009), glossography may be defined ...

  20. Computer surety: computer system inspection guidance. [Contains glossary

    Energy Technology Data Exchange (ETDEWEB)

    1981-07-01

    This document discusses computer surety in NRC-licensed nuclear facilities from the perspective of physical protection inspectors. It gives background information and a glossary of computer terms, along with threats and computer vulnerabilities, methods used to harden computer elements, and computer audit controls.

  1. 47 CFR 32.9000 - Glossary of terms.

    Science.gov (United States)

    2010-10-01

    ... information, signals or messages over a distance. Included in the telecommunications industry is the... 47 Telecommunication 2 2010-10-01 2010-10-01 false Glossary of terms. 32.9000 Section 32.9000 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES UNIFORM SYSTEM OF ACCOUNTS...

  2. Abbreviations of nuclear power plant engineering

    International Nuclear Information System (INIS)

    Freyberger, G.H.

    1979-01-01

    The edition of this English and German list of abbreviations comprises about 5200 entries in English and about 1400 entries in German as well as the most important American, English, German and other foreign Utilities and component manufacturers frequently quoted in nuclear engineering literature and documentation. (orig./HP) [de

  3. 40 CFR 86.203-94 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.203-94 Section 86.203-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Later Model Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium-Duty...

  4. Creating an online dictionary of abbreviations from MEDLINE.

    Science.gov (United States)

    Chang, Jeffrey T; Schütze, Hinrich; Altman, Russ B

    2002-01-01

    The growth of the biomedical literature presents special challenges for both human readers and automatic algorithms. One such challenge derives from the common and uncontrolled use of abbreviations in the literature. Each additional abbreviation increases the effective size of the vocabulary for a field. Therefore, to create an automatically generated and maintained lexicon of abbreviations, we have developed an algorithm to match abbreviations in text with their expansions. Our method uses a statistical learning algorithm, logistic regression, to score abbreviation expansions based on their resemblance to a training set of human-annotated abbreviations. We applied it to Medstract, a corpus of MEDLINE abstracts in which abbreviations and their expansions have been manually annotated. We then ran the algorithm on all abstracts in MEDLINE, creating a dictionary of biomedical abbreviations. To test the coverage of the database, we used an independently created list of abbreviations from the China Medical Tribune. We measured the recall and precision of the algorithm in identifying abbreviations from the Medstract corpus. We also measured the recall when searching for abbreviations from the China Medical Tribune against the database. On the Medstract corpus, our algorithm achieves up to 83% recall at 80% precision. Applying the algorithm to all of MEDLINE yielded a database of 781,632 high-scoring abbreviations. Of all the abbreviations in the list from the China Medical Tribune, 88% were in the database. We have developed an algorithm to identify abbreviations from text. We are making this available as a public abbreviation server at \\url[http://abbreviation.stanford.edu/].

  5. 40 CFR 89.303 - Symbols/abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Symbols/abbreviations. 89.303 Section... Provisions § 89.303 Symbols/abbreviations. (a) The abbreviations in § 86.094-3 or part 89.3 of this chapter apply to this subpart. (b) The abbreviations in table 1 in appendix A of this subpart apply to this...

  6. 40 CFR 89.403 - Symbols/abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Symbols/abbreviations. 89.403 Section... Procedures § 89.403 Symbols/abbreviations. (a) The abbreviations in § 86.094-3 or § 89.3 of this chapter apply to this subpart. (b) The abbreviations in Table 1 in appendix A to subpart D also apply to this...

  7. Abbreviations of polymer names and guidelines for abbreviating polymer names (IUPAC Recommendations 2014)

    Czech Academy of Sciences Publication Activity Database

    He, J.; Chen, J.; Hellwich, K. H.; Hess, M.; Horie, K.; Jones, R. G.; Kahovec, Jaroslav; Kitayama, T.; Kratochvíl, Pavel; Meille, S. V.; Mita, I.; dos Santos, C.; Vert, M.; Vohlídal, J.

    2014-01-01

    Roč. 86, č. 6 (2014), s. 1003-1015 ISSN 0033-4545 Institutional support: RVO:61389013 Keywords : abbreviations * IUPAC Polymer Division * polymer names Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.492, year: 2014

  8. 40 CFR 91.303 - Acronyms and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Acronyms and abbreviations. 91.303 Section 91.303 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS....303 Acronyms and abbreviations. (a) The acronyms and abbreviations in § 91.5 apply to this subpart. (b...

  9. 40 CFR 97.203 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... Trading Program General Provisions § 97.203 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this subpart and subparts BBB through III are defined as follows: Btu...

  10. 40 CFR 60.3 - Units and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 6 2010-07-01 2010-07-01 false Units and abbreviations. 60.3 Section...) STANDARDS OF PERFORMANCE FOR NEW STATIONARY SOURCES General Provisions § 60.3 Units and abbreviations. Used in this part are abbreviations and symbols of units of measure. These are defined as follows: (a...

  11. 40 CFR 91.4 - Acronyms and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Acronyms and abbreviations. 91.4...) CONTROL OF EMISSIONS FROM MARINE SPARK-IGNITION ENGINES General § 91.4 Acronyms and abbreviations. The following acronyms and abbreviations apply to this part 91. AECD—Auxiliary emission control device ASME...

  12. 40 CFR 90.403 - Symbols, acronyms, and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Symbols, acronyms, and abbreviations... Gaseous Exhaust Test Procedures § 90.403 Symbols, acronyms, and abbreviations. (a) The acronyms and abbreviations in § 90.5 apply to this subpart. (b) The symbols in Table 1 in Appendix A to Subpart D apply to...

  13. 7 CFR 766.2 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 766.2 Section 766.2... AGRICULTURE SPECIAL PROGRAMS DIRECT LOAN SERVICING-SPECIAL Overview § 766.2 Abbreviations and definitions. Abbreviations and definitions for terms used in this part are provided in § 761.2 of this chapter. ...

  14. 7 CFR 4274.302 - Definitions and abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Definitions and abbreviations. 4274.302 Section 4274... Relending Program (IRP) § 4274.302 Definitions and abbreviations. (a) General definitions. The following..., the Federated States of Micronesia, and the Republic of the Marshall Islands. (b) Abbreviations. The...

  15. 40 CFR 61.03 - Units and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Units and abbreviations. 61.03 Section...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS General Provisions § 61.03 Units and abbreviations. Used in this part are abbreviations and symbols of units of measure. These are defined as follows: (a...

  16. 40 CFR 72.3 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 16 2010-07-01 2010-07-01 false Measurements, abbreviations, and acronyms. 72.3 Section 72.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR..., abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this part are defined as follows...

  17. 7 CFR 762.102 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 762.102 Section 762.102 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE AGENCY, DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS GUARANTEED FARM LOANS § 762.102 Abbreviations and definitions. Abbreviations and...

  18. 7 CFR 770.2 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 770.2 Section 770.2... AGRICULTURE SPECIAL PROGRAMS INDIAN TRIBAL LAND ACQUISITION LOANS § 770.2 Abbreviations and definitions. (a) Abbreviations. FSA Farm Service Agency, an Agency of the United States Department of Agriculture, including its...

  19. 7 CFR 765.2 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 765.2 Section 765.2... AGRICULTURE SPECIAL PROGRAMS DIRECT LOAN SERVICING-REGULAR Overview § 765.2 Abbreviations and definitions. Abbreviations and definitions for terms used in this part are provided in § 761.2 of this chapter. ...

  20. 40 CFR 63.3 - Units and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 9 2010-07-01 2010-07-01 false Units and abbreviations. 63.3 Section 63.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Units and abbreviations. Used in this part are abbreviations and symbols of units of measure. These are...

  1. 40 CFR 89.3 - Acronyms and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Acronyms and abbreviations. 89.3 Section 89.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... abbreviations. The following acronyms and abbreviations apply to part 89. AECD Auxiliary emission control device...

  2. 40 CFR 96.303 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and acronyms. 96.303 Section 96.303 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR..., abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this subpart and subparts BBBB...

  3. 32 CFR 245.6 - Abbreviations and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Abbreviations and acronyms. 245.6 Section 245.6 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED... Abbreviations § 245.6 Abbreviations and acronyms. AADC—Area Air Defense Commander ADE—Air Defense Emergency ADIZ...

  4. 7 CFR 767.2 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 767.2 Section 767.2... AGRICULTURE SPECIAL PROGRAMS INVENTORY PROPERTY MANAGEMENT Overview § 767.2 Abbreviations and definitions. Abbreviations and definitions for terms used in this part are provided in § 761.2 of this chapter. ...

  5. 40 CFR 60.4103 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 6 2010-07-01 2010-07-01 false Measurements, abbreviations, and acronyms. 60.4103 Section 60.4103 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR....4103 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this...

  6. 24 CFR 50.2 - Terms and abbreviations.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Terms and abbreviations. 50.2... Terms and abbreviations. (a) The definitions for most of the key terms or phrases contained in this part... for HUD assistance or insurance. (b) The following abbreviations are used throughout this part: AS/CPD...

  7. 40 CFR 90.5 - Acronyms and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Acronyms and abbreviations. 90.5 Section 90.5 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... and abbreviations. The following acronyms and abbreviations apply to part 90. AECD—Auxiliary emission...

  8. 40 CFR 97.3 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... Trading Program General Provisions § 97.3 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this part are defined as follows: Btu-British thermal unit. CO2-carbon...

  9. 40 CFR 96.3 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... IMPLEMENTATION PLANS NOX Budget Trading Program General Provisions § 96.3 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this part are defined as follows: Btu—British...

  10. 40 CFR 90.303 - Symbols, acronyms, abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Symbols, acronyms, abbreviations. 90.303 Section 90.303 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS... Equipment Provisions § 90.303 Symbols, acronyms, abbreviations. (a) The acronyms and abbreviations in § 90.5...

  11. 7 CFR 772.2 - Abbreviations and Definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and Definitions. 772.2 Section 772.2... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.2 Abbreviations and Definitions. (a) Abbreviations. AMPAssociation-Type Minor Program loan; CFRCode of Federal Regulations; FOFarm Ownership Loan...

  12. 40 CFR 96.203 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... IMPLEMENTATION PLANS CAIR SO2 Trading Program General Provisions § 96.203 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this subpart and subparts BBB through III are...

  13. 40 CFR 96.103 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... IMPLEMENTATION PLANS CAIR NOX Annual Trading Program General Provisions § 96.103 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this subpart and subparts BB through II are...

  14. 24 CFR 58.2 - Terms, abbreviations and definitions.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Terms, abbreviations and... RESPONSIBILITIES Purpose, Legal Authority, Federal Laws and Authorities § 58.2 Terms, abbreviations and definitions... means a habitable structure that has been vacant for more than one year. (b) The following abbreviations...

  15. 40 CFR 97.303 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... Ozone Season Trading Program General Provisions § 97.303 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this subpart and subparts BBBB through IIII are defined as...

  16. 7 CFR 764.2 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 764.2 Section 764.2 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE AGENCY, DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS DIRECT LOAN MAKING Overview § 764.2 Abbreviations and definitions. Abbreviations...

  17. 40 CFR 87.2 - Acronyms and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Acronyms and abbreviations. 87.2 Section 87.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... abbreviations. The abbreviations used in this part have the following meanings in both upper and lower case...

  18. 40 CFR 91.403 - Symbols and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Symbols and abbreviations. 91.403 Section 91.403 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS... Symbols and abbreviations. (a) The abbreviations in § 91.5 apply to this subpart. (b) The symbols in Table...

  19. 40 CFR 97.103 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... Annual Trading Program General Provisions § 97.103 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this subpart and subparts BB through II are defined as...

  20. 40 CFR 92.102 - Definitions and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... the number of carbon atoms in a molecule of that compound. Precision means the standard deviation of... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Definitions and abbreviations. 92.102... Definitions and abbreviations. The definitions and abbreviations of subpart A of this part apply to this...

  1. ITER technical term bilingual glossary year 2008 first half edition

    International Nuclear Information System (INIS)

    Sato, Koichi; Sengoku, Akio; Kitazawa, Sin-iti; Neyatani, Yuzuru; Koizumi, Koichi; Seki, Fumiko; Hasegawa, Shiori

    2008-09-01

    On October 24th, 2007, the Agreement on the Establishment of the ITER International Fusion Energy Organization for the Joint Implementation of the ITER Project (the 'ITER Agreement') came into force, and Japan Atomic Energy Agency (JAEA) was appointed to a Domestic Agency (DA). The DA will contribute to the ITER construction in cooperation with ITER Organization (IO) where many ITER-specific technical terms and abbreviations were used. This book is a collection of those terms and abbreviations translated to Japanese. (author)

  2. Purine cytokinins: a proposal of abbreviations

    Czech Academy of Sciences Publication Activity Database

    Kamínek, Miroslav; Březinová, Alena; Gaudinová, Alena; Motyka, Václav; Vaňková, Radomíra; Zažímalová, Eva

    2001-01-01

    Roč. 32, - (2001), s. 253-256 ISSN 0167-6903 R&D Projects: GA AV ČR IAA6038002; GA ČR GA522/00/1346; GA ČR GA522/99/1130 Institutional research plan: CEZ:AV0Z5038910 Keywords : cytokinin abbreviations * cytokinins * plant nomenclature Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.761, year: 2001

  3. The International Glossary on Infertility and Fertility Care, 2017.

    Science.gov (United States)

    Zegers-Hochschild, Fernando; Adamson, G David; Dyer, Silke; Racowsky, Catherine; de Mouzon, Jacques; Sokol, Rebecca; Rienzi, Laura; Sunde, Arne; Schmidt, Lone; Cooke, Ian D; Simpson, Joe Leigh; van der Poel, Sheryl

    2017-09-01

    Can a consensus and evidence-driven set of terms and definitions be generated to be used globally in order to ensure consistency when reporting on infertility issues and fertility care interventions, as well as to harmonize communication among the medical and scientific communities, policy-makers, and lay public including individuals and couples experiencing fertility problems? A set of 283 consensus-based and evidence-driven terminologies used in infertility and fertility care has been generated through an inclusive consensus-based process with multiple stakeholders. In 2006 the International Committee for Monitoring Assisted Reproductive Technologies (ICMART) published a first glossary of 53 terms and definitions. In 2009 ICMART together with WHO published a revised version expanded to 87 terms, which defined infertility as a disease of the reproductive system, and increased standardization of fertility treatment terminology. Since 2009, limitations were identified in several areas and enhancements were suggested for the glossary, especially concerning male factor, demography, epidemiology and public health issues. Twenty-five professionals, from all parts of the world and representing their expertise in a variety of sub-specialties, were organized into five working groups: clinical definitions; outcome measurements; embryology laboratory; clinical and laboratory andrology; and epidemiology and public health. Assessment for revisions, as well as expansion on topics not covered by the previous glossary, were undertaken. A larger group of independent experts and representatives from collaborating organizations further discussed and assisted in refining all terms and definitions. Members of the working groups and glossary co-ordinators interacted through electronic mail and face-to-face in international/regional conferences. Two formal meetings were held in Geneva, Switzerland, with a final consensus meeting including independent experts as well as observers and

  4. The International Glossary on Infertility and Fertility Care, 2017.

    Science.gov (United States)

    Zegers-Hochschild, Fernando; Adamson, G David; Dyer, Silke; Racowsky, Catherine; de Mouzon, Jacques; Sokol, Rebecca; Rienzi, Laura; Sunde, Arne; Schmidt, Lone; Cooke, Ian D; Simpson, Joe Leigh; van der Poel, Sheryl

    2017-09-01

    Can a consensus and evidence-driven set of terms and definitions be generated to be used globally in order to ensure consistency when reporting on infertility issues and fertility care interventions, as well as to harmonize communication among the medical and scientific communities, policy-makers, and lay public including individuals and couples experiencing fertility problems? A set of 283 consensus-based and evidence-driven terminologies used in infertility and fertility care has been generated through an inclusive consensus-based process with multiple stakeholders. In 2006 the International Committee for Monitoring Assisted Reproductive Technologies (ICMART) published a first glossary of 53 terms and definitions. In 2009 ICMART together with WHO published a revised version expanded to 87 terms, which defined infertility as a disease of the reproductive system, and increased standardization of fertility treatment terminology. Since 2009, limitations were identified in several areas and enhancements were suggested for the glossary, especially concerning male factor, demography, epidemiology and public health issues. Twenty-five professionals, from all parts of the world and representing their expertise in a variety of sub-specialties, were organized into five working groups: clinical definitions; outcome measurements; embryology laboratory; clinical and laboratory andrology; and epidemiology and public health. Assessment for revisions, as well as expansion on topics not covered by the previous glossary, were undertaken. A larger group of independent experts and representatives from collaborating organizations further discussed and assisted in refining all terms and definitions. Members of the working groups and glossary co-ordinators interacted through electronic mail and face-to-face in international/regional conferences. Two formal meetings were held in Geneva, Switzerland, with a final consensus meeting including independent experts as well as observers and

  5. A glossary of terms in measuring and automation engineering

    International Nuclear Information System (INIS)

    Schruefer, E.

    1992-01-01

    This German-language glossary has been compiled by cooperative work of more than sixty authors. It contains 1800 terms and their definitions relating to measuring engineering, sensor science and engineering, testing engineering, display and read-out techniques, physical quantities, control systems, fundamentals of control engineering, engineered reliability, process control engineering, robot technology, artificial intelligence and expert systems, simulation and modelling, navigation, electronic and electromechanical components, and microtechnology. (RHM) [de

  6. Using UMLS lexical resources to disambiguate abbreviations in clinical text.

    Science.gov (United States)

    Kim, Youngjun; Hurdle, John; Meystre, Stéphane M

    2011-01-01

    Clinical text is rich in acronyms and abbreviations, and they are highly ambiguous. As a pre-processing step before subsequent NLP analysis, we are developing and evaluating clinical abbreviation disambiguation methods. The evaluation of two sequential steps, the detection and the disambiguation of abbreviations, is reported here, for various types of clinical notes. For abbreviations detection, our result indicated the SPECIALIST Lexicon LRABR needed to be revised for better abbreviation detection. Our semi-supervised method using generated training data based on expanded form matching for 12 frequent abbreviations in our clinical notes reached over 90% accuracy in five-fold cross validation and unsupervised approach produced comparable results with the semi-supervised methods.

  7. Abbreviations: the need for legibility and accuracy in documentation.

    Science.gov (United States)

    Dimond, Bridgit

    This article explores the use of abbreviations in health care. It considers the current advice of the Nursing and Midwifery Council against the use of any abbreviations and suggests, in the interests of using time effectively, that it would be wise for directorates within trusts to create a list of approved abbreviations and symbols so that the dangers of misunderstandings are removed. It also considers how the problem of illegibility should be dealt with as a clinical governance issue.

  8. Abbreviated guide pneumatic conveying design guide

    CERN Document Server

    Mills, David

    1990-01-01

    Abbreviated Guide: Pneumatic Conveying Design Guide describes the selection, design, and specification of conventional pneumatic conveying systems. The design procedure uses previous test data on the materials to be conveyed. The book also discusses system economics, operating costs, the choice of appropriate components or systems, system control, and system flexibility. The design system involves the type of conveying system for installation, the pipeline parameters, and also the plant components. System selection covers the properties of the material to be conveyed, plant layout, material pr

  9. Completion of a Dislocated Metric Space

    Directory of Open Access Journals (Sweden)

    P. Sumati Kumari

    2015-01-01

    Full Text Available We provide a construction for the completion of a dislocated metric space (abbreviated d-metric space; we also prove that the completion of the metric associated with a d-metric coincides with the metric associated with the completion of the d-metric.

  10. Assessment of morbidity in carcinoma of the cervix: a comparison of the LENT SOMA scales and the Franco-Italian glossary

    International Nuclear Information System (INIS)

    Davidson, Susan E.; Burns, Meriel P.; Routledge, Jacqueline A.; Swindell, Ric; Bentzen, Soeren M.; West, Catharine M.L.

    2003-01-01

    Background and purpose: To assess the correlation between the LENT (late effects on normal tissue) SOMA (subjective objective management analytic) system and the Franco-Italian glossary scores of late morbidity in cervical cancer patients treated with radiation, and to compare the ability of the scoring systems to detect differences between radiation treatment groups. Materials and methods: The study was retrospective. Patients, invited to take part in the study, had radiotherapy for cervical cancer and had a minimum of 3 years follow-up with no evidence of recurrence. One hundred patients agreed to take part. LENT subjective data were obtained using a patient questionnaire approach in order to complete the scales as published. The LENT objective, management and Franco-Italian glossary scores were obtained by a physician. Correlations between scores and differences between treatment groups were examined using non-parametric tests. Results: The average LENT SOMA scores had a greater resolution than the maximum scores, and using the maximum score alone underestimated treatment morbidity. The Franco-Italian glossary scores correlated strongly with the LENT objective scores (ρ=0.61, P<0.0005), and less strongly with the LENT subjective scores (ρ=0.45, P<0.0005). Significant differences in morbidity between the radiation treatment groups were measured using both the LENT SOMA system and the Franco-Italian glossary. Conclusions: The maximum and average LENT scores should be reported for each subsite. The LENT objective scores correlated well with the scores obtained using the established Franco-Italian glossary, but the LENT system provided additional information on subjective treatment effects. Both systems were able to measure significant differences in morbidity between radiation treatment groups. In conclusion, the LENT SOMA system is a valid and comprehensive approach for scoring the late normal tissue effects of radiotherapy

  11. Developing and Validating an Abbreviated Version of the Microscale Audit for Pedestrian Streetscapes (MAPS-Abbreviated).

    Science.gov (United States)

    Cain, Kelli L; Gavand, Kavita A; Conway, Terry L; Geremia, Carrie M; Millstein, Rachel A; Frank, Lawrence D; Saelens, Brian E; Adams, Marc A; Glanz, Karen; King, Abby C; Sallis, James F

    2017-06-01

    Macroscale built environment factors (e.g., street connectivity) are correlated with physical activity. Less-studied but more modifiable microscale elements (e.g., sidewalks) may also influence physical activity, but shorter audit measures of microscale elements are needed to promote wider use. This study evaluated the relation of an abbreviated 54-item streetscape audit tool with multiple measures of physical activity in four age groups. We developed a 54-item version from the original 120-item Microscale Audit of Pedestrian Streetscapes (MAPS). Audits were conducted on 0.25-0.45 mile routes from participant residences toward the nearest nonresidential destination for children (N=758), adolescents (N=897), younger adults (N=1,655), and older adults (N=367). Active transport and leisure physical activity were measured with surveys, and objective physical activity was measured with accelerometers. Items to retain from original MAPS were selected primarily by correlations with physical activity. Mixed linear regression analyses were conducted for MAPS-Abbreviated summary scores, adjusting for demographics, participant clustering, and macroscale walkability. MAPS-Abbreviated and original MAPS total scores correlated r=.94 The MAPS-Abbreviated tool was related similarly to physical activity outcomes as the original MAPS. Destinations and land use, streetscape and walking path characteristics, and overall total scores were significantly related to active transport in all age groups. Street crossing characteristics were related to active transport in children and older adults. Aesthetics and social characteristics were related to leisure physical activity in children and younger adults, and cul-de-sacs were related with physical activity in youth. Total scores were related to accelerometer-measured physical activity in children and older adults. MAPS-Abbreviated is a validated observational measure for use in research. The length and related cost of implementation has

  12. Cogeneration handbook for the food processing industry. [Contains glossary

    Energy Technology Data Exchange (ETDEWEB)

    Eakin, D.E.; Fassbender, L.L.; Garrett-Price, B.A.; Moore, N.L.; Fasbender, A.G.; Gorges, H.A.

    1984-03-01

    The decision of whether to cogenerate involves several considerations, including technical, economic, environmental, legal, and regulatory issues. Each of these issues is addressed separately in this handbook. In addition, a chapter is included on preparing a three-phase work statement, which is needed to guide the design of a cogeneration system. In addition, an annotated bibliography and a glossary of terminology are provided. Appendix A provides an energy-use profile of the food processing industry. Appendices B through O provide specific information that will be called out in subsequent chapters.

  13. Cogeneration handbook for the petroleum refining industry. [Contains glossary

    Energy Technology Data Exchange (ETDEWEB)

    Fassbender, L.L.; Garrett-Price, B.A.; Moore, N.L.; Fassbender, A.G.; Eakin, D.E.; Gorges, H.A.

    1984-03-01

    The decision of whether to cogenerate involves several considerations, including technical, economic, environmental, legal, and regulatory issues. Each of these issues is addressed separately in this handbook. In addition, a chapter is included on preparing a three-phase work statement, which is needed to guide the design of a cogeneration system. In addition, an annotated bibliography and a glossary of terminology are provided. Appendix A provides an energy-use profile of the petroleum refining industry. Appendices B through O provide specific information that will be called out in subsequent chapters.

  14. Cogeneration handbook for the pulp and paper industry. [Contains glossary

    Energy Technology Data Exchange (ETDEWEB)

    Griffin, E.A.; Moore, N.L.; Fassbender, L.L.; Garrett-Price, B.A.; Fassbender, A.G.; Eakin, D.E.; Gorges, H.A.

    1984-03-01

    The decision of whether to cogenerate involves several considerations, including technical, economic, environmental, legal, and regulatory issues. Each of these issues is addressed separately in this handbook. In addition, a chapter is included on preparing a three-phase work statement, which is needed to guide the design of a cogeneration system. In addition, an annotated bibliography and a glossary of terminology are provided. Appendix A provides an energy-use profile of the pulp and paper industry. Appendices B and O provide specific information that will be called out in subsequent chapters.

  15. Bilingual Glossary of Professional Mental Health Terms = Glosario Bilingue de Terminos Profesionales de Salud Mental.

    Science.gov (United States)

    Cherry, Ralph, Comp.

    Designed to acquaint social workers and other professionals in the mental health field with the basic terms necessary for professional discussions, paper presentations, and international correspondence, the English/Spanish-Spanish/English glossary lists 130 selected mental health terms. The glossary includes two sections: English to Spanish and…

  16. 77 FR 8706 - Summary of Benefits and Coverage and Uniform Glossary-Templates, Instructions, and Related...

    Science.gov (United States)

    2012-02-14

    ... ``standards for the definitions of terms used in health insurance coverage.'' The statute directs the... included prostate cancer, colorectal cancer, hypertension, heart attack, stroke, major depression, and... glossary is intended to be educational in nature and that the definitions contained in the glossary may not...

  17. Cosmetology; Glossary of Key Words. Vocational Reading Power Project, Title III, E.S.E.A.

    Science.gov (United States)

    Premer, LaVerne

    The glossary is one of twenty in various subject areas of vocational education designed to assist the student in vocabulary mastery for particular vocational education courses. They are part of the Vocational Reading Power Project, Title III, E.S.E.A. This glossary is for a course in cosmetology. It is divided into two parts: one provides the…

  18. Glossary of terms recommended for use in radiation control legislation and associated codes of practice

    International Nuclear Information System (INIS)

    Swindon, T.; Kennedy, K.N.; Elliott, G.

    1983-06-01

    A glossary of terms associated with radiological health is presented. It includes basic physics terms, quantities and units, radiological physics terms and radiation protection terms. The National Health and Medical Research Council has recommended that the glossary be used by organizations producing official documents and by appropriate regulatory authorities

  19. Abbreviations for device names: a proposed methodology with specific examples.

    Science.gov (United States)

    Alam, Murad; Dover, Jeffrey S; Alam, Murad; Goldman, Mitchel P; Kaminer, Michael S; Orringer, Jeffrey; Waldorf, Heidi; Alam, Murad; Avram, Mathew; Cohen, Joel L; Draelos, Zoe Diana; Dover, Jeffrey S; Hruza, George; Kilmer, Suzanne; Lawrence, Naomi; Lupo, Mary; Metelitsa, Andrei; Nestor, Mark; Ross, E Victor

    2013-04-01

    Many devices used in dermatology lack generic names. If investigators use commercial device names, they risk the appearance of bias. Alternatively, reliance on ad-hoc names and abbreviations may confuse readers who do not recognize these. To develop a system for assigning abbreviations to denote devices commonly used in dermatology. Secondarily, to use this system to create abbreviations for FDA-approved neurotoxins and prepackaged injectable soft-tissue augmentation materials. The American Society for Dermatologic Surgery convened a Lexicon Task Force in March 2012. One charge of this Task Force was to develop criteria for assigning abbreviations to medical devices. A modified consensus process was used. Abbreviations to denote devices were to be: based on a standardized approach; transparent to the casual reader; markedly brief; and in all cases, different than the commercial names. Three-letter all caps abbreviations, some with subscripts, were assigned to denote each of the approved neurotoxins and fillers. A common system of abbreviations for medical devices in dermatology may avoid the appearance of bias while ensuring effective communication. The proposed system may be expanded to name other devices, and the ensuing abbreviations may be suitable for journal articles, continuing medical education lectures, or other academic or clinical purposes. © 2013 by the American Society for Dermatologic Surgery, Inc. Published by Wiley Periodicals, Inc.

  20. 32 CFR Appendix B to Part 806 - Abbreviations and Acronyms

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Abbreviations and Acronyms B Appendix B to Part 806 National Defense Department of Defense (Continued) DEPARTMENT OF THE AIR FORCE ADMINISTRATION AIR FORCE FREEDOM OF INFORMATION ACT PROGRAM Pt. 806, App. B Appendix B to Part 806—Abbreviations and...

  1. 16 CFR 300.9 - Abbreviations, ditto marks, and asterisks.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Abbreviations, ditto marks, and asterisks. 300.9 Section 300.9 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULES AND REGULATIONS UNDER THE WOOL PRODUCTS LABELING ACT OF 1939 Labeling § 300.9 Abbreviations...

  2. 32 CFR Appendix F to Subpart M of... - Abbreviations

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 3 2010-07-01 2010-07-01 true Abbreviations F Appendix F to Subpart M of Part 552 National Defense Department of Defense (Continued) DEPARTMENT OF THE ARMY MILITARY RESERVATIONS...—Abbreviations AAOArea Access Officer ARArmy Regulation CBRCCamp Bonneville Range Control DEHDirector of...

  3. 7 CFR 635.1 - Definitions and abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Definitions and abbreviations. 635.1 Section 635.1 Agriculture Regulations of the Department of Agriculture (Continued) NATURAL RESOURCES CONSERVATION SERVICE... abbreviations. The following terms apply to this part: Covered program means a natural resource conservation...

  4. 49 CFR 179.2 - Definitions and abbreviations.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Definitions and abbreviations. 179.2 Section 179.2 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... Introduction, Approvals and Reports § 179.2 Definitions and abbreviations. (a) The following apply in part 179...

  5. The use of abbreviations in surgical note keeping

    Directory of Open Access Journals (Sweden)

    B. Collard

    2015-06-01

    Full Text Available Abbreviations are used to improve the speed of note keeping and to simplify patient notes. However studies have shown that they can reduce clarity, increase mistakes and cause confusion in management plans. Our review highlights the misuse of abbreviations in surgical note keeping.

  6. The use of abbreviations in surgical note keeping.

    Science.gov (United States)

    Collard, B; Royal, A

    2015-06-01

    Abbreviations are used to improve the speed of note keeping and to simplify patient notes. However studies have shown that they can reduce clarity, increase mistakes and cause confusion in management plans. Our review highlights the misuse of abbreviations in surgical note keeping.

  7. 7 CFR 718.302 - Definitions and abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Definitions and abbreviations. 718.302 Section 718.302 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE AGENCY, DEPARTMENT OF... MULTIPLE PROGRAMS Equitable Relief From Ineligibility § 718.302 Definitions and abbreviations. In addition...

  8. 16 CFR 301.4 - Abbreviations or ditto marks prohibited.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Abbreviations or ditto marks prohibited. 301.4 Section 301.4 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULES AND REGULATIONS UNDER FUR PRODUCTS LABELING ACT Regulations § 301.4 Abbreviations or ditto...

  9. 7 CFR 1421.400 - Applicability and abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Applicability and abbreviations. 1421.400 Section 1421.400 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT... Associations for Peanuts § 1421.400 Applicability and abbreviations. (a) This subpart sets forth the terms and...

  10. Twenty years of social capital and health research: a glossary.

    Science.gov (United States)

    Moore, S; Kawachi, I

    2017-05-01

    Research on social capital in public health is approaching its 20th anniversary. Over this period, there have been rich and productive debates on the definition, measurement and importance of social capital for public health research and practice. As a result, the concepts and measures characterising social capital and health research have also evolved, often drawing from research in the social, political and behavioural sciences. The multidisciplinary adaptation of social capital-related concepts to study health has made it challenging for researchers to reach consensus on a common theoretical approach. This glossary thus aims to provide a general overview without recommending any particular approach. Based on our knowledge and research on social capital and health, we have selected key concepts and terms that have gained prominence over the last decade and complement an earlier glossary on social capital and health. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  11. Glossary of technical terms for the medical technology professionals.

    Directory of Open Access Journals (Sweden)

    Rafael Felipe García Rodríguez

    2014-03-01

    Full Text Available The current work is a glossary of technical terms in English language for Medical Health Professionals, has been prepared due to the lack of technical lexicon the students have during and after their university studies, that is, the students have a deficit of technical words which limits their professional competence and accountability. This shortage limits them and makes it a great laboring challenge if they have to work overseas in English-speaking countries. The glossary comprises the main and necessary words which are needed for this type of professional in their field of action. These graduates have a solid knowledge and comprehension of biological, biochemical and biophysical fundamentals in their mother tongue but they do not have the necessary elements in the target language to operate properly. It is a need that they can work appropriately in the spheres of prevention, promotion and health recovery to support a diagnosis, a treatment and a management not only in their mother tongue but in English for their future work.

  12. A CRITICAL REVIEW OF THE ENGLISH LANGUAGE TEXTBOOK WITH EMPHASIS ON ENGLISH-SERBIAN GLOSSARY

    OpenAIRE

    Иван Књижар

    2012-01-01

    In this paper we made a critical review of textbook Messages 1 with emphasis on English-Serbian glossary. Since this textbook is intended for pupils of 5th grade, we examined its appropriateness for this age group. In addition, we did lexical and semantic analysis of a glossary that is incorporated in the textbook. Messages 1 is extraordinarily designed textbook. It is alsko uitable for pupils of 5th grade whose first language is not English. In terms of the English-Serbian glossary, there is...

  13. A guide and glossary on post-positivist theory building for population health.

    Science.gov (United States)

    Carpiano, R M; Daley, Dorothy M

    2006-07-01

    This guide and glossary focuses on the role of theory and conceptual models within population health research. Upon discussing the critical need for theory in conducting interdisciplinary research, it provides strategies for crafting theories that can be empirically tested and a glossary of theory building terms that are useful for guiding research. In addition to general concepts, the glossary includes some terminology commonly found in the social sciences, whose well established traditions and practices of formal theory building may be particularly informative for epidemiologists and other population health researchers who have minimal formal social science training, but study social factors in their research.

  14. The REFINEMENT Glossary of Terms: An International Terminology for Mental Health Systems Assessment.

    Science.gov (United States)

    Montagni, Ilaria; Salvador-Carulla, Luis; Mcdaid, David; Straßmayr, Christa; Endel, Florian; Näätänen, Petri; Kalseth, Jorid; Kalseth, Birgitte; Matosevic, Tihana; Donisi, Valeria; Chevreul, Karine; Prigent, Amélie; Sfectu, Raluca; Pauna, Carmen; Gutiérrez-Colosia, Mencia R; Amaddeo, Francesco; Katschnig, Heinz

    2018-03-01

    Comparing mental health systems across countries is difficult because of the lack of an agreed upon terminology covering services and related financing issues. Within the European Union project REFINEMENT, international mental health care experts applied an innovative mixed "top-down" and "bottom-up" approach following a multistep design thinking strategy to compile a glossary on mental health systems, using local services as pilots. The final REFINEMENT glossary consisted of 432 terms related to service provision, service utilisation, quality of care and financing. The aim of this study was to describe the iterative process and methodology of developing this glossary.

  15. 40 CFR 1042.905 - Symbols, acronyms, and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... Definitions and Other Reference Information § 1042.905 Symbols, acronyms, and abbreviations. The following... Archives and Records Administration. NMHCnonmethane hydrocarbons. NOXoxides of nitrogen (NO and NO2.... SCRselective catalytic reduction. THCtotal hydrocarbon. THCEtotal hydrocarbon equivalent. ULSDultra low-sulfur...

  16. Rabies vaccinations: are abbreviated intradermal schedules the future?

    NARCIS (Netherlands)

    Wieten, R. W.; Leenstra, T.; van Thiel, P. P. A. M.; van Vugt, M.; Stijnis, C.; Goorhuis, A.; Grobusch, M. P.

    2013-01-01

    Rabies is a deadly disease, and current preexposure vaccination schedules are lengthy and expensive. We identified nine studies investigating abbreviated schedules. Although initial responses were lower, accelerated adequate immune responses were elicited after booster vaccinations. Lower-dose (and

  17. Fasting abbreviation among patients submitted to oncologic surgery: systematic review

    OpenAIRE

    PINTO, Andressa dos Santos; GRIGOLETTI, Shana Souza; MARCADENTI, Aline

    2015-01-01

    INTRODUCTION: The abbreviation of perioperative fasting among candidates to elective surgery have been associated with shorter hospital stay and decreased postoperative complications. OBJECTIVE: To conduct a systematic review from randomized controlled trials to detect whether the abbreviation of fasting is beneficial to patients undergoing cancer surgery compared to traditional fasting protocols. METHOD: A literature search was performed in electronic databases: MEDLINE (PubMed), SciELO...

  18. Adaptation of abbreviated mathematics anxiety rating scale for engineering students

    Science.gov (United States)

    Nordin, Sayed Kushairi Sayed; Samat, Khairul Fadzli; Sultan, Al Amin Mohamed; Halim, Bushra Abdul; Ismail, Siti Fatimah; Mafazi, Nurul Wirdah

    2015-05-01

    Mathematics is an essential and fundamental tool used by engineers to analyse and solve problems in their field. Due to this, most engineering education programs involve a concentration of study in mathematics courses whereby engineering students have to take mathematics courses such as numerical methods, differential equations and calculus in the first two years and continue to do so until the completion of the sequence. However, the students struggled and had difficulties in learning courses that require mathematical abilities. Hence, this study presents the factors that caused mathematics anxiety among engineering students using Abbreviated Mathematics Anxiety Rating Scale (AMARS) through 95 students of Universiti Teknikal Malaysia Melaka (UTeM). From 25 items in AMARS, principal component analysis (PCA) suggested that there are four mathematics anxiety factors, namely experiences of learning mathematics, cognitive skills, mathematics evaluation anxiety and students' perception on mathematics. Minitab 16 software was used to analyse the nonparametric statistics. Kruskal-Wallis Test indicated that there is a significant difference in the experience of learning mathematics and mathematics evaluation anxiety among races. The Chi-Square Test of Independence revealed that the experience of learning mathematics, cognitive skills and mathematics evaluation anxiety depend on the results of their SPM additional mathematics. Based on this study, it is recommended to address the anxiety problems among engineering students at the early stage of studying in the university. Thus, lecturers should play their part by ensuring a positive classroom environment which encourages students to study mathematics without fear.

  19. English/Russian and Russian/English glossary of physical protection terms

    International Nuclear Information System (INIS)

    Soo Hoo, M.S.

    1995-07-01

    This glossary was prepared in fulfillment of the Glossary Preparation Task identified in the Program Plan for providing Assistance to the Russian Federation in Nuclear Material Control and Accounting and Physical Protection. The Program Plan is part of the Cooperative Threat Reduction Program as provided for under House Resolution (H.R.) 3807 (Title II, as referenced under Public Law (P.L.) 102-229. The terms in this glossary were derived from physical protection training material prepared at Sandia. The training material, and thus refinements to the glossary, has undergone years of development in presentation to both domestic and international audiences. Also, Russian Colleagues and interpreters have reviewed the translations for accuracy

  20. Abbreviated kinetic profiles in area-under-the-curve monitoring of cyclosporine therapy.

    Science.gov (United States)

    Grevel, J; Kahan, B D

    1991-11-01

    Abbreviated kinetic profiles can reduce the number of phlebotomies and drug assays, and thereby the cost of area-under-the-curve (AUC) monitoring. In the present investigation, we used two independent data sets: group 1, 101 AUC profiles from 77 stable renal-transplant patients, which included a 5-h sample in addition to the usual 0-, 2-, 4-, 6-, 10-, 14-, and 24-h samples; and group 2, 100 profiles from 50 stable renal-transplant patients before and after a change in their daily oral dose of cyclosporine. Group I demonstrated a fair correlation between cyclosporine trough concentrations and the AUC calculated from a complete set of seven concentrations (r2 = 0.820 and 0.758 for the 24- and 0-h samples, respectively). Stepwise multiple linear-regression analysis revealed that the abbreviated set of three time points (2, 6, and 14 h) explained 96% of the variance in AUC values calculated from the full set of seven samples; additional time points increased the accuracy only slightly. For group 2, we examined the difference between the observed and the predicted concentrations by linear extrapolation; the error in the observed AUC value, compared with the predicted value calculated from seven time points (-13.2% to -1.2%), was similar to the error from just three time points (-11.5% to 4.5%). Abbreviated AUC profiles involving three time points used with a model equation seem to provide a reliable alternative to full seven-point profiles.

  1. Building knowledge for quality improvement in healthcare: an introductory glossary.

    Science.gov (United States)

    Batalden, P B

    1991-01-01

    At the heart of organization-wide quality improvement in healthcare is the need to build knowledge for improvement that complements the subject matter knowledge of healthcare. Dr. W. Edwards Deming, the quality improvement pioneer, has suggested that "profound knowledge," or knowledge required for improvement, consists of four basic dimensions: Knowledge of the organization as a system. At its heart this knowledge is an understanding of the methods of production, the methods of improvement, and the aim of the entire enterprise. This concept was first presented by Deming at Mount Hakone, Japan, in 1950. In his book Out of the Crisis (1986), Deming illustrates the organization as a system. Knowledge of variation. This understanding comes from the awareness that a system of causes is at work producing any result. These sources of the variation, which can be observed in any process, are what must be acted upon to improve the results of the process. Studying the variation in a process can provide clues to the most economical actions that managers can take for improvement. It involves knowledge of the difference between common and special cause variation. Knowledge of psychology. The focus is on an awareness of the power of intrinsic motivation, a sense of self-worth and pride in what is done in the workplace. Theory of knowledge. How is new knowledge built? What is the purpose of knowledge? What is the nature of knowledge? Unless these issues are clear, it will not be easy to build useful knowledge. Deming has provided further insight into this framework in a recent unpublished essay and is currently working to further expand these concepts in additional publications in preparation. This framework helps build the knowledge necessary for the improvement of healthcare. As you work to build that knowledge, however, you will confront a wide variety of terms and a language that may in some ways be unfamiliar. In recognition of that, an introductory glossary is offered for

  2. [Electroencephalography of the premature and term newborn. Maturational aspects and glossary].

    Science.gov (United States)

    Lamblin, M D; André, M; Challamel, M J; Curzi-Dascalova, L; d'Allest, A M; De Giovanni, E; Moussalli-Salefranque, F; Navelet, Y; Plouin, P; Radvanyi-Bouvet, M F; Samson-Dollfus, D; Vecchierini-Blineau, M F

    1999-04-01

    From the first publication of C. Dreyfus-Brisac and N. Monod, a strong tradition combined with tremendous development of neonatal EEG has taken place in France. After 3 years of collaborative work, 12 clinical neurophysiologists trained at the Port-Royal medical school in Paris detail in this paper the currently available neonatal EEG recording techniques. They have synthesized the criteria of maturational state analysis and have defined the normal and pathological neonatal EEG patterns, including descriptions already present in the French as well as the English literature. In this review one may find a complete description of neonatal EEG patterns according to the states of vigilance and to gestational age. Furthermore, definitions of all normal and pathological patterns are provided in a glossary. Both chapters are illustrated by numerous figures. This detailed terminology in neonatal EEG should allow a better homogeneity in EEG reports, and could lead to multicentric studies on normal, unusual or pathological patterns, according to etiology. Although based on analogic EEG data, this work can equally be applied to digitized EEG tracings.

  3. Interim performance criteria for photovoltaic energy systems. [Glossary included

    Energy Technology Data Exchange (ETDEWEB)

    DeBlasio, R.; Forman, S.; Hogan, S.; Nuss, G.; Post, H.; Ross, R.; Schafft, H.

    1980-12-01

    This document is a response to the Photovoltaic Research, Development, and Demonstration Act of 1978 (P.L. 95-590) which required the generation of performance criteria for photovoltaic energy systems. Since the document is evolutionary and will be updated, the term interim is used. More than 50 experts in the photovoltaic field have contributed in the writing and review of the 179 performance criteria listed in this document. The performance criteria address characteristics of present-day photovoltaic systems that are of interest to manufacturers, government agencies, purchasers, and all others interested in various aspects of photovoltaic system performance and safety. The performance criteria apply to the system as a whole and to its possible subsystems: array, power conditioning, monitor and control, storage, cabling, and power distribution. They are further categorized according to the following performance attributes: electrical, thermal, mechanical/structural, safety, durability/reliability, installation/operation/maintenance, and building/site. Each criterion contains a statement of expected performance (nonprescriptive), a method of evaluation, and a commentary with further information or justification. Over 50 references for background information are also given. A glossary with definitions relevant to photovoltaic systems and a section on test methods are presented in the appendices. Twenty test methods are included to measure performance characteristics of the subsystem elements. These test methods and other parts of the document will be expanded or revised as future experience and needs dictate.

  4. Invertebrate neurophylogeny: suggested terms and definitions for a neuroanatomical glossary

    Directory of Open Access Journals (Sweden)

    Müller Carsten HG

    2010-11-01

    Full Text Available Abstract Background Invertebrate nervous systems are highly disparate between different taxa. This is reflected in the terminology used to describe them, which is very rich and often confusing. Even very general terms such as 'brain', 'nerve', and 'eye' have been used in various ways in the different animal groups, but no consensus on the exact meaning exists. This impedes our understanding of the architecture of the invertebrate nervous system in general and of evolutionary transformations of nervous system characters between different taxa. Results We provide a glossary of invertebrate neuroanatomical terms with a precise and consistent terminology, taxon-independent and free of homology assumptions. This terminology is intended to form a basis for new morphological descriptions. A total of 47 terms are defined. Each entry consists of a definition, discouraged terms, and a background/comment section. Conclusions The use of our revised neuroanatomical terminology in any new descriptions of the anatomy of invertebrate nervous systems will improve the comparability of this organ system and its substructures between the various taxa, and finally even lead to better and more robust homology hypotheses.

  5. Glossary for Cultural Transformation: The Language of Partnership and Domination

    Directory of Open Access Journals (Sweden)

    Stefano Mercanti

    2015-06-01

    Full Text Available When global and interdisciplinary scholars share a field of inquiry, terms must be defined so that there is a common understanding of key concepts to guide research. Similarly, applied knowledge requires accepted definitions of terms so that a cohesive message can be disseminated. The “Glossary for Cultural Transformation: The Language of Partnership and Domination” defines key terms related to cultural transformation and the partnership/domination continuum, to provide a resource for research, practice, and community applications of Riane Eisler’s partnership paradigm. Erratum Issued March 15, 2016. On page 21, the definition of "Matrilineal, matrifocal, matristic, matrilocal" should read: Matrilineal, matrifocal, matristic, matrilocal: Matrilineal refers to societies in which descent and inheritance are traced for children in terms of their mother rather than their father. In family organizations, matrifocal and matristic mean mother-centered; these families are generally also matrilocal, meaning that both daughters and sons reside in their mothers’ households, and of men entering into women’s family houses or villages upon marriage. According to Eisler, the shift from matriliny to patriliny played a major role in establishing dominator social and sexual relations which led to the invention of one-sided monogamy, along with prostitution, adultery, and illegitimacy, as well as the harsh punishment of women for any sexual and personal independence, along with the institutionalization and glorification of warfare.

  6. Detecting abbreviations in discharge summaries using machine learning methods.

    Science.gov (United States)

    Wu, Yonghui; Rosenbloom, S Trent; Denny, Joshua C; Miller, Randolph A; Mani, Subramani; Giuse, Dario A; Xu, Hua

    2011-01-01

    Recognition and identification of abbreviations is an important, challenging task in clinical natural language processing (NLP). A comprehensive lexical resource comprised of all common, useful clinical abbreviations would have great applicability. The authors present a corpus-based method to create a lexical resource of clinical abbreviations using machine-learning (ML) methods, and tested its ability to automatically detect abbreviations from hospital discharge summaries. Domain experts manually annotated abbreviations in seventy discharge summaries, which were randomly broken into a training set (40 documents) and a test set (30 documents). We implemented and evaluated several ML algorithms using the training set and a list of pre-defined features. The subsequent evaluation using the test set showed that the Random Forest classifier had the highest F-measure of 94.8% (precision 98.8% and recall of 91.2%). When a voting scheme was used to combine output from various ML classifiers, the system achieved the highest F-measure of 95.7%.

  7. Analysis of abbreviations used by residents in admission notes and discharge summaries.

    Science.gov (United States)

    Shilo, L; Shilo, G

    2018-03-01

    There are abbreviations that are used daily such as BP for blood pressure and ECG for electrocardiogram, but many of the abbreviations found in medical documents are unclear. The purpose of this study was to assess the frequency, type and comprehension of abbreviations in admission notes and discharge letters composed by orthopedic surgery and medical residents. Abbreviations were extracted from discharge letters and admission notes composed by residents from orthopedic surgery and medical wards. The frequency of use of the abbreviations was determined. Additionally, the fifty commonest abbreviations from each specialty were graded by three medical and three orthopedic surgery senior physicians as 1. understandable or 2. Ambiguous or unknown. The number of abbreviations found in the documents composed by medical and orthopedic surgery residents was 1525 with 80 different abbreviations and 493 with 51 different abbreviations respectively (9.3% and 4.9% of the total word number respectively). Analysis revealed that 14% of the abbreviations from medical ward documents were graded as ambiguous or unknown by medical senior physicians compared with 25% by senior orthopedic surgeons. When abbreviations from orthopedic surgery documents were presented to both groups, senior orthopedic surgeons graded 8% as ambiguous or unknown compared with 21% by the medical senior physicians. In order to prevent impairment of patient care, only standard abbreviations should be used in medical documents. Measures should be taken to decrease the use of non standard abbreviations such as the incorporation of authorized abbreviations to the electronic medical record.

  8. Detection of sentence boundaries and abbreviations in clinical narratives.

    Science.gov (United States)

    Kreuzthaler, Markus; Schulz, Stefan

    2015-01-01

    In Western languages the period character is highly ambiguous, due to its double role as sentence delimiter and abbreviation marker. This is particularly relevant in clinical free-texts characterized by numerous anomalies in spelling, punctuation, vocabulary and with a high frequency of short forms. The problem is addressed by two binary classifiers for abbreviation and sentence detection. A support vector machine exploiting a linear kernel is trained on different combinations of feature sets for each classification task. Feature relevance ranking is applied to investigate which features are important for the particular task. The methods are applied to German language texts from a medical record system, authored by specialized physicians. Two collections of 3,024 text snippets were annotated regarding the role of period characters for training and testing. Cohen's kappa resulted in 0.98. For abbreviation and sentence boundary detection we can report an unweighted micro-averaged F-measure using a 10-fold cross validation of 0.97 for the training set. For test set based evaluation we obtained an unweighted micro-averaged F-measure of 0.95 for abbreviation detection and 0.94 for sentence delineation. Language-dependent resources and rules were found to have less impact on abbreviation detection than on sentence delineation. Sentence detection is an important task, which should be performed at the beginning of a text processing pipeline. For the text genre under scrutiny we showed that support vector machines exploiting a linear kernel produce state of the art results for sentence boundary detection. The results are comparable with other sentence boundary detection methods applied to English clinical texts. We identified abbreviation detection as a supportive task for sentence delineation.

  9. WikiHyperGlossary (WHG): an information literacy technology for chemistry documents.

    Science.gov (United States)

    Bauer, Michael A; Berleant, Daniel; Cornell, Andrew P; Belford, Robert E

    2015-01-01

    The WikiHyperGlossary is an information literacy technology that was created to enhance reading comprehension of documents by connecting them to socially generated multimedia definitions as well as semantically relevant data. The WikiHyperGlossary enhances reading comprehension by using the lexicon of a discipline to generate dynamic links in a document to external resources that can provide implicit information the document did not explicitly provide. Currently, the most common method to acquire additional information when reading a document is to access a search engine and browse the web. This may lead to skimming of multiple documents with the novice actually never returning to the original document of interest. The WikiHyperGlossary automatically brings information to the user within the current document they are reading, enhancing the potential for deeper document understanding. The WikiHyperGlossary allows users to submit a web URL or text to be processed against a chosen lexicon, returning the document with tagged terms. The selection of a tagged term results in the appearance of the WikiHyperGlossary Portlet containing a definition, and depending on the type of word, tabs to additional information and resources. Current types of content include multimedia enhanced definitions, ChemSpider query results, 3D molecular structures, and 2D editable structures connected to ChemSpider queries. Existing glossaries can be bulk uploaded, locked for editing and associated with multiple social generated definitions. The WikiHyperGlossary leverages both social and semantic web technologies to bring relevant information to a document. This can not only aid reading comprehension, but increases the users' ability to obtain additional information within the document. We have demonstrated a molecular editor enabled knowledge framework that can result in a semantic web inductive reasoning process, and integration of the WikiHyperGlossary into other software technologies, like

  10. Sourcing archaeological obsidian by an abbreviated NAA procedure

    International Nuclear Information System (INIS)

    Glascock, M.D.; Neff, H.; Stryker, K.S.; Jonhson, T.N.

    1994-01-01

    An abbreviated NAA procedure has been developed to fingerprint obsidian artifacts in the Mesoamerican region. Despite the large number of available sources, an NAA procedure, which relies on producing short-lived isotopes, has been applied with a success rate greater than 90 percent. The abbreviated NAA procedure is rapid and cost competitive with the XRF technique more often applied in obsidian sourcing. Results from the analysis of over 1,200 obsidian artifacts from throughout Mesoamerica are presented. (author) 8 refs.; 6 figs.; 2 tabs

  11. NATO Glossary of Abbreviations Used in NATO Documents and Publications (glossaire otan des abreviations utilisees dans les documents et publications otan)

    Science.gov (United States)

    2010-01-01

    NASG] CHOP change of operational control [ATP-01] changement de contrôle opérationnel [NASG] CHRM civilian human resources manager [AAP-16...matières Summary of changes to AAP-15(2009) VII to/à XV Récapitulatif des changements apportés à l’AAP-15(2009) Preface XVI to/à XX Préface...BLANK PAGE SANS TEXTE -VI- AAP-15(2010) SUMMARY OF CHANGES / RÉCAPULATIF DES CHANGEMENTS ADDITIONS

  12. NATO Glossary of Abbreviations Used in NATO Documents and Publications (Glossaire OTAN des Abreviations Utilisees dans les Documents et Publications OTAN)

    Science.gov (United States)

    2007-01-01

    mouvements NASG AMP 1. Allied Mine Warfare Publication Catalogue 1. publication interalliée sur la guerre des mines NASG 2. assisted maintenance period NASG...2. période de maintenance assistée NASG AMPA advanced mission planning aid NASG aide perfectionnée à la planification des missions NASG AMPS ...rendu d’avarie [marine] NASG CASA 1. chapitre, article, sous-article NASG 1. chapter, item, sub-item /CISI/ NASG 2. comité d’association de système

  13. Industrial Electricity; Glossary of Key Words. Vocational Reading Power Project, Title III, E.S.E.A.

    Science.gov (United States)

    Tedsen, Edgar

    The glossary is one of twenty in various subject areas of vocational education designed to assist the student in vocabulary mastery for particular vocational education courses. They are part of the Vocational Reading Power Project, Title III, E.S.E.A. This glossary is for a course in industrial electricity. It is divided into two parts: one…

  14. On the Effectiveness of Pop-Up English Language Glossary Accommodations for EL Students in Large-Scale Assessments

    Science.gov (United States)

    Cohen, Dale; Tracy, Ryan; Cohen, Jon

    2017-01-01

    This study examined the effectiveness and influence on validity of a computer-based pop-up English glossary accommodation for English learners (ELs) in grades 3 and 7. In a randomized controlled trial, we administered pop-up English glossaries with audio to students taking a statewide accountability English language arts (ELA) and mathematics…

  15. Validation Study of the Abbreviated Math Anxiety Scale: Spanish Adaptation

    Science.gov (United States)

    Brown, Jennifer L.; Sifuentes, Lucía Macías

    2016-01-01

    With growing numbers of Hispanic students enrolling in post-secondary school, there is a need to increase retention and graduation rates. The purpose of this study was to validate the Spanish adaptation of the Abbreviated Math Anxiety Scale (AMAS). The AMAS was translated and administered to 804 freshman students at a post-secondary institution in…

  16. Abbreviated Pandemic Influenza Planning Template for Primary Care Offices

    Energy Technology Data Exchange (ETDEWEB)

    HCTT CHE

    2010-01-01

    The Abbreviated Pandemic Influenza Plan Template for Primary Care Provider Offices is intended to assist primary care providers and office managers with preparing their offices for quickly putting a plan in place to handle an increase in patient calls and visits, whether during the 2009-2010 influenza season or future influenza seasons.

  17. 40 CFR 310.4 - What abbreviations should I know?

    Science.gov (United States)

    2010-07-01

    ... RESPONSE TO HAZARDOUS SUBSTANCE RELEASES General Information § 310.4 What abbreviations should I know? The.... 11000-11050). LEPC—Local Emergency Planning Committee. NCP—National Oil and Hazardous Substances... Response Center. OMB—Office of Management and Budget. PRP—Potentially Responsible Party. SARA—The Superfund...

  18. Abbreviations and acronyms: the case of Tlhalosi ya

    African Journals Online (AJOL)

    user

    Abstract: This paper looks at how abbreviations and acronyms are treated in African language dictionaries in general compared to selected mainstream English dictionaries. Specifically, the study looks at their treatment in T.J. Otlogetswe's (2012) Tlhalosi ya Medi ya Setswana dictionary. Altogether, a survey of twenty ...

  19. Children's Text Messaging: Abbreviations, Input Methods and Links with Literacy

    Science.gov (United States)

    Kemp, N.; Bushnell, C.

    2011-01-01

    This study investigated the effects of mobile phone text-messaging method (predictive and multi-press) and experience (in texters and non-texters) on children's textism use and understanding. It also examined popular claims that the use of text-message abbreviations, or "textese" spelling, is associated with poor literacy skills. A sample of 86…

  20. Interactive Hangman Teaches Amino Acid Structures and Abbreviations

    Science.gov (United States)

    Pennington, Britney O.; Sears, Duane; Clegg, Dennis O.

    2014-01-01

    We developed an interactive exercise to teach students how to draw the structures of the 20 standard amino acids and to identify the one-letter abbreviations by modifying the familiar game of "Hangman." Amino acid structures were used to represent single letters throughout the game. To provide additional practice in identifying…

  1. 32 CFR 634.3 - Explanation of abbreviations and terms.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 4 2010-07-01 2010-07-01 true Explanation of abbreviations and terms. 634.3 Section 634.3 National Defense Department of Defense (Continued) DEPARTMENT OF THE ARMY (CONTINUED) LAW ENFORCEMENT AND CRIMINAL INVESTIGATIONS MOTOR VEHICLE TRAFFIC SUPERVISION Introduction § 634.3 Explanation of...

  2. Detecting unapproved abbreviations in the electronic medical record.

    Science.gov (United States)

    Capraro, Andrew; Stack, Anne; Harper, Marvin B; Kimia, Amir

    2012-04-01

    At an emergency department (ED) in a tertiary care children's hospital with a level 1 pediatric trauma designation, unapproved abbreviations (UAAs) within electronic medical records (EMRs) were identified, and feedback was provided to providers regarding their types and use rates. Existing EMRs, including the ED physicians' patient notes were used as templates to develop a UAA list and an abbreviation detector. The detector was validated against human-screened samples of electronic ED notes from 2003 and then applied to all existing data to generate baseline rates of UAA, before intervention/implementation. Next, the validated abbreviation detector was applied prospectively in screening all EMRs monthly during a six-month period. In validation, the abbreviation detector had a sensitivity of 89%, a specificity of 99.9%, and a positive predictive value of 89%. Some 475,613 EMRs were screened, with UAAs identified at a rate of 26.4 +/- 4 per 1,000 EMRs. The most common nonmedication UAA was "qd" [11.8/1,000 EMRs], and the most common medication UAA was "PCN" [4.2/1,000 EMRs]. A total of 27,282 patient notes from 74 physicians were screened between January 1, 2007, and June 30, 2007, and 392 monthly reports were generated. Aggregate UAA use decreased by 8% (95% confidence interval [CI]: 6%-14%) per month-from 19.3 to > 12.1/100 charts, for a 37.3% decrease in UAA use in the six-month period. The estimated monthly decrease per physician was 0.9/100 (95% CI: 0.86-0.94, p abbreviation detector for surveillance of newly created EMRs, followed by consistent education and feedback, led to a significant decrease in UAA use in the study period.

  3. Development of abbreviated measures to assess patient trust in a physician, a health insurer, and the medical profession

    Directory of Open Access Journals (Sweden)

    Trachtenberg Felicia

    2005-10-01

    Full Text Available Abstract Background Despite the recent proliferation in research on patient trust, it is seldom a primary outcome, and is often a peripheral area of interest. The length of our original scales to measure trust may limit their use because of the practical needs to minimize both respondent burden and research cost. The objective of this study was to develop three abbreviated scales to measure trust in: (1 a physician, (2 a health insurer, and (3 the medical profession. Methods Data from two samples were used. The first was a telephone survey of English-speaking adults in the United States (N = 1117 and the second was a telephone survey of English-speaking adults residing in North Carolina who were members of a health maintenance organization (N = 1024. Data were analyzed to examine data completeness, scaling assumptions, internal consistency properties, and factor structure. Results Abbreviated measures (5-items were developed for each of the three scales. Cronbach's alpha was 0.87 for trust in a physician (test-retest reliability = 0.71, 0.84 for trust in a health insurer (test-retest reliability = 0.73, and 0.77 for trust in the medical profession. Conclusion Assessment of data completeness, scale score dispersion characteristics, reliability and validity test results all provide evidence for the soundness of the abbreviated 5-item scales.

  4. The Basic Tenets of Invitational Theory and Practice: An Invitational Glossary

    Science.gov (United States)

    Shaw, Daniel E.; Siegel, Betty L.; Schoenlein, Allyson

    2013-01-01

    A review of the literature which concentrates on Invitational Theory and Practice (ITP) has revealed an inconsistent and oft times confusing or contradictory use of named concepts, labels, phrases, wordings, definitions, and other such titles of major ITP principles (Shaw and Siegel, 2010). Presented in a glossary type format, the purpose of this…

  5. Glosario de Tecnologia Educativa. Monografia No. 1 (Glossary of Educational Technology. Monograph No. 1).

    Science.gov (United States)

    Chadwick, Clifton; Rojas, Alicia Mabel

    This glossary offers definitions of almost 600 terms normally associated with the field of educational technology in brief and easy-to-understand form, all in Spanish (a Portugese version exists). The terms are organized into six major areas: learning, communications, instructional design, evaluation, media production, and systems theory. (Author)

  6. Terminology of Library and Information Science: A Selective Glossary. Preliminary Edition.

    Science.gov (United States)

    Hines, Theodore C.; Harris, Jessica L.

    The scope of this glossary is defined pragmatically and selectively on the basis of the needs of the students at the Columbia University School of Library Service. Most of the terms selected for inclusion are those found to require definition in the courses in information science and indexing. The focus is on those areas where the terminology…

  7. Stakeholder Confidence and Radioactive Waste management - An annotated glossary of key terms

    International Nuclear Information System (INIS)

    Martell, Meritxell; Pescatore, Claudio; Mays, Claire

    2013-01-01

    The OECD Nuclear Energy Agency (NEA) Forum on Stakeholder Confidence (FSC) Annotated Glossary is a review of concepts central to societal decision making about radioactive waste management. It records the evolution in understanding that has taken place in the group as the FSC has worked with these concepts over time. This should be a useful resource not only for new FSC participants but also for others: this annotated glossary forms a good reference handbook for future texts regarding societal aspects of radioactive waste management and its governance. Each glossary entry is structured, to the extent possible, as follows: - The term and its variants, if any, in FSC literature are identified. - The common FSC understanding of the concept and any guidance are captured, based upon a review of all FSC documents to date. - Any evolution of the concept observed over the decade of FSC work is analysed. - The FSC interpretation of the symbolic dimension is explored. - The current status of outlook in the FSC, and intended activities according to the current Programme of Work (2010 and beyond) are assessed. Overall, although different persons and groups may assign different meanings to words, and although terminology will continue to evolve, this glossary is the FSC's 'state-of-the-art' guide to key terms in use. As such, it should prove to be a handy reference for all those interested in the governance of radioactive waste management

  8. Glossary of CERCLA, RCRA and TSCA related terms and acronyms. Environmental Guidance

    Energy Technology Data Exchange (ETDEWEB)

    1993-10-01

    This glossary contains CERCLA, RCRA and TSCA related terms that are most often encountered in the US Department of Energy (DOE) Environmental Restoration and Emergency Preparedness activities. Detailed definitions are included for key terms. The CERCLA definitions included in this glossary are taken from the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA), as amended and related federal rulemakings. The RCRA definitions included in this glossary are taken from the Resource Conservation and Recovery Act (RCRA) and related federal rulemakings. The TSCA definitions included in this glossary are taken from the Toxic Substances and Control Act (TSCA) and related federal rulemakings. Definitions related to TSCA are limited to those sections in the statute and regulations concerning PCBs and asbestos.Other sources for definitions include additional federal rulemakings, assorted guidance documents prepared by the US Environmental Protection Agency (EPA), guidance and informational documents prepared by the US Department of Energy (DOE), and DOE Orders. The source of each term is noted beside the term. Terms presented in this document reflect revised and new definitions published before July 1, 1993.

  9. Subject Area Glossary: Greek-English Vocabulary. Curriculum Bulletin Number 14.

    Science.gov (United States)

    Chicago Board of Education, IL. Dept. of Curriculum.

    A glossary of Greek counterparts for terms used in the Chicago public schools' curricula is intended to be used by teachers of native Greek-speaking, limited-English speaking students. An introductory section outlines Greek phonology and pronunciation, and ensuing sections provide English vocabulary lists with both the Greek orthography and…

  10. Solar Energy Education. Home economics: teacher's guide. Field test edition. [Includes glossary

    Energy Technology Data Exchange (ETDEWEB)

    1981-06-01

    An instructional aid is provided for home economics teachers who wish to integrate the subject of solar energy into their classroom activities. This teacher's guide was produced along with the student activities book for home economics by the US Department of Energy Solar Energy Education. A glossary of solar energy terms is included. (BCS)

  11. IDC Re-Engineering Phase 2 Glossary Version 1.3

    Energy Technology Data Exchange (ETDEWEB)

    Young, Christopher J. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Harris, James M. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-01-01

    This document contains the glossary of terms used for the IDC Re-Engineering Phase 2 project. This version was created for Iteration E3. The IDC applies automatic processing methods in order to produce, archive, and distribute standard IDC products on behalf of all States Parties.

  12. Glossary of Mongolian Technical Terms. Program in Oriental Languages. Publications Series B--Aids--Number 13.

    Science.gov (United States)

    Buck, Frederick H.

    This glossary of Mongolian technical terms includes approximately 4,500 entries, covering such areas as political administration, economics, science, railways, stockfarming, agriculture, medicine, foreign affairs, military matters and miscellaneous items. A number of colloquial expressions are included, since they occur quite frequently and appear…

  13. Glossary of terms used in the disposal of high-level wastes: Salt Repository Project

    International Nuclear Information System (INIS)

    1987-02-01

    This glossary provides definitions of words and phrases specific to, or used in a special way in, documents of the US Department of Energy's Civilian Radioactive Waste Management Program. In many cases, two or more definitions of a word or phrase are given. Sources are provided for all definitions. 33 refs

  14. Interactive Hangman teaches amino acid structures and abbreviations

    OpenAIRE

    Pennington, BO; Sears, D; Clegg, DO

    2014-01-01

    © 2014 by The International Union of Biochemistry and Molecular Biology, 42(6):495-500, 2014. We developed an interactive exercise to teach students how to draw the structures of the 20 standard amino acids and to identify the one-letter abbreviations by modifying the familiar game of "Hangman." Amino acid structures were used to represent single letters throughout the game. To provide additional practice in identifying structures, hints to the answers were written in "amino acid sentences" f...

  15. Abbreviated RD and D program portfolio selection workbook

    Energy Technology Data Exchange (ETDEWEB)

    Boyd, D.W.; Cohan, D.; Regulinski, S.G.

    1979-12-01

    A workbook for implementing an abbreviated version of the RD and D portfolio selection methodology described in A Resource Allocation Methodology for Establishing RD and D Budgetary Priorities is presented. The purpose of the abbreviated methodology is to allow a fast, first-cut analysis of a set of programs and to provide a means of discovering important issues that deserve more detailed analysis. The use of the abbreviated methodology in the overall process of evaluating RD and D programs is outlined. The effect of the program on a process is represented by the process model. Those process cost and performance characteristics that are important to the market for an energy product are described. The product cost model takes the cost and performance characteristics and the feedstock price and calculates the cost of producing a unit of energy using the technology in question. The market model takes this cost, the demand for the energy product, and the characteristics of alternative sources of the same product, and specifies the market share captured by the new technology. From this point it is relatively straightforward to infer the impacts of the new technology on the energy system. The benefit model evaluates the impacts in a consistent way, given the cost of the Federal support.

  16. Diversity of eukaryotic microorganisms: computer-based resources, "The Handbook of Protoctista" and its "Glossary"

    Science.gov (United States)

    Margulis, L.; Olendzenski, L.; Dolan, M.; MacIntyre, F.

    1996-01-01

    The kingdom Protoctista comprises some 30 phyla, including the eukaryotic anaerobes that permanently lack mitochondria, the Phylum Archaeprotista, with its three classes: (i) Archamoebae, e.g., Pelomyxa, Mastigina, (ii) Metamonada, e.g., Giardia, Pyrsonympha, and (iii) Parabasalia, e.g., Trichomonas, Calonympha, and the Phylum Microspora (Microsporidia), e.g., Vairimorpha. These and all algae, protozoa, labyrinthulids, "water molds" (oomycota, plasmodiophorans, hyphochytrids, chytrids, etc.) and other eukaryotes excluded from plants, animals and fungi are detailed in the Handbook of Protoctista. The Illustrated Glossary of Protoctista contains descriptions of the morphology and taxonomy of these microorganisms, including the many equivalent and homologous structures with different names. The Glossary has also been made into a Macintosh-compatible CD-ROM disk.

  17. [Anglo-russian terminological glossary for freestyle skiing, alpine skiing, snowboard and ski jumping

    OpenAIRE

    2014-01-01

    Ce glossaire contient les traductions des mots les plus utiles en russe et en anglais pour les sports du ski acrobatique, ski alpin, snowboard et saut à ski dans le contexte des Jeux Olympiques et Paralympiques d'hiver à Sochi 2014. This glossary contains translations of the most useful words in Russian and English for the sports of freestyle skiing, alpine skiing, snowboard and ski jumping within the context of the 2014 Olympic Winter Games and Paralympic Winter Games in Sochi.

  18. PROPOSAL FOR A BILINGUAL GLOSSARY - PORTUGUESE/SPANISH - FOR MEDICAL CARE TO IMMIGRANT

    OpenAIRE

    Marta Ingrith Molina Cabrera

    2016-01-01

    The pain is a multidimensional and subjective experience, so we reflect on the importance of communicating it in a medical consultation, in multicultural immigration contexts. Therefore, it becomes necessary the development of language tools that enable narrate the subjective experience of pain and evaluate it.Considering this demand, we propose a glossary with the Portuguese-Spanish pair for the purpose of offering a tool that helps doctors, immigrants and refugees when they need to communic...

  19. New bilingual version of the VGB abbreviation catalogue for power plant technology released

    Energy Technology Data Exchange (ETDEWEB)

    Hantschel, Jochen; Seiffert, Joerg [E.ON New Build and Technology GmbH, Gelsenkirchen (Germany); Froehner, Joerg [ct.e Controltechnology Engineering GmbH, Herne (Germany)

    2013-04-01

    The objective of the VGB Standard for power plant technology VGB-S-891-00 (abbreviation catalogue) is to regulate the systematic creation of abbreviations. The determination of abbreviations for terms related to power plants provides a common basis for planners, erectors, and operators of power plants and their systems. In combination with VGB-B 108 ''Rules for the creation of denominations and their application for power plant engineering'' the abbreviation catalogue is the basis for the creation of denominations.

  20. [Abbreviations of special terms for presentation/paper titles in magnetic resonance study].

    Science.gov (United States)

    Komi, Masanori; Shiraishi, Junji

    2013-08-01

    A large number of abbreviations have been created for various special terms, and used in magnetic resonance (MR) study. However, the use of these abbreviations in the paper title has been restricted by the majority of societies and journals. In this study, we investigated the use of various abbreviations for special terms in MR study in order to clarify which abbreviation could be used in the paper title without spelling. We used two journals, Magnetic Resonance in Medicine (MRM) and Journal of Magnetic Resonance Imaging (JMRI) published by the International Society for Magnetic Resonance in Medicine (ISMRM), which has been considered to be the most advanced society for MR study in the world, as the reference standard for use of the abbreviations. Except for some basic abbreviations and specific abbreviations that were used on a long-term basis, the majority of abbreviations were used in the paper title with its full spelling in order to ensure generality. It is preferable that abbreviations not be used in the title of the or title of the paper.

  1. Proposed entry of organization in bilingual glossaries terminology - sign language and brazilian portuguese language

    Directory of Open Access Journals (Sweden)

    Patricia Tuxi

    2015-10-01

    Full Text Available This work, which is inserted in the research line of Translation and Terminology, presented as an object of study the basic terms used in political and educational discourses that permeate national conference events. In respect to the Law 10436/2002 and Decree 5626/2005 is right for the Deaf have access to information in Brazilian Sign Language - Libras. One way to ensure this right is the presence of translator and interpreter to act in areas with specialized subjects should retain the knowledge of the specific terminology used in different contexts. The current study is based on the methodology for the preparation of dictionaries and glossaries Faulstich (1995. The research follows the approach of Socioterminology and as following: i recognition and identification of the target audience; ii delimitation of the surveyed area; iii collection and organization of data; iv organization glossary and validity test. The search result is the presentation of a proposal for entry of organizing a Terminology Glossary Bilingual facing the conference area that can serve as a reference source and training of translators and interpreters who work in the national conference events.

  2. 14 CFR 221.200 - Content and explanation of abbreviations, reference marks and symbols.

    Science.gov (United States)

    2010-01-01

    ..., reference marks and symbols. 221.200 Section 221.200 Aeronautics and Space OFFICE OF THE SECRETARY... § 221.200 Content and explanation of abbreviations, reference marks and symbols. (a) Content. The format..., reference marks and symbols. Abbreviations, reference marks and symbols which are used in the tariff shall...

  3. 16 CFR 303.5 - Abbreviations, ditto marks, and asterisks prohibited.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Abbreviations, ditto marks, and asterisks... Abbreviations, ditto marks, and asterisks prohibited. (a) In disclosing required information, words or terms shall not be designated by ditto marks or appear in footnotes referred to by asterisks or other symbols...

  4. List of abbreviations for currently valid generic-level taxa in family Culicidae (Diptera).

    Science.gov (United States)

    A list of two letter abbreviations for all genera and three letter abbreviations for all subgenera of mosquitoes (family Culicidae, order Diptera) is given. This information on generic-level taxa of mosquitoes is useful in reducing printed space in publications, tables and lists. The work was comp...

  5. Automatic Word Sense Disambiguation of Acronyms and Abbreviations in Clinical Texts

    Science.gov (United States)

    Moon, Sungrim

    2012-01-01

    The use of acronyms and abbreviations is increasing profoundly in the clinical domain in large part due to the greater adoption of electronic health record (EHR) systems and increased electronic documentation within healthcare. A single acronym or abbreviation may have multiple different meanings or senses. Comprehending the proper meaning of an…

  6. Use of abbreviations in the nursing records of a teaching hospital

    Directory of Open Access Journals (Sweden)

    Sylvia Miranda Carneiro

    2016-05-01

    Full Text Available Objective: to evaluate the use of abbreviations in nursing records of a teaching hospital and describing their profile in different sectors, work shifts and professional nursing categories. Methods: documentary study that analyzed 627 nursing records in 24 patient charts using a systematic observation script. Results: we identified 1,792 abbreviations, and 35.8% were nonstandard. The incidence of abbreviations was higher in the Intensive Care Unit, used by nurses and in the night shift. Conclusion: abbreviations are part of the day-to-day of nursing records. The use of nonstandard abbreviations make difficult to understand the note content, can generate misinterpretations, put at risk the users’ safety and impair the continuity of labor work.

  7. International nuclear fuel cycle fact book. [Contains glossary

    Energy Technology Data Exchange (ETDEWEB)

    Leigh, I.W.; Lakey, L.T.; Schneider, K.J.; Silviera, D.J.

    1987-01-01

    As the US Department of Energy (DOE) and DOE contractors have become increasingly involved with other nations in nuclear fuel cycle and waste management cooperative activities, a need has developed for a ready source of information concerning foreign fuel cycle programs, facilities, and personnel. This Fact Book was compiled to meet that need. The information contained has been obtained from nuclear trade journals and newsletters; reports of foreign visits and visitors; CEC, IAEA, and OECD/NEA activities reports; proceedings of conferences and workshops; and so forth. Sources do not agree completely with each other, and the data listed herein does not reflect any one single source but frequently is a consolidation/combination of information. Lack of space as well as the intent and purpose of the Fact Book limit the given information to that pertaining to the Nuclear Fuel Cycle and to data considered of primary interest or most helpful to the majority of users.

  8. Allie: a database and a search service of abbreviations and long forms.

    Science.gov (United States)

    Yamamoto, Yasunori; Yamaguchi, Atsuko; Bono, Hidemasa; Takagi, Toshihisa

    2011-01-01

    Many abbreviations are used in the literature especially in the life sciences, and polysemous abbreviations appear frequently, making it difficult to read and understand scientific papers that are outside of a reader's expertise. Thus, we have developed Allie, a database and a search service of abbreviations and their long forms (a.k.a. full forms or definitions). Allie searches for abbreviations and their corresponding long forms in a database that we have generated based on all titles and abstracts in MEDLINE. When a user query matches an abbreviation, Allie returns all potential long forms of the query along with their bibliographic data (i.e. title and publication year). In addition, for each candidate, co-occurring abbreviations and a research field in which it frequently appears in the MEDLINE data are displayed. This function helps users learn about the context in which an abbreviation appears. To deal with synonymous long forms, we use a dictionary called GENA that contains domain-specific terms such as gene, protein or disease names along with their synonymic information. Conceptually identical domain-specific terms are regarded as one term, and then conceptually identical abbreviation-long form pairs are grouped taking into account their appearance in MEDLINE. To keep up with new abbreviations that are continuously introduced, Allie has an automatic update system. In addition, the database of abbreviations and their long forms with their corresponding PubMed IDs is constructed and updated weekly. Database URL: The Allie service is available at http://allie.dbcls.jp/.

  9. Frequency, comprehension and attitudes of physicians towards abbreviations in the medical record.

    Science.gov (United States)

    Hamiel, Uri; Hecht, Idan; Nemet, Achia; Pe'er, Liron; Man, Vitaly; Hilely, Assaf; Achiron, Asaf

    2018-03-14

    Abbreviations are common in the medical record. Their inappropriate use may ultimately lead to patient harm, yet little is known regarding the extent of their use and their comprehension. Our aim was to assess the extent of their use, their comprehension and physicians' attitudes towards them, using ophthalmology consults in a tertiary hospital as a model. We first mapped the frequency with which English abbreviations were used in the departments' computerised databases. We then used the most frequently used abbreviations as part of a cross-sectional survey designed to assess the attitudes of non-ophthalmologist physicians towards the abbreviations and their comprehension of them. Finally, we tested whether an online lecture would improve comprehension. 4375 records were screened, and 235 physicians responded to the survey. Only 42.5% knew at least 10% of the abbreviations, and no one knew them all. Ninety-two per cent of respondents admitted to searching online for the meanings of abbreviations, and 59.1% believe abbreviations should be prohibited in medical records. A short online lecture improved the number of respondents answering correctly at least 50% of the time from 1.2% to 42% (PAbbreviations are common in medical records and are frequently misinterpreted. Online teaching is a valuable tool for physician education. The majority of respondents believed that misinterpreting abbreviations could negatively impact patient care, and that the use of abbreviations should be prohibited in medical records. Due to low rates of comprehension and negative attitudes towards abbreviations in medical communications, we believe their use should be discouraged. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  10. Allie: a database and a search service of abbreviations and long forms

    Science.gov (United States)

    Yamamoto, Yasunori; Yamaguchi, Atsuko; Bono, Hidemasa; Takagi, Toshihisa

    2011-01-01

    Many abbreviations are used in the literature especially in the life sciences, and polysemous abbreviations appear frequently, making it difficult to read and understand scientific papers that are outside of a reader’s expertise. Thus, we have developed Allie, a database and a search service of abbreviations and their long forms (a.k.a. full forms or definitions). Allie searches for abbreviations and their corresponding long forms in a database that we have generated based on all titles and abstracts in MEDLINE. When a user query matches an abbreviation, Allie returns all potential long forms of the query along with their bibliographic data (i.e. title and publication year). In addition, for each candidate, co-occurring abbreviations and a research field in which it frequently appears in the MEDLINE data are displayed. This function helps users learn about the context in which an abbreviation appears. To deal with synonymous long forms, we use a dictionary called GENA that contains domain-specific terms such as gene, protein or disease names along with their synonymic information. Conceptually identical domain-specific terms are regarded as one term, and then conceptually identical abbreviation-long form pairs are grouped taking into account their appearance in MEDLINE. To keep up with new abbreviations that are continuously introduced, Allie has an automatic update system. In addition, the database of abbreviations and their long forms with their corresponding PubMed IDs is constructed and updated weekly. Database URL: The Allie service is available at http://allie.dbcls.jp/. PMID:21498548

  11. New method for abbreviating the fault tree graphical representation

    International Nuclear Information System (INIS)

    Stewart, M.E.; Fussell, J.B.; Crump, R.J.

    1974-12-01

    Fault tree analysis is being widely used for reliability and safety analysis of systems encountered in the nuclear industry and elsewhere. A disadvantage of the fault tree method is the voluminous fault tree graphical representation that conventionally results from analysis of a complex system. Previous methods for shortening the fault tree graphical representation include (1) transfers within the fault tree, and (2) the use of the SAMPLE (K out of N logic) gate, the MATRIX gate, and the SUMMATION gate. The purpose of this presentation is to introduce TABULATION gates as a method to abbreviate the fault tree graphical representation. These new gates reduce the cost of analysis and generally increase the system behavior visibility that is inherent in the fault tree technique

  12. Enhancing acronym/abbreviation knowledge bases with semantic information.

    Science.gov (United States)

    Torii, Manabu; Liu, Hongfang

    2007-10-11

    In the biomedical domain, a terminology knowledge base that associates acronyms/abbreviations (denoted as SFs) with the definitions (denoted as LFs) is highly needed. For the construction such terminology knowledge base, we investigate the feasibility to build a system automatically assigning semantic categories to LFs extracted from text. Given a collection of pairs (SF,LF) derived from text, we i) assess the coverage of LFs and pairs (SF,LF) in the UMLS and justify the need of a semantic category assignment system; and ii) automatically derive name phrases annotated with semantic category and construct a system using machine learning. Utilizing ADAM, an existing collection of (SF,LF) pairs extracted from MEDLINE, our system achieved an f-measure of 87% when assigning eight UMLS-based semantic groups to LFs. The system has been incorporated into a web interface which integrates SF knowledge from multiple SF knowledge bases. Web site: http://gauss.dbb.georgetown.edu/liblab/SFThesurus.

  13. Dictionary of International Abbreviations - Environment and Natural Sciences

    International Nuclear Information System (INIS)

    2003-01-01

    The dictionary comprises about 3000 acronyms and abbreviations, with explanations in German and English. Subjects: Chemistry, medicine, geology, air, water, soil, waste, air pollution and noise abatement, chemicals and pollutants, agriculture and food, conservation and landscaping, energy, immission protection, radiation protection and nuclear safety, industry and biotechnology, environmental pollution, waste management and recycling. It is intended as a working and communication tool for a wide range of users in industry, administration, universities, scientists and students, journalists, translators and interested laymen. There is an appendix with supplementary information, i.e. mass, volume, SI units, chemical compounds and formulas, occupational pollutant exposure, food additives, environmental disasters, environmental laws, regulations and specifications, international programmes and organisations for environmental protection, and guidelines of environmental and international law. (orig.) [de

  14. A study on the use of abbreviations among doctors and nurses in the medical department of a tertiary hospital in Malaysia.

    Science.gov (United States)

    Koh, K C; Lau, K M; Yusof, S A M; Mohamad, A I; Shahabuddin, F S A; Ahmat, N H; Teh, P C

    2015-12-01

    Misinterpretation of abbreviations by healthcare professionals has been reported to compromise patient safety. This study was done to determine the prevalence of abbreviations usage among medical doctors and nurses and their ability to interpret commonly used abbreviations in medical practice. Seventy-seven medical doctors and eighty nurses answered a self-administered questionnaire designed to capture demographic data and information regarding abbreviation use in medical practice. Comparisons were made between doctors and nurses with regards to frequency and reasons for using abbreviations; from where abbreviations were learned; frequency of encountering abbreviations in medical practice; prevalence of medical errors due to misinterpretation of abbreviations; and their ability to correctly interpret commonly used abbreviations. The use of abbreviations was highly prevalent among doctors and nurses. Time saving, avoidance of writing sentences in full and convenience, were the main reasons for using abbreviations. Doctors learned abbreviations from fellow doctors while nurses learned from fellow nurses and doctors. More doctors than nurses reported encountering abbreviations. Both groups reported no difficulties in interpreting abbreviations although nurses reported often resorting to guesswork. Both groups felt abbreviations were necessary and an acceptable part of work. Doctors outperformed nurses in correctly interpreting commonly used standard and non-standard abbreviations. The use of standard and non-standard abbreviation in clinical practice by doctors and nurses was highly prevalent. Significant variability in interpretation of abbreviations exists between doctors and nurses.

  15. Pharmacist and Physician Interpretation of Abbreviations for Acetaminophen Intended for Use in a Consumer Icon

    Directory of Open Access Journals (Sweden)

    Saul Shiffman

    2015-10-01

    Full Text Available Concomitant use of multiple acetaminophen medications is associated with overdose. To help patients identify acetaminophen medications and thus avoid concomitant use, an icon with an abbreviation for “acetaminophen” has been proposed for all acetaminophen medications. This study assessed pharmacists’ and physicians’ use and interpretation of abbreviations for “acetaminophen”, to identify abbreviations with other meanings that might cause confusion. Physicians (n = 150 reported use and interpretation of candidate abbreviations Ac and Acm. Pharmacists (n = 150 interpretations of prescription orders using the candidate abbreviations APAP, Ac, Ace and Acm in typed, handwritten or spoken form, were judged for critical confusions likely to cause patient harm. Critical confusion was rare, except for omission by pharmacists of the acetaminophen dose for Hydrocodone/APAP prescriptions (10%. Ac was in common use to indicate “before meals”, and was interpreted as such, but some physicians (8% said they use Ac to indicate anticoagulant drugs. Most pharmacists (54% interpreted Ace as acetaminophen, and none interpreted it as referring to ACE-inhibitors. Acm was rarely used in prescriptions, had no common interfering meanings, and was often (63% interpreted as acetaminophen, especially when prescribed in combination with an opiate (85%. The data validated concerns about abbreviations in prescribing: all abbreviations resulted in some misinterpretations. However, Acm was rarely misinterpreted, was readily associated with “acetaminophen”, and seemed appropriate for use in a graphic icon to help consumers/patients identify acetaminophen medications.

  16. Glossary of Terms. Preservation of Records, Knowledge and Memory (RK and M) Across Generations. Draft - Definitions as of 3 March 2014

    International Nuclear Information System (INIS)

    2014-01-01

    The RK and M glossary defines important concepts and terms that are commonly used. It is under continuous development by the project team and represents a peer-reviewed set of terms. It should be pointed out that some terms may be defined differently from other glossaries in science and technology. The RK and M glossary, however, fits the purpose of achieving a better understanding and more efficient communication of RK and M issues. The aim of the RK and M glossary is to compile a dedicated, internally consistent, and unambiguous set of definitions. Each definition should not be seen in isolation, but as complementary to the definition of other terms in the glossary

  17. A sense inventory for clinical abbreviations and acronyms created using clinical notes and medical dictionary resources.

    Science.gov (United States)

    Moon, Sungrim; Pakhomov, Serguei; Liu, Nathan; Ryan, James O; Melton, Genevieve B

    2014-01-01

    To create a sense inventory of abbreviations and acronyms from clinical texts. The most frequently occurring abbreviations and acronyms from 352,267 dictated clinical notes were used to create a clinical sense inventory. Senses of each abbreviation and acronym were manually annotated from 500 random instances and lexically matched with long forms within the Unified Medical Language System (UMLS V.2011AB), Another Database of Abbreviations in Medline (ADAM), and Stedman's Dictionary, Medical Abbreviations, Acronyms & Symbols, 4th edition (Stedman's). Redundant long forms were merged after they were lexically normalized using Lexical Variant Generation (LVG). The clinical sense inventory was found to have skewed sense distributions, practice-specific senses, and incorrect uses. Of 440 abbreviations and acronyms analyzed in this study, 949 long forms were identified in clinical notes. This set was mapped to 17,359, 5233, and 4879 long forms in UMLS, ADAM, and Stedman's, respectively. After merging long forms, only 2.3% matched across all medical resources. The UMLS, ADAM, and Stedman's covered 5.7%, 8.4%, and 11% of the merged clinical long forms, respectively. The sense inventory of clinical abbreviations and acronyms and anonymized datasets generated from this study are available for public use at http://www.bmhi.umn.edu/ihi/research/nlpie/resources/index.htm ('Sense Inventories', website). Clinical sense inventories of abbreviations and acronyms created using clinical notes and medical dictionary resources demonstrate challenges with term coverage and resource integration. Further work is needed to help with standardizing abbreviations and acronyms in clinical care and biomedicine to facilitate automated processes such as text-mining and information extraction.

  18. Abbreviated mindfulness intervention for job satisfaction, quality of life, and compassion in primary care clinicians: a pilot study.

    Science.gov (United States)

    Fortney, Luke; Luchterhand, Charlene; Zakletskaia, Larissa; Zgierska, Aleksandra; Rakel, David

    2013-01-01

    Burnout, attrition, and low work satisfaction of primary care physicians are growing concerns and can have a negative influence on health care. Interventions for clinicians that improve work-life balance are few and poorly understood. We undertook this study as a first step in investigating whether an abbreviated mindfulness intervention could increase job satisfaction, quality of life, and compassion among primary care clinicians. A total of 30 primary care clinicians participated in an abbreviated mindfulness course. We used a single-sample, pre-post design. At 4 points in time (baseline, and 1 day, 8 weeks, and 9 months postintervention), participants completed a set of online measures assessing burnout, anxiety, stress, resilience, and compassion. We used a linear mixed-effects model analysis to assess changes in outcome measures. Participants had improvements compared with baseline at all 3 follow-up time points. At 9 months postintervention, they had significantly better scores (1) on all Maslach Burnout Inventory burnout subscales-Emotional Exhaustion (P =.009), Depersonalization (P = .005), and Personal Accomplishment (P primary care clinicians was associated with reductions in indicators of job burnout, depression, anxiety, and stress. Modified mindfulness training may be a time-efficient tool to help support clinician health and well-being, which may have implications for patient care.

  19. Arthritis Glossary

    Science.gov (United States)

    ... dividing weight (in kilograms squared) by height (in meters squared). Bouchard’s nodes Knobby bone growths that may ... efficacy  A person’s belief that with self-management, smart behaviors and actions, one can improve one’s symptoms ...

  20. NIDCD Glossary

    Science.gov (United States)

    ... the sense of taste. Albinism - lack of normal pigment in the skin, eyes, and hair. Alport Syndrome - ... throat) that is the primary organ of voice production. Learning Disabilities - childhood disorders characterized by difficulty with ...

  1. Methamphetamine: Glossary

    Science.gov (United States)

    ... Adolescent Brain Comorbidity College-Age & Young Adults Criminal Justice Drugged Driving Drug Testing Drugs and the Brain ... series reports on research findings of national interest. View all ​Research Reports Lesson Plan and Activity Finder ...

  2. Hematology Glossary

    Science.gov (United States)

    ... small organs throughout the body that play a role in the immune system by filtering out foreign particles, such as viruses ... type of white blood cell that plays a role in the immune system; there are two main populations of these cells: ...

  3. Alzheimer's: Glossary

    Science.gov (United States)

    ... Stress Caregiver Depression Relationship Changes Grief & Loss as Alzheimer's Progresses Start Here What You Need to Know ... Weekly E-News Stay up-to-date on Alzheimer's treatments and care. First name: Last name: Email: * ...

  4. Avoiding Potential Medication Errors Associated with Non-intuitive Medication Abbreviations.

    Science.gov (United States)

    Shultz, Jonas; Strosher, Lisa; Nathoo, Shaheen Nenshi; Manley, Jim

    2011-07-01

    Pharmaceutical companies use a variety of abbreviations to denote short- and long-acting medications. Errors involving the administration of these medications are frequently reported. To evaluate comprehension rates for abbreviations used to denote short- and long-acting medications and to evaluate whether changes to medication labels could reduce potential errors in the selection and administration of medications. In phase 1 of the study, nursing staff were asked to define 4 abbreviations and then to categorize them by release rate. In phase 2, a simulation exercise, nursing staff were asked if it would be appropriate to administer a medication illustrated in a photograph (oxycodone CR 5-mg blister pack) on the basis of information highlighted in a screen shot of an electronic medication administration record (order for oxycodone 5 mg). Three different presentations were used to identify the medication in the medication administration record and on the drug label. In phase 1, 10 (28%) of 36 nursing staff members knew what all 4 abbreviations meant, and 14 (39%) correctly classified all 4 abbreviations as indicating a short- or a long-acting medication. In the simulation exercise (phase 2), labelling changes reduced the likelihood of a potential medication administration error. Most abbreviations used to indicate short- versus long-acting medications were not correctly understood by study participants. Of more concern was the incorrect interpretation of some abbreviations as indicating the opposite release rate (e.g., "ER" interpreted as meaning "emergency release", rather than "extended release", with incorrect classification as a short-acting medication). This evaluation highlighted the potential consequences of using non-intuitive abbreviations to differentiate high-risk medications having different release rates.

  5. The effectiveness of a 'Do Not Use' list and perceptions of healthcare professionals on error-prone abbreviations.

    Science.gov (United States)

    Samaranayake, Nithushi R; Cheung, Dixon S T; Lam, May P S; Cheung, Tommy T; Chui, William C M; Wong, Ian C K; Cheung, Bernard M Y

    2014-10-01

    The use of error-prone abbreviations has led to medication errors. Many safety organisations have introduced 'Do Not Use' lists (lists of error-prone abbreviations that should be avoided by prescribers), but the effectiveness of these lists have not been studied. We assessed the effectiveness of the 'Do Not Use' list introduced to the study hospital, and sought the attitudes of healthcare professionals on other potentially dangerous abbreviations (not included in the 'Do Not Use' list) used in prescriptions. The study was conducted in a university affiliated tertiary hospital in Hong Kong. An uncontrolled observational study was conducted. In-patient prescriptions were reviewed to assess the use of error-prone abbreviations included in the 'Do Not Use' list before, after its introduction, and following the first reinforcement. An on-line survey was also conducted among prescribers, pharmacists and nurses. Rate of using error-prone abbreviations and other unapproved abbreviations among reviewed prescriptions. 3,238 prescriptions (23,398 drug items) were reviewed. The use of abbreviations in the 'Do Not Use' list decreased from 7.8 to 3.3 % after its introduction (P abbreviations were used to denote prescribing instructions in 19.2 % of the drugs prescribed. 49 different types of unapproved abbreviations were used for drug names. A 'Do Not Use' list is effective in reducing error-prone abbreviations. Reinforcements of the 'Do Not Use' list further improves prescriber adherence. However, many other unapproved abbreviations (not included in current 'Do Not Use' lists) are used when prescribing. Periodic reminders on error-prone abbreviations and education of prescribers on associated risks may help to reduce the use of error-prone abbreviations in hospitals.

  6. Active Negative Pressure Peritoneal Therapy After Abbreviated Laparotomy

    Science.gov (United States)

    Roberts, Derek J.; Faris, Peter D.; Ball, Chad G.; Kubes, Paul; Tiruta, Corina; Xiao, Zhengwen; Holodinsky, Jessalyn K.; McBeth, Paul B.; Doig, Christopher J.; Jenne, Craig N.

    2015-01-01

    Objective: To determine whether active negative pressure peritoneal therapy with the ABThera temporary abdominal closure device reduces systemic inflammation after abbreviated laparotomy. Background: Excessive systemic inflammation after abdominal injury or intra-abdominal sepsis is associated with poor outcomes. Methods: We conducted a single-center, randomized controlled trial. Forty-five adults with abdominal injury (46.7%) or intra-abdominal sepsis (52.3%) were randomly allocated to the ABThera (n = 23) or Barker's vacuum pack (n = 22). On study days 1, 2, 3, 7, and 28, blood and peritoneal fluid were collected. The primary endpoint was the difference in the plasma concentration of interleukin-6 (IL-6) 24 and 48 hours after temporary abdominal closure application. Results: There was a significantly lower peritoneal fluid drainage from the ABThera at 48 hours after randomization. Despite this, there was no difference in plasma concentration of IL-6 at baseline versus 24 (P = 0.52) or 48 hours (P = 0.82) between the groups. There was also no significant intergroup difference in the plasma concentrations of IL-1β, −8, −10, or −12 p70 or tumor necrosis factor α between these time points. The cumulative incidence of primary fascial closure at 90 days was similar between groups (hazard ratio, 1.6; 95% confidence interval, 0.82–3.0; P = 0.17). However, 90-day mortality was improved in the ABThera group (hazard ratio, 0.32; 95% confidence interval, 0.11–0.93; P = 0.04). Conclusions: This trial observed a survival difference between patients randomized to the ABThera versus Barker's vacuum pack that did not seem to be mediated by an improvement in peritoneal fluid drainage, fascial closure rates, or markers of systemic inflammation. Trial Registration: ClinicalTrials.gov identifier NCT01355094. PMID:25536308

  7. [Understanding new progress in prosthodontics from the perspective of updates in the glossary of prosthodontic terms].

    Science.gov (United States)

    Jiang, T

    2017-12-09

    Glossary of Prosthodontic Terms is a standardized vocabulary with international influence. Its ninth edition was published in J Prosthet Dent in 2017, 12 years after the last edition. During this period, great development has taken place in the dental prosthetics due to dental implant and digital dentistry as well as application of new materials and technologies. The research results of dental adhesion, aesthetic dentistry, orofacial function, and tissue regeneration has been fully applied in dental clinic. This paper attempts to capture and accurately understand the changes of some important, especially controversial academic concepts through the comparison of the seventh, eighth and ninth edition of vocabulary. Four parts including new terms, obsolete terms, terms with updated concept, and terms with the continuity of concept are used to show the important progress of prosthodontics.

  8. OCRWM [Office of Civilian Radioactive Waste Management] transportation program reference: Glossary, acronym list, bibliography

    International Nuclear Information System (INIS)

    1988-07-01

    A successful transportation system for nuclear waste must be safe, efficient, and widely acceptable. To achieve the necessary public understanding, there must be an exchange of information and an identification of issues. This booklet has been developed to assist in that exchange of information and help in the communication of issues. It will provide a glossary of commonly used terms, a list of acronyms, a bibliography selected from the public information developed by the OCRWM Program, and contacts for additional information. Transportation is an integral and essential part of the projected waste management system. The United States has a long history of transporting radioactive material. Commercial spent fuel has been shipped for over 20 years and high-level waste from defense activities for an even longer period. These shipments have been conducted without any accidents causing death or environmental damage because of the radiological nature of the cargo. DOE is taking measures to ensure that this safety record continues. 24 refs

  9. Available Methods in Farsi-English Cross Language Information Retrieval Using Machine-readable, Bilingual Glossary

    Directory of Open Access Journals (Sweden)

    Hamid Alizadeh

    2009-12-01

    Full Text Available In this paper the impact scope of Natural Language Processing (NLP on translating search statements was determined by testing out research hypotheses. The NLP techniques employed for search statement processing included text parsing, linguistic forms identification, stopword removal, morphological analysis, and tokenization. Examination of the hypotheses indicated that using the method of translating the first equivalent term selected versus the method of selecting all equivalent terms, would contribute to increased efficiency of the review that while morphological analysis of the terms not translated by the glossary, would increase the retrieval precision cutoff, there would be no significant difference established by the lack of such analysis thereof that sentence translation as opposed to term by term translation, would increase the efficiency of Farsi-English proofreading. Other findings are also represented.

  10. Glossary of terms for career guidance through the use of ICT

    Directory of Open Access Journals (Sweden)

    Maidilis Beltrán-Moret

    2016-11-01

    Full Text Available The process of Formation of the Medical Sciences Professionals requires a constant improvement for the fulfilment of the purposes demanded by the current society in the Cuban University. The scanty mastery of the terms and concept on Medical Information Technology Discipline for the realisation of research and teaching activities has been one of the main difficulties shown by the students at the School of Medicine No. 2. This glossary is a supporting teaching material intended to first and second year students of Medicine and it is shaping up to improve the study and  understanding of the subjects in the first two years: Methodology of Research, Statisitics and Medical information Technology. It was necesary to carry out a very exhaustive bibliographic revision of texts and other Spanish and English bibliography taking into account the full meaning with a logical sequence and alphabetical order.

  11. Glosario explicativo ingles-castellano de terminos de Gramatica Generativa Transformacional (An English-Spanish Explanatory Glossary of Terminology in Transformational Generative Grammar).

    Science.gov (United States)

    Sanchez Diaz, Anibal; Zierer, Ernesto

    This glossary provides Spanish translations for English technical terminology used in work connected with transformational generative grammar and theory. Approximately 300 terms are listed alphabetically in English with Spanish equivalents, Spanish explanations, and examples where necessary. (VM)

  12. Prevalence of error-prone abbreviations used in medication prescribing for hospitalised patients: multi-hospital evaluation.

    Science.gov (United States)

    Dooley, M J; Wiseman, M; Gu, G

    2012-03-01

    The use of error-prone abbreviations in prescribing is a potential cause of misinterpretation that may lead to medication error. This study determined frequency and type of error-prone abbreviations in inpatient medication prescribing across three Australian hospitals. Three hundred and sixty-nine (76.9%) patients had one or more error-prone abbreviations used in prescribing, with 8.4% of orders containing at least one error-prone abbreviation and 29.6% of these considered to be high risk for causing significant harm. © 2012 The Authors. Internal Medicine Journal © 2012 Royal Australasian College of Physicians.

  13. Combining corpus-derived sense profiles with estimated frequency information to disambiguate clinical abbreviations.

    Science.gov (United States)

    Xu, Hua; Stetson, Peter D; Friedman, Carol

    2012-01-01

    Abbreviations are widely used in clinical notes and are often ambiguous. Word sense disambiguation (WSD) for clinical abbreviations therefore is a critical task for many clinical natural language processing (NLP) systems. Supervised machine learning based WSD methods are known for their high performance. However, it is time consuming and costly to construct annotated samples for supervised WSD approaches and sense frequency information is often ignored by these methods. In this study, we proposed a profile-based method that used dictated discharge summaries as an external source to automatically build sense profiles and applied them to disambiguate abbreviations in hospital admission notes via the vector space model. Our evaluation using a test set containing 2,386 annotated instances from 13 ambiguous abbreviations in admission notes showed that the profile-based method performed better than two baseline methods and achieved a best average precision of 0.792. Furthermore, we developed a strategy to combine sense frequency information estimated from a clustering analysis with the profile-based method. Our results showed that the combined approach largely improved the performance and achieved a highest precision of 0.875 on the same test set, indicating that integrating sense frequency information with local context is effective for clinical abbreviation disambiguation.

  14. Use of abbreviations by healthcare professionals: what is the way forward?

    Science.gov (United States)

    Sinha, S; McDermott, F; Srinivas, G; Houghton, P W J

    2011-07-01

    To assess the understanding of commonly used abbreviations in the medical records among healthcare professionals. A selection of abbreviations from surgical inpatient admissions (gathered over a 10 day period in October 2008), in the form of a standard questionnaire, was shown to different members of a multidisciplinary team to examine interpretation and knowledge. 209 questionnaires were analysed. The average correct response was 43%. Foundation Year 1 (F1) doctors scored the highest with 57% correct responses, whereas dieticians fared worst (20% correct). Among different abbreviations, NAD (91%) and SCBU (93%) were most often correctly answered, whereas CIC (3%) and STS (0.5%) were the most incorrectly answered. Certain abbreviations which are mostly used by nurses (eg, OTT) achieved a 75% correct response by them compared to only 11% by F1 and 10% by F2 doctors (pabbreviations such as COBH (p=0.025) and LUTS (pabbreviations. Use of unambiguous and approved list of abbreviations is suggested in order to ensure good communication in patient care.

  15. Audit on the Use of Dangerous Abbreviations, Symbols, and Dose Designations in Paper Compared to Electronic Medication Orders: A Multicenter Study.

    Science.gov (United States)

    Cheung, Stephanie; Hoi, Sannifer; Fernandes, Olavo; Huh, Jin; Kynicos, Sara; Murphy, Laura; Lowe, Donna

    2018-04-01

    Dangerous abbreviations on the Institute for Safe Medication Practices Canada's "Do Not Use" list have resulted in medication errors leading to harm. Data comparing rates of use of dangerous abbreviations in paper and electronic medication orders are limited. To compare rates of use of dangerous abbreviations from the "Do Not Use" list, in paper and electronic medication orders. Secondary objectives include determining the proportion of patients at risk for medication errors due to dangerous abbreviations and the most commonly used dangerous abbreviations. One-day cross-sectional audits of medication orders were conducted at a 6-site hospital network in Toronto, Canada, between December 2013 and January 2014. Proportions of paper and electronic medication orders containing dangerous abbreviation(s) were compared using a χ 2 test. The proportion of patients with at least 1 medication order containing dangerous abbreviation(s) and the top 5 dangerous abbreviations used were described. Overall, 255 patient charts were reviewed. The proportions of paper and electronic medication orders containing dangerous abbreviation(s) were 172/714 (24.1%) and 9/2207 (0.4%), respectively ( P abbreviation(s). The proportions of patients with at least 1 medication order during the audit period containing dangerous abbreviation(s) for patients with paper only, electronic only, or a hybrid of paper and electronic medication orders were 50.5%, 5%, and 47.2%, respectively. Those most commonly used were "D/C", drug name abbreviations, "OD," "cc," and "U." Electronic medication orders have significantly lower rates of dangerous abbreviation use compared to paper medication orders.

  16. Reliability and validity of Brief Problem Monitor, an abbreviated form of the Child Behavior Checklist.

    Science.gov (United States)

    Piper, Brian J; Gray, Hilary M; Raber, Jacob; Birkett, Melissa A

    2014-10-01

    The parent form of the 113-item Child Behavior Checklist (CBCL) is widely utilized by child psychiatrists and psychologists. This report examines the reliability and validity of a recently developed abbreviated version of the CBCL, the Brief Problem Monitor (BPM). Caregivers (n = 567) completed the CBCL online and the 19 BPM items were examined separately. Internal consistency of the BPM was high (Cronbach's alpha = 0.91) and satisfactory for the Internalizing (0.78), Externalizing (0.86), and Attention (0.87) scales. High correlations between the CBCL and BPM were identified for the total score (r = 0.95) as well as the Internalizing (0.86), Externalizing (0.93), and Attention (0.97) scales. The BPM and scales were sensitive and identified significantly higher behavioral and emotional problems among children whose caregiver reported a psychiatric diagnosis of attention-deficit hyperactivity disorder, bipolar disorder, depression, anxiety, developmental disabilities, or autism spectrum disorders relative to a comparison group that had not been diagnosed with these disorders. BPM ratings also differed by the socioeconomic status and education of the caregiver. Mothers with higher annual incomes rated their children as having 38.8% fewer total problems (Cohen's d = 0.62) as well as 42.8% lower Internalizing (d = 0.53), 44.1% less Externalizing (d = 0.62), and 30.9% decreased Attention (d = 0.39). A similar pattern was evident for maternal education (d = 0.30-0.65). Overall, these findings provide strong psychometric support for the BPM, although the differences based on the characteristics of the parent indicate that additional information from other sources (e.g., teachers) should be obtained to complement parental reports. © 2014 The Authors. Psychiatry and Clinical Neurosciences © 2014 Japanese Society of Psychiatry and Neurology.

  17. Psychometric testing of the abbreviated Clinical Learning Environment Inventory (CLEI-19).

    Science.gov (United States)

    Salamonson, Yenna; Bourgeois, Sharon; Everett, Bronwyn; Weaver, Roslyn; Peters, Kath; Jackson, Debra

    2011-12-01

    This paper is a report of a test of the psychometric properties of a 19-item version of the Clinical Learning Environment Inventory. Although the clinical learning environment provides the 'real-life' context essential for preparing nursing students for their professional role, the quality of student learning is influenced by the quality of the clinical placement. Nursing students completed an abbreviated (19-item) form of the Clinical Learning Environment Inventory to rate their perception of the clinical learning environment. Descriptive statistics, principal component analysis, discriminant validity and Cronbach's alpha reliabilities were computed. Between March and December 2009, 231 online surveys were submitted. The mean age of participants was 30.3 years (sd: 10.4) and 87% were female. All 19 items loaded on two factors, 'Clinical Facilitator Support of Learning' and 'Satisfaction with Clinical Placement', with factor loadings above the 0.4 threshold. Cronbach's alpha coefficient was 0.93 for the total Clinical Learning Environment Inventory-19, with subscales ranging from 0.92 to 0.94. Multiple regression uncovered that participants who engaged in health-related paid work were independently and significantly more positive on the 'Clinical Facilitator Support of Learning' subscale, whereas those who worked >16 hours a week, or allocated the afternoon shift were independently and significantly more negative on the 'Satisfaction with Clinical Placement' subscale. Providing an effective and productive clinical experience is vital in preparing nursing students to become competent clinicians. The Clinical Learning Environment Inventory-19 offers a useful measure to explore nursing students' satisfaction with two aspects of this clinical experience--clinical facilitator support of learning and the clinical learning environment. © 2011 Blackwell Publishing Ltd.

  18. SACRD: a data base for fast reactor safety computer codes, contents and glossary of Version 1 of the system

    Energy Technology Data Exchange (ETDEWEB)

    Greene, N.M.; Forsberg, V.M.; Raiford, G.B.; Arwood, J.W.; Flanagan, G.F.

    1979-01-01

    SACRD is a data base of material properties and other handbook data needed in computer codes used for fast reactor safety studies. This document lists the contents of Version 1 and also serves as a glossary of terminology used in the data base. Data are available in the thermodynamics, heat transfer, fluid mechanics, structural mechanics, aerosol transport, meteorology, neutronics and dosimetry areas. Tabular, graphical and parameterized data are provided in many cases.

  19. Impact of abbreviated lecture with interactive mini-cases vs traditional lecture on student performance in the large classroom.

    Science.gov (United States)

    Marshall, Leisa L; Nykamp, Diane L; Momary, Kathryn M

    2014-12-15

    To compare the impact of 2 different teaching and learning methods on student mastery of learning objectives in a pharmacotherapy module in the large classroom setting. Two teaching and learning methods were implemented and compared in a required pharmacotherapy module for 2 years. The first year, multiple interactive mini-cases with inclass individual assessment and an abbreviated lecture were used to teach osteoarthritis; a traditional lecture with 1 inclass case discussion was used to teach gout. In the second year, the same topics were used but the methods were flipped. Student performance on pre/post individual readiness assessment tests (iRATs), case questions, and subsequent examinations were compared each year by the teaching and learning method and then between years by topic for each method. Students also voluntarily completed a 20-item evaluation of the teaching and learning methods. Postpresentation iRATs were significantly higher than prepresentation iRATs for each topic each year with the interactive mini-cases; there was no significant difference in iRATs before and after traditional lecture. For osteoarthritis, postpresentation iRATs after interactive mini-cases in year 1 were significantly higher than postpresentation iRATs after traditional lecture in year 2; the difference in iRATs for gout per learning method was not significant. The difference between examination performance for osteoarthritis and gout was not significant when the teaching and learning methods were compared. On the student evaluations, 2 items were significant both years when answers were compared by teaching and learning method. Each year, students ranked their class participation higher with interactive cases than with traditional lecture, but both years they reported enjoying the traditional lecture format more. Multiple interactive mini-cases with an abbreviated lecture improved immediate mastery of learning objectives compared to a traditional lecture format, regardless of

  20. Techniques for analyzing the impacts of certain electric-utility ratemaking and regulatory-policy concepts. Glossary

    Energy Technology Data Exchange (ETDEWEB)

    None

    1980-08-01

    This document, Glossary, is the first in a series of reports to identify, describe, and apply techniques for analyzing the impacts of certain electric utility concepts. This report was developed with a focus on the currently evolving issues of ratemaking, especially as they might be expected to arise under Sections 101, 111, 113, 114, 131, 132, and 210 of the P.U.R.P.A. of 1978. Because the evolutionary process of ratemaking has led to multiple proceedings and changes of inference in some terms, the glossary attempts to delineate these changes where appropriate. Definitions not uniquely related to ratemaking are included if they are likely to be used in ratemaking proceedings. To avoid unnecessary duplication of effort and expense, the compilers relied heavily on previously developed, publicly available glossaries and definitions developed by organizations such as Edison Electric Institute, the Electric Power Research Institute, and the Institute of Electrical and Electronics Engineers. Existing definitions were revised and new ones were developed as appropriate.

  1. Review Essay: The New Complexity: Encyclopedias, Glossaries and Dictionaries on Qualitative Research

    Directory of Open Access Journals (Sweden)

    Günter Mey

    2008-05-01

    Full Text Available A new genre—glossaries and dictionaries on qualitative research—has started to enter the Anglo-American publishing market. Following Thomas A. SCHWANDT's Dictionary of Qualitative Inquiry, published for the first time in 1997 and now available in a 3rd edition, two new books have appeared: The SAGE Dictionary of Social Research Methods, edited by Victor JUPP, and Keywords in Qualitative Research, written by Michael BLOOR and Fiona WOOD. Similar volumes are in the pipeline, such as The SAGE Encyclopedia of Qualitative Research Methods, edited by Lisa M. GIVEN, which is to be published in spring 2008. In face of the diversification of qualitative research, such a development is not surprising: encyclopedias, glossaries and dictionaries promise a quick overview of an increasingly complex research area. Yet it is surprising that although more than 600 terms and concepts are defined and discussed in the books mentioned above, there is only a small group of about 30 terms common to all of them. Even for this common denominator descriptions are divergent and there is little overlap of the references provided for further reading in relation to each term. In this regard qualitative research seems to be something it is hard for encyclopedic endeavors to grasp. A further comparison of the English books with the only one currently available in German reveals the impact of language and national barriers: many terms familiar to at least some sections of the German qualitative research community do not exist at all in the English-language texts. The books discussed in this essay offer an overview but do not really do justice to the complexity and diversity of the research field. To purchase just one of them would bring only partial success to those hoping for a comprehensive overview of the field of qualitative research. And whether such fixed—print—reference guides will be attractive outside of libraries when the Internet, including Wikipedia and

  2. AAC menu interface: effectiveness of active versus passive learning to master abbreviation-expansion codes.

    Science.gov (United States)

    Gregory, Ellyn; Soderman, Melinda; Ward, Christy; Beukelman, David R; Hux, Karen

    2006-06-01

    This study investigated the accuracy with which 30 young adults without disabilities learned abbreviation expansion codes associated with specific vocabulary items that were stored in an AAC device with two accessing methods: mouse access and keyboard access. Both accessing methods utilized a specialized computer application, called AAC Menu, which allowed for errorless practice. Mouse access prompted passive learning, whereas keyboard access prompted active learning. Results revealed that participants who accessed words via a keyboard demonstrated significantly higher mastery of abbreviation-expansion codes than those who accessed words via a computer mouse.

  3. Abbreviated protocol for breast MRI: Are multiple sequences needed for cancer detection?

    Energy Technology Data Exchange (ETDEWEB)

    Mango, Victoria L., E-mail: vlm2125@columbia.edu [Columbia University Medical Center, Herbert Irving Pavilion, 161 Fort Washington Avenue, 10th Floor, New York, NY 10032 (United States); Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); Morris, Elizabeth A., E-mail: morrise@mskcc.org [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); David Dershaw, D., E-mail: dershawd@mskcc.org [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); Abramson, Andrea, E-mail: abramsoa@mskcc.org [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); Fry, Charles, E-mail: charles_fry@nymc.edu [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); New York Medical College, 40 Sunshine Cottage Rd, Valhalla, NY 10595 (United States); Moskowitz, Chaya S. [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); Hughes, Mary, E-mail: hughesm@mskcc.org [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); Kaplan, Jennifer, E-mail: kaplanj@mskcc.org [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); Jochelson, Maxine S., E-mail: jochelsm@mskcc.org [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States)

    2015-01-15

    Highlights: • Abbreviated breast MR demonstrates high sensitivity for breast carcinoma detection. • Time to perform/interpret the abbreviated exam is shorter than a standard MRI exam. • An abbreviated breast MRI could reduce costs and make MRI screening more available. - Abstract: Objective: To evaluate the ability of an abbreviated breast magnetic resonance imaging (MRI) protocol, consisting of a precontrast T1 weighted (T1W) image and single early post-contrast T1W image, to detect breast carcinoma. Materials and methods: A HIPAA compliant Institutional Review Board approved review of 100 consecutive breast MRI examinations in patients with biopsy proven unicentric breast carcinoma. 79% were invasive carcinomas and 21% were ductal carcinoma in situ. Four experienced breast radiologists, blinded to carcinoma location, history and prior examinations, assessed the abbreviated protocol evaluating only the first post-contrast T1W image, post-processed subtracted first post-contrast and subtraction maximum intensity projection images. Detection and localization of tumor were compared to the standard full diagnostic examination consisting of 13 pre-contrast, post-contrast and post-processed sequences. Results: All 100 cancers were visualized on initial reading of the abbreviated protocol by at least one reader. The mean sensitivity for each sequence was 96% for the first post-contrast sequence, 96% for the first post-contrast subtraction sequence and 93% for the subtraction MIP sequence. Within each sequence, there was no significant difference between the sensitivities among the 4 readers (p = 0.471, p = 0.656, p = 0.139). Mean interpretation time was 44 s (range 11–167 s). The abbreviated imaging protocol could be performed in approximately 10–15 min, compared to 30–40 min for the standard protocol. Conclusion: An abbreviated breast MRI protocol allows detection of breast carcinoma. One pre and post-contrast T1W sequence may be adequate for detecting

  4. Abbreviated protocol for breast MRI: Are multiple sequences needed for cancer detection?

    International Nuclear Information System (INIS)

    Mango, Victoria L.; Morris, Elizabeth A.; David Dershaw, D.; Abramson, Andrea; Fry, Charles; Moskowitz, Chaya S.; Hughes, Mary; Kaplan, Jennifer; Jochelson, Maxine S.

    2015-01-01

    Highlights: • Abbreviated breast MR demonstrates high sensitivity for breast carcinoma detection. • Time to perform/interpret the abbreviated exam is shorter than a standard MRI exam. • An abbreviated breast MRI could reduce costs and make MRI screening more available. - Abstract: Objective: To evaluate the ability of an abbreviated breast magnetic resonance imaging (MRI) protocol, consisting of a precontrast T1 weighted (T1W) image and single early post-contrast T1W image, to detect breast carcinoma. Materials and methods: A HIPAA compliant Institutional Review Board approved review of 100 consecutive breast MRI examinations in patients with biopsy proven unicentric breast carcinoma. 79% were invasive carcinomas and 21% were ductal carcinoma in situ. Four experienced breast radiologists, blinded to carcinoma location, history and prior examinations, assessed the abbreviated protocol evaluating only the first post-contrast T1W image, post-processed subtracted first post-contrast and subtraction maximum intensity projection images. Detection and localization of tumor were compared to the standard full diagnostic examination consisting of 13 pre-contrast, post-contrast and post-processed sequences. Results: All 100 cancers were visualized on initial reading of the abbreviated protocol by at least one reader. The mean sensitivity for each sequence was 96% for the first post-contrast sequence, 96% for the first post-contrast subtraction sequence and 93% for the subtraction MIP sequence. Within each sequence, there was no significant difference between the sensitivities among the 4 readers (p = 0.471, p = 0.656, p = 0.139). Mean interpretation time was 44 s (range 11–167 s). The abbreviated imaging protocol could be performed in approximately 10–15 min, compared to 30–40 min for the standard protocol. Conclusion: An abbreviated breast MRI protocol allows detection of breast carcinoma. One pre and post-contrast T1W sequence may be adequate for detecting

  5. 21 CFR 314.430 - Availability for public disclosure of data and information in an application or abbreviated...

    Science.gov (United States)

    2010-04-01

    ... or abbreviated application, including investigational new drug applications, drug master files under... or abbreviated application before an approval letter is sent to the applicant under § 314.105 or tentative approval letter is sent to the applicant under § 314.107, unless the existence of the application...

  6. Nomenclature and basic concepts in automation in the clinical laboratory setting: a practical glossary.

    Science.gov (United States)

    Evangelopoulos, Angelos A; Dalamaga, Maria; Panoutsopoulos, Konstantinos; Dima, Kleanthi

    2013-01-01

    In the early 80s, the word automation was used in the clinical laboratory setting referring only to analyzers. But in late 80s and afterwards, automation found its way into all aspects of the diagnostic process, embracing not only the analytical but also the pre- and post-analytical phase. While laboratories in the eastern world, mainly Japan, paved the way for laboratory automation, US and European laboratories soon realized the benefits and were quick to follow. Clearly, automation and robotics will be a key survival tool in a very competitive and cost-concious healthcare market. What sets automation technology apart from so many other efficiency solutions are the dramatic savings that it brings to the clinical laboratory. Further standardization will assure the success of this revolutionary new technology. One of the main difficulties laboratory managers and personnel must deal with when studying solutions to reengineer a laboratory is familiarizing themselves with the multidisciplinary and technical terminology of this new and exciting field. The present review/glossary aims at giving an overview of the most frequently used terms within the scope of laboratory automation and to put laboratory automation on a sounder linguistic basis.

  7. A novel abbreviation standard for organobromine, organochlorine and organophosphorus flame retardants and some characteristics of the chemicals

    Science.gov (United States)

    Bergman, Åke; Rydén, Andreas; Law, Robin J.; de Boer, Jacob; Covaci, Adrian; Alaee, Mehran; Birnbaum, Linda; Petreas, Myrto; Rose, Martin; Sakai, Shinichi; Van den Eede, Nele; van der Veen, Ike

    2012-01-01

    Ever since the interest in organic environmental contaminants first emerged 50 years ago, there has been a need to present discussion of such chemicals and their transformation products using simple abbreviations so as to avoid the repetitive use of long chemical names. As the number of chemicals of concern has increased, the number of abbreviations has also increased dramatically, sometimes resulting in the use of different abbreviations for the same chemical. In this article, we propose abbreviations for flame retardants (FRs) substituted with bromine or chlorine atoms or including a functional group containing phosphorus, i.e. BFRs, CFRs and PFRs, respectively. Due to the large number of halogenated and organophosphorus FRs, it has become increasingly important to develop a strategy for abbreviating the chemical names of FRs. In this paper, a two step procedure is proposed for deriving practical abbreviations (PRABs) for the chemicals discussed. In the first step, structural abbreviations (STABs) are developed using specific STAB criteria based on the FR structure. However, since several of the derived STABs are complicated and long, we propose instead the use of PRABs. These are, commonly, an extract of the most essential part of the STAB, while also considering abbreviations previously used in the literature. We indicate how these can be used to develop an abbreviation that can be generally accepted by scientists and other professionals involved in FR related work. Tables with PRABs and STABs for BFRs, CFRs and PFRs are presented, including CAS (Chemical Abstract Service) numbers, notes of abbreviations that have been used previously, CA (Chemical Abstract) name, common names and trade names, as well as some fundamental physico-chemical constants. PMID:22982223

  8. An abbreviated SNP panel for ancestry assignment of honeybees (Apis mellifera)

    Science.gov (United States)

    This paper examines whether an abbreviated panel of 37 single nucleotide polymorphisms (SNPs) has the same power as a larger and more expensive panel of 95 SNPs to assign ancestry of honeybees (Apis mellifera) to three ancestral lineages. We selected 37 SNPs from the original 95 SNP panel using alle...

  9. 40 CFR 1051.805 - What symbols, acronyms, and abbreviations does this part use?

    Science.gov (United States)

    2010-07-01

    ... Definitions and Other Reference Information § 1051.805 What symbols, acronyms, and abbreviations does this... per meter-square per test day. HC—hydrocarbon. Hg—mercury. hr—hours. km—kilometer. kW—kilowatt. LPG... and Records Administration. NMHC—nonmethane hydrocarbons. NOX—oxides of nitrogen (NO and NOX). psig...

  10. 40 CFR 1048.805 - What symbols, acronyms, and abbreviations does this part use?

    Science.gov (United States)

    2010-07-01

    ... ENGINES Definitions and Other Reference Information § 1048.805 What symbols, acronyms, and abbreviations... hydrocarbons. NOXoxides of nitrogen (NO and NO2). psipounds per square inch of absolute pressure. psigpounds.... SIspark-ignition. THCtotal hydrocarbon. THCEtotal hydrocarbon equivalent. U.S.C.United States Code. [67 FR...

  11. Abbreviated Title of the Artwork in the System of Signs by Ch. Peirce

    Directory of Open Access Journals (Sweden)

    Grigoriy Valeryevich Tokarev

    2015-09-01

    Full Text Available The article is devoted to the semiotic aspect of the functioning of the abbreviated title of the postmodern artwork. The authors analyze the relationship of title-sign to the object which it replaces. The title is considered from the perspective of three main features peculiar of the sign in accordance with the Charles S. Peirce's theory. This fact allows us to conclude that, being a sign, the abbreviated title replaces a literary text, which is also expressed in symbolic form of the author's knowledge of reality. In this aspect the title becomes the metasign of its text. It is shown that in this connection, decoding and interpretation process take place in two stages – before reading the text and in the process of its reading and interpretation. It is alleged that the result of the interpretation of the title depends on the reader's competence which is determined by their individual literary scope, as well as by the skills of productive work with the text. On the basis of the classification of signs created by Charles Pierce, it was found that the abbreviated title has a complex semiotic nature combining the features of indexicality, conventionality, and iconicity, the latter of which may be present only in the abbreviated title.

  12. Improving Discrete Trial Instruction by Paraprofessional Staff Through an Abbreviated Performance Feedback Intervention

    Science.gov (United States)

    Leblanc, Marie-Pierre; Ricciardi, Joseph N.; Luiselli, James K.

    2005-01-01

    We evaluated an abbreviated performance feedback intervention as a training strategy to improve discrete trial instruction of children with autism by three paraprofessional staff (assistant teachers) at a specialized day school. Feedback focused on 10 discrete trial instructional skills demonstrated by the staff during teaching sessions. Following…

  13. The Use of Abbreviations in English-Medium Astrophysics Research Paper Titles: A Problematic Issue

    Science.gov (United States)

    Méndez, David I.; Alcaraz, M. Ángeles

    2015-01-01

    In this study, we carry out a qualitative and quantitative analysis of abbreviations in 300 randomly collected research paper titles published in the most prestigious European and US-based Astrophysics journals written in English. Our main results show that the process of shortening words and groups of words is one of the most characteristic and…

  14. Greek or Not: The Use of Symbols and Abbreviations in Mathematics

    Science.gov (United States)

    Quinnell, Lorna; Carter, Merilyn

    2012-01-01

    The language of mathematics is unique and complex. One feature of the mathematical register is the use of symbols and abbreviations. Whilst it may be possible for a student to think mathematically in the absence of symbols, the written communication of mathematical ideas cannot be achieved concisely without the use of mathematical symbols.…

  15. Use of Text Message Abbreviations and Literacy Skills in Children with Dyslexia

    Science.gov (United States)

    Veater, Helen M.; Plester, Beverly; Wood, Clare

    2011-01-01

    This small-scale study compared 10 to 13-year-old dyslexic children's use of text message abbreviations with that of reading age- and chronological age-matched controls. There were no significant differences in the proportion of textisms used between the dyslexic children and the two control groups, although a preference for non-phonetic text…

  16. Text-Message Abbreviations and Language Skills in High School and University Students

    Science.gov (United States)

    De Jonge, Sarah; Kemp, Nenagh

    2012-01-01

    This study investigated the use of text-message abbreviations (textisms) in Australian adolescents and young adults, and relations between textism use and literacy abilities. Fifty-two high school students aged 13-15 years, and 53 undergraduates aged 18-24 years, all users of predictive texting, translated conventional English sentences into…

  17. Symbolic Capital in a Virtual Heterosexual Market: Abbreviation and Insertion in Italian iTV SMS

    Science.gov (United States)

    Herring, Susan C.; Zelenkauskaite, Asta

    2009-01-01

    This study analyzes gender variation in nonstandard typography--specifically, abbreviations and insertions--in mobile phone text messages (SMS) posted to a public Italian interactive television (iTV) program. All broadcast SMS were collected for a period of 2 days from the Web archive for the iTV program, and the frequency and distribution of…

  18. Relax and Try This Instead: Abbreviated Habit Reversal for Maladaptive Self-Biting.

    Science.gov (United States)

    Jones, Kevin M.; Swearer, Susan M.; Friman, Patrick C.

    1997-01-01

    A study evaluated the effectiveness of an abbreviated habit reversal procedure to reduce maladaptive oral self-biting in an adolescent boy in residential care. Treatment involved a combination of relaxation and two competing responses (gum chewing and tongue-lip rubbing). The intervention eliminated the biting and the tissue damage it caused.…

  19. 76 FR 71601 - Record of Decision, Long Walk National Historic Trail Feasibility Study/Abbreviated Final...

    Science.gov (United States)

    2011-11-18

    ... National Park Service Record of Decision, Long Walk National Historic Trail Feasibility Study/Abbreviated... Environmental Impact Statement for the Long Walk National Historic Trail Feasibility Study. SUMMARY: Pursuant to... Statement for the Long Walk National Historic Trail Feasibility Study, prepared by National Trails...

  20. Introduction of the Abbreviated Westmead Post-Traumatic Amnesia Scale and Impact on Length of Stay

    NARCIS (Netherlands)

    Watson, C. E.; Clous, E. A.; Jaeger, M.; D'Amours, S. K.

    2017-01-01

    Mild traumatic brain injury is a common presentation to Emergency Departments. Early identification of patients with cognitive deficits and provision of discharge advice are important. The Abbreviated Westmead Post-traumatic Amnesia Scale provides an early and efficient assessment of post-traumatic

  1. 21 CFR 314.94 - Content and format of an abbreviated application.

    Science.gov (United States)

    2010-04-01

    ... Trademark Office that, in the opinion of the applicant and to the best of its knowledge, claims the... listed drug. (v) Licensing agreements. If the abbreviated new drug application is for a drug or method of using a drug claimed by a patent and the applicant has a licensing agreement with the patent owner, a...

  2. 21 CFR 314.440 - Addresses for applications and abbreviated applications.

    Science.gov (United States)

    2010-04-01

    ... leukapheresis; (3) Blood component processing solutions and shelf life extenders; and (4) Oxygen carriers. [50... 21 Food and Drugs 5 2010-04-01 2010-04-01 false Addresses for applications and abbreviated applications. 314.440 Section 314.440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND...

  3. Validating abbreviated measures of effort-reward imbalance at work in European cohort studies: the IPD-Work consortium.

    Science.gov (United States)

    Siegrist, Johannes; Dragano, Nico; Nyberg, Solja T; Lunau, Thorsten; Alfredsson, Lars; Erbel, Raimund; Fahlén, Göran; Goldberg, Marcel; Jöckel, Karl-Heinz; Knutsson, Anders; Leineweber, Constanze; Magnusson Hanson, Linda L; Nordin, Maria; Rugulies, Reiner; Schupp, Jürgen; Singh-Manoux, Archana; Theorell, Töres; Wagner, Gert G; Westerlund, Hugo; Zins, Marie; Heikkilä, Katriina; Fransson, Eleonor I; Kivimäki, Mika

    2014-04-01

    Effort-reward imbalance (ERI) is an established conceptualisation of work stress. Although a validated effort-reward questionnaire is available for public use, many epidemiological studies adopt shortened scales and proxy measures. To examine the agreement between different abbreviated measures and the original instrument, we compared different versions of the effort-reward scales available in 15 European cohort studies participating in the IPD-Work (Individual-participant-data meta-analysis in working populations) consortium. Five of the 15 studies provide information on the original ('complete') scales measuring 'effort' and 'reward', whereas the 10 remaining studies used 'partial' scales. To compare different versions of the ERI scales, we analyse individual-level data from 31,790 participants from the five studies with complete scales. Pearson's correlation between partial and complete scales was very high in case of 'effort' (where 2 out of 3 items were used) and very high or high in case of 'reward', if at least 4 items (out of 7) were included. Reward scales composed of 3 items revealed good to satisfactory agreement, and in one case, a reward scale consisting of 2 items only demonstrated a modest, but still acceptable degree of agreement. Sensitivity and specificity of a composite measure, the ratio of effort and reward, comparing partial versus complete scales ranged between 59-93 and 85-99 %, respectively. Complete and partial scales were strongly associated with poor self-rated health. Our results support the notion that short proxy measures or partial versions of the original scales can be used to assess effort-reward imbalance.

  4. The utility of abbreviated patient-reported outcomes for predicting survival in early stage colorectal cancer.

    Science.gov (United States)

    Hsu, Tina; Speers, Caroline H; Kennecke, Hagen F; Cheung, Winson Y

    2017-05-15

    Patient-reported outcomes (PROs) are increasingly used in clinical settings. Prior research suggests that PROs collected at baseline may be associated with cancer survival, but most of those studies were conducted in patients with breast or lung cancer. The objective of this study was to determine the correlation between prospectively collected PROs and cancer-specific outcomes in patients with early stage colorectal cancer. Patients who had newly diagnosed stage II or III colorectal cancer from 2009 to 2010 and had a consultation at the British Columbia Cancer Agency completed the brief Psychosocial Screen for Cancer (PSSCAN) questionnaire, which collects data on patients' perceived social supports, quality of life (QOL), anxiety and depression, and general health. PROs from the PSSCAN were linked with the Gastrointestinal Cancers Outcomes Database, which contains information on patient and tumor characteristics, treatment details, and cancer outcomes. Cox regression models were constructed for overall survival (OS), and Fine and Gray regression models were developed for disease-specific survival (DSS). In total, 692 patients were included. The median patient age was 67 years (range, 26-95 years), and the majority had colon cancer (61%), were diagnosed with stage III disease (54%), and received chemotherapy (58%). In general, patients felt well supported and reported good overall health and QOL. On multivariate analysis, increased fatigue was associated with worse OS (hazard ratio [HR], 1.99; P = .00007) and DSS (HR, 1.63; P = .03), as was lack of emotional support (OS: HR, 4.36; P = .0003; DSS: HR, 1.92; P = .02). Although most patients described good overall health and QOL and indicated that they were generally well supported, patients who experienced more pronounced fatigue or lacked emotional support had a higher likelihood of worse OS and DSS. These findings suggest that abbreviated PROs can inform and assist clinicians to identify patients who have a worse

  5. An Abbreviated Version of the Mindful Eating Questionnaire.

    Science.gov (United States)

    Clementi, Cecilia; Casu, Giulia; Gremigni, Paola

    2017-04-01

    To assess the psychometric properties of the Mindful Eating Questionnaire (MEQ). A total of 15 mindfulness experts evaluated the content of the 28 items and 5 factors of the MEQ. A sample of 1,067 Italian adults (61.4% women) completed the MEQ and other measures; 62 participants completed a 4-week test-retest. Content analysis reduced the MEQ to 20 items. Exploratory and confirmatory factor analyses supported a 2-factor model based on awareness and recognition of hunger and satiety cues. Factors showed adequate internal consistency (α = .75 and .83, respectively) and test-retest reliability (intraclass correlation coefficient = 0.73 and 0.85, respectively), and were associated in expected ways, although with small to moderate effect sizes, with general mindfulness, meditation experience, yoga practice, not being on a diet plan, and body mass index categories. Findings provided evidence of validity and reliability for the 20-item MEQ and support its use by clinicians and researchers for addressing eating-related issues. Copyright © 2017 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

  6. Abbreviated closure for remote damage control laparotomy in extreme environments: A randomized trial of sutures versus wound clamps comparing terrestrial and weightless conditions.

    Science.gov (United States)

    Kirkpatrick, Andrew W; McKee, Jessica Lynn; Tien, Colonel Homer; LaPorta, Anthony J; Lavell, Kit; Leslie, Tim; McBeth, Paul B; Roberts, Derek J; Ball, Chad G

    2017-05-01

    Far-Forward Damage Control Laparotomies (DCLs) might provide direct-compression of visceral hemorrhage, however, suturing is a limiting factor, especially for non-physicians. We thus compared abbreviated skin closures comparing skin-suture (SS) versus wound-clamp (WC), on-board a research aircraft in weightlessness (0g) and normal gravity (1g). Surgeons conducted DCLs on a surgical-simulator; onboard the hangered-aircraft (1g), or during parabolic flight (0g), randomized to either WC or SS. Ten surgeons participated. Two (40%) surgeons randomized to suture in 0g were incapacitated with motion-sickness, and none were able to close in either 1 or 0g. With WC, two completely closed in 1g as did three in 0g, despite having longer incisions (p = 0.016). Overall skin-closure with WC was significantly greater in both 1g (p = 0.016) and 0g (p = 0.008). WC was more effective in 1g and particularly 0g. Future studies should address the utility of abbreviated WC abdominal closure to facilitate potential Far-Forward DCL. ID ISRCTN/77929274. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. McArthur-Bates Communicative Development Inventory (CDI: Proposal of an abbreviate version

    Directory of Open Access Journals (Sweden)

    Chamarrita Farkas Klein

    2011-01-01

    Full Text Available The McArthur-Bates Communicative Development Inventories (CDI assesses language development en children, through a significant caregiver report. The first inventory assesses verbal and non verbal language in infants who are from 8 to 18 months old and it is composed of 949 items distributed in 6 scales. This study proposes an abbreviate form of this instrument, and was tested on families and educators of 130 Chilean children of 11-15 months old. Analyses related to the items, reliability and validity of the instrument and factorial analyses of subscales were realized. The abbreviate version consider 241 items distributed in 4 scales. The evaluation of the psychometric properties of the instrument was acceptable, demonstrating adequate reliability and validity.

  8. Validation of the abbreviated Radon Progeny Integrating Sampling Unit (RPISU) method for Mesa County, Colorado

    International Nuclear Information System (INIS)

    Langner, G.H. Jr.

    1987-06-01

    The US Department of Energy (DOE) Office of Remedial Action and Waste Technology established the Technical Measurements Center at the DOE Grand Junction, Colorado, Projects Office to standardize, calibrate, and compare measurements made in support of DOE remedial action programs. Indoor radon-daughter concentration measurements are made to determine whether a structure is in need of remedial action. The Technical Measurements Center conducted this study to validate an abbreviated Radon Progeny Integrated Sampling Unit (RPISU) method of making indoor radon-daughter measurements to determine whether a structure has a radon-daughter concentration (RDC) below the levels specified in various program standards. The Technical Measurements Center established a criterion against which RDC measurements made using the RPISU sampling method are evaluated to determine if sampling can be terminated or whether further measurements are required. This abbreviated RPISU criterion was tested against 317 actual sets of RPISU data from measurements made over an eight-year period in Mesa County, Colorado. The data from each location were tested against a standard that was assumed to be the same as the actual annual average RDC from that location. At only two locations was the criterion found to fail. Using the abbreviated RPISU method, only 0.6% of locations sampled can be expected to be falsely indicated as having annual average RDC levels below a given standard

  9. Abbreviated epitaxial growth mode (AGM) method for reducing cost and improving quality of LEDs and lasers

    Science.gov (United States)

    Tansu, Nelson; Chan, Helen M; Vinci, Richard P; Ee, Yik-Khoon; Biser, Jeffrey

    2013-09-24

    The use of an abbreviated GaN growth mode on nano-patterned AGOG sapphire substrates, which utilizes a process of using 15 nm low temperature GaN buffer and bypassing etch-back and recovery processes during epitaxy, enables the growth of high-quality GaN template on nano-patterned AGOG sapphire. The GaN template grown on nano-patterned AGOG sapphire by employing abbreviated growth mode has two orders of magnitude lower threading dislocation density than that of conventional GaN template grown on planar sapphire. The use of abbreviated growth mode also leads to significant reduction in cost of the epitaxy. The growths and characteristics of InGaN quantum wells (QWs) light emitting diodes (LEDs) on both templates were compared. The InGaN QWs LEDs grown on the nano-patterned AGOG sapphire demonstrated at least a 24% enhancement of output power enhancement over that of LEDs grown on conventional GaN templates.

  10. Clinical and metabolic results of fasting abbreviation with carbohydrates in coronary artery bypass graft surgery.

    Science.gov (United States)

    Feguri, Gibran Roder; Lima, Paulo Ruiz Lúcio; Lopes, Andréa Mazoni; Roledo, Andréa; Marchese, Miriam; Trevisan, Mônica; Ahmad, Haitham; Freitas, Bruno Baranhuk de; Aguilar-Nascimento, José Eduardo de

    2012-01-01

    Limited information is available about preoperative fasting abbreviation with administration of liquid enriched with carbohydrates (CHO) in cardiovascular surgeries. To evaluate clinical variables, security of the method and effects on the metabolism of patients undergoing fasting abbreviation in coronary artery bypass graft (CABG) surgery. Forty patients undergoing CABG were randomized to receive 400 ml (6 hours before) and 200 ml (2 hours before) of maltodextrin at 12.5% (Group I, n=20) or just water (Group II, n=20) before anesthetic induction. Perioperative clinical variables were evaluated. Insulin resistance (IR) was evaluated by Homa-IR index and also by the need of exogenous insulin; pancreatic beta-cell excretory function by Homa-Beta index and glycemic control by tests of capillary glucose. Deaths, bronchoaspiration, mediastinitis, stroke and acute myocardial infarction did not occur. Atrial fibrillation occurred in two patients of each group and infectious complications did not differ among groups (P=0.611). Patients of Group I presented two days less of hospital stay (P=0.025) and one day less in the ICU (P0.05). A decline in the endogenous production of insulin was observed in both groups (P<0.001). Preoperative fasting abbreviation with the administration of CHO in the CABG was safe. The glycemic control improved in the ICU; there was less time in the use of dobutamine and length of hospital and ICU stay was reduced. However, neither IR nor morbimortality during hospital phase were influenced.

  11. The abbreviated form of the Brief Cognitive Battery in the diagnosis of dementia in Alzheimer's disease

    Directory of Open Access Journals (Sweden)

    Stephanie Castro

    Full Text Available Abstract The Brief Cognitive Battery (BCB developed by our group for cognitive assessment of low educated individuals has also shown to be highly accurate in diagnosing dementia of individuals with medium or high levels of education, making it a useful tool for populations with heterogeneous educational background. The application of BCB takes around eight minutes, a rather long period for a screening test. Objectives: Our aim was to evaluate whether the exclusion of items of the BCB could reduce its application time without losing accuracy. Methods: Patients with Alzheimer's disease with mild or moderate dementia (N=20, and 30 control subjects were submitted to an abbreviated version of the BCB in which the clock drawing test was not included as an interference test for the delayed recall test. Data from another 22 control individuals who were submitted to the original BCB in another study were also included for comparison. A mathematical formula was employed to compare the two versions of the BCB. Descriptive statistics and ROC (receiver operator characteristic curves were used (alpha=0.05. Results: Using the abbreviated version, the delayed recall test also had high accuracy in diagnosing dementia and the mathematical formula results did not differ to those obtained using the original version, while mean time was reduced by 2 minutes and 37 seconds. Conclusions: This abbreviated form of the BCB is a potentially valuable tool for screening dementia in population studies as well as in busy clinical practices in countries with heterogeneous educational backgrounds.

  12. The abbreviated form of the Brief Cognitive Battery in the diagnosis of dementia in Alzheimer's disease.

    Science.gov (United States)

    Castro, Stephanie; Damin, Antonio Eduardo; Porto, Cláudia Sellitto; Caramelli, Paulo; Nitrini, Ricardo

    2009-01-01

    The Brief Cognitive Battery (BCB) developed by our group for cognitive assessment of low educated individuals has also shown to be highly accurate in diagnosing dementia of individuals with medium or high levels of education, making it a useful tool for populations with heterogeneous educational background. The application of BCB takes around eight minutes, a rather long period for a screening test. Our aim was to evaluate whether the exclusion of items of the BCB could reduce its application time without losing accuracy. Patients with Alzheimer's disease with mild or moderate dementia (N=20), and 30 control subjects were submitted to an abbreviated version of the BCB in which the clock drawing test was not included as an interference test for the delayed recall test. Data from another 22 control individuals who were submitted to the original BCB in another study were also included for comparison. A mathematical formula was employed to compare the two versions of the BCB. Descriptive statistics and ROC (receiver operator characteristic) curves were used (alpha=0.05). Using the abbreviated version, the delayed recall test also had high accuracy in diagnosing dementia and the mathematical formula results did not differ to those obtained using the original version, while mean time was reduced by 2 minutes and 37 seconds. This abbreviated form of the BCB is a potentially valuable tool for screening dementia in population studies as well as in busy clinical practices in countries with heterogeneous educational backgrounds.

  13. A glossary for big data in population and public health: discussion and commentary on terminology and research methods.

    Science.gov (United States)

    Fuller, Daniel; Buote, Richard; Stanley, Kevin

    2017-11-01

    The volume and velocity of data are growing rapidly and big data analytics are being applied to these data in many fields. Population and public health researchers may be unfamiliar with the terminology and statistical methods used in big data. This creates a barrier to the application of big data analytics. The purpose of this glossary is to define terms used in big data and big data analytics and to contextualise these terms. We define the five Vs of big data and provide definitions and distinctions for data mining, machine learning and deep learning, among other terms. We provide key distinctions between big data and statistical analysis methods applied to big data. We contextualise the glossary by providing examples where big data analysis methods have been applied to population and public health research problems and provide brief guidance on how to learn big data analysis methods. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  14. Abbreviated Breast MRI and Digital Tomosynthesis Mammography in Screening Women With Dense Breasts | Division of Cancer Prevention

    Science.gov (United States)

    This randomized phase II trial studies how well abbreviated breast magnetic resonance imaging (MRI) and digital tomosynthesis mammography work in detecting cancer in women with dense breasts. Abbreviated breast MRI is a low cost procedure in which radio waves and a powerful magnet linked to a computer and used to create detailed pictures of the breast in less than 10 minutes. These pictures can show the difference between normal and diseased tissue. |

  15. BUSINESS ENGLISH OUTSIDE THE BOX. BUSINESS JARGON AND ABBREVIATIONS IN BUSINESS COMMUNICATION

    Directory of Open Access Journals (Sweden)

    Pop Anamaria-Mirabela

    2014-12-01

    Full Text Available Business English is commonly understood language, yet Harvard Business Review called business jargon “The Silent Killer of Big Companies”. As we all have been taught in school, we are aware of the fact that in communication we must comply with linguistic rules so that our message gets across succinctly. Yet, there is one place where all these rules can be omitted (at least in the recent decades: the corporate office. Here, one can use euphemisms and clichés, can capitalize any word that is considered important, the passive voice is used wherever possible and abbreviations occur in every sentence. The worst part is that all of these linguistic enormities are carried out deliberately. The purpose of this paper is to analyse to what extent business jargon and abbreviations have affected business communication (which most of the time, it is filled with opaque language to mask different activities and operations and the reasons for which these linguistic phenomena have become so successful in the present. One of the reasons for the research is that in business English, jargon can be annoying because it overcomplicates. It is frequently unnecessary and it can transform a simple idea or instruction into something very confusing. It is true that every field has its jargon. Education, journalism, law, politics, medicine, urban planning – no filed is immune. Yet, it seems that business jargon has been described as “the most annoying”. Another reason is that jargon tends to be elitist. Those who do not understand the terms feel confused and uncertain. The paper starts with defining these two concepts, business jargon and abbreviations, and then it attempts to explain the “unusual” pervasion of these, both in business communication and in everyday communication. For this, the paper includes a list with the most common business jargon and abbreviations. In this view, the authors have accessed different economic blogs and specialty journals

  16. A revised glossary of terms most commonly used by clinical electroencephalographers and updated proposal for the report format of the EEG findings : Revision 2017

    NARCIS (Netherlands)

    Kane, Nick; Acharya, Jayant; Benickzy, Sandor; Caboclo, Luis; Finnigan, Simon; Kaplan, Peter W.; Shibasaki, Hiroshi; Pressler, Ronit; van Putten, Michel J.A.M.

    2017-01-01

    This glossary includes the terms most commonly used in clinical EEG. It is based on the previous proposals (Chatrian et al., 1974; Noachtar et al., 1999) and includes terms necessary to describe the EEG and to generate the EEG report. All EEG phenomena should be described as precisely as possible in

  17. Using Geographic Information Systems (GIS) to assess the role of the built environment in influencing obesity: a glossary.

    Science.gov (United States)

    Thornton, Lukar E; Pearce, Jamie R; Kavanagh, Anne M

    2011-07-01

    Features of the built environment are increasingly being recognised as potentially important determinants of obesity. This has come about, in part, because of advances in methodological tools such as Geographic Information Systems (GIS). GIS has made the procurement of data related to the built environment easier and given researchers the flexibility to create a new generation of environmental exposure measures such as the travel time to the nearest supermarket or calculations of the amount of neighbourhood greenspace. Given the rapid advances in the availability of GIS data and the relative ease of use of GIS software, a glossary on the use of GIS to assess the built environment is timely. As a case study, we draw on aspects the food and physical activity environments as they might apply to obesity, to define key GIS terms related to data collection, concepts, and the measurement of environmental features.

  18. Reducing sedation for pediatric body MRI using accelerated and abbreviated imaging protocols

    International Nuclear Information System (INIS)

    Ahmad, Rizwan; Hu, Houchun Harry; Krishnamurthy, Ramkumar; Krishnamurthy, Rajesh

    2018-01-01

    Magnetic resonance imaging (MRI) is an established diagnostic imaging tool for investigating pediatric disease. MRI allows assessment of structure, function, and morphology in cardiovascular imaging, as well as tissue characterization in body imaging, without the use of ionizing radiation. For MRI in children, sedation and general anesthesia (GA) are often utilized to suppress patient motion, which can otherwise compromise image quality and diagnostic efficacy. However, evidence is emerging that use of sedation and GA in children might have long-term neurocognitive side effects, in addition to the short-term procedure-related risks. These concerns make risk-benefit assessment of sedation and GA more challenging. Therefore, reducing or eliminating the need for sedation and GA is an important goal of imaging innovation and research in pediatric MRI. In this review, the authors focus on technical and clinical approaches to reducing and eliminating the use of sedation in the pediatric population based on image acquisition acceleration and imaging protocols abbreviation. This paper covers important physiological and technical considerations for pediatric body MR imaging and discusses MRI techniques that offer the potential of recovering diagnostic-quality images from accelerated scans. In this review, the authors also introduce the concept of reporting elements for important indications for pediatric body MRI and use this as a basis for abbreviating the MR protocols. By employing appropriate accelerated and abbreviated approaches based on an understanding of the imaging needs and reporting elements for a given clinical indication, it is possible to reduce sedation and GA for pediatric chest, cardiovascular and abdominal MRI. (orig.)

  19. Abbreviations, acronyms, and initialisms frequently used by Martin Marietta Energy Systems, Inc.. Second edition

    Energy Technology Data Exchange (ETDEWEB)

    Miller, J.T.

    1994-09-01

    Guidelines are given for using abbreviations, acronyms, and initialisms (AAIs) in documents prepared by US Department of Energy facilities managed by Martin Marietta Energy Systems, Inc., in Oak Ridge, Tennessee. The more than 10,000 AAIs listed represent only a small portion of those found in recent documents prepared by contributing editors of the Information Management Services organization of Oak Ridge National Laboratory, the Oak Ridge K-25 Site, and the Oak Ridge Y-12 Plant. This document expands on AAIs listed in the Document Preparation Guide and is intended as a companion document

  20. Waiver of the judgment’s guarantees through the abbreviated procedure in Chile

    Directory of Open Access Journals (Sweden)

    Cristián Riego

    2017-10-01

    Full Text Available The paper describes the defendant rights in the new Chilean Criminal Procedure Code of 2000. Also describes how the Code allowed in a very limited expression the possibility of the waiver of the judgment guarantees through the abbreviated procedure. Finally it describes a new law that expanded substantially the use and the incentives for negotiation just in property offences. This last development has divided the Chilean criminal procedure in two subsystems, one in which the oral trial is still the center of the procedure and another in which the trial will becomes exceptional.

  1. Development of abbreviated eight-item form of the Penn Verbal Reasoning Test.

    Science.gov (United States)

    Bilker, Warren B; Wierzbicki, Michael R; Brensinger, Colleen M; Gur, Raquel E; Gur, Ruben C

    2014-12-01

    The ability to reason with language is a highly valued cognitive capacity that correlates with IQ measures and is sensitive to damage in language areas. The Penn Verbal Reasoning Test (PVRT) is a 29-item computerized test for measuring abstract analogical reasoning abilities using language. The full test can take over half an hour to administer, which limits its applicability in large-scale studies. We previously described a procedure for abbreviating a clinical rating scale and a modified procedure for reducing tests with a large number of items. Here we describe the application of the modified method to reducing the number of items in the PVRT to a parsimonious subset of items that accurately predicts the total score. As in our previous reduction studies, a split sample is used for model fitting and validation, with cross-validation to verify results. We find that an 8-item scale predicts the total 29-item score well, achieving a correlation of .9145 for the reduced form for the model fitting sample and .8952 for the validation sample. The results indicate that a drastically abbreviated version, which cuts administration time by more than 70%, can be safely administered as a predictor of PVRT performance. © The Author(s) 2014.

  2. Development of Abbreviated Eight-Item Form of the Penn Verbal Reasoning Test

    Science.gov (United States)

    Bilker, Warren B.; Wierzbicki, Michael R.; Brensinger, Colleen M.; Gur, Raquel E.; Gur, Ruben C.

    2014-01-01

    The ability to reason with language is a highly valued cognitive capacity that correlates with IQ measures and is sensitive to damage in language areas. The Penn Verbal Reasoning Test (PVRT) is a 29-item computerized test for measuring abstract analogical reasoning abilities using language. The full test can take over half an hour to administer, which limits its applicability in large-scale studies. We previously described a procedure for abbreviating a clinical rating scale and a modified procedure for reducing tests with a large number of items. Here we describe the application of the modified method to reducing the number of items in the PVRT to a parsimonious subset of items that accurately predicts the total score. As in our previous reduction studies, a split sample is used for model fitting and validation, with cross-validation to verify results. We find that an 8-item scale predicts the total 29-item score well, achieving a correlation of .9145 for the reduced form for the model fitting sample and .8952 for the validation sample. The results indicate that a drastically abbreviated version, which cuts administration time by more than 70%, can be safely administered as a predictor of PVRT performance. PMID:24577310

  3. Completely continuous and weakly completely continuous abstract ...

    Indian Academy of Sciences (India)

    approximate identity for B, bounded in A. In addition, a necessary condition for the weak complete continuity of A is ... continuous elements of a Banach algebra A and symmetric abstract Segal algebras B with respect to A, in the case ..... [13] Hewitt E and Ross K A, Abstract harmonic analysis, 2nd edn. I, II (1970) (New York,.

  4. Buffalo complete streets.

    Science.gov (United States)

    2013-01-01

    Buffalo, NY formally adopted a local Complete Streets ordinance in 2008; however, implementation has yet : to become institutionalized. Buffalos Complete Streets Coalition, a multi-sector partnership was convened : to implement a Summit and Neighb...

  5. [A study on the abbreviated form of the Eysenck Personality Questionnaire Revised-Abbreviated (EPQR-A) in a student population].

    Science.gov (United States)

    Bouvard, M; Aulard-Jaccod, J; Pessonneaux, S; Hautekeete, M; Rogé, B

    2010-12-01

    The aim of this paper is to examine the short questionnaire of the Eysenck Personality Questionnaire Revised (the Eysenck Personality Questionnaire Revised-Abbreviated [EPQR-A]) among a student population. University students were invited, in groups, to fill in the forms proposed. Three sites were compared, representing a sample of 346 participants (Chambéry=118 subjects [44 males and 74 females]; Lille=110 subjects [50 males and 60 females] and Toulouse=118 subjects [60 males and 58 females]). The three groups of students have comparable scores on the EPQR-A wherever they live (Chambéry, Lille or Toulouse). Moreover, neither the age nor the gender allowed the detection of differences between subjects. Our sample of students is situated in the range of a "normal" group of students. Regarding the internal consistency coefficients, the French version we used of the neuroticism and the extraversion scales of the EPQR-A obtained a satisfactory result. The internal consistency coefficient of psychoticism was rather low (<70). This unsatisfactory level of internal reliability for the psychoticism is also found in the English version [7]. The four-factor model of the EPQR-A is judged to be an adequate explanation of the data. In the end, self-esteem correlated positively with extraversion and negatively with neuroticism. On the other hand, there is no link between psychoticism and self-esteem. Copyright © 2010 L'Encéphale, Paris. Published by Elsevier Masson SAS. All rights reserved.

  6. Abbreviated bibliography on energy development—A focus on the Rocky Mountain Region

    Science.gov (United States)

    Montag, Jessica M.; Willis, Carolyn J.; Glavin, Levi W.

    2011-01-01

    Energy development of all types continues to grow in the Rocky Mountain Region of the western United States. Federal resource managers increasingly need to balance energy demands, effects on the natural landscape and public perceptions towards these issues. To assist in efficient access to valuable information, this abbreviated bibliography provides citations to relevant information for myriad of issues for which resource managers must contend. The bibliography is organized by seven large topics with various sup-topics: broad energy topics (energy crisis, conservation, supply and demand, etc.); energy sources (fossil fuel, nuclear, renewable, etc.); natural landscape effects (climate change, ecosystem, mitigation, restoration, and reclamation, wildlife, water, etc.); human landscape effects (attitudes and perceptions, economics, community effects, health, Native Americans, etc.); research and technology; international research; and, methods and modeling. A large emphasis is placed on the natural and human landscape effects.

  7. Clinical utility of Standardised Assessment of Personality - Abbreviated Scale (SAPAS) among patients with first episode depression

    DEFF Research Database (Denmark)

    Bukh, Jens Drachmann; Bock, Camilla; Vinberg, Maj

    2010-01-01

    for comorbid personality disorder among patients suffering from depression would be of clinical use. METHOD: The present study aimed to assess the utility of the Standardised Assessment of Personality - Abbreviated Scale (SAPAS) as a screen for personality disorder in a population of patients recently......BACKGROUND: Personality disorder frequently co-occurs with depression and seems to be associated with a poorer outcome of treatment and increased risk for recurrences. However, the diagnosing of personality disorder can be lengthy and requires some training. Therefore, a brief screening interview...... diagnosed with first episode depression. A total number of 394 patients with an ICD-10 diagnosis of a single depressive episode were sampled consecutively via the Danish Psychiatric Central Research Register during a 2years inclusion period and assessed by the screening interview and, subsequently...

  8. 76 FR 52475 - Summary of Benefits and Coverage and Uniform Glossary-Templates, Instructions, and Related...

    Science.gov (United States)

    2011-08-22

    ...; instructions, sample language, and a guide for coverage examples calculations to be used in completing the... professionals, patient advocates including those representing ] individuals with limited English proficiency... of vocabulary, such as ``don't'' verses ``do not'' reflects intentional design based on feedback from...

  9. A suggested glossary of terms and standards for measuring wood and bark mill residues

    Science.gov (United States)

    Jeffrey L. Wartluft

    1976-01-01

    Current information about wood and bark residues lacks the consistency needed to enable complete understanding and comparison from source to source. To make information about wood and bark residues more useful for production and marketing decisions, the Forest Products Marketing Laboratory of the USDA Forest Service and the Tennessee Valley Authority prepared this...

  10. Matching Element Symbols with State Abbreviations: A Fun Activity for Browsing the Periodic Table of Chemical Elements

    Science.gov (United States)

    Woelk, Klaus

    2009-01-01

    A classroom activity is presented in which students are challenged to find matches between the United States two-letter postal abbreviations for states and chemical element symbols. The activity aims to lessen negative apprehensions students might have when the periodic table of the elements with its more than 100 combinations of letters is first…

  11. A novel abbreviation standard for organobromine, organochlorine and organophosphorus flame retardants and some characteristics of the chemicals

    NARCIS (Netherlands)

    Bergman, A.; Rydén, A.; Law, R.J.; de Boer, J.; Covaci, A.; Alaee, M.; Birnbaum, L.; Petreas, M.; Rose, M.; Sakai, S.; Van den Eede, N.; van der Veen, I.

    2012-01-01

    Ever since the interest in organic environmental contaminants first emerged 50. years ago, there has been a need to present discussion of such chemicals and their transformation products using simple abbreviations so as to avoid the repetitive use of long chemical names. As the number of chemicals

  12. An Abbreviated Protocol for In Vitro Generation of Functional Human Embryonic Stem Cell-Derived Beta-Like Cells

    DEFF Research Database (Denmark)

    Massumi, Mohammad; Pourasgari, Farzaneh; Nalla, Amarnadh

    2016-01-01

    developed an abbreviated five-stage protocol (25-30 days) to generate human Embryonic Stem Cell-Derived Beta-like Cells (ES-DBCs). We showed that Geltrex, as an extracellular matrix, could support the generation of ES-DBCs more efficiently than that of the previously described culture systems...

  13. The Revised Junior Eysenck Personality Questionnaire (JEPQ-R): Dutch replications of the full length, short, and abbreviated forms

    NARCIS (Netherlands)

    Scholte, R.H.J.; Bruyn, E.E.J. De

    2001-01-01

    This study examines the full-length, short and abbreviated forms of the Revised Junior Eysenck Personality Questionnaire (JEPQ-R) in a Dutch sample of 215 boys and 207 girls, aged 12–14. The reliability and concurrent validity of the scales of the full-length form (JEPQ-R, 81 items), short form

  14. Latino College Completion: Hawaii

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  15. Latino College Completion: Nevada

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  16. Completely random signed measures

    DEFF Research Database (Denmark)

    Hellmund, Gunnar

    Completely random signed measures are defined, characterized and related to Lévy random measures and Lévy bases.......Completely random signed measures are defined, characterized and related to Lévy random measures and Lévy bases....

  17. Latino College Completion: Virginia

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  18. Completeness, supervenience and ontology

    International Nuclear Information System (INIS)

    Maudlin, Tim W E

    2007-01-01

    In 1935, Einstein, Podolsky and Rosen raised the issue of the completeness of the quantum description of a physical system. What they had in mind is whether or not the quantum description is informationally complete, in that all physical features of a system can be recovered from it. In a collapse theory such as the theory of Ghirardi, Rimini and Weber, the quantum wavefunction is informationally complete, and this has often been taken to suggest that according to that theory the wavefunction is all there is. If we distinguish the ontological completeness of a description from its informational completeness, we can see that the best interpretations of the GRW theory must postulate more physical ontology than just the wavefunction

  19. SOURgraphs for efficient completion

    Directory of Open Access Journals (Sweden)

    Christopher Lynch

    1998-12-01

    Full Text Available We introduce a data structure called SOUR graphs and present an efficient Knuth-Bendix completion procedure based on it. SOUR graphs allow for a maximal structure sharing of terms in rewriting systems. The term representation is a dag representation, except that edges are labelled with equational constraints and variable renamings. The rewrite rules correspond to rewrite edges, the unification problems to unification edges. The Critical Pair and Simplification inferences are recognized as patterns in the graph and are performed as local graph transformations. Our algorithm avoids duplicating term structure while performing inferences, which causes exponential behavior in the standard procedure. This approach gives a basis to design other completion algorithms, such as goal-oriented completion, concurrent completion and group completion procedures.

  20. Complete Ureteral Avulsion

    Directory of Open Access Journals (Sweden)

    V. Gupta

    2005-01-01

    Full Text Available Complete avulsion of the ureter is one of the most serious complications of ureteroscopy. It requires open or laparoscopic intervention for repair. This case report emphasizes its management and presents recommendations for prevention in current urological practice.

  1. A Companion to Astronomy and Astrophysics Chronology and Glossary with Data Tables

    CERN Document Server

    Lang, Kenneth R

    2006-01-01

    Astronomy and Astrophysics is a comprehensive, fundamental, up-to-date reference book. It is filled with vital information and basic facts for amateur astronomers and professional astrophysicists, and for anyone interested in the Universe, from the Earth and other planets to the stars, galaxies and beyond. Although serious and thorough, the language, and ideas will attract the general reader, as well as students and professionals. Astronomy and Astrophysics consists of two main parts, a Timeline and a Dictionary. The Timeline is a concise history, arranged chronologically, which provides the complete story of cosmic discovery from early Chinese and Greek astronomy to the latest findings of modern astrophysics and robotic spacecraft. It provides a sense of destination and flow in our growing awareness of the Universe. Each entry in the unfolding narrative is written in a concise, light and friendly style that will be appreciated by all, without being weighted down with incomprehensible specialized terms. The s...

  2. Completeness of Lyapunov Abstraction

    DEFF Research Database (Denmark)

    Wisniewski, Rafal; Sloth, Christoffer

    2013-01-01

    the vector field, which allows the generation of a complete abstraction. To compute the functions that define the subdivision of the state space in an algorithm, we formulate a sum of squares optimization problem. This optimization problem finds the best subdivisioning functions, with respect to the ability......This paper addresses the generation of complete abstractions of polynomial dynamical systems by timed automata. For the proposed abstraction, the state space is divided into cells by sublevel sets of functions. We identify a relation between these functions and their directional derivatives along...

  3. An abbreviated protocol for multilineage neural differentiation of murine embryonic stem cells and its perturbation by methyl mercury.

    Science.gov (United States)

    Theunissen, P T; Schulpen, S H W; van Dartel, D A M; Hermsen, S A B; van Schooten, F J; Piersma, A H

    2010-07-01

    Alternative assays are highly desirable to reduce the extensive experimental animal use in developmental toxicity testing. In the present study, we developed an improved test system for assessing neurodevelopmental toxicity using differentiating embryonic stem cells. We advanced previously established methods by merging, modifying and abbreviating the original 20-day protocol into a more efficient 13-day neural differentiation protocol. Using morphological observation, immunocytochemistry, gene expression and flow cytometry, it was shown predominantly multiple lineages of neuroectodermal cells were formed in our protocol and to a lower extent, endodermal and mesodermal differentiated cell types. This abbreviated protocol should lead to an advanced screening method using morphology in combination with selected differentiation markers aimed at predicting neurodevelopmental toxicity. Finally, the assay was shown to express differential sensitivity to a model developmental neurotoxicant, methyl mercury.

  4. Construction completion report

    International Nuclear Information System (INIS)

    1990-01-01

    This Construction Completion Report documents the major construction projects at the Waste Isolation Pilot Plant (WIPP) site and related information on contracts, schedules, and other areas which affected construction. This report is not intended to be an exhaustive detailed analysis of construction, but is a general overview and summary of the WIPP construction. 10 refs., 29 figs

  5. Complete French Teach Yourself

    CERN Document Server

    Graham, Gaelle

    2010-01-01

    The best-selling complete course for a fun and effective way to learn French. This ISBN is for the paperback book. The corresponding audio support (ISBN: 9781444100068) is also available. The book and audio support can also be purchased as a pack (ISBN: 9781444100051).

  6. Validity and Reliability of the Abbreviated Barratt Impulsiveness Scale in Spanish (BIS-15S)*

    Science.gov (United States)

    Orozco-Cabal, Luis; Rodríguez, Maritza; Herin, David V.; Gempeler, Juanita; Uribe, Miguel

    2010-01-01

    Objective This study determined the validity and reliability of a new, abbreviated version of the Spanish Barratt Impulsiveness Scale (BIS-15S) in Colombian subjects. Method The BIS-15S was tested in non-clinical (n=283) and clinical (n=164) native Spanish-speakers. Intra-scale reliability was calculated using Cronbach’s α, and test-retest reliability was measured with Pearson correlations. Psychometric properties were determined using standard statistics. A factor analysis was performed to determine BIS-15S factor structure. Results 447 subjects participated in the study. Clinical subjects were older and more educated compared to non-clinical subjects. Impulsivity scores were normally distributed in each group. BIS-15S total, motor, non-planning and attention scores were significantly lower in non-clinical vs. clinical subjects. Subjects with substance-related disorders had the highest BIS-15S total scores, followed by subjects with bipolar disorders and bulimia nervosa/binge eating. Internal consistency was 0.793 and test-retest reliability was 0.80. Factor analysis confirmed a three-factor structure (attention, motor, non-planning) accounting for 47.87% of the total variance in BIS-15S total scores. Conclusions The BIS-15S is a valid and reliable self-report measure of impulsivity in this population. Further research is needed to determine additional components of impulsivity not investigated by this measure. PMID:21152412

  7. The Convergent, Discriminant, and Concurrent Validity of Scores on the Abbreviated Self-Leadership Questionnaire

    Directory of Open Access Journals (Sweden)

    Faruk Şahin

    2015-10-01

    Full Text Available The present study reports the psychometric properties of a short measure of self-leadership in the Turkish context: the Abbreviated Self-Leadership Questionnaire (ASLQ. The ASLQ was examined using two samples and showed sound psychometric properties. Confirmatory factor analysis showed that nine-item ASLQ measured a single construct of self-leadership. The results supported the convergent and discriminant validity of the one-factor model of the ASLQ in relation to the 35-item Revised Self-Leadership Questionnaire and General Self-Efficacy scale, respectively. With regard to internal consistency and test-retest reliability, the ASLQ showed acceptable results. Furthermore, the results provided evidence that scores on the ASLQ positively predicted individual's self-reported task performance and self-efficacy mediated this relationship. Taken together, these findings suggest that the Turkish version of the ASLQ is a reliable and valid measure that can be used to measure self-leadership as one variable of interest in the future studies.

  8. Relationship between acceptable noise level and the abbreviated profile of hearing aid benefit.

    Science.gov (United States)

    Freyaldenhoven, Melinda C; Nabelek, Anna K; Tampas, Joanna W

    2008-02-01

    This study investigated the relationship between acceptable noise levels (ANLs) and the Abbreviated Profile of Hearing Aid Benefit (APHAB; R. M. Cox & G. C. Alexander, 1995). This study further examined the APHAB's ability to predict hearing aid use. ANL and APHAB data were collected for 191 listeners with impaired hearing, separated into 3 groups based on hearing aid use: full-time, part-time, or nonuse. Results demonstrated ANLs were not correlated with APHAB scores. Results further demonstrated 2 of the 4 APHAB subscales (Ease of Communication [EC] and Background Noise [BN]) predicted hearing aid success with 60% accuracy, which is 25% poorer than that observed using the ANL alone. When combining the ANL with the EC and BN subscales, accuracy of the prediction increased to 91%. Lastly, 3 of the 4 APHAB subscales (EC, BN, and Reverberation) enhanced the present prediction of hearing aid use for patients with mid-range ANLs. These results indicate that ANLs and APHAB scores provide unique information regarding hearing aid use. These results further indicate that the prediction can be enhanced by administering both the ANL and the EC and BN APHAB subscales. Lastly, some of the ambiguity of the prediction of hearing aid use for listeners with mid-range ANLs may be eliminated.

  9. Development of an abbreviated Career Indecision Profile-65 using item response theory: The CIP-Short.

    Science.gov (United States)

    Xu, Hui; Tracey, Terence J G

    2017-03-01

    The current study developed an abbreviated version of the Career Indecision Profile-65 (CIP-65; Hacker, Carr, Abrams, & Brown, 2013) by using item response theory. In order to improve the efficiency of the CIP-65 in measuring career indecision, the individual item performance of the CIP-65 was examined with respect to the ordering of response occurrence and gender differential item functioning. The best 5 items of each scale of the CIP-65 (i.e., neuroticism/negative affectivity, choice/commitment anxiety, lack of readiness, and interpersonal conflicts) were retained in the CIP-Short using a sample of 588 college students. A validation sample (N = 174) supported the reliability and structural validity of the CIP-Short. The convergent and divergent validity of the CIP-Short was additionally supported in the findings of a hypothesized differential relational pattern in a separate sample (N = 360). While the current study supported the CIP-Short being a sound brief measure of career indecision, the limitations of this study and suggestions for future research were discussed as well. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  10. Rest improves performance, nature improves happiness: Assessment of break periods on the abbreviated vigilance task.

    Science.gov (United States)

    Finkbeiner, Kristin M; Russell, Paul N; Helton, William S

    2016-05-01

    The abbreviated vigilance task can quickly generate vigilance decrements, which has been argued is due to depletion of cognitive resources needed to sustain performance. Researchers suggest inclusion of rest breaks within vigilance tasks improve overall performance (Helton & Russell, 2015; Ross, Russell, & Helton, 2014), while different types of breaks demonstrate different effects. Some literature suggests exposure to natural movements/stimuli helps restore attention (Herzog, Black, Fountaine, & Knotts, 1997; Kaplan, 1995). Participants were randomly assigned to one experimental condition: dog video breaks, robot video breaks, countdown breaks or continuous vigilance. We assessed task performance and subjective reports of stress/workload. The continuous group displayed worst performance, suggesting breaks help restore attention. The dog videos did not affect performance, however, decreased reports of distress. These results support the importance of rest breaks and acknowledge the benefit of natural stimuli for promoting wellbeing/stress relief, overall suggesting performance and wellbeing may be independent, which warrants future studies. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Reliability and validity of the Farsi version of the standardized assessment of personality-abbreviated scale

    Directory of Open Access Journals (Sweden)

    Maryam Sepehri

    2017-06-01

    Full Text Available Introduction: A short screening tool for high-risk individuals with personality disorder (PD is useful both for clinicians and researchers. The aim of this study was to assess the validity and reliability of the Farsi version of the Standardized Assessment of Personality-Abbreviated Scale (SAPAS. Methods: The original English version of the SAPAS questionnaire was translated into Farsi, and then, translated back into English by two professionals. A survey was then conducted using the questionnaire on 150 clients of primary health care centers in Tabriz, Iran. A total of 235 medical students were also studied for the reliability assessment of the questionnaire. The SAPAS was compared to the short form of Minnesota Multiphasic Personality Inventory (MMPI. The data analysis was performed using receiver operating characteristic (ROC curve technique, operating characteristic for diagnostic efficacy, Cronbach's alpha, and test-retest for reliability evaluation. Results: We found an area under the curve (AUC of 0.566 [95% confidence intervals (CI: 0.455-0.677]; sensitivity of 0.89 and specificity of 0.26 at the cut-off score of 2 and higher. The total Cronbach's alpha coefficient was 0.38 and Cohen's kappa ranged between 0.5 and 0.8. Conclusion: The current study showed that the Farsi version of the SAPAS was relatively less efficient, in term of validity and reliability, in the screening of PD in the population.

  12. Finding abbreviations in biomedical literature: three BioC-compatible modules and four BioC-formatted corpora.

    Science.gov (United States)

    Islamaj Doğan, Rezarta; Comeau, Donald C; Yeganova, Lana; Wilbur, W John

    2014-01-01

    BioC is a recently created XML format to share text data and annotations, and an accompanying input/output library to promote interoperability of data and tools for natural language processing of biomedical text. This article reports the use of BioC to address a common challenge in processing biomedical text information-that of frequent entity name abbreviation. We selected three different abbreviation definition identification modules, and used the publicly available BioC code to convert these independent modules into BioC-compatible components that interact seamlessly with BioC-formatted data, and other BioC-compatible modules. In addition, we consider four manually annotated corpora of abbreviations in biomedical text: the Ab3P corpus of 1250 PubMed abstracts, the BIOADI corpus of 1201 PubMed abstracts, the old MEDSTRACT corpus of 199 PubMed(®) citations and the Schwartz and Hearst corpus of 1000 PubMed abstracts. Annotations in these corpora have been re-evaluated by four annotators and their consistency and quality levels have been improved. We converted them to BioC-format and described the representation of the annotations. These corpora are used to measure the three abbreviation-finding algorithms and the results are given. The BioC-compatible modules, when compared with their original form, have no difference in their efficiency, running time or any other comparable aspects. They can be conveniently used as a common pre-processing step for larger multi-layered text-mining endeavors. Database URL: Code and data are available for download at the BioC site: http://bioc.sourceforge.net. Published by Oxford University Press 2014. This work is written by US Government employees and is in the public domain in the US.

  13. Environmental restoration and waste management site-specific plan for Richland Operations Office. [Contains glossary

    Energy Technology Data Exchange (ETDEWEB)

    1991-09-01

    This document was prepared to implement and support the US Department of Energy-Headquarters (DOE-HQ) national plan. The national plan, entitled Environmental Restoration and Waste Management Five-Year Plan (DOE 1990b) (hereinafter referred to as the DOE-HQ Five-Year Plan) is the cornerstone of the US Department of Energy's (DOE) long-term strategy in environmental restoration and waste management. The DOE-HQ Five-Year Plan addresses overall philosophy and environmental and waste-related activities under the responsibilities of the DOE Office of Environmental Restoration and Waste Management. The plan also reaffirms DOE-HQ goals to bring its nuclear sites into environmental compliance in cooperation with its regulators and the public, and to clean up and restore the environment by 2019 (the commitment for the Hanford Site is for one year sooner, or 2018). This document is part of the site-specific plan for the US Department of Energy-Richland Operations Office (DOE-RL). It is the first revision of the original plan, which was dated December 1989 (DOE-RL 1989a). This document is a companion document to the Overview of the Hanford Cleanup Five-Year Plan (DOE-RL 1989d) and The Hanford Site Environmental Restoration and Waste Management Five-Year Plan Activity Data Sheets (DOE-RL 1991). Although there are three documents that make up the complete DOE-RL plan, this detailed information volume was prepared so it could be used as a standalone document. 71 refs., 40 figs., 28 tabs.

  14. Multi-country evaluation of affective experience: validation of an abbreviated version of the day reconstruction method in seven countries.

    Directory of Open Access Journals (Sweden)

    José Luis Ayuso-Mateos

    Full Text Available The Day Reconstruction Method (DRM was developed to assess affective states as measures of experienced well-being. The present study aimed to validate an abbreviated version of the DRM in a representative sample of the population in seven countries (China, Ghana, India, Mexico, Russia, South Africa, and Spain, and to examine whether there are country differences in affect and in the relationships among the activities based on the similarity of the affect associated with each of them.Interviews were conducted with 47,222 non-institutionalized adults from seven countries, using an abbreviated version of the DRM. A cluster analysis was carried out to classify activities on the basis of the similarity of the associated affect. In each country, the factorial structure of the affect adjectives was tested through Confirmatory Factor Analysis. Internal consistency and construct validity were also assessed. Moreover, the differences in affect across countries and the diurnal cycles of affect were evaluated.The DRM showed adequate psychometric properties regarding reliability and construct validity in all countries. Respondents from Ghana and South Africa reported more positive net affect whereas Indian respondents reported less positive net affect. Most of the countries showed a similar diurnal variation of affect, which tended to improve throughout the day.The results show that this abbreviated version of the DRM is a useful tool for multi-country evaluation of experienced well-being.

  15. The Abbreviated Westmead Post-traumatic Amnesia Scale and Pocket Concussion Recognition Tool: Data from amateur sports players in live-match conditions.

    Science.gov (United States)

    Hayter, Christopher; Meares, Susanne; Shores, E Arthur

    2017-01-01

    Sports-related concussion is a growing public health concern. A short, simple sideline assessment tool is essential for evaluation of concussion at an amateur participation level. The current study examined responses to sideline assessment measures in a sample of amateur Australian Rules Football players competing in real-time live matches who had not sustained a concussion on the day of testing. Participants (N = 127) completed the Abbreviated Westmead Post-traumatic Amnesia Scale (A-WPTAS) and the Pocket Concussion Recognition Tool (Pocket CRT), which contains the Maddocks Questions (assessing orientation and recent memory) and the Postconcussion Symptom Scale (PCSS). The study showed 98.4% of participants passed the A-WPTAS, while 81.9% passed the Maddocks Questions. Participants endorsed a mean of 4.16 (SD = 4.02) symptoms on the PCSS, with 86.6% endorsing at least 1 symptom at a mild level or greater and 40.2% endorsing at least 1 symptom at a moderate or severe level. The current results suggest the Maddocks Questions may not be sufficient for use in an amateur sports context. To reduce the risk for a false positive diagnosis of concussion, it is recommended that the Pocket CRT be complemented with the A-WPTAS for use in an amateur sports context.

  16. The complete cosmicomics

    CERN Document Server

    Calvino, Italo

    2014-01-01

    The definitive edition of Calvino’s cosmicomics, bringing together all of these enchanting stories—including some never before translated—in one volume for the first time. In Italo Calvino’s cosmicomics, primordial beings cavort on the nearby surface of the moon, play marbles with atoms, and bear ecstatic witness to Earth’s first dawn. Exploring natural phenomena and the origins of the universe, these beloved tales relate complex scientific concepts to our common sensory, emotional, human world. Now, The Complete Cosmicomics brings together all of the cosmicomic stories for the first time. Containing works previously published in Cosmicomics, t zero, and Numbers in the Dark, this single volume also includes seven previously uncollected stories, four of which have never been published in translation in the United States. This “complete and definitive collection” (Evening Standard) reconfirms the cosmicomics as a crowning literary achievement and makes them available to new generations of reader...

  17. Complete scanpaths analysis toolbox.

    Science.gov (United States)

    Augustyniak, Piotr; Mikrut, Zbigniew

    2006-01-01

    This paper presents a complete open software environment for control, data processing and assessment of visual experiments. Visual experiments are widely used in research on human perception physiology and the results are applicable to various visual information-based man-machine interfacing, human-emulated automatic visual systems or scanpath-based learning of perceptual habits. The toolbox is designed for Matlab platform and supports infra-red reflection-based eyetracker in calibration and scanpath analysis modes. Toolbox procedures are organized in three layers: the lower one, communicating with the eyetracker output file, the middle detecting scanpath events on a physiological background and the one upper consisting of experiment schedule scripts, statistics and summaries. Several examples of visual experiments carried out with use of the presented toolbox complete the paper.

  18. CMS Is Finally Completed

    CERN Multimedia

    2008-01-01

    Yet another step in the completion of the Large Hadron Collider was taken yesterday morning, as the final element of the Compact Muon Solenoid was lowered nearly 100 meters bellow ground. After more than eight years of work at the world's most powerful particle accelerator, scientists hope that they will be able to start initial experiments with the LHC until the end of this year.

  19. LEAR construction completed

    CERN Multimedia

    CERN PhotoLab

    1982-01-01

    In July 1982, LEAR construction was completed, the individual systems had been dry-tested. On 16 July, the first 50 MeV (309 MeV/c) protons from Linac 1 were injected and circulated. On 11 October, the first antiprotons from the AA, decelerated in the PS to 609 MeV/c, were injected. Also in 1982, acceleration, deceleration and stochastic cooling were successfully tested. See 9007366 for a more detailed description. See also 8201061, 8204131, 8309026.

  20. SOURgraphs for efficient completion

    OpenAIRE

    Christopher Lynch; Polina Strogova

    1998-01-01

    We introduce a data structure called SOUR graphs and present an efficient Knuth-Bendix completion procedure based on it. SOUR graphs allow for a maximal structure sharing of terms in rewriting systems. The term representation is a dag representation, except that edges are labelled with equational constraints and variable renamings. The rewrite rules correspond to rewrite edges, the unification problems to unification edges. The Critical Pair and Simplification inferences are recogniz...

  1. SHIVA laser: nearing completion

    International Nuclear Information System (INIS)

    Glaze, J.A.; Godwin, R.O.

    1977-01-01

    Construction of the Shiva laser system is nearing completion. This laser will be operating in fall 1977 and will produce over 20 terawatts of focusable power in a subnanosecond pulse. Fusion experiments will begin early in 1978. It is anticipated that thermonuclear energy release equal to one percent that of the incident light energy will be achieved with sub-millimeter deuterium-tritium targets. From other experiments densities in excess of a thousand times that of liquid are also expected

  2. SCT Barrel Assembly Complete

    CERN Multimedia

    L. Batchelor

    As reported in the April 2005 issue of the ATLAS eNews, the first of the four Semiconductor Tracker (SCT) barrels, complete with modules and services, arrived safely at CERN in January of 2005. In the months since January, the other three completed barrels arrived as well, and integration of the four barrels into the entire barrel assembly commenced at CERN, in the SR1 building on the ATLAS experimental site, in July. Assembly was completed on schedule in September, with the addition of the innermost layer to the 4-barrel assembly. Work is now underway to seal the barrel thermal enclosure. This is necessary in order to enclose the silicon tracker in a nitrogen atmosphere and provide it with faraday-cage protection, and is a delicate and complicated task: 352 silicon module powertapes, 352 readout-fibre bundles, and over 400 Detector Control System sensors must be carefully sealed into the thermal enclosure bulkhead. The team is currently verifying the integrity of the low mass cooling system, which must be d...

  3. Statistics a complete introduction

    CERN Document Server

    Graham, Alan

    2013-01-01

    Statistics: A Complete Introduction is the most comprehensive yet easy-to-use introduction to using Statistics. Written by a leading expert, this book will help you if you are studying for an important exam or essay, or if you simply want to improve your knowledge. The book covers all the key areas of Statistics including graphs, data interpretation, spreadsheets, regression, correlation and probability. Everything you will need is here in this one book. Each chapter includes not only an explanation of the knowledge and skills you need, but also worked examples and test questions.

  4. Complete pancreas traumatic transsection

    Directory of Open Access Journals (Sweden)

    H. Hodžić

    2005-02-01

    Full Text Available This report presents a case of a twenty-year old male with complete pancreas breakdown in the middle of its corpus, which was caused by a strong abdomen compression, with injuries of the spleen, the firstjejunumcurve,mesocolon transversum, left kidney, and appereance of retroperitoneal haemathoma. Surgical treatment started 70 minutes after the injury. The treatment consisted of left pancreatectomy with previous spleenectomy, haemostasis of ruptured mesocolon transversum blood vessels, left kidney exploration, suturing of the firstjejunumcurvelession and double abdomen drainage. Posttraumatic pancreatitis which appeared on the second postoperative day and prolonged drain secretion were successfully solved by conservative treatment.

  5. TestComplete cookbook

    CERN Document Server

    Alpaev, Gennadiy

    2013-01-01

    A practical cookbook, with a perfect package of simple, medium, and advanced recipes targeted at basic programmers as well as expert software testers, who will learn to create, manage, and run automated tests. It is packed with problem-solving recipes that are supported by simple examples.If you are a software tester or a programmer who is involved with testing automation using TestComplete, this book is ideal for you! You will be introduced to the very basics of using the tool, as well as polish any previously gained knowledge in using the tool. If you are already aware of programming basics,

  6. Abbreviated MRI protocols for detecting breast cancer in women with dense breasts

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Shung Qing; Huang, Min; Shen, Yu Ying; Liu, Chen Lu; Xu, Chuan Xiao [The Affiliated Suzhou Hospital, Nanjing Medical University, Suzhou (China)

    2017-06-15

    To evaluate the validity of two abbreviated protocols (AP) of MRI in breast cancer screening of dense breast tissue. This was a retrospective study in 356 participants with dense breast tissue and negative mammography results. The study was approved by the Nanjing Medical University Ethics Committee. Patients were imaged with a full diagnostic protocol (FDP) of MRI. Two APs (AP-1 consisting of the first post-contrast subtracted [FAST] and maximum-intensity projection [MIP] images, and AP-2 consisting of AP-1 combined with diffusion-weighted imaging [DWI]) and FDP images were analyzed separately, and the sensitivities and specificities of breast cancer detection were calculated. Of the 356 women, 67 lesions were detected in 67 women (18.8%) by standard MR protocol, and histological examination revealed 14 malignant lesions and 53 benign lesions. The average interpretation time of AP-1 and AP-2 were 37 seconds and 54 seconds, respectively, while the average interpretation time of the FDP was 3 minutes and 25 seconds. The sensitivities of the AP-1, AP-2, and FDP were 92.9, 100, and 100%, respectively, and the specificities of the three MR protocols were 86.5, 95.0, and 96.8%, respectively. There was no significant difference among the three MR protocols in the diagnosis of breast cancer (p > 0.05). However, the specificity of AP-1 was significantly lower than that of AP-2 (p = 0.031) and FDP (p = 0.035), while there was no difference between AP-2 and FDP (p > 0.05). The AP may be efficient in the breast cancer screening of dense breast tissue. FAST and MIP images combined with DWI of MRI are helpful to improve the specificity of breast cancer detection.

  7. Norfolk and southern eastville 10 x 20 NTMS areas Virginia and North Carolina. Data report (abbreviated)

    International Nuclear Information System (INIS)

    Cook, J.R.

    1981-06-01

    This abbreviated data report presents results of ground water and stream sediment reconnaissance in the National Topographic Map Series (NTMS) Norfolk 1 0 x 2 0 quadrangle and the southern one-half of the Eastville 1 0 x 2 0 quadrangle. Surface sediment samples were collected at 840 sites. Ground water samples were collected at 1008 sites. Neutron activation analysis (NAA) results are given for uranium and 16 other elements in sediments, and for uranium and 8 other elements in ground water. Field measurements and observations are reported for each site. Analytical data and field measurements are presented in tables and maps. Data from ground water sites include: (1) water chemistry measurements (pH, conductivity, and alkalinity); (2) physical measurements, where applicable (water temperature, well description, etc.); and (3) elemental analyses (U, Al, Br, Cl, Dy, F, Mn, Na, and V). Data from sediment sites include: (1) stream water chemistry measurements (pH, conductivity, and alkalinity); and (2) elemental analyses for sediment samples (U, Th, Hf, Al, Ce, Dy, Eu, Fe, La, Lu, Mn, Sc, Sm, Na, Ti, V, and Yb). Sample site descriptors (stream characteristics, vegetation, etc.) are also tabulated. Areal distribution maps, histograms, and cumulative frequency plots for most elements and for U/Th and U/Hf ratios are included. Uranium concentrations in the sediments that were above detection limits ranged from 0.60 to 40.2 ppM. The mean of the logarithms of the uranium concentrations was 0.61. A large area of high uranium concentrations occurs in the southwestern part of the Norfolk quadrangle. High concentrations of thorium and hafnium in the same area indicate that the uranium is associated with the resistate minerals monazite and zircon

  8. Abbreviated MRI protocols for detecting breast cancer in women with dense breasts

    International Nuclear Information System (INIS)

    Chen, Shung Qing; Huang, Min; Shen, Yu Ying; Liu, Chen Lu; Xu, Chuan Xiao

    2017-01-01

    To evaluate the validity of two abbreviated protocols (AP) of MRI in breast cancer screening of dense breast tissue. This was a retrospective study in 356 participants with dense breast tissue and negative mammography results. The study was approved by the Nanjing Medical University Ethics Committee. Patients were imaged with a full diagnostic protocol (FDP) of MRI. Two APs (AP-1 consisting of the first post-contrast subtracted [FAST] and maximum-intensity projection [MIP] images, and AP-2 consisting of AP-1 combined with diffusion-weighted imaging [DWI]) and FDP images were analyzed separately, and the sensitivities and specificities of breast cancer detection were calculated. Of the 356 women, 67 lesions were detected in 67 women (18.8%) by standard MR protocol, and histological examination revealed 14 malignant lesions and 53 benign lesions. The average interpretation time of AP-1 and AP-2 were 37 seconds and 54 seconds, respectively, while the average interpretation time of the FDP was 3 minutes and 25 seconds. The sensitivities of the AP-1, AP-2, and FDP were 92.9, 100, and 100%, respectively, and the specificities of the three MR protocols were 86.5, 95.0, and 96.8%, respectively. There was no significant difference among the three MR protocols in the diagnosis of breast cancer (p > 0.05). However, the specificity of AP-1 was significantly lower than that of AP-2 (p = 0.031) and FDP (p = 0.035), while there was no difference between AP-2 and FDP (p > 0.05). The AP may be efficient in the breast cancer screening of dense breast tissue. FAST and MIP images combined with DWI of MRI are helpful to improve the specificity of breast cancer detection

  9. Baltimore 10 x 20 NTMS area, Maryland, Pennsylvania, Virginia, and West Virginia: data report (abbreviated)

    International Nuclear Information System (INIS)

    Fay, W.M.

    1981-07-01

    This abbreviated data report presents results of ground water, surface water, and stream sediment reconnaissance in the National Topographic Map Series (NTMS) Baltimore 1 0 x 2 0 NTMS quadrangle. Surface sediment samples were collected at 993 sites. Ground water samples were collected at 777 sites. Neutron activation analysis (NAA) results are given for uranium and 16 other elements in sediments, for uranium and 8 other elements in ground water, and for uranium and 9 other elements in surface water. Field measurements and observations are reported for each site. Analytical data and field measurements are presented. Data from ground water sites include: (1) water chemistry measurements (pH, conductivity, and alkalinity), (2) physical measurements, where applicable (water temperature, well description, etc.), and (3) elemental analyses (U, Al, Br, Cl, Dy, F, Mn, Na, and V). Data from sediment sites include: (1) stream water chemistry measurements (pH, conductivity and alkalinity), and (2) elemental analyses for sediment samples (U, Th, Hf, Al, Ce, Dy, Eu, Fe, La, Lu, Mn, Sc, Sm, Na, Ti, V, and Yb). Sample site descriptors (stream characteristics, vegetation, etc.) are also tabulated. Areal distribution maps, histograms, and cumulative frequency plots for most elements and for U/Th and U/Hf ratios are included on the microfiche. Key data from stream water sites include: (1) water quality measurements (pH, conductivity and alkalinity) and (2) elemental analyses (U, Al, Br, Cl, Dy, F, Mg, Mn, Na, and V). Uranium concentrations in the sediments that were above detection limits ranged from up to 38.7 ppM. The samples with high uranium values also have high thorium values, suggesting that most of the uranium is held within resistate minerals. The north-northeast trend of the geologic units is clearly reflected in the data

  10. [Reliability and validity studies of Turkish translation of Eysenck Personality Questionnaire Revised-Abbreviated].

    Science.gov (United States)

    Karanci, A Nuray; Dirik, Gülay; Yorulmaz, Orçun

    2007-01-01

    The aim of the present study was to examine the reliability and the validity of the Turkish translation of the Eysneck Personality Questionnaire Revised-abbreviated Form (EPQR-A) (Francis et al., 1992), which consists of 24 items that assess neuroticism, extraversion, psychoticism, and lying. The questionnaire was first translated into Turkish and then back translated. Subsequently, it was administered to 756 students from 4 different universities. The Fear Survey Inventory-III (FSI-III), Rosenberg Self-Esteem Scales (RSES), and Egna Minnen Betraffande Uppfostran (EMBU-C) were also administered in order to assess the questionnaire's validity. The internal consistency, test-retest reliability, and validity were subsequently evaluated. Factor analysis, similar to the original scale, yielded 4 factors; the neuroticism, extraversion, psychoticism, and lie scales. Kuder-Richardson alpha coefficients for the extraversion, neuroticism, psychoticism, and lie scales were 0.78, 0.65, 0.42, and 0.64, respectively, and the test-retest reliability of the scales was 0.84, 0.82, 0.69, and 0.69, respectively. The relationships between EPQR-A-48, FSI-III, EMBU-C, and RSES were examined in order to evaluate the construct validity of the scale. Our findings support the construct validity of the questionnaire. To investigate gender differences in scores on the subscales, MANOVA was conducted. The results indicated that there was a gender difference only in the lie scale scores. Our findings largely supported the reliability and validity of the questionnaire in a Turkish student sample. The psychometric characteristics of the Turkish version of the EPQR-A were discussed in light of the relevant literature.

  11. Correntropy Based Matrix Completion

    Directory of Open Access Journals (Sweden)

    Yuning Yang

    2018-03-01

    Full Text Available This paper studies the matrix completion problems when the entries are contaminated by non-Gaussian noise or outliers. The proposed approach employs a nonconvex loss function induced by the maximum correntropy criterion. With the help of this loss function, we develop a rank constrained, as well as a nuclear norm regularized model, which is resistant to non-Gaussian noise and outliers. However, its non-convexity also leads to certain difficulties. To tackle this problem, we use the simple iterative soft and hard thresholding strategies. We show that when extending to the general affine rank minimization problems, under proper conditions, certain recoverability results can be obtained for the proposed algorithms. Numerical experiments indicate the improved performance of our proposed approach.

  12. GOGOL: ACADEMIC AND COMPLETE

    Directory of Open Access Journals (Sweden)

    Yuri V. Mann

    2016-12-01

    Full Text Available The ever-increasing international interest to Gogol explains the necessity of publishing a new edition of his works. The present Complete Collection of Gogol’s Works and Letters is an academic edition prepared and published by the A. M. Gorky Institute of World Literature of the Russian Academy of Sciences. It draws on rich experience of studying and publishing Gogol’s heritage in Russia but at the same time questions and underscores Gogol’s relevance for the modern reader and his place in the world culture of our time. It intends to fill in the gaps left by the previous scholarly tradition that failed to recognize some of Gogol’s texts as part of his heritage. Such are, for example, dedicatory descriptions in books and business notes. The present edition accounts not only for the completeness of texts but also for their place within the body of Gogol’s work, as part of his life-long creative process. By counterpoising different editions, it attempts to trace down the dynamics of Gogol’s creative thought while at the same time underscores the autonomy and relevance of each period in his career. For example, this collection publishes two different versions (editions of the same work: while the most recent version has become canonical at the expense of the preceding one, the latter still preserves its meaning and historical relevance. The present edition has the advantage over its predecessors since it has an actual, physical opportunity to erase the gaps, e.g. to publish the hitherto unpublished texts. However, the editors realize that new, hitherto unknown gaps may appear and the present edition will become, in its turn, outdated. At this point, there will be a necessity in the new edition.

  13. Risk adapted transmission prophylaxis to prevent vertical HIV-1 transmission: effectiveness and safety of an abbreviated regimen of postnatal oral zidovudine.

    Science.gov (United States)

    Neubert, Jennifer; Pfeffer, Maren; Borkhardt, Arndt; Niehues, Tim; Adams, Ortwin; Bolten, Mareike; Reuter, Stefan; Stannigel, Hans; Laws, Hans-Juergen

    2013-01-24

    Antiretroviral drugs including zidovudine (ZDV) are effective in reducing HIV mother to child transmission (MTCT), however safety concern remains. The optimal duration of postnatal ZDV has not been established in clinical studies and there is a lack of consensus regarding optimal management. The objective of this study was to investigate the effectiveness and safety of a risk adapted two week course of oral postnatal ZDV as part of a combined intervention to reduce MTCT. 118 mother infant pairs were treated according to the German-Austrian recommendations for HIV therapy in pregnancy and in HIV exposed newborns between 2000-2010. In the absence of factors associated with an increased HIV-1 transmission risk, children were assigned to the low risk group and treated with an abbreviated postnatal regimen with oral ZDV for 2 weeks. In the presence of risk factors, postnatal ZDV was escalated accordingly. Of 118 mother-infant pairs 79 were stratified to the low risk group, 27 to the high risk group and 11 to the very high risk group for HIV-1 MTCT. 4 children were lost to follow up. Overall Transmission risk in the group regardless of risk factors and completion of prophylaxis was 1.8% (95% confidence interval (CI) 0.09-6.6). If transmission prophylaxis was complete, transmission risk was 0.9% (95% CI 0.01-5.7). In the low risk group receiving two week oral ZDV transmission risk was 1.4% (95% CI 0.01-8.4) These data demonstrate the effectiveness of a short neonatal ZDV regimen in infants of women on stable ART and effective HIV-1 suppression. Further evaluation is needed in larger studies.

  14. Risk adapted transmission prophylaxis to prevent vertical HIV–1 transmission: Effectiveness and safety of an abbreviated regimen of postnatal oral Zidovudine

    Directory of Open Access Journals (Sweden)

    Neubert Jennifer

    2013-01-01

    Full Text Available Abstract Background Antiretroviral drugs including zidovudine (ZDV are effective in reducing HIV mother to child transmission (MTCT, however safety concern remains. The optimal duration of postnatal ZDV has not been established in clinical studies and there is a lack of consensus regarding optimal management. The objective of this study was to investigate the effectiveness and safety of a risk adapted two week course of oral postnatal ZDV as part of a combined intervention to reduce MTCT. Methods 118 mother infant pairs were treated according to the German-Austrian recommendations for HIV therapy in pregnancy and in HIV exposed newborns between 2000–2010. In the absence of factors associated with an increased HIV–1 transmission risk, children were assigned to the low risk group and treated with an abbreviated postnatal regimen with oral ZDV for 2 weeks. In the presence of risk factors, postnatal ZDV was escalated accordingly. Results Of 118 mother-infant pairs 79 were stratified to the low risk group, 27 to the high risk group and 11 to the very high risk group for HIV–1 MTCT. 4 children were lost to follow up. Overall Transmission risk in the group regardless of risk factors and completion of prophylaxis was 1.8% (95% confidence interval (CI 0.09–6.6. If transmission prophylaxis was complete, transmission risk was 0.9% (95% CI 0.01-5.7. In the low risk group receiving two week oral ZDV transmission risk was 1.4% (95% CI 0.01–8.4 Conclusion These data demonstrate the effectiveness of a short neonatal ZDV regimen in infants of women on stable ART and effective HIV–1 suppression. Further evaluation is needed in larger studies.

  15. An Abbreviated Protocol for High-risk Screening Breast Magnetic Resonance Imaging: Impact on Performance Metrics and BI-RADS Assessment.

    Science.gov (United States)

    Panigrahi, Babita; Mullen, Lisa; Falomo, Eniola; Panigrahi, Benita; Harvey, Susan

    2017-09-01

    Annual breast magnetic resonance imaging (MRI) is recommended to screen high-risk populations for breast cancer, although costs are significant. This study assesses the performance of an abbreviated MRI protocol as a resource-efficient approach for screening patients at high-risk of breast cancer, and assesses whether the abbreviated protocol alters the assigned Breast Imaging Reporting and Data System (BI-RADS) category. This is a prospective paired cohort study performed in an academic ambulatory setting. MRI images of women at high risk of breast cancer were reviewed using an abbreviated MRI protocol, followed by an immediate review of additional sequences included in a full diagnostic protocol. BI-RADS assessments, including all changes and interpretation times, were recorded for both the abbreviated and full protocol reviews. Cancer detection rate, positive predictive value 3 (PPV3), sensitivity, and specificity were calculated. A total of 1052 MRI cases were reviewed. The cancer detection rate was 13.3 per 1000 with a PPV3 of 30.4% based on the full protocol. Review of sequences included in the full protocol resulted in a change in the final BI-RADS assessments in 3.4% of the cases, the majority of which did not change clinical management with respect to biopsy. The sensitivity and specificity of the abbreviated and full protocols were not significantly different. This pilot study of an abbreviated MRI protocol demonstrates effective performance in cancer detection. BI-RADS assessments were rarely altered with the additional information afforded by the full protocol. The abbreviated protocol holds promise for resource-efficient breast cancer screening in high-risk women. Copyright © 2017 The Association of University Radiologists. Published by Elsevier Inc. All rights reserved.

  16. Glossary of Terms

    Science.gov (United States)

    ... They will help plan an appropriate diet for optimal nutrition upon discharge as well. 89 Phoenix Society ... specialized pressure masks for the face. Prosthesis Artificial replacement parts for missing body parts or organs: e. ...

  17. Glossary of Television Terms

    Science.gov (United States)

    1987-11-01

    config- uration in an evacuated enclosure so that the ensemble of photo- electrons emitted from each tiny photocathode area does not have the time to...special filter designed to produce a starburst effect whenever the camera sees a high intensity light source. STATIC CONVERGENCE--The combination of

  18. Parasitic Diseases: Glossary

    Science.gov (United States)

    ... of health-related states or events in specified populations, and the application of this study to the control of health problems. Back To Top G Granulomatous Amebic Encephalitis (GAE): A serious infection of the brain and spinal cord that typically occurs in persons with a compromised ...

  19. Tree Improvement Glossary

    DEFF Research Database (Denmark)

    Schmidt, Lars Holger

    Forest tree improvement encompasses a number of scientific and technical areas like floral-, reproductive- and micro-biology, genetics breeding methods and strategies, propagation, gene conservation, data analysis and statistics, each area with a comprehensive terminology. The terms selected...... for definition here are those most frequently used in tree improvement literature. Clonal propagation is included in the view of the great expansion of that field as a means of mass multiplication of improved material....

  20. Eosinophilic Disorders Glossary

    Science.gov (United States)

    ... the small intestine, bypassing the esophagus and stomach. Glucocorticoid See Steroid . Gluten A type of protein found ... the release of leukotrienes or prevents their proinflammatory action in the body. Several different subtypes of leukotrienes ...

  1. TACT glossary: technoscience.

    Science.gov (United States)

    Tambone, V; Pennacchini, M

    2010-01-01

    The term technoscience (T) indicates the complex interactions between contemporary science and technology, that have become practically inseparable. From an epistemological point of view, T only considers the quantitative knowledge in a reductionist way. Nature has been reduced to a machine that works according to laws learnt through the experimental science. At present, technical efficiency represents an operational dominion on Nature; it gives the power to those who possess it. Scientists, considered as visionaries, have the assignment to lead society. They create new cosmos-visions that are technocentric, thus Ts use the human being as subject of experimentation and they transform some essential dimensions of the human being. All this suggests the necessity of an ethical evaluation of the action integration of different subjects in what we call integrated action. This configuration involves ethical obligations for the agent: he/she has to act preserving and allowing the collaboration, and respecting the professional's individual responsibility.

  2. Stem Cell Information: Glossary

    Science.gov (United States)

    ... Long-term self-renewal Meiosis Mesenchymal stem cells Mesoderm Microenvironment Mitosis Multipotent Neural stem cell Neurons Oligodendrocyte ... layers. The three layers are the ectoderm , the mesoderm , and the endoderm . Hematopoietic stem cell - A stem ...

  3. Nuclear power. [Contains glossary

    Energy Technology Data Exchange (ETDEWEB)

    Patterson, W.C.

    1983-01-01

    Lay language brings an understanding of nuclear technology and nuclear politics to the non-specialist reader. The author notes that there has been little change in the technology during the four decades of the nuclear age, but mankind has still to learn how to live with it. Part One explains how reactors work, identifies different reactor types, and describes the fuel cycle. Part two follows research developments during the pre-Manhatten Project days, the war effort, and the decision to pursue commercial nuclear power. He traces the development of policies to secure fission materials and international efforts to prevent the proliferation of weapons grade material and the safe handling of radioactive wastes on a global as well as national scale. There are four appendices, including an annotated reference to other publications. 9 figures.

  4. Glossary of Dental Terms

    Science.gov (United States)

    ... a result of disease or injury of the dental pulp of the tooth, such as a root canal ... artificial appliances designed to restore and maintain oral function by replacing missing teeth and other oral structures such as dentures Public ...

  5. Glossary of Terms

    Science.gov (United States)

    ... use of very low temperatures; cryotherapy or cryoinstrumentation. Mechanical: Incision or excision of tissues. Pharmaceutical: Delivery of ... specially fabricated optical devices. Ocularist A professional who designs, makes, and fits artificial eyes. Comprehensive, or Total, ...

  6. Conformal radiotherapy: a glossary

    International Nuclear Information System (INIS)

    Dubray, B.; Giraud, P.; Beaudre, A.

    1999-01-01

    Most of the concepts and terms related to conformal radiotherapy were produced by English-speaking authors and eventually validated by international groups of experts, whose working language was also English. Therefore, a significant part of this literature is poorly accessible to the French-speaking radiation oncology community. The present paper gathers the 'official' definitions already published in French, along with propositions for the remaining terms which should be submitted to a more formal and representative validation process. (author)

  7. Glossary of MS Terms

    Science.gov (United States)

    ... of the brain to the spinal cord. Brainstem auditory evoked potential (BAEP) A test in which the ... recovery from those relapses along the way. Prospective memory The ability to remember an event or commitment ...

  8. NEI for Kids: Glossary

    Science.gov (United States)

    ... of a normal eye is curved like a basketball, with the same degree of roundness in all ... known as a doctor of optometry, receives different training than an ophthalmologist. Optometrists examine, diagnose, treat, and ...

  9. Lewy Body Dementia Glossary

    Science.gov (United States)

    ... as talk therapy or cognitive behavioral therapy. clinical psychology: Professional specialty concerned with diagnosing and treating diseases ... medical devices by monitoring their effects on large groups of ... occurs at an unusually early age, onset under 65, and affects some individuals in ...

  10. Lung Cancer: Glossary

    Science.gov (United States)

    ... origin, usually the organ where it began. Locally Advanced Cancer: Cancer that has spread only to nearby ... to enjoy life. R Radiation: Energy carried by waves or a stream of particles. Radiation Field: The ...

  11. Diabetes: Glossary of Terms

    Science.gov (United States)

    ... unknown population parameter. Continuous In the Diabetes Atlas application, the data does not have breaks; therefore, the data are ... determines the "break points" where there are relatively big jumps in the data values to best group similar values and to ...

  12. Index of Glossary Terms

    Science.gov (United States)

    ... negative feedback system maintains a steady state or equilibrium and is the one most commonly found in ... constituents of blood and other body fluids (clinical chemistry), analysis of blood cells (hematology), identification of microorganisms ( ...

  13. Eosinophilic Disorders Glossary

    Science.gov (United States)

    ... Pathology Reports Nutrition and Recipes The ABC’s of Food Allergies Alternate Sources of Nutrients Food Diaries & Histories Recipes ... doctor Pathology Reports Nutrition and Recipes ABC’s of Food Allergies Alternate Sources of Nutrients Food Diaries and Histories ...

  14. An English-Spanish glossary of terminology used in forestry, range, wildlife, fishery, soils, and botany (Glosario en Ingles-Espanol de terminologia usada en forestales, pastizales, fauna, silvestre, pesqueria, suelos, y botanica)

    Science.gov (United States)

    Alvin Leroy Medina

    1988-01-01

    The English-Spanish/Spanish-English equivalent translations of scientific and management terms (jargon) commonly used in the field of natural resource management are presented. The glossary is useful in improving communications and fostering understanding between Spanish- and English-speaking persons.

  15. An English-Spanish Glossary of Terminology Used in Forestry, Range, Wildlife, Fishery, Soils, and Botany = Glosario en Ingles-Espanol de Terminologia Usada en Forestales, Pastizales, Fauna, Silvestre, Pesqueria, Suelos, y Botanica.

    Science.gov (United States)

    Medina, Alvin Leroy

    This document presents English-Spanish/Spanish-English equivalent translations of scientific and management terms commonly used in the field of natural resource management. The glossary is composed of two sections. Section 1 contains the English to Spanish translations, while Section 2 provides the Spanish to English translations. Each section is…

  16. Is the full version of the AUDIT really necessary? Study of the validity and internal construct of its abbreviated versions.

    Science.gov (United States)

    Meneses-Gaya, Carolina; Zuardi, Antonio W; Loureiro, Sonia R; Hallak, Jaime E C; Trzesniak, Clarissa; de Azevedo Marques, João M; Machado-de-Sousa, João P; Chagas, Marcos H N; Souza, Roberto M; Crippa, José A S

    2010-08-01

    This study was aimed at assessing the psychometric qualities of the abbreviated versions of the Alcohol Use Disorders Identification Test (AUDIT-3, AUDIT-4, AUDIT-C, AUDIT-PC, AUDIT-QF, FAST, and Five-Shot) and at comparing them to the 10-item AUDIT and the CAGE in 2 samples of Brazilian adults. The validity and internal consistency of the scales were assessed in a sample of 530 subjects attended at an emergency department and at a Psychosocial Care Center for Alcohol and Drugs. The Structured Clinical Interview for DSM-IV was used as the diagnostic comparative measure for the predictive validity assessment. The concurrent validity between the scales was analyzed by means of Pearson's correlation coefficient. The assessment of the predictive validity of the abbreviated versions showed high sensitivity (of 0.78 to 0.96) and specificity (of 0.74 to 0.94) indices, with areas under the curve as elevated as those of the AUDIT (0.89 and 0.92 to screen for abuse and 0.93 and 0.95 in the screening of dependence). The CAGE presented lower indices: 0.81 for abuse and 0.87 for dependence. The analysis of the internal consistency of the AUDIT and its versions exhibited Cronbach's alpha coefficients between 0.83 and 0.94, while the coefficient for the CAGE was 0.78. Significant correlations were found between the 10-item AUDIT and its versions, ranging from 0.91 to 0.99. Again, the results for the CAGE were satisfactory (0.77), although inferior to the other instruments. The results obtained in this study confirm the validity of the abbreviated versions of the AUDIT for the screening of alcohol use disorders and show that their psychometric properties are as satisfactory as those of the 10-item AUDIT and the CAGE.

  17. Does a booster intervention augment the preventive effects of an abbreviated version of the coping power program for aggressive children?

    Science.gov (United States)

    Lochman, John E; Baden, Rachel E; Boxmeyer, Caroline L; Powell, Nicole P; Qu, Lixin; Salekin, Karen L; Windle, Michel

    2014-01-01

    Booster interventions have been presumed to be important methods for maintaining the effects of evidence-based programs for children with behavioral problems, but there has been remarkably little empirical attention to this assumption. The present study examines the effect of a child-oriented booster preventive intervention with children who had previously received an abbreviated version (24 child sessions, 10 parent sessions) of the Coping Power targeted prevention program. Two hundred and forty-one children (152 boys, 89 girls) were screened as having moderate to high levels of aggressive behavior in 4th grade, then half were randomly assigned to receive the abbreviated Coping Power program in 5th grade, and half of the preventive intervention children were then randomly assigned to a Booster condition in 6th grade. The Booster sessions consisted of brief monthly individual contacts, and were primarily with the children. Five assessments across 4 years were collected from teachers, providing a three-year follow-up for all children who participated in the project. Results indicated that the abbreviated Coping Power program (one-third shorter than the full intervention) had long-term effects in reducing children's externalizing problem behaviors, proactive and reactive aggression, impulsivity traits and callous-unemotional traits. The Booster intervention did not augment these prevention effects. These findings indicate that a briefer and more readily disseminated form of an evidence-based targeted preventive intervention was effective. The findings have potential implications for policy and guidelines about possible intervention length and booster interventions.

  18. Drug-abbreviated infections of Trichostrongylus colubriformis and development of immunity in jirds (Meriones unguiculatus).

    Science.gov (United States)

    Ziam, H; Pandey, V S; Elegbe, E; Kumar, V; Dorny, P; Huntley, J F; Maes, L

    2000-08-01

    The objective of this study was to examine the development and the duration of immunity achieved with drug-abbreviated infections of Trichostrongylus colubriformis in jirds (Meriones unguiculatus). Jirds were primarily infected either by trickle infection with 6 x 100 infective larvae (L3) of T. colubriformis at 3-day intervals or by a single infection with 600 L3. On day 35 post-infection, one batch of jirds from each group was autopsied; the others were treated with oxfendazole at a dose of 5 mg/kg and were challenged with 1,000 L3 on either day 7 or day 42 post-treatment. All jirds were autopsied at 17 days post-challenge. Trickle infection resulted in lower levels of egg production during the primary infection period. The systemic IgM and IgG antibody response was significantly stronger in trickle- and single-infected groups as compared with the negative control group (P < 0.01-P < 0.05). Significantly higher levels of intestinal IgA were demonstrated in trickle- and single-infected groups than in the negative control group (P < 0.01). Numbers of mucosal mast cells increased following infection, but this was not dependent on the type of immunisation. After challenge the extent of worm reduction was greater in trickle-infected than in single-infected subgroups. The IgM and IgG response was significantly stronger in challenged subgroups as compared with negative control subgroups (P < 0.01). However, the IgG response was weaker in control challenged subgroups than in challenged subgroups (P < 0.01). There was a negative correlation between the IgG response and the worm burden after the second challenge (r = -0.73). The acquired immunity to T. colubriformis infection in jirds developed within 5 weeks of primary infection. The level of immunity was higher after trickle infection than after single infection. Furthermore, the immunity persisted for at least 6 weeks after oxfendazole treatment in the absence of a worm burden and larval intake, which is very similar to

  19. Diagnostic accuracy of the Kampala Trauma Score using estimated Abbreviated Injury Scale scores and physician opinion.

    Science.gov (United States)

    Gardner, Andrew; Forson, Paa Kobina; Oduro, George; Stewart, Barclay; Dike, Nkechi; Glover, Paul; Maio, Ronald F

    2017-01-01

    The Kampala Trauma Score (KTS) has been proposed as a triage tool for use in low- and middle-income countries (LMICs). This study aimed to examine the diagnostic accuracy of KTS in predicting emergency department outcomes using timely injury estimation with Abbreviated Injury Scale (AIS) score and physician opinion to calculate KTS scores. This was a diagnostic accuracy study of KTS among injured patients presenting to Komfo Anokye Teaching Hospital A&E, Ghana. South African Triage Scale (SATS); KTS component variables, including AIS scores and physician opinion for serious injury quantification; and ED disposition were collected. Agreement between estimated AIS score and physician opinion were analyzed with normal, linear weighted, and maximum kappa. Receiver operating characteristic (ROC) analysis of KTS-AIS and KTS-physician opinion was performed to evaluate each measure's ability to predict A&E mortality and need for hospital admission to the ward or theatre. A total of 1053 patients were sampled. There was moderate agreement between AIS criteria and physician opinion by normal (κ=0.41), weighted (κ lin =0.47), and maximum (κ max =0.53) kappa. A&E mortality ROC area for KTS-AIS was 0.93, KTS-physician opinion 0.89, and SATS 0.88 with overlapping 95% confidence intervals (95%CI). Hospital admission ROC area for KTS-AIS was 0.73, KTS-physician opinion 0.79, and SATS 0.71 with statistical similarity. When evaluating only patients with serious injuries, KTS-AIS (ROC 0.88) and KTS-physician opinion (ROC 0.88) performed similarly to SATS (ROC 0.78) in predicting A&E mortality. The ROC area for KTS-AIS (ROC 0.71; 95%CI 0.66-0.75) and KTS-physician opinion (ROC 0.74; 95%CI 0.69-0.79) was significantly greater than SATS (ROC 0.57; 0.53-0.60) with regard to need for admission. KTS predicted mortality and need for admission from the ED well when early estimation of the number of serious injuries was used, regardless of method (i.e. AIS criteria or physician opinion

  20. Sensitivity and specificity of the abbreviated profile of hearing aid benefit (APHAB).

    Science.gov (United States)

    Löhler, Jan; Gräbner, F; Wollenberg, B; Schlattmann, P; Schönweiler, R

    2017-10-01

    Subjective hearing loss in hearing-impaired patients can be assessed by inventory questionnaires. The abbreviated profile of hearing aid benefit (APHAB) measures subjective hearing loss in four typical hearing situations (subscales). It is used to fit hearing aids in patients with statutory insurance in Germany. In addition, the unaided APHAB (APHAB u ) can be used as a primary diagnostic instrument in audiology. There are no published data regarding the sensitivity and specificity of the unaided APHAB u . Therefore, we investigated these parameters for detecting hearing loss of at least 25 dB at any frequency between 0.5 and 8.0 kHz. We used the APHAB u to determine hearing loss in 245 subjects aged 50 years and older without any reported disease of the ears. Due to incomplete answering of the APHAB form, 55 subjects have been excluded. We also measured the pure-tone thresholds by air conduction for all octave frequencies between 0.5 and 8 kHz. Receiver operating characteristic (ROC) curves and the Youden Index were used to determine the diagnostic value of the APHAB u , particularly sensitivity and specificity, in three different ways: (1) separately for ease of communication (EC u ), background noise (BN u ), and hearing with reverberation (RV u ) subscales; (2) with the mean value of EC u , BN u , and RV u ; and (3) with a logistic regression model. The area under the ROC curve was lower for BN only (0.83) and nearly equal for all other methods (0.87-0.89). Depending on how we performed the analyses, the sensitivity of the APHAB u was 0.70-0.84 (single subscales), 0.76 (mean value of EC u , BN u , and RV u ), or 0.85 (logistic regression model). The specificity was 0.79-0.95. The use of single APHAB u subscales for determining the sensitivity and specificity of the APHAB u due to confusing results. In comparison, the use of the mean value of EC u , BN u , and RV u and the use of the logistic regression model due to equal values in the ROC curves but a

  1. The Compilation of Multilingual Concept Literacy Glossaries at the University of Cape Town: A Lexicographical Function Theoretical Approach Die samestelling van veeltaligekonsep-geletterheidswoordelyste by die Universiteit van Kaapstad: 'n Leksikografiesefunksieteoretiese benadering.

    Directory of Open Access Journals (Sweden)

    Dion Nkomo

    2012-01-01

    Full Text Available

    This article proposes a lexicographical approach to the compilation of multilingual concept literacy glossaries which may play a very important role in supporting students at institutions of higher education. In order to support concept literacy, especially for students for whom English is not the native language, a number of universities in South Africa are compiling multilingual glossaries through which the use of languages other than English may be employed as auxiliary media. Terminologies in languages other than English are developed by translating English terms or coining new terms in these languages to exploit the native language competence of most students. The glossary project at the University of Cape Town (UCT which was conceived under the auspices of the Multilingualism Education Project (MEP is discussed. It is shown that the UCT glossaries are compiled using methods consistent with those employed in modern lexicography or proffered in lexicographical theory. The lexicographical function theory is specifically used to account for the glossaries and their production. It is suggested that modern lexicography can provide useful guidance for the production of glossaries, given that the earliest glossaries constitute the humble beginnings of lexicography.

    Hierdie artikel stel 'n leksikografiese benadering tot die samestelling van meertaligekonsep-geletterheidswoordelyste voor wat 'n baie belangrike rol kan speel by die ondersteuning van studente by instellings vir hoër onderwys. Om konsepgeletterdheid te ondersteun, veral vir studente vir wie Engels nie die moedertaal is nie, stel 'n aantal universiteite in Suid-Afrika meertalige woordelyste saam waardeur die gebruik van ander tale as Engels as hulpmedia aangewend kan word. Terminologieë in ander tale as Engels word ontwikkel deur Engelse terme te vertaal of nuwe terme in hierdie tale te skep om die moedertaalvaardigheid van die meeste

  2. Essay on the pertinence of Luscher's abbreviate test in psychological evaluation of the radioactive accident victims of Goiania

    International Nuclear Information System (INIS)

    Costa Neto, Sebastiao Benicio da

    1995-01-01

    The essay on the pertinence of Luscher's abbreviate test in psychological evaluation of the radioactive accident victims of Goiania - Brazilian city - occurred in 1987 is consequence of confront of data obtained in two distinct situations having for criterion: time, efficiency and pertinence. Besides of this, they are introduced palografic and the house-tree-person - HTP - tests. These tests aimed at the common psychological characteristics verification to radioactive accident victims' personality of Goiania and to the data existential moment for those people. Among the three tests, the one of Luscher was what obtained the best interviewees acceptance index

  3. IAEA safety glossary. Terminology used in nuclear safety and radiation protection, multilingual 2007 edition, including the IAEA safety fundamentals [no. SF-1

    International Nuclear Information System (INIS)

    2008-10-01

    The IAEA Safety Glossary defines and explains technical terms used in the IAEA Safety Standards and other safety related IAEA publications, and provides information on their usage.The publication is multilingual and covers the six official IAEA languages,, Arabic, Chinese, English, French, Russian and Spanish. It has been in use since April 2000. The 2007 Edition is a revised and updated version. The primary purpose of the publication is to harmonize terminology and usage in the IAEA Safety Standards. It is a source of information for users of the IAEA Safety Standards and other safety related IAEA publications and provides guidance for the drafters and reviewers of publications, including IAEA technical officers and consultants, and members of technical committees, advisory groups, working groups and bodies for the endorsement of safety standards

  4. Zipf's Law of Abbreviation and the Principle of Least Effort: Language users optimise a miniature lexicon for efficient communication.

    Science.gov (United States)

    Kanwal, Jasmeen; Smith, Kenny; Culbertson, Jennifer; Kirby, Simon

    2017-08-01

    The linguist George Kingsley Zipf made a now classic observation about the relationship between a word's length and its frequency; the more frequent a word is, the shorter it tends to be. He claimed that this "Law of Abbreviation" is a universal structural property of language. The Law of Abbreviation has since been documented in a wide range of human languages, and extended to animal communication systems and even computer programming languages. Zipf hypothesised that this universal design feature arises as a result of individuals optimising form-meaning mappings under competing pressures to communicate accurately but also efficiently-his famous Principle of Least Effort. In this study, we use a miniature artificial language learning paradigm to provide direct experimental evidence for this explanatory hypothesis. We show that language users optimise form-meaning mappings only when pressures for accuracy and efficiency both operate during a communicative task, supporting Zipf's conjecture that the Principle of Least Effort can explain this universal feature of word length distributions. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Abbreviated Biparametric Prostate MR Imaging in Men with Elevated Prostate-specific Antigen.

    Science.gov (United States)

    Kuhl, Christiane K; Bruhn, Robin; Krämer, Nils; Nebelung, Sven; Heidenreich, Axel; Schrading, Simone

    2017-11-01

    Purpose To determine the diagnostic accuracy for clinically significant prostate cancer achieved with abbreviated biparametric prostate magnetic resonance (MR) imaging in comparison with full multiparametric contrast material-enhanced prostate MR imaging in men with elevated prostate-specific antigen (PSA) and negative transrectal ultrasonography (US)-guided biopsy findings; to determine the significant cancer detection rate of biparametric versus full multiparametric contrast-enhanced MR imaging and between-reader agreement for interpretation of biparametric MR imaging. Materials and Methods In this institutional review board-approved retrospective review of prospectively acquired data, men with PSA greater than or equal to 3 ng/mL after negative transrectal US-guided biopsy findings underwent state-of-the-art, full multiparametric contrast-enhanced MR imaging at 3.0-T including high-spatial-resolution structural imaging in several planes, diffusion-weighted imaging at 0, 800, 1000, and 1400 mm 2 /sec, and dynamic contrast-enhanced MR imaging, obtained without endorectal coil within 34 minutes 19 seconds. One of four radiologists with different levels of expertise (1-9 years) first reviewed only a fraction of the full multiparametric contrast-enhanced MR images, consisting of single-plane (axial) structural imaging (T2-weighted turbo spin-echo and diffusion-weighted imaging), acquired within 8 minutes 45 seconds (referred to as biparametric MR imaging), and established a diagnosis according to the Prostate Imaging Reporting and Data System (PI-RADS) version 2; only thereafter, the remaining full multiparametric contrast-enhanced MR images were read. Men with PI-RADS categories 3-5 underwent MR-guided targeted biopsy. Men with PI-RADS categories 1-2 remained in urologic follow-up for at least 2 years, with rebiopsy (transrectal US-guided or transperineal saturation) where appropriate. McNemar test was used to compare diagnostic accuracies. To investigate between

  6. p-topological Cauchy completions

    Directory of Open Access Journals (Sweden)

    J. Wig

    1999-01-01

    Full Text Available The duality between “regular” and “topological” as convergence space properties extends in a natural way to the more general properties “p-regular” and “p-topological.” Since earlier papers have investigated regular, p-regular, and topological Cauchy completions, we hereby initiate a study of p-topological Cauchy completions. A p-topological Cauchy space has a p-topological completion if and only if it is “cushioned,” meaning that each equivalence class of nonconvergent Cauchy filters contains a smallest filter. For a Cauchy space allowing a p-topological completion, it is shown that a certain class of Reed completions preserve the p-topological property, including the Wyler and Kowalsky completions, which are, respectively, the finest and the coarsest p-topological completions. However, not all p-topological completions are Reed completions. Several extension theorems for p-topological completions are obtained. The most interesting of these states that any Cauchy-continuous map between Cauchy spaces allowing p-topological and p′-topological completions, respectively, can always be extended to a θ-continuous map between any p-topological completion of the first space and any p′-topological completion of the second.

  7. Proposal for a revised taxonomy of the family Filoviridae: classification, names of taxa and viruses, and virus abbreviations.

    Science.gov (United States)

    Kuhn, Jens H; Becker, Stephan; Ebihara, Hideki; Geisbert, Thomas W; Johnson, Karl M; Kawaoka, Yoshihiro; Lipkin, W Ian; Negredo, Ana I; Netesov, Sergey V; Nichol, Stuart T; Palacios, Gustavo; Peters, Clarence J; Tenorio, Antonio; Volchkov, Viktor E; Jahrling, Peter B

    2010-12-01

    The taxonomy of the family Filoviridae (marburgviruses and ebolaviruses) has changed several times since the discovery of its members, resulting in a plethora of species and virus names and abbreviations. The current taxonomy has only been partially accepted by most laboratory virologists. Confusion likely arose for several reasons: species names that consist of several words or which (should) contain diacritical marks, the current orthographic identity of species and virus names, and the similar pronunciation of several virus abbreviations in the absence of guidance for the correct use of vernacular names. To rectify this problem, we suggest (1) to retain the current species names Reston ebolavirus, Sudan ebolavirus, and Zaire ebolavirus, but to replace the name Cote d'Ivoire ebolavirus [sic] with Taï Forest ebolavirus and Lake Victoria marburgvirus with Marburg marburgvirus; (2) to revert the virus names of the type marburgviruses and ebolaviruses to those used for decades in the field (Marburg virus instead of Lake Victoria marburgvirus and Ebola virus instead of Zaire ebolavirus); (3) to introduce names for the remaining viruses reminiscent of jargon used by laboratory virologists but nevertheless different from species names (Reston virus, Sudan virus, Taï Forest virus), and (4) to introduce distinct abbreviations for the individual viruses (RESTV for Reston virus, SUDV for Sudan virus, and TAFV for Taï Forest virus), while retaining that for Marburg virus (MARV) and reintroducing that used over decades for Ebola virus (EBOV). Paying tribute to developments in the field, we propose (a) to create a new ebolavirus species (Bundibugyo ebolavirus) for one member virus (Bundibugyo virus, BDBV); (b) to assign a second virus to the species Marburg marburgvirus (Ravn virus, RAVV) for better reflection of now available high-resolution phylogeny; and (c) to create a new tentative genus (Cuevavirus) with one tentative species (Lloviu cuevavirus) for the recently

  8. Automated Test Requirement Document Generation

    Science.gov (United States)

    1987-11-01

    DIAGNOSTICS BASED ON THE PRINCIPLES OF ARTIFICIAL INTELIGENCE ", 1984 International Test Conference, 01Oct84, (A3, 3, Cs D3, E2, G2, H2, 13, J6, K) 425...j0O GLOSSARY OF ACRONYMS 0 ABBREVIATION DEFINITION AFSATCOM Air Force Satellite Communication Al Artificial Intelligence ASIC Application Specific...In-Test Equipment (BITE) and AI ( Artificial Intelligence) - Expert Systems - need to be fully applied before a completely automated process can be

  9. Psychometric investigation of the abbreviated concussion symptom inventory in a sample of U.S. Marines returning from combat.

    Science.gov (United States)

    Campbell, Justin S; Pulos, Steven; Haran, F Jay; Tsao, Jack W; Alphonso, Aimee L

    2015-01-01

    This study describes the psychometric investigation of an 11-item symptom checklist, the Abbreviated Concussion Symptom Inventory (ACSI). The ACSI is a dichotomously scored list of postconcussive symptoms associated with mild traumatic brain injury. The ACSI was administered to Marines (N = 1,435) within the 1st month of their return from combat deployments to Afghanistan. Psychometric analyses based upon nonparametric item response theory supported scoring the ACSI via simple summation of symptom endorsements; doing so produced a total score with good reliability (α = .802). Total scores were also found to significantly differentiate between different levels of head injury complexity during deployment, F(3, 1,431) = 100.75, p < .001. The findings support the use of the ASCI in research settings requiring a psychometrically reliable measure of postconcussion symptoms.

  10. Meet interesting abbreviations in clinical mass spectrometry: from compound classification by REIMS to multimodal and mass spectrometry imaging (MSI).

    Science.gov (United States)

    Luptáková, D; Pluháček, T; Palyzová, A; Přichystal, J; Balog, J; Lemr, K; Juránek, I; Havlíček, V

    This feature article discusses two modern mass spectrometry abbreviations in their clinical applications. Rapid evaporative ionization mass spectrometry (REIMS) is reported as a molecular classification tool useful for spectral features definition prior to mass spectrometry imaging (MSI). REIMS is appreciated not only as an ionization technique coupled with a surgical device but particularly as a biomarker discovery tool. For more complex understanding of pathological processes at cellular and molecular levels, the importance of multimodal approach in imaging applications is documented in the context of fiducial markers needed for hyperspectral data fusion collected by optical microscopy, elemental and molecular MSI. Finally, pathogen inactivation needed prior to the sectioning of the infected tissue is reported, and the impact of formaldehyde crosslinking to signal reduction is discussed.

  11. Myeloproliferative neoplasm (MPN) symptom assessment form total symptom score: Prospective international assessment of an abbreviated symptom burden scoring system among patients with MPNs

    NARCIS (Netherlands)

    R.M. Emanuel (Robyn); A.C. Dueck (Amylou); H.L. Geyer (Holly); J.J. Kiladjian; S. Slot (Stefanie); S. Zweegman (Sonja); P.A.W. te Boekhorst (Peter); S. Commandeur (Suzan); H. Schouten (Harry); F. Sackmann (Federico); A.K. Fuentes (Ana Kerguelen); D. Hernández-Maraver (Dolores); C. Pahl (Clemens); M. Griesshammer (Martin); F. Stegelmann (Frank); K. Doehner (Konstanze); T. Lehmann (Thomas); K. Bonatz (Karin); A. Reiter (Alfred); F. Boyer (Francoise); J. Etienne (Jerome); J.-C. Ianotto (Jean-Christophe); D. Ranta (Dana); L. Roy (Lydia); J.-Y. Cahn (Jean-Yves); C.N. Harrison (Claire); D. Radia (Deepti); P. Muxi (Pablo); N. Maldonado (Norman); C. Besses (Carlos); F. Cervantes (Francisco); P.L. Johansson (Peter); T. Barbui (Tiziano); G. Barosi (Giovanni); A.M. Vannucchi (Alessandro); F. Passamonti (Francesco); B. Andreasson (Bjorn); M.L. Ferarri (Maria); A. Rambaldi (Alessandro); J. Samuelsson (Jan); G. Birgegard (Gunnar); A. Tefferi (Ayalew); A.A. Mesa

    2012-01-01

    textabstractPurpose: Myeloproliferative neoplasm (MPN) symptoms are troublesome to patients, and alleviation of this burden represents a paramount treatment objective in the development of MPN-directed therapies. We aimed to assess the utility of an abbreviated symptom score for the most pertinent

  12. Measuring health outcomes of a multidisciplinary care approach in individuals with chronic environmental conditions using an abbreviated symptoms questionnaire

    Directory of Open Access Journals (Sweden)

    Roy Fox

    2008-12-01

    Full Text Available Roy Fox1, Tara Sampalli1, Jonathan Fox11Nova Scotia Environmental Health Centre, Fall River, NS, CanadaAbstract: The Nova Scotia Environmental Health Centre is a treatment facility for individuals with chronic environmental conditions such as multiple chemical sensitivity, chronic fatigue syndrome, fibromyalgia, chronic respiratory conditions and in some cases chronic pain. The premise of care is to provide a patient-centred multidisciplinary care approach leading to self-management strategies. In order to measure the outcome of the treatment in these complex problems, with overlapping diagnoses, symptoms in many body systems and suspected environmental triggers, a detailed symptoms questionnaire was developed specifically for this patient population and validated. Results from a pilot study in which an abbreviated symptoms questionnaire based on the top reported symptoms captured in previous research was used to measure the efficacy of a multidisciplinary care approach in individuals with multiple chemical sensitivity are presented in this paper. The purpose of this study was to examine the extent, type and patterns of changes over time in the top reported symptoms with treatment measured using the abbreviated symptoms questionnaire. A total of 183 active and 109 discharged patients participated in the study where the health status was measured at different time periods of follow up since the commencement of treatment at the Centre. The findings from this study were successful in generating an initial picture of the nature and type of changes in these symptoms. For instance, symptoms such as difficulty concentrating, sinus conditions and tiredness showed early improvement, within the first 6 months of being in treatment, while others, such as fatigue, hoarseness or loss of voice, took longer while others showed inconsistent changes warranting further enquiry. A controlled longitudinal study is planned to confirm the findings of the pilot study

  13. The patient health questionnaire-15 and its abbreviated version as screening tools for depression in Korean college and graduate students.

    Science.gov (United States)

    Lyoo, Younghyun C; Ju, Sejin; Kim, Eunjung; Kim, Jieun E; Lee, Junghyun H

    2014-04-01

    Over half of all suicides worldwide occur in Asia. Given the close association between suicide and depression, it is quite unexpected that depression is least frequently diagnosed in Asia. This is, in part, due to the fact that Asians somatize depression. Young adults including college and graduate students are no exceptions. Therefore, a somatic symptom-focused screening tool would be useful in detecting depression in Asian college and graduate students. The purpose of this study was to evaluate the psychometric properties of the Patient Health Questionnaire-15 (PHQ-15) in screening for depression among Korean college and graduate students. In addition, we developed an abbreviated version of the PHQ-15 (aPHQ-15) and studied validity measures. Three-hundred and fifty Korean college and graduate students were screened with the PHQ-15. Of all participants, 176 were interviewed using the Structured Clinical Interview for DSM-IV to diagnose major depressive episode, while the other 174 were evaluated with the Beck Depression Inventory-II (BDI-II) and the Inventory of Depressive Symptomatology-Self-Report (IDS-SR). Reliability and validity measures including the internal consistency, test-retest reliability, and criterion, convergent, and divergent validity were tested. Principal component analysis was used in developing the abbreviated version of the PHQ-15. The PHQ-15 showed good internal consistency and test-retest reliability (Cronbach's alpha 0.82, intra-class correlation coefficient 0.87). The optimal cut-off point for detecting depression was estimated to be 8. There were strong correlations between the PHQ-15 total scores and self-report measures of depressive symptom severity (BDI-II: r=0.69 and pdepression. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Complete guide to preventive and predictive maintenance

    CERN Document Server

    Levitt, Joel

    2011-01-01

    This book shares the best practices, mistakes, victories, and essential steps for success which the author has gleaned from working with countless organizations. Unlike other books that only focus on the engineering issues (task lists) or management issues (CMMS), this in-depth resource is the first to give true emphasize to the four aspects of success in preventive maintenance systems - engineering, management, economic, and psychological - thereby enabling readers to have a balanced view and understanding of what is happening in their organizations. Additionally, it blends concrete actionable steps and structures with the theory behind the steps. It includes check sheets, history of PM, stories, photographs, and case histories. It contains a glossary of terms. It provides sample task lists for a variety of equipment with some of the logic behind each task. It offers templates for developing your own tasking. It includes protocols for detailed economic analysis with examples.

  15. N-matrix completion problem

    OpenAIRE

    Araújo, C. Mendes; Torregrosa, Juan R.; Urbano, Ana M.

    2003-01-01

    An n x n matrix is called an N-matrix if all principal minors are negative. In this paper, we are interested in N-matrix completion problems, that is, when a partial N-matrix hás an N-matrix completion. In general, a combinatorially or non-combinatorially symmetric partial N-matrix does not have an N-matrix completion. Here we prove that a combinatorially symmetric partial N-matrix has an N-matrix completion if the graph of its specified entries is a 1-chordal graph. We also prove that there ...

  16. Completeness theorems in transport theory

    International Nuclear Information System (INIS)

    Zweifel, P.F.

    1984-01-01

    Ever since K. M.; Case's famous 1960 paper, transport theorists have been studying the questions of full- and half-range completeness for various transport type equations. The purpose of this note is to try to define exactly what is meant by completeness as it is needed, and used, in solving transport equations and to discuss some of the various techniques which have been, or might be, used to verify completeness. Attention is restricted to the question of full-range completeness. As a paradigm the generalized form of the transport equation first introduced by Beals is adopted

  17. Latino College Completion: New Mexico

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  18. Latino College Completion: West Virginia

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  19. Latino College Completion: United States

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  20. Latino College Completion: South Dakota

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  1. Latino College Completion: North Dakota

    Science.gov (United States)

    Excelencia in Education (NJ1), 2012

    2012-01-01

    In 2009, Excelencia in Education launched the Ensuring America's Future initiative to inform, organize, and engage leaders in a tactical plan to increase Latino college completion. An executive summary of Latino College Completion in 50 states synthesizes information on 50 state factsheets and builds on the national benchmarking guide. Each…

  2. Structure completion for facade layouts

    KAUST Repository

    Fan, Lubin

    2014-11-18

    (Figure Presented) We present a method to complete missing structures in facade layouts. Starting from an abstraction of the partially observed layout as a set of shapes, we can propose one or multiple possible completed layouts. Structure completion with large missing parts is an ill-posed problem. Therefore, we combine two sources of information to derive our solution: the observed shapes and a database of complete layouts. The problem is also very difficult, because shape positions and attributes have to be estimated jointly. Our proposed solution is to break the problem into two components: a statistical model to evaluate layouts and a planning algorithm to generate candidate layouts. This ensures that the completed result is consistent with the observation and the layouts in the database.

  3. Complexity of Products of Some Complete and Complete Bipartite Graphs

    Directory of Open Access Journals (Sweden)

    S. N. Daoud

    2013-01-01

    Full Text Available The number of spanning trees in graphs (networks is an important invariant; it is also an important measure of reliability of a network. In this paper, we derive simple formulas of the complexity, number of spanning trees, of products of some complete and complete bipartite graphs such as cartesian product, normal product, composition product, tensor product, and symmetric product, using linear algebra and matrix analysis techniques.

  4. Cross-validation of the factorial structure of the Neighborhood Environment Walkability Scale (NEWS and its abbreviated form (NEWS-A

    Directory of Open Access Journals (Sweden)

    Cerin Ester

    2009-06-01

    Full Text Available Abstract Background The Neighborhood Environment Walkability Scale (NEWS and its abbreviated form (NEWS-A assess perceived environmental attributes believed to influence physical activity. A multilevel confirmatory factor analysis (MCFA conducted on a sample from Seattle, WA showed that, at the respondent level, the factor-analyzable items of the NEWS and NEWS-A measured 11 and 10 constructs of perceived neighborhood environment, respectively. At the census blockgroup (used by the US Census Bureau as a subunit of census tracts level, the MCFA yielded five factors for both NEWS and NEWS-A. The aim of this study was to cross-validate the individual- and blockgroup-level measurement models of the NEWS and NEWS-A in a geographical location and population different from those used in the original validation study. Methods A sample of 912 adults was recruited from 16 selected neighborhoods (116 census blockgroups in the Baltimore, MD region. Neighborhoods were stratified according to their socio-economic status and transport-related walkability level measured using Geographic Information Systems. Participants self-completed the NEWS. MCFA was used to cross-validate the individual- and blockgroup-level measurement models of the NEWS and NEWS-A. Results The data provided sufficient support for the factorial validity of the original individual-level measurement models, which consisted of 11 (NEWS and 10 (NEWS-A correlated factors. The original blockgroup-level measurement model of the NEWS and NEWS-A showed poor fit to the data and required substantial modifications. These included the combining of aspects of building aesthetics with safety from crime into one factor; the separation of natural aesthetics and building aesthetics into two factors; and for the NEWS-A, the separation of presence of sidewalks/walking routes from other infrastructure for walking. Conclusion This study provided support for the generalizability of the individual

  5. Trend of Complete Hydatidiform Mole

    Directory of Open Access Journals (Sweden)

    K Thapa

    2010-03-01

    Full Text Available INTRODUCTION: Complete Hydatidiform mole is one of the most frequent abnormal pregnancies. This review studies the trend of complete mole in Paropakar Maternity and Women's hospital and clinical ability to detect it. METHODS: This is a retrospective study of 504 cases of complete hydatidiform mole recorded at Paropakar maternity and women's hospital, Kathmandu, during 2058-2065 B.S. Medical records were reviewed and incidence, clinical presentation and method of diagnosis were studied. RESULTS: During the study period, there were 13,9117 births and 504 complete moles, 12 partial moles, 48 persistent gestational tumours, six choriocarcinoma and four invasive moles recorded in the hospital. The incidence of complete mole was one per 276 births. It was prevalent among women younger than 29 years (80% and among the primigravidae (36.7%. More than 90% women presented in the first half of their pregnancy and vaginal bleeding was the main complaint (68.3%. Suction evacuation, dilation and evacuation followed by sharp curettage and abdominal hysterectomy were performed in 80.6%, 17.6% and 1.2% of the women respectively. Persistent mole and choriocarcinoma developed in 9.5% and 0.4% respectively. CONCLUSIONS: Complete mole has the highest incidence. It affects mostly younger women and presents with vaginal bleeding most of the time, usually in the first half of their pregnancy. Keywords: complete hydatidiform mole, gestational trophoblastic disease, persistent gestational tumours.

  6. Isolated complete corpus callosal agenesis

    Directory of Open Access Journals (Sweden)

    Jaiganesh S, Venkateshwaran A, Naresh Kumar C, Rajasekhar KV

    2014-11-01

    Full Text Available Isolated complete corpus callosal agenesis is a rare entity. Usually this condition will be an associated finding in other syndromes. 3 month old male child came with complaints of deformed foot on both sides, not having a social smile and neck holding. Patient referred to the Radiology department for MRI brain which showed complete absence of corpus callosum, widely separated and parallely placed lateral ventricles, colpocephaly, high riding of 3rd ventricle and absence of cingulate gyrus and radial arrangement of gyri along the interhemispheric fissure. Hence it was reported as isolated complete corpus callosal agenesis and this article describes the Embryogenesis, anatomy, developmental anomalies and its clinical manifestations & prognosis.

  7. Large Hadron Collider nears completion

    CERN Multimedia

    2008-01-01

    Installation of the final component of the Large Hadron Collider particle accelerator is under way along the Franco-Swiss border near Geneva, Switzerland. When completed this summer, the LHC will be the world's largest and most complex scientific instrument.

  8. Panorama completion for street views

    OpenAIRE

    Zhu, Zhe; Martin, Ralph Robert; Hu, Shi-Min

    2015-01-01

    This paper considers panorama images used for street views. Their viewing angle of 360° causes pixels at the top and bottom to appear stretched and warped. Although current image completion algorithms work well, they cannot be directly used in the presence of such distortions found in panoramas of street views. We thus propose a novel approach to complete such 360° panoramas using optimization-based projection to deal with distortions. Experimental results show that our approach is efficient ...

  9. The pain self-efficacy questionnaire: validation of an abbreviated two-item questionnaire.

    Science.gov (United States)

    Briet, Jan Paul; Bot, Arjan G J; Hageman, Michiel G J S; Menendez, Mariano E; Mudgal, Chaitanya S; Ring, David C

    2014-01-01

    The Pain Self-Efficacy Questionnaire (PSEQ) is a validated tool to assess pain self-efficacy and is strongly correlated with disability. Reducing the number of questions of the original PSEQ to screen for self-efficacy will result in more efficient screening and less burden for the patient. The aim of this study was to prospectively validate the shortened version of the PSEQ. Overall, 249 new and follow-up patients visiting our outpatient orthopedic hand surgery clinic were prospectively enrolled and asked to complete the PSEQ, short version of the Disabilities of the Arm Shoulder and Hand, and 2-question version of the Patient Health Questionnaire (PHQ-2) depression questionnaires. The patients completed the questionnaires in the office and online 2 weeks after their visit. At the follow-up visit, the PSEQ was substituted with the 2-question version of the Pain Self-Efficacy Questionnaire (PSEQ-2). The factors associated with higher short forms of the Disabilities of the Arm, Shoulder and Hand scores were investigated in a bivariate and multivariable analysis. Paired t-test was used to compare the mean values of the short and long questionnaires at enrollment. There was a large correlation (r = 0.90; p correlation was found with the short forms of the Disabilities of the Arm, Shoulder and Hand (r = 0.71 vs r = 0.61). Both the PSEQ-2 and the PSEQ were the most important predictors of the short forms of the Disabilities of the Arm, Shoulder and Hand scores. A substantial test-retest reliability was found for the PSEQ-2 (0.66). The PSEQ-2 can be used to quickly assess patients׳ pain self-efficacy. Copyright © 2014 The Academy of Psychosomatic Medicine. Published by Elsevier Inc. All rights reserved.

  10. Math Anxiety Assessment with the Abbreviated Math Anxiety Scale: Applicability and usefulness: insights from the Polish adaptation

    Directory of Open Access Journals (Sweden)

    Krzysztof eCipora

    2015-11-01

    Full Text Available Math anxiety has an important impact on mathematical development and performance. However, although math anxiety is supposed to be a transcultural trait, assessment instruments are scarce and are validated mainly for Western cultures so far. Therefore, we aimed at examining the transcultural generality of math anxiety by a thorough investigation of the validity of math anxiety assessment in Eastern Europe. We investigated the validity and reliability of a Polish adaptation of the Abbreviated Math Anxiety Scale (AMAS, known to have very good psychometric characteristics in its original, American-English version as well as in its Italian and Iranian adaptations.We also observed high reliability, both for internal consistency and test-retest stability of the AMAS in the Polish sample. The results also show very good construct, convergent and discriminant validity: The factorial structure in Polish adult participants (n = 857 was very similar to the one previously found in other samples; AMAS scores correlated moderately in expected directions with state and trait anxiety, self-assessed math achievement and skill as well temperamental traits of emotional reactivity, briskness, endurance and perseverance. Average scores obtained by participants as well as gender differences and correlations with external measures were also similar across cultures. Beyond the cultural comparison, we used path model analyses to show that math anxiety relates to math grades and self-competence when controlling for trait anxiety.The current study shows transcultural validity of math anxiety assessment with the AMAS.

  11. Sleep Problem of Children with Autistic Spectrum Disorder Assessed by Children Sleep Habits Questionnaire-Abbreviated in Indonesia and Japan.

    Science.gov (United States)

    Irwanto; Rehatta, Nancy Margarita; Hartini, Sri; Takada, Satoshi

    2016-07-04

    Sleep problems are associated with problems of cognitive functioning, learning, attention and school performance. It has been found that sleep problems are highly prevalent in children with Autistic spectrum disorders (ASD), with rates ranging from 40% to 80%. We aimed to identify the prevalence of sleep problems on children with ASD in Indonesia and Japan. A cross-sectional study was conducted in Surabaya, Indonesia and Kobe, Japan. Children aged 4 -10 years old were enrolled using stratified cluster sampling. Children's Sleep Habits Questionnaire-Abbreviated (CSHQ-A) was used in this research to assess the sleep problems, consisted of 22 questions (NICHD SECCYD-Wisconsin). Data were analyzed with Mann-Whitney U test to compare the CSHQ-A scores between Indonesian and Japanese children, while the proportion of sleep problems was evaluated by chi-square test with 95% confidence interval. Fifty children with ASD were included in this study, 25 children from Kobe, Japan and 25 children from Surabaya, Indonesia. The prevalence of sleep problems on children with ASD was 60% (15 children) in Indonesia and 16% (4 children) in Japan respectively. There were significant differences in total waking during the night and in morning wake for the CSHQ-A between children from Indonesia and Japan (psleep problems on children with ASD was higher in children from Indonesia than from Japan.

  12. Testing the Abbreviated Food Technology Neophobia Scale and its relation to satisfaction with food-related life in university students.

    Science.gov (United States)

    Schnettler, Berta; Grunert, Klaus G; Miranda-Zapata, Edgardo; Orellana, Ligia; Sepúlveda, José; Lobos, Germán; Hueche, Clementina; Höger, Yesli

    2017-06-01

    The aims of this study were to test the relationships between food neophobia, satisfaction with food-related life and food technology neophobia, distinguishing consumer segments according to these variables and characterizing them according to willingness to purchase food produced with novel technologies. A survey was conducted with 372 university students (mean aged=20.4years, SD=2.4). The questionnaire included the Abbreviated version of the Food Technology Neophobia Scale (AFTNS), Satisfaction with Life Scale (SWLS), and a 6-item version of the Food Neophobia Scale (FNS). Using confirmatory factor analysis, it was confirmed that SWFL correlated inversely with FNS, whereas FNS correlated inversely with AFTNS. No relationship was found between SWFL and AFTNS. Two main segments were identified using cluster analysis; these segments differed according to gender and family size. Group 1 (57.8%) possessed higher AFTNS and FNS scores than Group 2 (28.5%). However, these groups did not differ in their SWFL scores. Group 1 was less willing to purchase foods produced with new technologies than Group 2. The AFTNS and the 6-item version of the FNS are suitable instruments to measure acceptance of foods produced using new technologies in South American developing countries. The AFTNS constitutes a parsimonious alternative for the international study of food technology neophobia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Validation of the Abbreviated Brucella AMOS PCR as a Rapid Screening Method for Differentiation of Brucella abortus Field Strain Isolates and the Vaccine Strains, 19 and RB51

    OpenAIRE

    Ewalt, Darla R.; Bricker, Betsy J.

    2000-01-01

    The Brucella AMOS PCR assay was previously developed to identify and differentiate specific Brucella species. In this study, an abbreviated Brucella AMOS PCR test was evaluated to determine its accuracy in differentiating Brucella abortus into three categories: field strains, vaccine strain 19 (S19), and vaccine strain RB51/parent strain 2308 (S2308). Two hundred thirty-one isolates were identified and tested by the conventional biochemical tests and Brucella AMOS PCR. This included 120 isola...

  14. Complete Normal Ordering 1: Foundations

    CERN Document Server

    Ellis, John; Skliros, Dimitri P.

    2016-01-01

    We introduce a new prescription for quantising scalar field theories perturbatively around a true minimum of the full quantum effective action, which is to `complete normal order' the bare action of interest. When the true vacuum of the theory is located at zero field value, the key property of this prescription is the automatic cancellation, to any finite order in perturbation theory, of all tadpole and, more generally, all `cephalopod' Feynman diagrams. The latter are connected diagrams that can be disconnected into two pieces by cutting one internal vertex, with either one or both pieces free from external lines. In addition, this procedure of `complete normal ordering' (which is an extension of the standard field theory definition of normal ordering) reduces by a substantial factor the number of Feynman diagrams to be calculated at any given loop order. We illustrate explicitly the complete normal ordering procedure and the cancellation of cephalopod diagrams in scalar field theories with non-derivative i...

  15. Relative Precision of Inhaler Aerodynamic Particle Size Distribution (APSD) Metrics by Full Resolution and Abbreviated Andersen Cascade Impactors (ACIs): Part 2—Investigation of Bias in Extra-Fine Mass Fraction with AIM-HRT Impactor

    OpenAIRE

    Mitchell, Jolyon P.; Nagel, Mark W.; Doyle, Cathy C.; Ali, Rubina S.; Avvakoumova, Valentina I.; Christopher, J. David; Quiroz, Jorge; Strickland, Helen; Tougas, Terrence; Lyapustina, Svetlana

    2010-01-01

    The purpose of this study was to resolve an anomalously high measure of extra-fine particle fraction (EPF) determined by the abbreviated cascade impactor possibly relevant for human respiratory tract (AIM-HRT) in the experiment described in Part 1 of this two-part series, in which the relative precision of abbreviated impactors was evaluated in comparison with a full resolution Andersen eight-stage cascade impactor (ACI). Evidence that the surface coating used to mitigate particle bounce was ...

  16. A-3 steel work completed

    Science.gov (United States)

    2009-01-01

    Stennis Space Center engineers celebrated a key milestone in construction of the A-3 Test Stand on April 9 - completion of structural steel work. Workers with Lafayette (La.) Steel Erector Inc. placed the last structural steel beam atop the stand during a noon ceremony attended by more than 100 workers and guests.

  17. Complete nitrification by Nitrospira bacteria

    DEFF Research Database (Denmark)

    Daims, Holger; Lebedeva, Elena V.; Pjevac, Petra

    2015-01-01

    Nitrification, the oxidation of ammonia via nitrite to nitrate, has always been considered to be a two-step process catalysed by chemolithoautotrophic microorganisms oxidizing either ammonia or nitrite. No known nitrifier carries out both steps, although complete nitrification should be energetic...

  18. The Completeness Theorem of Godel

    Indian Academy of Sciences (India)

    GENERAL I ARTICLE. The Completeness Theorem of Godel. 2. Henkin's Proof for First Order Logic. S M Srivastava is with the. Indian Statistical,. Institute, Calcutta. He received his PhD from the Indian Statistical. Institute in 1980. His research interests are in descriptive set theory. I Part 1. An Introduction to Math- ematical ...

  19. YB0 SERVICES INSTALLATION COMPLETED

    CERN Document Server

    The beauty of the completed YB0 was briefly visible at P5 as preparations continue for Tracker installation. A tremendous effort, lasting 7 months and involving more than 100 workers on the busiest days, resulted in 5700 electrical cables, 780 optical cables with 65k fibre channels, and 550 pipes laid on YB0 for HB, EB and Tracker.

  20. Program Costs and Student Completion

    Science.gov (United States)

    Manning, Terri M.; Crosta, Peter M.

    2014-01-01

    Community colleges are under pressure to increase completion rates, prepare students for the workplace, and contain costs. Colleges need to know the financial implications of what are often perceived as routine decisions: course scheduling, program offerings, and the provision of support services. This chapter presents a methodology for estimating…

  1. Completely integrable operator evolutionary equations

    International Nuclear Information System (INIS)

    Chudnovsky, D.V.

    1979-01-01

    The authors present natural generalizations of classical completely integrable equations where the functions are replaced by arbitrary operators. Among these equations are the non-linear Schroedinger, the Korteweg-de Vries, and the modified KdV equations. The Lax representation and the Baecklund transformations are presented. (Auth.)

  2. Structural Completeness in Fuzzy Logics

    Czech Academy of Sciences Publication Activity Database

    Cintula, Petr; Metcalfe, G.

    2009-01-01

    Roč. 50, č. 2 (2009), s. 153-183 ISSN 0029-4527 R&D Projects: GA MŠk(CZ) 1M0545 Institutional research plan: CEZ:AV0Z10300504 Keywords : structral logics * fuzzy logics * structural completeness * admissible rules * primitive variety * residuated lattices Subject RIV: BA - General Mathematics

  3. Completeness in Hybrid Type Theory

    DEFF Research Database (Denmark)

    Areces, Carlos; Blackburn, Patrick Rowan; Huertas, Antonia

    2014-01-01

    We show that basic hybridization (adding nominals and @ operators) makes it possible to give straightforward Henkin-style completeness proofs even when the modal logic being hybridized is higher-order. The key ideas are to add nominals as expressions of type t, and to extend to arbitrary types th...

  4. Largest particle detector nearing completion

    CERN Multimedia

    2006-01-01

    "Construction of another part of the Large Hadron Collider (LHC), the worl's largest particle accelerator at CERN in Switzerland, is nearing completion. The Compact Muon Solenoid (CMS) is oner of the LHC project's four large particle detectors. (1/2 page)

  5. UV-Completion by Classicalization

    CERN Document Server

    Dvali, Gia; Gomez, Cesar; Kehagias, Alex

    2011-01-01

    We suggest a novel approach to UV-completion of a class of non-renormalizable theories, according to which the high-energy scattering amplitudes get unitarized by production of extended classical objects (classicalons), playing a role analogous to black holes, in the case of non-gravitational theories. The key property of classicalization is the existence of a classicalizer field that couples to energy-momentum sources. Such localized sources are excited in high-energy scattering processes and lead to the formation of classicalons. Two kinds of natural classicalizers are Nambu-Goldstone bosons (or, equivalently, longitudinal polarizations of massive gauge fields) and scalars coupled to energy-momentum type sources. Classicalization has interesting phenomenological applications for the UV-completion of the Standard Model both with or without the Higgs. In the Higgless Standard Model the high-energy scattering amplitudes of longitudinal $W$-bosons self-unitarize via classicalization, without the help of any new...

  6. Complete spacelike immersions with topology

    International Nuclear Information System (INIS)

    Harris, S.G.

    1988-01-01

    A fairly large class of Lorentz manifolds is defined, called WH normal manifolds, which are approximately those for which timelike infinity is a single point. It is shown that, in such a space, an immersed spacelike hypersurface which is complete must, if it is self-intersecting, not achronal or proper, satisfy strong topological conditions; in particular, if the immersion is injective in the fundamental group, then the hypersurface must be closed, embedded and achronal (i.e. a partial Cauchy surface). WH normal spaces include products of any Riemannian manifold with Minkowski 1-space; in such space, a complete immersed spacelike hypersurface must be immersed as a covering space for the Riemannian factor. (author)

  7. [Anterior guidance in complete dentures].

    Science.gov (United States)

    Dubreuil, J; Trevelo, A

    1990-01-01

    Although the anterior guidance in complete dentures is not really a guide, the arrangement of the anterior maxillary and mandibular prosthetic teeth, defines a propulsive line called the virtual anterior guidance, a part from the cinematic criterias. The influence of this guide on cuspal movement is superior, in all mandibular points, to the influence of the condylar pathway. If this line is not respected, the practitioner may have to do excessive grindings during occlusal adjustments.

  8. SOUR graphs for efficient completion

    OpenAIRE

    Lynch, Christopher; Strogova, Polina

    1998-01-01

    International audience; We introduce a data structure called \\emphSOUR graphs and present an efficient Knuth-Bendix completion procedure based on it. \\emphSOUR graphs allow for a maximal structure sharing of terms in rewriting systems. The term representation is a dag representation, except that edges are labelled with equational constraints and variable renamings. The rewrite rules correspond to rewrite edges, the unification problems to unification edges. The Critical Pair and Simplificatio...

  9. Complete normal ordering 1: Foundations

    Directory of Open Access Journals (Sweden)

    John Ellis

    2016-08-01

    Full Text Available We introduce a new prescription for quantising scalar field theories (in generic spacetime dimension and background perturbatively around a true minimum of the full quantum effective action, which is to ‘complete normal order’ the bare action of interest. When the true vacuum of the theory is located at zero field value, the key property of this prescription is the automatic cancellation, to any finite order in perturbation theory, of all tadpole and, more generally, all ‘cephalopod’ Feynman diagrams. The latter are connected diagrams that can be disconnected into two pieces by cutting one internal vertex, with either one or both pieces free from external lines. In addition, this procedure of ‘complete normal ordering’ (which is an extension of the standard field theory definition of normal ordering reduces by a substantial factor the number of Feynman diagrams to be calculated at any given loop order. We illustrate explicitly the complete normal ordering procedure and the cancellation of cephalopod diagrams in scalar field theories with non-derivative interactions, and by using a point splitting ‘trick’ we extend this result to theories with derivative interactions, such as those appearing as non-linear σ-models in the world-sheet formulation of string theory. We focus here on theories with trivial vacua, generalising the discussion to non-trivial vacua in a follow-up paper.

  10. Computed tomography abbreviated assessment of sarcopenia following trauma: The CAAST measurement predicts 6-month mortality in older adult trauma patients.

    Science.gov (United States)

    Leeper, Christine M; Lin, Elizabeth; Hoffman, Marcus; Fombona, Anisleidy; Zhou, Tianhua; Kutcher, Matthew; Rosengart, Matthew; Watson, Gregory; Billiar, Timothy; Peitzman, Andrew; Zuckerbraun, Brian; Sperry, Jason

    2016-05-01

    Older adult trauma patients are at increased risk of poor outcome, both immediately after injury and beyond hospital discharge. Identifying patients early in the hospital stay who are at increased risk of death after discharge can be challenging. Retrospective analysis was performed using our trauma registry linked with the social security death index from 2010 to 2014. Age was categorized as 18 to 64 and 65 years or older. We calculated mortality rates by age category then selected elderly patients with mechanism of injury being a fall for further analysis. Computed Tomography Abbreviated Assessment of Sarcopenia for Trauma (CAAST) was obtained by measuring psoas muscle cross-sectional area adjusted for height and weight. Kaplan-Meier survival analysis was performed, and proportional hazards regression modeling was used to determine independent risk factors for in-hospital and out-of-hospital mortality. A total of 23,622 patients were analyzed (16,748, aged 18-64 years; and 6,874, aged 65 or older). In-hospital mortality was 1.96% for ages 18 to 64 and 7.19% for age 65 or older (p older (p older group included injury characteristics such as ISS, admission vitals, and head injury. Predictors of postdischarge mortality for age 65or older included skilled nursing before admission, disposition, and mechanism of injury being a fall. A total of 57.5% (n = 256) of older patients who sustained a fall met criteria for sarcopenia. Sarcopenia was the strongest predictor of out-of-hospital mortality in this cohort with a hazard ratio of 4.77 (95% confidence interval, 2.71-8.40; p older adults. The CAAST measurement is an efficient and inexpensive measure that can allow clinicians to target older trauma patients at risk of poor outcome for early intervention and/or palliative care services. Prognostic and epidemiologic study, level III.

  11. An Abbreviated Protocol for In Vitro Generation of Functional Human Embryonic Stem Cell-Derived Beta-Like Cells.

    Directory of Open Access Journals (Sweden)

    Mohammad Massumi

    Full Text Available The ability to yield glucose-responsive pancreatic beta-cells from human pluripotent stem cells in vitro will facilitate the development of the cell replacement therapies for the treatment of Type 1 Diabetes. Here, through the sequential in vitro targeting of selected signaling pathways, we have developed an abbreviated five-stage protocol (25-30 days to generate human Embryonic Stem Cell-Derived Beta-like Cells (ES-DBCs. We showed that Geltrex, as an extracellular matrix, could support the generation of ES-DBCs more efficiently than that of the previously described culture systems. The activation of FGF and Retinoic Acid along with the inhibition of BMP, SHH and TGF-beta led to the generation of 75% NKX6.1+/NGN3+ Endocrine Progenitors. The inhibition of Notch and tyrosine kinase receptor AXL, and the treatment with Exendin-4 and T3 in the final stage resulted in 35% mono-hormonal insulin positive cells, 1% insulin and glucagon positive cells and 30% insulin and NKX6.1 co-expressing cells. Functionally, ES-DBCs were responsive to high glucose in static incubation and perifusion studies, and could secrete insulin in response to successive glucose stimulations. Mitochondrial metabolic flux analyses using Seahorse demonstrated that the ES-DBCs could efficiently metabolize glucose and generate intracellular signals to trigger insulin secretion. In conclusion, targeting selected signaling pathways for 25-30 days was sufficient to generate ES-DBCs in vitro. The ability of ES-DBCs to secrete insulin in response to glucose renders them a promising model for the in vitro screening of drugs, small molecules or genes that may have potential to influence beta-cell function.

  12. Use of an abbreviated neuroscience education approach in the treatment of chronic low back pain: a case report.

    Science.gov (United States)

    Louw, Adriaan; Puentedura, Emilio Louie; Mintken, Paul

    2012-01-01

    Chronic low back pain (CLBP) remains prevalent in society, and conservative treatment strategies appear to have little effect. It is proposed that patients with CLBP may have altered cognition and increased fear, which impacts their ability to move, perform exercise, and partake in activities of daily living. Neuroscience education (NE) aims to change a patient's cognition regarding their pain state, which may result in decreased fear, ultimately resulting in confrontation of pain barriers and a resumption of normal activities. A 64-year-old female with history of CLBP was the patient for this case report. A physical examination, the Numeric Pain Rating Scale (NPRS), Oswestry Disability Index (ODI), Fear-Avoidance Beliefs Questionnaire (FABQ), and Zung Depression Scale were assessed during her initial physical therapy visit, immediately after her first physical therapy session, and at 7-month follow-up. Treatment consisted of an abbreviated NE approach, exercises (range of motion, stretches, and cardiovascular), and aquatic therapy. She attended twice a week for 4 weeks, or 8 visits total. Pre-NE, the patient reported NPRS = 9/10; ODI = 54%; FABQ-W = 25/42,; FABQ-PA = 20/24, and Zung = 58. Immediately following the 75-minute evaluation and NE session, the patient reported improvement in all four outcome measures, most notably a reduction in the FABQ-W score to 2/42 and the FABQ-PA to 1/24. At a 7-month follow-up, all outcome measures continued to be improved. NE aimed at decreasing fear associated with movement may be a valuable adjunct to movement-based therapy, such as exercise, for patients with CLBP.

  13. On convergence completeness in symmetric spaces | Moshokoa ...

    African Journals Online (AJOL)

    convergence complete symmetric space. As applications of convergence completeness, we present some fixed point results for self-maps defined on a symmetric space. Keywords: completeness; convergence completeness; fixed points; metric ...

  14. Robert Zajonc: The Complete Psychologist

    Science.gov (United States)

    Berridge, Kent C.

    2010-01-01

    This article joins with others in the same issue to celebrate the career of Robert B. Zajonc who was a broad, as well as deeply talented, psychologist. Beyond his well-known focus in social psychology, the work of Zajonc also involved, at one time or another, forays into nearly every other subfield of psychology. This article focuses specifically on his studies that extended into biopsychology, which deserve special highlighting in order to be recognized alongside his many major achievements in emotion and related social topics. The biopsychological focus is offered here in the hope that all his diverse contributions be savored together when celebrating the complete psychology of Robert Zajonc. PMID:22473376

  15. Juvenile eye growth, when completed?

    DEFF Research Database (Denmark)

    Fledelius, Hans C; Christensen, Anders S; Fledelius, Christian

    2014-01-01

    PURPOSE: To test Sorsby's classical statement of axial eye growth as completed at the age of 13 years, with a view also to differentiating between basic eye growth and juvenile elongation associated with eventual refractive change towards myopia. METHODS: (i) A total of 160 healthy eyes close...... about age 13 as general limit found support from the cross-sectional data, which suggested stable emmetropic eye size from about 11-12 years, with an average apparently outgrown male emmetropic value of 23.5 mm versus females' 22.9 mm. The longitudinal data, however, showed emmetropic growth also beyond...

  16. Projective modules and complete intersections

    CERN Document Server

    Mandal, Satya

    1997-01-01

    In these notes on "Projective Modules and Complete Intersections" an account on the recent developments in research on this subject is presented. The author's preference for the technique of Patching isotopic isomorphisms due to Quillen, formalized by Plumsted, over the techniques of elementary matrices is evident here. The treatment of Basic Element theory here incorporates Plumstead's idea of the "generalized dimension functions". These notes are highly selfcontained and should be accessible to any graduate student in commutative algebra or algebraic geometry. They include fully self-contained presentations of the theorems of Ferrand-Szpiro, Cowsik-Nori and the techniques of Lindel.

  17. SPS completes LS1 activities

    CERN Multimedia

    Katarina Anthony

    2014-01-01

    On 27 June, the SPS closed its doors to the LS1 engineers, bringing to an end almost 17 months of activities. The machine now enters the hardware-testing phase in preparation for an October restart.   Photo 1: The SPS transfer tunnel, TT10, reinforced with steal beams. Having completed their LS1 activities right on schedule (to the day!), the SPS team is now preparing the machine for its restart. Over the next eight weeks, hardware tests of the SPS dipole and quadrupole power converters will be underway, led by the TE-EPC (Electrical Power Converters) team. "OP start-up test activities will also be running in parallel, utilising the off hours when EPC is not using the machine," says David McFarlane, the SPS technical coordinator from the Engineering Department. "The primary beam testing phase will start at the beginning of September, once hardware tests and DSO safety tests have been completed." It has been a long journey to this point, with several major...

  18. Completion of the TRT Barrel

    CERN Multimedia

    Gagnon, P

    On February 3, the US-TRT team proudly completed the installation of the 96th barrel TRT module on its support structure in the SR building at CERN. This happy event came after many years of R&D initiated in the nineties by the TA1 team at CERN, followed by the construction of the modules in three American institutes (Duke, Hampton and Indiana Universities) from 1996 to 2003. In total, the 96 barrel modules contain 52544 kapton straws, each 4 mm in diameter and strung with a 30 micron gold-plated tungsten wire. Each wire was manually inserted, a feat in itself! The inner layer modules contain 329 straws, the middle layer modules have 520 straws and the outer layer, 793 straws. Thirty- two modules of each type form a full layer. Their special geometry was designed such as to leave no dead region. On average, a particle will cross 36 straws. Kirill Egorov, Chuck Mahlon and John Callahan inserted the last module in the Barrel Support Structure. After completion in the US, all modules were transferred...

  19. AEgIS installation completed

    CERN Multimedia

    Katarina Anthony

    2012-01-01

    Gravity. Despite first being described over three centuries ago, it remains one of the least understood of the fundamental forces explored by physicists. At CERN’s recently completed AEgIS experiment, a team has set out to examine the effect of gravity on an as-yet-uncharted realm: antimatter.   The complete AEgIS set-up. Located in the AD hall, the AEgIS experiment plans to  make the first direct measurement of Earth’s gravitation effect on antimatter. By sending a beam of antihydrogen atoms through very thin gratings, the experiment will be able to measure how far the antihydrogen atoms fall and in how much time – giving the AEgIS team a measurement of the gravitational coupling. “By the end of 2012, we had finished by putting all the elements of the experiment together,” explains Michael Doser, AEgIS Spokesperson. “Now we have to show that they can all work together and, unfortunately, we will have no antiproton beams fo...

  20. LHCf completes its first run

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    LHCf, one of the three smaller experiments at the LHC, has completed its first run. The detectors were removed last week and the analysis of data is continuing. The first results will be ready by the end of the year.   One of the two LHCf detectors during the removal operations inside the LHC tunnel. LHCf is made up of two independent detectors located in the tunnel 140 m either side of the ATLAS collision point. The experiment studies the secondary particles created during the head-on collisions in the LHC because they are similar to those created in a cosmic ray shower produced when a cosmic particle hits the Earth’s atmosphere. The focus of the experiment is to compare the various shower models used to estimate the primary energy of ultra-high-energy cosmic rays. The energy of proton-proton collisions at the LHC will be equivalent to a cosmic ray of 1017eV hitting the atmosphere, very close to the highest energies observed in the sky. “We have now completed the fir...

  1. Usos do glossário do risco em revistas: contrastando "tempo" e "públicos" Uses of the risk glossary in magazines: contrasting "time" and "public"

    Directory of Open Access Journals (Sweden)

    Mary Jane P. Spink

    2008-01-01

    Full Text Available Este artigo visa contribuir para a compreensão das maneiras de falar de risco na mídia, apoiando-se no referencial teórico da Psicologia Social discursiva. Duas estratégias complementares de investigação foram utilizadas: análise diacrônica de amostra de revista de interesse geral (210 exemplares da Veja e sincrônica de revistas destinadas a públicos variados (101 revistas. A análise da Veja focalizou as temáticas das matérias e anos de sua publicação. Para a amostra sincrônica foram priorizadas as temáticas das revistas de modo a entender o endereçamento a públicos distintos. A análise "no tempo" sugere que os glossários do risco-perigo e risco-probabilidade já estão consolidados e seu uso traz ressonâncias dos contextos históricos em que essas tradições tomaram forma. No enquadre do risco-aventura, vimos surgir novos vocábulos para referir-se às emoções dos esportes radicais ou posicionar aqueles que optam por correr risco. Esses usos da linguagem do risco são mais bem apreendidos no fluxo da comunicação em que o público tem cara: as revistas segmentadas.This paper is a contribution to the understanding of risk-talk in the media from a theoretical perspective of discursive Social Psychology. Two complementary strategies were used: diachronic analysis of a sample of a magazine of general interest (210 issues of Veja and synchronic analysis of magazines directed to various types of people (101 magazines. For Veja, the analysis focused on article themes and date of publication. For the synchronic sample, priority was given to how risk is presented to different kinds of public. The analysis "over time" suggests that risk as danger and risk as probability glossaries are already well established and their use is a resonance of the historic contexts in which this tradition took shape. New repertoire emerges in the tradition of risk as adventure to refer to emotions associated with radical sports or to people who

  2. DAQ INSTALLATION IN USC COMPLETED

    CERN Multimedia

    A. Racz

    After one year of work at P5 in the underground control rooms (USC55-S1&S2), the DAQ installation in USC55 is completed. The first half of 2006 was dedicated to the DAQ infrastructures installation (private cable trays, rack equipment for a very dense cabling, connection to services i.e. water, power, network). The second half has been spent to install the custom made electronics (FRLs and FMMs) and place all the inter-rack cables/fibers connecting all sub-systems to central DAQ (more details are given in the internal pages). The installation has been carried out by DAQ group members, coming from the hardware and software side as well. The pictures show the very nice team spirit !

  3. The Completion of SPEAR 3

    Energy Technology Data Exchange (ETDEWEB)

    Hettel, R.

    2005-04-11

    On December 15, 2003, 8 1/2 months after the last electrons circulated in the old SPEAR2 storage ring and 5 days after the beginning of commissioning, the first electrons were accumulated in the completely new SPEAR 3 ring. By January 22, the first 100-mA beam was stored, preparing the path for delivering beam to users in early March of this year. The rapid installation and commissioning are a testimony to the SPEAR 3 project staff and collaborators who have built an excellent machine and equipped it with powerful and accessible machine modeling and control programs. The final year of component fabrication, the 7-month installation period, and present-day SPEAR 3 operation are described.

  4. Completeness of algebraic CPS simulations

    Directory of Open Access Journals (Sweden)

    Ali Assaf

    2012-07-01

    Full Text Available The algebraic lambda calculus and the linear algebraic lambda calculus are two extensions of the classical lambda calculus with linear combinations of terms. They arise independently in distinct contexts: the former is a fragment of the differential lambda calculus, the latter is a candidate lambda calculus for quantum computation. They differ in the handling of application arguments and algebraic rules. The two languages can simulate each other using an algebraic extension of the well-known call-by-value and call-by-name CPS translations. These simulations are sound, in that they preserve reductions. In this paper, we prove that the simulations are actually complete, strengthening the connection between the two languages.

  5. Collections cited under abbreviations

    NARCIS (Netherlands)

    Jacobs, M.

    1967-01-01

    The practice of citing collections made in institutional series by the letters of that series instead of by the collector’s name (e.g. FB 23435 instead of Aquilar & Valderrama FB 23435) led, with the publication of so many Identification Lists, to the dishing out of an alphabet soup that many a

  6. LIST OF ABBREVIATIONS

    African Journals Online (AJOL)

    four

    2013-02-20

    Feb 20, 2013 ... microsatellite or simple sequence repeat (SSR) markers. Twenty .... The amplified SSR DNA bands representing different alleles were. Berilus et al. .... 248 210. 228. RM152. 53 gaaaccaccacacctcaccg ccgtagaccttcttgaagtag. 133. 157 135. 153. 9. RM316. 55 ctagttgggcatacgatggc acgcttatatgttacgtcaac. 194.

  7. Patient perspectives with abbreviated versus standard pre-test HIV counseling in the prenatal setting: a randomized-controlled, non-inferiority trial.

    Science.gov (United States)

    Cohan, Deborah; Gomez, Elvira; Greenberg, Mara; Washington, Sierra; Charlebois, Edwin D

    2009-01-01

    In the US, an unacceptably high percentage of pregnant women do not undergo prenatal HIV testing. Previous studies have found increased uptake of prenatal HIV testing with abbreviated pre-test counseling, however little is known about patient decision making, testing satisfaction and knowledge in this setting. A randomized-controlled, non-inferiority trial was conducted from October 2006 through February 2008 at San Francisco General Hospital (SFGH), the public teaching hospital of the City and County of San Francisco. A total of 278 English- and Spanish-speaking pregnant women were randomized to receive either abbreviated or standard nurse-performed HIV test counseling at the initial prenatal visit. Patient decision making experience was compared between abbreviated versus standard HIV counseling strategies among a sample of low-income, urban, ethnically diverse prenatal patients. The primary outcome was the decisional conflict score (DCS) using O'Connor low-literacy scale and secondary outcomes included satisfaction with test decision, basic HIV knowledge and HIV testing uptake. We conducted an intention-to-treat analysis of 278 women--134 (48.2%) in the abbreviated arm (AA) and 144 (51.8%) in the standard arm (SA). There was no significant difference in the proportion of women with low decisional conflict (71.6% in AA vs. 76.4% in SA, p = .37), and the observed mean difference between the groups of 3.88 (95% CI: -0.65, 8.41) did not exceed the non-inferiority margin. HIV testing uptake was very high (97. 8%) and did not differ significantly between the 2 groups (99.3% in AA vs. 96.5% in SA, p = .12). Likewise, there was no difference in satisfaction with testing decision (97.8% in AA vs. 99.3% in SA, p = .36). However, women in AA had significantly lower mean HIV knowledge scores (78.4%) compared to women in SA (83.7%, pprocess, while associated with slightly lower knowledge, does not compromise patient decision making or satisfaction regarding HIV testing

  8. Screening for personality disorder in a sample of incarcerated male youth: preliminary validation of the Standardised Assessment of Personality-Abbreviated Scale (SAPAS)

    DEFF Research Database (Denmark)

    Kongerslev, Mickey; Bo, Sune; Simonsen, Erik

    2011-01-01

    Aims: To test the validity of an age-appropriate adaptation of the Standardised Assessment of Personality - Abbreviated Scale (SAPAS) in a sample of incarcerated male youth Method: A sample of incarcerated boys, age 15 to 18, were administered the SAPAS by social workers from the participating...... prisons and secure institutions Within one week a clinical psychologist administered the Structured Clinical Inter-view for DSM-IV Personality Disorders (SCID-II) and the Psychopathy Checklist: Youth Version (PCL:YV) to assess for personality disorders and psychopathy In order to control for confounding...

  9. Self Completeness of Einstein Gravity

    CERN Document Server

    Dvali, Gia

    2010-01-01

    We argue, that in Einsteinian gravity the Planck length is the shortest length of nature, and any attempt of resolving trans-Planckian physics bounces back to macroscopic distances due to black hole formation. In Einstein gravity trans-Planckian propagating quantum degrees of freedom cannot exist, instead they are equivalent to the classical black holes that are fully described by lighter infra-red degrees of freedom and give exponentially-soft contribution into the virtual processes. Based on this property we argue that pure-Einstein (super)gravity and its high-dimensional generalizations are self-complete in deep-UV, but not in standard Wilsonian sense. We suggest that certain strong-coupling limit of string theory is built-in in pure Einstein gravity, whereas the role of weakly-coupled string theory limit is to consistently couple gravity to other particle species, with their number being set by the inverse string coupling. We also discuss some speculative ideas generalizing the notion of non-Wilsonian sel...

  10. Ear recognition: a complete system

    Science.gov (United States)

    Abaza, Ayman; Harrison, Mary Ann F.

    2013-05-01

    Ear Recognition has recently received significant attention in the literature. Even though current ear recognition systems have reached a certain level of maturity, their success is still limited. This paper presents an efficient complete ear-based biometric system that can process five frames/sec; Hence it can be used for surveillance applications. The ear detection is achieved using Haar features arranged in a cascaded Adaboost classifier. The feature extraction is based on dividing the ear image into several blocks from which Local Binary Pattern feature distributions are extracted. These feature distributions are then fused at the feature level to represent the original ear texture in the classification stage. The contribution of this paper is three fold: (i) Applying a new technique for ear feature extraction, and studying various optimization parameters for that technique; (ii) Presenting a practical ear recognition system and a detailed analysis about error propagation in that system; (iii) Studying the occlusion effect of several ear parts. Detailed experiments show that the proposed ear recognition system achieved better performance (94:34%) compared to other shape-based systems as Scale-invariant feature transform (67:92%). The proposed approach can also handle efficiently hair occlusion. Experimental results show that the proposed system can achieve about (78%) rank-1 identification, even in presence of 60% occlusion.

  11. Glossary of Stream Restoration Terms

    Science.gov (United States)

    1999-01-01

    kitchen sink, dishwasher, or water used for washing diapers . Technical Note EMRRP SR-0x 1 Groundwater -- Subsurface water and underground...activity, such as skiing, biking, hiking, fishing, boating, and/or camping, for any part of a day by one person. Recycled water ~ Urban wastewater...that becomes suitable, as a result of treatment, for a specific direct beneficial use. See also water recycling . Reforestation ~ The natural or

  12. Glossary of Suicide Prevention Terms

    Science.gov (United States)

    ... public through various media such as radio, television, advertisements, newspapers, magazines, and billboards. Public Health Approach – the ... used for an injury that is unplanned; in many settings these are termed accidental injuries. Universal preventive ...

  13. Glossary of Managed Care Definitions

    Science.gov (United States)

    ... Alternative health care : products and services such as acupuncture, homeopathy, nutrition therapy, and massage, that can complement ... group of consumers, based upon age, sex, health history, or other factors. The plan uses medical underwriting ...

  14. RADinfo Glossary of Radiation Terms

    Science.gov (United States)

    ... living or inanimate material. gamma rays: High-energy electromagnetic radiation emitted by certain radioactive nuclei. These rays have ... neutrons. nuclide: A general term applicable to all atomic forms of an element. Nuclides are characterized by ...

  15. Talking Glossary of Genetic Terms

    Science.gov (United States)

    ... Links for Patient Care Education All About the Human Genome Project Fact Sheets Genetic Education Resources for Teachers Genomic Careers National DNA Day Online Education Kit Online Genetics Education ... Subjects Research Informed Consent for Genomics Research Intellectual ...

  16. Resource consumption of Germany - indicators and definitions. Development of a glossary on the concept of ''resources'' and calculation of missing characteristic data of resources consumption for further political analysis; Ressourcenverbrauch von Deutschland - aktuelle Kennzahlen und Begriffsbestimmungen. Erstellung eines Glossars zum ''Ressourcenbegriff'' und Berechnung von fehlenden Kennzahlen des Ressourcenverbrauchs fuer die weitere politische Analyse

    Energy Technology Data Exchange (ETDEWEB)

    Schuetz, Helmut; Bringezu, Stefan [Wuppertal Institut fuer Klima, Umwelt, Energie GmbH, Wuppertal (Germany). Forschungsgruppe 3: Stoffstroeme und Ressourcenmanagement

    2008-02-15

    The goals of the reported study are: - to prepare a glossary on the term ''Resources'' in order to support communication based on a harmonised resource term and associated terms and - to provide key data on resource use in Germany in time series since 1991 up to the most recent year for which data were available (2004 in general), and to attribute results to the resource terms. Results achieved are presented and discussed below by the following sections: Provision of a glossary on the term ''resource'', use of the term ''resource'' at different levels, and provision of data and derived indicators for resource consumption in time series. First, a list of the relevant publications in the topic field ''resources'' was provided and co-ordinated with the client. This publication list is given in the annex to this report. On basis of national and international sources a glossary was provided which clearly describes and comments the resource term, its sub-terms and associated terms. This glossary is in the annex to this report. (orig.)

  17. Active Transportation on a Complete Street: Perceived and Audited Walkability Correlates.

    Science.gov (United States)

    Jensen, Wyatt A; Brown, Barbara B; Smith, Ken R; Brewer, Simon C; Amburgey, Jonathan W; McIff, Brett

    2017-09-05

    Few studies of walkability include both perceived and audited walkability measures. We examined perceived walkability (Neighborhood Environment Walkability Scale-Abbreviated, NEWS-A) and audited walkability (Irvine-Minnesota Inventory, IMI) measures for residents living within 2 km of a "complete street"-one renovated with light rail, bike lanes, and sidewalks. For perceived walkability, we found some differences but substantial similarity between our final scales and those in a prior published confirmatory factor analysis. Perceived walkability, in interaction with distance, was related to complete street active transportation. Residents were likely to have active transportation on the street when they lived nearby and perceived good aesthetics, crime safety, and traffic safety. Audited walkability, analyzed with decision trees, showed three general clusters of walkability areas, with 12 specific subtypes. A subset of walkability items ( n = 11), including sidewalks, zebra-striped crosswalks, decorative sidewalks, pedestrian signals, and blank walls combined to cluster street segments. The 12 subtypes yielded 81% correct classification of residents' active transportation. Both perceived and audited walkability were important predictors of active transportation. For audited walkability, we recommend more exploration of decision tree approaches, given their predictive utility and ease of translation into walkability interventions.

  18. An abbreviated Faecal Incontinence Quality of Life Scale for Chinese-speaking population with colorectal cancer after surgery: cultural adaptation and item reduction.

    Science.gov (United States)

    Hsu, L-F; Hung, C-L; Kuo, L-J; Tsai, P-S

    2017-09-01

    No instrument is available to assess the impact of faecal incontinence (FI) of quality of life for Chinese-speaking population. The purpose of the study was to adapt the Faecal Incontinence Quality of Life Scale (FIQL) for patients with colorectal cancer, assess the factor structure and reduce the items for brevity. A sample of 120 participants were enrolled. Internal consistency, test-retest reliability, and convergent and contrasted-groups validity were assessed. Construct validity was analysed using an exploratory and confirmatory factor analyses (CFA). The internal consistency (Cronbach's α of the total scale and four subscales = 0.98 and 0.97, 0.96, 0.92, 0.82 respectively), test-retest reliability (intraclass correlation coefficients ≥.98 for all scales with p < .001) and significant correlations of all scales with selected subscales of the Medical Outcomes Study 36-Item Short-Form Health Survey and the Wexner scale suggested satisfactory reliability and validity. The severe FI group (with a Wexner score ≥9) scored significantly lower on the scale than the less severe FI group (with a Wexner score <9) did (p < .001). The CFA supported a two-factor structure and demonstrated an excellent model fit of the 15-item abbreviated version of the FIQL-Chinese. The FIQL-Chinese has satisfactory validity and reliability and the abbreviated version may be more practical and applicable. © 2016 John Wiley & Sons Ltd.

  19. Completely Described Undirected Graph Structure

    Directory of Open Access Journals (Sweden)

    G. S. Ivanova

    2016-01-01

    Full Text Available The objects of research are undirected graphs. The paper considers a problem of their isomorphism. A literature analysis of its solution, has shown that there is no way to define a complete graph invariant in the form of unique structural characteristics of each its vertex, which has a computational complexity of definition better than О (n 4 .The work objective is to provide the characteristics of the graph structure, which could be used to solve the problem of their isomorphism for a time better than О (n 4 . As such characteristics, the paper proposes to use the set of codes of tree roots of all the shortest - in terms of the number of edges - paths from each vertex to the others, uniquely defining the structure of each tree. It proves the theorem that it is possible to reduce the problem of isomorphism of the undirected graphs to the isomorphism problem of their splitting into the trees of all the shortest - in terms of the number of edges - paths of each vertex to the others. An algorithm to construct the shortest paths from each vertex to all others and to compute codes of their vertices has been developed. As the latter, are used Aho-codes, which find application in recognising the isomorphism of trees. The computational complexity to obtain structural characteristics of vertices has been estimated to be about О (n 3 .The pilot studies involved the full-scale experiment using the developed complex programmes to generate raw data, i.e. analytic representation of the graph with the number of vertices equal to 1200, and a programme to provide codes of the tree roots. To have an estimate of - "the worst" in terms of time - complexity of expansion algorithm of graphs into trees of the shortest paths and define the codes of their roots has been an experimentally studied how the number of tree vertices depends on the graph density. For the worst case was obtained a dependence of the number of tree vertices on the number of graph vertices

  20. Safety of an abbreviated duration of dual antiplatelet therapy (≤6 months) following second-generation drug-eluting stents for coronary artery disease: A systematic review and meta-analysis of randomized trials.

    Science.gov (United States)

    Ziada, Khaled M; Abdel-Latif, Ahmed K; Charnigo, Richard; Moliterno, David J

    2016-03-01

    Dual antiplatelet therapy (DAPT) is recommended for ≥12 months following coronary drug-eluting stents (DES) to reduce risk of major adverse ischemic events. Randomized trials suggest an abbreviated DAPT duration (≤6 months) is adequately protective. However, these trials are individually underpowered to detect differences in rare but serious events such as stent thrombosis (ST). We performed a meta-analysis of published randomized trials to define the impact of abbreviated DAPT (≤6 months) on death, myocardial infarction (MI), stent thrombosis (ST), and bleeding complications compared to standard-duration DAPT (≥12 months). Seven randomized controlled trials comparing abbreviated vs. standard DAPT regimens following DES use were identified by two independent investigators. Study characteristics were reviewed and clinical endpoint data were abstracted and analyzed in aggregate using fixed and random-effects models. The seven trials included 15,874 randomized patients. Second-generation DES were used in most patients. Compared to standard-duration DAPT, abbreviated DAPT was not associated with an increase in mortality (OR 0.93; CI: 0.73 to 1.17; P = 0.52), MI (OR 1.14; CI: 0.89 to 1.45; P = 0.30) or ST (OR 1.25; CI: 0.81 to 1.93; P = 0.31). Abbreviated DAPT was associated with significantly fewer major bleeding complications (OR 0.52; CI: 0.34 to 0.82; P = 0.005). The results were consistent between fixed and random-effects models, with no heterogeneity. Sensitivity analyses adjusting for inclusion of bare metal stents, 1st generation DES and/or abbreviated DAPT regimens of 3 months resulted in similar conclusions. In a meta-analysis of >15,000 patients primarily treated with second-generation DES, abbreviated-duration DAPT (≤6 months) was associated with a significant reduction in major bleeding complications with no evidence of a significant increase in risk of death, MI or ST. Accordingly, abbreviated DAPT should be strongly considered