WorldWideScience

Sample records for abbreviated version release

  1. New bilingual version of the VGB abbreviation catalogue for power plant technology released

    Energy Technology Data Exchange (ETDEWEB)

    Hantschel, Jochen; Seiffert, Joerg [E.ON New Build and Technology GmbH, Gelsenkirchen (Germany); Froehner, Joerg [ct.e Controltechnology Engineering GmbH, Herne (Germany)

    2013-04-01

    The objective of the VGB Standard for power plant technology VGB-S-891-00 (abbreviation catalogue) is to regulate the systematic creation of abbreviations. The determination of abbreviations for terms related to power plants provides a common basis for planners, erectors, and operators of power plants and their systems. In combination with VGB-B 108 ''Rules for the creation of denominations and their application for power plant engineering'' the abbreviation catalogue is the basis for the creation of denominations.

  2. Developing and Validating an Abbreviated Version of the Microscale Audit for Pedestrian Streetscapes (MAPS-Abbreviated).

    Science.gov (United States)

    Cain, Kelli L; Gavand, Kavita A; Conway, Terry L; Geremia, Carrie M; Millstein, Rachel A; Frank, Lawrence D; Saelens, Brian E; Adams, Marc A; Glanz, Karen; King, Abby C; Sallis, James F

    2017-06-01

    Macroscale built environment factors (e.g., street connectivity) are correlated with physical activity. Less-studied but more modifiable microscale elements (e.g., sidewalks) may also influence physical activity, but shorter audit measures of microscale elements are needed to promote wider use. This study evaluated the relation of an abbreviated 54-item streetscape audit tool with multiple measures of physical activity in four age groups. We developed a 54-item version from the original 120-item Microscale Audit of Pedestrian Streetscapes (MAPS). Audits were conducted on 0.25-0.45 mile routes from participant residences toward the nearest nonresidential destination for children (N=758), adolescents (N=897), younger adults (N=1,655), and older adults (N=367). Active transport and leisure physical activity were measured with surveys, and objective physical activity was measured with accelerometers. Items to retain from original MAPS were selected primarily by correlations with physical activity. Mixed linear regression analyses were conducted for MAPS-Abbreviated summary scores, adjusting for demographics, participant clustering, and macroscale walkability. MAPS-Abbreviated and original MAPS total scores correlated r=.94 The MAPS-Abbreviated tool was related similarly to physical activity outcomes as the original MAPS. Destinations and land use, streetscape and walking path characteristics, and overall total scores were significantly related to active transport in all age groups. Street crossing characteristics were related to active transport in children and older adults. Aesthetics and social characteristics were related to leisure physical activity in children and younger adults, and cul-de-sacs were related with physical activity in youth. Total scores were related to accelerometer-measured physical activity in children and older adults. MAPS-Abbreviated is a validated observational measure for use in research. The length and related cost of implementation has

  3. Is the full version of the AUDIT really necessary? Study of the validity and internal construct of its abbreviated versions.

    Science.gov (United States)

    Meneses-Gaya, Carolina; Zuardi, Antonio W; Loureiro, Sonia R; Hallak, Jaime E C; Trzesniak, Clarissa; de Azevedo Marques, João M; Machado-de-Sousa, João P; Chagas, Marcos H N; Souza, Roberto M; Crippa, José A S

    2010-08-01

    This study was aimed at assessing the psychometric qualities of the abbreviated versions of the Alcohol Use Disorders Identification Test (AUDIT-3, AUDIT-4, AUDIT-C, AUDIT-PC, AUDIT-QF, FAST, and Five-Shot) and at comparing them to the 10-item AUDIT and the CAGE in 2 samples of Brazilian adults. The validity and internal consistency of the scales were assessed in a sample of 530 subjects attended at an emergency department and at a Psychosocial Care Center for Alcohol and Drugs. The Structured Clinical Interview for DSM-IV was used as the diagnostic comparative measure for the predictive validity assessment. The concurrent validity between the scales was analyzed by means of Pearson's correlation coefficient. The assessment of the predictive validity of the abbreviated versions showed high sensitivity (of 0.78 to 0.96) and specificity (of 0.74 to 0.94) indices, with areas under the curve as elevated as those of the AUDIT (0.89 and 0.92 to screen for abuse and 0.93 and 0.95 in the screening of dependence). The CAGE presented lower indices: 0.81 for abuse and 0.87 for dependence. The analysis of the internal consistency of the AUDIT and its versions exhibited Cronbach's alpha coefficients between 0.83 and 0.94, while the coefficient for the CAGE was 0.78. Significant correlations were found between the 10-item AUDIT and its versions, ranging from 0.91 to 0.99. Again, the results for the CAGE were satisfactory (0.77), although inferior to the other instruments. The results obtained in this study confirm the validity of the abbreviated versions of the AUDIT for the screening of alcohol use disorders and show that their psychometric properties are as satisfactory as those of the 10-item AUDIT and the CAGE.

  4. McArthur-Bates Communicative Development Inventory (CDI: Proposal of an abbreviate version

    Directory of Open Access Journals (Sweden)

    Chamarrita Farkas Klein

    2011-01-01

    Full Text Available The McArthur-Bates Communicative Development Inventories (CDI assesses language development en children, through a significant caregiver report. The first inventory assesses verbal and non verbal language in infants who are from 8 to 18 months old and it is composed of 949 items distributed in 6 scales. This study proposes an abbreviate form of this instrument, and was tested on families and educators of 130 Chilean children of 11-15 months old. Analyses related to the items, reliability and validity of the instrument and factorial analyses of subscales were realized. The abbreviate version consider 241 items distributed in 4 scales. The evaluation of the psychometric properties of the instrument was acceptable, demonstrating adequate reliability and validity.

  5. Reliability and validity of the Farsi version of the standardized assessment of personality-abbreviated scale

    Directory of Open Access Journals (Sweden)

    Maryam Sepehri

    2017-06-01

    Full Text Available Introduction: A short screening tool for high-risk individuals with personality disorder (PD is useful both for clinicians and researchers. The aim of this study was to assess the validity and reliability of the Farsi version of the Standardized Assessment of Personality-Abbreviated Scale (SAPAS. Methods: The original English version of the SAPAS questionnaire was translated into Farsi, and then, translated back into English by two professionals. A survey was then conducted using the questionnaire on 150 clients of primary health care centers in Tabriz, Iran. A total of 235 medical students were also studied for the reliability assessment of the questionnaire. The SAPAS was compared to the short form of Minnesota Multiphasic Personality Inventory (MMPI. The data analysis was performed using receiver operating characteristic (ROC curve technique, operating characteristic for diagnostic efficacy, Cronbach's alpha, and test-retest for reliability evaluation. Results: We found an area under the curve (AUC of 0.566 [95% confidence intervals (CI: 0.455-0.677]; sensitivity of 0.89 and specificity of 0.26 at the cut-off score of 2 and higher. The total Cronbach's alpha coefficient was 0.38 and Cohen's kappa ranged between 0.5 and 0.8. Conclusion: The current study showed that the Farsi version of the SAPAS was relatively less efficient, in term of validity and reliability, in the screening of PD in the population.

  6. MCNP Version 6.2 Release Notes

    Energy Technology Data Exchange (ETDEWEB)

    Werner, Christopher John [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Bull, Jeffrey S. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Solomon, C. J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Brown, Forrest B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); McKinney, Gregg Walter [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Rising, Michael Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Dixon, David A. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Martz, Roger Lee [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hughes, Henry G. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Cox, Lawrence James [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Zukaitis, Anthony J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Armstrong, J. C. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Forster, Robert Arthur [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Casswell, Laura [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2018-02-05

    Monte Carlo N-Particle or MCNP® is a general-purpose Monte Carlo radiation-transport code designed to track many particle types over broad ranges of energies. This MCNP Version 6.2 follows the MCNP6.1.1 beta version and has been released in order to provide the radiation transport community with the latest feature developments and bug fixes for MCNP. Since the last release of MCNP major work has been conducted to improve the code base, add features, and provide tools to facilitate ease of use of MCNP version 6.2 as well as the analysis of results. These release notes serve as a general guide for the new/improved physics, source, data, tallies, unstructured mesh, code enhancements and tools. For more detailed information on each of the topics, please refer to the appropriate references or the user manual which can be found at http://mcnp.lanl.gov. This release of MCNP version 6.2 contains 39 new features in addition to 172 bug fixes and code enhancements. There are still some 33 known issues the user should familiarize themselves with (see Appendix).

  7. Multi-country evaluation of affective experience: validation of an abbreviated version of the day reconstruction method in seven countries.

    Directory of Open Access Journals (Sweden)

    José Luis Ayuso-Mateos

    Full Text Available The Day Reconstruction Method (DRM was developed to assess affective states as measures of experienced well-being. The present study aimed to validate an abbreviated version of the DRM in a representative sample of the population in seven countries (China, Ghana, India, Mexico, Russia, South Africa, and Spain, and to examine whether there are country differences in affect and in the relationships among the activities based on the similarity of the affect associated with each of them.Interviews were conducted with 47,222 non-institutionalized adults from seven countries, using an abbreviated version of the DRM. A cluster analysis was carried out to classify activities on the basis of the similarity of the associated affect. In each country, the factorial structure of the affect adjectives was tested through Confirmatory Factor Analysis. Internal consistency and construct validity were also assessed. Moreover, the differences in affect across countries and the diurnal cycles of affect were evaluated.The DRM showed adequate psychometric properties regarding reliability and construct validity in all countries. Respondents from Ghana and South Africa reported more positive net affect whereas Indian respondents reported less positive net affect. Most of the countries showed a similar diurnal variation of affect, which tended to improve throughout the day.The results show that this abbreviated version of the DRM is a useful tool for multi-country evaluation of experienced well-being.

  8. Does a booster intervention augment the preventive effects of an abbreviated version of the coping power program for aggressive children?

    Science.gov (United States)

    Lochman, John E; Baden, Rachel E; Boxmeyer, Caroline L; Powell, Nicole P; Qu, Lixin; Salekin, Karen L; Windle, Michel

    2014-01-01

    Booster interventions have been presumed to be important methods for maintaining the effects of evidence-based programs for children with behavioral problems, but there has been remarkably little empirical attention to this assumption. The present study examines the effect of a child-oriented booster preventive intervention with children who had previously received an abbreviated version (24 child sessions, 10 parent sessions) of the Coping Power targeted prevention program. Two hundred and forty-one children (152 boys, 89 girls) were screened as having moderate to high levels of aggressive behavior in 4th grade, then half were randomly assigned to receive the abbreviated Coping Power program in 5th grade, and half of the preventive intervention children were then randomly assigned to a Booster condition in 6th grade. The Booster sessions consisted of brief monthly individual contacts, and were primarily with the children. Five assessments across 4 years were collected from teachers, providing a three-year follow-up for all children who participated in the project. Results indicated that the abbreviated Coping Power program (one-third shorter than the full intervention) had long-term effects in reducing children's externalizing problem behaviors, proactive and reactive aggression, impulsivity traits and callous-unemotional traits. The Booster intervention did not augment these prevention effects. These findings indicate that a briefer and more readily disseminated form of an evidence-based targeted preventive intervention was effective. The findings have potential implications for policy and guidelines about possible intervention length and booster interventions.

  9. The patient health questionnaire-15 and its abbreviated version as screening tools for depression in Korean college and graduate students.

    Science.gov (United States)

    Lyoo, Younghyun C; Ju, Sejin; Kim, Eunjung; Kim, Jieun E; Lee, Junghyun H

    2014-04-01

    Over half of all suicides worldwide occur in Asia. Given the close association between suicide and depression, it is quite unexpected that depression is least frequently diagnosed in Asia. This is, in part, due to the fact that Asians somatize depression. Young adults including college and graduate students are no exceptions. Therefore, a somatic symptom-focused screening tool would be useful in detecting depression in Asian college and graduate students. The purpose of this study was to evaluate the psychometric properties of the Patient Health Questionnaire-15 (PHQ-15) in screening for depression among Korean college and graduate students. In addition, we developed an abbreviated version of the PHQ-15 (aPHQ-15) and studied validity measures. Three-hundred and fifty Korean college and graduate students were screened with the PHQ-15. Of all participants, 176 were interviewed using the Structured Clinical Interview for DSM-IV to diagnose major depressive episode, while the other 174 were evaluated with the Beck Depression Inventory-II (BDI-II) and the Inventory of Depressive Symptomatology-Self-Report (IDS-SR). Reliability and validity measures including the internal consistency, test-retest reliability, and criterion, convergent, and divergent validity were tested. Principal component analysis was used in developing the abbreviated version of the PHQ-15. The PHQ-15 showed good internal consistency and test-retest reliability (Cronbach's alpha 0.82, intra-class correlation coefficient 0.87). The optimal cut-off point for detecting depression was estimated to be 8. There were strong correlations between the PHQ-15 total scores and self-report measures of depressive symptom severity (BDI-II: r=0.69 and pdepression. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. SHAKER Version 0.0/5 Pre-release Notes

    CERN Document Server

    CERN. Geneva

    1993-01-01

    SHAKER V0.0/5 is a pre-release of a simple cocktail central rapidity phase space event generator developed for the simulation of LHC Heavy Ion events. A modified version of JETSET 7.3 (the / LUJETS / common has been enlarged to 50000 particles and the LUEDIT routine has been modified to rearrange the particle weights vectors when called with MEDIT=1) is used to manage the events. All event information is included in / LUJETS / according to Lund conventions [1].

  11. Utility of an abbreviated version of the stanford-binet intelligence scales (5thed.) in estimating 'full scale' IQ for young children with autism spectrum disorder.

    Science.gov (United States)

    Twomey, Conal; O'Connell, Helen; Lillis, Mary; Tarpey, Sarah Louise; O'Reilly, Gary

    2018-03-01

    The fifth edition of the Stanford-Binet Intelligence scales allows 'full scale' IQ (FSIQ) to be estimated using an abridged version of the test-the abbreviated battery IQ (ABIQ). Set within a public early intervention team service, the current cross-sectional study investigated the utility of the ABIQ in estimating FSIQ for 40 children with autism spectrum disorder (ASD) aged 3-5 years. A strong ABIQ-FSIQ association was yielded (r = 0.89; r 2  = 0.808) and the ABIQ did not over-estimate mean FSIQ above a clinically-relevant threshold; however, clinically significant over-estimation occurred in 17.5% of individual cases. While the findings provide support for the utility of the ABIQ in estimating FSIQ for young children with ASD, caution relating to the over-estimation of FSIQ is warranted. Careful clinical judgment-ideally based on examination of previous cognitive assessment results (if available), thorough interactional observations, and close multi-disciplinary consultation-is necessary to determine the applicability of the ABIQ to individual cases. Autism Res 2018, 11: 503-508. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. We investigated the utility of a shortened version of the Stanford-Binet Intelligence Scales in estimating IQ for 40 young children with autism spectrum disorder (ASD). The findings provide qualified support for the instrument: acceptably accurate IQ estimation was achieved for most cases; but not so for a sizeable minority (17.5%). Careful clinical judgment is necessary to determine the applicability of the ABIQ to individual cases. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

  12. Some Common Abbreviations

    Science.gov (United States)

    ... medlineplus.gov/appendixb.html Appendix B: Some Common Abbreviations To use the sharing features on this page, ... JavaScript. This is a list of some common abbreviations and acronyms. Abbreviation Stands for More information ABG ...

  13. Abbreviations in Maritime English

    Science.gov (United States)

    Yang, Zhirong

    2011-01-01

    Aiming at the phenomena that more and more abbreviations occur in maritime English correspondences, the composing laws of the abbreviations in maritime English correspondence are analyzed, and the correct methods to answer the abbreviations are pointed out, and the translation method of abbreviations are summarized in this article, and the…

  14. FDA Acronyms and Abbreviations

    Data.gov (United States)

    U.S. Department of Health & Human Services — The FDA Acronyms and Abbreviations database provides a quick reference to acronyms and abbreviations related to Food and Drug Administration (FDA) activities

  15. NRC collection of abbreviations

    International Nuclear Information System (INIS)

    1992-03-01

    The US Nuclear Regulatory Commission (NRC) staff collected this list of abbreviations from NRC documents and nuclear industry documents, both foreign and domestic. Readers can use the collection, which is not all inclusive, to identify the terms from which the abbreviations are formed. The Editorial Section of the Division of Freedom of Information and Publications Services compiled this collection. In the introduction, the editorial staff offers suggestions for using abbreviations but does not recommend the use of one abbreviation over another

  16. Validation Study of the Abbreviated Version of the Lubben Social Network Scale Spanish Translation among Mexican and Mexican-American Older Adults.

    Science.gov (United States)

    Vilar-Compte, Mireya; Vargas-Bustamante, Arturo; Lubben, James

    2018-03-01

    To perform a face validity study of the Spanish version of the Lubben Social Network Scale (LSNS-6) among Mexican and Mexican-American older adults. A cross-national qualitative descriptive approach, based on cognitive survey testing and cross-cultural equivalence analysis, was followed to assess the face validity of the Spanish version of the LSNS-6. Data were collected through 2 focus groups in Los Angeles (LA) and 4 in Mexico City (CDMX). Focus groups followed a semi-structured guide. Eligibility criteria included being 60 years and older, native Spanish speaking, and not suffering from significant cognitive impairments. Four initial focus groups were targeted at conducting a face validity assessment of the initial scale, which led to some modifications. The two remaining focus groups reassessed the face validity of the modified version of the Spanish LSNS-6. 56 older adults participated in the focus groups yielding 152 pages of verbatim transcripts. Analysis of the transcripts identified relevant themes affecting how Mexican and Mexican American older adults understood the items from the LSNS-6 Spanish version, among them: labelling of family members and friends, notions of neighborhood, identifying and counting people, and understanding of "private matters". This led to propose a modified Spanish version of the LSNS-6 following a name generating approach, as well as some language and instruction modifications. The face validity of the modified version suggested a better understanding. The study proposes that the LSNS-6 Spanish version needs to be adapted for its use among Mexican and Mexican American older adults, and we suggest a modified version. This potentially implies that social isolation may be more accurately measured in a vulnerable group of older adults. Further research is needed to ascertain the construct validity and psychometric properties of the modified version.

  17. FY17Q4 Ristra project: Release Version 1.0 of a production toolkit

    Energy Technology Data Exchange (ETDEWEB)

    Hungerford, Aimee L. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Daniel, David John [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-21

    The Next Generation Code project will release Version 1.0 of a production toolkit for multi-physics application development on advanced architectures. Features of this toolkit will include remap and link utilities, control and state manager, setup, visualization and I/O, as well as support for a variety of mesh and particle data representations. Numerical physics packages that operate atop this foundational toolkit will be employed in a multi-physics demonstration problem and released to the community along with results from the demonstration.

  18. Ladtap XL Version 2017: A Spreadsheet For Estimating Dose Resulting From Aqueous Releases

    Energy Technology Data Exchange (ETDEWEB)

    Minter, K. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Jannik, T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2017-06-15

    LADTAP XL© is an EXCEL© spreadsheet used to estimate dose to offsite individuals and populations resulting from routine and accidental releases of radioactive materials to the Savannah River. LADTAP XL© contains two worksheets: LADTAP and IRRIDOSE. The LADTAP worksheet estimates dose for environmental pathways including external exposure resulting from recreational activities on the Savannah River and internal exposure resulting from ingestion of water, fish, and invertebrates originating from the Savannah River. IRRIDOSE estimates offsite dose to individuals and populations from irrigation of foodstuffs with contaminated water from the Savannah River. In 2004, a complete description of the LADTAP XL© code and an associated user’s manual was documented in LADTAP XL©: A Spreadsheet for Estimating Dose Resulting from Aqueous Release (WSRC-TR-2004-00059) and revised input parameters, dose coefficients, and radionuclide decay constants were incorporated into LADTAP XL© Version 2013 (SRNL-STI-2011-00238). LADTAP XL© Version 2017 is a slight modification to Version 2013 with minor changes made for more user-friendly parameter inputs and organization, updates in the time conversion factors used within the dose calculations, and fixed an issue with the expected time build-up parameter referenced within the population shoreline dose calculations. This manual has been produced to update the code description, verification of the models, and provide an updated user’s manual. LADTAP XL© Version 2017 has been verified by Minter (2017) and is ready for use at the Savannah River Site (SRS).

  19. [DAD-6: an abbreviated version of the DAD scale (disability assessment for dementia). An instrument for detection of loss of autonomy at an early stage].

    Science.gov (United States)

    de Rotrou, Jocelyne; Wu, Ya-Huei; Djabelkhir, Leila; Seux, Marie-Laure; Hugonot, Laurence; Rigaud, Anne-Sophie; Hanon, Olivier; Vidal, Jean-Sébastien

    2014-09-01

    This paper presents the French version of DAD-6, a validated instrument for the assessment of IADL (instrumental activities of daily living) considered as intentional and complex activities. A loss of autonomy remains a major criterion in the diagnosis of dementia. In addition, IADL assessment is recommended as a primary outcome in dementia drug trials. Since the publication in 1969 by Lawton and Brody of an IADL scale, many instruments have been developed. However, their psychometric properties remain to be improved. The need for improving the early diagnosis yielded to the design of DAD-6, an instrument allowing capturing subtle difficulties in IADL management. The DAD-6 scale emphasizes the role of the cognitive function, mainly the executive function in early IADL impairment. DAD-6 requires the participation of an informant (a patient's proxy). Relative to patients' self-reports or performance-based methods, informant-based questionnaires are the most common and practical methods used in memory clinics. In previous work, DAD-6 score gradually decreased with increasing severity of the cognitive status. The present work shows the inter-rater reliability of DAD-6. The use of the scale with the same informants by one neurologist and two neuropsychologists, separately, indicated a high agreement between raters (alpha of Krippendorff>0.80).This work also highlights the main sources of bias in the context of evaluation based on subjective judgement. The authors stress the necessity of: 1--a clarification of the relationship between cognitive function and IADL; 2--the measurement of IADL performance in a routine neuropsychological assessment by experienced professionals.

  20. Soil Moisture Active Passive Mission L4_SM Data Product Assessment (Version 2 Validated Release)

    Science.gov (United States)

    Reichle, Rolf Helmut; De Lannoy, Gabrielle J. M.; Liu, Qing; Ardizzone, Joseph V.; Chen, Fan; Colliander, Andreas; Conaty, Austin; Crow, Wade; Jackson, Thomas; Kimball, John; hide

    2016-01-01

    During the post-launch SMAP calibration and validation (Cal/Val) phase there are two objectives for each science data product team: 1) calibrate, verify, and improve the performance of the science algorithm, and 2) validate the accuracy of the science data product as specified in the science requirements and according to the Cal/Val schedule. This report provides an assessment of the SMAP Level 4 Surface and Root Zone Soil Moisture Passive (L4_SM) product specifically for the product's public Version 2 validated release scheduled for 29 April 2016. The assessment of the Version 2 L4_SM data product includes comparisons of SMAP L4_SM soil moisture estimates with in situ soil moisture observations from core validation sites and sparse networks. The assessment further includes a global evaluation of the internal diagnostics from the ensemble-based data assimilation system that is used to generate the L4_SM product. This evaluation focuses on the statistics of the observation-minus-forecast (O-F) residuals and the analysis increments. Together, the core validation site comparisons and the statistics of the assimilation diagnostics are considered primary validation methodologies for the L4_SM product. Comparisons against in situ measurements from regional-scale sparse networks are considered a secondary validation methodology because such in situ measurements are subject to up-scaling errors from the point-scale to the grid cell scale of the data product. Based on the limited set of core validation sites, the wide geographic range of the sparse network sites, and the global assessment of the assimilation diagnostics, the assessment presented here meets the criteria established by the Committee on Earth Observing Satellites for Stage 2 validation and supports the validated release of the data. An analysis of the time average surface and root zone soil moisture shows that the global pattern of arid and humid regions are captured by the L4_SM estimates. Results from the

  1. Psychometric Assessment of the Chinese Version of the Abbreviated Expanded Prostate Cancer Index Composite (EPIC-26) and the Clinical Practice Version (EPIC-CP) in Chinese Men With Prostate Cancer.

    Science.gov (United States)

    Lam, Wendy W T; Tse, Michael A; Ng, Chris N L; Chung, Edward K M; Fielding, Richard

    2017-06-01

    The Expanded Prostate Cancer Index Composite (EPIC) instrument was designed to assess a range of health-related quality-of-life issues specifically relevant to patients with prostate cancer. This study examined the validity and reliability of Chinese versions of the 26-item EPIC and of the 16-item EPIC for Clinical Practice (EPIC-CP) in Chinese patients with prostate cancer. A Chinese version of the 26-item EPIC and the 16-item EPIC-CP were self-completed by 252 Chinese patients with prostate cancer who were recruited from three community-based cancer service centers. Confirmatory factors analysis assessed the factor structures of the EPIC and the EPIC-CP. Internal consistency and construct and clinical validities of the factor structures were assessed. Confirmatory factor analysis revealed that the original factor structure of both EPIC-26 and EPIC-CP showed good fit to this sample. A correlated model was superior to a hierarchical model in both EPIC-26 and EPIC-CP supporting the utility of the domain scores over the total scores. Cronbach α ranged from 0.55 to 0.91 for EPIC-26 and 0.44 to 0.67 for EPIC-CP. Construct validity was supported by correlations between EPIC-26/EPIC-CP and psychological distress measures. Clinical validity was supported by differentiation between patients with and without prostatectomy. These Chinese versions of the five-factor EPIC-26 and the EPIC-CP are valid and practical measures for assessing a range of health-related quality-of-life issues related to the diagnosis and treatment of prostate cancer, highlighting their utility in assessing health-related quality of life for patients diagnosed with prostate cancer. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

  2. Characterization of Disability in Canadians with Mental Disorders Using an Abbreviated Version of a DSM-5 Emerging Measure: The 12-Item WHO Disability Assessment Schedule (WHODAS) 2.0.

    Science.gov (United States)

    Sjonnesen, Kirsten; Bulloch, Andrew G M; Williams, Jeanne; Lavorato, Dina; B Patten, Scott

    2016-04-01

    The World Health Organization Disability Assessment Schedule 2.0 (WHODAS 2.0) is a disability scale included in Section 3 of the fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-5) as a possible replacement for the Global Assessment of Functioning Scale (GAF). To assist Canadian psychiatrists with interpretation of the scale, we have conducted a descriptive analysis using data from the 2012 Canadian Community Health Survey-Mental Health component (CCHS-MH). The 2012 CCHS-MH was a cross-sectional survey of the Canadian community (n = 23,757). The survey included an abbreviated 12-item version of the WHODAS 2.0. Mental disorder diagnoses were assessed for schizophrenia, other psychosis, major depressive episode (MDE), generalized anxiety disorder (GAD), bipolar I disorder, substance abuse/dependence, and alcohol abuse/dependence. Mean scores ranged from 14.2 (95% CI, 14.1 to 14.3) for the overall community population to 23.1 (95% CI, 19.5 to 26.7) for those with schizophrenia, with higher scores indicating greater disability. Furthermore, the difference in scores between those with lifetime and past-month episodes suggests that the scale is sensitive to changes occurring during the course of these disorders; for example, scores varied from 23.6 (95% CI, 22.2 to 25.1) for past-month MDE to 14.4 (95% CI, 14.2 to 14.7) in the lifetime MDE group without a past-year episode. This analysis suggests that the WHODAS 2.0 may be a suitable replacement for the GAF. As a disability measure, even though it is not a mental health-specific instrument, the 12-item WHODAS 2.0 appears to be sensitive to the impact of mental disorders and to changes over the time course of a mental disorder. However, the clinical utility of this measure requires additional assessment. © The Author(s) 2016.

  3. Newly Released TRMM Version 7 Products, Other Precipitation Datasets and Data Services at NASA GES DISC

    Science.gov (United States)

    Liu, Zhong; Ostrenga, D.; Teng, W. L.; Trivedi, Bhagirath; Kempler, S.

    2012-01-01

    The NASA Goddard Earth Sciences Data and Information Services Center (GES DISC) is home of global precipitation product archives, in particular, the Tropical Rainfall Measuring Mission (TRMM) products. TRMM is a joint U.S.-Japan satellite mission to monitor tropical and subtropical (40 S - 40 N) precipitation and to estimate its associated latent heating. The TRMM satellite provides the first detailed and comprehensive dataset on the four dimensional distribution of rainfall and latent heating over vastly undersampled tropical and subtropical oceans and continents. The TRMM satellite was launched on November 27, 1997. TRMM data products are archived at and distributed by GES DISC. The newly released TRMM Version 7 consists of several changes including new parameters, new products, meta data, data structures, etc. For example, hydrometeor profiles in 2A12 now have 28 layers (14 in V6). New parameters have been added to several popular Level-3 products, such as, 3B42, 3B43. Version 2.2 of the Global Precipitation Climatology Project (GPCP) dataset has been added to the TRMM Online Visualization and Analysis System (TOVAS; URL: http://disc2.nascom.nasa.gov/Giovanni/tovas/), allowing online analysis and visualization without downloading data and software. The GPCP dataset extends back to 1979. Version 3 of the Global Precipitation Climatology Centre (GPCC) monitoring product has been updated in TOVAS as well. The product provides global gauge-based monthly rainfall along with number of gauges per grid. The dataset begins in January 1986. To facilitate data and information access and support precipitation research and applications, we have developed a Precipitation Data and Information Services Center (PDISC; URL: http://disc.gsfc.nasa.gov/precipitation). In addition to TRMM, PDISC provides current and past observational precipitation data. Users can access precipitation data archives consisting of both remote sensing and in-situ observations. Users can use these data

  4. JaxoDraw: A graphical user interface for drawing Feynman diagrams. Version 2.0 release notes

    Science.gov (United States)

    Binosi, D.; Collins, J.; Kaufhold, C.; Theussl, L.

    2009-09-01

    variety of new features and bug fixes. Summary of revisions: Major revisions since the last published user guide were versions 1.1, 1.2 and 1.3 with several minor bug-fix releases in between. Restrictions: To make use of the latex export/preview functionality, a latex style file has to be installed separately. Certain operations (like internal latex compilation, Postscript preview) require the execution of external commands that might not work on untested operating systems. Running time: As an interactive program, the running time depends on the complexity of the diagram to be drawn.

  5. MACCS version 1.5.11.1: A maintenance release of the code

    International Nuclear Information System (INIS)

    Chanin, D.; Foster, J.; Rollstin, J.; Miller, L.

    1993-10-01

    A new version of the MACCS code (version 1.5.11.1) has been developed by Sandia National Laboratories under sponsorship of the US Nuclear Regulatory Commission. MACCS was developed to support evaluations of the off-site consequences from hypothetical severe accidents at commercial power plants. MACCS is the only current public domain code in the US that embodies all of the following modeling capabilities: (1) weather sampling using a year of recorded weather data; (2) mitigative actions such as evacuation, sheltering, relocation, decontamination, and interdiction; (3) economic costs of mitigative actions; (4) cloudshine, groundshine, and inhalation pathways as well as food and water ingestion; (5) calculation of both individual and societal doses to various organs; and (6) calculation of both acute (nonstochastic) and latent (stochastic) health effects and risks of health effects. All of the consequence measures may be fun generated in the form of a complementary cumulative distribution function (CCDF). The current version implements a revised cancer model consistent with recent reports such as BEIR V and ICRP 60. In addition, a number of error corrections and portability enhancements have been implemented. This report describes only the changes made in creating the new version. Users of the code will need to obtain the code's original documentation, NUREG/CR-4691

  6. The OCO-2 Version 8 XCO2 Data Product Fall 2017 Release: Description and Preliminary Validation

    Science.gov (United States)

    O'Dell, C.; Eldering, A.; Crisp, D.; Fisher, B.; Gunson, M. R.; Kiel, M.; Mandrake, L.; Taylor, T. L.; Wennberg, P. O.

    2017-12-01

    Since beginning its science mission in September 2014, the Orbiting Carbon Observatory-2 (OCO-2) has provided 1-2 million estimates of the column average carbon dioxide (CO2) dry air mole fraction, XCO2, each month. While the Version-7 (V7) OCO-2 data product is generally of high quality, it includes some notable biases, including low and high biases in the tropical and extratropical oceans, respectively, and biases associated with unscreened clouds and variable topography. Because even small (simulates small aerosol particles high in the atmosphere, such as the Junge Layer and aerosols due to volcanic eruptions. It also mitigates the impact of zero level offsets due to a thin layer of ice that accumulates on the OCO-2 detectors, which actually mimics a small, lofted aerosol particle in the retrieval forward model. We show comparisons of the new XCO2 product to both TCCON and models. Improvements in the V8 screening also provides additional data over tropical oceans, which may enhance coverage in these regions. These data are currently being evaluated. Similarly, the new version 8 data may enable improved coverage at higher latitudes via a renewed focus on the challenging retrievals at higher solar zenith angles and over snow and ice covered surfaces.

  7. 40 CFR 300.4 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Abbreviations. 300.4 Section 300.4... Introduction § 300.4 Abbreviations. (a) Department and Agency Title Abbreviations: ATSDR—Agency for Toxic... the abbreviation “NRC” only with respect to the National Response Center. (b) Operational...

  8. 49 CFR 172.308 - Authorized abbreviations.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Authorized abbreviations. 172.308 Section 172.308... SECURITY PLANS Marking § 172.308 Authorized abbreviations. (a) Abbreviations may not be used in a proper shipping name marking except as authorized in this section. (b) The abbreviation “ORM” may be used in place...

  9. 40 CFR 86.094-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.094-3 Section 86.094...-Fueled and Methanol-Fueled Heavy-Duty Vehicles § 86.094-3 Abbreviations. (a) The abbreviations in § 86.090-3 remain effective. The abbreviations in this section apply beginning with the 1994 model year. (b...

  10. 40 CFR 86.1703-99 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.1703-99 Section 86....1703-99 Abbreviations. (a) The abbreviations in subpart A of this part apply to this subpart. (b) In addition, the following abbreviations shall apply to this subpart: ASTR—All States Trading Region HEV...

  11. 40 CFR 86.090-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.090-3 Section 86.090...-Fueled and Methanol-Fueled Heavy-Duty Vehicles § 86.090-3 Abbreviations. (a) The abbreviations in § 86.078-3 remain effective. The abbreviations in this section apply beginning with the 1990 model year. (b...

  12. 40 CFR 88.103-94 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Abbreviations. 88.103-94 Section 88...) CLEAN-FUEL VEHICLES Emission Standards for Clean-Fuel Vehicles § 88.103-94 Abbreviations. The abbreviations of part 86 also apply to this subpart. The abbreviations in this section apply to all of part 88...

  13. 40 CFR 88.303-93 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Abbreviations. 88.303-93 Section 88...) CLEAN-FUEL VEHICLES Clean-Fuel Fleet Program § 88.303-93 Abbreviations. The abbreviations in subpart A of this part and in 40 CFR part 86 apply to this subpart. The abbreviations in this section apply to...

  14. 40 CFR 86.000-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.000-3 Section 86.000...-Fueled and Methanol-Fueled Heavy-Duty Vehicles § 86.000-3 Abbreviations. The abbreviations in § 86.098-3 continue to apply to 1998 and later model year vehicles. The abbreviations in this section apply beginning...

  15. 40 CFR 86.098-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.098-3 Section 86.098...-Fueled and Methanol-Fueled Heavy-Duty Vehicles § 86.098-3 Abbreviations. (a) The abbreviations in § 86.096-3 continue to apply. The abbreviations in this section apply beginning with the 1998 model year...

  16. 40 CFR 86.096-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.096-3 Section 86.096...-Fueled and Methanol-Fueled Heavy-Duty Vehicles § 86.096-3 Abbreviations. (a) The abbreviations in § 86.094-3 continue to apply. The abbreviation in this section applies beginning with the 1996 model year...

  17. 40 CFR 310.4 - What abbreviations should I know?

    Science.gov (United States)

    2010-07-01

    ... RESPONSE TO HAZARDOUS SUBSTANCE RELEASES General Information § 310.4 What abbreviations should I know? The.... 11000-11050). LEPC—Local Emergency Planning Committee. NCP—National Oil and Hazardous Substances... Response Center. OMB—Office of Management and Budget. PRP—Potentially Responsible Party. SARA—The Superfund...

  18. Soil Moisture Active Passive Mission L4_C Data Product Assessment (Version 2 Validated Release)

    Science.gov (United States)

    Kimball, John S.; Jones, Lucas A.; Glassy, Joseph; Stavros, E. Natasha; Madani, Nima; Reichle, Rolf H.; Jackson, Thomas; Colliander, Andreas

    2016-01-01

    The SMAP satellite was successfully launched January 31st 2015, and began acquiring Earth observation data following in-orbit sensor calibration. Global data products derived from the SMAP L-band microwave measurements include Level 1 calibrated and geolocated radiometric brightness temperatures, Level 23 surface soil moisture and freezethaw geophysical retrievals mapped to a fixed Earth grid, and model enhanced Level 4 data products for surface to root zone soil moisture and terrestrial carbon (CO2) fluxes. The post-launch SMAP mission CalVal Phase had two primary objectives for each science product team: 1) calibrate, verify, and improve the performance of the science algorithms, and 2) validate accuracies of the science data products as specified in the L1 science requirements. This report provides analysis and assessment of the SMAP Level 4 Carbon (L4_C) product pertaining to the validated release. The L4_C validated product release effectively replaces an earlier L4_C beta-product release (Kimball et al. 2015). The validated release described in this report incorporates a longer data record and benefits from algorithm and CalVal refinements acquired during the SMAP post-launch CalVal intensive period. The SMAP L4_C algorithms utilize a terrestrial carbon flux model informed by SMAP soil moisture inputs along with optical remote sensing (e.g. MODIS) vegetation indices and other ancillary biophysical data to estimate global daily net ecosystem CO2 exchange (NEE) and component carbon fluxes for vegetation gross primary production (GPP) and ecosystem respiration (Reco). Other L4_C product elements include surface (10 cm depth) soil organic carbon (SOC) stocks and associated environmental constraints to these processes, including soil moisture and landscape freeze/thaw (FT) controls on GPP and respiration (Kimball et al. 2012). The L4_C product encapsulates SMAP carbon cycle science objectives by: 1) providing a direct link between terrestrial carbon fluxes and

  19. Cementitious Barriers Partnership (CBP): Training and Release of CBP Toolbox Software, Version 1.0 - 13480

    International Nuclear Information System (INIS)

    Brown, K.G.; Kosson, D.S.; Garrabrants, A.C.; Sarkar, S.; Flach, G.; Langton, C.; Smith, F.G. III; Burns, H.; Van der Sloot, H.; Meeussen, J.C.L.; Samson, E.; Mallick, P.; Suttora, L.; Esh, D.; Fuhrmann, M.; Philip, J.

    2013-01-01

    of enhancements desired by participants. Tools were revised based on feedback obtained during the workshops held from April through June 2012. The resulting improved CBP Software Toolbox, including evaluation versions of and LeachXS TM /ORCHESTRA and STADIUM R has been made available to workshop and selected other participants for further assessment. Inquiries about future workshops and requests for access to the Toolbox software can be made via the CBP web site [1]. (authors)

  20. Cementitious Barriers Partnership (CBP): Training and Release of CBP Toolbox Software, Version 1.0 - 13480

    Energy Technology Data Exchange (ETDEWEB)

    Brown, K.G.; Kosson, D.S.; Garrabrants, A.C.; Sarkar, S. [Vanderbilt University, School of Engineering, CRESP, Nashville, TN 37235 (United States); Flach, G.; Langton, C.; Smith, F.G. III; Burns, H. [Savannah River National Laboratory, Aiken, SC 29808 (United States); Van der Sloot, H. [Hans Van der Sloot Consultancy, Dorpsstraat 216, 1721BV Langedijk (Netherlands); Meeussen, J.C.L. [Nuclear Research and Consultancy Group, Westerduinweg 3, Petten (Netherlands); Samson, E. [SIMCO Technologies, Inc., Quebec (Canada); Mallick, P.; Suttora, L. [U.S. Department of Energy, Washington, DC (United States); Esh, D.; Fuhrmann, M.; Philip, J. [U.S. Nuclear Regulatory Commission, Washington, DC (United States)

    2013-07-01

    by discussions of enhancements desired by participants. Tools were revised based on feedback obtained during the workshops held from April through June 2012. The resulting improved CBP Software Toolbox, including evaluation versions of and LeachXS{sup TM}/ORCHESTRA and STADIUM{sup R} has been made available to workshop and selected other participants for further assessment. Inquiries about future workshops and requests for access to the Toolbox software can be made via the CBP web site [1]. (authors)

  1. [Abbreviations in daily language: stop it].

    Science.gov (United States)

    Girbes, A C; Girbes, A R J

    2017-01-01

    Abbreviations are used more and more in physician common parlance and it seems they are on the way to becoming a new jargon. However, identical abbreviations may have different meanings, especially in different medical specialties. Moreover, many physicians do not know the meaning of specific abbreviations or are attributing the wrong meaning to the abbreviation. This will lead to misunderstanding and therefore danger to the patient. The authors are calling for a stop on the use of spoken abbreviations and for minimising the use of abbreviations in clinical notes and medical prescriptions.

  2. Global change: Acronyms and abbreviations

    Energy Technology Data Exchange (ETDEWEB)

    Woodard, C.T. [Oak Ridge National Lab., TN (United States); Stoss, F.W. [Univ. of Tennessee, Knoxville, TN (United States). Energy, Environment and Resources Center

    1995-05-01

    This list of acronyms and abbreviations is compiled to provide the user with a ready reference to dicipher the linguistic initialisms and abridgements for the study of global change. The terms included in this first edition were selected from a wide variety of sources: technical reports, policy documents, global change program announcements, newsletters, and other periodicals. The disciplinary interests covered by this document include agriculture, atmospheric science, ecology, environmental science, oceanography, policy science, and other fields. In addition to its availability in hard copy, the list of acronyms and abbreviations is available in DOS-formatted diskettes and through CDIAC`s anonymous File Transfer Protocol (FTP) area on the Internet.

  3. MEDLARS Abbreviations for Medical Journal Titles

    Science.gov (United States)

    Charen, Thelma; Gillespie, Constantine J.

    1971-01-01

    The National Library of Medicine announces its adoption of the Anglo-American standard for the formulation of journal title abbreviations according to the American National Standard for the Abbreviation of Titles of Periodicals (1969), with individual words abbreviated, in turn, according to the International List of Periodical Title Word Abbreviations (1970). The history of the activity of the specific Z39 Committee of USASI (now ANSI) concerned with journal title abbreviations is reviewed, covering the period from 1962 to the present. A history of the National Clearinghouse for Periodical Title Word Abbreviations and of the International List is also given. Former NLM usage is compared with the forms of the present International List and examples show the major changes in NLM abbreviations. The NLM Rules for Abbreviation of Periodical Titles as derived from the new standard are appended. PMID:5146764

  4. Normative data and psychometric properties of the Connor-Davidson Resilience Scale (CD-RISC) and the abbreviated version (CD-RISC2) among the general population in Hong Kong.

    Science.gov (United States)

    Ni, Michael Y; Li, Tom K; Yu, Nancy X; Pang, Herbert; Chan, Brandford H Y; Leung, Gabriel M; Stewart, Sunita M

    2016-01-01

    To examine whether the two-item version (CD-RISC2) of the Connor-Davidson Resilience Scale (CD-RISC) has adequate internal consistency and construct validity, as well as significant correlation with the full scale, and to provide normative data for the CD-RISC and the CD-RISC2 in a Chinese general population in Hong Kong. In total, 10,997 randomly selected participants aged ≥20 years completed the Chinese version of the CD-RISC (including the 2 items of the CD-RISC2), the Patient Health Questionnaire, Family Harmony Scale, Family APGAR, and CAGE Questionnaire. Internal consistency and convergent and discriminant validity of the CD-RISC and CD-RISC2 were assessed. Cronbach's α for CD-RISC and CD-RISC2 was 0.97 and 0.79, respectively. CD-RISC2 was associated with the 25-item version of the CD-RISC (r = 0.88), depressive symptoms (r s = -0.18), family harmony (r = 0.20), family functioning (r = 0.27) and was not associated with alcohol consumption (r = 0.05). The mean score for the CD-RISC and CD-RISC2 was 59.99 (SD = 13.92) and 5.03 (SD = 1.37), respectively. Men, younger individuals, and those with higher education or higher household income reported higher resilience levels. The Chinese version of the CD-RISC2 was demonstrated to be a reliable and valid measure in assessing resilience among the general population in Hong Kong.

  5. 40 CFR 129.3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Abbreviations. 129.3 Section 129.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS TOXIC POLLUTANT EFFLUENT STANDARDS Toxic Pollutant Effluent Standards and Prohibitions § 129.3 Abbreviations. The abbreviations used...

  6. 40 CFR 86.503-78 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.503-78 Section 86.503-78 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Later New Motorcycles; Test Procedures § 86.503-78 Abbreviations. (a) The abbreviations in § 86.403-78...

  7. 7 CFR 1945.5 - Abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 13 2010-01-01 2009-01-01 true Abbreviations. 1945.5 Section 1945.5 Agriculture... REGULATIONS (CONTINUED) EMERGENCY Disaster Assistance-General § 1945.5 Abbreviations. The following abbreviations are used in this subpart. (a) ASCS—Agricultural Stabilization and Conservation Service. (b) DAR...

  8. 40 CFR 600.003-77 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Abbreviations. 600.003-77 Section 600.003-77 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL... Model Year Automobiles-General Provisions § 600.003-77 Abbreviations. (a) The abbreviations used in this...

  9. 40 CFR 600.503-78 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Abbreviations. 600.503-78 Section 600... Automobiles)-Procedures for Determining Manufacturer's Average Fuel Economy § 600.503-78 Abbreviations. The abbreviations in § 600.003 apply to this subpart. ...

  10. 40 CFR 94.3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Abbreviations. 94.3 Section 94.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Compression-Ignition Marine Engines § 94.3 Abbreviations. The abbreviations of this section apply to all...

  11. 40 CFR 600.203-77 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Abbreviations. 600.203-77 Section 600... Model Year Automobiles-Procedures for Calculating Fuel Economy Values § 600.203-77 Abbreviations. The abbreviations in § 600.003 apply to this subpart. ...

  12. 40 CFR 86.1503 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.1503 Section 86.1503 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Abbreviations. The abbreviations in § 86.084-3 or in § 86.1804-01, as applicable, apply to this subpart. [64 FR...

  13. 40 CFR 92.3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Abbreviations. 92.3 Section 92.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF AIR... Locomotives and Locomotive Engines § 92.3 Abbreviations. The abbreviations of this section apply to all...

  14. 16 CFR 500.22 - Abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Abbreviations. 500.22 Section 500.22 Commercial Practices FEDERAL TRADE COMMISSION RULES, REGULATIONS, STATEMENT OF GENERAL POLICY OR... PACKAGING AND LABELING ACT § 500.22 Abbreviations. The following abbreviations and none other may be...

  15. 40 CFR 86.884-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.884-3 Section 86.884... New Diesel Heavy-Duty Engines; Smoke Exhaust Test Procedure § 86.884-3 Abbreviations. The abbreviations in § 86.078-3 apply to this subpart. ...

  16. 40 CFR 86.703-94 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.703-94 Section 86.703-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... § 86.703-94 Abbreviations. The abbreviations in subparts A and B of this part apply to this subpart. ...

  17. 40 CFR 86.103 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.103 Section 86.103 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF...; Test Procedures § 86.103 Abbreviations. The abbreviations in subpart A apply to this subpart. [45 FR...

  18. 40 CFR 86.078-3 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.078-3 Section 86.078-3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED...-Fueled and Methanol-Fueled Heavy-Duty Vehicles § 86.078-3 Abbreviations. The abbreviations in this...

  19. 14 CFR 34.2 - Abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Abbreviations. 34.2 Section 34.2... EXHAUST EMISSION REQUIREMENTS FOR TURBINE ENGINE POWERED AIRPLANES General Provisions § 34.2 Abbreviations. The abbreviations used in this part have the following meanings in both upper and lower case: COCarbon...

  20. 48 CFR 3002.270 - Abbreviations.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Abbreviations. 3002.270 Section 3002.270 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND SECURITY ACQUISITION REGULATION (HSAR) GENERAL DEFINITIONS OF WORDS AND TERMS Abbreviations 3002.270 Abbreviations...

  1. 40 CFR 86.1303-84 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.1303-84 Section 86.1303-84 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED....1303-84 Abbreviations. The abbreviations in § 86.084-3 apply to this subpart. ...

  2. 40 CFR 600.103-78 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Abbreviations. 600.103-78 Section 600.103-78 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL... Model Year Automobiles-Test Procedures § 600.103-78 Abbreviations. The abbreviations in § 600.003 apply...

  3. 40 CFR 600.403-77 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Abbreviations. 600.403-77 Section 600... Model Year Automobiles-Dealer Availability of Fuel Economy Information § 600.403-77 Abbreviations. The abbreviations in § 600.003 apply to this subpart. ...

  4. 40 CFR 52.18 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Abbreviations. 52.18 Section 52.18 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS General Provisions § 52.18 Abbreviations. Abbreviations used in this part...

  5. 40 CFR 88.203-94 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Abbreviations. 88.203-94 Section 88.203-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CLEAN-FUEL VEHICLES California Pilot Test Program § 88.203-94 Abbreviations. The abbreviations in...

  6. 40 CFR 86.1203-85 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.1203-85 Section 86.1203-85 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Methanol-Fueled Heavy-Duty Vehicles § 86.1203-85 Abbreviations. The abbreviations in § 86.079-3 apply to...

  7. 40 CFR 86.403-78 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.403-78 Section 86.403-78 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Later New Motorcycles, General Provisions § 86.403-78 Abbreviations. The abbreviations used in this...

  8. 40 CFR 600.303-77 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Abbreviations. 600.303-77 Section 600.303-77 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL... Model Year Automobiles-Labeling § 600.303-77 Abbreviations. The abbreviations in § 600.003 apply to this...

  9. 40 CFR 86.303-79 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.303-79 Section 86.303-79 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Abbreviations. The abbreviations in § 86.078-3 apply to this subpart. ...

  10. 40 CFR 86.1403 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Abbreviations. 86.1403 Section 86.1403 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Short Test Procedures § 86.1403 Abbreviations. The abbreviations in § 86.096-3 apply to this subpart. ...

  11. Avoiding Potential Medication Errors Associated with Non-intuitive Medication Abbreviations.

    Science.gov (United States)

    Shultz, Jonas; Strosher, Lisa; Nathoo, Shaheen Nenshi; Manley, Jim

    2011-07-01

    Pharmaceutical companies use a variety of abbreviations to denote short- and long-acting medications. Errors involving the administration of these medications are frequently reported. To evaluate comprehension rates for abbreviations used to denote short- and long-acting medications and to evaluate whether changes to medication labels could reduce potential errors in the selection and administration of medications. In phase 1 of the study, nursing staff were asked to define 4 abbreviations and then to categorize them by release rate. In phase 2, a simulation exercise, nursing staff were asked if it would be appropriate to administer a medication illustrated in a photograph (oxycodone CR 5-mg blister pack) on the basis of information highlighted in a screen shot of an electronic medication administration record (order for oxycodone 5 mg). Three different presentations were used to identify the medication in the medication administration record and on the drug label. In phase 1, 10 (28%) of 36 nursing staff members knew what all 4 abbreviations meant, and 14 (39%) correctly classified all 4 abbreviations as indicating a short- or a long-acting medication. In the simulation exercise (phase 2), labelling changes reduced the likelihood of a potential medication administration error. Most abbreviations used to indicate short- versus long-acting medications were not correctly understood by study participants. Of more concern was the incorrect interpretation of some abbreviations as indicating the opposite release rate (e.g., "ER" interpreted as meaning "emergency release", rather than "extended release", with incorrect classification as a short-acting medication). This evaluation highlighted the potential consequences of using non-intuitive abbreviations to differentiate high-risk medications having different release rates.

  12. New Abbreviations in Colloquial French

    Directory of Open Access Journals (Sweden)

    Vladimir Pogačnik

    2015-12-01

    Full Text Available The author of the article treats the process of abbreviations, which he explored forty years ago in his master thesis. The article is based on the corpus created on the basis of Télématin broadcast on French television network TV5. According to the author, clipping is a widespread process that occurs primarily in various forms of oral communication.

  13. NESHAP Area-Specific Dose-Release Factors for Potential Onsite Member-of-the-Public Locations at SRS using CAP88-PC Version 4.0

    Energy Technology Data Exchange (ETDEWEB)

    Trimor, P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2017-08-09

    The Environmental Protection Agency (EPA) requires the use of the computer model CAP88-PC to estimate the total effective doses (TED) for demonstrating compliance with 40 CFR 61, Subpart H (EPA 2006), the National Emission Standards for Hazardous Air Pollutants (NESHAP) regulations. As such, CAP88 Version 4.0 was used to calculate the receptor dose due to routine atmospheric releases at the Savannah River Site (SRS). For estimation, NESHAP dose-release factors (DRFs) have been supplied to Environmental Compliance and Area Closure Projects (EC&ACP) for many years. DRFs represent the dose to a maximum receptor exposed to 1 Ci of a specified radionuclide being released into the atmosphere. They are periodically updated to include changes in the CAP88 version, input parameter values, site meteorology, and location of the maximally exposed individual (MEI). In this report, the DRFs were calculated for potential radionuclide atmospheric releases from 13 SRS release points. The three potential onsite MEI locations to be evaluated are B-Area, Three Rivers Landfill (TRL), and Savannah River Ecology Lab Conference Center (SRELCC) with TRL’s onsite workers considered as members-of-the-public, and the potential future constructions of dormitories at SRELCC and Barracks at B-Area. Each MEI location was evaluated at a specified compass sector with different area to receptor distances and was conducted for both ground-level and elevated release points. The analysis makes use of area-specific meteorological data (Viner 2014). The resulting DRFs are compared to the 2014 NESHAP offsite MEI DRFs for three operational areas; A-Area, H-Area, and COS for a release rate of 1 Ci of tritium oxide at 0 ft. elevation. CAP88 was executed again using the 2016 NESHAP MEI release rates for 0 and 61 m stack heights to determine the radionuclide dose at TRL from the center-of-site (COS).

  14. List of abbreviation of nuclear energy term

    International Nuclear Information System (INIS)

    1986-06-01

    This book deals with abbreviation of nuclear energy terms, which are in alphabetical order. List of abbreviation of nuclear energy term can be used in various field like the medical world, power plant and research center of researchers and students. This book contains a lot of abbreviation of nuclear energy term like LWR, PWR, SG, MGE, MNE, MNF, AINS, AMS, ATWS, CARE, EOF, MCR, RIMS, SMS and TRF.

  15. Abbreviations

    OpenAIRE

    2013-01-01

    "AB" The official French logo for certified organic produce ("Agriculture Biologique") CF Conventional farming EF Ecological farming IFS Integrated farming systems LIF Low-input farming OF Organic farming OFgc Organic farming under group certification AFSAA Agence Française de Sécurité Sanitaire des Aliments (French food safety agency) AMAP Association pour le Maintien d'une Agriculture Paysanne (Association for the maintenance of small-scale farming – there is a network of such associations ...

  16. Abbreviations used in scientific and technical reports

    International Nuclear Information System (INIS)

    Sun Chang.

    1986-04-01

    Reports contain a large number of abbreviations which have not yet been included in the current specialized dictionaries or lists of abbreviations. It is therefore often time-consuming or even fruitless to search for such abbreviations. The present alphabetical list of more than 4,000 abbreviations gathered from the report inventory of the Central Library of the KFA Juelich in the period from 1982-1986, taking into consideration all the scientific and technical disciplines, is intended to remedy a deficiency and to offer assistance which will undoubtedly be welcomed by scientists and engineers. (orig./HP) [de

  17. Abbreviated RD and D program portfolio selection workbook

    Energy Technology Data Exchange (ETDEWEB)

    Boyd, D.W.; Cohan, D.; Regulinski, S.G.

    1979-12-01

    A workbook for implementing an abbreviated version of the RD and D portfolio selection methodology described in A Resource Allocation Methodology for Establishing RD and D Budgetary Priorities is presented. The purpose of the abbreviated methodology is to allow a fast, first-cut analysis of a set of programs and to provide a means of discovering important issues that deserve more detailed analysis. The use of the abbreviated methodology in the overall process of evaluating RD and D programs is outlined. The effect of the program on a process is represented by the process model. Those process cost and performance characteristics that are important to the market for an energy product are described. The product cost model takes the cost and performance characteristics and the feedstock price and calculates the cost of producing a unit of energy using the technology in question. The market model takes this cost, the demand for the energy product, and the characteristics of alternative sources of the same product, and specifies the market share captured by the new technology. From this point it is relatively straightforward to infer the impacts of the new technology on the energy system. The benefit model evaluates the impacts in a consistent way, given the cost of the Federal support.

  18. Acronyms, initialisms, and abbreviations: Fourth Revision

    Energy Technology Data Exchange (ETDEWEB)

    Tolman, B.J. [comp.

    1994-04-01

    This document lists acronyms used in technical writing. The immense list is supplemented by an appendix containing chemical elements, classified information access, common abbreviations used for functions, conversion factors for selected SI units, a flowcharting template, greek alphabet, metrix terminology, proofreader`s marks, signs and symbols, and state abbreviations.

  19. 40 CFR 117.2 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Abbreviations. 117.2 Section 117.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS DETERMINATION OF REPORTABLE QUANTITIES FOR HAZARDOUS SUBSTANCES General Provisions § 117.2 Abbreviations. NPDES equals...

  20. 40 CFR 116.2 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Abbreviations. 116.2 Section 116.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS DESIGNATION OF HAZARDOUS SUBSTANCES § 116.2 Abbreviations. ppm=parts per million mg=milligram(s) kg=kilogram(s) mg/l=milligrams(s) per...

  1. 15 CFR 995.5 - Abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Abbreviations. 995.5 Section 995.5 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) NATIONAL OCEANIC... HYDROGRAPHIC PRODUCTS General § 995.5 Abbreviations. CEDCertified NOAA ENC Distributor CEVADCertified NOAA ENC...

  2. 32 CFR 552.162 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 3 2010-07-01 2010-07-01 true Abbreviations. 552.162 Section 552.162 National Defense Department of Defense (Continued) DEPARTMENT OF THE ARMY MILITARY RESERVATIONS AND NATIONAL..., and Camp Bonneville § 552.162 Abbreviations. See appendix F to this subpart. ...

  3. 48 CFR 1302.170 - Abbreviations

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Abbreviations 1302.170 Section 1302.170 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE GENERAL DEFINTIONS OF WORDS AND TERMS Definitions 1302.170 Abbreviations AIRAdditional Item Requirements BPOSenior Bureau...

  4. An Abbreviated Version of the Mindful Eating Questionnaire.

    Science.gov (United States)

    Clementi, Cecilia; Casu, Giulia; Gremigni, Paola

    2017-04-01

    To assess the psychometric properties of the Mindful Eating Questionnaire (MEQ). A total of 15 mindfulness experts evaluated the content of the 28 items and 5 factors of the MEQ. A sample of 1,067 Italian adults (61.4% women) completed the MEQ and other measures; 62 participants completed a 4-week test-retest. Content analysis reduced the MEQ to 20 items. Exploratory and confirmatory factor analyses supported a 2-factor model based on awareness and recognition of hunger and satiety cues. Factors showed adequate internal consistency (α = .75 and .83, respectively) and test-retest reliability (intraclass correlation coefficient = 0.73 and 0.85, respectively), and were associated in expected ways, although with small to moderate effect sizes, with general mindfulness, meditation experience, yoga practice, not being on a diet plan, and body mass index categories. Findings provided evidence of validity and reliability for the 20-item MEQ and support its use by clinicians and researchers for addressing eating-related issues. Copyright © 2017 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

  5. 7 CFR 1951.852 - Definitions and abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 14 2010-01-01 2009-01-01 true Definitions and abbreviations. 1951.852 Section 1951....852 Definitions and abbreviations. (a) General definitions. The following definitions are applicable... business. (b) Abbreviations. The following abbreviations are applicable: B&I—Business and Industry CSA...

  6. 38 CFR 21.8010 - Definitions and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... abbreviations. 21.8010 Section 21.8010 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... abbreviations. (a) Program-specific definitions and abbreviations. For the purposes of this subpart: Covered.... (Authority: 38 U.S.C. 101, 1802, 1804, 1811-1812, 1814, 1821) (b) Other terms and abbreviations. The...

  7. 7 CFR 771.2 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 771.2 Section 771.2... AGRICULTURE SPECIAL PROGRAMS BOLL WEEVIL ERADICATION LOAN PROGRAM § 771.2 Abbreviations and definitions. The following abbreviations and definitions apply to this part: (a) Abbreviations: APHIS means the Animal and...

  8. Abbreviations in Swedish Clinical Text--use by three professions.

    Science.gov (United States)

    Lövestam, Elin; Velupillai, Sumithra; Kvist, Maria

    2014-01-01

    A list of 266 abbreviations from dieticians' notes in patient records was used to extract the same abbreviations from patient records written by three professions: dieticians, nurses and physicians. A context analysis of 40 of the abbreviations showed that ambiguous meanings were common. Abbreviations used by dieticians were found to be used by other professions, but not always with the same meaning. This ambiguity of abbreviations might cause misunderstandings and put patient safety at risk.

  9. The abbreviated form of the Brief Cognitive Battery in the diagnosis of dementia in Alzheimer's disease

    Directory of Open Access Journals (Sweden)

    Stephanie Castro

    Full Text Available Abstract The Brief Cognitive Battery (BCB developed by our group for cognitive assessment of low educated individuals has also shown to be highly accurate in diagnosing dementia of individuals with medium or high levels of education, making it a useful tool for populations with heterogeneous educational background. The application of BCB takes around eight minutes, a rather long period for a screening test. Objectives: Our aim was to evaluate whether the exclusion of items of the BCB could reduce its application time without losing accuracy. Methods: Patients with Alzheimer's disease with mild or moderate dementia (N=20, and 30 control subjects were submitted to an abbreviated version of the BCB in which the clock drawing test was not included as an interference test for the delayed recall test. Data from another 22 control individuals who were submitted to the original BCB in another study were also included for comparison. A mathematical formula was employed to compare the two versions of the BCB. Descriptive statistics and ROC (receiver operator characteristic curves were used (alpha=0.05. Results: Using the abbreviated version, the delayed recall test also had high accuracy in diagnosing dementia and the mathematical formula results did not differ to those obtained using the original version, while mean time was reduced by 2 minutes and 37 seconds. Conclusions: This abbreviated form of the BCB is a potentially valuable tool for screening dementia in population studies as well as in busy clinical practices in countries with heterogeneous educational backgrounds.

  10. The abbreviated form of the Brief Cognitive Battery in the diagnosis of dementia in Alzheimer's disease.

    Science.gov (United States)

    Castro, Stephanie; Damin, Antonio Eduardo; Porto, Cláudia Sellitto; Caramelli, Paulo; Nitrini, Ricardo

    2009-01-01

    The Brief Cognitive Battery (BCB) developed by our group for cognitive assessment of low educated individuals has also shown to be highly accurate in diagnosing dementia of individuals with medium or high levels of education, making it a useful tool for populations with heterogeneous educational background. The application of BCB takes around eight minutes, a rather long period for a screening test. Our aim was to evaluate whether the exclusion of items of the BCB could reduce its application time without losing accuracy. Patients with Alzheimer's disease with mild or moderate dementia (N=20), and 30 control subjects were submitted to an abbreviated version of the BCB in which the clock drawing test was not included as an interference test for the delayed recall test. Data from another 22 control individuals who were submitted to the original BCB in another study were also included for comparison. A mathematical formula was employed to compare the two versions of the BCB. Descriptive statistics and ROC (receiver operator characteristic) curves were used (alpha=0.05). Using the abbreviated version, the delayed recall test also had high accuracy in diagnosing dementia and the mathematical formula results did not differ to those obtained using the original version, while mean time was reduced by 2 minutes and 37 seconds. This abbreviated form of the BCB is a potentially valuable tool for screening dementia in population studies as well as in busy clinical practices in countries with heterogeneous educational backgrounds.

  11. Análise da eficácia do metilfenidato usando a versão abreviada do questionário de conners em transtorno de déficit de atenção/hiperatividade Analysis of the methylphenidate's efficacy using the abbreviated version Conners' questionnaire in attention deficit hyperactivity disorder

    Directory of Open Access Journals (Sweden)

    Ênio Roberto de Andrade

    2004-03-01

    Full Text Available O transtorno de déficit de atenção/hiperatividade (TDAH é quadro diagnóstico bastante complexo, de início precoce, com evolução crônica que repercute em diversos contextos. Três a 5% das crianças em idade escolar apresentam esse transtorno. O questionário de Conners vem sendo utilizado como instrumento de levantamento epidemiológico para o TDAH. OBJETIVO: Este estudo visa a utilização deste instrumento para a análise da eficácia do tratamento com metilfenidato em crianças com TDAH. MÉTODO: Foram selecionadas 21 crianças do gênero masculino, com TDAH do tipo combinado, idade cronológica entre sete anos completos a 10 anos e 11 meses e todos foram tratados com metilfenidato. A versão abreviada do questionário de Conners para pais e professores foi aplicada em dois momentos: um antes da medicação e outro entre seis a oito meses após o seu início. RESULTADOS: Obteve-se redução na pontuação no questionário de Conners em todas as crianças com TDAH concomitante à melhora clínica. CONCLUSÃO: Observou-se que o questionário de Conners mostrou-se útil não só como auxílio diagnóstico, mas também como um instrumento de avaliação da eficácia do tratamento do TDAH.The attention deficit/hyperactivity disorder (ADHD is a complex diagnosis. Its installation is precocious, with chronic evolution that impacts on the subject's performance in several contexts. Three to 5% of the school aged children present this disorder. The Conners' questionnaire has been used as an instrument of epidemiological survey for ADHD children. OBJECTIVE: This study aimed to investigate if this instrument could be an useful tool for the analysis of the methylphenidate's treatment efficacy in ADHD's children. METHOD: Twenty-one male children were selected, with ADHD combined type, chronological ages ranging from seven to 10 years and 11 months and all were treated with methylphenidate. The Conners' questionnaire abbreviated version for parents

  12. The use and abuse of abbreviations in orthopaedic literature.

    Science.gov (United States)

    Kilshaw, Michael J; Rooker, Jemma; Harding, Ian J

    2010-04-01

    Abbreviations are commonly used in medical literature. Their use has been associated with medical errors and they can be a source of irritation and misunderstanding. There are strict guidelines for their use. This study analysed the use of abbreviations in orthopaedic literature and compared adherence with guidelines in a general orthopaedic and spinal journal. It also examined orthopaedic professionals' understanding of abbreviations. The use of abbreviations in articles over a 3-month period in a general orthopaedic and spinal journal was analysed. The number of abbreviations and adherence with guidelines was recorded. A group of orthopaedic healthcare professionals were tested for their understanding of abbreviations. Almost half of all abbreviations were not properly used and 30% of abbreviations were never defined. Abbreviations were used significantly more often in the spinal journal. Only 40% of abbreviations were correctly defined by the orthopaedic professionals tested. Guidelines regarding the use of abbreviations are not being adhered to by authors or editors. The poor understanding of abbreviations underlines the importance of minimising their use and defining abbreviations when they are used.

  13. MBA: a literature mining system for extracting biomedical abbreviations.

    Science.gov (United States)

    Xu, Yun; Wang, ZhiHao; Lei, YiMing; Zhao, YuZhong; Xue, Yu

    2009-01-09

    The exploding growth of the biomedical literature presents many challenges for biological researchers. One such challenge is from the use of a great deal of abbreviations. Extracting abbreviations and their definitions accurately is very helpful to biologists and also facilitates biomedical text analysis. Existing approaches fall into four broad categories: rule based, machine learning based, text alignment based and statistically based. State of the art methods either focus exclusively on acronym-type abbreviations, or could not recognize rare abbreviations. We propose a systematic method to extract abbreviations effectively. At first a scoring method is used to classify the abbreviations into acronym-type and non-acronym-type abbreviations, and then their corresponding definitions are identified by two different methods: text alignment algorithm for the former, statistical method for the latter. A literature mining system MBA was constructed to extract both acronym-type and non-acronym-type abbreviations. An abbreviation-tagged literature corpus, called Medstract gold standard corpus, was used to evaluate the system. MBA achieved a recall of 88% at the precision of 91% on the Medstract gold-standard EVALUATION Corpus. We present a new literature mining system MBA for extracting biomedical abbreviations. Our evaluation demonstrates that the MBA system performs better than the others. It can identify the definition of not only acronym-type abbreviations including a little irregular acronym-type abbreviations (e.g., ), but also non-acronym-type abbreviations (e.g., ).

  14. Abbreviations of nuclear power plant engineering

    International Nuclear Information System (INIS)

    Freyberger, G.H.

    1979-01-01

    The edition of this English and German list of abbreviations comprises about 5200 entries in English and about 1400 entries in German as well as the most important American, English, German and other foreign Utilities and component manufacturers frequently quoted in nuclear engineering literature and documentation. (orig./HP) [de

  15. 40 CFR 86.203-94 - Abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Abbreviations. 86.203-94 Section 86.203-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Later Model Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium-Duty...

  16. Creating an online dictionary of abbreviations from MEDLINE.

    Science.gov (United States)

    Chang, Jeffrey T; Schütze, Hinrich; Altman, Russ B

    2002-01-01

    The growth of the biomedical literature presents special challenges for both human readers and automatic algorithms. One such challenge derives from the common and uncontrolled use of abbreviations in the literature. Each additional abbreviation increases the effective size of the vocabulary for a field. Therefore, to create an automatically generated and maintained lexicon of abbreviations, we have developed an algorithm to match abbreviations in text with their expansions. Our method uses a statistical learning algorithm, logistic regression, to score abbreviation expansions based on their resemblance to a training set of human-annotated abbreviations. We applied it to Medstract, a corpus of MEDLINE abstracts in which abbreviations and their expansions have been manually annotated. We then ran the algorithm on all abstracts in MEDLINE, creating a dictionary of biomedical abbreviations. To test the coverage of the database, we used an independently created list of abbreviations from the China Medical Tribune. We measured the recall and precision of the algorithm in identifying abbreviations from the Medstract corpus. We also measured the recall when searching for abbreviations from the China Medical Tribune against the database. On the Medstract corpus, our algorithm achieves up to 83% recall at 80% precision. Applying the algorithm to all of MEDLINE yielded a database of 781,632 high-scoring abbreviations. Of all the abbreviations in the list from the China Medical Tribune, 88% were in the database. We have developed an algorithm to identify abbreviations from text. We are making this available as a public abbreviation server at \\url[http://abbreviation.stanford.edu/].

  17. 40 CFR 89.303 - Symbols/abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Symbols/abbreviations. 89.303 Section... Provisions § 89.303 Symbols/abbreviations. (a) The abbreviations in § 86.094-3 or part 89.3 of this chapter apply to this subpart. (b) The abbreviations in table 1 in appendix A of this subpart apply to this...

  18. 40 CFR 89.403 - Symbols/abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Symbols/abbreviations. 89.403 Section... Procedures § 89.403 Symbols/abbreviations. (a) The abbreviations in § 86.094-3 or § 89.3 of this chapter apply to this subpart. (b) The abbreviations in Table 1 in appendix A to subpart D also apply to this...

  19. Abbreviations of polymer names and guidelines for abbreviating polymer names (IUPAC Recommendations 2014)

    Czech Academy of Sciences Publication Activity Database

    He, J.; Chen, J.; Hellwich, K. H.; Hess, M.; Horie, K.; Jones, R. G.; Kahovec, Jaroslav; Kitayama, T.; Kratochvíl, Pavel; Meille, S. V.; Mita, I.; dos Santos, C.; Vert, M.; Vohlídal, J.

    2014-01-01

    Roč. 86, č. 6 (2014), s. 1003-1015 ISSN 0033-4545 Institutional support: RVO:61389013 Keywords : abbreviations * IUPAC Polymer Division * polymer names Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.492, year: 2014

  20. 40 CFR 91.303 - Acronyms and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Acronyms and abbreviations. 91.303 Section 91.303 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS....303 Acronyms and abbreviations. (a) The acronyms and abbreviations in § 91.5 apply to this subpart. (b...

  1. 40 CFR 97.203 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... Trading Program General Provisions § 97.203 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this subpart and subparts BBB through III are defined as follows: Btu...

  2. 40 CFR 60.3 - Units and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 6 2010-07-01 2010-07-01 false Units and abbreviations. 60.3 Section...) STANDARDS OF PERFORMANCE FOR NEW STATIONARY SOURCES General Provisions § 60.3 Units and abbreviations. Used in this part are abbreviations and symbols of units of measure. These are defined as follows: (a...

  3. 40 CFR 86.1804-01 - Acronyms and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Acronyms and abbreviations. 86.1804-01..., and Complete Otto-Cycle Heavy-Duty Vehicles § 86.1804-01 Acronyms and abbreviations. The following abbreviations apply to this subpart: A/C—Air conditioning. AECD—Auxiliary emission control device. A/F—Air/Fuel...

  4. 40 CFR 91.4 - Acronyms and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Acronyms and abbreviations. 91.4...) CONTROL OF EMISSIONS FROM MARINE SPARK-IGNITION ENGINES General § 91.4 Acronyms and abbreviations. The following acronyms and abbreviations apply to this part 91. AECD—Auxiliary emission control device ASME...

  5. 40 CFR 90.403 - Symbols, acronyms, and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Symbols, acronyms, and abbreviations... Gaseous Exhaust Test Procedures § 90.403 Symbols, acronyms, and abbreviations. (a) The acronyms and abbreviations in § 90.5 apply to this subpart. (b) The symbols in Table 1 in Appendix A to Subpart D apply to...

  6. 7 CFR 766.2 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 766.2 Section 766.2... AGRICULTURE SPECIAL PROGRAMS DIRECT LOAN SERVICING-SPECIAL Overview § 766.2 Abbreviations and definitions. Abbreviations and definitions for terms used in this part are provided in § 761.2 of this chapter. ...

  7. 7 CFR 4274.302 - Definitions and abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Definitions and abbreviations. 4274.302 Section 4274... Relending Program (IRP) § 4274.302 Definitions and abbreviations. (a) General definitions. The following..., the Federated States of Micronesia, and the Republic of the Marshall Islands. (b) Abbreviations. The...

  8. 40 CFR 61.03 - Units and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Units and abbreviations. 61.03 Section...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS General Provisions § 61.03 Units and abbreviations. Used in this part are abbreviations and symbols of units of measure. These are defined as follows: (a...

  9. 40 CFR 72.3 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 16 2010-07-01 2010-07-01 false Measurements, abbreviations, and acronyms. 72.3 Section 72.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR..., abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this part are defined as follows...

  10. 7 CFR 762.102 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 762.102 Section 762.102 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE AGENCY, DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS GUARANTEED FARM LOANS § 762.102 Abbreviations and definitions. Abbreviations and...

  11. 7 CFR 770.2 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 770.2 Section 770.2... AGRICULTURE SPECIAL PROGRAMS INDIAN TRIBAL LAND ACQUISITION LOANS § 770.2 Abbreviations and definitions. (a) Abbreviations. FSA Farm Service Agency, an Agency of the United States Department of Agriculture, including its...

  12. 7 CFR 765.2 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 765.2 Section 765.2... AGRICULTURE SPECIAL PROGRAMS DIRECT LOAN SERVICING-REGULAR Overview § 765.2 Abbreviations and definitions. Abbreviations and definitions for terms used in this part are provided in § 761.2 of this chapter. ...

  13. 40 CFR 63.3 - Units and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 9 2010-07-01 2010-07-01 false Units and abbreviations. 63.3 Section 63.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Units and abbreviations. Used in this part are abbreviations and symbols of units of measure. These are...

  14. 40 CFR 89.3 - Acronyms and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Acronyms and abbreviations. 89.3 Section 89.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... abbreviations. The following acronyms and abbreviations apply to part 89. AECD Auxiliary emission control device...

  15. 40 CFR 96.303 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and acronyms. 96.303 Section 96.303 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR..., abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this subpart and subparts BBBB...

  16. 32 CFR 245.6 - Abbreviations and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Abbreviations and acronyms. 245.6 Section 245.6 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED... Abbreviations § 245.6 Abbreviations and acronyms. AADC—Area Air Defense Commander ADE—Air Defense Emergency ADIZ...

  17. 7 CFR 767.2 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 767.2 Section 767.2... AGRICULTURE SPECIAL PROGRAMS INVENTORY PROPERTY MANAGEMENT Overview § 767.2 Abbreviations and definitions. Abbreviations and definitions for terms used in this part are provided in § 761.2 of this chapter. ...

  18. 40 CFR 60.4103 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 6 2010-07-01 2010-07-01 false Measurements, abbreviations, and acronyms. 60.4103 Section 60.4103 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR....4103 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this...

  19. 24 CFR 50.2 - Terms and abbreviations.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Terms and abbreviations. 50.2... Terms and abbreviations. (a) The definitions for most of the key terms or phrases contained in this part... for HUD assistance or insurance. (b) The following abbreviations are used throughout this part: AS/CPD...

  20. 40 CFR 90.5 - Acronyms and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Acronyms and abbreviations. 90.5 Section 90.5 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... and abbreviations. The following acronyms and abbreviations apply to part 90. AECD—Auxiliary emission...

  1. 40 CFR 97.3 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... Trading Program General Provisions § 97.3 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this part are defined as follows: Btu-British thermal unit. CO2-carbon...

  2. 40 CFR 96.3 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... IMPLEMENTATION PLANS NOX Budget Trading Program General Provisions § 96.3 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this part are defined as follows: Btu—British...

  3. 40 CFR 90.303 - Symbols, acronyms, abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Symbols, acronyms, abbreviations. 90.303 Section 90.303 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS... Equipment Provisions § 90.303 Symbols, acronyms, abbreviations. (a) The acronyms and abbreviations in § 90.5...

  4. 7 CFR 772.2 - Abbreviations and Definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and Definitions. 772.2 Section 772.2... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.2 Abbreviations and Definitions. (a) Abbreviations. AMPAssociation-Type Minor Program loan; CFRCode of Federal Regulations; FOFarm Ownership Loan...

  5. 40 CFR 96.203 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... IMPLEMENTATION PLANS CAIR SO2 Trading Program General Provisions § 96.203 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this subpart and subparts BBB through III are...

  6. 40 CFR 96.103 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... IMPLEMENTATION PLANS CAIR NOX Annual Trading Program General Provisions § 96.103 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this subpart and subparts BB through II are...

  7. 24 CFR 58.2 - Terms, abbreviations and definitions.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Terms, abbreviations and... RESPONSIBILITIES Purpose, Legal Authority, Federal Laws and Authorities § 58.2 Terms, abbreviations and definitions... means a habitable structure that has been vacant for more than one year. (b) The following abbreviations...

  8. 40 CFR 97.303 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... Ozone Season Trading Program General Provisions § 97.303 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this subpart and subparts BBBB through IIII are defined as...

  9. 7 CFR 764.2 - Abbreviations and definitions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Abbreviations and definitions. 764.2 Section 764.2 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE AGENCY, DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS DIRECT LOAN MAKING Overview § 764.2 Abbreviations and definitions. Abbreviations...

  10. 40 CFR 87.2 - Acronyms and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Acronyms and abbreviations. 87.2 Section 87.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... abbreviations. The abbreviations used in this part have the following meanings in both upper and lower case...

  11. 40 CFR 91.403 - Symbols and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Symbols and abbreviations. 91.403 Section 91.403 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS... Symbols and abbreviations. (a) The abbreviations in § 91.5 apply to this subpart. (b) The symbols in Table...

  12. 40 CFR 97.103 - Measurements, abbreviations, and acronyms.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Measurements, abbreviations, and... Annual Trading Program General Provisions § 97.103 Measurements, abbreviations, and acronyms. Measurements, abbreviations, and acronyms used in this subpart and subparts BB through II are defined as...

  13. 40 CFR 92.102 - Definitions and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... the number of carbon atoms in a molecule of that compound. Precision means the standard deviation of... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Definitions and abbreviations. 92.102... Definitions and abbreviations. The definitions and abbreviations of subpart A of this part apply to this...

  14. Purine cytokinins: a proposal of abbreviations

    Czech Academy of Sciences Publication Activity Database

    Kamínek, Miroslav; Březinová, Alena; Gaudinová, Alena; Motyka, Václav; Vaňková, Radomíra; Zažímalová, Eva

    2001-01-01

    Roč. 32, - (2001), s. 253-256 ISSN 0167-6903 R&D Projects: GA AV ČR IAA6038002; GA ČR GA522/00/1346; GA ČR GA522/99/1130 Institutional research plan: CEZ:AV0Z5038910 Keywords : cytokinin abbreviations * cytokinins * plant nomenclature Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.761, year: 2001

  15. National preparedness guide for exiting the emergency phase subsequent to a nuclear accident causing moderate, short-term release on French soil - working document, version 0, May 2010

    International Nuclear Information System (INIS)

    2010-05-01

    This National Guide provides basic explanations and methods to assist in drawing up a local plan for the emergency phase way-out, subsequent to a nuclear accident of moderate magnitude causing short-term (under 24 hours) radioactive release, which could possibly occur in France. The accident situations considered in this Guide have little likelihood of arising and are representative of environmental contamination accidents that might occur at French nuclear facilities covered by a special intervention plan (plan particulier d'intervention, PPI). Such accidents may cause environmental contamination warranting action for post-accident impact management within a range of ten to fifty kilometres from the accident site. To provide some perspective, the accidents considered here would be classified Levels 3, 4 or 5 (incidents or accidents causing release into the environment) on the INES scale customarily used to help the public and media to immediately understand the severity of an incident or accident in the nuclear field. This Guide was drawn up subsequently to the work carried out by the Steering Committee on Post- Accident Phase Management in the Event of a Nuclear Accident or Radiological Emergency Situation (CODIRPA), instituted by the French Nuclear Safety Authority (ASN) in June 2005, and in charge of setting out the basic principles underlying the management of nuclear post-accident situations. This version of the Guide shall be updated on the basis of the operating experience feedback received on its use. The Guide is a planning tool, intended for the Prefectures of department where a basic nuclear facility PPI has been instituted. Its purpose is to enable Prefects to plan and effectively conduct preparedness measures at the local level with the aim of winding down the emergency phase, actively involving all of the relevant actors for this purpose. The exit period from the emergency phase is defined as extending approximately one week from the end of the

  16. NESHAP Dose-Release Factor Isopleths for Five Source-to-Receptor Distances from the Center of Site and H-Area for all Compass Sectors at SRS using CAP88-PC Version 4.0

    Energy Technology Data Exchange (ETDEWEB)

    Trimor, P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2017-08-09

    The Environmental Protection Agency (EPA) requires the use of the computer model CAP88-PC to estimate the total effective doses (TED) for demonstrating compliance with 40 CFR 61, Subpart H (EPA 2006), the National Emission Standards for Hazardous Air Pollutants (NESHAP) regulations. As such, CAP88 Version 4.0 was used to calculate the receptor dose due to routine atmospheric releases at the Savannah River Site (SRS). For estimation, NESHAP dose-release factors (DRFs) have been supplied to Environmental Compliance and Area Closure Projects (EC&ACP) for many years. DRFs represent the dose to a maximum receptor exposed to 1 Ci of a specified radionuclide being released into the atmosphere. They are periodically updated to include changes in the CAP88 version, input parameter values, site meteorology, and location of the maximally exposed individual (MEI). This report presents the DRFs of tritium oxide released at two onsite locations, center-of-site (COS) and H-Area, at 0 ft. elevation to maximally exposed individuals (MEIs) located 1000, 3000, 6000, 9000, and 12000 meters from the release areas for 16 compass sectors. The analysis makes use of area-specific meteorological data (Viner 2014).

  17. Using UMLS lexical resources to disambiguate abbreviations in clinical text.

    Science.gov (United States)

    Kim, Youngjun; Hurdle, John; Meystre, Stéphane M

    2011-01-01

    Clinical text is rich in acronyms and abbreviations, and they are highly ambiguous. As a pre-processing step before subsequent NLP analysis, we are developing and evaluating clinical abbreviation disambiguation methods. The evaluation of two sequential steps, the detection and the disambiguation of abbreviations, is reported here, for various types of clinical notes. For abbreviations detection, our result indicated the SPECIALIST Lexicon LRABR needed to be revised for better abbreviation detection. Our semi-supervised method using generated training data based on expanded form matching for 12 frequent abbreviations in our clinical notes reached over 90% accuracy in five-fold cross validation and unsupervised approach produced comparable results with the semi-supervised methods.

  18. Abbreviations: the need for legibility and accuracy in documentation.

    Science.gov (United States)

    Dimond, Bridgit

    This article explores the use of abbreviations in health care. It considers the current advice of the Nursing and Midwifery Council against the use of any abbreviations and suggests, in the interests of using time effectively, that it would be wise for directorates within trusts to create a list of approved abbreviations and symbols so that the dangers of misunderstandings are removed. It also considers how the problem of illegibility should be dealt with as a clinical governance issue.

  19. Abbreviated guide pneumatic conveying design guide

    CERN Document Server

    Mills, David

    1990-01-01

    Abbreviated Guide: Pneumatic Conveying Design Guide describes the selection, design, and specification of conventional pneumatic conveying systems. The design procedure uses previous test data on the materials to be conveyed. The book also discusses system economics, operating costs, the choice of appropriate components or systems, system control, and system flexibility. The design system involves the type of conveying system for installation, the pipeline parameters, and also the plant components. System selection covers the properties of the material to be conveyed, plant layout, material pr

  20. Abbreviations for device names: a proposed methodology with specific examples.

    Science.gov (United States)

    Alam, Murad; Dover, Jeffrey S; Alam, Murad; Goldman, Mitchel P; Kaminer, Michael S; Orringer, Jeffrey; Waldorf, Heidi; Alam, Murad; Avram, Mathew; Cohen, Joel L; Draelos, Zoe Diana; Dover, Jeffrey S; Hruza, George; Kilmer, Suzanne; Lawrence, Naomi; Lupo, Mary; Metelitsa, Andrei; Nestor, Mark; Ross, E Victor

    2013-04-01

    Many devices used in dermatology lack generic names. If investigators use commercial device names, they risk the appearance of bias. Alternatively, reliance on ad-hoc names and abbreviations may confuse readers who do not recognize these. To develop a system for assigning abbreviations to denote devices commonly used in dermatology. Secondarily, to use this system to create abbreviations for FDA-approved neurotoxins and prepackaged injectable soft-tissue augmentation materials. The American Society for Dermatologic Surgery convened a Lexicon Task Force in March 2012. One charge of this Task Force was to develop criteria for assigning abbreviations to medical devices. A modified consensus process was used. Abbreviations to denote devices were to be: based on a standardized approach; transparent to the casual reader; markedly brief; and in all cases, different than the commercial names. Three-letter all caps abbreviations, some with subscripts, were assigned to denote each of the approved neurotoxins and fillers. A common system of abbreviations for medical devices in dermatology may avoid the appearance of bias while ensuring effective communication. The proposed system may be expanded to name other devices, and the ensuing abbreviations may be suitable for journal articles, continuing medical education lectures, or other academic or clinical purposes. © 2013 by the American Society for Dermatologic Surgery, Inc. Published by Wiley Periodicals, Inc.

  1. 32 CFR Appendix B to Part 806 - Abbreviations and Acronyms

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Abbreviations and Acronyms B Appendix B to Part 806 National Defense Department of Defense (Continued) DEPARTMENT OF THE AIR FORCE ADMINISTRATION AIR FORCE FREEDOM OF INFORMATION ACT PROGRAM Pt. 806, App. B Appendix B to Part 806—Abbreviations and...

  2. 16 CFR 300.9 - Abbreviations, ditto marks, and asterisks.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Abbreviations, ditto marks, and asterisks. 300.9 Section 300.9 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULES AND REGULATIONS UNDER THE WOOL PRODUCTS LABELING ACT OF 1939 Labeling § 300.9 Abbreviations...

  3. 32 CFR Appendix F to Subpart M of... - Abbreviations

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 3 2010-07-01 2010-07-01 true Abbreviations F Appendix F to Subpart M of Part 552 National Defense Department of Defense (Continued) DEPARTMENT OF THE ARMY MILITARY RESERVATIONS...—Abbreviations AAOArea Access Officer ARArmy Regulation CBRCCamp Bonneville Range Control DEHDirector of...

  4. 7 CFR 635.1 - Definitions and abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Definitions and abbreviations. 635.1 Section 635.1 Agriculture Regulations of the Department of Agriculture (Continued) NATURAL RESOURCES CONSERVATION SERVICE... abbreviations. The following terms apply to this part: Covered program means a natural resource conservation...

  5. 49 CFR 179.2 - Definitions and abbreviations.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Definitions and abbreviations. 179.2 Section 179.2 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... Introduction, Approvals and Reports § 179.2 Definitions and abbreviations. (a) The following apply in part 179...

  6. The use of abbreviations in surgical note keeping

    Directory of Open Access Journals (Sweden)

    B. Collard

    2015-06-01

    Full Text Available Abbreviations are used to improve the speed of note keeping and to simplify patient notes. However studies have shown that they can reduce clarity, increase mistakes and cause confusion in management plans. Our review highlights the misuse of abbreviations in surgical note keeping.

  7. The use of abbreviations in surgical note keeping.

    Science.gov (United States)

    Collard, B; Royal, A

    2015-06-01

    Abbreviations are used to improve the speed of note keeping and to simplify patient notes. However studies have shown that they can reduce clarity, increase mistakes and cause confusion in management plans. Our review highlights the misuse of abbreviations in surgical note keeping.

  8. 7 CFR 718.302 - Definitions and abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Definitions and abbreviations. 718.302 Section 718.302 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE AGENCY, DEPARTMENT OF... MULTIPLE PROGRAMS Equitable Relief From Ineligibility § 718.302 Definitions and abbreviations. In addition...

  9. 16 CFR 301.4 - Abbreviations or ditto marks prohibited.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Abbreviations or ditto marks prohibited. 301.4 Section 301.4 Commercial Practices FEDERAL TRADE COMMISSION REGULATIONS UNDER SPECIFIC ACTS OF CONGRESS RULES AND REGULATIONS UNDER FUR PRODUCTS LABELING ACT Regulations § 301.4 Abbreviations or ditto...

  10. 7 CFR 1421.400 - Applicability and abbreviations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Applicability and abbreviations. 1421.400 Section 1421.400 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT... Associations for Peanuts § 1421.400 Applicability and abbreviations. (a) This subpart sets forth the terms and...

  11. MinION Analysis and Reference Consortium: Phase 2 data release and analysis of R9.0 chemistry [version 1; referees: 1 approved, 2 approved with reservations

    Directory of Open Access Journals (Sweden)

    Miten Jain

    2017-05-01

    Full Text Available Background: Long-read sequencing is rapidly evolving and reshaping the suite of opportunities for genomic analysis. For the MinION in particular, as both the platform and chemistry develop, the user community requires reference data to set performance expectations and maximally exploit third-generation sequencing. We performed an analysis of MinION data derived from whole genome sequencing of Escherichia coli K-12 using the R9.0 chemistry, comparing the results with the older R7.3 chemistry. Methods: We computed the error-rate estimates for insertions, deletions, and mismatches in MinION reads. Results: Run-time characteristics of the flow cell and run scripts for R9.0 were similar to those observed for R7.3 chemistry, but with an 8-fold increase in bases per second (from 30 bps in R7.3 and SQK-MAP005 library preparation, to 250 bps in R9.0 processed by individual nanopores, and less drop-off in yield over time. The 2-dimensional (“2D” N50 read length was unchanged from the prior chemistry. Using the proportion of alignable reads as a measure of base-call accuracy, 99.9% of “pass” template reads from 1-dimensional (“1D”  experiments were mappable and ~97% from 2D experiments. The median identity of reads was ~89% for 1D and ~94% for 2D experiments. The total error rate (miscall + insertion + deletion decreased for 2D “pass” reads from 9.1% in R7.3 to 7.5% in R9.0 and for template “pass” reads from 26.7% in R7.3 to 14.5% in R9.0. Conclusions: These Phase 2 MinION experiments serve as a baseline by providing estimates for read quality, throughput, and mappability. The datasets further enable the development of bioinformatic tools tailored to the new R9.0 chemistry and the design of novel biological applications for this technology. Abbreviations: K: thousand, Kb: kilobase (one thousand base pairs, M: million, Mb: megabase (one million base pairs, Gb: gigabase (one billion base pairs.

  12. 40 CFR 1042.905 - Symbols, acronyms, and abbreviations.

    Science.gov (United States)

    2010-07-01

    ... Definitions and Other Reference Information § 1042.905 Symbols, acronyms, and abbreviations. The following... Archives and Records Administration. NMHCnonmethane hydrocarbons. NOXoxides of nitrogen (NO and NO2.... SCRselective catalytic reduction. THCtotal hydrocarbon. THCEtotal hydrocarbon equivalent. ULSDultra low-sulfur...

  13. Rabies vaccinations: are abbreviated intradermal schedules the future?

    NARCIS (Netherlands)

    Wieten, R. W.; Leenstra, T.; van Thiel, P. P. A. M.; van Vugt, M.; Stijnis, C.; Goorhuis, A.; Grobusch, M. P.

    2013-01-01

    Rabies is a deadly disease, and current preexposure vaccination schedules are lengthy and expensive. We identified nine studies investigating abbreviated schedules. Although initial responses were lower, accelerated adequate immune responses were elicited after booster vaccinations. Lower-dose (and

  14. Fasting abbreviation among patients submitted to oncologic surgery: systematic review

    OpenAIRE

    PINTO, Andressa dos Santos; GRIGOLETTI, Shana Souza; MARCADENTI, Aline

    2015-01-01

    INTRODUCTION: The abbreviation of perioperative fasting among candidates to elective surgery have been associated with shorter hospital stay and decreased postoperative complications. OBJECTIVE: To conduct a systematic review from randomized controlled trials to detect whether the abbreviation of fasting is beneficial to patients undergoing cancer surgery compared to traditional fasting protocols. METHOD: A literature search was performed in electronic databases: MEDLINE (PubMed), SciELO...

  15. Cielo Computational Environment Usage Model With Mappings to ACE Requirements for the General Availability User Environment Capabilities Release Version 1.1

    Energy Technology Data Exchange (ETDEWEB)

    Vigil,Benny Manuel [Los Alamos National Laboratory; Ballance, Robert [SNL; Haskell, Karen [SNL

    2012-08-09

    Cielo is a massively parallel supercomputer funded by the DOE/NNSA Advanced Simulation and Computing (ASC) program, and operated by the Alliance for Computing at Extreme Scale (ACES), a partnership between Los Alamos National Laboratory (LANL) and Sandia National Laboratories (SNL). The primary Cielo compute platform is physically located at Los Alamos National Laboratory. This Cielo Computational Environment Usage Model documents the capabilities and the environment to be provided for the Q1 FY12 Level 2 Cielo Capability Computing (CCC) Platform Production Readiness Milestone. This document describes specific capabilities, tools, and procedures to support both local and remote users. The model is focused on the needs of the ASC user working in the secure computing environments at Lawrence Livermore National Laboratory (LLNL), Los Alamos National Laboratory, or Sandia National Laboratories, but also addresses the needs of users working in the unclassified environment. The Cielo Computational Environment Usage Model maps the provided capabilities to the tri-Lab ASC Computing Environment (ACE) Version 8.0 requirements. The ACE requirements reflect the high performance computing requirements for the Production Readiness Milestone user environment capabilities of the ASC community. A description of ACE requirements met, and those requirements that are not met, are included in each section of this document. The Cielo Computing Environment, along with the ACE mappings, has been issued and reviewed throughout the tri-Lab community.

  16. Detecting abbreviations in discharge summaries using machine learning methods.

    Science.gov (United States)

    Wu, Yonghui; Rosenbloom, S Trent; Denny, Joshua C; Miller, Randolph A; Mani, Subramani; Giuse, Dario A; Xu, Hua

    2011-01-01

    Recognition and identification of abbreviations is an important, challenging task in clinical natural language processing (NLP). A comprehensive lexical resource comprised of all common, useful clinical abbreviations would have great applicability. The authors present a corpus-based method to create a lexical resource of clinical abbreviations using machine-learning (ML) methods, and tested its ability to automatically detect abbreviations from hospital discharge summaries. Domain experts manually annotated abbreviations in seventy discharge summaries, which were randomly broken into a training set (40 documents) and a test set (30 documents). We implemented and evaluated several ML algorithms using the training set and a list of pre-defined features. The subsequent evaluation using the test set showed that the Random Forest classifier had the highest F-measure of 94.8% (precision 98.8% and recall of 91.2%). When a voting scheme was used to combine output from various ML classifiers, the system achieved the highest F-measure of 95.7%.

  17. Analysis of abbreviations used by residents in admission notes and discharge summaries.

    Science.gov (United States)

    Shilo, L; Shilo, G

    2018-03-01

    There are abbreviations that are used daily such as BP for blood pressure and ECG for electrocardiogram, but many of the abbreviations found in medical documents are unclear. The purpose of this study was to assess the frequency, type and comprehension of abbreviations in admission notes and discharge letters composed by orthopedic surgery and medical residents. Abbreviations were extracted from discharge letters and admission notes composed by residents from orthopedic surgery and medical wards. The frequency of use of the abbreviations was determined. Additionally, the fifty commonest abbreviations from each specialty were graded by three medical and three orthopedic surgery senior physicians as 1. understandable or 2. Ambiguous or unknown. The number of abbreviations found in the documents composed by medical and orthopedic surgery residents was 1525 with 80 different abbreviations and 493 with 51 different abbreviations respectively (9.3% and 4.9% of the total word number respectively). Analysis revealed that 14% of the abbreviations from medical ward documents were graded as ambiguous or unknown by medical senior physicians compared with 25% by senior orthopedic surgeons. When abbreviations from orthopedic surgery documents were presented to both groups, senior orthopedic surgeons graded 8% as ambiguous or unknown compared with 21% by the medical senior physicians. In order to prevent impairment of patient care, only standard abbreviations should be used in medical documents. Measures should be taken to decrease the use of non standard abbreviations such as the incorporation of authorized abbreviations to the electronic medical record.

  18. Development of abbreviated eight-item form of the Penn Verbal Reasoning Test.

    Science.gov (United States)

    Bilker, Warren B; Wierzbicki, Michael R; Brensinger, Colleen M; Gur, Raquel E; Gur, Ruben C

    2014-12-01

    The ability to reason with language is a highly valued cognitive capacity that correlates with IQ measures and is sensitive to damage in language areas. The Penn Verbal Reasoning Test (PVRT) is a 29-item computerized test for measuring abstract analogical reasoning abilities using language. The full test can take over half an hour to administer, which limits its applicability in large-scale studies. We previously described a procedure for abbreviating a clinical rating scale and a modified procedure for reducing tests with a large number of items. Here we describe the application of the modified method to reducing the number of items in the PVRT to a parsimonious subset of items that accurately predicts the total score. As in our previous reduction studies, a split sample is used for model fitting and validation, with cross-validation to verify results. We find that an 8-item scale predicts the total 29-item score well, achieving a correlation of .9145 for the reduced form for the model fitting sample and .8952 for the validation sample. The results indicate that a drastically abbreviated version, which cuts administration time by more than 70%, can be safely administered as a predictor of PVRT performance. © The Author(s) 2014.

  19. Development of Abbreviated Eight-Item Form of the Penn Verbal Reasoning Test

    Science.gov (United States)

    Bilker, Warren B.; Wierzbicki, Michael R.; Brensinger, Colleen M.; Gur, Raquel E.; Gur, Ruben C.

    2014-01-01

    The ability to reason with language is a highly valued cognitive capacity that correlates with IQ measures and is sensitive to damage in language areas. The Penn Verbal Reasoning Test (PVRT) is a 29-item computerized test for measuring abstract analogical reasoning abilities using language. The full test can take over half an hour to administer, which limits its applicability in large-scale studies. We previously described a procedure for abbreviating a clinical rating scale and a modified procedure for reducing tests with a large number of items. Here we describe the application of the modified method to reducing the number of items in the PVRT to a parsimonious subset of items that accurately predicts the total score. As in our previous reduction studies, a split sample is used for model fitting and validation, with cross-validation to verify results. We find that an 8-item scale predicts the total 29-item score well, achieving a correlation of .9145 for the reduced form for the model fitting sample and .8952 for the validation sample. The results indicate that a drastically abbreviated version, which cuts administration time by more than 70%, can be safely administered as a predictor of PVRT performance. PMID:24577310

  20. User Guide ECOREA-RICE (version 1.0). Program for assessing the transfer of radionuclides released accidentally onto flooded rice-fields

    International Nuclear Information System (INIS)

    Keum, Dong Kwon; Lee, Han Soo; Choi, Hei Hu; Kang, Hee Seok; Lee, Chang Woo

    2004-05-01

    The computer code ECOREA-RICE is a dynamic compartment model that is specially designed for estimating the transfer of radionuclides deposited onto flooded rice-fields after an accidental release. The model consists of six independent compartments including rice-body, grain, surface water, root-zone soil, fixed soil and deep soil, and takes into account the transfer processes including radioactive decay, percolation, leaching, shoot-base absorption, root-uptake, weathering, translocation, fixation in soil by adsorption and desorption, and soil-mixing by plowing. The rate of the change of radioactivity in compartments is expressed by a set of the first order ordinary differential equations, which are solved by the fourth order Runge-Kutta algorithm. Input to the program includes the deposition date, transplanting date, ear emergence date, harvest date, soil data, the biomass data of rice-plant, and rate constants associated with transfer processes. Output includes the list of input data, the activity of radionuclides in compartment, the rate constant, and the transfer factor of rice-body and grain with time

  1. Detection of sentence boundaries and abbreviations in clinical narratives.

    Science.gov (United States)

    Kreuzthaler, Markus; Schulz, Stefan

    2015-01-01

    In Western languages the period character is highly ambiguous, due to its double role as sentence delimiter and abbreviation marker. This is particularly relevant in clinical free-texts characterized by numerous anomalies in spelling, punctuation, vocabulary and with a high frequency of short forms. The problem is addressed by two binary classifiers for abbreviation and sentence detection. A support vector machine exploiting a linear kernel is trained on different combinations of feature sets for each classification task. Feature relevance ranking is applied to investigate which features are important for the particular task. The methods are applied to German language texts from a medical record system, authored by specialized physicians. Two collections of 3,024 text snippets were annotated regarding the role of period characters for training and testing. Cohen's kappa resulted in 0.98. For abbreviation and sentence boundary detection we can report an unweighted micro-averaged F-measure using a 10-fold cross validation of 0.97 for the training set. For test set based evaluation we obtained an unweighted micro-averaged F-measure of 0.95 for abbreviation detection and 0.94 for sentence delineation. Language-dependent resources and rules were found to have less impact on abbreviation detection than on sentence delineation. Sentence detection is an important task, which should be performed at the beginning of a text processing pipeline. For the text genre under scrutiny we showed that support vector machines exploiting a linear kernel produce state of the art results for sentence boundary detection. The results are comparable with other sentence boundary detection methods applied to English clinical texts. We identified abbreviation detection as a supportive task for sentence delineation.

  2. Sourcing archaeological obsidian by an abbreviated NAA procedure

    International Nuclear Information System (INIS)

    Glascock, M.D.; Neff, H.; Stryker, K.S.; Jonhson, T.N.

    1994-01-01

    An abbreviated NAA procedure has been developed to fingerprint obsidian artifacts in the Mesoamerican region. Despite the large number of available sources, an NAA procedure, which relies on producing short-lived isotopes, has been applied with a success rate greater than 90 percent. The abbreviated NAA procedure is rapid and cost competitive with the XRF technique more often applied in obsidian sourcing. Results from the analysis of over 1,200 obsidian artifacts from throughout Mesoamerica are presented. (author) 8 refs.; 6 figs.; 2 tabs

  3. [A study on the abbreviated form of the Eysenck Personality Questionnaire Revised-Abbreviated (EPQR-A) in a student population].

    Science.gov (United States)

    Bouvard, M; Aulard-Jaccod, J; Pessonneaux, S; Hautekeete, M; Rogé, B

    2010-12-01

    The aim of this paper is to examine the short questionnaire of the Eysenck Personality Questionnaire Revised (the Eysenck Personality Questionnaire Revised-Abbreviated [EPQR-A]) among a student population. University students were invited, in groups, to fill in the forms proposed. Three sites were compared, representing a sample of 346 participants (Chambéry=118 subjects [44 males and 74 females]; Lille=110 subjects [50 males and 60 females] and Toulouse=118 subjects [60 males and 58 females]). The three groups of students have comparable scores on the EPQR-A wherever they live (Chambéry, Lille or Toulouse). Moreover, neither the age nor the gender allowed the detection of differences between subjects. Our sample of students is situated in the range of a "normal" group of students. Regarding the internal consistency coefficients, the French version we used of the neuroticism and the extraversion scales of the EPQR-A obtained a satisfactory result. The internal consistency coefficient of psychoticism was rather low (<70). This unsatisfactory level of internal reliability for the psychoticism is also found in the English version [7]. The four-factor model of the EPQR-A is judged to be an adequate explanation of the data. In the end, self-esteem correlated positively with extraversion and negatively with neuroticism. On the other hand, there is no link between psychoticism and self-esteem. Copyright © 2010 L'Encéphale, Paris. Published by Elsevier Masson SAS. All rights reserved.

  4. JPRS Report, Latin America, Reference Aid Glossary of Spanish Military and General Acronyms and Abbreviations

    National Research Council Canada - National Science Library

    1988-01-01

    Glossary of Spanish Military and general acronyms and abbreviations. This Reference Aid is a first attempt at making a systematic compilation of Spanish acronyms and abbreviations, particularly in the military field...

  5. Validation Study of the Abbreviated Math Anxiety Scale: Spanish Adaptation

    Science.gov (United States)

    Brown, Jennifer L.; Sifuentes, Lucía Macías

    2016-01-01

    With growing numbers of Hispanic students enrolling in post-secondary school, there is a need to increase retention and graduation rates. The purpose of this study was to validate the Spanish adaptation of the Abbreviated Math Anxiety Scale (AMAS). The AMAS was translated and administered to 804 freshman students at a post-secondary institution in…

  6. Abbreviated Pandemic Influenza Planning Template for Primary Care Offices

    Energy Technology Data Exchange (ETDEWEB)

    HCTT CHE

    2010-01-01

    The Abbreviated Pandemic Influenza Plan Template for Primary Care Provider Offices is intended to assist primary care providers and office managers with preparing their offices for quickly putting a plan in place to handle an increase in patient calls and visits, whether during the 2009-2010 influenza season or future influenza seasons.

  7. Abbreviations and acronyms: the case of Tlhalosi ya

    African Journals Online (AJOL)

    user

    Abstract: This paper looks at how abbreviations and acronyms are treated in African language dictionaries in general compared to selected mainstream English dictionaries. Specifically, the study looks at their treatment in T.J. Otlogetswe's (2012) Tlhalosi ya Medi ya Setswana dictionary. Altogether, a survey of twenty ...

  8. Children's Text Messaging: Abbreviations, Input Methods and Links with Literacy

    Science.gov (United States)

    Kemp, N.; Bushnell, C.

    2011-01-01

    This study investigated the effects of mobile phone text-messaging method (predictive and multi-press) and experience (in texters and non-texters) on children's textism use and understanding. It also examined popular claims that the use of text-message abbreviations, or "textese" spelling, is associated with poor literacy skills. A sample of 86…

  9. Interactive Hangman Teaches Amino Acid Structures and Abbreviations

    Science.gov (United States)

    Pennington, Britney O.; Sears, Duane; Clegg, Dennis O.

    2014-01-01

    We developed an interactive exercise to teach students how to draw the structures of the 20 standard amino acids and to identify the one-letter abbreviations by modifying the familiar game of "Hangman." Amino acid structures were used to represent single letters throughout the game. To provide additional practice in identifying…

  10. 32 CFR 634.3 - Explanation of abbreviations and terms.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 4 2010-07-01 2010-07-01 true Explanation of abbreviations and terms. 634.3 Section 634.3 National Defense Department of Defense (Continued) DEPARTMENT OF THE ARMY (CONTINUED) LAW ENFORCEMENT AND CRIMINAL INVESTIGATIONS MOTOR VEHICLE TRAFFIC SUPERVISION Introduction § 634.3 Explanation of...

  11. HANFORD TANK WASTE OPERATIONS SIMULATOR VERSION DESCRIPTION DOCUMENT

    International Nuclear Information System (INIS)

    ALLEN, G.K.

    2003-01-01

    This document describes the software version controls established for the Hanford Tank Waste Operations Simulator (HTWOS). It defines: the methods employed to control the configuration of HTWOS; the version of each of the 26 separate modules for the version 1.0 of HTWOS; the numbering rules for incrementing the version number of each module; and a requirement to include module version numbers in each case results documentation. Version 1.0 of HTWOS is the first version under formal software version control. HTWOS contains separate revision numbers for each of its 26 modules. Individual module version numbers do not reflect the major release HTWOS configured version number

  12. Detecting unapproved abbreviations in the electronic medical record.

    Science.gov (United States)

    Capraro, Andrew; Stack, Anne; Harper, Marvin B; Kimia, Amir

    2012-04-01

    At an emergency department (ED) in a tertiary care children's hospital with a level 1 pediatric trauma designation, unapproved abbreviations (UAAs) within electronic medical records (EMRs) were identified, and feedback was provided to providers regarding their types and use rates. Existing EMRs, including the ED physicians' patient notes were used as templates to develop a UAA list and an abbreviation detector. The detector was validated against human-screened samples of electronic ED notes from 2003 and then applied to all existing data to generate baseline rates of UAA, before intervention/implementation. Next, the validated abbreviation detector was applied prospectively in screening all EMRs monthly during a six-month period. In validation, the abbreviation detector had a sensitivity of 89%, a specificity of 99.9%, and a positive predictive value of 89%. Some 475,613 EMRs were screened, with UAAs identified at a rate of 26.4 +/- 4 per 1,000 EMRs. The most common nonmedication UAA was "qd" [11.8/1,000 EMRs], and the most common medication UAA was "PCN" [4.2/1,000 EMRs]. A total of 27,282 patient notes from 74 physicians were screened between January 1, 2007, and June 30, 2007, and 392 monthly reports were generated. Aggregate UAA use decreased by 8% (95% confidence interval [CI]: 6%-14%) per month-from 19.3 to > 12.1/100 charts, for a 37.3% decrease in UAA use in the six-month period. The estimated monthly decrease per physician was 0.9/100 (95% CI: 0.86-0.94, p abbreviation detector for surveillance of newly created EMRs, followed by consistent education and feedback, led to a significant decrease in UAA use in the study period.

  13. Interactive Hangman teaches amino acid structures and abbreviations

    OpenAIRE

    Pennington, BO; Sears, D; Clegg, DO

    2014-01-01

    © 2014 by The International Union of Biochemistry and Molecular Biology, 42(6):495-500, 2014. We developed an interactive exercise to teach students how to draw the structures of the 20 standard amino acids and to identify the one-letter abbreviations by modifying the familiar game of "Hangman." Amino acid structures were used to represent single letters throughout the game. To provide additional practice in identifying structures, hints to the answers were written in "amino acid sentences" f...

  14. PVWatts Version 5 Manual

    Energy Technology Data Exchange (ETDEWEB)

    Dobos, A. P.

    2014-09-01

    The NREL PVWatts calculator is a web application developed by the National Renewable Energy Laboratory (NREL) that estimates the electricity production of a grid-connected photovoltaic system based on a few simple inputs. PVWatts combines a number of sub-models to predict overall system performance, and makes includes several built-in parameters that are hidden from the user. This technical reference describes the sub-models, documents assumptions and hidden parameters, and explains the sequence of calculations that yield the final system performance estimate. This reference is applicable to the significantly revised version of PVWatts released by NREL in 2014.

  15. Hydra Code Release

    OpenAIRE

    Couchman, H. M. P.; Pearce, F. R.; Thomas, P. A.

    1996-01-01

    Comment: A new version of the AP3M-SPH code, Hydra, is now available as a tar file from the following sites; http://coho.astro.uwo.ca/pub/hydra/hydra.html , http://star-www.maps.susx.ac.uk/~pat/hydra/hydra.html . The release now also contains a cosmological initial conditions generator, documentation, an installation guide and installation tests. A LaTex version of the documentation is included here

  16. [Abbreviations of special terms for presentation/paper titles in magnetic resonance study].

    Science.gov (United States)

    Komi, Masanori; Shiraishi, Junji

    2013-08-01

    A large number of abbreviations have been created for various special terms, and used in magnetic resonance (MR) study. However, the use of these abbreviations in the paper title has been restricted by the majority of societies and journals. In this study, we investigated the use of various abbreviations for special terms in MR study in order to clarify which abbreviation could be used in the paper title without spelling. We used two journals, Magnetic Resonance in Medicine (MRM) and Journal of Magnetic Resonance Imaging (JMRI) published by the International Society for Magnetic Resonance in Medicine (ISMRM), which has been considered to be the most advanced society for MR study in the world, as the reference standard for use of the abbreviations. Except for some basic abbreviations and specific abbreviations that were used on a long-term basis, the majority of abbreviations were used in the paper title with its full spelling in order to ensure generality. It is preferable that abbreviations not be used in the title of the or title of the paper.

  17. What's new in the Atmospheric Model Evaluation Tool (AMET) version 1.3

    Science.gov (United States)

    A new version of the Atmospheric Model Evaluation Tool (AMET) has been released. The new version of AMET, version 1.3 (AMETv1.3), contains a number of updates and changes from the previous of version of AMET (v1.2) released in 2012. First, the Perl scripts used in the previous ve...

  18. Validity and Reliability of the Abbreviated Barratt Impulsiveness Scale in Spanish (BIS-15S)*

    Science.gov (United States)

    Orozco-Cabal, Luis; Rodríguez, Maritza; Herin, David V.; Gempeler, Juanita; Uribe, Miguel

    2010-01-01

    Objective This study determined the validity and reliability of a new, abbreviated version of the Spanish Barratt Impulsiveness Scale (BIS-15S) in Colombian subjects. Method The BIS-15S was tested in non-clinical (n=283) and clinical (n=164) native Spanish-speakers. Intra-scale reliability was calculated using Cronbach’s α, and test-retest reliability was measured with Pearson correlations. Psychometric properties were determined using standard statistics. A factor analysis was performed to determine BIS-15S factor structure. Results 447 subjects participated in the study. Clinical subjects were older and more educated compared to non-clinical subjects. Impulsivity scores were normally distributed in each group. BIS-15S total, motor, non-planning and attention scores were significantly lower in non-clinical vs. clinical subjects. Subjects with substance-related disorders had the highest BIS-15S total scores, followed by subjects with bipolar disorders and bulimia nervosa/binge eating. Internal consistency was 0.793 and test-retest reliability was 0.80. Factor analysis confirmed a three-factor structure (attention, motor, non-planning) accounting for 47.87% of the total variance in BIS-15S total scores. Conclusions The BIS-15S is a valid and reliable self-report measure of impulsivity in this population. Further research is needed to determine additional components of impulsivity not investigated by this measure. PMID:21152412

  19. The Convergent, Discriminant, and Concurrent Validity of Scores on the Abbreviated Self-Leadership Questionnaire

    Directory of Open Access Journals (Sweden)

    Faruk Şahin

    2015-10-01

    Full Text Available The present study reports the psychometric properties of a short measure of self-leadership in the Turkish context: the Abbreviated Self-Leadership Questionnaire (ASLQ. The ASLQ was examined using two samples and showed sound psychometric properties. Confirmatory factor analysis showed that nine-item ASLQ measured a single construct of self-leadership. The results supported the convergent and discriminant validity of the one-factor model of the ASLQ in relation to the 35-item Revised Self-Leadership Questionnaire and General Self-Efficacy scale, respectively. With regard to internal consistency and test-retest reliability, the ASLQ showed acceptable results. Furthermore, the results provided evidence that scores on the ASLQ positively predicted individual's self-reported task performance and self-efficacy mediated this relationship. Taken together, these findings suggest that the Turkish version of the ASLQ is a reliable and valid measure that can be used to measure self-leadership as one variable of interest in the future studies.

  20. Development of an abbreviated Career Indecision Profile-65 using item response theory: The CIP-Short.

    Science.gov (United States)

    Xu, Hui; Tracey, Terence J G

    2017-03-01

    The current study developed an abbreviated version of the Career Indecision Profile-65 (CIP-65; Hacker, Carr, Abrams, & Brown, 2013) by using item response theory. In order to improve the efficiency of the CIP-65 in measuring career indecision, the individual item performance of the CIP-65 was examined with respect to the ordering of response occurrence and gender differential item functioning. The best 5 items of each scale of the CIP-65 (i.e., neuroticism/negative affectivity, choice/commitment anxiety, lack of readiness, and interpersonal conflicts) were retained in the CIP-Short using a sample of 588 college students. A validation sample (N = 174) supported the reliability and structural validity of the CIP-Short. The convergent and divergent validity of the CIP-Short was additionally supported in the findings of a hypothesized differential relational pattern in a separate sample (N = 360). While the current study supported the CIP-Short being a sound brief measure of career indecision, the limitations of this study and suggestions for future research were discussed as well. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  1. 14 CFR 221.200 - Content and explanation of abbreviations, reference marks and symbols.

    Science.gov (United States)

    2010-01-01

    ..., reference marks and symbols. 221.200 Section 221.200 Aeronautics and Space OFFICE OF THE SECRETARY... § 221.200 Content and explanation of abbreviations, reference marks and symbols. (a) Content. The format..., reference marks and symbols. Abbreviations, reference marks and symbols which are used in the tariff shall...

  2. 16 CFR 303.5 - Abbreviations, ditto marks, and asterisks prohibited.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Abbreviations, ditto marks, and asterisks... Abbreviations, ditto marks, and asterisks prohibited. (a) In disclosing required information, words or terms shall not be designated by ditto marks or appear in footnotes referred to by asterisks or other symbols...

  3. List of abbreviations for currently valid generic-level taxa in family Culicidae (Diptera).

    Science.gov (United States)

    A list of two letter abbreviations for all genera and three letter abbreviations for all subgenera of mosquitoes (family Culicidae, order Diptera) is given. This information on generic-level taxa of mosquitoes is useful in reducing printed space in publications, tables and lists. The work was comp...

  4. Automatic Word Sense Disambiguation of Acronyms and Abbreviations in Clinical Texts

    Science.gov (United States)

    Moon, Sungrim

    2012-01-01

    The use of acronyms and abbreviations is increasing profoundly in the clinical domain in large part due to the greater adoption of electronic health record (EHR) systems and increased electronic documentation within healthcare. A single acronym or abbreviation may have multiple different meanings or senses. Comprehending the proper meaning of an…

  5. Screening for personality disorder in a sample of incarcerated male youth: preliminary validation of the Standardised Assessment of Personality-Abbreviated Scale (SAPAS)

    DEFF Research Database (Denmark)

    Kongerslev, Mickey; Bo, Sune; Simonsen, Erik

    2011-01-01

    Aims: To test the validity of an age-appropriate adaptation of the Standardised Assessment of Personality - Abbreviated Scale (SAPAS) in a sample of incarcerated male youth Method: A sample of incarcerated boys, age 15 to 18, were administered the SAPAS by social workers from the participating...... prisons and secure institutions Within one week a clinical psychologist administered the Structured Clinical Inter-view for DSM-IV Personality Disorders (SCID-II) and the Psychopathy Checklist: Youth Version (PCL:YV) to assess for personality disorders and psychopathy In order to control for confounding...

  6. Use of abbreviations in the nursing records of a teaching hospital

    Directory of Open Access Journals (Sweden)

    Sylvia Miranda Carneiro

    2016-05-01

    Full Text Available Objective: to evaluate the use of abbreviations in nursing records of a teaching hospital and describing their profile in different sectors, work shifts and professional nursing categories. Methods: documentary study that analyzed 627 nursing records in 24 patient charts using a systematic observation script. Results: we identified 1,792 abbreviations, and 35.8% were nonstandard. The incidence of abbreviations was higher in the Intensive Care Unit, used by nurses and in the night shift. Conclusion: abbreviations are part of the day-to-day of nursing records. The use of nonstandard abbreviations make difficult to understand the note content, can generate misinterpretations, put at risk the users’ safety and impair the continuity of labor work.

  7. Knowledge of text message abbreviations as a predictor of spelling ability.

    Science.gov (United States)

    Kreiner, David S; Davis, Danielle L

    2011-02-01

    The relationships of self-reported text messaging frequency and knowledge of text message abbreviations with spelling ability were investigated. Two studies were conducted in which the college student participants provided self-reports of text messaging frequency, responded to a test of knowledge of text message abbreviations, and completed a standardized spelling test. In both studies, self-reported text messaging frequency was not predictive of scores on the spelling test. Knowledge of text message abbreviations was positively correlated with spelling scores. In the second study, spelling ability was positively correlated with processing time to identify abbreviations as real. The results were not consistent with the idea that better knowledge of text messaging is predictive of lower spelling ability. Instead, individuals with better knowledge of abbreviations tended to be better spellers.

  8. Testing the Abbreviated Food Technology Neophobia Scale and its relation to satisfaction with food-related life in university students.

    Science.gov (United States)

    Schnettler, Berta; Grunert, Klaus G; Miranda-Zapata, Edgardo; Orellana, Ligia; Sepúlveda, José; Lobos, Germán; Hueche, Clementina; Höger, Yesli

    2017-06-01

    The aims of this study were to test the relationships between food neophobia, satisfaction with food-related life and food technology neophobia, distinguishing consumer segments according to these variables and characterizing them according to willingness to purchase food produced with novel technologies. A survey was conducted with 372 university students (mean aged=20.4years, SD=2.4). The questionnaire included the Abbreviated version of the Food Technology Neophobia Scale (AFTNS), Satisfaction with Life Scale (SWLS), and a 6-item version of the Food Neophobia Scale (FNS). Using confirmatory factor analysis, it was confirmed that SWFL correlated inversely with FNS, whereas FNS correlated inversely with AFTNS. No relationship was found between SWFL and AFTNS. Two main segments were identified using cluster analysis; these segments differed according to gender and family size. Group 1 (57.8%) possessed higher AFTNS and FNS scores than Group 2 (28.5%). However, these groups did not differ in their SWFL scores. Group 1 was less willing to purchase foods produced with new technologies than Group 2. The AFTNS and the 6-item version of the FNS are suitable instruments to measure acceptance of foods produced using new technologies in South American developing countries. The AFTNS constitutes a parsimonious alternative for the international study of food technology neophobia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Allie: a database and a search service of abbreviations and long forms.

    Science.gov (United States)

    Yamamoto, Yasunori; Yamaguchi, Atsuko; Bono, Hidemasa; Takagi, Toshihisa

    2011-01-01

    Many abbreviations are used in the literature especially in the life sciences, and polysemous abbreviations appear frequently, making it difficult to read and understand scientific papers that are outside of a reader's expertise. Thus, we have developed Allie, a database and a search service of abbreviations and their long forms (a.k.a. full forms or definitions). Allie searches for abbreviations and their corresponding long forms in a database that we have generated based on all titles and abstracts in MEDLINE. When a user query matches an abbreviation, Allie returns all potential long forms of the query along with their bibliographic data (i.e. title and publication year). In addition, for each candidate, co-occurring abbreviations and a research field in which it frequently appears in the MEDLINE data are displayed. This function helps users learn about the context in which an abbreviation appears. To deal with synonymous long forms, we use a dictionary called GENA that contains domain-specific terms such as gene, protein or disease names along with their synonymic information. Conceptually identical domain-specific terms are regarded as one term, and then conceptually identical abbreviation-long form pairs are grouped taking into account their appearance in MEDLINE. To keep up with new abbreviations that are continuously introduced, Allie has an automatic update system. In addition, the database of abbreviations and their long forms with their corresponding PubMed IDs is constructed and updated weekly. Database URL: The Allie service is available at http://allie.dbcls.jp/.

  10. Frequency, comprehension and attitudes of physicians towards abbreviations in the medical record.

    Science.gov (United States)

    Hamiel, Uri; Hecht, Idan; Nemet, Achia; Pe'er, Liron; Man, Vitaly; Hilely, Assaf; Achiron, Asaf

    2018-03-14

    Abbreviations are common in the medical record. Their inappropriate use may ultimately lead to patient harm, yet little is known regarding the extent of their use and their comprehension. Our aim was to assess the extent of their use, their comprehension and physicians' attitudes towards them, using ophthalmology consults in a tertiary hospital as a model. We first mapped the frequency with which English abbreviations were used in the departments' computerised databases. We then used the most frequently used abbreviations as part of a cross-sectional survey designed to assess the attitudes of non-ophthalmologist physicians towards the abbreviations and their comprehension of them. Finally, we tested whether an online lecture would improve comprehension. 4375 records were screened, and 235 physicians responded to the survey. Only 42.5% knew at least 10% of the abbreviations, and no one knew them all. Ninety-two per cent of respondents admitted to searching online for the meanings of abbreviations, and 59.1% believe abbreviations should be prohibited in medical records. A short online lecture improved the number of respondents answering correctly at least 50% of the time from 1.2% to 42% (PAbbreviations are common in medical records and are frequently misinterpreted. Online teaching is a valuable tool for physician education. The majority of respondents believed that misinterpreting abbreviations could negatively impact patient care, and that the use of abbreviations should be prohibited in medical records. Due to low rates of comprehension and negative attitudes towards abbreviations in medical communications, we believe their use should be discouraged. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  11. Allie: a database and a search service of abbreviations and long forms

    Science.gov (United States)

    Yamamoto, Yasunori; Yamaguchi, Atsuko; Bono, Hidemasa; Takagi, Toshihisa

    2011-01-01

    Many abbreviations are used in the literature especially in the life sciences, and polysemous abbreviations appear frequently, making it difficult to read and understand scientific papers that are outside of a reader’s expertise. Thus, we have developed Allie, a database and a search service of abbreviations and their long forms (a.k.a. full forms or definitions). Allie searches for abbreviations and their corresponding long forms in a database that we have generated based on all titles and abstracts in MEDLINE. When a user query matches an abbreviation, Allie returns all potential long forms of the query along with their bibliographic data (i.e. title and publication year). In addition, for each candidate, co-occurring abbreviations and a research field in which it frequently appears in the MEDLINE data are displayed. This function helps users learn about the context in which an abbreviation appears. To deal with synonymous long forms, we use a dictionary called GENA that contains domain-specific terms such as gene, protein or disease names along with their synonymic information. Conceptually identical domain-specific terms are regarded as one term, and then conceptually identical abbreviation-long form pairs are grouped taking into account their appearance in MEDLINE. To keep up with new abbreviations that are continuously introduced, Allie has an automatic update system. In addition, the database of abbreviations and their long forms with their corresponding PubMed IDs is constructed and updated weekly. Database URL: The Allie service is available at http://allie.dbcls.jp/. PMID:21498548

  12. New method for abbreviating the fault tree graphical representation

    International Nuclear Information System (INIS)

    Stewart, M.E.; Fussell, J.B.; Crump, R.J.

    1974-12-01

    Fault tree analysis is being widely used for reliability and safety analysis of systems encountered in the nuclear industry and elsewhere. A disadvantage of the fault tree method is the voluminous fault tree graphical representation that conventionally results from analysis of a complex system. Previous methods for shortening the fault tree graphical representation include (1) transfers within the fault tree, and (2) the use of the SAMPLE (K out of N logic) gate, the MATRIX gate, and the SUMMATION gate. The purpose of this presentation is to introduce TABULATION gates as a method to abbreviate the fault tree graphical representation. These new gates reduce the cost of analysis and generally increase the system behavior visibility that is inherent in the fault tree technique

  13. Enhancing acronym/abbreviation knowledge bases with semantic information.

    Science.gov (United States)

    Torii, Manabu; Liu, Hongfang

    2007-10-11

    In the biomedical domain, a terminology knowledge base that associates acronyms/abbreviations (denoted as SFs) with the definitions (denoted as LFs) is highly needed. For the construction such terminology knowledge base, we investigate the feasibility to build a system automatically assigning semantic categories to LFs extracted from text. Given a collection of pairs (SF,LF) derived from text, we i) assess the coverage of LFs and pairs (SF,LF) in the UMLS and justify the need of a semantic category assignment system; and ii) automatically derive name phrases annotated with semantic category and construct a system using machine learning. Utilizing ADAM, an existing collection of (SF,LF) pairs extracted from MEDLINE, our system achieved an f-measure of 87% when assigning eight UMLS-based semantic groups to LFs. The system has been incorporated into a web interface which integrates SF knowledge from multiple SF knowledge bases. Web site: http://gauss.dbb.georgetown.edu/liblab/SFThesurus.

  14. Dictionary of International Abbreviations - Environment and Natural Sciences

    International Nuclear Information System (INIS)

    2003-01-01

    The dictionary comprises about 3000 acronyms and abbreviations, with explanations in German and English. Subjects: Chemistry, medicine, geology, air, water, soil, waste, air pollution and noise abatement, chemicals and pollutants, agriculture and food, conservation and landscaping, energy, immission protection, radiation protection and nuclear safety, industry and biotechnology, environmental pollution, waste management and recycling. It is intended as a working and communication tool for a wide range of users in industry, administration, universities, scientists and students, journalists, translators and interested laymen. There is an appendix with supplementary information, i.e. mass, volume, SI units, chemical compounds and formulas, occupational pollutant exposure, food additives, environmental disasters, environmental laws, regulations and specifications, international programmes and organisations for environmental protection, and guidelines of environmental and international law. (orig.) [de

  15. A study on the use of abbreviations among doctors and nurses in the medical department of a tertiary hospital in Malaysia.

    Science.gov (United States)

    Koh, K C; Lau, K M; Yusof, S A M; Mohamad, A I; Shahabuddin, F S A; Ahmat, N H; Teh, P C

    2015-12-01

    Misinterpretation of abbreviations by healthcare professionals has been reported to compromise patient safety. This study was done to determine the prevalence of abbreviations usage among medical doctors and nurses and their ability to interpret commonly used abbreviations in medical practice. Seventy-seven medical doctors and eighty nurses answered a self-administered questionnaire designed to capture demographic data and information regarding abbreviation use in medical practice. Comparisons were made between doctors and nurses with regards to frequency and reasons for using abbreviations; from where abbreviations were learned; frequency of encountering abbreviations in medical practice; prevalence of medical errors due to misinterpretation of abbreviations; and their ability to correctly interpret commonly used abbreviations. The use of abbreviations was highly prevalent among doctors and nurses. Time saving, avoidance of writing sentences in full and convenience, were the main reasons for using abbreviations. Doctors learned abbreviations from fellow doctors while nurses learned from fellow nurses and doctors. More doctors than nurses reported encountering abbreviations. Both groups reported no difficulties in interpreting abbreviations although nurses reported often resorting to guesswork. Both groups felt abbreviations were necessary and an acceptable part of work. Doctors outperformed nurses in correctly interpreting commonly used standard and non-standard abbreviations. The use of standard and non-standard abbreviation in clinical practice by doctors and nurses was highly prevalent. Significant variability in interpretation of abbreviations exists between doctors and nurses.

  16. GENII Version 2 Users’ Guide

    Energy Technology Data Exchange (ETDEWEB)

    Napier, Bruce A.

    2004-03-08

    The GENII Version 2 computer code was developed for the Environmental Protection Agency (EPA) at Pacific Northwest National Laboratory (PNNL) to incorporate the internal dosimetry models recommended by the International Commission on Radiological Protection (ICRP) and the radiological risk estimating procedures of Federal Guidance Report 13 into updated versions of existing environmental pathway analysis models. The resulting environmental dosimetry computer codes are compiled in the GENII Environmental Dosimetry System. The GENII system was developed to provide a state-of-the-art, technically peer-reviewed, documented set of programs for calculating radiation dose and risk from radionuclides released to the environment. The codes were designed with the flexibility to accommodate input parameters for a wide variety of generic sites. Operation of a new version of the codes, GENII Version 2, is described in this report. Two versions of the GENII Version 2 code system are available, a full-featured version and a version specifically designed for demonstrating compliance with the dose limits specified in 40 CFR 61.93(a), the National Emission Standards for Hazardous Air Pollutants (NESHAPS) for radionuclides. The only differences lie in the limitation of the capabilities of the user to change specific parameters in the NESHAPS version. This report describes the data entry, accomplished via interactive, menu-driven user interfaces. Default exposure and consumption parameters are provided for both the average (population) and maximum individual; however, these may be modified by the user. Source term information may be entered as radionuclide release quantities for transport scenarios, or as basic radionuclide concentrations in environmental media (air, water, soil). For input of basic or derived concentrations, decay of parent radionuclides and ingrowth of radioactive decay products prior to the start of the exposure scenario may be considered. A single code run can

  17. Pharmacist and Physician Interpretation of Abbreviations for Acetaminophen Intended for Use in a Consumer Icon

    Directory of Open Access Journals (Sweden)

    Saul Shiffman

    2015-10-01

    Full Text Available Concomitant use of multiple acetaminophen medications is associated with overdose. To help patients identify acetaminophen medications and thus avoid concomitant use, an icon with an abbreviation for “acetaminophen” has been proposed for all acetaminophen medications. This study assessed pharmacists’ and physicians’ use and interpretation of abbreviations for “acetaminophen”, to identify abbreviations with other meanings that might cause confusion. Physicians (n = 150 reported use and interpretation of candidate abbreviations Ac and Acm. Pharmacists (n = 150 interpretations of prescription orders using the candidate abbreviations APAP, Ac, Ace and Acm in typed, handwritten or spoken form, were judged for critical confusions likely to cause patient harm. Critical confusion was rare, except for omission by pharmacists of the acetaminophen dose for Hydrocodone/APAP prescriptions (10%. Ac was in common use to indicate “before meals”, and was interpreted as such, but some physicians (8% said they use Ac to indicate anticoagulant drugs. Most pharmacists (54% interpreted Ace as acetaminophen, and none interpreted it as referring to ACE-inhibitors. Acm was rarely used in prescriptions, had no common interfering meanings, and was often (63% interpreted as acetaminophen, especially when prescribed in combination with an opiate (85%. The data validated concerns about abbreviations in prescribing: all abbreviations resulted in some misinterpretations. However, Acm was rarely misinterpreted, was readily associated with “acetaminophen”, and seemed appropriate for use in a graphic icon to help consumers/patients identify acetaminophen medications.

  18. A sense inventory for clinical abbreviations and acronyms created using clinical notes and medical dictionary resources.

    Science.gov (United States)

    Moon, Sungrim; Pakhomov, Serguei; Liu, Nathan; Ryan, James O; Melton, Genevieve B

    2014-01-01

    To create a sense inventory of abbreviations and acronyms from clinical texts. The most frequently occurring abbreviations and acronyms from 352,267 dictated clinical notes were used to create a clinical sense inventory. Senses of each abbreviation and acronym were manually annotated from 500 random instances and lexically matched with long forms within the Unified Medical Language System (UMLS V.2011AB), Another Database of Abbreviations in Medline (ADAM), and Stedman's Dictionary, Medical Abbreviations, Acronyms & Symbols, 4th edition (Stedman's). Redundant long forms were merged after they were lexically normalized using Lexical Variant Generation (LVG). The clinical sense inventory was found to have skewed sense distributions, practice-specific senses, and incorrect uses. Of 440 abbreviations and acronyms analyzed in this study, 949 long forms were identified in clinical notes. This set was mapped to 17,359, 5233, and 4879 long forms in UMLS, ADAM, and Stedman's, respectively. After merging long forms, only 2.3% matched across all medical resources. The UMLS, ADAM, and Stedman's covered 5.7%, 8.4%, and 11% of the merged clinical long forms, respectively. The sense inventory of clinical abbreviations and acronyms and anonymized datasets generated from this study are available for public use at http://www.bmhi.umn.edu/ihi/research/nlpie/resources/index.htm ('Sense Inventories', website). Clinical sense inventories of abbreviations and acronyms created using clinical notes and medical dictionary resources demonstrate challenges with term coverage and resource integration. Further work is needed to help with standardizing abbreviations and acronyms in clinical care and biomedicine to facilitate automated processes such as text-mining and information extraction.

  19. An abbreviated Faecal Incontinence Quality of Life Scale for Chinese-speaking population with colorectal cancer after surgery: cultural adaptation and item reduction.

    Science.gov (United States)

    Hsu, L-F; Hung, C-L; Kuo, L-J; Tsai, P-S

    2017-09-01

    No instrument is available to assess the impact of faecal incontinence (FI) of quality of life for Chinese-speaking population. The purpose of the study was to adapt the Faecal Incontinence Quality of Life Scale (FIQL) for patients with colorectal cancer, assess the factor structure and reduce the items for brevity. A sample of 120 participants were enrolled. Internal consistency, test-retest reliability, and convergent and contrasted-groups validity were assessed. Construct validity was analysed using an exploratory and confirmatory factor analyses (CFA). The internal consistency (Cronbach's α of the total scale and four subscales = 0.98 and 0.97, 0.96, 0.92, 0.82 respectively), test-retest reliability (intraclass correlation coefficients ≥.98 for all scales with p < .001) and significant correlations of all scales with selected subscales of the Medical Outcomes Study 36-Item Short-Form Health Survey and the Wexner scale suggested satisfactory reliability and validity. The severe FI group (with a Wexner score ≥9) scored significantly lower on the scale than the less severe FI group (with a Wexner score <9) did (p < .001). The CFA supported a two-factor structure and demonstrated an excellent model fit of the 15-item abbreviated version of the FIQL-Chinese. The FIQL-Chinese has satisfactory validity and reliability and the abbreviated version may be more practical and applicable. © 2016 John Wiley & Sons Ltd.

  20. Reliability and validity of Brief Problem Monitor, an abbreviated form of the Child Behavior Checklist.

    Science.gov (United States)

    Piper, Brian J; Gray, Hilary M; Raber, Jacob; Birkett, Melissa A

    2014-10-01

    The parent form of the 113-item Child Behavior Checklist (CBCL) is widely utilized by child psychiatrists and psychologists. This report examines the reliability and validity of a recently developed abbreviated version of the CBCL, the Brief Problem Monitor (BPM). Caregivers (n = 567) completed the CBCL online and the 19 BPM items were examined separately. Internal consistency of the BPM was high (Cronbach's alpha = 0.91) and satisfactory for the Internalizing (0.78), Externalizing (0.86), and Attention (0.87) scales. High correlations between the CBCL and BPM were identified for the total score (r = 0.95) as well as the Internalizing (0.86), Externalizing (0.93), and Attention (0.97) scales. The BPM and scales were sensitive and identified significantly higher behavioral and emotional problems among children whose caregiver reported a psychiatric diagnosis of attention-deficit hyperactivity disorder, bipolar disorder, depression, anxiety, developmental disabilities, or autism spectrum disorders relative to a comparison group that had not been diagnosed with these disorders. BPM ratings also differed by the socioeconomic status and education of the caregiver. Mothers with higher annual incomes rated their children as having 38.8% fewer total problems (Cohen's d = 0.62) as well as 42.8% lower Internalizing (d = 0.53), 44.1% less Externalizing (d = 0.62), and 30.9% decreased Attention (d = 0.39). A similar pattern was evident for maternal education (d = 0.30-0.65). Overall, these findings provide strong psychometric support for the BPM, although the differences based on the characteristics of the parent indicate that additional information from other sources (e.g., teachers) should be obtained to complement parental reports. © 2014 The Authors. Psychiatry and Clinical Neurosciences © 2014 Japanese Society of Psychiatry and Neurology.

  1. Psychometric testing of the abbreviated Clinical Learning Environment Inventory (CLEI-19).

    Science.gov (United States)

    Salamonson, Yenna; Bourgeois, Sharon; Everett, Bronwyn; Weaver, Roslyn; Peters, Kath; Jackson, Debra

    2011-12-01

    This paper is a report of a test of the psychometric properties of a 19-item version of the Clinical Learning Environment Inventory. Although the clinical learning environment provides the 'real-life' context essential for preparing nursing students for their professional role, the quality of student learning is influenced by the quality of the clinical placement. Nursing students completed an abbreviated (19-item) form of the Clinical Learning Environment Inventory to rate their perception of the clinical learning environment. Descriptive statistics, principal component analysis, discriminant validity and Cronbach's alpha reliabilities were computed. Between March and December 2009, 231 online surveys were submitted. The mean age of participants was 30.3 years (sd: 10.4) and 87% were female. All 19 items loaded on two factors, 'Clinical Facilitator Support of Learning' and 'Satisfaction with Clinical Placement', with factor loadings above the 0.4 threshold. Cronbach's alpha coefficient was 0.93 for the total Clinical Learning Environment Inventory-19, with subscales ranging from 0.92 to 0.94. Multiple regression uncovered that participants who engaged in health-related paid work were independently and significantly more positive on the 'Clinical Facilitator Support of Learning' subscale, whereas those who worked >16 hours a week, or allocated the afternoon shift were independently and significantly more negative on the 'Satisfaction with Clinical Placement' subscale. Providing an effective and productive clinical experience is vital in preparing nursing students to become competent clinicians. The Clinical Learning Environment Inventory-19 offers a useful measure to explore nursing students' satisfaction with two aspects of this clinical experience--clinical facilitator support of learning and the clinical learning environment. © 2011 Blackwell Publishing Ltd.

  2. [Reliability and validity studies of Turkish translation of Eysenck Personality Questionnaire Revised-Abbreviated].

    Science.gov (United States)

    Karanci, A Nuray; Dirik, Gülay; Yorulmaz, Orçun

    2007-01-01

    The aim of the present study was to examine the reliability and the validity of the Turkish translation of the Eysneck Personality Questionnaire Revised-abbreviated Form (EPQR-A) (Francis et al., 1992), which consists of 24 items that assess neuroticism, extraversion, psychoticism, and lying. The questionnaire was first translated into Turkish and then back translated. Subsequently, it was administered to 756 students from 4 different universities. The Fear Survey Inventory-III (FSI-III), Rosenberg Self-Esteem Scales (RSES), and Egna Minnen Betraffande Uppfostran (EMBU-C) were also administered in order to assess the questionnaire's validity. The internal consistency, test-retest reliability, and validity were subsequently evaluated. Factor analysis, similar to the original scale, yielded 4 factors; the neuroticism, extraversion, psychoticism, and lie scales. Kuder-Richardson alpha coefficients for the extraversion, neuroticism, psychoticism, and lie scales were 0.78, 0.65, 0.42, and 0.64, respectively, and the test-retest reliability of the scales was 0.84, 0.82, 0.69, and 0.69, respectively. The relationships between EPQR-A-48, FSI-III, EMBU-C, and RSES were examined in order to evaluate the construct validity of the scale. Our findings support the construct validity of the questionnaire. To investigate gender differences in scores on the subscales, MANOVA was conducted. The results indicated that there was a gender difference only in the lie scale scores. Our findings largely supported the reliability and validity of the questionnaire in a Turkish student sample. The psychometric characteristics of the Turkish version of the EPQR-A were discussed in light of the relevant literature.

  3. Adaptation of abbreviated mathematics anxiety rating scale for engineering students

    Science.gov (United States)

    Nordin, Sayed Kushairi Sayed; Samat, Khairul Fadzli; Sultan, Al Amin Mohamed; Halim, Bushra Abdul; Ismail, Siti Fatimah; Mafazi, Nurul Wirdah

    2015-05-01

    Mathematics is an essential and fundamental tool used by engineers to analyse and solve problems in their field. Due to this, most engineering education programs involve a concentration of study in mathematics courses whereby engineering students have to take mathematics courses such as numerical methods, differential equations and calculus in the first two years and continue to do so until the completion of the sequence. However, the students struggled and had difficulties in learning courses that require mathematical abilities. Hence, this study presents the factors that caused mathematics anxiety among engineering students using Abbreviated Mathematics Anxiety Rating Scale (AMARS) through 95 students of Universiti Teknikal Malaysia Melaka (UTeM). From 25 items in AMARS, principal component analysis (PCA) suggested that there are four mathematics anxiety factors, namely experiences of learning mathematics, cognitive skills, mathematics evaluation anxiety and students' perception on mathematics. Minitab 16 software was used to analyse the nonparametric statistics. Kruskal-Wallis Test indicated that there is a significant difference in the experience of learning mathematics and mathematics evaluation anxiety among races. The Chi-Square Test of Independence revealed that the experience of learning mathematics, cognitive skills and mathematics evaluation anxiety depend on the results of their SPM additional mathematics. Based on this study, it is recommended to address the anxiety problems among engineering students at the early stage of studying in the university. Thus, lecturers should play their part by ensuring a positive classroom environment which encourages students to study mathematics without fear.

  4. School version of ESTE EU

    International Nuclear Information System (INIS)

    Carny, P.; Suchon, D.; Chyly, M.; Smejkalova, E.; Fabova, V.

    2008-01-01

    ESTE EU is information system and software for radiological impacts assessment to the territory of the country in case of radiation accident inside/outside of the country .The program enables to model dispersion of radioactive clouds in small-scale and meso-scale. The system enables the user to estimate prediction of the source term (release to the atmosphere ) for any point of radiation/nuclear accident in Europe (for any point of the release, but especially for the sites of European power reactors ). The system enables to utilize results of real radiological monitoring in the process of source term estimation. Radiological impacts of release to the atmosphere are modelled and calculated across the Europe and displayed in the geographical information system (GIS). The school version of ESTE EU is intended for students of the universities which are interested in or could work in the field of emergency response, radiological and nuclear accidents, dispersion modelling, radiological impacts calculation and urgent or preventive protective measures implementation. The school version of ESTE EU is planned to be donated to specialized departments of faculties in Slovakia, Czech Republic, etc. System can be fully operated in Slovak, Czech or English language. (authors)

  5. School version of ESTE EU

    International Nuclear Information System (INIS)

    Carny, P.; Suchon, D.; Chyly, M.; Smejkalova, E.; Fabova, V.

    2009-01-01

    ESTE EU is information system and software for radiological impacts assessment to the territory of the country in case of radiation accident inside/outside of the country .The program enables to model dispersion of radioactive clouds in small-scale and meso-scale. The system enables the user to estimate prediction of the source term (release to the atmosphere ) for any point of radiation/nuclear accident in Europe (for any point of the release, but especially for the sites of European power reactors ). The system enables to utilize results of real radiological monitoring in the process of source term estimation. Radiological impacts of release to the atmosphere are modelled and calculated across the Europe and displayed in the geographical information system (GIS). The school version of ESTE EU is intended for students of the universities which are interested in or could work in the field of emergency response, radiological and nuclear accidents, dispersion modelling, radiological impacts calculation and urgent or preventive protective measures implementation. The school version of ESTE EU is planned to be donated to specialized departments of faculties in Slovakia, Czech Republic, etc. System can be fully operated in Slovak, Czech or English language. (authors)

  6. The effectiveness of a 'Do Not Use' list and perceptions of healthcare professionals on error-prone abbreviations.

    Science.gov (United States)

    Samaranayake, Nithushi R; Cheung, Dixon S T; Lam, May P S; Cheung, Tommy T; Chui, William C M; Wong, Ian C K; Cheung, Bernard M Y

    2014-10-01

    The use of error-prone abbreviations has led to medication errors. Many safety organisations have introduced 'Do Not Use' lists (lists of error-prone abbreviations that should be avoided by prescribers), but the effectiveness of these lists have not been studied. We assessed the effectiveness of the 'Do Not Use' list introduced to the study hospital, and sought the attitudes of healthcare professionals on other potentially dangerous abbreviations (not included in the 'Do Not Use' list) used in prescriptions. The study was conducted in a university affiliated tertiary hospital in Hong Kong. An uncontrolled observational study was conducted. In-patient prescriptions were reviewed to assess the use of error-prone abbreviations included in the 'Do Not Use' list before, after its introduction, and following the first reinforcement. An on-line survey was also conducted among prescribers, pharmacists and nurses. Rate of using error-prone abbreviations and other unapproved abbreviations among reviewed prescriptions. 3,238 prescriptions (23,398 drug items) were reviewed. The use of abbreviations in the 'Do Not Use' list decreased from 7.8 to 3.3 % after its introduction (P abbreviations were used to denote prescribing instructions in 19.2 % of the drugs prescribed. 49 different types of unapproved abbreviations were used for drug names. A 'Do Not Use' list is effective in reducing error-prone abbreviations. Reinforcements of the 'Do Not Use' list further improves prescriber adherence. However, many other unapproved abbreviations (not included in current 'Do Not Use' lists) are used when prescribing. Periodic reminders on error-prone abbreviations and education of prescribers on associated risks may help to reduce the use of error-prone abbreviations in hospitals.

  7. Active Negative Pressure Peritoneal Therapy After Abbreviated Laparotomy

    Science.gov (United States)

    Roberts, Derek J.; Faris, Peter D.; Ball, Chad G.; Kubes, Paul; Tiruta, Corina; Xiao, Zhengwen; Holodinsky, Jessalyn K.; McBeth, Paul B.; Doig, Christopher J.; Jenne, Craig N.

    2015-01-01

    Objective: To determine whether active negative pressure peritoneal therapy with the ABThera temporary abdominal closure device reduces systemic inflammation after abbreviated laparotomy. Background: Excessive systemic inflammation after abdominal injury or intra-abdominal sepsis is associated with poor outcomes. Methods: We conducted a single-center, randomized controlled trial. Forty-five adults with abdominal injury (46.7%) or intra-abdominal sepsis (52.3%) were randomly allocated to the ABThera (n = 23) or Barker's vacuum pack (n = 22). On study days 1, 2, 3, 7, and 28, blood and peritoneal fluid were collected. The primary endpoint was the difference in the plasma concentration of interleukin-6 (IL-6) 24 and 48 hours after temporary abdominal closure application. Results: There was a significantly lower peritoneal fluid drainage from the ABThera at 48 hours after randomization. Despite this, there was no difference in plasma concentration of IL-6 at baseline versus 24 (P = 0.52) or 48 hours (P = 0.82) between the groups. There was also no significant intergroup difference in the plasma concentrations of IL-1β, −8, −10, or −12 p70 or tumor necrosis factor α between these time points. The cumulative incidence of primary fascial closure at 90 days was similar between groups (hazard ratio, 1.6; 95% confidence interval, 0.82–3.0; P = 0.17). However, 90-day mortality was improved in the ABThera group (hazard ratio, 0.32; 95% confidence interval, 0.11–0.93; P = 0.04). Conclusions: This trial observed a survival difference between patients randomized to the ABThera versus Barker's vacuum pack that did not seem to be mediated by an improvement in peritoneal fluid drainage, fascial closure rates, or markers of systemic inflammation. Trial Registration: ClinicalTrials.gov identifier NCT01355094. PMID:25536308

  8. Validating abbreviated measures of effort-reward imbalance at work in European cohort studies: the IPD-Work consortium.

    Science.gov (United States)

    Siegrist, Johannes; Dragano, Nico; Nyberg, Solja T; Lunau, Thorsten; Alfredsson, Lars; Erbel, Raimund; Fahlén, Göran; Goldberg, Marcel; Jöckel, Karl-Heinz; Knutsson, Anders; Leineweber, Constanze; Magnusson Hanson, Linda L; Nordin, Maria; Rugulies, Reiner; Schupp, Jürgen; Singh-Manoux, Archana; Theorell, Töres; Wagner, Gert G; Westerlund, Hugo; Zins, Marie; Heikkilä, Katriina; Fransson, Eleonor I; Kivimäki, Mika

    2014-04-01

    Effort-reward imbalance (ERI) is an established conceptualisation of work stress. Although a validated effort-reward questionnaire is available for public use, many epidemiological studies adopt shortened scales and proxy measures. To examine the agreement between different abbreviated measures and the original instrument, we compared different versions of the effort-reward scales available in 15 European cohort studies participating in the IPD-Work (Individual-participant-data meta-analysis in working populations) consortium. Five of the 15 studies provide information on the original ('complete') scales measuring 'effort' and 'reward', whereas the 10 remaining studies used 'partial' scales. To compare different versions of the ERI scales, we analyse individual-level data from 31,790 participants from the five studies with complete scales. Pearson's correlation between partial and complete scales was very high in case of 'effort' (where 2 out of 3 items were used) and very high or high in case of 'reward', if at least 4 items (out of 7) were included. Reward scales composed of 3 items revealed good to satisfactory agreement, and in one case, a reward scale consisting of 2 items only demonstrated a modest, but still acceptable degree of agreement. Sensitivity and specificity of a composite measure, the ratio of effort and reward, comparing partial versus complete scales ranged between 59-93 and 85-99 %, respectively. Complete and partial scales were strongly associated with poor self-rated health. Our results support the notion that short proxy measures or partial versions of the original scales can be used to assess effort-reward imbalance.

  9. East Asian Seas Regional Climatology Version 2.0 from 1804 to 2014 (NODC Accession 0123300)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The East Asian Seas Regional Climatology Version 2.0 is an update to the preliminary version released in May 2012. This update includes new temperature and salinity...

  10. Prevalence of error-prone abbreviations used in medication prescribing for hospitalised patients: multi-hospital evaluation.

    Science.gov (United States)

    Dooley, M J; Wiseman, M; Gu, G

    2012-03-01

    The use of error-prone abbreviations in prescribing is a potential cause of misinterpretation that may lead to medication error. This study determined frequency and type of error-prone abbreviations in inpatient medication prescribing across three Australian hospitals. Three hundred and sixty-nine (76.9%) patients had one or more error-prone abbreviations used in prescribing, with 8.4% of orders containing at least one error-prone abbreviation and 29.6% of these considered to be high risk for causing significant harm. © 2012 The Authors. Internal Medicine Journal © 2012 Royal Australasian College of Physicians.

  11. Combining corpus-derived sense profiles with estimated frequency information to disambiguate clinical abbreviations.

    Science.gov (United States)

    Xu, Hua; Stetson, Peter D; Friedman, Carol

    2012-01-01

    Abbreviations are widely used in clinical notes and are often ambiguous. Word sense disambiguation (WSD) for clinical abbreviations therefore is a critical task for many clinical natural language processing (NLP) systems. Supervised machine learning based WSD methods are known for their high performance. However, it is time consuming and costly to construct annotated samples for supervised WSD approaches and sense frequency information is often ignored by these methods. In this study, we proposed a profile-based method that used dictated discharge summaries as an external source to automatically build sense profiles and applied them to disambiguate abbreviations in hospital admission notes via the vector space model. Our evaluation using a test set containing 2,386 annotated instances from 13 ambiguous abbreviations in admission notes showed that the profile-based method performed better than two baseline methods and achieved a best average precision of 0.792. Furthermore, we developed a strategy to combine sense frequency information estimated from a clustering analysis with the profile-based method. Our results showed that the combined approach largely improved the performance and achieved a highest precision of 0.875 on the same test set, indicating that integrating sense frequency information with local context is effective for clinical abbreviation disambiguation.

  12. Use of abbreviations by healthcare professionals: what is the way forward?

    Science.gov (United States)

    Sinha, S; McDermott, F; Srinivas, G; Houghton, P W J

    2011-07-01

    To assess the understanding of commonly used abbreviations in the medical records among healthcare professionals. A selection of abbreviations from surgical inpatient admissions (gathered over a 10 day period in October 2008), in the form of a standard questionnaire, was shown to different members of a multidisciplinary team to examine interpretation and knowledge. 209 questionnaires were analysed. The average correct response was 43%. Foundation Year 1 (F1) doctors scored the highest with 57% correct responses, whereas dieticians fared worst (20% correct). Among different abbreviations, NAD (91%) and SCBU (93%) were most often correctly answered, whereas CIC (3%) and STS (0.5%) were the most incorrectly answered. Certain abbreviations which are mostly used by nurses (eg, OTT) achieved a 75% correct response by them compared to only 11% by F1 and 10% by F2 doctors (pabbreviations such as COBH (p=0.025) and LUTS (pabbreviations. Use of unambiguous and approved list of abbreviations is suggested in order to ensure good communication in patient care.

  13. Multinational Experiment 7: Access to the Global Commons. Objective 3.3 Lexicon and Abbreviations. Version 1.1

    Science.gov (United States)

    2012-05-28

    uses cyber space (MNE 7 Outcome 3 Working Definition). Cyber defence: The ability to prevent and mitigate effects of cyber attacks (MNE 7 Outcome 3...caused by the cyber attacks to intimidate or coerce society, or influence the policy of a government, or affect decision-making process of a government

  14. Audit on the Use of Dangerous Abbreviations, Symbols, and Dose Designations in Paper Compared to Electronic Medication Orders: A Multicenter Study.

    Science.gov (United States)

    Cheung, Stephanie; Hoi, Sannifer; Fernandes, Olavo; Huh, Jin; Kynicos, Sara; Murphy, Laura; Lowe, Donna

    2018-04-01

    Dangerous abbreviations on the Institute for Safe Medication Practices Canada's "Do Not Use" list have resulted in medication errors leading to harm. Data comparing rates of use of dangerous abbreviations in paper and electronic medication orders are limited. To compare rates of use of dangerous abbreviations from the "Do Not Use" list, in paper and electronic medication orders. Secondary objectives include determining the proportion of patients at risk for medication errors due to dangerous abbreviations and the most commonly used dangerous abbreviations. One-day cross-sectional audits of medication orders were conducted at a 6-site hospital network in Toronto, Canada, between December 2013 and January 2014. Proportions of paper and electronic medication orders containing dangerous abbreviation(s) were compared using a χ 2 test. The proportion of patients with at least 1 medication order containing dangerous abbreviation(s) and the top 5 dangerous abbreviations used were described. Overall, 255 patient charts were reviewed. The proportions of paper and electronic medication orders containing dangerous abbreviation(s) were 172/714 (24.1%) and 9/2207 (0.4%), respectively ( P abbreviation(s). The proportions of patients with at least 1 medication order during the audit period containing dangerous abbreviation(s) for patients with paper only, electronic only, or a hybrid of paper and electronic medication orders were 50.5%, 5%, and 47.2%, respectively. Those most commonly used were "D/C", drug name abbreviations, "OD," "cc," and "U." Electronic medication orders have significantly lower rates of dangerous abbreviation use compared to paper medication orders.

  15. Global Historical Climatology Network - Monthly Temperature, Version 4 (BETA)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Only available as BETA release. The GHCN-Monthly Temperature Version 4 dataset consists of monthly mean temperature - both raw and bias corrected data. A full...

  16. The ESA/ESO/NASA Photoshop fits Liberator Version 2

    Science.gov (United States)

    Christensen, L. L.; Nielsen, L. H.; Nielsen, K. K.; Johansen, T.

    2005-12-01

    Since the fi rst version of the FITS Liberator software was released on the 8th July 2004 more than 50,000 people worldwide have looked over the scientists' shoulders and worked with digital images from telescopes in space and on the ground themselves. In this way the Liberator has become the `industry standard' for the production of astronomical colour images. The new version 2 of the software has recently been released and opens up a signifi cant number of new possibilities.

  17. Math Anxiety Assessment with the Abbreviated Math Anxiety Scale: Applicability and usefulness: insights from the Polish adaptation

    Directory of Open Access Journals (Sweden)

    Krzysztof eCipora

    2015-11-01

    Full Text Available Math anxiety has an important impact on mathematical development and performance. However, although math anxiety is supposed to be a transcultural trait, assessment instruments are scarce and are validated mainly for Western cultures so far. Therefore, we aimed at examining the transcultural generality of math anxiety by a thorough investigation of the validity of math anxiety assessment in Eastern Europe. We investigated the validity and reliability of a Polish adaptation of the Abbreviated Math Anxiety Scale (AMAS, known to have very good psychometric characteristics in its original, American-English version as well as in its Italian and Iranian adaptations.We also observed high reliability, both for internal consistency and test-retest stability of the AMAS in the Polish sample. The results also show very good construct, convergent and discriminant validity: The factorial structure in Polish adult participants (n = 857 was very similar to the one previously found in other samples; AMAS scores correlated moderately in expected directions with state and trait anxiety, self-assessed math achievement and skill as well temperamental traits of emotional reactivity, briskness, endurance and perseverance. Average scores obtained by participants as well as gender differences and correlations with external measures were also similar across cultures. Beyond the cultural comparison, we used path model analyses to show that math anxiety relates to math grades and self-competence when controlling for trait anxiety.The current study shows transcultural validity of math anxiety assessment with the AMAS.

  18. AAC menu interface: effectiveness of active versus passive learning to master abbreviation-expansion codes.

    Science.gov (United States)

    Gregory, Ellyn; Soderman, Melinda; Ward, Christy; Beukelman, David R; Hux, Karen

    2006-06-01

    This study investigated the accuracy with which 30 young adults without disabilities learned abbreviation expansion codes associated with specific vocabulary items that were stored in an AAC device with two accessing methods: mouse access and keyboard access. Both accessing methods utilized a specialized computer application, called AAC Menu, which allowed for errorless practice. Mouse access prompted passive learning, whereas keyboard access prompted active learning. Results revealed that participants who accessed words via a keyboard demonstrated significantly higher mastery of abbreviation-expansion codes than those who accessed words via a computer mouse.

  19. Abbreviated protocol for breast MRI: Are multiple sequences needed for cancer detection?

    Energy Technology Data Exchange (ETDEWEB)

    Mango, Victoria L., E-mail: vlm2125@columbia.edu [Columbia University Medical Center, Herbert Irving Pavilion, 161 Fort Washington Avenue, 10th Floor, New York, NY 10032 (United States); Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); Morris, Elizabeth A., E-mail: morrise@mskcc.org [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); David Dershaw, D., E-mail: dershawd@mskcc.org [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); Abramson, Andrea, E-mail: abramsoa@mskcc.org [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); Fry, Charles, E-mail: charles_fry@nymc.edu [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); New York Medical College, 40 Sunshine Cottage Rd, Valhalla, NY 10595 (United States); Moskowitz, Chaya S. [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); Hughes, Mary, E-mail: hughesm@mskcc.org [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); Kaplan, Jennifer, E-mail: kaplanj@mskcc.org [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States); Jochelson, Maxine S., E-mail: jochelsm@mskcc.org [Memorial Sloan-Kettering Cancer Center, Breast and Imaging Center, 300 East 66th Street, New York, NY 10065 (United States)

    2015-01-15

    Highlights: • Abbreviated breast MR demonstrates high sensitivity for breast carcinoma detection. • Time to perform/interpret the abbreviated exam is shorter than a standard MRI exam. • An abbreviated breast MRI could reduce costs and make MRI screening more available. - Abstract: Objective: To evaluate the ability of an abbreviated breast magnetic resonance imaging (MRI) protocol, consisting of a precontrast T1 weighted (T1W) image and single early post-contrast T1W image, to detect breast carcinoma. Materials and methods: A HIPAA compliant Institutional Review Board approved review of 100 consecutive breast MRI examinations in patients with biopsy proven unicentric breast carcinoma. 79% were invasive carcinomas and 21% were ductal carcinoma in situ. Four experienced breast radiologists, blinded to carcinoma location, history and prior examinations, assessed the abbreviated protocol evaluating only the first post-contrast T1W image, post-processed subtracted first post-contrast and subtraction maximum intensity projection images. Detection and localization of tumor were compared to the standard full diagnostic examination consisting of 13 pre-contrast, post-contrast and post-processed sequences. Results: All 100 cancers were visualized on initial reading of the abbreviated protocol by at least one reader. The mean sensitivity for each sequence was 96% for the first post-contrast sequence, 96% for the first post-contrast subtraction sequence and 93% for the subtraction MIP sequence. Within each sequence, there was no significant difference between the sensitivities among the 4 readers (p = 0.471, p = 0.656, p = 0.139). Mean interpretation time was 44 s (range 11–167 s). The abbreviated imaging protocol could be performed in approximately 10–15 min, compared to 30–40 min for the standard protocol. Conclusion: An abbreviated breast MRI protocol allows detection of breast carcinoma. One pre and post-contrast T1W sequence may be adequate for detecting

  20. Abbreviated protocol for breast MRI: Are multiple sequences needed for cancer detection?

    International Nuclear Information System (INIS)

    Mango, Victoria L.; Morris, Elizabeth A.; David Dershaw, D.; Abramson, Andrea; Fry, Charles; Moskowitz, Chaya S.; Hughes, Mary; Kaplan, Jennifer; Jochelson, Maxine S.

    2015-01-01

    Highlights: • Abbreviated breast MR demonstrates high sensitivity for breast carcinoma detection. • Time to perform/interpret the abbreviated exam is shorter than a standard MRI exam. • An abbreviated breast MRI could reduce costs and make MRI screening more available. - Abstract: Objective: To evaluate the ability of an abbreviated breast magnetic resonance imaging (MRI) protocol, consisting of a precontrast T1 weighted (T1W) image and single early post-contrast T1W image, to detect breast carcinoma. Materials and methods: A HIPAA compliant Institutional Review Board approved review of 100 consecutive breast MRI examinations in patients with biopsy proven unicentric breast carcinoma. 79% were invasive carcinomas and 21% were ductal carcinoma in situ. Four experienced breast radiologists, blinded to carcinoma location, history and prior examinations, assessed the abbreviated protocol evaluating only the first post-contrast T1W image, post-processed subtracted first post-contrast and subtraction maximum intensity projection images. Detection and localization of tumor were compared to the standard full diagnostic examination consisting of 13 pre-contrast, post-contrast and post-processed sequences. Results: All 100 cancers were visualized on initial reading of the abbreviated protocol by at least one reader. The mean sensitivity for each sequence was 96% for the first post-contrast sequence, 96% for the first post-contrast subtraction sequence and 93% for the subtraction MIP sequence. Within each sequence, there was no significant difference between the sensitivities among the 4 readers (p = 0.471, p = 0.656, p = 0.139). Mean interpretation time was 44 s (range 11–167 s). The abbreviated imaging protocol could be performed in approximately 10–15 min, compared to 30–40 min for the standard protocol. Conclusion: An abbreviated breast MRI protocol allows detection of breast carcinoma. One pre and post-contrast T1W sequence may be adequate for detecting

  1. [External cephalic version].

    Science.gov (United States)

    Navarro-Santana, B; Duarez-Coronado, M; Plaza-Arranz, J

    2016-08-01

    To analyze the rate of successful external cephalic versions in our center and caesarean sections that would be avoided with the use of external cephalic versions. From January 2012 to March 2016 external cephalic versions carried out at our center, which were a total of 52. We collected data about female age, gestational age at the time of the external cephalic version, maternal body mass index (BMI), fetal variety and situation, fetal weight, parity, location of the placenta, amniotic fluid index (ILA), tocolysis, analgesia, and newborn weight at birth, minor adverse effects (dizziness, hypotension and maternal pain) and major adverse effects (tachycardia, bradycardia, decelerations and emergency cesarean section). 45% of the versions were unsuccessful and 55% were successful. The percentage of successful vaginal delivery in versions was 84% (4% were instrumental) and 15% of caesarean sections. With respect to the variables studied, only significant differences in birth weight were found; suggesting that birth weight it is related to the outcome of external cephalic version. Probably we did not find significant differences due to the number of patients studied. For women with breech presentation, we recommend external cephalic version before the expectant management or performing a cesarean section. The external cephalic version increases the proportion of fetuses in cephalic presentation and also decreases the rate of caesarean sections.

  2. Screening for personality disorder in a sample of incarcerated male youth: preliminary validation of the Standardised Assessment of Personality-Abbreviated Scale (SAPAS)

    DEFF Research Database (Denmark)

    Kongerslev, Mickey; Bo, Sune; Simonsen, Erik

    2011-01-01

    prisons and secure institutions Within one week a clinical psychologist administered the Structured Clinical Inter-view for DSM-IV Personality Disorders (SCID-II) and the Psychopathy Checklist: Youth Version (PCL:YV) to assess for personality disorders and psychopathy In order to control for confounding......, including assessment of the sensitivity and specificity of the SAPAS for various cut-off scores, will be presented Conclusions: The study provides a basis for preliminary conclusions regarding the validity of SAPAS as a brief routine screen for personality disorders amongst incarcerated male youth......Aims: To test the validity of an age-appropriate adaptation of the Standardised Assessment of Personality - Abbreviated Scale (SAPAS) in a sample of incarcerated male youth Method: A sample of incarcerated boys, age 15 to 18, were administered the SAPAS by social workers from the participating...

  3. 21 CFR 314.430 - Availability for public disclosure of data and information in an application or abbreviated...

    Science.gov (United States)

    2010-04-01

    ... or abbreviated application, including investigational new drug applications, drug master files under... or abbreviated application before an approval letter is sent to the applicant under § 314.105 or tentative approval letter is sent to the applicant under § 314.107, unless the existence of the application...

  4. Versioning Complex Data

    Energy Technology Data Exchange (ETDEWEB)

    Macduff, Matt C.; Lee, Benno; Beus, Sherman J.

    2014-06-29

    Using the history of ARM data files, we designed and demonstrated a data versioning paradigm that is feasible. Assigning versions to sets of files that are modified with some special assumptions and domain specific rules was effective in the case of ARM data, which has more than 5000 datastreams and 500TB of data.

  5. A novel abbreviation standard for organobromine, organochlorine and organophosphorus flame retardants and some characteristics of the chemicals

    Science.gov (United States)

    Bergman, Åke; Rydén, Andreas; Law, Robin J.; de Boer, Jacob; Covaci, Adrian; Alaee, Mehran; Birnbaum, Linda; Petreas, Myrto; Rose, Martin; Sakai, Shinichi; Van den Eede, Nele; van der Veen, Ike

    2012-01-01

    Ever since the interest in organic environmental contaminants first emerged 50 years ago, there has been a need to present discussion of such chemicals and their transformation products using simple abbreviations so as to avoid the repetitive use of long chemical names. As the number of chemicals of concern has increased, the number of abbreviations has also increased dramatically, sometimes resulting in the use of different abbreviations for the same chemical. In this article, we propose abbreviations for flame retardants (FRs) substituted with bromine or chlorine atoms or including a functional group containing phosphorus, i.e. BFRs, CFRs and PFRs, respectively. Due to the large number of halogenated and organophosphorus FRs, it has become increasingly important to develop a strategy for abbreviating the chemical names of FRs. In this paper, a two step procedure is proposed for deriving practical abbreviations (PRABs) for the chemicals discussed. In the first step, structural abbreviations (STABs) are developed using specific STAB criteria based on the FR structure. However, since several of the derived STABs are complicated and long, we propose instead the use of PRABs. These are, commonly, an extract of the most essential part of the STAB, while also considering abbreviations previously used in the literature. We indicate how these can be used to develop an abbreviation that can be generally accepted by scientists and other professionals involved in FR related work. Tables with PRABs and STABs for BFRs, CFRs and PFRs are presented, including CAS (Chemical Abstract Service) numbers, notes of abbreviations that have been used previously, CA (Chemical Abstract) name, common names and trade names, as well as some fundamental physico-chemical constants. PMID:22982223

  6. An abbreviated SNP panel for ancestry assignment of honeybees (Apis mellifera)

    Science.gov (United States)

    This paper examines whether an abbreviated panel of 37 single nucleotide polymorphisms (SNPs) has the same power as a larger and more expensive panel of 95 SNPs to assign ancestry of honeybees (Apis mellifera) to three ancestral lineages. We selected 37 SNPs from the original 95 SNP panel using alle...

  7. 40 CFR 1051.805 - What symbols, acronyms, and abbreviations does this part use?

    Science.gov (United States)

    2010-07-01

    ... Definitions and Other Reference Information § 1051.805 What symbols, acronyms, and abbreviations does this... per meter-square per test day. HC—hydrocarbon. Hg—mercury. hr—hours. km—kilometer. kW—kilowatt. LPG... and Records Administration. NMHC—nonmethane hydrocarbons. NOX—oxides of nitrogen (NO and NOX). psig...

  8. 40 CFR 1048.805 - What symbols, acronyms, and abbreviations does this part use?

    Science.gov (United States)

    2010-07-01

    ... ENGINES Definitions and Other Reference Information § 1048.805 What symbols, acronyms, and abbreviations... hydrocarbons. NOXoxides of nitrogen (NO and NO2). psipounds per square inch of absolute pressure. psigpounds.... SIspark-ignition. THCtotal hydrocarbon. THCEtotal hydrocarbon equivalent. U.S.C.United States Code. [67 FR...

  9. Abbreviated Title of the Artwork in the System of Signs by Ch. Peirce

    Directory of Open Access Journals (Sweden)

    Grigoriy Valeryevich Tokarev

    2015-09-01

    Full Text Available The article is devoted to the semiotic aspect of the functioning of the abbreviated title of the postmodern artwork. The authors analyze the relationship of title-sign to the object which it replaces. The title is considered from the perspective of three main features peculiar of the sign in accordance with the Charles S. Peirce's theory. This fact allows us to conclude that, being a sign, the abbreviated title replaces a literary text, which is also expressed in symbolic form of the author's knowledge of reality. In this aspect the title becomes the metasign of its text. It is shown that in this connection, decoding and interpretation process take place in two stages – before reading the text and in the process of its reading and interpretation. It is alleged that the result of the interpretation of the title depends on the reader's competence which is determined by their individual literary scope, as well as by the skills of productive work with the text. On the basis of the classification of signs created by Charles Pierce, it was found that the abbreviated title has a complex semiotic nature combining the features of indexicality, conventionality, and iconicity, the latter of which may be present only in the abbreviated title.

  10. Improving Discrete Trial Instruction by Paraprofessional Staff Through an Abbreviated Performance Feedback Intervention

    Science.gov (United States)

    Leblanc, Marie-Pierre; Ricciardi, Joseph N.; Luiselli, James K.

    2005-01-01

    We evaluated an abbreviated performance feedback intervention as a training strategy to improve discrete trial instruction of children with autism by three paraprofessional staff (assistant teachers) at a specialized day school. Feedback focused on 10 discrete trial instructional skills demonstrated by the staff during teaching sessions. Following…

  11. The Use of Abbreviations in English-Medium Astrophysics Research Paper Titles: A Problematic Issue

    Science.gov (United States)

    Méndez, David I.; Alcaraz, M. Ángeles

    2015-01-01

    In this study, we carry out a qualitative and quantitative analysis of abbreviations in 300 randomly collected research paper titles published in the most prestigious European and US-based Astrophysics journals written in English. Our main results show that the process of shortening words and groups of words is one of the most characteristic and…

  12. Greek or Not: The Use of Symbols and Abbreviations in Mathematics

    Science.gov (United States)

    Quinnell, Lorna; Carter, Merilyn

    2012-01-01

    The language of mathematics is unique and complex. One feature of the mathematical register is the use of symbols and abbreviations. Whilst it may be possible for a student to think mathematically in the absence of symbols, the written communication of mathematical ideas cannot be achieved concisely without the use of mathematical symbols.…

  13. Use of Text Message Abbreviations and Literacy Skills in Children with Dyslexia

    Science.gov (United States)

    Veater, Helen M.; Plester, Beverly; Wood, Clare

    2011-01-01

    This small-scale study compared 10 to 13-year-old dyslexic children's use of text message abbreviations with that of reading age- and chronological age-matched controls. There were no significant differences in the proportion of textisms used between the dyslexic children and the two control groups, although a preference for non-phonetic text…

  14. Text-Message Abbreviations and Language Skills in High School and University Students

    Science.gov (United States)

    De Jonge, Sarah; Kemp, Nenagh

    2012-01-01

    This study investigated the use of text-message abbreviations (textisms) in Australian adolescents and young adults, and relations between textism use and literacy abilities. Fifty-two high school students aged 13-15 years, and 53 undergraduates aged 18-24 years, all users of predictive texting, translated conventional English sentences into…

  15. Symbolic Capital in a Virtual Heterosexual Market: Abbreviation and Insertion in Italian iTV SMS

    Science.gov (United States)

    Herring, Susan C.; Zelenkauskaite, Asta

    2009-01-01

    This study analyzes gender variation in nonstandard typography--specifically, abbreviations and insertions--in mobile phone text messages (SMS) posted to a public Italian interactive television (iTV) program. All broadcast SMS were collected for a period of 2 days from the Web archive for the iTV program, and the frequency and distribution of…

  16. Relax and Try This Instead: Abbreviated Habit Reversal for Maladaptive Self-Biting.

    Science.gov (United States)

    Jones, Kevin M.; Swearer, Susan M.; Friman, Patrick C.

    1997-01-01

    A study evaluated the effectiveness of an abbreviated habit reversal procedure to reduce maladaptive oral self-biting in an adolescent boy in residential care. Treatment involved a combination of relaxation and two competing responses (gum chewing and tongue-lip rubbing). The intervention eliminated the biting and the tissue damage it caused.…

  17. 76 FR 71601 - Record of Decision, Long Walk National Historic Trail Feasibility Study/Abbreviated Final...

    Science.gov (United States)

    2011-11-18

    ... National Park Service Record of Decision, Long Walk National Historic Trail Feasibility Study/Abbreviated... Environmental Impact Statement for the Long Walk National Historic Trail Feasibility Study. SUMMARY: Pursuant to... Statement for the Long Walk National Historic Trail Feasibility Study, prepared by National Trails...

  18. Introduction of the Abbreviated Westmead Post-Traumatic Amnesia Scale and Impact on Length of Stay

    NARCIS (Netherlands)

    Watson, C. E.; Clous, E. A.; Jaeger, M.; D'Amours, S. K.

    2017-01-01

    Mild traumatic brain injury is a common presentation to Emergency Departments. Early identification of patients with cognitive deficits and provision of discharge advice are important. The Abbreviated Westmead Post-traumatic Amnesia Scale provides an early and efficient assessment of post-traumatic

  19. 21 CFR 314.94 - Content and format of an abbreviated application.

    Science.gov (United States)

    2010-04-01

    ... Trademark Office that, in the opinion of the applicant and to the best of its knowledge, claims the... listed drug. (v) Licensing agreements. If the abbreviated new drug application is for a drug or method of using a drug claimed by a patent and the applicant has a licensing agreement with the patent owner, a...

  20. 21 CFR 314.440 - Addresses for applications and abbreviated applications.

    Science.gov (United States)

    2010-04-01

    ... leukapheresis; (3) Blood component processing solutions and shelf life extenders; and (4) Oxygen carriers. [50... 21 Food and Drugs 5 2010-04-01 2010-04-01 false Addresses for applications and abbreviated applications. 314.440 Section 314.440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND...

  1. The Eysenck Personality Questionnaire Brief Version: factor structure and reliability.

    Science.gov (United States)

    Sato, Toru

    2005-11-01

    The short scale of the Eysenck Personality Questionnaire-Revised (EPQR-S; H. J. Eysenck & S. B. G. Eysenck, 1992) is a 48-item personality questionnaire primarily designed to measure an individual's level of extraversion (vs. introversion) and neuroticism. Although L. J. Francis, L. B. Brown, and R. Philipchalk (1992) created the Eysenck Personality Questionnaire Revised-Abbreviated (EPQR-A), an even briefer version of the EPQR-S, the reliability coefficients of some of the measures have been less than satisfactory (S. Forrest, C. A. Lewis, & M. Shevlin, 2000). Because brevity and reliability are both extremely important, the author of the present study created a briefer version of the EPQR-S, more reliable than the EPQR-A, by making slight alterations in the item content as well as the response format of the EPQR-S. Two hundred and sixty eight participants completed the original EPQR-S and the 24-item newly revised briefer version of the EPQR-S (EPQ-BV) twice. The findings revealed that the EPQ-BV has good internal consistency, test-retest reliability, and concurrent validity. A principal component analysis revealed a solution with factor loadings that accurately reflected the primary measures of the EPQR-S. These findings are discussed in relation to the psychometric properties of the EPQR-A and the original version of the EPQR-S.

  2. Nuclear criticality safety handbook. Version 2

    International Nuclear Information System (INIS)

    1999-03-01

    The Nuclear Criticality Safety Handbook, Version 2 essentially includes the description of the Supplement Report to the Nuclear Criticality Safety Handbook, released in 1995, into the first version of Nuclear Criticality Safety Handbook, published in 1988. The following two points are new: (1) exemplifying safety margins related to modelled dissolution and extraction processes, (2) describing evaluation methods and alarm system for criticality accidents. Revision is made based on previous studies for the chapter that treats modelling the fuel system: e.g., the fuel grain size that the system can be regarded as homogeneous, non-uniformity effect of fuel solution, and burnup credit. This revision solves the inconsistencies found in the first version between the evaluation of errors found in JACS code system and criticality condition data that were calculated based on the evaluation. (author)

  3. Impacts of an ethanol-blended fuel release on groundwater and fate of produced methane: Simulation of field observations

    Science.gov (United States)

    In a field experiment at Vandenberg Air Force Base (VAFB) designed to mimic the impact of a small-volume release of E10, two plumes were created by injecting extracted groundwater spiked with benzene, toluene, and o-xylene, abbreviated BToX (No-Ethanol Lane) and BToX plus ethanol...

  4. MCNP(trademark) Version 5

    International Nuclear Information System (INIS)

    Cox, Lawrence J.; Barrett, Richard F.; Booth, Thomas Edward; Briesmeister, Judith F.; Brown, Forrest B.; Bull, Jeffrey S.; Giesler, Gregg Carl; Goorley, John T.; Mosteller, Russell D.; Forster, R. Arthur; Post, Susan E.; Prael, Richard E.; Selcow, Elizabeth Carol; Sood, Avneet

    2002-01-01

    The Monte Carlo transport workhorse, MCNP, is undergoing a massive renovation at Los Alamos National Laboratory (LANL) in support of the Eolus Project of the Advanced Simulation and Computing (ASCI) Program. MCNP Version 5 (V5) (expected to be released to RSICC in Spring, 2002) will consist of a major restructuring from FORTRAN-77 (with extensions) to ANSI-standard FORTRAN-90 with support for all of the features available in the present release (MCNP-4C2/4C3). To most users, the look-and-feel of MCNP will not change much except for the improvements (improved graphics, easier installation, better online documentation). For example, even with the major format change, full support for incremental patching will still be provided. In addition to the language and style updates, MCNP V5 will have various new user features. These include improved photon physics, neutral particle radiography, enhancements and additions to variance reduction methods, new source options, and improved parallelism support (PVM, MPI, OpenMP).

  5. Abbreviated Biparametric Prostate MR Imaging in Men with Elevated Prostate-specific Antigen.

    Science.gov (United States)

    Kuhl, Christiane K; Bruhn, Robin; Krämer, Nils; Nebelung, Sven; Heidenreich, Axel; Schrading, Simone

    2017-11-01

    Purpose To determine the diagnostic accuracy for clinically significant prostate cancer achieved with abbreviated biparametric prostate magnetic resonance (MR) imaging in comparison with full multiparametric contrast material-enhanced prostate MR imaging in men with elevated prostate-specific antigen (PSA) and negative transrectal ultrasonography (US)-guided biopsy findings; to determine the significant cancer detection rate of biparametric versus full multiparametric contrast-enhanced MR imaging and between-reader agreement for interpretation of biparametric MR imaging. Materials and Methods In this institutional review board-approved retrospective review of prospectively acquired data, men with PSA greater than or equal to 3 ng/mL after negative transrectal US-guided biopsy findings underwent state-of-the-art, full multiparametric contrast-enhanced MR imaging at 3.0-T including high-spatial-resolution structural imaging in several planes, diffusion-weighted imaging at 0, 800, 1000, and 1400 mm 2 /sec, and dynamic contrast-enhanced MR imaging, obtained without endorectal coil within 34 minutes 19 seconds. One of four radiologists with different levels of expertise (1-9 years) first reviewed only a fraction of the full multiparametric contrast-enhanced MR images, consisting of single-plane (axial) structural imaging (T2-weighted turbo spin-echo and diffusion-weighted imaging), acquired within 8 minutes 45 seconds (referred to as biparametric MR imaging), and established a diagnosis according to the Prostate Imaging Reporting and Data System (PI-RADS) version 2; only thereafter, the remaining full multiparametric contrast-enhanced MR images were read. Men with PI-RADS categories 3-5 underwent MR-guided targeted biopsy. Men with PI-RADS categories 1-2 remained in urologic follow-up for at least 2 years, with rebiopsy (transrectal US-guided or transperineal saturation) where appropriate. McNemar test was used to compare diagnostic accuracies. To investigate between

  6. Urban Terrain Building Types: Second Edition Public Releasable Version

    Science.gov (United States)

    2012-11-01

    Various fibers are combined with resins to form an effective roof material; coir (from coconuts ) and jute are used in India. Asbestos has been...employed widely. Thickness is usually greater than with metal, ranging from 4 to 8 mm. Sheets are often made of a combination of asbestos fiber and...are 48 cm thick (a combi- nation of a 30 cm stretcher and a 15 cm header plus 3 cm of mortar ). The interior wall is also load-bearing but only one

  7. Version 2 of RSXMULTI

    International Nuclear Information System (INIS)

    Heinicke, P.; Berg, D.; Constanta-Fanourakis, P.; Quigg, E.K.

    1985-01-01

    MULTI is a general purpose, high speed, high energy physics interface to data acquisition and data investigation system that runs on PDP-11 and VAX architecture. This paper describes the latest version of MULTI, which runs under RSX-11M version 4.1 and supports a modular approach to the separate tasks that interface to it, allowing the same system to be used in single CPU test beam experiments as well as multiple interconnected CPU, large scale experiments. MULTI uses CAMAC (IEE-583) for control and monitoring of an experiment, and is written in FORTRAN-77 and assembler. The design of this version, which simplified the interface between tasks, and eliminated the need for a hard to maintain homegrown I/O system is also discussed

  8. Determining Optimal Decision Version

    Directory of Open Access Journals (Sweden)

    Olga Ioana Amariei

    2014-06-01

    Full Text Available In this paper we start from the calculation of the product cost, applying the method of calculating the cost of hour- machine (THM, on each of the three cutting machines, namely: the cutting machine with plasma, the combined cutting machine (plasma and water jet and the cutting machine with a water jet. Following the calculation of cost and taking into account the precision of manufacturing of each machine, as well as the quality of the processed surface, the optimal decisional version needs to be determined regarding the product manufacturing. To determine the optimal decisional version, we resort firstly to calculating the optimal version on each criterion, and then overall using multiattribute decision methods.

  9. Validation of the abbreviated Radon Progeny Integrating Sampling Unit (RPISU) method for Mesa County, Colorado

    International Nuclear Information System (INIS)

    Langner, G.H. Jr.

    1987-06-01

    The US Department of Energy (DOE) Office of Remedial Action and Waste Technology established the Technical Measurements Center at the DOE Grand Junction, Colorado, Projects Office to standardize, calibrate, and compare measurements made in support of DOE remedial action programs. Indoor radon-daughter concentration measurements are made to determine whether a structure is in need of remedial action. The Technical Measurements Center conducted this study to validate an abbreviated Radon Progeny Integrated Sampling Unit (RPISU) method of making indoor radon-daughter measurements to determine whether a structure has a radon-daughter concentration (RDC) below the levels specified in various program standards. The Technical Measurements Center established a criterion against which RDC measurements made using the RPISU sampling method are evaluated to determine if sampling can be terminated or whether further measurements are required. This abbreviated RPISU criterion was tested against 317 actual sets of RPISU data from measurements made over an eight-year period in Mesa County, Colorado. The data from each location were tested against a standard that was assumed to be the same as the actual annual average RDC from that location. At only two locations was the criterion found to fail. Using the abbreviated RPISU method, only 0.6% of locations sampled can be expected to be falsely indicated as having annual average RDC levels below a given standard

  10. Abbreviated kinetic profiles in area-under-the-curve monitoring of cyclosporine therapy.

    Science.gov (United States)

    Grevel, J; Kahan, B D

    1991-11-01

    Abbreviated kinetic profiles can reduce the number of phlebotomies and drug assays, and thereby the cost of area-under-the-curve (AUC) monitoring. In the present investigation, we used two independent data sets: group 1, 101 AUC profiles from 77 stable renal-transplant patients, which included a 5-h sample in addition to the usual 0-, 2-, 4-, 6-, 10-, 14-, and 24-h samples; and group 2, 100 profiles from 50 stable renal-transplant patients before and after a change in their daily oral dose of cyclosporine. Group I demonstrated a fair correlation between cyclosporine trough concentrations and the AUC calculated from a complete set of seven concentrations (r2 = 0.820 and 0.758 for the 24- and 0-h samples, respectively). Stepwise multiple linear-regression analysis revealed that the abbreviated set of three time points (2, 6, and 14 h) explained 96% of the variance in AUC values calculated from the full set of seven samples; additional time points increased the accuracy only slightly. For group 2, we examined the difference between the observed and the predicted concentrations by linear extrapolation; the error in the observed AUC value, compared with the predicted value calculated from seven time points (-13.2% to -1.2%), was similar to the error from just three time points (-11.5% to 4.5%). Abbreviated AUC profiles involving three time points used with a model equation seem to provide a reliable alternative to full seven-point profiles.

  11. Abbreviated epitaxial growth mode (AGM) method for reducing cost and improving quality of LEDs and lasers

    Science.gov (United States)

    Tansu, Nelson; Chan, Helen M; Vinci, Richard P; Ee, Yik-Khoon; Biser, Jeffrey

    2013-09-24

    The use of an abbreviated GaN growth mode on nano-patterned AGOG sapphire substrates, which utilizes a process of using 15 nm low temperature GaN buffer and bypassing etch-back and recovery processes during epitaxy, enables the growth of high-quality GaN template on nano-patterned AGOG sapphire. The GaN template grown on nano-patterned AGOG sapphire by employing abbreviated growth mode has two orders of magnitude lower threading dislocation density than that of conventional GaN template grown on planar sapphire. The use of abbreviated growth mode also leads to significant reduction in cost of the epitaxy. The growths and characteristics of InGaN quantum wells (QWs) light emitting diodes (LEDs) on both templates were compared. The InGaN QWs LEDs grown on the nano-patterned AGOG sapphire demonstrated at least a 24% enhancement of output power enhancement over that of LEDs grown on conventional GaN templates.

  12. Clinical and metabolic results of fasting abbreviation with carbohydrates in coronary artery bypass graft surgery.

    Science.gov (United States)

    Feguri, Gibran Roder; Lima, Paulo Ruiz Lúcio; Lopes, Andréa Mazoni; Roledo, Andréa; Marchese, Miriam; Trevisan, Mônica; Ahmad, Haitham; Freitas, Bruno Baranhuk de; Aguilar-Nascimento, José Eduardo de

    2012-01-01

    Limited information is available about preoperative fasting abbreviation with administration of liquid enriched with carbohydrates (CHO) in cardiovascular surgeries. To evaluate clinical variables, security of the method and effects on the metabolism of patients undergoing fasting abbreviation in coronary artery bypass graft (CABG) surgery. Forty patients undergoing CABG were randomized to receive 400 ml (6 hours before) and 200 ml (2 hours before) of maltodextrin at 12.5% (Group I, n=20) or just water (Group II, n=20) before anesthetic induction. Perioperative clinical variables were evaluated. Insulin resistance (IR) was evaluated by Homa-IR index and also by the need of exogenous insulin; pancreatic beta-cell excretory function by Homa-Beta index and glycemic control by tests of capillary glucose. Deaths, bronchoaspiration, mediastinitis, stroke and acute myocardial infarction did not occur. Atrial fibrillation occurred in two patients of each group and infectious complications did not differ among groups (P=0.611). Patients of Group I presented two days less of hospital stay (P=0.025) and one day less in the ICU (P0.05). A decline in the endogenous production of insulin was observed in both groups (P<0.001). Preoperative fasting abbreviation with the administration of CHO in the CABG was safe. The glycemic control improved in the ICU; there was less time in the use of dobutamine and length of hospital and ICU stay was reduced. However, neither IR nor morbimortality during hospital phase were influenced.

  13. Versioning of printed products

    Science.gov (United States)

    Tuijn, Chris

    2005-01-01

    During the definition of a printed product in an MIS system, a lot of attention is paid to the production process. The MIS systems typically gather all process-related parameters at such a level of detail that they can determine what the exact cost will be to make a specific product. This information can then be used to make a quote for the customer. Considerably less attention is paid to the content of the products since this does not have an immediate impact on the production costs (assuming that the number of inks or plates is known in advance). The content management is typically carried out either by the prepress systems themselves or by dedicated workflow servers uniting all people that contribute to the manufacturing of a printed product. Special care must be taken when considering versioned products. With versioned products we here mean distinct products that have a number of pages or page layers in common. Typical examples are comic books that have to be printed in different languages. In this case, the color plates can be shared over the different versions and the black plate will be different. Other examples are nation-wide magazines or newspapers that have an area with regional pages or advertising leaflets in different languages or currencies. When considering versioned products, the content will become an important cost factor. First of all, the content management (and associated proofing and approval cycles) becomes much more complex and, therefore, the risk that mistakes will be made increases considerably. Secondly, the real production costs are very much content-dependent because the content will determine whether plates can be shared across different versions or not and how many press runs will be needed. In this paper, we will present a way to manage different versions of a printed product. First, we will introduce a data model for version management. Next, we will show how the content of the different versions can be supplied by the customer

  14. Abbreviated Breast MRI and Digital Tomosynthesis Mammography in Screening Women With Dense Breasts | Division of Cancer Prevention

    Science.gov (United States)

    This randomized phase II trial studies how well abbreviated breast magnetic resonance imaging (MRI) and digital tomosynthesis mammography work in detecting cancer in women with dense breasts. Abbreviated breast MRI is a low cost procedure in which radio waves and a powerful magnet linked to a computer and used to create detailed pictures of the breast in less than 10 minutes. These pictures can show the difference between normal and diseased tissue. |

  15. BUSINESS ENGLISH OUTSIDE THE BOX. BUSINESS JARGON AND ABBREVIATIONS IN BUSINESS COMMUNICATION

    Directory of Open Access Journals (Sweden)

    Pop Anamaria-Mirabela

    2014-12-01

    Full Text Available Business English is commonly understood language, yet Harvard Business Review called business jargon “The Silent Killer of Big Companies”. As we all have been taught in school, we are aware of the fact that in communication we must comply with linguistic rules so that our message gets across succinctly. Yet, there is one place where all these rules can be omitted (at least in the recent decades: the corporate office. Here, one can use euphemisms and clichés, can capitalize any word that is considered important, the passive voice is used wherever possible and abbreviations occur in every sentence. The worst part is that all of these linguistic enormities are carried out deliberately. The purpose of this paper is to analyse to what extent business jargon and abbreviations have affected business communication (which most of the time, it is filled with opaque language to mask different activities and operations and the reasons for which these linguistic phenomena have become so successful in the present. One of the reasons for the research is that in business English, jargon can be annoying because it overcomplicates. It is frequently unnecessary and it can transform a simple idea or instruction into something very confusing. It is true that every field has its jargon. Education, journalism, law, politics, medicine, urban planning – no filed is immune. Yet, it seems that business jargon has been described as “the most annoying”. Another reason is that jargon tends to be elitist. Those who do not understand the terms feel confused and uncertain. The paper starts with defining these two concepts, business jargon and abbreviations, and then it attempts to explain the “unusual” pervasion of these, both in business communication and in everyday communication. For this, the paper includes a list with the most common business jargon and abbreviations. In this view, the authors have accessed different economic blogs and specialty journals

  16. UN-EDITED VERSION

    Indian Academy of Sciences (India)

    27

    Picasa (version 3.0). 2.4 Statistical analysis. As ambient water temperature during experimentation was 24°C, the group exposed to this temperature was considered as a control. A number of males and females (sex ratio) obtained in all remaining groups was compared with the control. Embryos and tadpoles exposed to ...

  17. Herwig++ 2.2 Release Note

    CERN Document Server

    Bahr, M; Gigg, M; Grellscheid, D; Hamilton, K; Latunde-Dada, O; Platzer, S; Richardson, P; Seymour, M H; Sherstnev, AUniversity of Cambridge; Webber, Bryan R

    2008-01-01

    A new release of the Monte Carlo program Herwig++ (version 2.2) is now available. This version includes a number of improvements including: matrix elements for the production of an electroweak gauge boson, W and Z, in association with a jet; several new processes for Higgs production in association with an electroweak gauge boson; and the matrix element correction for QCD radiation in Higgs production via gluon fusion.

  18. Herwig++ 2.5 release note

    International Nuclear Information System (INIS)

    Gieseke, S.; Roehr, C.A.; Siodmok, A.

    2011-02-01

    A new release of the Monte Carlo program Herwig++ (version 2.5) is now available. This version comes with a number of improvements including: new next-to-leading order matrix elements, including weak boson pair production; a colour reconnection model; diffractive processes; additional models of physics beyond the Standard Model; new leading-order matrix elements for hadron-hadron and lepton-lepton collisions as well as photon-initiated processes. (orig.)

  19. Version control with Git

    CERN Document Server

    Loeliger, Jon

    2012-01-01

    Get up to speed on Git for tracking, branching, merging, and managing code revisions. Through a series of step-by-step tutorials, this practical guide takes you quickly from Git fundamentals to advanced techniques, and provides friendly yet rigorous advice for navigating the many functions of this open source version control system. This thoroughly revised edition also includes tips for manipulating trees, extended coverage of the reflog and stash, and a complete introduction to the GitHub repository. Git lets you manage code development in a virtually endless variety of ways, once you understand how to harness the system's flexibility. This book shows you how. Learn how to use Git for several real-world development scenarios ; Gain insight into Git's common-use cases, initial tasks, and basic functions ; Use the system for both centralized and distributed version control ; Learn how to manage merges, conflicts, patches, and diffs ; Apply advanced techniques such as rebasing, hooks, and ways to handle submodu...

  20. Training Materials for Release 3

    DEFF Research Database (Denmark)

    Wake, Jo Dugstad; Hansen, Cecilie; Debus, Kolja

    This document, D7.4 – training materials for release 3, provides an overview of the training material for version 3 of the NEXT-TELL tools and methods. Previous documents submitted as part of work package 7, which is about teacher training, are D7.1 – Training Concept, D7.2 – Training Materials...... for Release 1 and D7.3 – Training Materials for Release 2. D7.4 builds on D7.1 and D7.2 and D7.3. D7.4 contains further development of previous work within WP7, essentially a revised theoretical approach to the teacher training, and expansion of the notion of tool training. The media in use have been expanded...

  1. EASI graphics - Version II

    International Nuclear Information System (INIS)

    Allensworth, J.A.

    1984-04-01

    EASI (Estimate of Adversary Sequence Interruption) is an analytical technique for measuring the effectiveness of physical protection systems. EASI Graphics is a computer graphics extension of EASI which provides a capability for performing sensitivity and trade-off analyses of the parameters of a physical protection system. This document reports on the implementation of the Version II of EASI Graphics and illustrates its application with some examples. 5 references, 15 figures, 6 tables

  2. Global Historical Climatology Network (GHCN), Version 1 (Version Superseded)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Please note, this dataset has been superseded by a newer version (see below). Users should not use this version except in rare cases (e.g., when reproducing previous...

  3. Reducing sedation for pediatric body MRI using accelerated and abbreviated imaging protocols

    International Nuclear Information System (INIS)

    Ahmad, Rizwan; Hu, Houchun Harry; Krishnamurthy, Ramkumar; Krishnamurthy, Rajesh

    2018-01-01

    Magnetic resonance imaging (MRI) is an established diagnostic imaging tool for investigating pediatric disease. MRI allows assessment of structure, function, and morphology in cardiovascular imaging, as well as tissue characterization in body imaging, without the use of ionizing radiation. For MRI in children, sedation and general anesthesia (GA) are often utilized to suppress patient motion, which can otherwise compromise image quality and diagnostic efficacy. However, evidence is emerging that use of sedation and GA in children might have long-term neurocognitive side effects, in addition to the short-term procedure-related risks. These concerns make risk-benefit assessment of sedation and GA more challenging. Therefore, reducing or eliminating the need for sedation and GA is an important goal of imaging innovation and research in pediatric MRI. In this review, the authors focus on technical and clinical approaches to reducing and eliminating the use of sedation in the pediatric population based on image acquisition acceleration and imaging protocols abbreviation. This paper covers important physiological and technical considerations for pediatric body MR imaging and discusses MRI techniques that offer the potential of recovering diagnostic-quality images from accelerated scans. In this review, the authors also introduce the concept of reporting elements for important indications for pediatric body MRI and use this as a basis for abbreviating the MR protocols. By employing appropriate accelerated and abbreviated approaches based on an understanding of the imaging needs and reporting elements for a given clinical indication, it is possible to reduce sedation and GA for pediatric chest, cardiovascular and abdominal MRI. (orig.)

  4. Abbreviations, acronyms, and initialisms frequently used by Martin Marietta Energy Systems, Inc.. Second edition

    Energy Technology Data Exchange (ETDEWEB)

    Miller, J.T.

    1994-09-01

    Guidelines are given for using abbreviations, acronyms, and initialisms (AAIs) in documents prepared by US Department of Energy facilities managed by Martin Marietta Energy Systems, Inc., in Oak Ridge, Tennessee. The more than 10,000 AAIs listed represent only a small portion of those found in recent documents prepared by contributing editors of the Information Management Services organization of Oak Ridge National Laboratory, the Oak Ridge K-25 Site, and the Oak Ridge Y-12 Plant. This document expands on AAIs listed in the Document Preparation Guide and is intended as a companion document

  5. Waiver of the judgment’s guarantees through the abbreviated procedure in Chile

    Directory of Open Access Journals (Sweden)

    Cristián Riego

    2017-10-01

    Full Text Available The paper describes the defendant rights in the new Chilean Criminal Procedure Code of 2000. Also describes how the Code allowed in a very limited expression the possibility of the waiver of the judgment guarantees through the abbreviated procedure. Finally it describes a new law that expanded substantially the use and the incentives for negotiation just in property offences. This last development has divided the Chilean criminal procedure in two subsystems, one in which the oral trial is still the center of the procedure and another in which the trial will becomes exceptional.

  6. The Unified Extensional Versioning Model

    DEFF Research Database (Denmark)

    Asklund, U.; Bendix, Lars Gotfred; Christensen, H. B.

    1999-01-01

    Versioning of components in a system is a well-researched field where various adequate techniques have already been established. In this paper, we look at how versioning can be extended to cover also the structural aspects of a system. There exist two basic techniques for versioning - intentional...

  7. ASSESSMENT OF RADIONUCLIDES DATABASES IN CAP88 MAINFRAME VERSION 1.0 AND WINDOWS-BASED VERSION 3.0

    Energy Technology Data Exchange (ETDEWEB)

    Farfan, E.; Lee, P.; Jannik, T.; Donnelly, E.

    2008-09-16

    In this study the radionuclide databases for two versions of the Clean Air Act Assessment Package-1988 (CAP88) computer model were assessed in detail. CAP88 estimates radiation dose and the risk of health effects to human populations from radionuclide emissions to air. This program is used by several Department of Energy (DOE) facilities to comply with National Emission Standards for Hazardous Air Pollutants (NESHAP) regulations. CAP88 Mainframe, referred to as Version 1.0 on the Environmental Protection Agency (EPA) website (http://www.epa.gov/radiation/assessment/CAP88/), was the very first CAP88 version released in 1988. Some DOE facilities including the Savannah River Site still employ this version (1.0) while others use the more user-friendly personal computer Windows-based Version 3.0 released in December 2007. Version 1.0 uses the program RADRISK based on International Commission on Radiological Protection (ICRP) Publication 30 as its radionuclide database. Version 3.0 uses half-life, dose and risk factor values based on Federal Guidance Report 13. Differences in these values could cause different results for the same input exposure data (same scenario), depending on which version of CAP88 is used. Consequently, the differences between the two versions are being assessed in detail at Savannah River National Laboratory. The version 1.0 and 3.0 database files contain 496 and 838 radionuclides, respectively, and though one would expect the newer version to include all the 496 radionuclides, thirty-five radionuclides are listed in version 1.0 that are not included in version 3.0. The majority of these has either extremely short or long half-lives or is no longer in production; however, some of the short-lived radionuclides might produce progeny of great interest at DOE sites. In addition, one hundred and twenty-two radionuclides were found to have different half-lives in the two versions, with 21 over 3 percent different and 12 over 10 percent different.

  8. Assessment of radionuclide databases in CAP88 mainframe version 1.0 and Windows-based version 3.0.

    Science.gov (United States)

    LaBone, Elizabeth D; Farfán, Eduardo B; Lee, Patricia L; Jannik, G Timothy; Donnelly, Elizabeth H; Foley, Trevor Q

    2009-09-01

    In this study the radionuclide databases for two versions of the Clean Air Act Assessment Package-1988 (CAP88) computer model were assessed in detail. CAP88 estimates radiation dose and the risk of health effects to human populations from radionuclide emissions to air. This program is used by several U.S. Department of Energy (DOE) facilities to comply with National Emission Standards for Hazardous Air Pollutants regulations. CAP88 Mainframe, referred to as version 1.0 on the U.S. Environmental Protection Agency Web site (http://www.epa.gov/radiation/assessment/CAP88/), was the very first CAP88 version released in 1988. Some DOE facilities including the Savannah River Site still employ this version (1.0) while others use the more user-friendly personal computer Windows-based version 3.0 released in December 2007. Version 1.0 uses the program RADRISK based on International Commission on Radiological Protection Publication 30 as its radionuclide database. Version 3.0 uses half-life, dose, and risk factor values based on Federal Guidance Report 13. Differences in these values could cause different results for the same input exposure data (same scenario), depending on which version of CAP88 is used. Consequently, the differences between the two versions are being assessed in detail at Savannah River National Laboratory. The version 1.0 and 3.0 database files contain 496 and 838 radionuclides, respectively, and though one would expect the newer version to include all the 496 radionuclides, 35 radionuclides are listed in version 1.0 that are not included in version 3.0. The majority of these has either extremely short or long half-lives or is no longer in production; however, some of the short-lived radionuclides might produce progeny of great interest at DOE sites. In addition, 122 radionuclides were found to have different half-lives in the two versions, with 21 over 3 percent different and 12 over 10 percent different.

  9. URGENCES NOUVELLE VERSION

    CERN Multimedia

    Medical Service

    2002-01-01

    The table of emergency numbers that appeared in Bulletin 10/2002 is out of date. The updated version provided by the Medical Service appears on the following page. Please disregard the previous version. URGENT NEED OF A DOCTOR GENEVAPATIENT NOT FIT TO BE MOVED: Call your family doctor Or SOS MEDECINS (24H/24H) 748 49 50 Or ASSOC. OF GENEVA DOCTORS (7H-23H) 322 20 20 PATIENT CAN BE MOVED: HOPITAL CANTONAL 24 Micheli du Crest 372 33 11 382 33 11 CHILDREN'S HOSPITAL 6 rue Willy Donzé 382 68 18 382 45 55 MATERNITY 24 Micheli du Crest 382 68 16 382 33 11 OPHTALMOLOGY 22 Alcide Jentzer 382 84 00 HOPITAL DE LA TOUR Meyrin 719 61 11 CENTRE MEDICAL DE MEYRIN Champs Fréchets 719 74 00 URGENCES : FIRE BRIGADE 118 FIRE BRIGADE CERN 767 44 44 BESOIN URGENT D'AMBULANCE (GENEVE ET VAUD) : 144 POLICE 117 ANTI-POISON CENTRE 24H/24H 01 251 51 510 EUROPEAN EMERGENCY CALL: 112 FRANCE PATIENT NOT FIT TO BE MOVED: call your family doctor PATIENT CAN BE MOVED: ST. JULIE...

  10. NODC Standard Product: World Ocean Database 1998 version 2 (5 disc set) (NODC Accession 0098461)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Since the first release of WOD98, the staff of the Ocean Climate Laboratory have performed additional quality control on the database. Version 2.0 also includes...

  11. Nuclear Criticality Safety Handbook, Version 2. English translation

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-08-01

    The Nuclear Criticality Safety Handbook, Version 2 essentially includes the description of the Supplement Report to the Nuclear Criticality Safety Handbook, released in 1995, into the first version of the Nuclear Criticality Safety Handbook, published in 1988. The following two points are new: (1) exemplifying safety margins related to modeled dissolution and extraction processes, (2) describing evaluation methods and alarm system for criticality accidents. Revision has been made based on previous studies for the chapter that treats modeling the fuel system: e.g., the fuel grain size that the system can be regarded as homogeneous, non-uniformity effect of fuel solution, an burnup credit. This revision has solved the inconsistencies found in the first version between the evaluation of errors found in JACS code system and the criticality condition data that were calculated based on the evaluation. This report is an English translation of the Nuclear Criticality Safety Handbook, Version 2, originally published in Japanese as JAERI 1340 in 1999. (author)

  12. Git version control cookbook

    CERN Document Server

    Olsson, Aske

    2014-01-01

    This practical guide contains a wide variety of recipes, taking you through all the topics you need to know about to fully utilize the most advanced features of the Git system. If you are a software developer or a build and release engineer who uses Git in your daily work and want to take your Git knowledge to the next level, then this book is for you. To understand and follow the recipes included in this book, basic knowledge of Git command-line code is mandatory.

  13. TOUGH2 User's Guide Version 2

    International Nuclear Information System (INIS)

    Pruess, K.; Oldenburg, C.M.; Moridis, G.J.

    1999-01-01

    TOUGH2 is a numerical simulator for nonisothermal flows of multicomponent, multiphase fluids in one, two, and three-dimensional porous and fractured media. The chief applications for which TOUGH2 is designed are in geothermal reservoir engineering, nuclear waste disposal, environmental assessment and remediation, and unsaturated and saturated zone hydrology. TOUGH2 was first released to the public in 1991; the 1991 code was updated in 1994 when a set of preconditioned conjugate gradient solvers was added to allow a more efficient solution of large problems. The current Version 2.0 features several new fluid property modules and offers enhanced process modeling capabilities, such as coupled reservoir-wellbore flow, precipitation and dissolution effects, and multiphase diffusion. Numerous improvements in previously released modules have been made and new user features have been added, such as enhanced linear equation solvers, and writing of graphics files. The T2VOC module for three-phase flows of water, air and a volatile organic chemical (VOC), and the T2DM module for hydrodynamic dispersion in 2-D flow systems have been integrated into the overall structure of the code and are included in the Version 2.0 package. Data inputs are upwardly compatible with the previous version. Coding changes were generally kept to a minimum, and were only made as needed to achieve the additional functionalities desired. TOUGH2 is written in standard FORTRAN77 and can be run on any platform, such as workstations, PCs, Macintosh, mainframe and supercomputers, for which appropriate FORTRAN compilers are available. This report is a self-contained guide to application of TOUGH2 to subsurface flow problems. It gives a technical description of the TOUGH2 code, including a discussion of the physical processes modeled, and the mathematical and numerical methods used. Illustrative sample problems are presented along with detailed instructions for preparing input data

  14. Abbreviated bibliography on energy development—A focus on the Rocky Mountain Region

    Science.gov (United States)

    Montag, Jessica M.; Willis, Carolyn J.; Glavin, Levi W.

    2011-01-01

    Energy development of all types continues to grow in the Rocky Mountain Region of the western United States. Federal resource managers increasingly need to balance energy demands, effects on the natural landscape and public perceptions towards these issues. To assist in efficient access to valuable information, this abbreviated bibliography provides citations to relevant information for myriad of issues for which resource managers must contend. The bibliography is organized by seven large topics with various sup-topics: broad energy topics (energy crisis, conservation, supply and demand, etc.); energy sources (fossil fuel, nuclear, renewable, etc.); natural landscape effects (climate change, ecosystem, mitigation, restoration, and reclamation, wildlife, water, etc.); human landscape effects (attitudes and perceptions, economics, community effects, health, Native Americans, etc.); research and technology; international research; and, methods and modeling. A large emphasis is placed on the natural and human landscape effects.

  15. Clinical utility of Standardised Assessment of Personality - Abbreviated Scale (SAPAS) among patients with first episode depression

    DEFF Research Database (Denmark)

    Bukh, Jens Drachmann; Bock, Camilla; Vinberg, Maj

    2010-01-01

    for comorbid personality disorder among patients suffering from depression would be of clinical use. METHOD: The present study aimed to assess the utility of the Standardised Assessment of Personality - Abbreviated Scale (SAPAS) as a screen for personality disorder in a population of patients recently......BACKGROUND: Personality disorder frequently co-occurs with depression and seems to be associated with a poorer outcome of treatment and increased risk for recurrences. However, the diagnosing of personality disorder can be lengthy and requires some training. Therefore, a brief screening interview...... diagnosed with first episode depression. A total number of 394 patients with an ICD-10 diagnosis of a single depressive episode were sampled consecutively via the Danish Psychiatric Central Research Register during a 2years inclusion period and assessed by the screening interview and, subsequently...

  16. Matching Element Symbols with State Abbreviations: A Fun Activity for Browsing the Periodic Table of Chemical Elements

    Science.gov (United States)

    Woelk, Klaus

    2009-01-01

    A classroom activity is presented in which students are challenged to find matches between the United States two-letter postal abbreviations for states and chemical element symbols. The activity aims to lessen negative apprehensions students might have when the periodic table of the elements with its more than 100 combinations of letters is first…

  17. A novel abbreviation standard for organobromine, organochlorine and organophosphorus flame retardants and some characteristics of the chemicals

    NARCIS (Netherlands)

    Bergman, A.; Rydén, A.; Law, R.J.; de Boer, J.; Covaci, A.; Alaee, M.; Birnbaum, L.; Petreas, M.; Rose, M.; Sakai, S.; Van den Eede, N.; van der Veen, I.

    2012-01-01

    Ever since the interest in organic environmental contaminants first emerged 50. years ago, there has been a need to present discussion of such chemicals and their transformation products using simple abbreviations so as to avoid the repetitive use of long chemical names. As the number of chemicals

  18. An Abbreviated Protocol for In Vitro Generation of Functional Human Embryonic Stem Cell-Derived Beta-Like Cells

    DEFF Research Database (Denmark)

    Massumi, Mohammad; Pourasgari, Farzaneh; Nalla, Amarnadh

    2016-01-01

    developed an abbreviated five-stage protocol (25-30 days) to generate human Embryonic Stem Cell-Derived Beta-like Cells (ES-DBCs). We showed that Geltrex, as an extracellular matrix, could support the generation of ES-DBCs more efficiently than that of the previously described culture systems...

  19. The Revised Junior Eysenck Personality Questionnaire (JEPQ-R): Dutch replications of the full length, short, and abbreviated forms

    NARCIS (Netherlands)

    Scholte, R.H.J.; Bruyn, E.E.J. De

    2001-01-01

    This study examines the full-length, short and abbreviated forms of the Revised Junior Eysenck Personality Questionnaire (JEPQ-R) in a Dutch sample of 215 boys and 207 girls, aged 12–14. The reliability and concurrent validity of the scales of the full-length form (JEPQ-R, 81 items), short form

  20. CLIPS 6.0 - C LANGUAGE INTEGRATED PRODUCTION SYSTEM, VERSION 6.0 (UNIX VERSION)

    Science.gov (United States)

    Donnell, B.

    1994-01-01

    command line version. For the UNIX version of CLIPS 6.0, the command line interface has been successfully implemented on a Sun4 running SunOS, a DECstation running DEC RISC ULTRIX, an SGI Indigo Elan running IRIX, a DEC Alpha AXP running OSF/1, and an IBM RS/6000 running AIX. Command line interface executables are included for Sun4 computers running SunOS 4.1.1 or later and for the DEC RISC ULTRIX platform. The makefiles may have to be modified slightly to be used on other UNIX platforms. The UNIX, Macintosh, and IBM PC versions of CLIPS 6.0 each have a platform specific interface. Source code, a makefile, and an executable for the Windows 3.1 interface version of CLIPS 6.0 are provided only on the IBM PC distribution diskettes. Source code, a makefile, and an executable for the Macintosh interface version of CLIPS 6.0 are provided only on the Macintosh distribution diskettes. Likewise, for the UNIX version of CLIPS 6.0, only source code and a makefile for an X-Windows interface are provided. The X-Windows interface requires MIT's X Window System, Version 11, Release 4 (X11R4), the Athena Widget Set, and the Xmu library. The source code for the Athena Widget Set is provided on the distribution medium. The X-Windows interface has been successfully implemented on a Sun4 running SunOS 4.1.2 with the MIT distribution of X11R4 (not OpenWindows), an SGI Indigo Elan running IRIX 4.0.5, and a DEC Alpha AXP running OSF/1 1.2. The VAX version of CLIPS 6.0 comes only with the generic command line interface. ASCII makefiles for the command line version of CLIPS are provided on all the distribution media for UNIX, VMS, and DOS. Four executables are provided with the IBM PC version: a windowed interface executable for Windows 3.1 built using Borland C++ v3.1, an editor for use with the windowed interface, a command line version of CLIPS for Windows 3.1, and a 386 command line executable for DOS built using Zortech C++ v3.1. All four executables are capable of utilizing extended memory

  1. CLIPS 6.0 - C LANGUAGE INTEGRATED PRODUCTION SYSTEM, VERSION 6.0 (MACINTOSH VERSION)

    Science.gov (United States)

    Riley, G.

    1994-01-01

    command line version. For the UNIX version of CLIPS 6.0, the command line interface has been successfully implemented on a Sun4 running SunOS, a DECstation running DEC RISC ULTRIX, an SGI Indigo Elan running IRIX, a DEC Alpha AXP running OSF/1, and an IBM RS/6000 running AIX. Command line interface executables are included for Sun4 computers running SunOS 4.1.1 or later and for the DEC RISC ULTRIX platform. The makefiles may have to be modified slightly to be used on other UNIX platforms. The UNIX, Macintosh, and IBM PC versions of CLIPS 6.0 each have a platform specific interface. Source code, a makefile, and an executable for the Windows 3.1 interface version of CLIPS 6.0 are provided only on the IBM PC distribution diskettes. Source code, a makefile, and an executable for the Macintosh interface version of CLIPS 6.0 are provided only on the Macintosh distribution diskettes. Likewise, for the UNIX version of CLIPS 6.0, only source code and a makefile for an X-Windows interface are provided. The X-Windows interface requires MIT's X Window System, Version 11, Release 4 (X11R4), the Athena Widget Set, and the Xmu library. The source code for the Athena Widget Set is provided on the distribution medium. The X-Windows interface has been successfully implemented on a Sun4 running SunOS 4.1.2 with the MIT distribution of X11R4 (not OpenWindows), an SGI Indigo Elan running IRIX 4.0.5, and a DEC Alpha AXP running OSF/1 1.2. The VAX version of CLIPS 6.0 comes only with the generic command line interface. ASCII makefiles for the command line version of CLIPS are provided on all the distribution media for UNIX, VMS, and DOS. Four executables are provided with the IBM PC version: a windowed interface executable for Windows 3.1 built using Borland C++ v3.1, an editor for use with the windowed interface, a command line version of CLIPS for Windows 3.1, and a 386 command line executable for DOS built using Zortech C++ v3.1. All four executables are capable of utilizing extended memory

  2. CLIPS 6.0 - C LANGUAGE INTEGRATED PRODUCTION SYSTEM, VERSION 6.0 (IBM PC VERSION)

    Science.gov (United States)

    Donnell, B.

    1994-01-01

    command line version. For the UNIX version of CLIPS 6.0, the command line interface has been successfully implemented on a Sun4 running SunOS, a DECstation running DEC RISC ULTRIX, an SGI Indigo Elan running IRIX, a DEC Alpha AXP running OSF/1, and an IBM RS/6000 running AIX. Command line interface executables are included for Sun4 computers running SunOS 4.1.1 or later and for the DEC RISC ULTRIX platform. The makefiles may have to be modified slightly to be used on other UNIX platforms. The UNIX, Macintosh, and IBM PC versions of CLIPS 6.0 each have a platform specific interface. Source code, a makefile, and an executable for the Windows 3.1 interface version of CLIPS 6.0 are provided only on the IBM PC distribution diskettes. Source code, a makefile, and an executable for the Macintosh interface version of CLIPS 6.0 are provided only on the Macintosh distribution diskettes. Likewise, for the UNIX version of CLIPS 6.0, only source code and a makefile for an X-Windows interface are provided. The X-Windows interface requires MIT's X Window System, Version 11, Release 4 (X11R4), the Athena Widget Set, and the Xmu library. The source code for the Athena Widget Set is provided on the distribution medium. The X-Windows interface has been successfully implemented on a Sun4 running SunOS 4.1.2 with the MIT distribution of X11R4 (not OpenWindows), an SGI Indigo Elan running IRIX 4.0.5, and a DEC Alpha AXP running OSF/1 1.2. The VAX version of CLIPS 6.0 comes only with the generic command line interface. ASCII makefiles for the command line version of CLIPS are provided on all the distribution media for UNIX, VMS, and DOS. Four executables are provided with the IBM PC version: a windowed interface executable for Windows 3.1 built using Borland C++ v3.1, an editor for use with the windowed interface, a command line version of CLIPS for Windows 3.1, and a 386 command line executable for DOS built using Zortech C++ v3.1. All four executables are capable of utilizing extended memory

  3. CLIPS - C LANGUAGE INTEGRATED PRODUCTION SYSTEM (MACINTOSH VERSION)

    Science.gov (United States)

    Culbert, C.

    1994-01-01

    version each contain a windowing variant of CLIPS as well as the standard line oriented version. The mouse/window interface version for the PC works with a Microsoft compatible mouse or without a mouse. This window version uses the proprietary CURSES library for the PC, but a working executable of the window version is provided. The window oriented version for the Macintosh includes a version which uses a full Macintosh-style interface, including an integrated editor. This version allows the user to observe the changing fact base and rule activations in separate windows while a CLIPS program is executing. The IBM PC version is available bundled with CLIPSITS, The CLIPS Intelligent Tutoring System for a special combined price (COS-10025). The goal of CLIPSITS is to provide the student with a tool to practice the syntax and concepts covered in the CLIPS User's Guide. It attempts to provide expert diagnosis and advice during problem solving which is typically not available without an instructor. CLIPSITS is divided into 10 lessons which mirror the first 10 chapters of the CLIPS User's Guide. The program was developed for the IBM PC series with a hard disk. CLIPSITS is also available separately as MSC-21679. The CLIPS program is written in C for interactive execution and has been implemented on an IBM PC computer operating under DOS, a Macintosh and DEC VAX series computers operating under VMS or ULTRIX. The line oriented version should run on any computer system which supports a full (Kernighan and Ritchie) C compiler or the ANSI standard C language. CLIPS was developed in 1986 and Version 4.2 was released in July of 1988. Version 4.3 was released in June of 1989.

  4. CLIPS - C LANGUAGE INTEGRATED PRODUCTION SYSTEM (IBM PC VERSION)

    Science.gov (United States)

    Riley, G.

    1994-01-01

    version each contain a windowing variant of CLIPS as well as the standard line oriented version. The mouse/window interface version for the PC works with a Microsoft compatible mouse or without a mouse. This window version uses the proprietary CURSES library for the PC, but a working executable of the window version is provided. The window oriented version for the Macintosh includes a version which uses a full Macintosh-style interface, including an integrated editor. This version allows the user to observe the changing fact base and rule activations in separate windows while a CLIPS program is executing. The IBM PC version is available bundled with CLIPSITS, The CLIPS Intelligent Tutoring System for a special combined price (COS-10025). The goal of CLIPSITS is to provide the student with a tool to practice the syntax and concepts covered in the CLIPS User's Guide. It attempts to provide expert diagnosis and advice during problem solving which is typically not available without an instructor. CLIPSITS is divided into 10 lessons which mirror the first 10 chapters of the CLIPS User's Guide. The program was developed for the IBM PC series with a hard disk. CLIPSITS is also available separately as MSC-21679. The CLIPS program is written in C for interactive execution and has been implemented on an IBM PC computer operating under DOS, a Macintosh and DEC VAX series computers operating under VMS or ULTRIX. The line oriented version should run on any computer system which supports a full (Kernighan and Ritchie) C compiler or the ANSI standard C language. CLIPS was developed in 1986 and Version 4.2 was released in July of 1988. Version 4.3 was released in June of 1989.

  5. Abbreviated larval development of Macrobrachium inpa Kensley and Walker, 1982 (Crustacea: Decapoda: Palaemonidae from an Amazon Basin forest stream, Brazil, reared in the laboratory

    Directory of Open Access Journals (Sweden)

    Célio Magalhães

    Full Text Available Abstract This paper brings the description and illustrations of the abbreviated larval development of the Amazonian freshwater palaemonid shrimp, Macrobrachium inpa Kensley and Walker, 1982. The study was based on ovigerous females (mean total body length of 27.0 ± 1.64 mm collected in a small forest stream in the Reserva Florestal Ducke, near Manaus, Brazil, of which four released their larvae in the laboratory. The females carried 8 to 19 eliptical (2.39 ± 0.10 X 1.67 ± 0.08 mm, yolk-rich eggs. The larval period consists of three benthic, lecithotrophic larval stages, and lasts 10-11 days. The newly-hatched larvae bear very advanced morphological features such as antenna with several marginal plumose seta on scaphocerite and long, multi-articulated flagellum; fully developed, functional uniramous pereiopods 3-5 (walking legs and biramous pleopods. The morphology of the carapace, all appendages of the cephalothorax and pleon, and the tail fan are described in detail and illustrated. The larval form was considered to be a decapodid because of the benthic behavior and due to the fact that functional walking legs and pleopods are the main structures for displacement and propulsion. The larval development of M. inpa is compared with those of the so-called "continental" group of the caridean shrimps from the Amazon River basin.

  6. GNU Octave Manual Version 3

    DEFF Research Database (Denmark)

    W. Eaton, John; Bateman, David; Hauberg, Søren

    This manual is the definitive guide to GNU Octave, an interactive environment for numerical computation. The manual covers the new version 3 of GNU Octave.......This manual is the definitive guide to GNU Octave, an interactive environment for numerical computation. The manual covers the new version 3 of GNU Octave....

  7. In-vessel source term analysis code TRACER version 2.3. User's manual

    International Nuclear Information System (INIS)

    Toyohara, Daisuke; Ohno, Shuji; Hamada, Hirotsugu; Miyahara, Shinya

    2005-01-01

    A computer code TRACER (Transport Phenomena of Radionuclides for Accident Consequence Evaluation of Reactor) version 2.3 has been developed to evaluate species and quantities of fission products (FPs) released into cover gas during a fuel pin failure accident in an LMFBR. The TRACER version 2.3 includes new or modified models shown below. a) Both model: a new model for FPs release from fuel. b) Modified model for FPs transfer from fuel to bubbles or sodium coolant. c) Modified model for bubbles dynamics in coolant. Computational models, input data and output data of the TRACER version 2.3 are described in this user's manual. (author)

  8. News/Press Releases

    Data.gov (United States)

    Office of Personnel Management — A press release, news release, media release, press statement is written communication directed at members of the news media for the purpose of announcing programs...

  9. Herwig++ 2.6 Release Note

    CERN Document Server

    Arnold, K; Gieseke, S; Grellscheid, D; Hamilton, K; Papaefstathiou, A; Platzer, S; Richardson, P; Rohr, C; Schofield, A; Siodmok, A; Stoll, M; Winn, D

    2012-01-01

    A new release of the Monte Carlo event generator Herwig++ (version 2.6) is now available. This version comes with a number of improvements including: a new structure for the implementation of next-to-leading order matrix elements; an improved treatment of wide-angle gluon radiation; new hard-coded next-to-leading order matrix elements for deep inelastic scattering and weak vector boson fusion; additional models of physics beyond the Standard Model, including the production of colour sextet particles; a statistical colour reconnection model; automated energy scaling of underlying-event tunes.

  10. EPICS application source/release control

    International Nuclear Information System (INIS)

    Zieman, B.; Anderson, J.; Kraimer, M.

    1995-01-01

    This manual describes a set of Application Source/Release Control tools (appSR) that can be used to develop software for EPICS based control systems. The Application Source/Release Control System (appSR) has been unbundled from base EPICS and is now available as an EPICS extension. Due to this unbundling, two new directories must be added to a user's path (see section ''Environment'' on page 3 for more information) and a new command getapp must be issued after the getrel command to get a specific version of appSR (see section ''Creating The Initial Application System Area'' on page 7 for more information). It is now required that GNU make version 3.71 or later be used for makes instead of SUN make. Users should now type gmake instead of make

  11. A Statistical Review of CALIOP Version 3 and Version 4 Cloud Aerosol Discrimination

    Science.gov (United States)

    Zeng, S.

    2016-12-01

    The Cloud-Aerosol Lidar with Orthogonal Polarization (CALIOP) on board the Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observations (CALIPSO) mission has now delivered a 10-year record of high-resolution profiles of backscatter at 532 nm and 1064 nm and linear depolarization at 532 nm. These long-term active sensor measurements at global scale have led to significant advances in our understanding of the vertical distribution of clouds and aerosols in the atmosphere. In the fall of 2016, the CALIPSO science team is scheduled to release a new version of their cloud and aerosol data products. The new cloud and aerosol discrimination products are derived using updated probability density functions that account for numerous improvements to the CALIOP calibration and the use of the GMAO MERRA-2 meteorological data. Moreover, the CAD algorithm is now applied to all layers detected, thus greatly improving the identification of such features as overshooting convective clouds, stratospheric aerosol layers, and high intensity dust storms. Post-processing modules are added to the standard CAD algorithm to ensure proper identification of (for example) the tenuous edges of cirrus clouds and water clouds lying beneath optically dense smoke layers. This work presents statistical comparisons between the CALIOP version 3 and version 4 data sets. Areas of improvement are highlighted, sources of continuing uncertainty are discussed and a list of best practices for data users is provided.

  12. Discriminating Ability of Abbreviated Impactor Measurement Approach (AIM) to Detect Changes in Mass Median Aerodynamic Diameter (MMAD) of an Albuterol/Salbutamol pMDI Aerosol.

    Science.gov (United States)

    David Christopher, J; Patel, Rajni B; Mitchell, Jolyon P; Tougas, Terrence P; Goodey, Adrian P; Quiroz, Jorge; Andersson, Patrik U; Lyapustina, Svetlana

    2017-11-01

    This article reports on results from a two-lab, multiple impactor experiment evaluating the abbreviated impactor measurement (AIM) concept, conducted by the Cascade Impaction Working Group of the International Pharmaceutical Aerosol Consortium on Regulation and Science (IPAC-RS). The goal of this experiment was to expand understanding of the performance of an AIM-type apparatus based on the Andersen eight-stage non-viable cascade impactor (ACI) for the assessment of inhalation aerosols and sprays, compared with the full-resolution version of that impactor described in the pharmacopeial compendia. The experiment was conducted at two centers with a representative commercially available pressurized metered dose inhaler (pMDI) containing albuterol (salbutamol) as active pharmaceutical ingredient (API). Metrics of interest were total mass (TM) emitted from the inhaler, impactor-sized mass (ISM), as well as the ratio of large particle mass (LPM) to small particle mass (SPM). ISM and the LPM/SPM ratio together comprise the efficient data analysis (EDA) metrics. The results of the comparison demonstrated that in this study, the AIM approach had adequate discrimination to detect changes in the mass median aerodynamic diameter (MMAD) of the ACI-sampled aerodynamic particle size distribution (APSD), and therefore could be employed for routine product quality control (QC). As with any test method considered for inclusion in a regulatory filing, the transition from an ACI (used in development) to an appropriate AIM/EDA methodology (used in QC) should be evaluated and supported by data on a product-by-product basis.

  13. An abbreviated protocol for multilineage neural differentiation of murine embryonic stem cells and its perturbation by methyl mercury.

    Science.gov (United States)

    Theunissen, P T; Schulpen, S H W; van Dartel, D A M; Hermsen, S A B; van Schooten, F J; Piersma, A H

    2010-07-01

    Alternative assays are highly desirable to reduce the extensive experimental animal use in developmental toxicity testing. In the present study, we developed an improved test system for assessing neurodevelopmental toxicity using differentiating embryonic stem cells. We advanced previously established methods by merging, modifying and abbreviating the original 20-day protocol into a more efficient 13-day neural differentiation protocol. Using morphological observation, immunocytochemistry, gene expression and flow cytometry, it was shown predominantly multiple lineages of neuroectodermal cells were formed in our protocol and to a lower extent, endodermal and mesodermal differentiated cell types. This abbreviated protocol should lead to an advanced screening method using morphology in combination with selected differentiation markers aimed at predicting neurodevelopmental toxicity. Finally, the assay was shown to express differential sensitivity to a model developmental neurotoxicant, methyl mercury.

  14. Adaptation and validation of the Spanish version of the ORTO-15 questionnaire for the diagnosis of orthorexia nervosa.

    Science.gov (United States)

    Parra-Fernandez, María Laura; Rodríguez-Cano, Teresa; Onieva-Zafra, María Dolores; Perez-Haro, Maria José; Casero-Alonso, Víctor; Muñoz Camargo, Juan Carlos; Notario-Pacheco, Blanca

    2018-01-01

    The aim of this study was the validation and analysis of the psychometric properties of a Spanish translation of the ORTO-15 questionnaire; an instrument designed to assess orthorexia nervosa behavior. Four hundred and fifty-four Spanish university students (65% women) aged between 18 and 51 years (M = 21.48 ± 0.31) completed the Spanish version of ORTO-15 and the Eating Disorders Inventory-2 (EDI-2). The Principal Component Analysis suggested a three-factor structure for the abbreviated 11-item version of the instrument. The internal consistency of the measurement was adequate (Cronbach's alpha = 0.80). The proposed test demonstrated a good predictive capacity at a threshold value of orthorexia nervosa. Its use is expected to greatly contribute to a better understanding of the impact of this disorder in Spain.

  15. Relationship between acceptable noise level and the abbreviated profile of hearing aid benefit.

    Science.gov (United States)

    Freyaldenhoven, Melinda C; Nabelek, Anna K; Tampas, Joanna W

    2008-02-01

    This study investigated the relationship between acceptable noise levels (ANLs) and the Abbreviated Profile of Hearing Aid Benefit (APHAB; R. M. Cox & G. C. Alexander, 1995). This study further examined the APHAB's ability to predict hearing aid use. ANL and APHAB data were collected for 191 listeners with impaired hearing, separated into 3 groups based on hearing aid use: full-time, part-time, or nonuse. Results demonstrated ANLs were not correlated with APHAB scores. Results further demonstrated 2 of the 4 APHAB subscales (Ease of Communication [EC] and Background Noise [BN]) predicted hearing aid success with 60% accuracy, which is 25% poorer than that observed using the ANL alone. When combining the ANL with the EC and BN subscales, accuracy of the prediction increased to 91%. Lastly, 3 of the 4 APHAB subscales (EC, BN, and Reverberation) enhanced the present prediction of hearing aid use for patients with mid-range ANLs. These results indicate that ANLs and APHAB scores provide unique information regarding hearing aid use. These results further indicate that the prediction can be enhanced by administering both the ANL and the EC and BN APHAB subscales. Lastly, some of the ambiguity of the prediction of hearing aid use for listeners with mid-range ANLs may be eliminated.

  16. Rest improves performance, nature improves happiness: Assessment of break periods on the abbreviated vigilance task.

    Science.gov (United States)

    Finkbeiner, Kristin M; Russell, Paul N; Helton, William S

    2016-05-01

    The abbreviated vigilance task can quickly generate vigilance decrements, which has been argued is due to depletion of cognitive resources needed to sustain performance. Researchers suggest inclusion of rest breaks within vigilance tasks improve overall performance (Helton & Russell, 2015; Ross, Russell, & Helton, 2014), while different types of breaks demonstrate different effects. Some literature suggests exposure to natural movements/stimuli helps restore attention (Herzog, Black, Fountaine, & Knotts, 1997; Kaplan, 1995). Participants were randomly assigned to one experimental condition: dog video breaks, robot video breaks, countdown breaks or continuous vigilance. We assessed task performance and subjective reports of stress/workload. The continuous group displayed worst performance, suggesting breaks help restore attention. The dog videos did not affect performance, however, decreased reports of distress. These results support the importance of rest breaks and acknowledge the benefit of natural stimuli for promoting wellbeing/stress relief, overall suggesting performance and wellbeing may be independent, which warrants future studies. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. GENIE Production Release 2.10.0

    Energy Technology Data Exchange (ETDEWEB)

    Alam, M. [Aligarh Muslim Univ., Aligarh (India). Dept. of Physics; Andreopoulos, C. [Univ. of Liverpool (United Kingdom). Dept. of Physics; Science and Technology Facilities Council (STFC), Oxford (United Kingdom). Rutherford Appleton Lab. (RAL); Athar, M. [Aligarh Muslim Univ., Aligarh (India). Dept. of Physics; Bodek, A. [Univ. of Rochester, NY (United States). Dept. of Physics; Christy, E. [Hampton Univ., Hampton, VA (United States). Dept. of Physics; Coopersmith, B. [Univ. of Rochester, NY (United States). Dept. of Physics; Dennis, S. [Univ. of Warwick, Coventry (United Kingdom). Dept .of Physics; Dytman, S. [Univ. of Pittsburgh, PA (United States). Dept. of Physics and Astronomy; Gallagher, H. [Tufts Univ., Medford, MA (United States). Dept. of Physics and Astronomy; Geary, N. [Univ. of Pittsburgh, PA (United States). Dept. of Physics and Astronomy; Golan, T. [Univ. of Rochester, NY (United States). Dept. of Physics; Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States); Hatcher, R. [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States); Hoshina, K. [Univ. of Wisconsin, Madison, WI (United States). Dept. of Physics. Wisconsin IceCube Particle Astrophysics Center; Liu, J. [College of William and Mary, Williamsburg, VA (United States). Dept. of Physics; Mahn, K. [Michigan State Univ., East Lansing, MI (United States). Dept. of Physics and Astronomy; Marshall, C. [Univ. of Rochester, NY (United States). Dept. of Physics; Morrison, J. [Michigan State Univ., East Lansing, MI (United States). Dept. of Physics and Astronomy; Nirkko, M. [Univ. of Bern (Switzerland). Albert Einstein Center for Fundamental Physics. Lab. for High Energy Physics (LHEP); Nowak, J. [Lancaster Univ. (United Kingdom). Dept. of Physics; Perdue, G. N. [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States); Yarba, J. [Fermi National Accelerator Lab. (FNAL), Batavia, IL (United States)

    2015-12-25

    GENIE is a neutrino Monte Carlo event generator that simulates the primary interaction of a neutrino with a nuclear target, along with the subsequent propagation of the reaction products through the nuclear medium. It additionally contains libraries for fully-featured detector geometries and for managing various types of neutrino flux. This note details recent updates to GENIE, in particular, changes introduced into the newest production release, version 2.10.0.

  18. GENIE Production Release 2.10.0

    International Nuclear Information System (INIS)

    Alam, M.; Athar, M.; Hatcher, R.; Hoshina, K.; Nowak, J.; Yarba, J.

    2015-01-01

    GENIE is a neutrino Monte Carlo event generator that simulates the primary interaction of a neutrino with a nuclear target, along with the subsequent propagation of the reaction products through the nuclear medium. It additionally contains libraries for fully-featured detector geometries and for managing various types of neutrino flux. This note details recent updates to GENIE, in particular, changes introduced into the newest production release, version 2.10.0.

  19. Finding abbreviations in biomedical literature: three BioC-compatible modules and four BioC-formatted corpora.

    Science.gov (United States)

    Islamaj Doğan, Rezarta; Comeau, Donald C; Yeganova, Lana; Wilbur, W John

    2014-01-01

    BioC is a recently created XML format to share text data and annotations, and an accompanying input/output library to promote interoperability of data and tools for natural language processing of biomedical text. This article reports the use of BioC to address a common challenge in processing biomedical text information-that of frequent entity name abbreviation. We selected three different abbreviation definition identification modules, and used the publicly available BioC code to convert these independent modules into BioC-compatible components that interact seamlessly with BioC-formatted data, and other BioC-compatible modules. In addition, we consider four manually annotated corpora of abbreviations in biomedical text: the Ab3P corpus of 1250 PubMed abstracts, the BIOADI corpus of 1201 PubMed abstracts, the old MEDSTRACT corpus of 199 PubMed(®) citations and the Schwartz and Hearst corpus of 1000 PubMed abstracts. Annotations in these corpora have been re-evaluated by four annotators and their consistency and quality levels have been improved. We converted them to BioC-format and described the representation of the annotations. These corpora are used to measure the three abbreviation-finding algorithms and the results are given. The BioC-compatible modules, when compared with their original form, have no difference in their efficiency, running time or any other comparable aspects. They can be conveniently used as a common pre-processing step for larger multi-layered text-mining endeavors. Database URL: Code and data are available for download at the BioC site: http://bioc.sourceforge.net. Published by Oxford University Press 2014. This work is written by US Government employees and is in the public domain in the US.

  20. Comparing Danish and Swedish versions of PISA scientific literacy

    DEFF Research Database (Denmark)

    Serder, Malmø University, Margareta; Sørensen, Helene

    This paper presents a comparison between the Swedish, Danish, English, and French versions of three scientific literacy test-units from the released PISA items 2006. More specifically it compares how different words and concepts have been translated in the Swedish and Danish tests, compared to th...... with these three PISA units. In the paper we claim that in spite of detailed and strongly controlled methods for achieving translations of high standard used by the PISA, important and perhaps even decisive, differences between the four versions exist.......This paper presents a comparison between the Swedish, Danish, English, and French versions of three scientific literacy test-units from the released PISA items 2006. More specifically it compares how different words and concepts have been translated in the Swedish and Danish tests, compared...... to the English and French original versions. Differences that occur as a result of the translation process concerning words’ meaning are demonstrated. The possible consequences of such differences are exemplified by an excerpt from a situation in which Swedish 15-year-old students collaboratively worked...

  1. Rock Visualization System. Technical description (RVS version 3.8)

    Energy Technology Data Exchange (ETDEWEB)

    Curtis, P.; Elfstroem, M.; Markstroem, I. [Golder Associates AB (Sweden)

    2007-06-15

    The Rock Visualization System (RVS) has been developed by SKB for use in visualizing geological and engineering data in 3D. The purpose of this report is to provide a technical description of RVS aimed at potential program users and interested parties as well as fulfilling the function of a more general RVS reference that can be cited when writing other technical reports. The report describes RVS version 4.0. Updated versions of this report or addenda will be made available following further development of RVS and the release of subsequent versions of the program. The report covers the following main items: Technical description of the program with illustrations and examples. Limitations of the program and of functionality. For most RVS functions step-by-step tutorials are available describing how a particular function can be used to carry out a specific task. A complete set of updated tutorials is issued with each new version release of the RVS program. However, the tutorials do not cover all the possible uses of all the individual functions but rather give an overall view of their functionality. A detailed description of every RVS function and how it can be used is included in the RVS online Help system.

  2. Rock Visualization System. Technical description (RVS version 3.8)

    Energy Technology Data Exchange (ETDEWEB)

    Curtis, P.; Elfstroem, M.; Markstroem, I. [FB Engineering, Goeteborg (Sweden)

    2005-04-01

    The Rock Visualization System (RVS) has been developed by SKB for use in visualizing geological and engineering data in 3D. The purpose of this report is to provide a technical description of RVS aimed at potential program users and interested parties as well as fulfilling the function of a more general RVS reference that can be cited when writing other technical reports. The report describes RVS version 3.8. Updated versions of this report or addenda will be made available following further development of RVS and the release of subsequent versions of the program. The report covers the following main items: Technical description of the program with illustrations and examples. Limitations of the program and of functionality. For most RVS functions step-by-step tutorials are available describing how a particular function can be used to carryout a specific task. A complete set of updated tutorials is issued with each new version release of the RVS program. However, the tutorials do not cover all the possible uses of all the individual functions but rather give an overall view of their functionality. A detailed description of every RVS function and how it can be used is included in the RVS online Help system.

  3. Development of abbreviated measures to assess patient trust in a physician, a health insurer, and the medical profession

    Directory of Open Access Journals (Sweden)

    Trachtenberg Felicia

    2005-10-01

    Full Text Available Abstract Background Despite the recent proliferation in research on patient trust, it is seldom a primary outcome, and is often a peripheral area of interest. The length of our original scales to measure trust may limit their use because of the practical needs to minimize both respondent burden and research cost. The objective of this study was to develop three abbreviated scales to measure trust in: (1 a physician, (2 a health insurer, and (3 the medical profession. Methods Data from two samples were used. The first was a telephone survey of English-speaking adults in the United States (N = 1117 and the second was a telephone survey of English-speaking adults residing in North Carolina who were members of a health maintenance organization (N = 1024. Data were analyzed to examine data completeness, scaling assumptions, internal consistency properties, and factor structure. Results Abbreviated measures (5-items were developed for each of the three scales. Cronbach's alpha was 0.87 for trust in a physician (test-retest reliability = 0.71, 0.84 for trust in a health insurer (test-retest reliability = 0.73, and 0.77 for trust in the medical profession. Conclusion Assessment of data completeness, scale score dispersion characteristics, reliability and validity test results all provide evidence for the soundness of the abbreviated 5-item scales.

  4. National Radiobiology Archives Distributed Access User`s Manual, Version 1.1. Revision 1

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S.K.; Prather, J.C.; Ligotke, E.K.; Watson, C.R.

    1992-06-01

    This supplement to the NRA Distributed Access User`s manual (PNL-7877), November 1991, describes installation and use of Version 1.1 of the software package; this is not a replacement of the previous manual. Version 1.1 of the NRA Distributed Access Package is a maintenance release. It eliminates several bugs, and includes a few new features which are described in this manual. Although the appearance of some menu screens has changed, we are confident that the Version 1.0 User`s Manual will provide an adequate introduction to the system. Users who are unfamiliar with Version 1.0 may wish to experiment with that version before moving on to Version 1.1.

  5. National Radiobiology Archives Distributed Access User's Manual, Version 1. 1

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S.K.; Prather, J.C.; Ligotke, E.K.; Watson, C.R.

    1992-06-01

    This supplement to the NRA Distributed Access User's manual (PNL-7877), November 1991, describes installation and use of Version 1.1 of the software package; this is not a replacement of the previous manual. Version 1.1 of the NRA Distributed Access Package is a maintenance release. It eliminates several bugs, and includes a few new features which are described in this manual. Although the appearance of some menu screens has changed, we are confident that the Version 1.0 User's Manual will provide an adequate introduction to the system. Users who are unfamiliar with Version 1.0 may wish to experiment with that version before moving on to Version 1.1.

  6. Herwig 7.1 Release Note arXiv

    CERN Document Server

    Bellm, Johannes; Grellscheid, David; Kirchgaeßer, Patrick; Loshaj, Frashër; Nail, Graeme; Papaefstathiou, Andreas; Plätzer, Simon; Podskubka, Radek; Rauch, Michael; Reuschle, Christian; Richardson, Peter; Schichtel, Peter; Seymour, Michael H.; Siódmok, Andrzej; Webster, Stephen

    A new release of the Monte Carlo event generator Herwig (version 7.1) is now available. This version introduces a number of improvements, notably: multi-jet merging with the dipole shower at LO and NLO QCD; a new model for soft interactions and diffraction; improvements to mass effects and top decays in the dipole shower, as well as a new tune of the hadronisation parameters.

  7. Release of RANKERN 16A

    Directory of Open Access Journals (Sweden)

    Bird Adam

    2017-01-01

    Full Text Available RANKERN 16 is the latest version of the point-kernel gamma radiation transport Monte Carlo code from AMEC Foster Wheeler’s ANSWERS Software Service. RANKERN is well established in the UK shielding community for radiation shielding and dosimetry assessments. Many important developments have been made available to users in this latest release of RANKERN. The existing general 3D geometry capability has been extended to include import of CAD files in the IGES format providing efficient full CAD modelling capability without geometric approximation. Import of tetrahedral mesh and polygon surface formats has also been provided. An efficient voxel geometry type has been added suitable for representing CT data. There have been numerous input syntax enhancements and an extended actinide gamma source library. This paper describes some of the new features and compares the performance of the new geometry capabilities.

  8. GENII Version 2 Software Design Document

    Energy Technology Data Exchange (ETDEWEB)

    Napier, Bruce A.; Strenge, Dennis L.; Ramsdell, James V.; Eslinger, Paul W.; Fosmire, Christian J.

    2004-03-08

    This document describes the architectural design for the GENII-V2 software package. This document defines details of the overall structure of the software, the major software components, their data file interfaces, and specific mathematical models to be used. The design represents a translation of the requirements into a description of the software structure, software components, interfaces, and necessary data. The design focuses on the major components and data communication links that are key to the implementation of the software within the operating framework. The purpose of the GENII-V2 software package is to provide the capability to perform dose and risk assessments of environmental releases of radionuclides. The software also has the capability of calculating environmental accumulation and radiation doses from surface water, groundwater, and soil (buried waste) media when an input concentration of radionuclide in these media is provided. This report represents a detailed description of the capabilities of the software product with exact specifications of mathematical models that form the basis for the software implementation and testing efforts. This report also presents a detailed description of the overall structure of the software package, details of main components (implemented in the current phase of work), details of data communication files, and content of basic output reports. The GENII system includes the capabilities for calculating radiation doses following chronic and acute releases. Radionuclide transport via air, water, or biological activity may be considered. Air transport options include both puff and plume models, each allow use of an effective stack height or calculation of plume rise from buoyant or momentum effects (or both). Building wake effects can be included in acute atmospheric release scenarios. The code provides risk estimates for health effects to individuals or populations; these can be obtained using the code by applying

  9. ELIPGRID-PC: Upgraded version

    International Nuclear Information System (INIS)

    Davidson, J.R.

    1995-12-01

    Evaluating the need for and the effectiveness of remedial cleanup at waste sites often includes finding average contaminant concentrations and identifying pockets of contamination called hot spots. The standard tool for calculating the probability of detecting pockets of contamination called hot spots has been the ELIPGRID code of singer and Wickman. The ELIPGRID-PC program has recently made this algorithm available for an IBM reg-sign personal computer (PC) or compatible. A new version of ELIPGRID-PC, incorporating Monte Carlo test results and simple graphics, is herein described. Various examples of how to use the program for both single and multiple hot spot cases are given. The code for an American National Standards Institute C version of the ELIPGRID algorithm is provided, and limitations and further work are noted. This version of ELIPGRID-PC reliably meets the goal of moving Singer's ELIPGRID algorithm to the PC

  10. Toxics Release Inventory (TRI)

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Toxics Release Inventory (TRI) is a dataset compiled by the U.S. Environmental Protection Agency (EPA). It contains information on the release and waste...

  11. Abbreviated MRI protocols for detecting breast cancer in women with dense breasts

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Shung Qing; Huang, Min; Shen, Yu Ying; Liu, Chen Lu; Xu, Chuan Xiao [The Affiliated Suzhou Hospital, Nanjing Medical University, Suzhou (China)

    2017-06-15

    To evaluate the validity of two abbreviated protocols (AP) of MRI in breast cancer screening of dense breast tissue. This was a retrospective study in 356 participants with dense breast tissue and negative mammography results. The study was approved by the Nanjing Medical University Ethics Committee. Patients were imaged with a full diagnostic protocol (FDP) of MRI. Two APs (AP-1 consisting of the first post-contrast subtracted [FAST] and maximum-intensity projection [MIP] images, and AP-2 consisting of AP-1 combined with diffusion-weighted imaging [DWI]) and FDP images were analyzed separately, and the sensitivities and specificities of breast cancer detection were calculated. Of the 356 women, 67 lesions were detected in 67 women (18.8%) by standard MR protocol, and histological examination revealed 14 malignant lesions and 53 benign lesions. The average interpretation time of AP-1 and AP-2 were 37 seconds and 54 seconds, respectively, while the average interpretation time of the FDP was 3 minutes and 25 seconds. The sensitivities of the AP-1, AP-2, and FDP were 92.9, 100, and 100%, respectively, and the specificities of the three MR protocols were 86.5, 95.0, and 96.8%, respectively. There was no significant difference among the three MR protocols in the diagnosis of breast cancer (p > 0.05). However, the specificity of AP-1 was significantly lower than that of AP-2 (p = 0.031) and FDP (p = 0.035), while there was no difference between AP-2 and FDP (p > 0.05). The AP may be efficient in the breast cancer screening of dense breast tissue. FAST and MIP images combined with DWI of MRI are helpful to improve the specificity of breast cancer detection.

  12. Norfolk and southern eastville 10 x 20 NTMS areas Virginia and North Carolina. Data report (abbreviated)

    International Nuclear Information System (INIS)

    Cook, J.R.

    1981-06-01

    This abbreviated data report presents results of ground water and stream sediment reconnaissance in the National Topographic Map Series (NTMS) Norfolk 1 0 x 2 0 quadrangle and the southern one-half of the Eastville 1 0 x 2 0 quadrangle. Surface sediment samples were collected at 840 sites. Ground water samples were collected at 1008 sites. Neutron activation analysis (NAA) results are given for uranium and 16 other elements in sediments, and for uranium and 8 other elements in ground water. Field measurements and observations are reported for each site. Analytical data and field measurements are presented in tables and maps. Data from ground water sites include: (1) water chemistry measurements (pH, conductivity, and alkalinity); (2) physical measurements, where applicable (water temperature, well description, etc.); and (3) elemental analyses (U, Al, Br, Cl, Dy, F, Mn, Na, and V). Data from sediment sites include: (1) stream water chemistry measurements (pH, conductivity, and alkalinity); and (2) elemental analyses for sediment samples (U, Th, Hf, Al, Ce, Dy, Eu, Fe, La, Lu, Mn, Sc, Sm, Na, Ti, V, and Yb). Sample site descriptors (stream characteristics, vegetation, etc.) are also tabulated. Areal distribution maps, histograms, and cumulative frequency plots for most elements and for U/Th and U/Hf ratios are included. Uranium concentrations in the sediments that were above detection limits ranged from 0.60 to 40.2 ppM. The mean of the logarithms of the uranium concentrations was 0.61. A large area of high uranium concentrations occurs in the southwestern part of the Norfolk quadrangle. High concentrations of thorium and hafnium in the same area indicate that the uranium is associated with the resistate minerals monazite and zircon

  13. Abbreviated MRI protocols for detecting breast cancer in women with dense breasts

    International Nuclear Information System (INIS)

    Chen, Shung Qing; Huang, Min; Shen, Yu Ying; Liu, Chen Lu; Xu, Chuan Xiao

    2017-01-01

    To evaluate the validity of two abbreviated protocols (AP) of MRI in breast cancer screening of dense breast tissue. This was a retrospective study in 356 participants with dense breast tissue and negative mammography results. The study was approved by the Nanjing Medical University Ethics Committee. Patients were imaged with a full diagnostic protocol (FDP) of MRI. Two APs (AP-1 consisting of the first post-contrast subtracted [FAST] and maximum-intensity projection [MIP] images, and AP-2 consisting of AP-1 combined with diffusion-weighted imaging [DWI]) and FDP images were analyzed separately, and the sensitivities and specificities of breast cancer detection were calculated. Of the 356 women, 67 lesions were detected in 67 women (18.8%) by standard MR protocol, and histological examination revealed 14 malignant lesions and 53 benign lesions. The average interpretation time of AP-1 and AP-2 were 37 seconds and 54 seconds, respectively, while the average interpretation time of the FDP was 3 minutes and 25 seconds. The sensitivities of the AP-1, AP-2, and FDP were 92.9, 100, and 100%, respectively, and the specificities of the three MR protocols were 86.5, 95.0, and 96.8%, respectively. There was no significant difference among the three MR protocols in the diagnosis of breast cancer (p > 0.05). However, the specificity of AP-1 was significantly lower than that of AP-2 (p = 0.031) and FDP (p = 0.035), while there was no difference between AP-2 and FDP (p > 0.05). The AP may be efficient in the breast cancer screening of dense breast tissue. FAST and MIP images combined with DWI of MRI are helpful to improve the specificity of breast cancer detection

  14. Baltimore 10 x 20 NTMS area, Maryland, Pennsylvania, Virginia, and West Virginia: data report (abbreviated)

    International Nuclear Information System (INIS)

    Fay, W.M.

    1981-07-01

    This abbreviated data report presents results of ground water, surface water, and stream sediment reconnaissance in the National Topographic Map Series (NTMS) Baltimore 1 0 x 2 0 NTMS quadrangle. Surface sediment samples were collected at 993 sites. Ground water samples were collected at 777 sites. Neutron activation analysis (NAA) results are given for uranium and 16 other elements in sediments, for uranium and 8 other elements in ground water, and for uranium and 9 other elements in surface water. Field measurements and observations are reported for each site. Analytical data and field measurements are presented. Data from ground water sites include: (1) water chemistry measurements (pH, conductivity, and alkalinity), (2) physical measurements, where applicable (water temperature, well description, etc.), and (3) elemental analyses (U, Al, Br, Cl, Dy, F, Mn, Na, and V). Data from sediment sites include: (1) stream water chemistry measurements (pH, conductivity and alkalinity), and (2) elemental analyses for sediment samples (U, Th, Hf, Al, Ce, Dy, Eu, Fe, La, Lu, Mn, Sc, Sm, Na, Ti, V, and Yb). Sample site descriptors (stream characteristics, vegetation, etc.) are also tabulated. Areal distribution maps, histograms, and cumulative frequency plots for most elements and for U/Th and U/Hf ratios are included on the microfiche. Key data from stream water sites include: (1) water quality measurements (pH, conductivity and alkalinity) and (2) elemental analyses (U, Al, Br, Cl, Dy, F, Mg, Mn, Na, and V). Uranium concentrations in the sediments that were above detection limits ranged from up to 38.7 ppM. The samples with high uranium values also have high thorium values, suggesting that most of the uranium is held within resistate minerals. The north-northeast trend of the geologic units is clearly reflected in the data

  15. Status and Plans for Finalization of SRT's Contribution to AIRS Version-7 and Version-7 AO

    Science.gov (United States)

    Susskind, Joel; Blaisdell, John; Iredell, Lena; Kouvaris, Louis C.

    2017-01-01

    Version-6.46 temperature profiles, water vapor profiles, and especially total O3, are very much compared to Version-6. With minor tweaking, Version-6.46 is a good candidate for use in Version-7. JPL Version-6.4.6 and Version-6.4.6 AO monthly mean products agree extremely well with each other. Version-6.4.6 AO is accurate enough that there is not necessarily a need to process both Version-7 and Version-7 AO data sets. Single day comparisons show Version-6.46 CrIS/ATMS and Version-6.46 AIRS/AMSU products agree extremely well with each other. We need to demonstrate agreement of Version-6.46 CrIS/ATMS and Version-6.46 AO products on a monthly mean basis for different months and years. CrIS/ATMS and AIRS/AMSU monthly mean comparisons showed excellent agreement using a previous version.

  16. An Abbreviated Protocol for High-risk Screening Breast Magnetic Resonance Imaging: Impact on Performance Metrics and BI-RADS Assessment.

    Science.gov (United States)

    Panigrahi, Babita; Mullen, Lisa; Falomo, Eniola; Panigrahi, Benita; Harvey, Susan

    2017-09-01

    Annual breast magnetic resonance imaging (MRI) is recommended to screen high-risk populations for breast cancer, although costs are significant. This study assesses the performance of an abbreviated MRI protocol as a resource-efficient approach for screening patients at high-risk of breast cancer, and assesses whether the abbreviated protocol alters the assigned Breast Imaging Reporting and Data System (BI-RADS) category. This is a prospective paired cohort study performed in an academic ambulatory setting. MRI images of women at high risk of breast cancer were reviewed using an abbreviated MRI protocol, followed by an immediate review of additional sequences included in a full diagnostic protocol. BI-RADS assessments, including all changes and interpretation times, were recorded for both the abbreviated and full protocol reviews. Cancer detection rate, positive predictive value 3 (PPV3), sensitivity, and specificity were calculated. A total of 1052 MRI cases were reviewed. The cancer detection rate was 13.3 per 1000 with a PPV3 of 30.4% based on the full protocol. Review of sequences included in the full protocol resulted in a change in the final BI-RADS assessments in 3.4% of the cases, the majority of which did not change clinical management with respect to biopsy. The sensitivity and specificity of the abbreviated and full protocols were not significantly different. This pilot study of an abbreviated MRI protocol demonstrates effective performance in cancer detection. BI-RADS assessments were rarely altered with the additional information afforded by the full protocol. The abbreviated protocol holds promise for resource-efficient breast cancer screening in high-risk women. Copyright © 2017 The Association of University Radiologists. Published by Elsevier Inc. All rights reserved.

  17. The pain self-efficacy questionnaire: validation of an abbreviated two-item questionnaire.

    Science.gov (United States)

    Briet, Jan Paul; Bot, Arjan G J; Hageman, Michiel G J S; Menendez, Mariano E; Mudgal, Chaitanya S; Ring, David C

    2014-01-01

    The Pain Self-Efficacy Questionnaire (PSEQ) is a validated tool to assess pain self-efficacy and is strongly correlated with disability. Reducing the number of questions of the original PSEQ to screen for self-efficacy will result in more efficient screening and less burden for the patient. The aim of this study was to prospectively validate the shortened version of the PSEQ. Overall, 249 new and follow-up patients visiting our outpatient orthopedic hand surgery clinic were prospectively enrolled and asked to complete the PSEQ, short version of the Disabilities of the Arm Shoulder and Hand, and 2-question version of the Patient Health Questionnaire (PHQ-2) depression questionnaires. The patients completed the questionnaires in the office and online 2 weeks after their visit. At the follow-up visit, the PSEQ was substituted with the 2-question version of the Pain Self-Efficacy Questionnaire (PSEQ-2). The factors associated with higher short forms of the Disabilities of the Arm, Shoulder and Hand scores were investigated in a bivariate and multivariable analysis. Paired t-test was used to compare the mean values of the short and long questionnaires at enrollment. There was a large correlation (r = 0.90; p correlation was found with the short forms of the Disabilities of the Arm, Shoulder and Hand (r = 0.71 vs r = 0.61). Both the PSEQ-2 and the PSEQ were the most important predictors of the short forms of the Disabilities of the Arm, Shoulder and Hand scores. A substantial test-retest reliability was found for the PSEQ-2 (0.66). The PSEQ-2 can be used to quickly assess patients׳ pain self-efficacy. Copyright © 2014 The Academy of Psychosomatic Medicine. Published by Elsevier Inc. All rights reserved.

  18. Correction to: Release of an enantioselective nitrilase from Alcaligenes faecalis MTCC 126: a comparative study.

    Science.gov (United States)

    Singh, Renu; Banerjee, Anirban; Kaul, Praveen; Barse, Brajesh; Banerjee, U C

    2018-02-24

    In the original version of our paper entitled "Release of an enantioselective nitrilase from Alcaligenes faecalis MTCC 126: a comparative study" (2005) 27:415-424, some references to already published articles were inadvertently left out.

  19. Drug-abbreviated infections of Trichostrongylus colubriformis and development of immunity in jirds (Meriones unguiculatus).

    Science.gov (United States)

    Ziam, H; Pandey, V S; Elegbe, E; Kumar, V; Dorny, P; Huntley, J F; Maes, L

    2000-08-01

    The objective of this study was to examine the development and the duration of immunity achieved with drug-abbreviated infections of Trichostrongylus colubriformis in jirds (Meriones unguiculatus). Jirds were primarily infected either by trickle infection with 6 x 100 infective larvae (L3) of T. colubriformis at 3-day intervals or by a single infection with 600 L3. On day 35 post-infection, one batch of jirds from each group was autopsied; the others were treated with oxfendazole at a dose of 5 mg/kg and were challenged with 1,000 L3 on either day 7 or day 42 post-treatment. All jirds were autopsied at 17 days post-challenge. Trickle infection resulted in lower levels of egg production during the primary infection period. The systemic IgM and IgG antibody response was significantly stronger in trickle- and single-infected groups as compared with the negative control group (P < 0.01-P < 0.05). Significantly higher levels of intestinal IgA were demonstrated in trickle- and single-infected groups than in the negative control group (P < 0.01). Numbers of mucosal mast cells increased following infection, but this was not dependent on the type of immunisation. After challenge the extent of worm reduction was greater in trickle-infected than in single-infected subgroups. The IgM and IgG response was significantly stronger in challenged subgroups as compared with negative control subgroups (P < 0.01). However, the IgG response was weaker in control challenged subgroups than in challenged subgroups (P < 0.01). There was a negative correlation between the IgG response and the worm burden after the second challenge (r = -0.73). The acquired immunity to T. colubriformis infection in jirds developed within 5 weeks of primary infection. The level of immunity was higher after trickle infection than after single infection. Furthermore, the immunity persisted for at least 6 weeks after oxfendazole treatment in the absence of a worm burden and larval intake, which is very similar to

  20. Diagnostic accuracy of the Kampala Trauma Score using estimated Abbreviated Injury Scale scores and physician opinion.

    Science.gov (United States)

    Gardner, Andrew; Forson, Paa Kobina; Oduro, George; Stewart, Barclay; Dike, Nkechi; Glover, Paul; Maio, Ronald F

    2017-01-01

    The Kampala Trauma Score (KTS) has been proposed as a triage tool for use in low- and middle-income countries (LMICs). This study aimed to examine the diagnostic accuracy of KTS in predicting emergency department outcomes using timely injury estimation with Abbreviated Injury Scale (AIS) score and physician opinion to calculate KTS scores. This was a diagnostic accuracy study of KTS among injured patients presenting to Komfo Anokye Teaching Hospital A&E, Ghana. South African Triage Scale (SATS); KTS component variables, including AIS scores and physician opinion for serious injury quantification; and ED disposition were collected. Agreement between estimated AIS score and physician opinion were analyzed with normal, linear weighted, and maximum kappa. Receiver operating characteristic (ROC) analysis of KTS-AIS and KTS-physician opinion was performed to evaluate each measure's ability to predict A&E mortality and need for hospital admission to the ward or theatre. A total of 1053 patients were sampled. There was moderate agreement between AIS criteria and physician opinion by normal (κ=0.41), weighted (κ lin =0.47), and maximum (κ max =0.53) kappa. A&E mortality ROC area for KTS-AIS was 0.93, KTS-physician opinion 0.89, and SATS 0.88 with overlapping 95% confidence intervals (95%CI). Hospital admission ROC area for KTS-AIS was 0.73, KTS-physician opinion 0.79, and SATS 0.71 with statistical similarity. When evaluating only patients with serious injuries, KTS-AIS (ROC 0.88) and KTS-physician opinion (ROC 0.88) performed similarly to SATS (ROC 0.78) in predicting A&E mortality. The ROC area for KTS-AIS (ROC 0.71; 95%CI 0.66-0.75) and KTS-physician opinion (ROC 0.74; 95%CI 0.69-0.79) was significantly greater than SATS (ROC 0.57; 0.53-0.60) with regard to need for admission. KTS predicted mortality and need for admission from the ED well when early estimation of the number of serious injuries was used, regardless of method (i.e. AIS criteria or physician opinion

  1. The utility of abbreviated patient-reported outcomes for predicting survival in early stage colorectal cancer.

    Science.gov (United States)

    Hsu, Tina; Speers, Caroline H; Kennecke, Hagen F; Cheung, Winson Y

    2017-05-15

    Patient-reported outcomes (PROs) are increasingly used in clinical settings. Prior research suggests that PROs collected at baseline may be associated with cancer survival, but most of those studies were conducted in patients with breast or lung cancer. The objective of this study was to determine the correlation between prospectively collected PROs and cancer-specific outcomes in patients with early stage colorectal cancer. Patients who had newly diagnosed stage II or III colorectal cancer from 2009 to 2010 and had a consultation at the British Columbia Cancer Agency completed the brief Psychosocial Screen for Cancer (PSSCAN) questionnaire, which collects data on patients' perceived social supports, quality of life (QOL), anxiety and depression, and general health. PROs from the PSSCAN were linked with the Gastrointestinal Cancers Outcomes Database, which contains information on patient and tumor characteristics, treatment details, and cancer outcomes. Cox regression models were constructed for overall survival (OS), and Fine and Gray regression models were developed for disease-specific survival (DSS). In total, 692 patients were included. The median patient age was 67 years (range, 26-95 years), and the majority had colon cancer (61%), were diagnosed with stage III disease (54%), and received chemotherapy (58%). In general, patients felt well supported and reported good overall health and QOL. On multivariate analysis, increased fatigue was associated with worse OS (hazard ratio [HR], 1.99; P = .00007) and DSS (HR, 1.63; P = .03), as was lack of emotional support (OS: HR, 4.36; P = .0003; DSS: HR, 1.92; P = .02). Although most patients described good overall health and QOL and indicated that they were generally well supported, patients who experienced more pronounced fatigue or lacked emotional support had a higher likelihood of worse OS and DSS. These findings suggest that abbreviated PROs can inform and assist clinicians to identify patients who have a worse

  2. Sensitivity and specificity of the abbreviated profile of hearing aid benefit (APHAB).

    Science.gov (United States)

    Löhler, Jan; Gräbner, F; Wollenberg, B; Schlattmann, P; Schönweiler, R

    2017-10-01

    Subjective hearing loss in hearing-impaired patients can be assessed by inventory questionnaires. The abbreviated profile of hearing aid benefit (APHAB) measures subjective hearing loss in four typical hearing situations (subscales). It is used to fit hearing aids in patients with statutory insurance in Germany. In addition, the unaided APHAB (APHAB u ) can be used as a primary diagnostic instrument in audiology. There are no published data regarding the sensitivity and specificity of the unaided APHAB u . Therefore, we investigated these parameters for detecting hearing loss of at least 25 dB at any frequency between 0.5 and 8.0 kHz. We used the APHAB u to determine hearing loss in 245 subjects aged 50 years and older without any reported disease of the ears. Due to incomplete answering of the APHAB form, 55 subjects have been excluded. We also measured the pure-tone thresholds by air conduction for all octave frequencies between 0.5 and 8 kHz. Receiver operating characteristic (ROC) curves and the Youden Index were used to determine the diagnostic value of the APHAB u , particularly sensitivity and specificity, in three different ways: (1) separately for ease of communication (EC u ), background noise (BN u ), and hearing with reverberation (RV u ) subscales; (2) with the mean value of EC u , BN u , and RV u ; and (3) with a logistic regression model. The area under the ROC curve was lower for BN only (0.83) and nearly equal for all other methods (0.87-0.89). Depending on how we performed the analyses, the sensitivity of the APHAB u was 0.70-0.84 (single subscales), 0.76 (mean value of EC u , BN u , and RV u ), or 0.85 (logistic regression model). The specificity was 0.79-0.95. The use of single APHAB u subscales for determining the sensitivity and specificity of the APHAB u due to confusing results. In comparison, the use of the mean value of EC u , BN u , and RV u and the use of the logistic regression model due to equal values in the ROC curves but a

  3. Modeling of Fission Gas Release in UO2

    Energy Technology Data Exchange (ETDEWEB)

    MH Krohn

    2006-01-23

    A two-stage gas release model was examined to determine if it could provide a physically realistic and accurate model for fission gas release under Prometheus conditions. The single-stage Booth model [1], which is often used to calculate fission gas release, is considered to be oversimplified and not representative of the mechanisms that occur during fission gas release. Two-stage gas release models require saturation at the grain boundaries before gas is release, leading to a time delay in release of gases generated in the fuel. Two versions of a two-stage model developed by Forsberg and Massih [2] were implemented using Mathcad [3]. The original Forsbers and Massih model [2] and a modified version of the Forsberg and Massih model that is used in a commercially available fuel performance code (FRAPCON-3) [4] were examined. After an examination of these models, it is apparent that without further development and validation neither of these models should be used to calculate fission gas release under Prometheus-type conditions. There is too much uncertainty in the input parameters used in the models. In addition. the data used to tune the modified Forsberg and Massih model (FRAPCON-3) was collected under commercial reactor conditions, which will have higher fission rates relative to Prometheus conditions [4].

  4. Modeling of Fission Gas Release in UO2

    International Nuclear Information System (INIS)

    MH Krohn

    2006-01-01

    A two-stage gas release model was examined to determine if it could provide a physically realistic and accurate model for fission gas release under Prometheus conditions. The single-stage Booth model [1], which is often used to calculate fission gas release, is considered to be oversimplified and not representative of the mechanisms that occur during fission gas release. Two-stage gas release models require saturation at the grain boundaries before gas is release, leading to a time delay in release of gases generated in the fuel. Two versions of a two-stage model developed by Forsberg and Massih [2] were implemented using Mathcad [3]. The original Forsbers and Massih model [2] and a modified version of the Forsberg and Massih model that is used in a commercially available fuel performance code (FRAPCON-3) [4] were examined. After an examination of these models, it is apparent that without further development and validation neither of these models should be used to calculate fission gas release under Prometheus-type conditions. There is too much uncertainty in the input parameters used in the models. In addition. the data used to tune the modified Forsberg and Massih model (FRAPCON-3) was collected under commercial reactor conditions, which will have higher fission rates relative to Prometheus conditions [4

  5. Essay on the pertinence of Luscher's abbreviate test in psychological evaluation of the radioactive accident victims of Goiania

    International Nuclear Information System (INIS)

    Costa Neto, Sebastiao Benicio da

    1995-01-01

    The essay on the pertinence of Luscher's abbreviate test in psychological evaluation of the radioactive accident victims of Goiania - Brazilian city - occurred in 1987 is consequence of confront of data obtained in two distinct situations having for criterion: time, efficiency and pertinence. Besides of this, they are introduced palografic and the house-tree-person - HTP - tests. These tests aimed at the common psychological characteristics verification to radioactive accident victims' personality of Goiania and to the data existential moment for those people. Among the three tests, the one of Luscher was what obtained the best interviewees acceptance index

  6. CALIPSO lidar calibration at 532 nm: version 4 nighttime algorithm

    Science.gov (United States)

    Kar, Jayanta; Vaughan, Mark A.; Lee, Kam-Pui; Tackett, Jason L.; Avery, Melody A.; Garnier, Anne; Getzewich, Brian J.; Hunt, William H.; Josset, Damien; Liu, Zhaoyan; Lucker, Patricia L.; Magill, Brian; Omar, Ali H.; Pelon, Jacques; Rogers, Raymond R.; Toth, Travis D.; Trepte, Charles R.; Vernier, Jean-Paul; Winker, David M.; Young, Stuart A.

    2018-03-01

    Data products from the Cloud-Aerosol Lidar with Orthogonal Polarization (CALIOP) on board Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observations (CALIPSO) were recently updated following the implementation of new (version 4) calibration algorithms for all of the Level 1 attenuated backscatter measurements. In this work we present the motivation for and the implementation of the version 4 nighttime 532 nm parallel channel calibration. The nighttime 532 nm calibration is the most fundamental calibration of CALIOP data, since all of CALIOP's other radiometric calibration procedures - i.e., the 532 nm daytime calibration and the 1064 nm calibrations during both nighttime and daytime - depend either directly or indirectly on the 532 nm nighttime calibration. The accuracy of the 532 nm nighttime calibration has been significantly improved by raising the molecular normalization altitude from 30-34 km to the upper possible signal acquisition range of 36-39 km to substantially reduce stratospheric aerosol contamination. Due to the greatly reduced molecular number density and consequently reduced signal-to-noise ratio (SNR) at these higher altitudes, the signal is now averaged over a larger number of samples using data from multiple adjacent granules. Additionally, an enhanced strategy for filtering the radiation-induced noise from high-energy particles was adopted. Further, the meteorological model used in the earlier versions has been replaced by the improved Modern-Era Retrospective analysis for Research and Applications, Version 2 (MERRA-2), model. An aerosol scattering ratio of 1.01 ± 0.01 is now explicitly used for the calibration altitude. These modifications lead to globally revised calibration coefficients which are, on average, 2-3 % lower than in previous data releases. Further, the new calibration procedure is shown to eliminate biases at high altitudes that were present in earlier versions and consequently leads to an improved representation of

  7. Fission product core release model evaluation in MELCOR code

    International Nuclear Information System (INIS)

    Song, Y. M.; Kim, D. H.; Kim, H. D.

    2003-01-01

    The fission product core release in the MELCOR code is based on the CORSOR models developed by Battelle Memorial Institute. Release of radionuclides can occur from the fuel-cladding gap when a failure temperature criterion exceeds or intact geometry is lost, and various CORSOR empirical release correlations based on fuel temperatures are used for the release. Released masses into the core may exist as aerosols and/or vapors, depending on the vapor pressure of the radionuclide class and the surrounding temperature. This paper shows a release analysis for selected representative volatile and non-volatile radionuclides during conservative high and low pressure sequences in the APR1400 plant. Three core release models (CORSOR, CORSOR-M, CORSOR-Booth) in the latest MELCOR 1.8.5 version are used. In the analysis, the option of the fuel component surface-to-volume ratio in the CORSOR and CORSOR-M models and the option of the high and low burn-up in the CORSOR-Booth model are considered together. As the results, the CORSOR-M release rate is high for volatile radionuclides, and the CORSOR release rate is high for non-volatile radionuclides with insufficient consistency. As the uncertainty range for the release rate expands from several times (volatile radionuclides) to more than maximum 10,000 times (non-volatile radionuclides), user's careful choice for core release models is needed

  8. SAFER CVIEW interface re-certification : description of re-certification process for CVISN stakeholders : version 1.0

    Science.gov (United States)

    2008-04-23

    In order to improve data quality in the SAFER system, two major software changes have been made in the recent SAFER releases. SAFER version 4.9, released in October 2005, has implemented data rules (SAFER CR 131) to support the requirements for manda...

  9. NCDC International Best Track Archive for Climate Stewardship (IBTrACS) Project, Version 2 (Version Superseded)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Version 2 of the dataset has been superseded by a newer version. Users should not use version 2 except in rare cases (e.g., when reproducing previous studies that...

  10. NCDC International Best Track Archive for Climate Stewardship (IBTrACS) Project, Version 1 (Version Superseded)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Version 1 of the dataset has been superseded by a newer version. Users should not use version 1 except in rare cases (e.g., when reproducing previous studies that...

  11. Fluoroelastomer Fouling Release Coating

    National Research Council Canada - National Science Library

    Malik, Aslam

    1998-01-01

    Our goal is to develop novel fluoroelastomers that exhibit fouling release capabilities and to understand the polymer characteristics that influence the adhesion of biofouling organisms to polymeric substrates...

  12. Compassionate release in California.

    Science.gov (United States)

    Greenspan, J

    1997-01-01

    Several States have instituted compassionate release programs to allow terminally ill inmates to be released early. The programs are politically sensitive, and the California program is highlighted. Early release, called recall of sentence under the State penal code, is a lengthy and cumbersome process that has resulted in early release of nearly 100 prisoners in the past 5 years. Guidelines for community activists who are trying to establish similar programs are provided. The guidelines include contact and discussion with prisoners, outside support through influential organizations, support of State legislators and policy makers, and media involvement in building support for the initiative.

  13. Release the Body, Release the Mind.

    Science.gov (United States)

    Stoner, Martha Goff

    1998-01-01

    A college English teacher describes the anxiety and resentment of students during in-class writing assignments and the successful classroom use of meditation and body movement. Movement seemed to relax the students, change their attitudes, and release their creative impulses to write. Implications related to the body-mind connection are pondered.…

  14. FORM version 4.0

    Science.gov (United States)

    Kuipers, J.; Ueda, T.; Vermaseren, J. A. M.; Vollinga, J.

    2013-05-01

    We present version 4.0 of the symbolic manipulation system FORM. The most important new features are manipulation of rational polynomials and the factorization of expressions. Many other new functions and commands are also added; some of them are very general, while others are designed for building specific high level packages, such as one for Gröbner bases. New is also the checkpoint facility, that allows for periodic backups during long calculations. Finally, FORM 4.0 has become available as open source under the GNU General Public License version 3. Program summaryProgram title: FORM. Catalogue identifier: AEOT_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEOT_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: GNU General Public License, version 3 No. of lines in distributed program, including test data, etc.: 151599 No. of bytes in distributed program, including test data, etc.: 1 078 748 Distribution format: tar.gz Programming language: The FORM language. FORM itself is programmed in a mixture of C and C++. Computer: All. Operating system: UNIX, LINUX, Mac OS, Windows. Classification: 5. Nature of problem: FORM defines a symbolic manipulation language in which the emphasis lies on fast processing of very large formulas. It has been used successfully for many calculations in Quantum Field Theory and mathematics. In speed and size of formulas that can be handled it outperforms other systems typically by an order of magnitude. Special in this version: The version 4.0 contains many new features. Most important are factorization and rational arithmetic. The program has also become open source under the GPL. The code in CPC is for reference. You are encouraged to upload the most recent sources from www.nikhef.nl/form/formcvs.php because of frequent bug fixes. Solution method: See "Nature of Problem", above. Additional comments: NOTE: The code in CPC is for reference. You are encouraged

  15. The Integrated Tiger Series version 5.0

    International Nuclear Information System (INIS)

    Laub, Th.W.; Kensek, R.P.; Franke, B.C.; Lorence, L.J.; Crawford, M.J.; Quirk, Th.J.

    2005-01-01

    The Integrated Tiger Series (ITS) is a powerful and user-friendly software package permitting Monte Carlo solution of linear time-independent coupled electron/photon radiation transport problems, with or without the presence of macroscopic electric and magnetic fields of arbitrary spatial dependence. The package contains programs to perform 1-, 2-, and 3-dimensional simulations. Improvements in the ITS code package since the release of version 3.0 include improved physics, multigroup and adjoint capabilities, Computer-Aided Design geometry tracking, parallel implementations of all ITS codes, and more automated sub-zoning capabilities. These improvements and others are described as current or planned development efforts. The ITS package is currently at version 5.0. (authors)

  16. Verification and validation of RADMODL Version 1.0

    Energy Technology Data Exchange (ETDEWEB)

    Kimball, K.D.

    1993-03-01

    RADMODL is a system of linked computer codes designed to calculate the radiation environment following an accident in which nuclear materials are released. The RADMODL code and the corresponding Verification and Validation (V&V) calculations (Appendix A), were developed for Westinghouse Savannah River Company (WSRC) by EGS Corporation (EGS). Each module of RADMODL is an independent code and was verified separately. The full system was validated by comparing the output of the various modules with the corresponding output of a previously verified version of the modules. The results of the verification and validation tests show that RADMODL correctly calculates the transport of radionuclides and radiation doses. As a result of this verification and validation effort, RADMODL Version 1.0 is certified for use in calculating the radiation environment following an accident.

  17. New version of the web based CERN Phonebook

    CERN Multimedia

    GS Department

    2011-01-01

    A new version of CERN’s web-based phonebook will be deployed during the weekend of 17/18 December 2011. The most important new feature will be the possibility to see the CERN identity card photo of every person listed in the phonebook who has a registered photo.   The photo will be available on each person's details page and will be visible to all employed and associated members of the personnel who have the appropriate authentication (i.e. those who log in using their AIS login). More information about other new features of the release will be available from 19 December 2011 from the webpage detailing the version history of the CERN phonebook.

  18. Herwig++ 2.7 release note

    Energy Technology Data Exchange (ETDEWEB)

    Bellm, J.; Gieseke, S. [Karlsruher Institut fuer Technologie, Karlsruhe (Germany). Inst. fuer Theoretische Physik; Grellscheid, D. [IPPP, Durham (United Kingdom). Dept. of Physics] [and others

    2013-10-15

    A new release of the Monte Carlo event generator Herwig++ (version 2.7) is now available. This version comes with a number of improvements including: an interface to the Universal FeynRules Output (UFO) format allowing the simulation of a wide range of new-physics models; developments of the Matchbox framework for next-to-leading order (NLO) simulations; better treatment of QCD radiation in heavy particle decays in new-physics models; a new tune of underlying event and colour connection parameters that allows a good simultaneous description of both Tevatron and LHC underlying event data and the effective cross-section parameter for double-parton scattering parameter {sigma}{sub eff}.

  19. Abbreviated mindfulness intervention for job satisfaction, quality of life, and compassion in primary care clinicians: a pilot study.

    Science.gov (United States)

    Fortney, Luke; Luchterhand, Charlene; Zakletskaia, Larissa; Zgierska, Aleksandra; Rakel, David

    2013-01-01

    Burnout, attrition, and low work satisfaction of primary care physicians are growing concerns and can have a negative influence on health care. Interventions for clinicians that improve work-life balance are few and poorly understood. We undertook this study as a first step in investigating whether an abbreviated mindfulness intervention could increase job satisfaction, quality of life, and compassion among primary care clinicians. A total of 30 primary care clinicians participated in an abbreviated mindfulness course. We used a single-sample, pre-post design. At 4 points in time (baseline, and 1 day, 8 weeks, and 9 months postintervention), participants completed a set of online measures assessing burnout, anxiety, stress, resilience, and compassion. We used a linear mixed-effects model analysis to assess changes in outcome measures. Participants had improvements compared with baseline at all 3 follow-up time points. At 9 months postintervention, they had significantly better scores (1) on all Maslach Burnout Inventory burnout subscales-Emotional Exhaustion (P =.009), Depersonalization (P = .005), and Personal Accomplishment (P primary care clinicians was associated with reductions in indicators of job burnout, depression, anxiety, and stress. Modified mindfulness training may be a time-efficient tool to help support clinician health and well-being, which may have implications for patient care.

  20. Zipf's Law of Abbreviation and the Principle of Least Effort: Language users optimise a miniature lexicon for efficient communication.

    Science.gov (United States)

    Kanwal, Jasmeen; Smith, Kenny; Culbertson, Jennifer; Kirby, Simon

    2017-08-01

    The linguist George Kingsley Zipf made a now classic observation about the relationship between a word's length and its frequency; the more frequent a word is, the shorter it tends to be. He claimed that this "Law of Abbreviation" is a universal structural property of language. The Law of Abbreviation has since been documented in a wide range of human languages, and extended to animal communication systems and even computer programming languages. Zipf hypothesised that this universal design feature arises as a result of individuals optimising form-meaning mappings under competing pressures to communicate accurately but also efficiently-his famous Principle of Least Effort. In this study, we use a miniature artificial language learning paradigm to provide direct experimental evidence for this explanatory hypothesis. We show that language users optimise form-meaning mappings only when pressures for accuracy and efficiency both operate during a communicative task, supporting Zipf's conjecture that the Principle of Least Effort can explain this universal feature of word length distributions. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Independent Verification and Validation SAPHIRE Version 8 Final Report Project Number: N6423 U.S. Nuclear Regulatory Commission

    Energy Technology Data Exchange (ETDEWEB)

    Kent Norris

    2010-04-01

    This report provides an evaluation of the SAPHIRE version 8 software product. SAPHIRE version 8 is being developed with a phased or cyclic iterative rapid application development methodology. Due to this approach, a similar approach has been taken for the IV&V activities on each vital software object. IV&V and Software Quality Assurance (SQA) activities occur throughout the entire development life cycle and therefore, will be required through the full development of SAPHIRE version 8. Later phases of the software life cycle, the operation and maintenance phases, are not applicable in this effort since the IV&V is being done prior to releasing Version 8.

  2. Implications of SNOMED CT versioning

    NARCIS (Netherlands)

    Lee, Dennis; Cornet, Ronald; Lau, Francis

    2011-01-01

    To determine the changes each Systematized Nomenclature of Medicine Clinical Terms (SNOMED CT) release undergoes and the implications of those changes. (1) We reviewed the SNOMED CT Component History documentation and analyzed the Component History table in detail. (2) We outlined a list of semantic

  3. GEMPAK 5.1 - A GENERAL METEOROLOGICAL PACKAGE (UNIX VERSION)

    Science.gov (United States)

    Desjardins, M. L.

    1994-01-01

    regional maps is included with this package. The standard distribution medium for the UNIX version of GEMPAK 5.1 is a .25 inch streaming magnetic tape cartridge in UNIX tar format. The standard distribution medium for the VMS version of GEMPAK 5.1 is a 6250 BPI 9-track magnetic tape in DEC VAX BACKUP format. The VMS version is also available on a TK50 tape cartridge in DEC VAX BACKUP format. This program was developed in 1985. The current version, GEMPAK 5.1, was released in 1992. The package is delivered with source code. An extensive collection of subroutine libraries allows users to format data for use by GEMPAK, to develop new programs, and to enhance existing ones.

  4. New Source Term Model for the RESRAD-OFFSITE Code Version 3

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Charley [Argonne National Lab. (ANL), Argonne, IL (United States); Gnanapragasam, Emmanuel [Argonne National Lab. (ANL), Argonne, IL (United States); Cheng, Jing-Jy [Argonne National Lab. (ANL), Argonne, IL (United States); Kamboj, Sunita [Argonne National Lab. (ANL), Argonne, IL (United States); Chen, Shih-Yew [Argonne National Lab. (ANL), Argonne, IL (United States)

    2013-06-01

    This report documents the new source term model developed and implemented in Version 3 of the RESRAD-OFFSITE code. This new source term model includes: (1) "first order release with transport" option, in which the release of the radionuclide is proportional to the inventory in the primary contamination and the user-specified leach rate is the proportionality constant, (2) "equilibrium desorption release" option, in which the user specifies the distribution coefficient which quantifies the partitioning of the radionuclide between the solid and aqueous phases, and (3) "uniform release" option, in which the radionuclides are released from a constant fraction of the initially contaminated material during each time interval and the user specifies the duration over which the radionuclides are released.

  5. Large scientific releases

    International Nuclear Information System (INIS)

    Pongratz, M.B.

    1981-01-01

    The motivation for active experiments in space is considered, taking into account the use of active techniques to obtain a better understanding of the natural space environment, the utilization of the advantages of space as a laboratory to study fundamental plasma physics, and the employment of active techniques to determine the magnitude, degree, and consequences of artificial modification of the space environment. It is pointed out that mass-injection experiments in space plasmas began about twenty years ago with the Project Firefly releases. Attention is given to mass-release techniques and diagnostics, operational aspects of mass release active experiments, the active observation of mass release experiments, active perturbation mass release experiments, simulating an artificial modification of the space environment, and active experiments to study fundamental plasma physics

  6. A constructive version of AIP revisited

    NARCIS (Netherlands)

    Barros, A.; Hou, T.

    2008-01-01

    In this paper, we review a constructive version of the Approximation Induction Principle. This version states that bisimilarity of regular processes can be decided by observing only a part of their behaviour. We use this constructive version to formulate a complete inference system for the Algebra

  7. New features in McStas, version 1.5

    CERN Document Server

    Aastrand, P O; Nielsen, K; Skaarup, P; Farhi, E

    2002-01-01

    The neutron ray-tracing simulation package McStas has attracted numerous users, and the development of the package continues with version 1.5 released at the ICNS 2001 conference. New features include: support for neutron polarisation, labelling of neutrons, realistic source and sample components, and interface to the Riso instrument-control software TASCOM. We give a general introduction to McStas and present the latest developments. In particular, we give an example of how the neutron-label option has been used to locate the origin of a spurious side-peak, observed in an experiment with RITA-1 at Riso. (orig.)

  8. New features in McStas, version 1.5

    DEFF Research Database (Denmark)

    Åstrand, P.O.; Lefmann, K.; Farhi, E.

    2002-01-01

    The neutron ray-tracing simulation package McStas has attracted numerous users, and the development of the package continues with version 1.5 released at the ICNS 2001 conference. New features include: support for neutron polarisation, labelling of neutrons, realistic source and sample components......, and interface to the Riso instrument-control software TASCOM. We give a general introduction to McStas and present the latest developments. In particular, we give an example of how the neutron-label option has been used to locate the origin of a spurious side-peak, observed in an experiment with RITA-1 at Riso....

  9. DEMAID - A DESIGN MANAGER'S AID FOR INTELLIGENT DECOMPOSITION (SUN VERSION)

    Science.gov (United States)

    Rogers, J. L.

    1994-01-01

    effects of an output with respect to a change in a particular input. The second method traces backward to determine what modules must be re-executed if the output of a module must be recomputed. DeMAID is available in three machine versions: a Macintosh version which is written in Symantec's Think C 3.01, a Sun version, and an SGI IRIS version, both of which are written in C language. The Macintosh version requires system software 6.0.2 or later and CLIPS 4.3. The source code for the Macintosh version will not compile under version 4.0 of Think C; however, a sample executable is provided on the distribution media. QuickDraw is required for plotting. The Sun version requires GKS 4.1 graphics libraries, OpenWindows 3, and CLIPS 4.3. The SGI IRIS version requires CLIPS 4.3. Since DeMAID is not compatible with CLIPS 5.0 or later, the source code for CLIPS 4.3 is included on the distribution media; however, the documentation for CLIPS 4.3 is not included in the documentation package for DeMAID. It is available from COSMIC separately as the documentation for MSC-21208. The standard distribution medium for the Macintosh version of DeMAID is a set of four 3.5 inch 800K Macintosh format diskettes. The standard distribution medium for the Sun version of DeMAID is a .25 inch streaming magnetic tape cartridge (QIC-24) in UNIX tar format. The standard distribution medium for the IRIS version is a .25 inch IRIX compatible streaming magnetic tape cartridge in UNIX tar format. All versions include sample input. DeMAID was originally developed for use on VAX VMS computers in 1989. The Macintosh version of DeMAID was released in 1991 and updated in 1992. The Sun version of DeMAID was released in 1992 and updated in 1993. The SGI IRIS version was released in 1993.

  10. DEMAID - A DESIGN MANAGER'S AID FOR INTELLIGENT DECOMPOSITION (MACINTOSH VERSION)

    Science.gov (United States)

    Rogers, J. L.

    1994-01-01

    effects of an output with respect to a change in a particular input. The second method traces backward to determine what modules must be re-executed if the output of a module must be recomputed. DeMAID is available in three machine versions: a Macintosh version which is written in Symantec's Think C 3.01, a Sun version, and an SGI IRIS version, both of which are written in C language. The Macintosh version requires system software 6.0.2 or later and CLIPS 4.3. The source code for the Macintosh version will not compile under version 4.0 of Think C; however, a sample executable is provided on the distribution media. QuickDraw is required for plotting. The Sun version requires GKS 4.1 graphics libraries, OpenWindows 3, and CLIPS 4.3. The SGI IRIS version requires CLIPS 4.3. Since DeMAID is not compatible with CLIPS 5.0 or later, the source code for CLIPS 4.3 is included on the distribution media; however, the documentation for CLIPS 4.3 is not included in the documentation package for DeMAID. It is available from COSMIC separately as the documentation for MSC-21208. The standard distribution medium for the Macintosh version of DeMAID is a set of four 3.5 inch 800K Macintosh format diskettes. The standard distribution medium for the Sun version of DeMAID is a .25 inch streaming magnetic tape cartridge (QIC-24) in UNIX tar format. The standard distribution medium for the IRIS version is a .25 inch IRIX compatible streaming magnetic tape cartridge in UNIX tar format. All versions include sample input. DeMAID was originally developed for use on VAX VMS computers in 1989. The Macintosh version of DeMAID was released in 1991 and updated in 1992. The Sun version of DeMAID was released in 1992 and updated in 1993. The SGI IRIS version was released in 1993.

  11. Embrittlement data base, version 1

    Energy Technology Data Exchange (ETDEWEB)

    Wang, J.A.

    1997-08-01

    The aging and degradation of light-water-reactor (LWR) pressure vessels is of particular concern because of their relevance to plant integrity and the magnitude of the expected irradiation embrittlement. The radiation embrittlement of reactor pressure vessel (RPV) materials depends on many different factors such as flux, fluence, fluence spectrum, irradiation temperature, and preirradiation material history and chemical compositions. These factors must be considered to reliably predict pressure vessel embrittlement and to ensure the safe operation of the reactor. Based on embrittlement predictions, decisions must be made concerning operating parameters and issues such as low-leakage-fuel management, possible life extension, and the need for annealing the pressure vessel. Large amounts of data from surveillance capsules and test reactor experiments, comprising many different materials and different irradiation conditions, are needed to develop generally applicable damage prediction models that can be used for industry standards and regulatory guides. Version 1 of the Embrittlement Data Base (EDB) is such a comprehensive collection of data resulting from merging version 2 of the Power Reactor Embrittlement Data Base (PR-EDB). Fracture toughness data were also integrated into Version 1 of the EDB. For power reactor data, the current EDB lists the 1,029 Charpy transition-temperature shift data points, which include 321 from plates, 125 from forgoings, 115 from correlation monitor materials, 246 from welds, and 222 from heat-affected-zone (HAZ) materials that were irradiated in 271 capsules from 101 commercial power reactors. For test reactor data, information is available for 1,308 different irradiated sets (352 from plates, 186 from forgoings, 303 from correlation monitor materials, 396 from welds and 71 from HAZs) and 268 different irradiated plus annealed data sets.

  12. Embrittlement data base, version 1

    International Nuclear Information System (INIS)

    Wang, J.A.

    1997-08-01

    The aging and degradation of light-water-reactor (LWR) pressure vessels is of particular concern because of their relevance to plant integrity and the magnitude of the expected irradiation embrittlement. The radiation embrittlement of reactor pressure vessel (RPV) materials depends on many different factors such as flux, fluence, fluence spectrum, irradiation temperature, and preirradiation material history and chemical compositions. These factors must be considered to reliably predict pressure vessel embrittlement and to ensure the safe operation of the reactor. Based on embrittlement predictions, decisions must be made concerning operating parameters and issues such as low-leakage-fuel management, possible life extension, and the need for annealing the pressure vessel. Large amounts of data from surveillance capsules and test reactor experiments, comprising many different materials and different irradiation conditions, are needed to develop generally applicable damage prediction models that can be used for industry standards and regulatory guides. Version 1 of the Embrittlement Data Base (EDB) is such a comprehensive collection of data resulting from merging version 2 of the Power Reactor Embrittlement Data Base (PR-EDB). Fracture toughness data were also integrated into Version 1 of the EDB. For power reactor data, the current EDB lists the 1,029 Charpy transition-temperature shift data points, which include 321 from plates, 125 from forgoings, 115 from correlation monitor materials, 246 from welds, and 222 from heat-affected-zone (HAZ) materials that were irradiated in 271 capsules from 101 commercial power reactors. For test reactor data, information is available for 1,308 different irradiated sets (352 from plates, 186 from forgoings, 303 from correlation monitor materials, 396 from welds and 71 from HAZs) and 268 different irradiated plus annealed data sets

  13. [Spanish translation and validation of an Executive Battery 25 (EB25) and its shortened version (ABE12) for executive dysfunction screening in dementia].

    Science.gov (United States)

    Serrani Azcurra, D J L

    2013-10-01

    There is a need for clinically administered instruments capable of detecting executive dysfunction in dementia. The translation and validation of Executive Battery 25 (EB25) and a short version for screening of executive dysfunction in dementia. The original battery was translated and validated using convergent and divergent correlation in 66 mild dementia patients (CDR 1) matched with 66 controls. EB25 consists of 25 items which detect executive dysfunction. Convergent correlation was made with 7 tests assessing executive dysfunction, the Frontal Systems Behaviour Scale (FrSBe) and Disability Fast Assessment Scale. Patients had higher scores than controls and correlated with the Stroop Test, verbal fluency test and Frontal Behaviour Inventory. Only 12 out of 25 items were needed to separate both groups, which were used to build an abbreviated Executive Battery with equal psychometric properties and discriminative power. The cut-off point for EB25 was 12, and 7 for the abbreviated version. A cut-off point of 12 was able to discriminate between ¿Alzheimer's disease? (AD) and frontotemporal lobe dementia (FTLD). EB25 and AEB12 enable executive dysfunction to be detected in mild dementia. On the other hand, AEB12 exhibits better psychometric properties than the original battery, allowing discrimination between AD and FTLD and is completed in less time. Copyright © 2010 Sociedad Española de Neurología. Published by Elsevier Espana. All rights reserved.

  14. CLIPS 6.0 - C LANGUAGE INTEGRATED PRODUCTION SYSTEM, VERSION 6.0 (DEC VAX VMS VERSION)

    Science.gov (United States)

    Donnell, B.

    1994-01-01

    command line version. For the UNIX version of CLIPS 6.0, the command line interface has been successfully implemented on a Sun4 running SunOS, a DECstation running DEC RISC ULTRIX, an SGI Indigo Elan running IRIX, a DEC Alpha AXP running OSF/1, and an IBM RS/6000 running AIX. Command line interface executables are included for Sun4 computers running SunOS 4.1.1 or later and for the DEC RISC ULTRIX platform. The makefiles may have to be modified slightly to be used on other UNIX platforms. The UNIX, Macintosh, and IBM PC versions of CLIPS 6.0 each have a platform specific interface. Source code, a makefile, and an executable for the Windows 3.1 interface version of CLIPS 6.0 are provided only on the IBM PC distribution diskettes. Source code, a makefile, and an executable for the Macintosh interface version of CLIPS 6.0 are provided only on the Macintosh distribution diskettes. Likewise, for the UNIX version of CLIPS 6.0, only source code and a makefile for an X-Windows interface are provided. The X-Windows interface requires MIT's X Window System, Version 11, Release 4 (X11R4), the Athena Widget Set, and the Xmu library. The source code for the Athena Widget Set is provided on the distribution medium. The X-Windows interface has been successfully implemented on a Sun4 running SunOS 4.1.2 with the MIT distribution of X11R4 (not OpenWindows), an SGI Indigo Elan running IRIX 4.0.5, and a DEC Alpha AXP running OSF/1 1.2. The VAX version of CLIPS 6.0 comes only with the generic command line interface. ASCII makefiles for the command line version of CLIPS are provided on all the distribution media for UNIX, VMS, and DOS. Four executables are provided with the IBM PC version: a windowed interface executable for Windows 3.1 built using Borland C++ v3.1, an editor for use with the windowed interface, a command line version of CLIPS for Windows 3.1, and a 386 command line executable for DOS built using Zortech C++ v3.1. All four executables are capable of utilizing extended memory

  15. Development of a Short Version of the Thyroid-Related Patient-Reported Outcome ThyPRO

    DEFF Research Database (Denmark)

    Watt, Torquil; Bjorner, Jakob Bue; Groenvold, Mogens

    2015-01-01

    composite score. Short-form scales were linked to original scales with IRT-based summed-score-linking. Agreement between the short and long form was estimated by agreement plots, intraclass correlations, and mean score levels. Responsiveness was compared by relative validity indices, clinical validity...... was to develop an abbreviated version of the ThyPRO, with conserved good measurement properties. METHODS: A cross-sectional (N = 907) and a longitudinal sample (N = 435) of thyroid patients were analyzed. A graded item response theory (IRT) model was fitted to the cross-sectional data. Short-form scales...... with three items were aimed for, by selecting items with best fit according to the IRT model, avoiding cross-culturally noninvariant items. Seven scales measuring mental and social well-being and function as well as one overall QoL impact item were analyzed in a bifactor model, to develop a supplementary...

  16. Proposal for a revised taxonomy of the family Filoviridae: classification, names of taxa and viruses, and virus abbreviations.

    Science.gov (United States)

    Kuhn, Jens H; Becker, Stephan; Ebihara, Hideki; Geisbert, Thomas W; Johnson, Karl M; Kawaoka, Yoshihiro; Lipkin, W Ian; Negredo, Ana I; Netesov, Sergey V; Nichol, Stuart T; Palacios, Gustavo; Peters, Clarence J; Tenorio, Antonio; Volchkov, Viktor E; Jahrling, Peter B

    2010-12-01

    The taxonomy of the family Filoviridae (marburgviruses and ebolaviruses) has changed several times since the discovery of its members, resulting in a plethora of species and virus names and abbreviations. The current taxonomy has only been partially accepted by most laboratory virologists. Confusion likely arose for several reasons: species names that consist of several words or which (should) contain diacritical marks, the current orthographic identity of species and virus names, and the similar pronunciation of several virus abbreviations in the absence of guidance for the correct use of vernacular names. To rectify this problem, we suggest (1) to retain the current species names Reston ebolavirus, Sudan ebolavirus, and Zaire ebolavirus, but to replace the name Cote d'Ivoire ebolavirus [sic] with Taï Forest ebolavirus and Lake Victoria marburgvirus with Marburg marburgvirus; (2) to revert the virus names of the type marburgviruses and ebolaviruses to those used for decades in the field (Marburg virus instead of Lake Victoria marburgvirus and Ebola virus instead of Zaire ebolavirus); (3) to introduce names for the remaining viruses reminiscent of jargon used by laboratory virologists but nevertheless different from species names (Reston virus, Sudan virus, Taï Forest virus), and (4) to introduce distinct abbreviations for the individual viruses (RESTV for Reston virus, SUDV for Sudan virus, and TAFV for Taï Forest virus), while retaining that for Marburg virus (MARV) and reintroducing that used over decades for Ebola virus (EBOV). Paying tribute to developments in the field, we propose (a) to create a new ebolavirus species (Bundibugyo ebolavirus) for one member virus (Bundibugyo virus, BDBV); (b) to assign a second virus to the species Marburg marburgvirus (Ravn virus, RAVV) for better reflection of now available high-resolution phylogeny; and (c) to create a new tentative genus (Cuevavirus) with one tentative species (Lloviu cuevavirus) for the recently

  17. Miniature Release Mechanism Project

    Data.gov (United States)

    National Aeronautics and Space Administration — The objective is to design, build and functionally test a miniature release mechanism for CubeSats and other small satellites. The WFF 6U satellite structure will be...

  18. EIA new releases

    International Nuclear Information System (INIS)

    1994-09-01

    This report is a compliation of news releases from the Energy Information Administration. The september-october report includes articles on energy conservation, energy consumption in commercial buildings, and a short term energy model for a personal computer

  19. Enhancing tolerability of a measure of social perception in schizophrenia: comparison of short and long Norwegian versions of the Relationships Across Domains test.

    Science.gov (United States)

    Vaskinn, Anja; Fiske, Alan P; Green, Michael F

    2017-05-01

    Relationship perception focuses on social interactions, is reduced in schizophrenia and is related to daily functioning. It can be assessed with the Relationships Across Domains (RAD) test, built on Relational Models Theory which states that people use four relational models to interpret social interaction. RAD is time consuming, low on tolerability and only used in English-speaking countries. We evaluated the psychometric properties of a translated, abbreviated Norwegian version. Sixty-two schizophrenia participants and 56 healthy controls underwent assessments of social and non-social cognition. The schizophrenia group completed functional and clinical measures. RAD's internal consistency was investigated with Cronbach's alphas, group differences with logistic regressions and associations between study variables with Pearson's correlations. RAD was reduced from 25 (Cronbach's alpha = .809) to 12 vignettes (Cronbach's alpha = .815). Schizophrenia participants had significant impairments, with larger effect sizes for the full version. Associations of RAD with study variables were similar for the two versions: smaller for clinical measures and larger for functional and cognitive measures. Results were comparable to results for the English version. The length of the Norwegian RAD was reduced while retaining its psychometric properties, which were similar to the English version. This suggests the test's cross-cultural utility.

  20. Psychometric investigation of the abbreviated concussion symptom inventory in a sample of U.S. Marines returning from combat.

    Science.gov (United States)

    Campbell, Justin S; Pulos, Steven; Haran, F Jay; Tsao, Jack W; Alphonso, Aimee L

    2015-01-01

    This study describes the psychometric investigation of an 11-item symptom checklist, the Abbreviated Concussion Symptom Inventory (ACSI). The ACSI is a dichotomously scored list of postconcussive symptoms associated with mild traumatic brain injury. The ACSI was administered to Marines (N = 1,435) within the 1st month of their return from combat deployments to Afghanistan. Psychometric analyses based upon nonparametric item response theory supported scoring the ACSI via simple summation of symptom endorsements; doing so produced a total score with good reliability (α = .802). Total scores were also found to significantly differentiate between different levels of head injury complexity during deployment, F(3, 1,431) = 100.75, p < .001. The findings support the use of the ASCI in research settings requiring a psychometrically reliable measure of postconcussion symptoms.

  1. Meet interesting abbreviations in clinical mass spectrometry: from compound classification by REIMS to multimodal and mass spectrometry imaging (MSI).

    Science.gov (United States)

    Luptáková, D; Pluháček, T; Palyzová, A; Přichystal, J; Balog, J; Lemr, K; Juránek, I; Havlíček, V

    This feature article discusses two modern mass spectrometry abbreviations in their clinical applications. Rapid evaporative ionization mass spectrometry (REIMS) is reported as a molecular classification tool useful for spectral features definition prior to mass spectrometry imaging (MSI). REIMS is appreciated not only as an ionization technique coupled with a surgical device but particularly as a biomarker discovery tool. For more complex understanding of pathological processes at cellular and molecular levels, the importance of multimodal approach in imaging applications is documented in the context of fiducial markers needed for hyperspectral data fusion collected by optical microscopy, elemental and molecular MSI. Finally, pathogen inactivation needed prior to the sectioning of the infected tissue is reported, and the impact of formaldehyde crosslinking to signal reduction is discussed.

  2. Myeloproliferative neoplasm (MPN) symptom assessment form total symptom score: Prospective international assessment of an abbreviated symptom burden scoring system among patients with MPNs

    NARCIS (Netherlands)

    R.M. Emanuel (Robyn); A.C. Dueck (Amylou); H.L. Geyer (Holly); J.J. Kiladjian; S. Slot (Stefanie); S. Zweegman (Sonja); P.A.W. te Boekhorst (Peter); S. Commandeur (Suzan); H. Schouten (Harry); F. Sackmann (Federico); A.K. Fuentes (Ana Kerguelen); D. Hernández-Maraver (Dolores); C. Pahl (Clemens); M. Griesshammer (Martin); F. Stegelmann (Frank); K. Doehner (Konstanze); T. Lehmann (Thomas); K. Bonatz (Karin); A. Reiter (Alfred); F. Boyer (Francoise); J. Etienne (Jerome); J.-C. Ianotto (Jean-Christophe); D. Ranta (Dana); L. Roy (Lydia); J.-Y. Cahn (Jean-Yves); C.N. Harrison (Claire); D. Radia (Deepti); P. Muxi (Pablo); N. Maldonado (Norman); C. Besses (Carlos); F. Cervantes (Francisco); P.L. Johansson (Peter); T. Barbui (Tiziano); G. Barosi (Giovanni); A.M. Vannucchi (Alessandro); F. Passamonti (Francesco); B. Andreasson (Bjorn); M.L. Ferarri (Maria); A. Rambaldi (Alessandro); J. Samuelsson (Jan); G. Birgegard (Gunnar); A. Tefferi (Ayalew); A.A. Mesa

    2012-01-01

    textabstractPurpose: Myeloproliferative neoplasm (MPN) symptoms are troublesome to patients, and alleviation of this burden represents a paramount treatment objective in the development of MPN-directed therapies. We aimed to assess the utility of an abbreviated symptom score for the most pertinent

  3. Impact of abbreviated lecture with interactive mini-cases vs traditional lecture on student performance in the large classroom.

    Science.gov (United States)

    Marshall, Leisa L; Nykamp, Diane L; Momary, Kathryn M

    2014-12-15

    To compare the impact of 2 different teaching and learning methods on student mastery of learning objectives in a pharmacotherapy module in the large classroom setting. Two teaching and learning methods were implemented and compared in a required pharmacotherapy module for 2 years. The first year, multiple interactive mini-cases with inclass individual assessment and an abbreviated lecture were used to teach osteoarthritis; a traditional lecture with 1 inclass case discussion was used to teach gout. In the second year, the same topics were used but the methods were flipped. Student performance on pre/post individual readiness assessment tests (iRATs), case questions, and subsequent examinations were compared each year by the teaching and learning method and then between years by topic for each method. Students also voluntarily completed a 20-item evaluation of the teaching and learning methods. Postpresentation iRATs were significantly higher than prepresentation iRATs for each topic each year with the interactive mini-cases; there was no significant difference in iRATs before and after traditional lecture. For osteoarthritis, postpresentation iRATs after interactive mini-cases in year 1 were significantly higher than postpresentation iRATs after traditional lecture in year 2; the difference in iRATs for gout per learning method was not significant. The difference between examination performance for osteoarthritis and gout was not significant when the teaching and learning methods were compared. On the student evaluations, 2 items were significant both years when answers were compared by teaching and learning method. Each year, students ranked their class participation higher with interactive cases than with traditional lecture, but both years they reported enjoying the traditional lecture format more. Multiple interactive mini-cases with an abbreviated lecture improved immediate mastery of learning objectives compared to a traditional lecture format, regardless of

  4. Measuring health outcomes of a multidisciplinary care approach in individuals with chronic environmental conditions using an abbreviated symptoms questionnaire

    Directory of Open Access Journals (Sweden)

    Roy Fox

    2008-12-01

    Full Text Available Roy Fox1, Tara Sampalli1, Jonathan Fox11Nova Scotia Environmental Health Centre, Fall River, NS, CanadaAbstract: The Nova Scotia Environmental Health Centre is a treatment facility for individuals with chronic environmental conditions such as multiple chemical sensitivity, chronic fatigue syndrome, fibromyalgia, chronic respiratory conditions and in some cases chronic pain. The premise of care is to provide a patient-centred multidisciplinary care approach leading to self-management strategies. In order to measure the outcome of the treatment in these complex problems, with overlapping diagnoses, symptoms in many body systems and suspected environmental triggers, a detailed symptoms questionnaire was developed specifically for this patient population and validated. Results from a pilot study in which an abbreviated symptoms questionnaire based on the top reported symptoms captured in previous research was used to measure the efficacy of a multidisciplinary care approach in individuals with multiple chemical sensitivity are presented in this paper. The purpose of this study was to examine the extent, type and patterns of changes over time in the top reported symptoms with treatment measured using the abbreviated symptoms questionnaire. A total of 183 active and 109 discharged patients participated in the study where the health status was measured at different time periods of follow up since the commencement of treatment at the Centre. The findings from this study were successful in generating an initial picture of the nature and type of changes in these symptoms. For instance, symptoms such as difficulty concentrating, sinus conditions and tiredness showed early improvement, within the first 6 months of being in treatment, while others, such as fatigue, hoarseness or loss of voice, took longer while others showed inconsistent changes warranting further enquiry. A controlled longitudinal study is planned to confirm the findings of the pilot study

  5. Zgoubi user's guide. Version 4

    International Nuclear Information System (INIS)

    Meot, F.

    1997-01-01

    The computer code Zgoubi calculates trajectories of charged particles in magnetic and electric fields. At the origin specially adapted to the definition and adjustment of beam lines and magnetic spectrometers, it has so-evolved that it allows the study of systems including complex sequences of optical elements such as dipoles, quadrupoles, arbitrary multipoles and other magnetic or electric devices, and is able as well to handle periodic structures. Compared to other codes, it presents several peculiarities: (1) a numerical method for integrating the Lorentz equation, based on Taylor series, which optimizes computing time and provides high accuracy and strong symplecticity, (2) spin tracking, using the same numerical method as for the Lorentz equation, (3) calculation of the synchrotron radiation electric field and spectra in arbitrary magnetic fields, from the ray-tracing outcomes, (4) the possibility of using a mesh, which allows ray-tracing from simulated or measured (1-D, 2-D or 3-D) field maps, (5) Monte Carlo procedures: unlimited number of trajectories, in-flight decay, etc. (6) built-in fitting procedure, (7) multiturn tracking in circular accelerators including many features proper to machine parameter calculation and survey, and also the simulation of time-varying power supplies. The initial version of the Code, dedicated to the ray-tracing in magnetic fields, was developed by D. Garreta and J.C. Faivre at CEN-Saclay in the early 1970's. It was perfected for the purpose of studying the four spectrometers (SPES I, II, III, IV) at the Laboratoire National Saturne (CEA-Saclay, France), and SPEG at Ganil (Caen, France). It is now in use in several national and foreign laboratories. This manual is intended only to describe the details of the most recent version of Zogoubi, which is far from being a open-quotes finished productclose quotes

  6. Adaptation and validation of the Spanish version of the ORTO-15 questionnaire for the diagnosis of orthorexia nervosa.

    Directory of Open Access Journals (Sweden)

    María Laura Parra-Fernandez

    Full Text Available The aim of this study was the validation and analysis of the psychometric properties of a Spanish translation of the ORTO-15 questionnaire; an instrument designed to assess orthorexia nervosa behavior. Four hundred and fifty-four Spanish university students (65% women aged between 18 and 51 years (M = 21.48 ± 0.31 completed the Spanish version of ORTO-15 and the Eating Disorders Inventory-2 (EDI-2. The Principal Component Analysis suggested a three-factor structure for the abbreviated 11-item version of the instrument. The internal consistency of the measurement was adequate (Cronbach's alpha = 0.80. The proposed test demonstrated a good predictive capacity at a threshold value of <25 (efficiency 84%, sensitivity 75% and specificity 84%. Our results support the psychometric properties of the proposed Spanish shortened-version of the ORTO-15 as being a reliable tool for assessing orthorexia nervosa. Its use is expected to greatly contribute to a better understanding of the impact of this disorder in Spain.

  7. USGS library for S-PLUS for Windows -- Release 4.0

    Science.gov (United States)

    Lorenz, David L.; Ahearn, Elizabeth A.; Carter, Janet M.; Cohn, Timothy A.; Danchuk, Wendy J.; Frey, Jeffrey W.; Helsel, Dennis R.; Lee, Kathy E.; Leeth, David C.; Martin, Jeffrey D.; McGuire, Virginia L.; Neitzert, Kathleen M.; Robertson, Dale M.; Slack, James R.; Starn, J. Jeffrey; Vecchia, Aldo V.; Wilkison, Donald H.; Williamson, Joyce E.

    2011-01-01

    Release 4.0 of the U.S. Geological Survey S-PLUS library supercedes release 2.1. It comprises functions, dialogs, and datasets used in the U.S. Geological Survey for the analysis of water-resources data. This version does not contain ESTREND, which was in version 2.1. See Release 2.1 for information and access to that version. This library requires Release 8.1 or later of S-PLUS for Windows. S-PLUS is a commercial statistical and graphical analysis software package produced by TIBCO corporation(http://www.tibco.com/). The USGS library is not supported by TIBCO or its technical support staff.

  8. Release Notes for Whisper-1.1

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Forrest B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Rising, Michael Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Alwin, Jennifer Louise [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-04-27

    Whisper is a statistical analysis package developed in 2014 to support nuclear criticality safety (NCS) validation [1-3]. It uses the sensitivity profile data for an application as computed by MCNP6 [4-6] along with covariance files [7,8] for the nuclear data to determine a baseline upper-subcritical-limit (USL) for the application. Whisper version 1.0 was first developed and used at LANL in 2014 [3]. During 2015-2016, Whisper was updated to version 1.1 [9] and is to be included with the upcoming release of MCNP6.2. This document describes the Whisper-1.1 package that will be included with the MCNP6.2 release during 2017. Specific details are provided on the computer systems supported, the software quality assurance (SQA) procedures, installation, and testing. This document does not address other important topics, such as the importance of sensitivity-uncertainty (SU) methods to NCS validation, the theory underlying SU methodology, tutorials on the usage of MCNP-Whisper, practical approaches to using SU methodology to support and extend traditional validation, etc. There are over 50 documents included with Whisper-1.1 and available in the MCNP Reference Collection on the MCNP website (mcnp.lanl.gov) that address all of those topics and more. In this document, however, a complete bibliography of relevant MCNP-Whisper references is provided.

  9. Why do cells release vesicles?

    NARCIS (Netherlands)

    Nieuwland, Rienk; Sturk, Augueste

    2010-01-01

    Prokaryotic and eukaryotic cells release vesicles into their environment. To answer the question why eukaryotic cells release vesicles, we may learn from prokaryotes. Bacteria release outer membrane vesicles, resembling microparticles, which act as "multi-purpose carriers". They contain signalling

  10. Fuel model studies. Comparison of our present version of GAPCON-THERMAL-2 with results from the EPRI code comparison study. Partial report

    International Nuclear Information System (INIS)

    Malen, K.; Jansson, L.

    1978-08-01

    Runs with our present version of GAPCON-THERMAL-2 have been compared to results from the EPRI code comparison study. Usually also our version of GAPCON predicts high temperatures, 100-300 K or 10-15% higher than average code predictions and experimental results. The well-known temperaturegas release instablility is found also with GAPCON. In this case one identifies the gas release limits 1400 deg C and 1700 deg C as instablility points. (author)

  11. TOUGH2 User's Guide Version 2

    Energy Technology Data Exchange (ETDEWEB)

    Pruess, K.; Oldenburg, C.M.; Moridis, G.J.

    1999-11-01

    TOUGH2 is a numerical simulator for nonisothermal flows of multicomponent, multiphase fluids in one, two, and three-dimensional porous and fractured media. The chief applications for which TOUGH2 is designed are in geothermal reservoir engineering, nuclear waste disposal, environmental assessment and remediation, and unsaturated and saturated zone hydrology. TOUGH2 was first released to the public in 1991; the 1991 code was updated in 1994 when a set of preconditioned conjugate gradient solvers was added to allow a more efficient solution of large problems. The current Version 2.0 features several new fluid property modules and offers enhanced process modeling capabilities, such as coupled reservoir-wellbore flow, precipitation and dissolution effects, and multiphase diffusion. Numerous improvements in previously released modules have been made and new user features have been added, such as enhanced linear equation solvers, and writing of graphics files. The T2VOC module for three-phase flows of water, air and a volatile organic chemical (VOC), and the T2DM module for hydrodynamic dispersion in 2-D flow systems have been integrated into the overall structure of the code and are included in the Version 2.0 package. Data inputs are upwardly compatible with the previous version. Coding changes were generally kept to a minimum, and were only made as needed to achieve the additional functionalities desired. TOUGH2 is written in standard FORTRAN77 and can be run on any platform, such as workstations, PCs, Macintosh, mainframe and supercomputers, for which appropriate FORTRAN compilers are available. This report is a self-contained guide to application of TOUGH2 to subsurface flow problems. It gives a technical description of the TOUGH2 code, including a discussion of the physical processes modeled, and the mathematical and numerical methods used. Illustrative sample problems are presented along with detailed instructions for preparing input data.

  12. Model-based version management system framework

    International Nuclear Information System (INIS)

    Mehmood, W.

    2016-01-01

    In this paper we present a model-based version management system. Version Management System (VMS) a branch of software configuration management (SCM) aims to provide a controlling mechanism for evolution of software artifacts created during software development process. Controlling the evolution requires many activities to perform, such as, construction and creation of versions, identification of differences between versions, conflict detection and merging. Traditional VMS systems are file-based and consider software systems as a set of text files. File based VMS systems are not adequate for performing software configuration management activities such as, version control on software artifacts produced in earlier phases of the software life cycle. New challenges of model differencing, merge, and evolution control arise while using models as central artifact. The goal of this work is to present a generic framework model-based VMS which can be used to overcome the problem of tradition file-based VMS systems and provide model versioning services. (author)

  13. Anthropogenic Biomes of the World, Version 1

    Data.gov (United States)

    National Aeronautics and Space Administration — The Anthropogenic Biomes of the World Dataset, Version 1 describes globally- significant ecological patterns within the terrestrial biosphere caused by sustained...

  14. RAVEN Beta Release

    International Nuclear Information System (INIS)

    Rabiti, Cristian; Alfonsi, Andrea; Cogliati, Joshua Joseph; Mandelli, Diego; Kinoshita, Robert Arthur; Wang, Congjian; Maljovec, Daniel Patrick; Talbot, Paul William

    2016-01-01

    This documents the release of the Risk Analysis Virtual Environment (RAVEN) code. A description of the RAVEN code is provided, and discussion of the release process for the M2LW-16IN0704045 milestone. The RAVEN code is a generic software framework to perform parametric and probabilistic analysis based on the response of complex system codes. RAVEN is capable of investigating the system response as well as the input space using Monte Carlo, Grid, or Latin Hyper Cube sampling schemes, but its strength is focused toward system feature discovery, such as limit surfaces, separating regions of the input space leading to system failure, using dynamic supervised learning techniques. RAVEN has now increased in maturity enough for the Beta 1.0 release.

  15. RAVEN Beta Release

    Energy Technology Data Exchange (ETDEWEB)

    Rabiti, Cristian [Idaho National Lab. (INL), Idaho Falls, ID (United States); Alfonsi, Andrea [Idaho National Lab. (INL), Idaho Falls, ID (United States); Cogliati, Joshua Joseph [Idaho National Lab. (INL), Idaho Falls, ID (United States); Mandelli, Diego [Idaho National Lab. (INL), Idaho Falls, ID (United States); Kinoshita, Robert Arthur [Idaho National Lab. (INL), Idaho Falls, ID (United States); Wang, Congjian [Idaho National Lab. (INL), Idaho Falls, ID (United States); Maljovec, Daniel Patrick [Idaho National Lab. (INL), Idaho Falls, ID (United States); Talbot, Paul William [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2016-02-01

    This documents the release of the Risk Analysis Virtual Environment (RAVEN) code. A description of the RAVEN code is provided, and discussion of the release process for the M2LW-16IN0704045 milestone. The RAVEN code is a generic software framework to perform parametric and probabilistic analysis based on the response of complex system codes. RAVEN is capable of investigating the system response as well as the input space using Monte Carlo, Grid, or Latin Hyper Cube sampling schemes, but its strength is focused toward system feature discovery, such as limit surfaces, separating regions of the input space leading to system failure, using dynamic supervised learning techniques. RAVEN has now increased in maturity enough for the Beta 1.0 release.

  16. StreamStats, version 4

    Science.gov (United States)

    Ries, Kernell G.; Newson, Jeremy K.; Smith, Martyn J.; Guthrie, John D.; Steeves, Peter A.; Haluska, Tana L.; Kolb, Katharine R.; Thompson, Ryan F.; Santoro, Richard D.; Vraga, Hans W.

    2017-10-30

    IntroductionStreamStats version 4, available at https://streamstats.usgs.gov, is a map-based web application that provides an assortment of analytical tools that are useful for water-resources planning and management, and engineering purposes. Developed by the U.S. Geological Survey (USGS), the primary purpose of StreamStats is to provide estimates of streamflow statistics for user-selected ungaged sites on streams and for USGS streamgages, which are locations where streamflow data are collected.Streamflow statistics, such as the 1-percent flood, the mean flow, and the 7-day 10-year low flow, are used by engineers, land managers, biologists, and many others to help guide decisions in their everyday work. For example, estimates of the 1-percent flood (which is exceeded, on average, once in 100 years and has a 1-percent chance of exceedance in any year) are used to create flood-plain maps that form the basis for setting insurance rates and land-use zoning. This and other streamflow statistics also are used for dam, bridge, and culvert design; water-supply planning and management; permitting of water withdrawals and wastewater and industrial discharges; hydropower facility design and regulation; and setting of minimum allowed streamflows to protect freshwater ecosystems. Streamflow statistics can be computed from available data at USGS streamgages depending on the type of data collected at the stations. Most often, however, streamflow statistics are needed at ungaged sites, where no streamflow data are available to determine the statistics.

  17. NOAA Climate Data Record (CDR) of Ocean Heat Fluxes, Version 1.0 (Version Superseded)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Please note, this dataset has been superseded by a newer version (see below). Users should not use this version except in rare cases (e.g., when reproducing previous...

  18. NOAA Climate Data Record (CDR) of Ocean Near Surface Atmospheric Properties, Version 1 (Version Superseded)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Please note, this dataset has been superseded by a newer version (see below). Users should not use this version except in rare cases (e.g., when reproducing previous...

  19. Global Historical Climatology Network - Daily (GHCN-Daily), Version 2 (Version Superseded)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Please note, this dataset has been superseded by a newer version (see below). Users should not use this version except in rare cases (e.g., when reproducing previous...

  20. NOAA Climate Data Record (CDR) of Sea Surface Temperature - WHOI, Version 1.0 (Version Superseded)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Please note, this dataset has been superseded by a newer version (see below). Users should not use this version except in rare cases (e.g., when reproducing previous...

  1. Hydraulic release oil tool

    International Nuclear Information System (INIS)

    Mims, M.G.; Mueller, M.D.; Ehlinger, J.C.

    1992-01-01

    This patent describes a hydraulic release tool. It comprises a setting assembly; a coupling member for coupling to drill string or petroleum production components, the coupling member being a plurality of sockets for receiving the dogs in the extended position and attaching the coupling member the setting assembly; whereby the setting assembly couples to the coupling member by engagement of the dogs in the sockets of releases from and disengages the coupling member in movement of the piston from its setting to its reposition in response to a pressure in the body in exceeding the predetermined pressure; and a relief port from outside the body into its bore and means to prevent communication between the relief port and the bore of the body axially of the piston when the piston is in the setting position and to establish such communication upon movement of the piston from the setting position to the release position and reduce the pressure in the body bore axially of the piston, whereby the reduction of the pressure signals that the tool has released the coupling member

  2. NASTRAN: April 1982 Release

    Science.gov (United States)

    Brugh, R. L.

    1982-01-01

    Latest public release of NASTRAN, April 1982 most efficient and versatile to date. Intended range of applications of NASTRAN includes almost every kind of structure and construction. Users may develop their own analysis capabilities by using Direct Matrix Abstraction Programming (DMAP) language to direct NASTRAN in solution of general matrix problems.

  3. Release the Prisoners Game

    Science.gov (United States)

    Van Hecke, Tanja

    2011-01-01

    This article presents the mathematical approach of the optimal strategy to win the "Release the prisoners" game and the integration of this analysis in a math class. Outline lesson plans at three different levels are given, where simulations are suggested as well as theoretical findings about the probability distribution function and its mean…

  4. CLIPS - C LANGUAGE INTEGRATED PRODUCTION SYSTEM (IBM PC VERSION WITH CLIPSITS)

    Science.gov (United States)

    Riley, , .

    1994-01-01

    version each contain a windowing variant of CLIPS as well as the standard line oriented version. The mouse/window interface version for the PC works with a Microsoft compatible mouse or without a mouse. This window version uses the proprietary CURSES library for the PC, but a working executable of the window version is provided. The window oriented version for the Macintosh includes a version which uses a full Macintosh-style interface, including an integrated editor. This version allows the user to observe the changing fact base and rule activations in separate windows while a CLIPS program is executing. The IBM PC version is available bundled with CLIPSITS, The CLIPS Intelligent Tutoring System for a special combined price (COS-10025). The goal of CLIPSITS is to provide the student with a tool to practice the syntax and concepts covered in the CLIPS User's Guide. It attempts to provide expert diagnosis and advice during problem solving which is typically not available without an instructor. CLIPSITS is divided into 10 lessons which mirror the first 10 chapters of the CLIPS User's Guide. The program was developed for the IBM PC series with a hard disk. CLIPSITS is also available separately as MSC-21679. The CLIPS program is written in C for interactive execution and has been implemented on an IBM PC computer operating under DOS, a Macintosh and DEC VAX series computers operating under VMS or ULTRIX. The line oriented version should run on any computer system which supports a full (Kernighan and Ritchie) C compiler or the ANSI standard C language. CLIPS was developed in 1986 and Version 4.2 was released in July of 1988. Version 4.3 was released in June of 1989.

  5. History of the CERN Web Software Public Releases

    CERN Document Server

    Fluckiger, Francois; CERN. Geneva. IT Department

    2016-01-01

    This note is an extended version of the article “Licencing the Web” (http://home.web.cern.ch/topics/birthweb/licensing-web) published by CERN, Nov 2013, in the “Birth of the Web” series of articles (http://home.cern/topics/birth-web). It describes the successive steps of the public release of the CERN Web software, from public domain to open source, and explains their rationale. It provides in annexes historical documents including release announcement and texts of the licences used by CERN and MIT in public software distributions.

  6. Global Precipitation Climatology Project (GPCP) - Monthly, Version 2.2 (Version Superseded)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Version 2.2 of the dataset has been superseded by a newer version. Users should not use version 2.2 except in rare cases (e.g., when reproducing previous studies...

  7. Energy released in fission

    International Nuclear Information System (INIS)

    James, M.F.

    1969-05-01

    The effective energy released in and following the fission of U-235, Pu-239 and Pu-241 by thermal neutrons, and of U-238 by fission spectrum neutrons, is discussed. The recommended values are: U-235 ... 192.9 ± 0.5 MeV/fission; U-238 ... 193.9 ± 0.8 MeV/fission; Pu-239 ... 198.5 ± 0.8 MeV/fission; Pu-241 ... 200.3 ± 0.8 MeV/fission. These values include all contributions except from antineutrinos and very long-lived fission products. The detailed contributions are discussed, and inconsistencies in the experimental data are pointed out. In Appendix A, the contribution to the total useful energy release in a reactor from reactions other than fission are discussed briefly, and in Appendix B there is a discussion of the variations in effective energy from fission with incident neutron energy. (author)

  8. Border cell release

    DEFF Research Database (Denmark)

    Mravec, Jozef

    2017-01-01

    Plant border cells are specialised cells derived from the root cap with roles in the biomechanics of root growth and in forming a barrier against pathogens. The mechanism of highly localised cell separation which is essential for their release to the environment is little understood. Here I present...... in situ analysis of Brachypodium distachyon, a model organism for grasses which possess type II primary cell walls poor in pectin content. Results suggest similarity in spatial dynamics of pectic homogalacturonan during dicot and monocot border cell release. Integration of observations from different...... species leads to the hypothesis that this process most likely does not involve degradation of cell wall material but rather employs unique cell wall structural and compositional means enabling both the rigidity of the root cap as well as detachability of given cells on its surface....

  9. Carpal tunnel release

    DEFF Research Database (Denmark)

    Larsen, Morten Bo; Sørensen, A I; Crone, K L

    2013-01-01

    A single-blind, randomized, controlled trial was done to compare the results of carpal tunnel release using classic incision, short incision, or endoscopic technique. In total, 90 consecutive cases were included. Follow-up was 24 weeks. We found a significantly shorter sick leave in the endoscopi...... incision could be found. There were no serious complications in either group. The results indicate that the endoscopic procedure is safe and has the benefit of faster rehabilitation and return to work....

  10. EIA new releases

    International Nuclear Information System (INIS)

    1994-12-01

    This report was prepared by the Energy Information Administration. It contains news releases on items of interest to the petroleum, coal, nuclear, electric and alternate fuels industries ranging from economic outlooks to environmental concerns. There is also a listing of reports by industry and an energy education resource listing containing sources for free or low-cost energy-related educational materials for educators and primary and secondary students

  11. Sudden releases of gases

    Directory of Open Access Journals (Sweden)

    Chaloupecká Hana

    2014-03-01

    Full Text Available Conurbations all over the world have enlarged for numberless years. The accidental or intentional releases of gases become more frequent. Therefore, these crises situations have to be studied. The aim of this paper is to describe experiments examining these processes that were carried out in the laboratory of Environmental Aerodynamics of the Institute of Thermomechanics AS CR in Nový Knín. Results show huge puff variability from replica to replica.

  12. Slow-release fertilizer

    Science.gov (United States)

    Ming, Douglas W. (Inventor); Golden, Dadigamuwage C. (Inventor)

    1995-01-01

    A synthetic apatite containing agronutrients and a method for making the apatite are disclosed. The apatite comprises crystalline calcium phosphate having agronutrients dispersed in the crystalline structure. The agronutrients can comprise potassium, magnesium, sulfur, iron, manganese, molybdenum, chlorine, boron, copper and zinc in amounts suited for plant growth. The apatite can optionally comprise a carbonate and/or silicon solubility control agent. The agronutrients are released slowly as the apatite dissolves.

  13. Contact: Releasing the news

    Science.gov (United States)

    Pinotti, Roberto

    The problem of mass behavior after man's future contacts with other intelligences in the universe is not only a challenge for social scientists and political leaders all over the world, but also a cultural time bomb as well. In fact, since the impact of CETI (Contact with Extraterrestrial Intelligence) on human civilization, with its different cultures, might cause a serious socio-anthropological shock, a common and predetermined worldwide strategy is necessary in releasing the news after the contact, in order to keep possible manifestations of fear, panic and hysteria under control. An analysis of past studies in this field and of parallel historical situations as analogs suggests a definite "authority crisis" in the public as a direct consequence of an unexpected release of the news, involving a devastating "chain reaction" process (from both the psychological and sociological viewpoints) of anomie and maybe the collapse of today's society. The only way to prevent all this is to prepare the world's public opinion concerning contact before releasing the news, and to develop a long-term strategy through the combined efforts of scientists, political leaders, intelligence agencies and the mass media, in order to create the cultural conditions in which a confrontation with ETI won't affect mankind in a traumatic way. Definite roles and tasks in this multi-level model are suggested.

  14. Sleep Problem of Children with Autistic Spectrum Disorder Assessed by Children Sleep Habits Questionnaire-Abbreviated in Indonesia and Japan.

    Science.gov (United States)

    Irwanto; Rehatta, Nancy Margarita; Hartini, Sri; Takada, Satoshi

    2016-07-04

    Sleep problems are associated with problems of cognitive functioning, learning, attention and school performance. It has been found that sleep problems are highly prevalent in children with Autistic spectrum disorders (ASD), with rates ranging from 40% to 80%. We aimed to identify the prevalence of sleep problems on children with ASD in Indonesia and Japan. A cross-sectional study was conducted in Surabaya, Indonesia and Kobe, Japan. Children aged 4 -10 years old were enrolled using stratified cluster sampling. Children's Sleep Habits Questionnaire-Abbreviated (CSHQ-A) was used in this research to assess the sleep problems, consisted of 22 questions (NICHD SECCYD-Wisconsin). Data were analyzed with Mann-Whitney U test to compare the CSHQ-A scores between Indonesian and Japanese children, while the proportion of sleep problems was evaluated by chi-square test with 95% confidence interval. Fifty children with ASD were included in this study, 25 children from Kobe, Japan and 25 children from Surabaya, Indonesia. The prevalence of sleep problems on children with ASD was 60% (15 children) in Indonesia and 16% (4 children) in Japan respectively. There were significant differences in total waking during the night and in morning wake for the CSHQ-A between children from Indonesia and Japan (psleep problems on children with ASD was higher in children from Indonesia than from Japan.

  15. Validation of the Abbreviated Brucella AMOS PCR as a Rapid Screening Method for Differentiation of Brucella abortus Field Strain Isolates and the Vaccine Strains, 19 and RB51

    OpenAIRE

    Ewalt, Darla R.; Bricker, Betsy J.

    2000-01-01

    The Brucella AMOS PCR assay was previously developed to identify and differentiate specific Brucella species. In this study, an abbreviated Brucella AMOS PCR test was evaluated to determine its accuracy in differentiating Brucella abortus into three categories: field strains, vaccine strain 19 (S19), and vaccine strain RB51/parent strain 2308 (S2308). Two hundred thirty-one isolates were identified and tested by the conventional biochemical tests and Brucella AMOS PCR. This included 120 isola...

  16. Protecting privacy in data release

    CERN Document Server

    Livraga, Giovanni

    2015-01-01

    This book presents a comprehensive approach to protecting sensitive information when large data collections are released by their owners. It addresses three key requirements of data privacy: the protection of data explicitly released, the protection of information not explicitly released but potentially vulnerable due to a release of other data, and the enforcement of owner-defined access restrictions to the released data. It is also the first book with a complete examination of how to enforce dynamic read and write access authorizations on released data, applicable to the emerging data outsou

  17. Triggered Release from Polymer Capsules

    Energy Technology Data Exchange (ETDEWEB)

    Esser-Kahn, Aaron P. [Univ. of Illinois, Urbana, IL (United States). Beckman Inst. for Advanced Science and Technology and Dept. of Chemistry; Odom, Susan A. [Univ. of Illinois, Urbana, IL (United States). Beckman Inst. for Advanced Science and Technology and Dept. of Chemistry; Sottos, Nancy R. [Univ. of Illinois, Urbana, IL (United States). Beckman Inst. for Advanced Science and Technology and Dept. of Materials Science and Engineering; White, Scott R. [Univ. of Illinois, Urbana, IL (United States). Beckman Inst. for Advanced Science and Technology and Dept. of Aerospace Engineering; Moore, Jeffrey S. [Univ. of Illinois, Urbana, IL (United States). Beckman Inst. for Advanced Science and Technology and Dept. of Chemistry

    2011-07-06

    Stimuli-responsive capsules are of interest in drug delivery, fragrance release, food preservation, and self-healing materials. Many methods are used to trigger the release of encapsulated contents. Here we highlight mechanisms for the controlled release of encapsulated cargo that utilize chemical reactions occurring in solid polymeric shell walls. Triggering mechanisms responsible for covalent bond cleavage that result in the release of capsule contents include chemical, biological, light, thermal, magnetic, and electrical stimuli. We present methods for encapsulation and release, triggering methods, and mechanisms and conclude with our opinions on interesting obstacles for chemically induced activation with relevance for controlled release.

  18. Test documentation for the GENII Software Version 1.485

    International Nuclear Information System (INIS)

    Rittmann, P.D.

    1994-01-01

    Version 1.485 of the GENII software was released by the PNL GENII custodian in December of 1990. At that time the WHC GENII custodian performed several tests to verify that the advertised revisions were indeed present and that these changes had not introduced errors in the calculations normally done by WHC. These tests were not documented at that time. The purpose of this document is to summarize suitable acceptance tests of GENII and compare them with a few hand calculations. The testing is not as thorough as that used by the PNL GENII Custodian, but is sufficient to establish that the GENII program appears to work correctly on WHC managed personal computers

  19. Relative Precision of Inhaler Aerodynamic Particle Size Distribution (APSD) Metrics by Full Resolution and Abbreviated Andersen Cascade Impactors (ACIs): Part 2—Investigation of Bias in Extra-Fine Mass Fraction with AIM-HRT Impactor

    OpenAIRE

    Mitchell, Jolyon P.; Nagel, Mark W.; Doyle, Cathy C.; Ali, Rubina S.; Avvakoumova, Valentina I.; Christopher, J. David; Quiroz, Jorge; Strickland, Helen; Tougas, Terrence; Lyapustina, Svetlana

    2010-01-01

    The purpose of this study was to resolve an anomalously high measure of extra-fine particle fraction (EPF) determined by the abbreviated cascade impactor possibly relevant for human respiratory tract (AIM-HRT) in the experiment described in Part 1 of this two-part series, in which the relative precision of abbreviated impactors was evaluated in comparison with a full resolution Andersen eight-stage cascade impactor (ACI). Evidence that the surface coating used to mitigate particle bounce was ...

  20. The korean version of the body image scale-reliability and validity in a sample of breast cancer patients.

    Science.gov (United States)

    Khang, Dongwoo; Rim, Hyo-Deog; Woo, Jungmin

    2013-03-01

    The Body Image Scale (BIS) developed in collaboration with the European Organization for Research and Treatment of Cancer (EORTC) Quality of Life Study Group is a brief questionnaire for measuring body image concerns in patients with cancer. This study sought to assess the reliability and validity of the Korean version of the Body Image Scale (K-BIS). The participants consisted of 155 postoperative breast cancer patients (56 breast conserving surgery, 56 mastectomy, and 43 oncoplastic surgery). Subjects were evaluated using the K-BIS, the Body-Esteem Scale for Adolescents and Adults (BESAA), the Rosenberg Self-Esteem Scale (RSES), the Hospital Anxiety and Depression Scale (HADS), and the World Health Organization Quality of Life Scale Abbreviated Version (WHOQOL-BREF). Test-retest reliability and internal consistency were examined as a measure of reliability and validity was evaluated by convergent validity, discriminant validity and factor analysis. Cronbach's α value was 0.943. The total score of the K-BIS was negatively correlated with the BESAA (r=0.301, pvalidity, scores were compared between the BCS subgroup, mastectomy subgroup, and oncoplastic surgery subgroup. Difference between the mastectomy subgroup and oncoplastic surgery subgroup was statistically significant (p=0.017). Factor analysis resulted in a single factor solution in three out of four anlyses, accounting for >59% variance. The K-BIS showed good reliability and validity for assessment of body image in Korean breast cancer patients.

  1. Integrated Global Radiosonde Archive (IGRA) Version 2

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Integrated Global Radiosonde Archive (IGRA) Version 2 consists of quality-controlled radiosonde observations of temperature, humidity, and wind at stations across...

  2. Anthropogenic Biomes of the World, Version 1

    Data.gov (United States)

    National Aeronautics and Space Administration — The Anthropogenic Biomes of the World, Version 1 data set describes globally-significant ecological patterns within the terrestrial biosphere caused by sustained...

  3. A new version of the event generator Sibyll

    CERN Document Server

    Riehn, Felix; Fedynitch, Anatoli; Gaisser, Thomas K.; Stanev, Todor

    2016-01-01

    The event generator Sibyll can be used for the simulation of hadronic multiparticle production up to the highest cosmic ray energies. It is optimized for providing an economic description of those aspects of the expected hadronic final states that are needed for the calculation of air showers and atmospheric lepton fluxes. New measurements from fixed target and collider experiments, in particular those at LHC, allow us to test the predictive power of the model version 2.1, which was released more than 10 years ago, and also to identify shortcomings. Based on a detailed comparison of the model predictions with the new data we revisit model assumptions and approximations to obtain an improved version of the interaction model. In addition a phenomenological model for the production of charm particles is implemented as needed for the calculation of prompt lepton fluxes in the energy range of the astrophysical neutrinos recently discovered by IceCube. After giving an overview of the new ideas implemented in Sibyll...

  4. Riola release report

    Energy Technology Data Exchange (ETDEWEB)

    Woodward, E.C.

    1983-08-04

    Eleven hours after execution of the Riola Event (at 0826 PDT on 25 September 1980) in hole U2eq of the Nevada Test Site (NTS), a release of radioactivity began. When the seepage stopped at about noon the following day, up to some 3200 Ci of activity had been dispersed by light variable winds. On 26 September, examination of the geophone records showed six hours of low-level, but fairly continuous, activity before the release. Electrical measurements indicated that most cables were still intact to a depth below the stemming platform. A survey of the ground zero area showed that the seepage came through cracks between the surface conductor and the pad, through cracks in the pad, and through a crack adjacent to the pad around the mousehole (a small hole adjacent to the emplacement hole). To preclude undue radiation exposure or injury from a surprise subsidence, safety measures were instituted. Tritium seepage was suffucient to postpone site activities until a box and pipeline were emplaced to contain and remove the gas. Radiation release modeling and calculations were generally consistent with observations. Plug-hole interaction calculations showed that the alluvium near the bottom of the plug may have been overstressed and that improvements in the design of the plug-medium interface can be made. Experimental studies verified that the surface appearance of the plug core was caused by erosion, but, assuming a normal strength for the plug material, that erosion alone could not account for the disappearance of such a large portion of the stemming platform. Samples from downhole plug experiments show that the plug may have been considerably weaker than had been indicted by quality assurance (QA) samples. 19 references, 32 figures, 10 tables.

  5. SHUFFLE. Windows 95/98/2000 version

    International Nuclear Information System (INIS)

    Slavic, S.; Zefran, B.

    2000-01-01

    Program package SHUFFLE was developed to help the user during fuel loading and unloading operations at a nuclear power plant. The first version, developed in 1992, has been written in the CLIPPER program language and run under the DOS operating system. Since the DOS environment exhibits several drawbacks regarding code portability and flexibility, the recent SHUFFLE version has been transformed to run under the MS Windows operating system. (author)

  6. Allegheny County Toxics Release Inventory

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — The Toxics Release Inventory (TRI) data provides information about toxic substances released into the environment or managed through recycling, energy recovery, and...

  7. Stapes Release in Tympanosclerosis.

    Science.gov (United States)

    Bedri, Es-Hak; Teferi, Nebiat; Redleaf, Miriam

    2018-02-01

    : Tympanosclerosis in the middle ear space is common in Ethiopia and often involves the ossicles and particularly the stapes. Ear operations in Ethiopia are relatively expensive in this country of limited medical resources and a low average living wage. In this setting, 2-stage operations using prostheses become prohibitively expensive. Therefore, the recommended 2-stage approach for tympanic membrane perforation with tympanosclerosis and stapes fixation is impractical for Ethiopia.We present a series of 67 patients who had a single stage tympanoplasty, removal of tympanosclerosis from the stapes suprastructure, and ossicular chain reconstruction using ossicular interposition. Crucial is the surgical technique employed for peeling the mound of tympanosclerotic plaque off of the stapes, which we term the stapes release. Controls were 67 patients with similar perforations and air-bone gap, but no tympanosclerosis. Most controls had ossciular discontinuity and were reconstructed with type III tympanoplasty.Air-bone gap improved in both groups: 18 dB (11 dB standard deviation) in the stapes release group, and 23 dB (11 dB standard deviation) in the control group. Paired t test found these improvements in each group significant at p < 0.001. Among the preoperative subjects there were 40 with air-bone gap greater than 45 dB, and none less than 20 dB. Among the postoperative subjects, none had air-bone gap worse than 45 dB, while 25/67 (37%) stapes release and 44/67 (66%) controls had air-bone gap better than 20 dB. Three patients in each group failed to close their perforations completely (96% closure rate).The only complications were two early cases of transient facial nerve weakness, which was avoided in subsequent cases by an alteration in technique. There was no deterioration of sensorineural hearing levels in either group's subjects postoperatively.In conclusion, stapes release with ossicular interposition can be performed at the same time as

  8. Continuous-energy version of KENO V.a for criticality safety applications

    International Nuclear Information System (INIS)

    Dunn, Michael E.; Greene, N. Maurice; Petrie, Lester M.

    2003-01-01

    KENO V.a is a multigroup Monte Carlo code that solves the Boltzmann transport equation and is used extensively in the criticality safety community to calculate the effective multiplication factor of systems with fissionable material. In this work, a continuous-energy or pointwise version of KENO V.a has been developed by first designing a new continuous-energy cross-section format and then by developing the appropriate Monte Carlo transport procedures to sample the new cross-section format. In order to generate pointwise cross sections for a test library, a series of cross-section processing modules were developed and used to process 50 ENDF/B-6 Release 7 nuclides for the test library. Once the cross-section processing procedures were in place, a continuous-energy version of KENO V.a was developed and tested by calculating 21 critical benchmark experiments. The point KENO-calculated results for the 21 benchmarks are in agreement with calculated results obtained with the multigroup version of KENO V.a using the 238-group ENDF/B-5 and 199-group ENDF/B-6 Release 3 libraries. Based on the calculated results with the prototypic cross-section library, a continuous-energy version of the KENO V.a code has been successfully developed and demonstrated for modeling systems with fissionable material. (author)

  9. First validation of the new continuous energy version of the MORET5 Monte Carlo code

    International Nuclear Information System (INIS)

    Miss, Joachim; Bernard, Franck; Forestier, Benoit; Haeck, Wim; Richet, Yann; Jacquet, Olivier

    2008-01-01

    The 5.A.1 version is the next release of the MORET Monte Carlo code dedicated to criticality and reactor calculations. This new version combines all the capabilities that are already available in the multigroup version with many new and enhanced features. The main capabilities of the previous version are the powerful association of a deterministic and Monte Carlo approach (like for instance APOLLO-MORET), the modular geometry, five source sampling techniques and two simulation strategies. The major advance in MORET5 is the ability to perform calculations either a multigroup or a continuous energy simulation. Thanks to these new developments, we now have better control over the whole process of criticality calculations, from reading the basic nuclear data to the Monte Carlo simulation itself. Moreover, this new capability enables us to better validate the deterministic-Monte Carlo multigroup calculations by performing continuous energy calculations with the same code, using the same geometry and tracking algorithms. The aim of this paper is to describe the main options available in this new release, and to present the first results. Comparisons of the MORET5 continuous-energy results with experimental measurements and against another continuous-energy Monte Carlo code are provided in terms of validation and time performance. Finally, an analysis of the interest of using a unified energy grid for continuous energy Monte Carlo calculations is presented. (authors)

  10. Particle and heavy ion transport code system, PHITS, version 2.52

    International Nuclear Information System (INIS)

    Sato, Tatsuhiko; Matsuda, Norihiro; Hashimoto, Shintaro; Iwamoto, Yosuke; Noda, Shusaku; Ogawa, Tatsuhiko; Nakashima, Hiroshi; Fukahori, Tokio; Okumura, Keisuke; Kai, Tetsuya; Niita, Koji; Iwase, Hiroshi; Chiba, Satoshi; Furuta, Takuya; Sihver, Lembit

    2013-01-01

    An upgraded version of the Particle and Heavy Ion Transport code System, PHITS2.52, was developed and released to the public. The new version has been greatly improved from the previously released version, PHITS2.24, in terms of not only the code itself but also the contents of its package, such as the attached data libraries. In the new version, a higher accuracy of simulation was achieved by implementing several latest nuclear reaction models. The reliability of the simulation was improved by modifying both the algorithms for the electron-, positron-, and photon-transport simulations and the procedure for calculating the statistical uncertainties of the tally results. Estimation of the time evolution of radioactivity became feasible by incorporating the activation calculation program DCHAIN-SP into the new package. The efficiency of the simulation was also improved as a result of the implementation of shared-memory parallelization and the optimization of several time-consuming algorithms. Furthermore, a number of new user-support tools and functions that help users to intuitively and effectively perform PHITS simulations were developed and incorporated. Due to these improvements, PHITS is now a more powerful tool for particle transport simulation applicable to various research and development fields, such as nuclear technology, accelerator design, medical physics, and cosmic-ray research. (author)

  11. Computed tomography abbreviated assessment of sarcopenia following trauma: The CAAST measurement predicts 6-month mortality in older adult trauma patients.

    Science.gov (United States)

    Leeper, Christine M; Lin, Elizabeth; Hoffman, Marcus; Fombona, Anisleidy; Zhou, Tianhua; Kutcher, Matthew; Rosengart, Matthew; Watson, Gregory; Billiar, Timothy; Peitzman, Andrew; Zuckerbraun, Brian; Sperry, Jason

    2016-05-01

    Older adult trauma patients are at increased risk of poor outcome, both immediately after injury and beyond hospital discharge. Identifying patients early in the hospital stay who are at increased risk of death after discharge can be challenging. Retrospective analysis was performed using our trauma registry linked with the social security death index from 2010 to 2014. Age was categorized as 18 to 64 and 65 years or older. We calculated mortality rates by age category then selected elderly patients with mechanism of injury being a fall for further analysis. Computed Tomography Abbreviated Assessment of Sarcopenia for Trauma (CAAST) was obtained by measuring psoas muscle cross-sectional area adjusted for height and weight. Kaplan-Meier survival analysis was performed, and proportional hazards regression modeling was used to determine independent risk factors for in-hospital and out-of-hospital mortality. A total of 23,622 patients were analyzed (16,748, aged 18-64 years; and 6,874, aged 65 or older). In-hospital mortality was 1.96% for ages 18 to 64 and 7.19% for age 65 or older (p older (p older group included injury characteristics such as ISS, admission vitals, and head injury. Predictors of postdischarge mortality for age 65or older included skilled nursing before admission, disposition, and mechanism of injury being a fall. A total of 57.5% (n = 256) of older patients who sustained a fall met criteria for sarcopenia. Sarcopenia was the strongest predictor of out-of-hospital mortality in this cohort with a hazard ratio of 4.77 (95% confidence interval, 2.71-8.40; p older adults. The CAAST measurement is an efficient and inexpensive measure that can allow clinicians to target older trauma patients at risk of poor outcome for early intervention and/or palliative care services. Prognostic and epidemiologic study, level III.

  12. An Abbreviated Protocol for In Vitro Generation of Functional Human Embryonic Stem Cell-Derived Beta-Like Cells.

    Directory of Open Access Journals (Sweden)

    Mohammad Massumi

    Full Text Available The ability to yield glucose-responsive pancreatic beta-cells from human pluripotent stem cells in vitro will facilitate the development of the cell replacement therapies for the treatment of Type 1 Diabetes. Here, through the sequential in vitro targeting of selected signaling pathways, we have developed an abbreviated five-stage protocol (25-30 days to generate human Embryonic Stem Cell-Derived Beta-like Cells (ES-DBCs. We showed that Geltrex, as an extracellular matrix, could support the generation of ES-DBCs more efficiently than that of the previously described culture systems. The activation of FGF and Retinoic Acid along with the inhibition of BMP, SHH and TGF-beta led to the generation of 75% NKX6.1+/NGN3+ Endocrine Progenitors. The inhibition of Notch and tyrosine kinase receptor AXL, and the treatment with Exendin-4 and T3 in the final stage resulted in 35% mono-hormonal insulin positive cells, 1% insulin and glucagon positive cells and 30% insulin and NKX6.1 co-expressing cells. Functionally, ES-DBCs were responsive to high glucose in static incubation and perifusion studies, and could secrete insulin in response to successive glucose stimulations. Mitochondrial metabolic flux analyses using Seahorse demonstrated that the ES-DBCs could efficiently metabolize glucose and generate intracellular signals to trigger insulin secretion. In conclusion, targeting selected signaling pathways for 25-30 days was sufficient to generate ES-DBCs in vitro. The ability of ES-DBCs to secrete insulin in response to glucose renders them a promising model for the in vitro screening of drugs, small molecules or genes that may have potential to influence beta-cell function.

  13. Use of an abbreviated neuroscience education approach in the treatment of chronic low back pain: a case report.

    Science.gov (United States)

    Louw, Adriaan; Puentedura, Emilio Louie; Mintken, Paul

    2012-01-01

    Chronic low back pain (CLBP) remains prevalent in society, and conservative treatment strategies appear to have little effect. It is proposed that patients with CLBP may have altered cognition and increased fear, which impacts their ability to move, perform exercise, and partake in activities of daily living. Neuroscience education (NE) aims to change a patient's cognition regarding their pain state, which may result in decreased fear, ultimately resulting in confrontation of pain barriers and a resumption of normal activities. A 64-year-old female with history of CLBP was the patient for this case report. A physical examination, the Numeric Pain Rating Scale (NPRS), Oswestry Disability Index (ODI), Fear-Avoidance Beliefs Questionnaire (FABQ), and Zung Depression Scale were assessed during her initial physical therapy visit, immediately after her first physical therapy session, and at 7-month follow-up. Treatment consisted of an abbreviated NE approach, exercises (range of motion, stretches, and cardiovascular), and aquatic therapy. She attended twice a week for 4 weeks, or 8 visits total. Pre-NE, the patient reported NPRS = 9/10; ODI = 54%; FABQ-W = 25/42,; FABQ-PA = 20/24, and Zung = 58. Immediately following the 75-minute evaluation and NE session, the patient reported improvement in all four outcome measures, most notably a reduction in the FABQ-W score to 2/42 and the FABQ-PA to 1/24. At a 7-month follow-up, all outcome measures continued to be improved. NE aimed at decreasing fear associated with movement may be a valuable adjunct to movement-based therapy, such as exercise, for patients with CLBP.

  14. Improvements to the MODIS Land Products in Collection Version 6

    Science.gov (United States)

    Wolfe, R. E.; Devadiga, S.; Masuoka, E. J.; Running, S. W.; Vermote, E.; Giglio, L.; Wan, Z.; Riggs, G. A.; Schaaf, C.; Myneni, R. B.; Friedl, M. A.; Wang, Z.; Sulla-menashe, D. J.; Zhao, M.

    2013-12-01

    single land cover product used for the entire mission in the C5 reprocessing. The C6 products are expected to be released from the Distributed Active Archive Center (DAAC) soon after the reprocessing begins. To facilitate user acquaintance with products from the new version and independent evaluation of C6 by comparison of two versions, MODAPS plans to continue generation of products from both versions for at least a year after completion of the C6 reprocessing after which C5 processing will be discontinued.

  15. London SPAN version 4 parameter file format

    International Nuclear Information System (INIS)

    2004-06-01

    Powernext SA is a Multilateral Trading Facility in charge of managing the French power exchange through an optional and anonymous organised trading system. Powernext SA collaborates with the clearing organization LCH.Clearnet SA to secure and facilitate the transactions. The French Standard Portfolio Analysis of Risk (SPAN) is a system used by LCH.Clearnet to calculate the initial margins from and for its clearing members. SPAN is a computerized system which calculates the impact of several possible variations of rates and volatility on by-product portfolios. The initial margin call is equal to the maximum probable loss calculated by the system. This document contains details of the format of the London SPAN version 4 parameter file. This file contains all the parameters and risk arrays required to calculate SPAN margins. London SPAN Version 4 is an upgrade from Version 3, which is also known as LME SPAN. This document contains the full revised file specification, highlighting the changes from Version 3 to Version 4

  16. Simion 3D Version 6.0 User`s Manual

    Energy Technology Data Exchange (ETDEWEB)

    Dahl, D.A.

    1995-11-01

    The original SIMION was an electrostatic lens analysis and design program developed by D.C. McGilvery at Latrobe University, Bundoora Victoria, Australia, 1977. SIMION for the PC, developed at the Idaho National Engineering Laboratory, shares little more than its name with the original McGilvery version. INEL`s fifth major SIMION release, version 6.0, represents a quantum improvement over previous versions. This C based program can model complex problems using an ion optics workbench that can hold up to 200 2D and/or 3D electrostatic/magnetic potential arrays. Arrays can have up to 10,000,000 points. SIMION 3D`s 32 bit virtual Graphics User Interface provides a highly interactive advanced user environment. All potential arrays are visualized as 3D objects that the user can cut away to inspect ion trajectories and potential energy surfaces. User programs have been greatly extended in versatility and power. A new geometry file option supports the definition of highly complex array geometry. Extensive algorithm modifications have dramatically improved this version`s computational speed and accuracy.

  17. [External cephalic version: experience about 237 versions at Port-Royal maternity].

    Science.gov (United States)

    Le Bret, T; Grangé, G; Goffinet, F; Cabrol, D

    2004-06-01

    To evaluate the effectiveness of external cephalic version for reducing the rate of cesarean section by preserving fetal safety. A retrospective review of 237 external cephalic versions between January 1, 1998 and December 31, 2000 was conducted at Port Royal maternity. The success rate of external cephalic version was 50.6%. When version failed vaginal birth could be allowed after strict evaluation. The rate of cesarean section was 12.5% in the success group and 53% in the unsuccessful group, two thirds were planned. The overall rate of vaginal birth among breech presentations was 67%. After version there were 3.4% abnormal fetal heart rate tracings and 2.9% positive Kleihauer tests. No major complications occurred. Successful external cephalic version was associated with statistically significant higher multiparity, complete breech out of the pelvis and normal amniotic fluid Volume. External cephalic version reduces the cesarean section rate by about 20.5% among breech presentations and so, lowers maternal morbidity. External cephalic version could be proposed to the patients when safety criteria are respected and close fetal monitoring is maintained.

  18. Spanish version of Colquitt's Organizational Justice Scale.

    Science.gov (United States)

    Díaz-Gracia, Liliana; Barbaranelli, Claudio; Moreno-Jiménez, Bernardo

    2014-01-01

    Organizational justice (OJ) is an important predictor of different work attitudes and behaviors. Colquitt's Organizational Justice Scale (COJS) was designed to assess employees' perceptions of fairness. This scale has four dimensions: distributive, procedural, informational, and interpersonal justice. The objective of this study is to validate it in a Spanish sample. The scale was administered to 460 Spanish employees from the service sector. 40.4% were men and 59.6% women. The Confirmatory Factor Analysis (CFA) supported the four dimensions structure for Spanish version of COJS. This model showed a better fit to data that the others models tested. Cronbach's alpha obtained for subscales ranged between .88 and .95. Correlations of the Spanish version of COJS with measures of incivility and job satisfaction were statistically significant and had a moderate to high magnitude, indicating a reasonable degree of construct validity. The Spanish version of COJS has adequate psychometric properties and may be of value in assessing OJ in Spanish setting.

  19. Special population planner, version 4.0.

    Energy Technology Data Exchange (ETDEWEB)

    Kuiper, J.; Tanzman, E.; Metz, W.

    2007-03-26

    Emergencies happen every day. Many are caused by storms or auto accidents and can be planned for, if not predicted. Emergencies resulting from natural hazards often affect a large number of people, and planning for them can be difficult, since knowledge of the needs of the people involved is generally unavailable. Emergencies resulting from accidents at industrial and military facilities can also be large scale in nature if people must be evacuated or sheltered in place. Federal planning for large scale emergencies is the responsibility of the Federal Emergency Management Agency (FEMA), which provides assistance to various emergency management agencies at the national, state and local level. More information about FEMA is available at http://www.fema.gov/. The purpose of the Special Population Planner (SPP) is to help emergency planners address the needs of persons with special needs. The exact definition of 'special population' is a policy decision. Policymakers have included a variety of groups in this term, such as persons with disabilities, those who do not have vehicles with which to evacuate, children who are unattended at times (latchkey children), and many others. The SPP was developed initially for the Alabama Emergency Management Agency as part of its Chemical Stockpile Emergency Preparedness Program (CSEPP), which aids emergency planning and preparedness in communities surrounding military installations across the United States where chemical weapons are stored pending their destruction under federal law. Like that specialized application, this open-source version contains a set of specialized Geographic Information System (GIS) tools to facilitate emergency planning on behalf of persons with special needs, regardless of how the term is defined. While the original SPP system was developed for emergency planning relating to chemical hazards, it can be applied to other threats as well. It is apparent from Hurricane Katrina and other natural and

  20. Collections cited under abbreviations

    NARCIS (Netherlands)

    Jacobs, M.

    1967-01-01

    The practice of citing collections made in institutional series by the letters of that series instead of by the collector’s name (e.g. FB 23435 instead of Aquilar & Valderrama FB 23435) led, with the publication of so many Identification Lists, to the dishing out of an alphabet soup that many a

  1. LIST OF ABBREVIATIONS

    African Journals Online (AJOL)

    four

    2013-02-20

    Feb 20, 2013 ... microsatellite or simple sequence repeat (SSR) markers. Twenty .... The amplified SSR DNA bands representing different alleles were. Berilus et al. .... 248 210. 228. RM152. 53 gaaaccaccacacctcaccg ccgtagaccttcttgaagtag. 133. 157 135. 153. 9. RM316. 55 ctagttgggcatacgatggc acgcttatatgttacgtcaac. 194.

  2. COMMERCIAL SNF ACCIDENT RELEASE FRACTIONS

    Energy Technology Data Exchange (ETDEWEB)

    S.O. Bader

    1999-10-18

    The purpose of this design analysis is to specify and document the total and respirable fractions for radioactive materials that are released from an accident event at the Monitored Geologic Repository (MGR) involving commercial spent nuclear fuel (CSNF) in a dry environment. The total and respirable release fractions will be used to support the preclosure licensing basis for the MGR. The total release fraction is defined as the fraction of total CSNF assembly inventory, typically expressed as an activity inventory (e.g., curies), of a given radionuclide that is released to the environment from a waste form. The radionuclides are released from the inside of breached fuel rods (or pins) and from the detachment of radioactive material (crud) from the outside surfaces of fuel rods and other components of fuel assemblies. The total release fraction accounts for several mechanisms that tend to retain, retard, or diminish the amount of radionuclides that are available for transport to dose receptors or otherwise can be shown to reduce exposure of receptors to radiological releases. The total release fraction includes a fraction of airborne material that is respirable and could result in inhalation doses. This subset of the total release fraction is referred to as the respirable release fraction. Potential accidents may involve waste forms that are characterized as either bare (unconfined) fuel assemblies or confined fuel assemblies. The confined CSNF assemblies at the MGR are contained in shipping casks, canisters, or disposal containers (waste packages). In contrast to the bare fuel assemblies, the container that confines the fuel assemblies has the potential of providing an additional barrier for diminishing the total release fraction should the fuel rod cladding breach during an accident. However, this analysis will not take credit for this additional bamer and will establish only the total release fractions for bare unconfined CSNF assemblies, which may however be

  3. Patient perspectives with abbreviated versus standard pre-test HIV counseling in the prenatal setting: a randomized-controlled, non-inferiority trial.

    Science.gov (United States)

    Cohan, Deborah; Gomez, Elvira; Greenberg, Mara; Washington, Sierra; Charlebois, Edwin D

    2009-01-01

    In the US, an unacceptably high percentage of pregnant women do not undergo prenatal HIV testing. Previous studies have found increased uptake of prenatal HIV testing with abbreviated pre-test counseling, however little is known about patient decision making, testing satisfaction and knowledge in this setting. A randomized-controlled, non-inferiority trial was conducted from October 2006 through February 2008 at San Francisco General Hospital (SFGH), the public teaching hospital of the City and County of San Francisco. A total of 278 English- and Spanish-speaking pregnant women were randomized to receive either abbreviated or standard nurse-performed HIV test counseling at the initial prenatal visit. Patient decision making experience was compared between abbreviated versus standard HIV counseling strategies among a sample of low-income, urban, ethnically diverse prenatal patients. The primary outcome was the decisional conflict score (DCS) using O'Connor low-literacy scale and secondary outcomes included satisfaction with test decision, basic HIV knowledge and HIV testing uptake. We conducted an intention-to-treat analysis of 278 women--134 (48.2%) in the abbreviated arm (AA) and 144 (51.8%) in the standard arm (SA). There was no significant difference in the proportion of women with low decisional conflict (71.6% in AA vs. 76.4% in SA, p = .37), and the observed mean difference between the groups of 3.88 (95% CI: -0.65, 8.41) did not exceed the non-inferiority margin. HIV testing uptake was very high (97. 8%) and did not differ significantly between the 2 groups (99.3% in AA vs. 96.5% in SA, p = .12). Likewise, there was no difference in satisfaction with testing decision (97.8% in AA vs. 99.3% in SA, p = .36). However, women in AA had significantly lower mean HIV knowledge scores (78.4%) compared to women in SA (83.7%, pprocess, while associated with slightly lower knowledge, does not compromise patient decision making or satisfaction regarding HIV testing

  4. Underground water stress release models

    Science.gov (United States)

    Li, Yong; Dang, Shenjun; Lü, Shaochuan

    2011-08-01

    The accumulation of tectonic stress may cause earthquakes at some epochs. However, in most cases, it leads to crustal deformations. Underground water level is a sensitive indication of the crustal deformations. We incorporate the information of the underground water level into the stress release models (SRM), and obtain the underground water stress release model (USRM). We apply USRM to the earthquakes occurred at Tangshan region. The analysis shows that the underground water stress release model outperforms both Poisson model and stress release model. Monte Carlo simulation shows that the simulated seismicity by USRM is very close to the real seismicity.

  5. Cobalt release from inexpensive jewellery

    DEFF Research Database (Denmark)

    Thyssen, Jacob Pontoppidan; Jellesen, Morten Stendahl; Menné, Torkil

    2010-01-01

    . Conclusions: This study showed that only a minority of inexpensive jewellery purchased in Denmark released cobalt when analysed with the cobalt spot test. As fashion trends fluctuate and we found cobalt release from dark appearing jewellery, cobalt release from consumer items should be monitored in the future....... Microstructural characterization was made using scanning electron microscope (SEM) and energy-dispersive spectroscopy (EDS). Results: Cobalt release was found in 4 (1.1%) of 354 items. All these had a dark appearance. SEM/EDS was performed on the four dark appearing items which showed tin-cobalt plating on these...

  6. Flash release - an alternative for releasing complex mems devices

    NARCIS (Netherlands)

    Deladi, S.; Svetovoy, Vitaly; Krijnen, Gijsbertus J.M.; Elwenspoek, Michael Curt

    2004-01-01

    A novel time-saving and cost-effective release technique has been developed and is described. The physical nature of the process is explained in combination with experimental observations. The results of the flash release process are compared with those of freeze-drying and supercritical CO2

  7. Flash release an alternative for releasing complex MEMS devices

    NARCIS (Netherlands)

    Deladi, S.; Krijnen, Gijsbertus J.M.; Elwenspoek, Michael Curt

    2004-01-01

    A novel time-saving and cost-effective release technique has been developed and is described. The physical nature of the process is explained in combination with experimental observations. The results of the flash release process are compared with those of freeze-drying and supercritical CO2

  8. Sustained-release, extended-release, and other time-release formulations in neuropsychiatry.

    Science.gov (United States)

    Andrade, Chittaranjan

    2015-08-01

    Pills and capsules may release their contents within minutes of ingestion; these are immediate-release formulations. Pills and capsules may also release their contents after a time lag, or a little at a time, or in some other predetermined way; these are time-release formulations. Many drugs in psychiatry have been time-release formulated to reduce their local adverse effects in the gastrointestinal tract, to reduce adverse effects associated with peak blood levels, or to artificially extend their half-life. Time-release formulations are associated with the added advantages of convenience of dosing, improved compliance, and less fluctuation in blood levels across the course of the day. A disadvantage of time-release formulations is that they may be incompletely absorbed; this is a serious issue in patients with acute or chronic intestinal hurry disorders, such as gastroenteritis or irritable bowel syndrome. Time-release formulations may also be more expensive than immediate-release formulations. © Copyright 2015 Physicians Postgraduate Press, Inc.

  9. An improved version of the Green's function molecular dynamics method

    Science.gov (United States)

    Kong, Ling Ti; Denniston, Colin; Müser, Martin H.

    2011-02-01

    .e., the crystal is rigidly translated, the force on any atom must be zero. This is known as the translational invariance, leading to the so-called acoustic sum rule: ∑Φ(Γ)=0 where Φ(Γ) is the kα,kβ component of the effective elastic coefficients at the Γ-point; we will denote it as Φ hereafter. α and β enumerate the Cartesian directions. In addition, Φ should be Hermitian (or symmetric, since at the Γ-point, the imaginary part of Φ is zero.) because of the commutative nature of the force constants: Φkα,kβΓ=Φkβ,kαΓ. These two properties are expected for Φ, yet the ASR is not satisfied during the measurement (done by FixGFC) because of the finite size effect. A scheme is therefore needed to enforce ASR on Φ afterwards, while the symmetric nature of Φ should be retained. We list below the detailed scheme adopted to enforce ASR implemented in the improved version of GFMD together with some other revisions to the code after the previous release. Restrictions: By adopting the new method to enforce the acoustic sum rule, the restriction that atoms in the Green's function slab must be in the same layer is lifted, while it is still necessary to ensure that the mean equilibrium positions of atoms in the Green's function slab satisfy the Born-von Karman boundary condition. In addition, only deformations within the harmonic regime are expected in the slab during Green's function molecular dynamics simulations. Additional comments: The new version is not compatible with the previous one: the contents in the binary file are different and therefore the effective elastic coefficients measured by the previous version of FixGFC cannot be used by the current version of FixGFMD. Running time: FixGFC varies from minutes to days, like a typical molecular dynamics simulation, depending on the system size, the number of processors used, and the complexity of the force field. FixGFMD varies from seconds to hours, depending on the system size and the number of processors

  10. The effects of FreeSurfer version, workstation type, and Macintosh operating system version on anatomical volume and cortical thickness measurements.

    Directory of Open Access Journals (Sweden)

    Ed H B M Gronenschild

    Full Text Available FreeSurfer is a popular software package to measure cortical thickness and volume of neuroanatomical structures. However, little if any is known about measurement reliability across various data processing conditions. Using a set of 30 anatomical T1-weighted 3T MRI scans, we investigated the effects of data processing variables such as FreeSurfer version (v4.3.1, v4.5.0, and v5.0.0, workstation (Macintosh and Hewlett-Packard, and Macintosh operating system version (OSX 10.5 and OSX 10.6. Significant differences were revealed between FreeSurfer version v5.0.0 and the two earlier versions. These differences were on average 8.8 ± 6.6% (range 1.3-64.0% (volume and 2.8 ± 1.3% (1.1-7.7% (cortical thickness. About a factor two smaller differences were detected between Macintosh and Hewlett-Packard workstations and between OSX 10.5 and OSX 10.6. The observed differences are similar in magnitude as effect sizes reported in accuracy evaluations and neurodegenerative studies.The main conclusion is that in the context of an ongoing study, users are discouraged to update to a new major release of either FreeSurfer or operating system or to switch to a different type of workstation without repeating the analysis; results thus give a quantitative support to successive recommendations stated by FreeSurfer developers over the years. Moreover, in view of the large and significant cross-version differences, it is concluded that formal assessment of the accuracy of FreeSurfer is desirable.

  11. Dry release of suspended nanostructures

    DEFF Research Database (Denmark)

    Forsén, Esko Sebastian; Davis, Zachary James; Dong, M.

    2004-01-01

    A dry release method for fabrication of suspended nanostructures is presented. The technique has been combined with an anti-stiction treatment for fabrication of nanocantilever based nanoelectromechanical systems (NEMS). The process combines a dry release method, using a supporting layer of photo...

  12. Press Oil Final Release Survey

    Energy Technology Data Exchange (ETDEWEB)

    Whicker, Jeffrey Jay [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Ruedig, Elizabeth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-11

    There are forty-eight 55 gallon barrels filled with hydraulic oil that are candidates for release and recycle. This oil needs to be characterized prior to release. Principles of sampling as provided in MARSAME/MARSSIM approaches were used as guidance for sampling.

  13. Abbreviated closure for remote damage control laparotomy in extreme environments: A randomized trial of sutures versus wound clamps comparing terrestrial and weightless conditions.

    Science.gov (United States)

    Kirkpatrick, Andrew W; McKee, Jessica Lynn; Tien, Colonel Homer; LaPorta, Anthony J; Lavell, Kit; Leslie, Tim; McBeth, Paul B; Roberts, Derek J; Ball, Chad G

    2017-05-01

    Far-Forward Damage Control Laparotomies (DCLs) might provide direct-compression of visceral hemorrhage, however, suturing is a limiting factor, especially for non-physicians. We thus compared abbreviated skin closures comparing skin-suture (SS) versus wound-clamp (WC), on-board a research aircraft in weightlessness (0g) and normal gravity (1g). Surgeons conducted DCLs on a surgical-simulator; onboard the hangered-aircraft (1g), or during parabolic flight (0g), randomized to either WC or SS. Ten surgeons participated. Two (40%) surgeons randomized to suture in 0g were incapacitated with motion-sickness, and none were able to close in either 1 or 0g. With WC, two completely closed in 1g as did three in 0g, despite having longer incisions (p = 0.016). Overall skin-closure with WC was significantly greater in both 1g (p = 0.016) and 0g (p = 0.008). WC was more effective in 1g and particularly 0g. Future studies should address the utility of abbreviated WC abdominal closure to facilitate potential Far-Forward DCL. ID ISRCTN/77929274. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Content and functions of the pilot version 1 of RODOS/RESY

    International Nuclear Information System (INIS)

    Benz, G.; Ehrhardt, J.; Faude, D.; Fischer, F.; Paesler-Sauer, J.; Rafat, M.; Schichtel, T.; Schuele, O.; Steinhauer, C.

    1994-01-01

    RODOS/RESY is an integrated real-time on-line decision support system for external emergency management after nuclear accidents. It is part of the comprehensive RODOS-system (real-time on-line decision support), which is designed for use in Europe after accidental releases of radioactive material to the atmosphere and hydrosphere. RODOS/RESY is limited in its applicability to the near range of nuclear facilities and the early phase of an accident with airborne radioactive releases. Therefore, it serves directly as a decision-aiding tool for countermeasure actions in the responsibility of local emergency management authorities. At present, RODOS is and RandD project which aims at the further development for operational use of the first prototype version completed in autumn 1992. A first step towards this goal will be the pilot version 1 of RODOS/RESY, which bill be ready by the end of 1994 for coupling to monitoring networks of nuclear reactor remote control surveillance systems and pre-operational use. The report describes the structure, content and functions of this pilot version. (orig.) [de

  15. Validation of the German version of the Burn Specific Health Scale-Brief (BSHS-B).

    Science.gov (United States)

    Müller, Astrid; Smits, Dirk; Jasper, Stefanie; Berg, Lea; Claes, Laurence; Ipaktchi, Ramin; Vogt, Peter M; de Zwaan, Martina

    2015-09-01

    The Burn Specific Health Scale-Brief (BSHS-B) is recognized as a valid self-rating scale to evaluate quality of life after burn. To validate the translated German version of the BSHS-B. One hundred and forty one burn survivors (65.2% men) with a mean age of 49.62 years (SD=15.16) and a mean duration after burn of 45.01 months (SD=26.18) answered the BSHS-B. Factor structure was tested by using confirmatory factor analysis, reliability (internal consistency) of the scales was determined by means of Cronbach's α. Construct validity was explored through correlations between the BSHS-B and the Short-Form 8 Health Survey (SF-8). In addition, the know-groups technique was used to determine to which degree the BSHS-B discriminates between patients with low and high burn severity based on the abbreviated burn severity index (ABSI). The Hospital Anxiety and Depression Scale (HADS) was used to examine criterion validity. The nine BSHS-B subscales showed good internal consistency. A second-order confirmatory factor analysis revealed the following main components: (1) Affect and Relationship, (2) Function and (3) Skin Involvement. The second-order factors were positively correlated with the SF-8 and negatively correlated with symptoms of anxiety and depression. Patients with low ABSI scored higher on all three BSHS-B domains than those with high ABSI. The results indicate good psychometric properties of the German BSHS-B. Further studies are needed to investigate the utility of the questionnaire in clinical routine practice, evaluation of burn management programs, and burn-specific research. Copyright © 2015 Elsevier Ltd and ISBI. All rights reserved.

  16. GHCN Version 3 Land Temperature and Version 2 Land Precipitation Dataset

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains gridded mean temperature anomalies from the Global Historical Climatology Network-Monthly (GHCN-M) version 3.3.0 temperature data set. The...

  17. Major Upgrades to the AIRS Version-6 Ozone Profile Methodology

    Science.gov (United States)

    Susskind, Joel; Blaisdell, John; Iredell, Lena

    2015-01-01

    This research is a continuation of part of what was shown at the last AIRS Science Team Meeting in the talk Improved Water Vapor and Ozone Profiles in SRT AIRS Version-6.X and the AIRS February 11, 2015 NetMeeting Further improvements in water vapor and ozone profiles compared to Version-6.AIRS Version-6 was finalized in late 2012 and is now operational. Version-6 contained many significant improvements in retrieval methodology compared to Version-5. However, Version-6 retrieval methodology used for the water vapor profile q(p) and ozone profile O3(p) retrievals is basically unchanged from Version-5, or even from Version-4. Subsequent research has made significant improvements in both water vapor and O3 profiles compared to Version-6. This talk will concentrate on O3 profile retrievals. Improvements in water vapor profile retrievals are given in a separate presentation.

  18. CALIPSO lidar calibration at 532 nm: version 4 nighttime algorithm

    Directory of Open Access Journals (Sweden)

    J. Kar

    2018-03-01

    Full Text Available Data products from the Cloud-Aerosol Lidar with Orthogonal Polarization (CALIOP on board Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observations (CALIPSO were recently updated following the implementation of new (version 4 calibration algorithms for all of the Level 1 attenuated backscatter measurements. In this work we present the motivation for and the implementation of the version 4 nighttime 532 nm parallel channel calibration. The nighttime 532 nm calibration is the most fundamental calibration of CALIOP data, since all of CALIOP's other radiometric calibration procedures – i.e., the 532 nm daytime calibration and the 1064 nm calibrations during both nighttime and daytime – depend either directly or indirectly on the 532 nm nighttime calibration. The accuracy of the 532 nm nighttime calibration has been significantly improved by raising the molecular normalization altitude from 30–34 km to the upper possible signal acquisition range of 36–39 km to substantially reduce stratospheric aerosol contamination. Due to the greatly reduced molecular number density and consequently reduced signal-to-noise ratio (SNR at these higher altitudes, the signal is now averaged over a larger number of samples using data from multiple adjacent granules. Additionally, an enhanced strategy for filtering the radiation-induced noise from high-energy particles was adopted. Further, the meteorological model used in the earlier versions has been replaced by the improved Modern-Era Retrospective analysis for Research and Applications, Version 2 (MERRA-2, model. An aerosol scattering ratio of 1.01 ± 0.01 is now explicitly used for the calibration altitude. These modifications lead to globally revised calibration coefficients which are, on average, 2–3 % lower than in previous data releases. Further, the new calibration procedure is shown to eliminate biases at high altitudes that were present in earlier versions and

  19. Kernel versions of some orthogonal transformations

    DEFF Research Database (Denmark)

    Nielsen, Allan Aasbjerg

    Kernel versions of orthogonal transformations such as principal components are based on a dual formulation also termed Q-mode analysis in which the data enter into the analysis via inner products in the Gram matrix only. In the kernel version the inner products of the original data are replaced...... by inner products between nonlinear mappings into higher dimensional feature space. Via kernel substitution also known as the kernel trick these inner products between the mappings are in turn replaced by a kernel function and all quantities needed in the analysis are expressed in terms of this kernel...... function. This means that we need not know the nonlinear mappings explicitly. Kernel principal component analysis (PCA) and kernel minimum noise fraction (MNF) analyses handle nonlinearities by implicitly transforming data into high (even infinite) dimensional feature space via the kernel function...

  20. Safety of an abbreviated duration of dual antiplatelet therapy (≤6 months) following second-generation drug-eluting stents for coronary artery disease: A systematic review and meta-analysis of randomized trials.

    Science.gov (United States)

    Ziada, Khaled M; Abdel-Latif, Ahmed K; Charnigo, Richard; Moliterno, David J

    2016-03-01

    Dual antiplatelet therapy (DAPT) is recommended for ≥12 months following coronary drug-eluting stents (DES) to reduce risk of major adverse ischemic events. Randomized trials suggest an abbreviated DAPT duration (≤6 months) is adequately protective. However, these trials are individually underpowered to detect differences in rare but serious events such as stent thrombosis (ST). We performed a meta-analysis of published randomized trials to define the impact of abbreviated DAPT (≤6 months) on death, myocardial infarction (MI), stent thrombosis (ST), and bleeding complications compared to standard-duration DAPT (≥12 months). Seven randomized controlled trials comparing abbreviated vs. standard DAPT regimens following DES use were identified by two independent investigators. Study characteristics were reviewed and clinical endpoint data were abstracted and analyzed in aggregate using fixed and random-effects models. The seven trials included 15,874 randomized patients. Second-generation DES were used in most patients. Compared to standard-duration DAPT, abbreviated DAPT was not associated with an increase in mortality (OR 0.93; CI: 0.73 to 1.17; P = 0.52), MI (OR 1.14; CI: 0.89 to 1.45; P = 0.30) or ST (OR 1.25; CI: 0.81 to 1.93; P = 0.31). Abbreviated DAPT was associated with significantly fewer major bleeding complications (OR 0.52; CI: 0.34 to 0.82; P = 0.005). The results were consistent between fixed and random-effects models, with no heterogeneity. Sensitivity analyses adjusting for inclusion of bare metal stents, 1st generation DES and/or abbreviated DAPT regimens of 3 months resulted in similar conclusions. In a meta-analysis of >15,000 patients primarily treated with second-generation DES, abbreviated-duration DAPT (≤6 months) was associated with a significant reduction in major bleeding complications with no evidence of a significant increase in risk of death, MI or ST. Accordingly, abbreviated DAPT should be strongly considered

  1. Safety of an Abbreviated Duration of Dual Antiplatelet Therapy (≤ Six Months) Following Second-Generation Drug-Eluting Stents for Coronary Artery Disease: A Systematic Review and Meta-Analysis of Randomized Trials

    Science.gov (United States)

    Charnigo, Richard; Moliterno, David J.

    2015-01-01

    Background Dual antiplatelet therapy (DAPT) is recommended for ≥12 months following coronary drug-eluting stents (DES) to reduce risk of major adverse ischemic events. Randomized trials suggest an abbreviated DAPT duration (≤6 months) is adequately protective. However, these trials are individually underpowered to detect differences in rare but serious events such as stent thrombosis (ST). Objectives We performed a meta-analysis of published randomized trials to define the impact of abbreviated DAPT (≤6 months) on death, myocardial infarction (MI), stent thrombosis(ST) and bleeding complications compared to standard-duration DAPT (≥12 months). Methods Seven randomized controlled trials comparing abbreviated vs. standard DAPT regimens following DES use were identified by 2 independent investigators. Study characteristics were reviewed and clinical endpoint data were abstracted and analyzed in aggregate using fixed and random-effects models. Results The 7 trials included 15,874 randomized patients. Second-generation DES were used in most patients. Compared to standard-duration DAPT, abbreviated DAPT was not associated with an increase in mortality (OR 0.93; CI: 0.73 to 1.17; p = 0.52), MI (OR 1.14; CI: 0.89 to 1.45; p = 0.30) or ST (OR 1.25; CI: 0.81 to 1.93; p = 0.31). Abbreviated DAPT was associated with significantly fewer major bleeding complications (OR 0.52; CI: 0.34 to 0.82; p = 0.005). The results were consistent between fixed and random-effects models, with no heterogeneity. Sensitivity analyses adjusting for inclusion of bare metal stents, 1st generation DES and/or abbreviated DAPT regeimens of 3 months resulted in similar conclusions. Conclusions In a meta-analysis of >15,000 patients primarily treated with second-generation DES, abbreviated-duration DAPT (≤6 months) was associated with a significant reduction in major bleeding complications with no evidence of a significant increase in risk of death, MI or ST. Accordingly, abbreviated DAPT

  2. Development and validation of a short version of the Spanish pediatric voice handicap index (P-VHI-10).

    Science.gov (United States)

    Sanz, Lorena; Bau, Patricia; Arribas, Ignacio; Rivera, Teresa

    2016-09-01

    A child's voice is used both as a tool for communication and as a form of emotional expression. Thus, voice disorders suffered by children have negative effects on their quality of life, which can be assessed using the "Pediatric Voice Handicap Index" (P-VHI). This questionnaire is completed by the parents of dysphonic patients and it has been validated in different languages: Italian, Korean, Arabic, and Spanish. More recently, the "Children Voice Handicap Index-10" test (C-VHI-10) was developed and validated, an Italian version reduced into 10 items that is answered by children themselves. The objective of this study was to develop and validate a short Spanish version of the P-VHI (P-VHI-10) and to assess whether it is comparable to the Italian C-VHI-10. We conducted a cross-sectional study on 27 patients between 6-15 years of age. We developed an abbreviated version of the P-VHI that consisted of 10 statements to be answered by parents of children with dysphonia (P-VHI-10). These statements were based on the 10 items with the highest score in the validated Spanish version of the P-VHI. In addition, the validated Italian version of C-VHI-10 was translated into Spanish and this translation was reviewed and modified by three specialists, resulting in an adapted version to be answered by parents (C*-VHI-10). The parents and children included in the study of this index were the same patients as those included in the study to validate the Spanish P-VHI. There were no significant differences in the results obtained with the extended version of the P-VHI (17.4) and with the P-VHI-10 (18.7: Pearson coefficient = 0.602, p < 0.36). A paired student's t-test identified significant differences (p < 0.0001) when comparing the P-VHI-10 and C*-VHI-10, both of which were answered by parents, with average scores of 18.7 and 9.48, respectively. Both these reduced versions have good internal consistency, with a satisfactory Cronbach's alpha coefficient (α = 0.75 to P

  3. The Gaia Framework: Version Support In Web Based Open Hypermedia

    DEFF Research Database (Denmark)

    Grønbæk, Kaj; Kejser, Thomas

    2004-01-01

    The GAIA framework prototype, described herein, explores the possibilities and problems that arise when combining versioning and open hypermedia paradigms. It will be argued that it - by adding versioning as a separate service in the hypermedia architecture – is possible to build consistent...... versioning field and GAIA is compared with previous attempts at defining hypermedia versioning frameworks. GAIA is capable of multi-level versioning and versioning of structures and supports freezing mechanisms for both documents and hyperstructure. The experiences from GAIA provide an input to new reference...

  4. PC 386-based version of DORT

    International Nuclear Information System (INIS)

    Tanker, E.

    1992-01-01

    Problems encountered during the adaptation of DORT on a personal computer using a Fortran77 compiler are described, modifications done to solve these are explained. Three test cases were run with the modified version and results are compared with those obtained on an IBM 3090/200. Numerical differences were observed in the last three decimal digits of the computations at most. The running times on the PC were found to be satisfactory for these test cases

  5. TOGAF version 9 a pocket guide

    CERN Document Server

    Josey, Andrew

    2008-01-01

    This Pocket Guide is based on TOGAF Version 9 Enterprise Edition. It gives a concise introduction to TOGAF 9. What's more, it's authoritative, with material derived from The Open Group's TOGAF 9 documentation and contributions from members of The Open Group Architecture Forum. The audience for this Pocket Guide is enterprise architects, business architects, IT architects, data architects, systems architects, solutions architects, and senior managers seeking a ?rst introduction to TOGAF.

  6. Integrated Reliability and Risk Analysis System (IRRAS) Version 2.0 user's guide

    International Nuclear Information System (INIS)

    Russell, K.D.; Sattison, M.B.; Rasmuson, D.M.

    1990-06-01

    The Integrated Reliability and Risk Analysis System (IRRAS) is a state-of-the-art, microcomputer-based probabilistic risk assessment (PRA) model development and analysis tool to address key nuclear plant safety issues. IRRAS is an integrated software tool that gives the user the ability to create and analyze fault trees and accident sequences using a microcomputer. This program provides functions that range from graphical fault tree construction to cut set generation and quantification. Also provided in the system is an integrated full-screen editor for use when interfacing with remote mainframe computer systems. Version 1.0 of the IRRAS program was released in February of 1987. Since that time, many user comments and enhancements have been incorporated into the program providing a much more powerful and user-friendly system. This version has been designated IRRAS 2.0 and is the subject of this user's guide. Version 2.0 of IRRAS provides all of the same capabilities as Version 1.0 and adds a relational data base facility for managing the data, improved functionality, and improved algorithm performance. 9 refs., 292 figs., 4 tabs

  7. Mission Data System Java Edition Version 7

    Science.gov (United States)

    Reinholtz, William K.; Wagner, David A.

    2013-01-01

    The Mission Data System framework defines closed-loop control system abstractions from State Analysis including interfaces for state variables, goals, estimators, and controllers that can be adapted to implement a goal-oriented control system. The framework further provides an execution environment that includes a goal scheduler, execution engine, and fault monitor that support the expression of goal network activity plans. Using these frameworks, adapters can build a goal-oriented control system where activity coordination is verified before execution begins (plan time), and continually during execution. Plan failures including violations of safety constraints expressed in the plan can be handled through automatic re-planning. This version optimizes a number of key interfaces and features to minimize dependencies, performance overhead, and improve reliability. Fault diagnosis and real-time projection capabilities are incorporated. This version enhances earlier versions primarily through optimizations and quality improvements that raise the technology readiness level. Goals explicitly constrain system states over explicit time intervals to eliminate ambiguity about intent, as compared to command-oriented control that only implies persistent intent until another command is sent. A goal network scheduling and verification process ensures that all goals in the plan are achievable before starting execution. Goal failures at runtime can be detected (including predicted failures) and handled by adapted response logic. Responses can include plan repairs (try an alternate tactic to achieve the same goal), goal shedding, ignoring the fault, cancelling the plan, or safing the system.

  8. Brazilian caregiver version of the Apathy Scale

    Science.gov (United States)

    Guimarães, Henrique Cerqueira; Fialho, Patricia Paes Araujo; Carvalho, Viviane Amaral; dos Santos, Etelvina Lucas; Caramelli, Paulo

    2009-01-01

    No Brazilian version of a specific scale for evaluating apathy in dementia is available. Objectives To introduce a translated version of the Apathy Scale (AS) for use with caregivers. Methods The instrument was formally translated and then administered to the caregivers of a small sample of dementia patients, in order to assess scale comprehensibility and make final adjustments. The scale was subsequently administered to the caregivers of a second, independent sample of Alzheimer’s disease (AD) patients. The content validity of the scale was tested by correlating the AS scores with the Neuropsychiatric Inventory (NPI) - apathy sub-score and Disability Assessment in Dementia (DAD) total scores. Results The first sample consisted of eleven subjects with dementia, most of whom had AD. The second sample comprised twenty patients with probable or possible AD (10 with mild dementia), a mean age of 84.1±5.8 years, and 2.2±1.6 years of schooling. The AS scores correlated with both NPI-apathy sub-score (r=0.756, p=0.001) and DAD total scores (r=–0.793, p=0.0005). Conclusions The final version had good comprehensibility and correlated strongly with standardized apathy and functional activities of daily living measures. PMID:29213647

  9. Brazilian caregiver version of the Apathy Scale

    Directory of Open Access Journals (Sweden)

    Henrique Cerqueira Guimarães

    Full Text Available Abstract No Brazilian version of a specific scale for evaluating apathy in dementia is available. Objectives: To introduce a translated version of the Apathy Scale (AS for use with caregivers. Methods: The instrument was formally translated and then administered to the caregivers of a small sample of dementia patients, in order to assess scale comprehensibility and make final adjustments. The scale was subsequently administered to the caregivers of a second, independent sample of Alzheimer's disease (AD patients. The content validity of the scale was tested by correlating the AS scores with the Neuropsychiatric Inventory (NPI - apathy sub-score and Disability Assessment in Dementia (DAD total scores. Results: The first sample consisted of eleven subjects with dementia, most of whom had AD. The second sample comprised twenty patients with probable or possible AD (10 with mild dementia, a mean age of 84.1±5.8 years, and 2.2±1.6 years of schooling. The AS scores correlated with both NPI-apathy sub-score (r=0.756, p=0.001 and DAD total scores (r=-0.793, p=0.0005. Conclusions: The final version had good comprehensibility and correlated strongly with standardized apathy and functional activities of daily living measures.

  10. EPICS Version 4 - Implementing Complex Data Types

    Energy Technology Data Exchange (ETDEWEB)

    Marty Kraimer,; John dalesio

    2012-11-27

    Through phase 1 and phase 2 SBIR grants, s fully functional I/O Controller and communication protocol for version 4 of EPICS is completed. This new software architecture provides a flexible and extendible architecture. Version 4 is implemented fully in Java. The performance metrics look promising. The final portion of phase 2 is to optimize the communication mechanisms. Subsequent work on different aspects of this are required to provide a viable solutions in various areas. Version 3 of EPICS is able to provide a platform for implementing channel based control, because the channel and attributes for time stamping, alarm, display and control were narrow, well defined, and complete. To extend EPICS functionality beyond this, it is necessary to define attributes needed for archive data, array, image data, and directory services. The proper handling of several array types enables the development of middle layer servers such as orbit and bump control in accelerators. Phase 1 should produce a well defined, reviewed, and agreed upon definition of the metadata required for these services. A Phase 2 grant would provide tools that implemented archiving, general array, imaging, and directory applications.

  11. Commercial SNF Accident Release Fractions

    Energy Technology Data Exchange (ETDEWEB)

    J. Schulz

    2004-11-05

    The purpose of this analysis is to specify and document the total and respirable fractions for radioactive materials that could be potentially released from an accident at the repository involving commercial spent nuclear fuel (SNF) in a dry environment. The total and respirable release fractions are used to support the preclosure licensing basis for the repository. The total release fraction is defined as the fraction of total commercial SNF assembly inventory, typically expressed as an activity inventory (e.g., curies), of a given radionuclide that is released to the environment from a waste form. Radionuclides are released from the inside of breached fuel rods (or pins) and from the detachment of radioactive material (crud) from the outside surfaces of fuel rods and other components of fuel assemblies. The total release fraction accounts for several mechanisms that tend to retain, retard, or diminish the amount of radionuclides that are available for transport to dose receptors or otherwise can be shown to reduce exposure of receptors to radiological releases. The total release fraction includes a fraction of airborne material that is respirable and could result in inhalation doses; this subset of the total release fraction is referred to as the respirable release fraction. Accidents may involve waste forms characterized as: (1) bare unconfined intact fuel assemblies, (2) confined intact fuel assemblies, or (3) canistered failed commercial SNF. Confined intact commercial SNF assemblies at the repository are contained in shipping casks, canisters, or waste packages. Four categories of failed commercial SNF are identified: (1) mechanically and cladding-penetration damaged commercial SNF, (2) consolidated/reconstituted assemblies, (3) fuel rods, pieces, and debris, and (4) nonfuel components. It is assumed that failed commercial SNF is placed into waste packages with a mesh screen at each end (CRWMS M&O 1999). In contrast to bare unconfined fuel assemblies, the

  12. Commercial SNF Accident Release Fractions

    International Nuclear Information System (INIS)

    Schulz, J.

    2004-01-01

    The purpose of this analysis is to specify and document the total and respirable fractions for radioactive materials that could be potentially released from an accident at the repository involving commercial spent nuclear fuel (SNF) in a dry environment. The total and respirable release fractions are used to support the preclosure licensing basis for the repository. The total release fraction is defined as the fraction of total commercial SNF assembly inventory, typically expressed as an activity inventory (e.g., curies), of a given radionuclide that is released to the environment from a waste form. Radionuclides are released from the inside of breached fuel rods (or pins) and from the detachment of radioactive material (crud) from the outside surfaces of fuel rods and other components of fuel assemblies. The total release fraction accounts for several mechanisms that tend to retain, retard, or diminish the amount of radionuclides that are available for transport to dose receptors or otherwise can be shown to reduce exposure of receptors to radiological releases. The total release fraction includes a fraction of airborne material that is respirable and could result in inhalation doses; this subset of the total release fraction is referred to as the respirable release fraction. Accidents may involve waste forms characterized as: (1) bare unconfined intact fuel assemblies, (2) confined intact fuel assemblies, or (3) canistered failed commercial SNF. Confined intact commercial SNF assemblies at the repository are contained in shipping casks, canisters, or waste packages. Four categories of failed commercial SNF are identified: (1) mechanically and cladding-penetration damaged commercial SNF, (2) consolidated/reconstituted assemblies, (3) fuel rods, pieces, and debris, and (4) nonfuel components. It is assumed that failed commercial SNF is placed into waste packages with a mesh screen at each end (CRWMS M andO 1999). In contrast to bare unconfined fuel assemblies, the

  13. MESOI Version 2.0: an interactive mesoscale Lagrangian puff dispersion model with deposition and decay

    International Nuclear Information System (INIS)

    Ramsdell, J.V.; Athey, G.F.; Glantz, C.S.

    1983-11-01

    MESOI Version 2.0 is an interactive Lagrangian puff model for estimating the transport, diffusion, deposition and decay of effluents released to the atmosphere. The model is capable of treating simultaneous releases from as many as four release points, which may be elevated or at ground-level. The puffs are advected by a horizontal wind field that is defined in three dimensions. The wind field may be adjusted for expected topographic effects. The concentration distribution within the puffs is initially assumed to be Gaussian in the horizontal and vertical. However, the vertical concentration distribution is modified by assuming reflection at the ground and the top of the atmospheric mixing layer. Material is deposited on the surface using a source depletion, dry deposition model and a washout coefficient model. The model also treats the decay of a primary effluent species and the ingrowth and decay of a single daughter species using a first order decay process. This report is divided into two parts. The first part discusses the theoretical and mathematical bases upon which MESOI Version 2.0 is based. The second part contains the MESOI computer code. The programs were written in the ANSI standard FORTRAN 77 and were developed on a VAX 11/780 computer. 43 references, 14 figures, 13 tables

  14. MESOI Version 2. 0: an interactive mesoscale Lagrangian puff dispersion model with deposition and decay

    Energy Technology Data Exchange (ETDEWEB)

    Ramsdell, J.V.; Athey, G.F.; Glantz, C.S.

    1983-11-01

    MESOI Version 2.0 is an interactive Lagrangian puff model for estimating the transport, diffusion, deposition and decay of effluents released to the atmosphere. The model is capable of treating simultaneous releases from as many as four release points, which may be elevated or at ground-level. The puffs are advected by a horizontal wind field that is defined in three dimensions. The wind field may be adjusted for expected topographic effects. The concentration distribution within the puffs is initially assumed to be Gaussian in the horizontal and vertical. However, the vertical concentration distribution is modified by assuming reflection at the ground and the top of the atmospheric mixing layer. Material is deposited on the surface using a source depletion, dry deposition model and a washout coefficient model. The model also treats the decay of a primary effluent species and the ingrowth and decay of a single daughter species using a first order decay process. This report is divided into two parts. The first part discusses the theoretical and mathematical bases upon which MESOI Version 2.0 is based. The second part contains the MESOI computer code. The programs were written in the ANSI standard FORTRAN 77 and were developed on a VAX 11/780 computer. 43 references, 14 figures, 13 tables.

  15. Screening for Mild Cognitive Impairment in Parkinson’s Disease: Comparison of the Italian Versions of Three Neuropsychological Tests

    Directory of Open Access Journals (Sweden)

    Angela Federico

    2015-01-01

    Full Text Available Mild cognitive impairment (MCI is frequent in Parkinson’s disease (PD. Recently proposed criteria for MCI in PD (PD-MCI indicate level I diagnosis based on abbreviated assessment and level II based on comprehensive neuropsychological evaluation. The study explored the sensitivity and specificity of the Italian versions of three neuropsychological tests for level I diagnosis of PD-MCI. We recruited 100 consecutive PD patients. After screening for inclusion criteria, 43 patients were included. The sensitivity and specificity of the Mini Mental State Examination (MMSE, the Montreal Cognitive Assessment (MoCA, and the Addenbrooke’s Cognitive Examination Revised (ACE-R in comparison to level II diagnosis of PD-MCI were examined. PD-MCI was diagnosed (level II in 51% of patients. Disease duration was significantly longer and PD motor scales were more severely impaired in MCI group. The receiver-operator characteristics curve documented nonsignificant difference in the performance of the three tests, with slight advantage of MMSE (corrected data. The time of administration favored MMSE. In Italian-speaking PD patients, MMSE might represent a good screening tool for PD-MCI, because of the shorter time of administration and the performance comparable to those of MoCA and ACE-R. Further studies are needed to validate the new PD-MCI criteria across different languages and cultures.

  16. A new version of transfer matrix method for multibody systems

    Energy Technology Data Exchange (ETDEWEB)

    Rui, Xiaoting, E-mail: ruixt@163.net [Nanjing University of Science and Technology, Institute of Launch Dynamics (China); Bestle, Dieter, E-mail: bestle@b-tu.de [Brandenburg University of Technology, Engineering Mechanics and Vehicle Dynamics (Germany); Zhang, Jianshu, E-mail: zhangdracpa@sina.com; Zhou, Qinbo, E-mail: zqb912-new@163.com [Nanjing University of Science and Technology, Institute of Launch Dynamics (China)

    2016-10-15

    In order to avoid the global dynamics equations and increase the computational efficiency for multibody system dynamics (MSD), the transfer matrix method of multibody system (MSTMM) has been developed and applied very widely in research and engineering in recent 20 years. It differs from ordinary methods in multibody system dynamics with respect to the feature that there is no need for a global dynamics equation, and it uses low-order matrices for high computational efficiency. For linear systems, MSTMM is exact even if continuous elements like beams are involved. The discrete time MSTMM, however, has to use local linearization. In order to release the method from such approximations, a new version of MSTMM is presented in this paper where translational and angular accelerations, on the one hand, and internal forces and moments, on the other hand, are used as state variables. Already linear relationships among these quantities are utilized, which results in new element transfer matrices and algorithms making the study of multibody systems as simple as the study of single bodies. The proposed approach also allows combining MSTMM with any general numerical integration procedure. Some numerical examples of MSD are given to demonstrate the proposed method.

  17. Release Note -- Vbfnlo-2.6.0

    CERN Document Server

    Arnold, K; Bozzi, G; Campanario, F; Englert, C; Feigl, B; Frank, J; Figy, T; Jager, B; Kerner, M; Kubocz, M; Oleari, C; Palmer, S; Rauch, M; Rzehak, H; Schissler, F; Schlimpert, O; Spannowsky, M; Zeppenfeld, D

    2012-01-01

    Vbfnlo is a flexible parton level Monte Carlo program for the simulation of vector boson fusion (VBF), double and triple vector boson (plus jet) production in hadronic collisions at next-to-leading order (NLO) in the strong coupling constant, as well as Higgs boson plus two jet production via gluon fusion at the one-loop level. This note briefly describes the main additional features and processes that have been added in the new release -- Vbfnlo Version 2.6.0. At NLO QCD diboson production (W\\gamma, WZ, ZZ, Z\\gamma and \\gamma\\gamma), same-sign W pair production via vector boson fusion and the process W\\gamma\\gamma j have been implemented (for which one-loop tensor integrals up to six-point functions are included). In addition, gluon induced diboson production can be studied separately at the leading order (one-loop) level. The diboson processes WW, WZ and W\\gamma can be run with anomalous gauge boson couplings, and anomalous couplings between a Higgs and a pair of gauge bosons is included in WW, ZZ, Z\\gamma ...

  18. Reliability and validity of the Japanese version of the Resilience Scale and its short version

    Directory of Open Access Journals (Sweden)

    Kondo Maki

    2010-11-01

    Full Text Available Abstract Background The clinical relevance of resilience has received considerable attention in recent years. The aim of this study is to demonstrate the reliability and validity of the Japanese version of the Resilience Scale (RS and short version of the RS (RS-14. Findings The original English version of RS was translated to Japanese and the Japanese version was confirmed by back-translation. Participants were 430 nursing and university psychology students. The RS, Center for Epidemiologic Studies Depression Scale (CES-D, Rosenberg Self-Esteem Scale (RSES, Social Support Questionnaire (SSQ, Perceived Stress Scale (PSS, and Sheehan Disability Scale (SDS were administered. Internal consistency, convergent validity and factor loadings were assessed at initial assessment. Test-retest reliability was assessed using data collected from 107 students at 3 months after baseline. Mean score on the RS was 111.19. Cronbach's alpha coefficients for the RS and RS-14 were 0.90 and 0.88, respectively. The test-retest correlation coefficients for the RS and RS-14 were 0.83 and 0.84, respectively. Both the RS and RS-14 were negatively correlated with the CES-D and SDS, and positively correlated with the RSES, SSQ and PSS (all p Conclusions This study demonstrates that the Japanese version of RS has psychometric properties with high degrees of internal consistency, high test-retest reliability, and relatively low concurrent validity. RS-14 was equivalent to the RS in internal consistency, test-retest reliability, and concurrent validity. Low scores on the RS, a positive correlation between the RS and perceived stress, and a relatively low correlation between the RS and depressive symptoms in this study suggest that validity of the Japanese version of the RS might be relatively low compared with the original English version.

  19. Reaper Induced Cytochrome C Release

    National Research Council Canada - National Science Library

    Olson, Michael

    2002-01-01

    .... The interaction of reaper with scythe liberates a soluble factor (SCF) that induces apoptosis by effecting the release of cytochrome c from mitochondria, a critical step in activating apoptosis in many systems...

  20. Birth control - slow release methods

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/007555.htm Birth control - slow release methods To use the sharing features on this page, please enable JavaScript. Certain birth control methods contain man-made forms of hormones. ...

  1. DOE-2 sample run book: Version 2.1E

    Energy Technology Data Exchange (ETDEWEB)

    Winkelmann, F.C.; Birdsall, B.E.; Buhl, W.F.; Ellington, K.L.; Erdem, A.E. [Lawrence Berkeley Lab., CA (United States); Hirsch, J.J.; Gates, S. [Hirsch (James J.) and Associates, Camarillo, CA (United States)

    1993-11-01

    The DOE-2 Sample Run Book shows inputs and outputs for a variety of building and system types. The samples start with a simple structure and continue to a high-rise office building, a medical building, three small office buildings, a bar/lounge, a single-family residence, a small office building with daylighting, a single family residence with an attached sunspace, a ``parameterized`` building using input macros, and a metric input/output example. All of the samples use Chicago TRY weather. The main purpose of the Sample Run Book is instructional. It shows the relationship of LOADS-SYSTEMS-PLANT-ECONOMICS inputs, displays various input styles, and illustrates many of the basic and advanced features of the program. Many of the sample runs are preceded by a sketch of the building showing its general appearance and the zoning used in the input. In some cases we also show a 3-D rendering of the building as produced by the program DrawBDL. Descriptive material has been added as comments in the input itself. We find that a number of users have loaded these samples onto their editing systems and use them as ``templates`` for creating new inputs. Another way of using them would be to store various portions as files that can be read into the input using the {number_sign}{number_sign} include command, which is part of the Input Macro feature introduced in version DOE-2.lD. Note that the energy rate structures here are the same as in the DOE-2.lD samples, but have been rewritten using the new DOE-2.lE commands and keywords for ECONOMICS. The samples contained in this report are the same as those found on the DOE-2 release files. However, the output numbers that appear here may differ slightly from those obtained from the release files. The output on the release files can be used as a check set to compare results on your computer.

  2. PCDD/PCDF release inventories

    Energy Technology Data Exchange (ETDEWEB)

    Fiedler, H. [UNEP Chemicals, Chatelaine (Switzerland)

    2004-09-15

    The Stockholm Convention on Persistent Organic Pollutants (POPs) entered into force on 17 May 2004 with 50 Parties. In May 2004, 59 countries had ratified or acceded the Convention. The objective of the Convention is ''to protect human health and the environment from persistent organic pollutants''. For intentionally produced POPs, e.g., pesticides and industrial chemicals such as hexachlorobenzene and polychlorinated biphenyls, this will be achieved by stop of production and use. For unintentionally generated POPs, such as polychlorinated dibenzo-pdioxins (PCDD) and polychlorinated dibenzofurans (PCDF), measures have to be taken to ''reduce the total releases derived from anthropogenic sources''; the final goal is ultimate elimination, where feasible. Under the Convention, Parties have to establish and maintain release inventories to prove the continuous release reduction. Since many countries do not have the technical and financial capacity to measure all releases from all potential PCDD/PCDF sources, UNEP Chemicals has developed the ''Standardized Toolkit for the Identification of Quantification of Dioxin and Furan Releases'' (''Toolkit'' for short), a methodology to estimate annual releases from a number of sources. With this methodology, annual releases can be estimated by multiplying process-specific default emission factors provided in the Toolkit with national activity data. At the seventh session of the Intergovernmental Negotiating Committee, the Toolkit was recommended to be used by countries when reporting national release data to the Conference of the Parties. The Toolkit is especially used by developing countries and countries with economies in transition where no measured data are available. Results from Uruguay, Thailand, Jordan, Philippines, and Brunei Darussalam have been published.

  3. Global Historical Climatology Network - Monthly (GHCN-M), Version 2

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Please note, the temperature portion of this dataset has been superseded by a newer version. Users should not use this version except in rare cases (e.g., when...

  4. United States Climate Reference Network (USCRN) Processed Data (Version Superseded)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Please note, this dataset has been superseded by a newer version (see below). Users should not use this version except in rare cases (e.g., when reproducing previous...

  5. Gridded Species Distribution, Version 1: Global Amphibians Presence Grids

    Data.gov (United States)

    National Aeronautics and Space Administration — The Global Amphibians Presence Grids of the Gridded Species Distribution, Version 1 is a reclassified version of the original grids of amphibian species distribution...

  6. Integrated Global Radiosonde Archive (IGRA) - Monthly Means (Version Superseded)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Please note, this dataset has been superseded by a newer version (see below). Users should not use this version except in rare cases (e.g., when reproducing previous...

  7. Validation of the Spanish version of the Oral Health Impact Profile (OHIP-14Sp) in elderly Chileans.

    Science.gov (United States)

    León, Soraya; Bravo-Cavicchioli, Daniel; Correa-Beltrán, Gloria; Giacaman, Rodrigo A

    2014-08-04

    The OHIP-49 is widely used to assess oral health-related quality of life, but its length makes it time-consuming and difficult to use. An abbreviated version of the OHIP-49 with fourteen items has been validated for older adults, but not in Chile. The aim was to develop and validate the Spanish version of the OHIP-14 in an elderly Chilean population. Two studies were conducted; a cross sectional to develop and a retrospective study to validate the OHIP-14Sp. The OHIP-49Sp was applied to 490 older adults and the fourteen questions with the higher impact on oral health-related quality of life were selected through linear regression. These items were applied on a retrospective dataset of 85 older adults to test internal consistency (Cronbach's alpha). A discriminative validity analysis was performed along with the assessment of sociodemographic (age and gender, educational level) and clinical variables (number of teeth, caries lesions, CPITN, prosthetic needs and prosthetic functionality). Data were analyzed using Mann-Whitney U, Student's t and one-way ANOVA tests with a 95% confidence level and finally were analyzed by a Multivariate Logistic Regression Model. High internal consistency values were obtained for the OHIP-14Sp instrument (0.91). There was an association between the OHIP-14Sp scores and the presence of caries (p = 0.003), need for complex periodontal treatment (p = 0.002), prosthetic needs (p periodontal treatment need were more likely to report reduced oral health-related quality of life (PR = 2.10). The OHIP-14Sp proved to be a consistent and valid tool to assess oral health-related quality of life when tested in Chilean older adults.

  8. The Expanded Capabilities Of The Cementitious Barriers Partnership Software Toolbox Version 2.0 - 14331

    Energy Technology Data Exchange (ETDEWEB)

    Burns, Heather; Flach, Greg; Smith, Frank; Langton, Christine; Brown, Kevin; Kosson, David; Samson, Eric; Mallick, Pramod

    2014-01-10

    The Cementitious Barriers Partnership (CBP) Project is a multi-disciplinary, multi-institutional collaboration supported by the U.S. Department of Energy (US DOE) Office of Tank Waste Management. The CBP program has developed a set of integrated tools (based on state-of-the-art models and leaching test methods) that help improve understanding and predictions of the long-term structural, hydraulic and chemical performance of cementitious barriers used in nuclear applications. The CBP Software Toolbox – “Version 1.0” was released early in FY2013 and was used to support DOE-EM performance assessments in evaluating various degradation mechanisms that included sulfate attack, carbonation and constituent leaching. The sulfate attack analysis predicted the extent and damage that sulfate ingress will have on concrete vaults over extended time (i.e., > 1000 years) and the carbonation analysis provided concrete degradation predictions from rebar corrosion. The new releaseVersion 2.0” includes upgraded carbonation software and a new software module to evaluate degradation due to chloride attack. Also included in the newer version are a dual regime module allowing evaluation of contaminant release in two regimes – both fractured and un-fractured. The integrated software package has also been upgraded with new plotting capabilities and many other features that increase the “user-friendliness” of the package. Experimental work has been generated to provide data to calibrate the models to improve the credibility of the analysis and reduce the uncertainty. Tools selected for and developed under this program have been used to evaluate and predict the behavior of cementitious barriers used in near-surface engineered waste disposal systems for periods of performance up to or longer than 100 years for operating facilities and longer than 1000 years for waste disposal. The CBP Software Toolbox is and will continue to produce tangible benefits to the working DOE

  9. GEMPAK 5.1 - A GENERAL METEOROLOGICAL PACKAGE (VAX VMS VERSION)

    Science.gov (United States)

    Des, Jardins M. L.

    1994-01-01

    regional maps is included with this package. The standard distribution medium for the UNIX version of GEMPAK 5.1 is a .25 inch streaming magnetic tape cartridge in UNIX tar format. The standard distribution medium for the VMS version of GEMPAK 5.1 is a 6250 BPI 9-track magnetic tape in DEC VAX BACKUP format. The VMS version is also available on a TK50 tape cartridge in DEC VAX BACKUP format. This program was developed in 1985. The current version, GEMPAK 5.1, was released in 1992. The package is delivered with source code. An extensive collection of subroutine libraries allows users to format data for use by GEMPAK, to develop new programs, and to enhance existing ones.

  10. Provenance tracking for scientific software toolchains through on-demand release and archiving

    Science.gov (United States)

    Ham, David

    2017-04-01

    There is an emerging consensus that published computational science results must be backed by a provenance chain tying results to the exact versions of input data and the code which generated them. There is also now an impressive range of web services devoted to revision control of software, and the archiving in citeable form of both software and input data. However, much scientific software itself builds on libraries and toolkits, and these themselves have dependencies. Further, it is common for cutting edge research to depend on the latest version of software in online repositories, rather than the official release version. This creates a situation in which an author who wishes to follow best practice in recording the provenance chain of their results must archive and cite unreleased versions of a series of dependencies. Here, we present an alternative which toolkit authors can easily implement to provide a semi-automatic mechanism for creating and archiving custom software releases of the precise version of a package used in a particular simulation. This approach leverages the excellent services provided by GitHub and Zenodo to generate a connected set of citeable DOIs for the archived software. We present the integration of this workflow into the Firedrake automated finite element framework as a practical example of this approach in use on a complex geoscientific tool chain in practical use.

  11. Progress Towards AIRS Science Team Version-7 at SRT

    Science.gov (United States)

    Susskind, Joel; Blaisdell, John; Iredell, Lena; Kouvaris, Louis

    2016-01-01

    The AIRS Science Team Version-6 retrieval algorithm is currently producing level-3 Climate Data Records (CDRs) from AIRS that have been proven useful to scientists in understanding climate processes. CDRs are gridded level-3 products which include all cases passing AIRS Climate QC. SRT has made significant further improvements to AIRS Version-6. At the last Science Team Meeting, we described results using SRT AIRS Version-6.22. SRT Version-6.22 is now an official build at JPL called 6.2.4. Version-6.22 results are significantly improved compared to Version-6, especially with regard to water vapor and ozone profiles. We have adapted AIRS Version-6.22 to run with CrIS/ATMS, at the Sounder SIPS which processed CrIS/ATMS data for August 2014. JPL AIRS Version-6.22 uses the Version-6 AIRS tuning coefficients. AIRS Version-6.22 has at least two limitations which must be improved before finalization of Version-7: Version-6.22 total O3 has spurious high values in the presence of Saharan dust over the ocean; and Version-6.22 retrieved upper stratospheric temperatures are very poor in polar winter. SRT Version-6.28 addresses the first concern. John Blaisdell ran the analog of AIRS Version-6.28 in his own sandbox at JPL for the 14th and 15th of every month in 2014 and all of July and October for 2014. AIRS Version-6.28a is hot off the presses and addresses the second concern.

  12. Detailed analysis of the Japanese version of the Rapid Dementia Screening Test, revised version.

    Science.gov (United States)

    Moriyama, Yasushi; Yoshino, Aihide; Muramatsu, Taro; Mimura, Masaru

    2017-11-01

    The number-transcoding task on the Japanese version of the Rapid Dementia Screening Test (RDST-J) requires mutual conversion between Arabic and Chinese numerals (209 to , 4054 to , to 681, to 2027). In this task, question and answer styles of Chinese numerals are written horizontally. We investigated the impact of changing the task so that Chinese numerals are written vertically. Subjects were 211 patients with very mild to severe Alzheimer's disease and 42 normal controls. Mini-Mental State Examination scores ranged from 26 to 12, and Clinical Dementia Rating scores ranged from 0.5 to 3. Scores of all four subtasks of the transcoding task significantly improved in the revised version compared with the original version. The sensitivity and specificity of total scores ≥9 on the RDST-J original and revised versions for discriminating between controls and subjects with Clinical Dementia Rating scores of 0.5 were 63.8% and 76.6% on the original and 60.1% and 85.8% on revised version. The revised RDST-J total score had low sensitivity and high specificity compared with the original RDST-J for discriminating subjects with Clinical Dementia Rating scores of 0.5 from controls. © 2017 Japanese Psychogeriatric Society.

  13. The Gaia Framework: Version Support In Web Based Open Hypermedia

    DEFF Research Database (Denmark)

    Kejser, Thomas; Grønbæk, Kaj

    2003-01-01

    The GAIA framework prototype, described herein, explores the possibilities and problems that arise when combining versioning and open hypermedia paradigms. It will be argued that it - by adding versioning as a separate service in the hypermedia architecture - is possible to build consistent versi...... architectures for future versioned hypermedia frameworks....

  14. Concept of versions of electronic documents in databases

    OpenAIRE

    Myshchyshyn, Vitalii; Zhezhnych, Pavlo

    2013-01-01

    The use of computer technologies for work with documents leads to appearance of such notion as electronic document. There can be entered the notion “Electronic document version” because of time properties in database. Version is a depending from time value. Electronic document version notion is methods of saving and display the part of electronic document version data in database.

  15. 77 FR 24594 - Version 4 Critical Infrastructure Protection Reliability Standards

    Science.gov (United States)

    2012-04-25

    ... Version 4 CIP Reliability Standards adequately protect control centers and control systems (i.e., control systems not housed in control centers). G&T Cooperatives believe that Version 4 goes too far, while SPP RE... Associations acknowledge the NOPR's concern that CIP Version 4 does not protect some control centers/common...

  16. 76 FR 58730 - Version 4 Critical Infrastructure Protection Reliability Standards

    Science.gov (United States)

    2011-09-22

    ... following ``Version 3'' CIP Standards: CIP-003-3 (Security Management Controls); CIP-004-3 (Personnel... control center; or (3) be dial-up accessible. In the proposed version, in the context of generating units... that the Version 4 CIP Standards would result in the identification of 532 control centers as Critical...

  17. 78 FR 72755 - Version 5 Critical Infrastructure Protection Reliability Standards

    Science.gov (United States)

    2013-12-03

    ... Reliability Standards. The CIP version 5 Standards adopt new cyber security controls and extend the scope of... category. The CIP version 5 Standards also include 12 requirements with new cyber security controls, which... version 5 Standards do not require specific controls for Low Impact assets nor do they contain objective...

  18. 78 FR 24107 - Version 5 Critical Infrastructure Protection Reliability Standards

    Science.gov (United States)

    2013-04-24

    ..., the proposed CIP version 5 Standards include twelve requirements with new cyber security controls. The... CIP version 5 Standards adopt new cyber security controls that are intended to safeguard physical and... Cyber Systems. 35. With regard to controls, the proposed CIP version 5 Standards include twelve...

  19. User's guide to the Yucca Mountain Integrating Model (YMIM) Version 2.1

    International Nuclear Information System (INIS)

    Gansemer, J.; Lamont, A.

    1995-04-01

    The Yucca Mountain Integrating Model (YMIM) is an integrated model of the engineered barrier system. It contains models of the processes of waste container failure and nuclide release from the fuel rods. YMIM is driven by scenarios of container and rod temperature, near-field chemistry, and near-field hydrology provided by other modules. It is designed to be highly modular so that a model of an individual process can be easily modified to replaced without interfering with the models of other processes. This manual describes the process models and provides instructions for setting up and running YMIM Version 2.1

  20. Overexpression of the truncated version of ILV2 enhances glycerol production in Saccharomyces cerevisiae.

    Science.gov (United States)

    Murashchenko, Lidiia; Abbas, Charles; Dmytruk, Kostyantyn; Sibirny, Andriy

    2016-08-01

    Acetolactate synthase is a mitochondrial enzyme that catalyses the conversion of two pyruvate molecules to an acetolactate molecule with release of carbon dioxide. The overexpression of the truncated version of the corresponding gene, ILV2, that codes for presumably cytosolic acetolactate synthase in the yeast Saccharomyces cerevisiae, led to a decrease in intracellular pyruvate concentration. This recombinant strain was also characterized by a four-fold increase in glycerol production, with a concomitant 1.8-fold reduction in ethanol production, when compared to that of the wild-type strain under anaerobic conditions in a glucose alcoholic fermentation. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  1. A new version of the ERICA tool to facilitate impact assessments of radioactivity on wild plants and animals.

    Science.gov (United States)

    Brown, J E; Alfonso, B; Avila, R; Beresford, N A; Copplestone, D; Hosseini, A

    2016-03-01

    A new version of the ERICA Tool (version 1.2) was released in November 2014; this constitutes the first major update of the Tool since release in 2007. The key features of the update are presented in this article. Of particular note are new transfer databases extracted from an international compilation of concentration ratios (CRwo-media) and the modification of 'extrapolation' approaches used to select transfer data in cases where information is not available. Bayesian updating approaches have been used in some cases to draw on relevant information that would otherwise have been excluded in the process of deriving CRwo-media statistics. All of these efforts have in turn led to the requirement to update Environmental Media Concentration Limits (EMCLs) used in Tier 1 assessments. Some of the significant changes with regard to EMCLs are highlighted. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. DEMAID - A DESIGN MANAGER'S AID FOR INTELLIGENT DECOMPOSITION (SGI IRIS VERSION)

    Science.gov (United States)

    Rogers, J. L.

    1994-01-01

    effects of an output with respect to a change in a particular input. The second method traces backward to determine what modules must be re-executed if the output of a module must be recomputed. DeMAID is available in three machine versions: a Macintosh version which is written in Symantec's Think C 3.01, a Sun version, and an SGI IRIS version, both of which are written in C language. The Macintosh version requires system software 6.0.2 or later and CLIPS 4.3. The source code for the Macintosh version will not compile under version 4.0 of Think C; however, a sample executable is provided on the distribution media. QuickDraw is required for plotting. The Sun version requires GKS 4.1 graphics libraries, OpenWindows 3, and CLIPS 4.3. The SGI IRIS version requires CLIPS 4.3. Since DeMAID is not compatible with CLIPS 5.0 or later, the source code for CLIPS 4.3 is included on the distribution media; however, the documentation for CLIPS 4.3 is not included in the documentation package for DeMAID. It is available from COSMIC separately as the documentation for MSC-21208. The standard distribution medium for the Macintosh version of DeMAID is a set of four 3.5 inch 800K Macintosh format diskettes. The standard distribution medium for the Sun version of DeMAID is a .25 inch streaming magnetic tape cartridge (QIC-24) in UNIX tar format. The standard distribution medium for the IRIS version is a .25 inch IRIX compatible streaming magnetic tape cartridge in UNIX tar format. All versions include sample input. DeMAID was originally developed for use on VAX VMS computers in 1989. The Macintosh version of DeMAID was released in 1991 and updated in 1992. The Sun version of DeMAID was released in 1992 and updated in 1993. The SGI IRIS version was released in 1993.

  3. Fuzzy Versions of Epistemic and Deontic Logic

    Science.gov (United States)

    Gounder, Ramasamy S.; Esterline, Albert C.

    1998-01-01

    Epistemic and deontic logics are modal logics, respectively, of knowledge and of the normative concepts of obligation, permission, and prohibition. Epistemic logic is useful in formalizing systems of communicating processes and knowledge and belief in AI (Artificial Intelligence). Deontic logic is useful in computer science wherever we must distinguish between actual and ideal behavior, as in fault tolerance and database integrity constraints. We here discuss fuzzy versions of these logics. In the crisp versions, various axioms correspond to various properties of the structures used in defining the semantics of the logics. Thus, any axiomatic theory will be characterized not only by its axioms but also by the set of properties holding of the corresponding semantic structures. Fuzzy logic does not proceed with axiomatic systems, but fuzzy versions of the semantic properties exist and can be shown to correspond to some of the axioms for the crisp systems in special ways that support dependency networks among assertions in a modal domain. This in turn allows one to implement truth maintenance systems. For the technical development of epistemic logic, and for that of deontic logic. To our knowledge, we are the first to address fuzzy epistemic and fuzzy deontic logic explicitly and to consider the different systems and semantic properties available. We give the syntax and semantics of epistemic logic and discuss the correspondence between axioms of epistemic logic and properties of semantic structures. The same topics are covered for deontic logic. Fuzzy epistemic and fuzzy deontic logic discusses the relationship between axioms and semantic properties for these logics. Our results can be exploited in truth maintenance systems.

  4. The transverse acetabular ligament: optimizing version.

    Science.gov (United States)

    Beverland, David

    2010-09-07

    In total hip arthroplasty (THA), excessive retroversion is associated with posterior instability, anterior impingement, and resultant groin pain. Excessive anteversion can lead to anterior instability and posterior impingement. The transverse acetabular ligament straddles the inferior limit of the bony acetabulum. It is a strong load-bearing structure and, in the normal hip, in association with the labrum, provides part of the load-bearing surface for the femoral head. It is our hypothesis that the transverse acetabular ligament defines normal version for the acetabulum. In Belfast, we found that using the transverse acetabular ligament helped reduce our primary dislocation rate from 3.7% to 1%. The key is good intraoperative exposure. A grading of 1 to 4 was based on 1000 consecutive cases: (1) normal transverse acetabular ligament easily visible on exposure of the acetabulum, 49%; (2) covered by soft tissue, 35.1%--cleared by blunt dissection; (3) covered by osteophytes, 15.6%--cleared using an acetabular reamer; (4) no transverse acetabular ligament identified, 0.3%. As can be seen, the transverse acetabular ligament is only immediately visible in 49% of cases. In the other 51%, soft tissue or bone must be cleared to define the ligament. The advantages of the transverse acetabular ligament are many. It is independent of patient positioning. The cup version can be individualized by the patient. The surgeon can avoid estimating version angle of 15° to 20° intraoperatively. It is easy to teach and consistently present. It is valuable in minimally invasive surgery. Using the transverse acetabular ligament provides an acceptable dislocation rate with the posterior approach. If the cup is cradled by the transverse acetabular ligament, it helps restore acetabular joint center. However, the transverse acetabular ligament does not help with inclination. We recommend 35° of operative inclination when using the posterior approach. Copyright 2010, SLACK Incorporated.

  5. WIMSD4 - Version 100 and cataloged procedure

    International Nuclear Information System (INIS)

    Taubman, C.J.; Lawrence, J.H.

    1981-02-01

    A new version of WMSD4 has been produced on the IBM 3033 computer at Harwell. The program has been completely recompiled using the enhanced H-extended compiler and several modifications have been made. Also the line printer output has been redirected from dataset reference number 7 to dataset reference number 6 and the working space previously identified by dataset reference number 6 has been reidentified by a new dataset reference number 12. The catalogued procedure has been rewritten to deal with the dataset changes. (author)

  6. Python pocket reference, version 2.4

    CERN Document Server

    Lutz, Mark

    2005-01-01

    Python is optimized for quality, productivity, portability, and integration. Hundreds of thousands of Python developers around the world rely on Python for general-purpose tasks, Internet scripting, systems programming, user interfaces, and product customization. Available on all major computing platforms, including commercial versions of Unix, Linux, Windows, and Mac OS X, Python is portable, powerful and remarkable easy to use. With its convenient, quick-reference format, Python Pocket Reference, 3rd Edition is the perfect on-the-job reference. More importantly, it's now been refreshed

  7. UQTk version 2.0 user manual

    Energy Technology Data Exchange (ETDEWEB)

    Debusschere, Bert J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Sargsyan, Khachik [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Safta, Cosmin [Sandia National Lab. (SNL-CA), Livermore, CA (United States)

    2013-10-01

    The UQ Toolkit (UQTk) is a collection of libraries and tools for the quantification of uncertainty in numerical model predictions. Version 2.0 ffers intrusive and non-intrusive methods for propagating input uncertainties through computational models, tools for sensitivity analysis, methods for sparse surrogate construction, and Bayesian inference tools for inferring parameters from experimental data. This manual discusses the download and installation process for UQTk, provides pointers to the UQ methods used in the toolkit, and describes some of the examples provided with the toolkit.

  8. The EPICS process variable Gateway Version 2

    International Nuclear Information System (INIS)

    Evans, K.

    2005-01-01

    The EPICS Process Variable Gateway is both a Channel Access Server and Channel Access Client that provides a means for many clients, typically on different subnets, to access a process variable while making only one connection to the server that owns the process variable. It also provides additional access security beyond that implemented on the server. It thus protects critical servers while providing suitably restricted access to needed process variables. The original version of the Gateway worked with EPICS Base 3.13 but required a special version, since the changes necessary for its operation were never incorporated into EPICS Base. Version 2 works with any standard EPICS Base 3.14.6 or later and has many improvements in both performance and features over the older version. The Gateway is now used at many institutions and has become a stable, high-performance application. It is capable of handling tens of thousands of process variables with hundreds of thousands of events per second. It has run for over three months in a production environment without having to be restarted. It has many internal process variables that can be used to monitor its state using standard EPICS client tools, such as MEDM and StripTool. Other internal process variables can be used to stop the Gateway, make several kinds of reports, or change the access security without stopping the Gateway. It can even be started on remote workstations from MEDM by using a Secure Shell script. This paper will describe the new Gateway and how it is used. The Gateway is both a server (like an EPICS Input/Output Controller (IOC)) and a client (like the EPICS Motif Editor and Display Manager (MEDM), StripTool, and others). Clients connect to the server side, and the client side connects to IOCs and other servers, possibly other Gateways. See Fig. 1. There are perhaps three principal reasons for using the Gateway: (1) it allows many clients to access a process variable while making only one connection to

  9. Fiscal impacts model documentation. Version 1. 0

    Energy Technology Data Exchange (ETDEWEB)

    Beck, S.L.; Scott, M.J.

    1986-05-01

    The Fiscal Impacts (FI) Model, Version 1.0 was developed under Pacific Northwest Laboratory's Monitored Retrievable Storage (MRS) Program to aid in development of the MRS Reference Site Environmental Document (PNL 5476). It computes estimates of 182 fiscal items for state and local government jurisdictions, using input data from the US Census Bureau's 1981 Survey of Governments and local population forecasts. The model can be adapted for any county or group of counties in the United States.

  10. A new species of small and highly abbreviated caecilian (Gymnophiona: Indotyphlidae) from the Seychelles island of Praslin, and a recharacterization of Hypogeophis brevis Boulenger, 1911.

    Science.gov (United States)

    Maddock, Simon T; Wilkinson, Mark; Nussbaum, Ronald A; Gower, David J

    2017-10-06

    A new species of indotyphlid caecilian amphibian, Hypogeophis pti sp. nov., is described based on a series of specimens from the Seychelles island of Praslin. The type series was collected in 2013 and 2014, and a referred specimen previously identified as H. brevis Boulenger, 1911 was collected from an unspecified Seychelles locality in 1957. The new species most closely resembles the Seychelles endemic Hypogeophis brevis in being short (maximum known total length in life ca. 120 mm) and long snouted, but differs by having a less anteriorly positioned tentacular aperture and fewer primary annuli and vertebrae. In having only 67-69 vertebrae, H. pti sp. nov. is the most abbreviated extant species of caecilian reported to date.

  11. Reliability and validity of the Japanese version of the Resilience Scale and its short version.

    Science.gov (United States)

    Nishi, Daisuke; Uehara, Ritei; Kondo, Maki; Matsuoka, Yutaka

    2010-11-17

    The clinical relevance of resilience has received considerable attention in recent years. The aim of this study is to demonstrate the reliability and validity of the Japanese version of the Resilience Scale (RS) and short version of the RS (RS-14). The original English version of RS was translated to Japanese and the Japanese version was confirmed by back-translation. Participants were 430 nursing and university psychology students. The RS, Center for Epidemiologic Studies Depression Scale (CES-D), Rosenberg Self-Esteem Scale (RSES), Social Support Questionnaire (SSQ), Perceived Stress Scale (PSS), and Sheehan Disability Scale (SDS) were administered. Internal consistency, convergent validity and factor loadings were assessed at initial assessment. Test-retest reliability was assessed using data collected from 107 students at 3 months after baseline. Mean score on the RS was 111.19. Cronbach's alpha coefficients for the RS and RS-14 were 0.90 and 0.88, respectively. The test-retest correlation coefficients for the RS and RS-14 were 0.83 and 0.84, respectively. Both the RS and RS-14 were negatively correlated with the CES-D and SDS, and positively correlated with the RSES, SSQ and PSS (all p validity. RS-14 was equivalent to the RS in internal consistency, test-retest reliability, and concurrent validity. Low scores on the RS, a positive correlation between the RS and perceived stress, and a relatively low correlation between the RS and depressive symptoms in this study suggest that validity of the Japanese version of the RS might be relatively low compared with the original English version.

  12. Routine use of an abbreviated 4-item scale to assess dependence in essential activities of daily living amongst elderly hemodialysis patients: a validation study.

    Science.gov (United States)

    Farrokhi, Farhat; Jassal, Sarbjit V

    2013-02-01

    Poor functional status is associated with reduced survival and poor outcomes in older dialysis patients. The Geriatric Nephrology Advisory Group recommends routine evaluation of functional status on all older patients; however, assessments can be time consuming and burdensome to clinical care providers. The objective of this study was to validate an abbreviated 4-item self-report screening tool for use in elderly hemodialysis patients. The functional dependence of community-dwelling hemodialysis patients, aged ≥65 years, was measured by trained evaluators. The accuracy of a 4-item self-report activities of daily living (ADL) score was compared against formal evaluation by the Barthel Index and the outcomes using agreement statistics and Cox regression analysis. The cohort included 167 patients with a mean age of 74.8 ± 5.9 years (57 % males). The 4-item scale correctly identified 83 % of the patients dependent in ≥1 ADL. Those incorrectly identified as independent on the abbreviated scale were uniformly unable to climb stairs without assistance. The sensitivity and specificity, and coefficient for agreement between the 4-item scale and the Barthel Index were 83.2, 100 and 0.78 %, respectively. The positive and negative predictive values of the 4-item scale were 100 and 76.9 %, respectively. Using the 4-item scale, the presence of severe disability was predictive of increased mortality (HR 12.5; 95 % CI 2.5-65.0; P = 0.03). The 4-item scale is a simple, valid screening test for disability which can be used in the elderly population on dialysis as a screening tool. Difficulties with stair climbing may be overlooked using this score.

  13. Predicting hydrocarbon release from soil

    International Nuclear Information System (INIS)

    Poppendieck, D.; Loehr, R.C.

    2002-01-01

    'Full text:' The remediation of hazardous chemicals from soils can be a lengthy and costly process. As a result, recent regulatory initiatives have focused on risk-based corrective action (RBCA) approaches. Such approaches attempt to identify the amount of chemical that can be left at a site with contaminated soil and still be protective of human health and the environment. For hydrocarbons in soils to pose risk to human heath and the environment, the hydrocarbons must be released from the soil and accessible to microorganisms, earthworms, or other higher level organisms. The sorption of hydrocarbons to soil can reduce the availability of the hydrocarbon to receptors. Typically in soils and sediments, there is an initial fast release of a hydrocarbon from the soil to the aqueous phase followed by a slower release of the remaining hydrocarbon to the aqueous phase. The rate and extent of slow release can influence aqueous hydrocarbon concentrations and the fate and transport of hydrocarbons in the subsurface. Once the fast fraction of the chemical has been removed from the soil, the remaining fraction of a chemical may desorb at a rate that natural mechanisms can attenuate the released hydrocarbon. Hence, active remediation may be needed only until the fast fraction has been removed. However, the fast fraction is a soil and chemical specific parameter. This presentation will present a tier I type protocol that has been developed to quickly estimate the fraction of hydrocarbons that are readily released from the soil matrix to the aqueous phase. Previous research in our laboratory and elsewhere has used long-term desorption (four months) studies to determine the readily released fraction. This research shows that a single short-term (less than two weeks) batch extraction procedure provides a good estimate of the fast released fraction derived from long-term experiments. This procedure can be used as a tool to rapidly evaluate the release and bioavailability of

  14. GEWEX SRB Shortwave Release 4

    Science.gov (United States)

    Cox, S. J.; Stackhouse, P. W., Jr.; Mikovitz, J. C.; Zhang, T.

    2017-12-01

    The NASA/GEWEX Surface Radiation Budget (SRB) project produces shortwave and longwave surface and top of atmosphere radiative fluxes for the 1983-near present time period. Spatial resolution is 1 degree. The new Release 4 uses the newly processed ISCCP HXS product as its primary input for cloud and radiance data. The ninefold increase in pixel number compared to the previous ISCCP DX allows finer gradations in cloud fraction in each grid box. It will also allow higher spatial resolutions (0.5 degree) in future releases. In addition to the input data improvements, several important algorithm improvements have been made since Release 3. These include recalculated atmospheric transmissivities and reflectivities yielding a less transmissive atmosphere. The calculations also include variable aerosol composition, allowing for the use of a detailed aerosol history from the Max Planck Institut Aerosol Climatology (MAC). Ocean albedo and snow/ice albedo are also improved from Release 3. Total solar irradiance is now variable, averaging 1361 Wm-2. Water vapor is taken from ISCCP's nnHIRS product. Results from GSW Release 4 are presented and analyzed. Early comparison to surface measurements show improved agreement.

  15. The predictive information obtained by testing multiple software versions

    Science.gov (United States)

    Lee, Larry D.

    1987-01-01

    Multiversion programming is a redundancy approach to developing highly reliable software. In applications of this method, two or more versions of a program are developed independently by different programmers and the versions are combined to form a redundant system. One variation of this approach consists of developing a set of n program versions and testing the versions to predict the failure probability of a particular program or a system formed from a subset of the programs. The precision that might be obtained, and also the effect of programmer variability if predictions are made over repetitions of the process of generating different program versions, are examined.

  16. An Introduction to Version Control Using GitHub Desktop

    Directory of Open Access Journals (Sweden)

    Daniel van Strien

    2016-06-01

    Full Text Available In this lesson you will be introduced to the basics of version control, understand why it is useful and implement basic version control for a plain text document using GitHub Desktop. By the end of this lesson you should understand: * what version control is and why it can be useful * the differences between Git and GitHub * how to implement version control using ‘GitHub Desktop,’ a Graphical User Interface for GitHub * be aware of other resources that will help you implement version control in your academic writing

  17. Modeling report of DYMOND code (DUPIC version)

    Energy Technology Data Exchange (ETDEWEB)

    Park, Joo Hwan [KAERI, Taejon (Korea, Republic of); Yacout, Abdellatif M. [Argonne National Laboratory, Ilinois (United States)

    2003-04-01

    The DYMOND code employs the ITHINK dynamic modeling platform to assess the 100-year dynamic evolution scenarios for postulated global nuclear energy parks. Firstly, DYMOND code has been developed by ANL(Argonne National Laboratory) to perform the fuel cycle analysis of LWR once-through and LWR-FBR mixed plant. Since the extensive application of DYMOND code has been requested, the first version of DYMOND has been modified to adapt the DUPIC, MSR and RTF fuel cycle. DYMOND code is composed of three parts; the source language platform, input supply and output. But those platforms are not clearly distinguished. This report described all the equations which were modeled in the modified DYMOND code (which is called as DYMOND-DUPIC version). It divided into five parts;Part A deals model in reactor history which is included amount of the requested fuels and spent fuels. Part B aims to describe model of fuel cycle about fuel flow from the beginning to the end of fuel cycle. Part C is for model in re-processing which is included recovery of burned uranium, plutonium, minor actinide and fission product as well as the amount of spent fuels in storage and disposal. Part D is for model in other fuel cycle which is considered the thorium fuel cycle for MSR and RTF reactor. Part E is for model in economics. This part gives all the information of cost such as uranium mining cost, reactor operating cost, fuel cost etc.

  18. Frost Multidimensional Perfectionism Scale: the portuguese version

    Directory of Open Access Journals (Sweden)

    Ana Paula Monteiro Amaral

    2013-01-01

    Full Text Available BACKGROUND: The Frost Multidimensional Perfectionism Scale is one of the most world widely used measures of perfectionism. OBJECTIVE: To analyze the psychometric properties of the Portuguese version of the Frost Multidimensional Perfectionism Scale. METHODS: Two hundred and seventeen (178 females students from two Portuguese Universities filled in the scale, and a subgroup (n = 166 completed a retest with a four weeks interval. RESULTS: The scale reliability was good (Cronbach alpha = .857. Corrected item-total correlations ranged from .019 to .548. The scale test-retest reliability suggested a good temporal stability with a test-retest correlation of .765. A principal component analysis with Varimax rotation was performed and based on the Scree plot, two robust factorial structures were found (four and six factors. The principal component analyses, using Monte Carlo PCA for parallel analyses confirmed the six factor solution. The concurrent validity with Hewitt and Flett MPS was high, as well as the discriminant validity of positive and negative affect (Profile of Mood Stats-POMS. DISCUSSION: The two factorial structures (of four and six dimensions of the Portuguese version of Frost Multidimensional Perfectionism Scale replicate the results from different authors, with different samples and cultures. This suggests this scale is a robust instrument to assess perfectionism, in several clinical and research settings as well as in transcultural studies.

  19. Controlled Release from Recombinant Polymers

    Science.gov (United States)

    Price, Robert; Poursaid, Azadeh; Ghandehari, Hamidreza

    2014-01-01

    Recombinant polymers provide a high degree of molecular definition for correlating structure with function in controlled release. The wide array of amino acids available as building blocks for these materials lend many advantages including biorecognition, biodegradability, potential biocompatibility, and control over mechanical properties among other attributes. Genetic engineering and DNA manipulation techniques enable the optimization of structure for precise control over spatial and temporal release. Unlike the majority of chemical synthetic strategies used, recombinant DNA technology has allowed for the production of monodisperse polymers with specifically defined sequences. Several classes of recombinant polymers have been used for controlled drug delivery. These include, but are not limited to, elastin-like, silk-like, and silk-elastinlike proteins, as well as emerging cationic polymers for gene delivery. In this article, progress and prospects of recombinant polymers used in controlled release will be reviewed. PMID:24956486

  20. Nanostructured Diclofenac Sodium Releasing Material

    Science.gov (United States)

    Nikkola, L.; Vapalahti, K.; Harlin, A.; Seppälä, J.; Ashammakhi, N.

    2008-02-01

    Various techniques have been developed to produce second generation biomaterials for tissue repair. These include extrusion, molding, salt leaching, spinning etc, but success in regenerating tissues has been limited. It is important to develop porous material, yet with a fibrous structure for it to be biomimetic. To mimic biological tissues, the extra-cellular matrix usually contains fibers in nano scale. To produce nanostructures, self-assembly or electrospinning can be used. Adding a drug release function to such a material may advance applications further for use in controlled tissue repair. This turns the resulting device into a multifunctional porous, fibrous structure to support cells and drug releasing properties in order to control tissue reactions. A bioabsorbable poly(ɛ-caprolactone-co-D,L lactide) 95/5 (PCL) was made into diluted solution using a solvent, to which was added 2w-% of diclofenac sodium (DS). Nano-fibers were made by electrospinning onto substrate. Microstructure of the resulting nanomat was studied using SEM and drug release profiles with UV/VIS spectroscopy. Thickness of the electrospun nanomat was about 2 mm. SEM analysis showed that polymeric nano-fibers containing drug particles form a highly interconnected porous nano structure. Average diameter of the nano-fibers was 130 nm. There was a high burst peak in drug release, which decreased to low levels after one day. The used polymer has slow a degradation rate and though the nanomat was highly porous with a large surface area, drug release rate is slow. It is feasible to develop a nano-fibrous porous structure of bioabsorbable polymer, which is loaded with test drug. Drug release is targeted at improving the properties of biomaterial for use in controlled tissue repair and regeneration.