WorldWideScience

Sample records for ab eia label

  1. Pharmacokinetics of radioimmunotherapeutic agent of direct labeling mAb 188Re-HAb18

    Institute of Scientific and Technical Information of China (English)

    Chao Lou; Zhi-Nan Chen; Hui-Jie Bian; Jie Li; Shou-Bo Zhou

    2002-01-01

    AIM: To labed Anti-hepatoma monoclonal antibody (mAb)fragment HAb18 F (ab')2 was labeled with 188 Re for thepharmacokinetic model of 188 Re-HAb18 F (ab')2 and toevaluate its pharmacokinetic parameters in hepatoma-bearing nude mice.METHODS: HAb18 F(ab')2 was directly labeled with 188Reusing 2-mercaptoethanol (2-ME) as reducing agents.Labeling efficiency and immunoreactivity of 188 Re-HAb18 F( ab')2 were evaluated by Whatman 3MM paperchromatography and live cell assay, respectively.Biodiatribution analysis was also conducted in nude micebearing human hepatoma in which animals were sacrificed atdifferent time points(1, 4, 18, 24 and 24h) after 188Re-HAb18F(ab' )2 was injected through tail-vein into hepatoma-bearingnude mice. The blood and radioactivity of organs and masswere measured. The concentrations of 188 Re-HAb18 F(ab')2were evaluated with a pharmacokinetic 3P97 software.RESULTS: The optimum labeling efficiency andimmunoreactive fraction were 91.7% and 0.78%,respectively. The parameters of 188Re-HAb18 F(ab')2 were:T1/2, 2.29h; Vd, 1.49 × 10-9L@ Bq- 1; AUC, 20.49 × 109Bq@ h@L-1 ;CL, 0.45 × 10-3L@ h- 1. 188Re- HAb18 F(ab')2 could locatespecially in hepatoma with high selective reactivity of HAb18F(ab')2. 188 Re-HAb18 F(ab')2 was mainly eliminated bykidney. The maximal tumor to blood ratio was at 48h, andmaximal tumor to liver ratio was at 18h.CONCLUTION: The pharmacokinetics of 188Re-HAb18 F(ab')2fit a I-compartment model. 188 Re-HAb18 F(ab')2 can beuptaken selectively at the hepatoma site.

  2. Labelling of MoAb with 153SmH1ETA: Preliminary results

    International Nuclear Information System (INIS)

    A method to label MoAb with Sm-153 using 1,5,9,13-tetraazacyclohexadecane N,N',N'',N''' tetraacetic acid (H4ETA) as a bifunctional chelator was developed. H4ETA and SmH1ETA were synthesized in our laboratory and characterized by IR spectroscopy, TGA (thermogravimetric analysis), SEM (Scattering Electronic Microscopy), EDAX (Elemental Dispersion Analysis by X-rays) and EPR (Electron Paramagnetic Resonance) at 6 K. The 153SmH1ETAMoAb was prepared by a simple incubation of the MoAb ior cea1, and the 153SmH1ETA complex at neutral pH and at room temperature for 24 h. The specific activity of the labelled antibody was 111 MBq/mg (3 mCi/mg). Sm-153(III) is commercially available with specific activities up to 318.2 GBq/mg. Therefore, under the conditions described above 153SmH1ETA labelled MoAb could be obtained with specific activity up to 1.14 GBq/mg (30.7 mCi/mg). (author)

  3. Preparation of a pure [sup 99m]Tc-F(ab')[sub 2] radioimmunoconjugate by direct labeling methods

    Energy Technology Data Exchange (ETDEWEB)

    Griffiths, G.L.; Jones, A.L.; Hansen, H.J. (Immunomedics Inc., Morris Plains, NJ (United States)); Goldenberg, D.M. (Center for Molecular Medicine and Immunology, Newark, NJ (United States))

    1994-05-01

    Intact IgG and Fab' can be labeled directly with [sup 99m]Tc to give quantitative incorporation of radioactivity into the protein. With F(ab')[sub 2] the reductive conditions yield a mixture of [sup 99m]Tc-F(ab')[sub 2] and [sup 99m]Tc-Fab'. We now report a direct labeling method to produce only [sup 99m]Tc-F(ab')[sub 2] in quantitative yield and contaminated with [sup 99m]Tc-Fab'. The properties, stability and biodistribution of the [sup 99m]Tc-F(ab')[sub 2] have been compared to [sup 99m]Tc-Fab'. This new technology will allow us to compare technetium direct-labeled IgG, F(ab')[sub 2] and Fab' derivatives of the same antibody for radioimmunodetection. (author).

  4. Distribution and dosimetry of indium-111 labeled F(ab')2 fragments in humans

    International Nuclear Information System (INIS)

    The purpose of this study was to obtain quantitative biodistribution data in patients injected with the indium-111 labeled F(ab')2 fragments of mouse monoclonal antibody. From this data dosimetric calculations were made for the individual organs. The authors also evaluated the quantitative properties of SPECT in this application and compared it with the more conventional two view planar technique in both phantom and patient studies. For one antibody (19-9) the mean dose in rads/mCi for the organs of highest accumulation, namely, the liver and kidneys was 3.2 and 2.6 respectively. Preliminary data from another antibody (OC 125) showed much higher blood levels and a significantly lower liver dose of 2.3 indicating that antibody type is another significant determinant in dosimetry. The SPECT approach particularly in the presence of background activity, was more accurate in the phantom studies and resulted in larger estimated doses in the patient studies. Also, SPECT has the added advantage of providing an index of organ volume, which has to be balanced with the fact the planar is more rapid, and does not require special hardware. 24 references, 5 figures, 1 table

  5. Detection of thrombi using a Tc-99m labelled antifibrin monoclonal antibody (MoAb)

    International Nuclear Information System (INIS)

    This thesis presents an investigation into the possibility of immunoscintigraphic detection of thrombi using an antifibrin monoclonal antibody, and fragments of the latter. The antifibrin antibody and tis fragments were labelled with Ec-99m, which has excellent characteristics for imaging with a gamma camera. The characterization of the antifibrin antibody and its fragments, the assessment of quality of labelling with Tc-99m, and results of experiments in vitro and in animals, which show the potential of immunoscintigraphic detection, are described. (author). 142 refs.; 44 figs.; 5 tabs

  6. Production of the {sup 14}C-labeled insecticidal protein Cry1Ab for soil metabolic studies using a recombinant Escherichia coli in small-scale batch fermentations

    Energy Technology Data Exchange (ETDEWEB)

    Valldor, Petra; Miethling-Graff, Rona; Dockhorn, Susanne; Martens, Rainer; Tebbe, Christoph C. [Federal Research Institute for Rural Areas, Forestry and Fisheries, Braunschweig (Germany). Thuenen Institute (vTI) for Biodiversity

    2012-10-15

    Insecticidal Cry proteins naturally produced by Bacillus thuringiensis are a major recombinant trait expressed by genetically modified crops. They are released into the soil during and after cropping. The objective of this study was to produce {sup 14}C-labeled Cry1Ab proteins for soil metabolic studies in scope of their environmental risk assessment. Cry1Ab was synthesized as a protoxin by Escherichia coli HB101 pMP in 200-mL liquid batch culture fermentations and purified from inclusion bodies after trypsin digestion. For cultivation, U-{sup 14}C-glycerol was the main carbon source. Inclusion bodies were smaller and Cry1Ab yield was lower when the initial amount of total organic carbon in the cultivation broth was below 6.4 mg C L{sup -1}. Concentrations of 12.6 g {sup 14}C-labeled glycerol L{sup -1} (1 % v/v) resulted in the production of 17.1 mg {sup 14}C-Cry1Ab L{sup -1} cultivation medium. {sup 14}C mass balances showed that approx. 50 % of the label was lost by respiration and 20 % remained in the growth media, while the residual activity was associated with biomass. Depending on the production batch, 0.01 to 0.05 % of the total {sup 14}C originated from Cry1Ab. In the presence of 2.04 MBq {sup 14}C-labeled carbon sources, a specific activity of up to 268 Bq mg{sup -1} {sup 14}C-Cry1Ab was obtained. A more than threefold higher specific activity was achieved with 4.63 MBq and an extended cultivation period of 144 h. This study demonstrates that {sup 14}C-labeled Cry1Ab can be obtained from batch fermentations with E. coli in the presence of a simple {sup 14}C-labeled carbon source. It also provides a general strategy to produce {sup 14}C-labeled proteins useful for soil metabolic studies. (orig.)

  7. Detection of GAD-Ab index in diabetic patients using 35S labeled recombinant human GAD65 antigen

    International Nuclear Information System (INIS)

    Objective: To establish a novel method for measuring glutamic acid decarboxylase autoanti-bodies(GAD-Ab). Methods: Recombinant human GAD65 was used as the antigen, in vitro transcribed and translated 35S-GAD65 as the tracer, a self-designed rotating incubation apparatus as the incubator, protein-A sepharose as the precipitator, and the liquid scintillation counter was used to measure radioactive count value to detect GAD-Ab. The positive cut-off point of GAD-Ab index was determined as > 0.05 by the 99.5% percentile in 109 healthy individuals. GAD-Ab levels were determined in 43 type 1 and 226 type 2 diabetic patients. Results: The optimized working conditions included SJ1515 35S-methionine for in vitro transcription and translation, 20-30 r/min setup of rotating incubation apparatus, test temperature 4-25 degree C, freshly prepared buffer of pH 7.2-7.4, and horizontal rotor centrifuge. The new method was better than original one, with intra-assay CV of 4.9%-8.3% and inter-assay CV of 7.1%-10.8 %, specificity of 98.2%. The results were comparable with the figures issued by an international standardized laboratory (concordance was 98.3%, Kappa value 0.971). The positive rate of GAD-Ab was 58.1% (25 of 43) in type 1 and 10.2%(23 of 226) in type 2 diabetes patients, but only 1.8% (2 of 109) in healthy individuals. Conclusion: The new assay for GAD-Ab is a highly sensitive, accurate, specific and reproducible method for clinical use

  8. EIA screening in Denmark

    DEFF Research Database (Denmark)

    Nielsen, Eskild Holm; Christensen, Per; Kørnøv, Lone

    2005-01-01

    The article points out that EIA screening is effectively a regulatory instrument and it can be a cost-effective instrument with environmental benefits.......The article points out that EIA screening is effectively a regulatory instrument and it can be a cost-effective instrument with environmental benefits....

  9. EIA publications directory, 1991

    International Nuclear Information System (INIS)

    Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department's independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, and resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the EIA from January through December 1991. This edition supplements EIA Publications Directory 1977--1989 and EIA Publications Directory 1990. The body of the Directory contains citations and abstracts arranged by broad subject categories, such as coal, petroleum, and natural gas and subcategories such as reserves, produces and byproducts, and marketing and economics. All reports are indexed alphabetically by subject and title and numerically by report number

  10. EIA publications directory, 1990

    International Nuclear Information System (INIS)

    Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department's independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, and resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the EIA from January through December 1990. This edition supplements EIA Publications Directory 1977--1989. The body of the Directory contains citations and abstracts arranged by broad subject categories, such as coal, petroleum, and natural gas and subcategories such as reserves, products and byproducts, and marketing and economics. All reports are indexed alphabetically by subject and title and numerically by report number

  11. EIA publications directory 1996

    International Nuclear Information System (INIS)

    This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the Energy Information Administration (EIA) from January through December 1996. The body of the Directory contains citations and abstracts arranged by broad subject categories; metadata, coal, oil and gas, nuclear, electricity, renewable and energy/alternative fuels, multifuel, end-use consumption, models, and forecasts

  12. EIA Publications Directory 1995

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-10-01

    This directory contains abstracts and ordering information for individual issues of semiannual, annual, biennial, and triennial Energy Information Administration (EIA) periodicals, analysis reports, Service Reports, and model documentations. This edition covers periodicals and one-time reports produced by EIA from January through December 1995. The citations and abstracts are arranged by broad subject categories: metadata, coal, oil/gas, nuclear, electricity, renewable energy/alternative fuels, multifuel, end-use consumption, models, and forecasts. Indexes are provided.

  13. EIA publications directory 1996

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-05-01

    This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the Energy Information Administration (EIA) from January through December 1996. The body of the Directory contains citations and abstracts arranged by broad subject categories; metadata, coal, oil and gas, nuclear, electricity, renewable and energy/alternative fuels, multifuel, end-use consumption, models, and forecasts.

  14. Design and preclinical evaluation of a 99mTc-labelled diabody of mAb J591 for SPECT imaging of prostate-specific membrane antigen (PSMA)

    OpenAIRE

    Kampmeier, Florian; Williams, Jennifer D.; Maher, John; Mullen, Gregory E.; Blower, Philip J.

    2014-01-01

    Background Sensitive and specific detection of nodal status, sites of metastases and low-volume recurrent disease could greatly improve management of patients with advanced prostate cancer. Prostate-specific membrane antigen (PSMA) is a well-established marker for prostate carcinoma with increased levels of expression in high-grade, hormone-refractory and metastatic disease. The monoclonal antibody (mAb) J591 is directed against an extracellular epitope of PSMA and has been shown to efficient...

  15. Targeting human prostate cancer with 111In-labeled D2B IgG, F(ab')2 and Fab fragments in nude mice with PSMA-expressing xenografts.

    Science.gov (United States)

    Lütje, Susanne; van Rij, Catharina M; Franssen, Gerben M; Fracasso, Giulio; Helfrich, Wijnand; Eek, Annemarie; Oyen, Wim J; Colombatti, Marco; Boerman, Otto C

    2015-01-01

    D2B is a new monoclonal antibody directed against an extracellular domain of prostate-specific membrane antigen (PSMA), which is overexpressed in prostate cancer. The potential of D2B IgG, and F(ab')2 and Fab fragments of this antibody for targeting prostate cancer was determined in mice bearing subcutaneous prostate cancer xenografts. The optimal time point for imaging was determined in biodistribution and microSPECT imaging studies with (111)In-D2B IgG, (111)In-capromab pendetide, (111)In-D2B F(ab')2 and (111)In-D2B Fab fragments in mice with PSMA-expressing LNCaP and PSMA-negative PC3 tumors at several time points after injection. All (111)In-labeled antibody formats specifically accumulated in the LNCaP tumors, with highest uptake of (111)In-D2B IgG and (111)In-capromab pendetide at 168 h p.i. (94.8 ± 19.2% injected dose per gram (ID/g) and 16.7 ± 2.2% ID/g, respectively), whereas uptake of (111)In-D2B F(ab')2 and (111)In-D2B Fab fragments peaked at 24 h p.i. (12.1 ± 3.0% ID/g and 15.1 ± 2.9% ID/g, respectively). Maximum LNCaP tumor-to-blood ratios were 13.0 ± 2.3 (168 h p.i.), 6.2 ± 0.7 (24 h p.i.), 23.0 ± 4.0 (24 h p.i.) and 4.5 ± 0.6 (168 h p.i.) for (111)In-D2B IgG, (111)In-F(ab')2, (111)In-Fab and (111)In-capromab pendetide, respectively. LNCaP tumors were clearly visualized with microSPECT with all antibody formats. This study demonstrates the feasibility of D2B IgG, F(ab')2 and Fab fragments for targeting PSMA-expressing prostate cancer xenografts.

  16. An automated technique for most-probable-number (MPN) analysis of densities of phagotrophic protists with lux-AB labelled bacteria as growth medium

    DEFF Research Database (Denmark)

    Ekelund, Flemming; Christensen, Søren; Rønn, Regin;

    1999-01-01

    with a luxAB gene cassette was constructed, and used as growth medium for the protozoa in the micro titre plates. The transconjugant produced high amounts of luciferase which was stable and allowed detection for at least 8 weeks. Dilution series of protozoan cultures and soil suspensions were inoculated...... into micro titre plates amended with a suspension of the transconjugant. After 45 days measurement of light emission allowed detection of individual wells in the titre plates, where protozoan grazing had removed the inoculated bacteria....

  17. LABELING McAb 3H11 AND ITS Fab FRAGMENT WITH 211At AND THEIR IMMUNOREACTIVITIES AND INJURY EFFECTS ON HUMAN GASTRIC CANCER CELLS

    Institute of Scientific and Technical Information of China (English)

    刘宁; 罗德元; 等

    1995-01-01

    An antigastric cancer monoclonal antibody,3H11,and its Fab fragment,were labeled using p-(211At)-astatobenzoic acid(pAtBA) intermediate,in the yields of more than 30%.The results of in vitro experiments show that 211 At-3H11 and 211At-3H11 Fab are stable,and have specific immunoreactivities and cytotoxic effects to human gastric cancer cell M85,The cytotoxic effects are dependent on the concentration of 211At-3H11 or 211 At-3H11 Fab and obviously stronger than that of Na211At.

  18. EIA publications directory, 1992

    Energy Technology Data Exchange (ETDEWEB)

    1993-06-24

    This directory contains abstracts and ordering information for EIA publications. The abstracts are arranged by broad subject category such as coal, petroleum, natural gas, and electric power. A comprehensive subject index, a title index, and a report number index are included. Each entry gives the title, report number, publication frequency, date, number of pages, and ordering information. Publication began with the 1979 edition.

  19. EIA Publications Directory 1993

    International Nuclear Information System (INIS)

    This directory contains abstracts and ordering information for EIA publications released in the above time period. The abstracts are arranged by broad subject category such as coal, petroleum, natural gas, and electric power. A comprehensive subject index, a title index, and a report number index are included. Each entry gives the title, report number, publication frequency, date, number of pages, and ordering information

  20. EIA publications directory, 1992

    International Nuclear Information System (INIS)

    This directory contains abstracts and ordering information for EIA publications. The abstracts are arranged by broad subject category such as coal, petroleum, natural gas, and electric power. A comprehensive subject index, a title index, and a report number index are included. Each entry gives the title, report number, publication frequency, date, number of pages, and ordering information. Publication began with the 1979 edition

  1. Fotfavoriten AB

    OpenAIRE

    Søilen, Klaus Solberg; HUBER, Stefan

    2004-01-01

    Fotfavoriten AB, a foot care company located in Sollefttå in Northern Sweden, is an example of how local government fires staff only to reengage them as entrepreneurs delivering similar service. The case is typical for the social sector and may mark a trend. The result is often felt to be positive both by the entrepreneur, who is now more directly in charge of her or his earnings, and the end consumer. The CEO of Fotfavoriten AB, Eva Wörmann, waited a long time before she dared to take the ne...

  2. ABS 497 Complete Class

    OpenAIRE

    admin

    2015-01-01

    ABS 497 Complete Class   To purchase this material click below link   http://www.assignmentcloud.com/ABS-497/ABS-497-Complete-Class-Guide   For more classes visit   www.assignmentcloud.com   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 ...

  3. Critical factors for EIA implementation

    DEFF Research Database (Denmark)

    Zhang, Jasmine; Kørnøv, Lone; Christensen, Per

    2013-01-01

    After decades of development, the gap between expectations of Environment Impact Assessments (EIA) and their practical performance remains significant. Research has been done to identify the critical factors for an effective implementation of EIA. However, this research, to a large extent, has...... between different critical factors and how they relate to different stages in the EIA and thus influence the decision making process. After reviewing 33 refereed journal articles published between 1999 and 2011, we identified 203 notions of critical factors. Of these, 102 related to different stages...... defined in our comprehensive EIA implementation model, and 101 were identified as general factors related to the whole EIA system. The number of notions of stage factors and general factors is thus about equal. An overlap between stage factors and general factors was found, which demonstrates...

  4. An assessment of EIA system in India

    International Nuclear Information System (INIS)

    Environmental impact assessment (EIA) was first introduced in India based on the Environmental Protection Act (EPA), 1986. But formally it came in to effect, when Ministry of Environment and Forest (MoEF) has passed a major legislative measure under EPA in January 1994 for Environmental Clearance (EC) known as EIA Notification, 1994. Subsequently, EIA processes have been strengthened by MoEF by a series of amendments. The current practice is adhering to EIA Notification, 2006 and its amendments. The pieces of evidence collected and analysis in the present assessment suggest that, despite a sound legislative, administrative and procedural set-up EIA has not yet evolved satisfactorily in India. An appraisal of the EIA system against systematic evaluation criteria, based on discussions with various stakeholders, EIA expert committee members, approval authorities, project proponents, NGOs and consulting professionals, reveals various drawbacks of the EIA system. These mainly include; inadequate capacity of EIA approval authorities, deficiencies in screening and scoping, poor quality EIA reports, inadequate public participation and weak monitoring. Overall, EIA is used presently as a project justification tool rather than as a project planning tool to contribute to achieving sustainable development. While shortcomings are challenging, Government of India is showing a high degree of commitment. The EIA system in the country is undergoing progressive refinements by steadily removing the constraints. The paper identifies opportunities for taking advantage of the current circumstances for strengthening the EIA process. - Highlights: ► An assessment has been carried out on Environmental Clearance under EIA Notification, 2006, MoEF, Government of India. ► EIA system is appraised against systematic evaluation criteria proposed by Ahmad and Wood (2002), Wood (2003), Fuller (1999). ► The analysis reveals reveals various drawbacks of the EIA system. ► The paper identifies

  5. Analysis of the Environmental Impact Assessment (EIA) Directive and the EIA decision in Turkey

    International Nuclear Information System (INIS)

    The Environmental Impact Assessment (EIA) Directive first entered into force in the United States in 1969, and began to be implemented in many other countries by 1990. The first Environmental Impact Assessment (EIA) Directive in Turkey was published on February 7, 1993, under the Environmental Law No. 2872. The EIA Directive was revised seven times on June 23, 1997, June 6, 2002, December 16, 2003, July 17, 2008, October 3, 2013, and November 25, 2014. Several amendments were made during this process. The first EIA Directive dated 1993 was narrow in scope and its procedure was long, while the amendments in 2003, 2008, 2013, and 2014 widened the scope of the EIA, and shortened the EIA assessment procedures. In this study, the amendments to the Turkish EIA Directive were analysed, and their effect on the number of EIA decisions made was addressed. It was concluded that the uncertainties in EIA procedures were removed, procedures were shortened, and as a result, the number of EIA decisions increased thanks to the revisions made in line with harmonisation with European Union (EU) acquis. - Highlights: • Demonstrates the Environmental Impact Assessment practices in Turkey. • Demonstrates the application of the EIA in Turkey by sector. • Demonstrates the amendments of the EIA by-laws in Turkey. • Demonstrates the changes in EIA practices and EIA decisions

  6. Analysis of the Environmental Impact Assessment (EIA) Directive and the EIA decision in Turkey

    Energy Technology Data Exchange (ETDEWEB)

    Bilgin, Ayla

    2015-07-15

    The Environmental Impact Assessment (EIA) Directive first entered into force in the United States in 1969, and began to be implemented in many other countries by 1990. The first Environmental Impact Assessment (EIA) Directive in Turkey was published on February 7, 1993, under the Environmental Law No. 2872. The EIA Directive was revised seven times on June 23, 1997, June 6, 2002, December 16, 2003, July 17, 2008, October 3, 2013, and November 25, 2014. Several amendments were made during this process. The first EIA Directive dated 1993 was narrow in scope and its procedure was long, while the amendments in 2003, 2008, 2013, and 2014 widened the scope of the EIA, and shortened the EIA assessment procedures. In this study, the amendments to the Turkish EIA Directive were analysed, and their effect on the number of EIA decisions made was addressed. It was concluded that the uncertainties in EIA procedures were removed, procedures were shortened, and as a result, the number of EIA decisions increased thanks to the revisions made in line with harmonisation with European Union (EU) acquis. - Highlights: • Demonstrates the Environmental Impact Assessment practices in Turkey. • Demonstrates the application of the EIA in Turkey by sector. • Demonstrates the amendments of the EIA by-laws in Turkey. • Demonstrates the changes in EIA practices and EIA decisions.

  7. New fluorimetric assay of horseradish peroxidase using sesamol as substrate and its application to EIA

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    Horseradish peroxidase (HRP) is generally used as a label enzyme in enzyme immunoassay (EIA).The procedure used for HRP detection in EIA is critical for sensitivity and precision.This paper describes a novel fluorimetric assay for horseradish peroxidase (HRP) using sesamol as substrate.The principle of the assay is as follow:sesamol (3,4-methylenedioxy phenol) is reacted enzymatically in the presence of hydrogen peroxide to produce dimeric sesamol.The dimer is fluorescent and can be detected sensitively at ...

  8. Dutch Energy Investment Allowance (EIA). Energy List for 2013; Energie-investeringsaftrek (EIA). Energielijst 2013

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-01-15

    The Energy Investment Allowance (EIA) is a tax system by means of which the Dutch government supports companies with investments in energy-saving equipment and renewable energy. This brochure explains the assets eligible for EIA and how the scheme works [Dutch] De Energie-investeringsaftrek (EIA) is een fiscale regeling waarmee de overheid ondersteuning biedt voor bedrijven bij investeringen in energiebesparende bedrijfsmiddelen en duurzame energie. In deze brochure wordt uitgelegd welke bedrijfsmiddelen in aanmerking komen voor EIA en hoe de regeling werkt.

  9. Food Labels

    Science.gov (United States)

    ... How Can I Help a Friend Who Cuts? Food Labels KidsHealth > For Teens > Food Labels Print A ... have at least 95% organic ingredients. continue Making Food Labels Work for You The first step in ...

  10. Danish experiences on EIA of livestock projects

    DEFF Research Database (Denmark)

    Christensen, Per

    2006-01-01

    Since its introduction into Danish planning in 1989, Environmental Impact Assessment (EIA) has been widely discussed. At the centre of the debate has been the question of whether EIA actually offered anything new and there has been a great deal of scepticism about the efficacy of the instrument...... that these changes definitely address some of the shortcomings found in the evaluation....

  11. EIA modelling for CZM applications. Part 1

    Digital Repository Service at National Institute of Oceanography (India)

    Vethamony, P.; Babu, M.T.

    stream_size 12 stream_content_type text/plain stream_name Summer_Sch_EIA_Manage_Coast_Zone_2001_84.pdf.txt stream_source_info Summer_Sch_EIA_Manage_Coast_Zone_2001_84.pdf.txt Content-Encoding ISO-8859-1 Content-Type text...

  12. EIA of anthropogenic activities on marine macrobenthos

    Digital Repository Service at National Institute of Oceanography (India)

    Govindan, K.

    stream_size 12 stream_content_type text/plain stream_name Summer_Sch_EIA_Mgmt_Coastal_Zone_Trg_Manual_158.pdf.txt stream_source_info Summer_Sch_EIA_Mgmt_Coastal_Zone_Trg_Manual_158.pdf.txt Content-Encoding ISO-8859-1 Content...

  13. ABS 497 ASH Tutorial / Uoptutorial

    OpenAIRE

    Latifa Baka

    2015-01-01

    For more course tutorials visit www.uoptutorial.com   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 ...

  14. ABS 497 ASH TUTORIAL / Uoptutorial

    OpenAIRE

    Remo

    2015-01-01

    For more course tutorials visit www.uoptutorial.com   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4...

  15. ABS 497 Courses/snaptutorial

    OpenAIRE

    charles

    2015-01-01

    For more classes visit www.snaptutorial.com   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 DQ ...

  16. A review of EIAs on trade policy in China: Exploring the way for economic policy EIAs

    Energy Technology Data Exchange (ETDEWEB)

    Mao, Xianqiang, E-mail: maoxq@bnu.edu.cn [Center for Global Environmental Policy, School of Environment, Beijing Normal University, Beijing 100875 (China); Song, Peng, E-mail: songpeng_ee@163.com [Center for Global Environmental Policy, School of Environment, Beijing Normal University, Beijing 100875 (China); Kørnøv, Lone, E-mail: lonek@plan.aau.dk [The Danish Centre for Environmental Assessment, Department of Planning, Aalborg University, Skibbrogade 5, B1-04, 9000 Aalborg (Denmark); Corsetti, Gabriel, E-mail: gabriel.corsetti@gmail.com [Center for Global Environmental Policy, School of Environment, Beijing Normal University, Beijing 100875 (China)

    2015-01-15

    During the discussion on the “Environmental Protection Law Amendment (draft)” in 2011, it was decided to drop the proposed clauses related to environmental impact assessments (EIAs) on policy, which means that there remained no provisions for policy EIAs, and China's strategic environmental assessment system stayed limited to the planning level. However, considering that economic policy making is causing significant direct and indirect environmental problems and that almost every aspect of governmental policy has an economic aspect, EIAs on economic policies are of the utmost urgency. The purpose of this study is to review the EIA work that has been carried out on trade policy in China through four case studies, and illustrate how trade policy EIAs can be helpful in achieving better environmental outcomes in the area of trade. Through the trade policy EIA case studies we try to argue for the feasibility of conducting EIAs on economic policies in China. We also discuss the implications of the case studies from the point of view of how to proceed with EIAs on economic policy and how to promote their practice. - Highlights: • SEA system is incomplete and stays limited to the plan EIA level in China. • EIA on economic policy is of utmost importance for all the developing countries. • Four case studies of trade policy EIA in China are reviewed for policy implications. • Departmental competition for political power impedes economic policy EIAs in China. • Legislative regulation on policy EIA is the first thing needed to overcome barrier.

  17. A review of EIAs on trade policy in China: Exploring the way for economic policy EIAs

    International Nuclear Information System (INIS)

    During the discussion on the “Environmental Protection Law Amendment (draft)” in 2011, it was decided to drop the proposed clauses related to environmental impact assessments (EIAs) on policy, which means that there remained no provisions for policy EIAs, and China's strategic environmental assessment system stayed limited to the planning level. However, considering that economic policy making is causing significant direct and indirect environmental problems and that almost every aspect of governmental policy has an economic aspect, EIAs on economic policies are of the utmost urgency. The purpose of this study is to review the EIA work that has been carried out on trade policy in China through four case studies, and illustrate how trade policy EIAs can be helpful in achieving better environmental outcomes in the area of trade. Through the trade policy EIA case studies we try to argue for the feasibility of conducting EIAs on economic policies in China. We also discuss the implications of the case studies from the point of view of how to proceed with EIAs on economic policy and how to promote their practice. - Highlights: • SEA system is incomplete and stays limited to the plan EIA level in China. • EIA on economic policy is of utmost importance for all the developing countries. • Four case studies of trade policy EIA in China are reviewed for policy implications. • Departmental competition for political power impedes economic policy EIAs in China. • Legislative regulation on policy EIA is the first thing needed to overcome barrier

  18. EIA completes corrections to drilling estimates series

    Energy Technology Data Exchange (ETDEWEB)

    Trapmann, W.; Shambaugh, P. [Energy Information Administration, Washington, DC (United States)

    1998-11-23

    The Energy Information Administration (EIA) has published monthly and annual estimates of US oil and gas drilling activity since 1978. These data are key information for many industry analysts, serving as a leading indicator of trends in the industry and a barometer of general industry status. They are assessed directly for trends, as well as in combination with other measures to assess the productivity and profitability of upstream industry operations. They are major reference points for federal and state policymakers. EIA does not itself collect drilling activity data. Instead, it relies on an external source for data on oil, bas, and dry well completions. These data are provided to EIA monthly on an as reported basis. During a recent effort to enhance EIA`s well completion data system, the detection of unusual patterns in the well completion data as received led to an expanded examination of these data. Substantial discrepancies between the data as received by EIA and correct record counts since 1987 were identified. For total wells by year, the errors ranged up to more than 2,300 wells, 11% of the 1995 total, and the impact of these errors extended backward in time to at least the early 1980s. When the magnitude and extent of the as reported well completion data problem were confirmed, EIA suspended its publication and distribution of updated drilling data. EIA staff proceeded to acquire replacement files with the as reported records and then revise the statistical portion of its drilling data system to reflect the new information. The replacement files unfortunately also included erroneous data based on the improper allocation of wells between exploration and development. EIA has now resolved the two data problems and generated revised time series estimates for well completions and footage drilled. The paper describes the problems in the data, differences between the series, and maintaining future data quality.

  19. EIA screening and nature protection in Denmark

    DEFF Research Database (Denmark)

    Christensen, Per; Kørnøv, Lone

    2011-01-01

    screening practices. In this paper, the demands formulated in the guidelines of local authorities were analysed in order to investigate how the protection of groundwater, coastal waters, lakes and Natura 2000 sites develops through EIA screening. It is concluded that the level of protection has improved......The number of environmental impact assessment (EIA) screenings in Denmark has increased dramatically since 2000. This is a consequence of increased pig production as well as the concentration of production on larger farms. In the same period, EIA rules have developed primarily due to an increased...

  20. He'eia Stream Contaminants Study

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Potential risk to ecological receptors in He’eia Stream and Wetland was characterized through the use of a food-web model to predict effects to the Hawaiian stilt,...

  1. Verdivurdering av SAS AB

    OpenAIRE

    Gangås, Silje Garberg

    2013-01-01

    Formålet med denne mastergradsavhandlingen har vært å beregne den teoretiske verdien på det børsnoterte selskapet SAS AB og på bakgrunn av denne gi en handlingsanbefaling på selskapets aksje. Forskningsspørsmålet for oppgaven er utledet som følger: ”Hva er verdien av SAS AB?” SAS AB er inne i en fundamental omstillingsprosses hvor den nye strategien, 4XNG, ble presentert og påbegynt november 2012. Omstillingsprosessen innebærer blant annet en omfattende omstrukturering i organisasjonen ...

  2. Nutrition Labeling

    DEFF Research Database (Denmark)

    Grunert, Klaus G

    2013-01-01

    because consumers will avoid products that the label shows to be nutritionally deficient, but also because food producers will try to avoid marketing products that appear, according to the label, as nutritionally problematic, for example, because of a high content of saturated fat or salt. Nutrition......Nutrition labeling refers to the provision of information on a food product’s nutritional content on the package label. It can serve both public health and commercial purposes. From a public health perspective, the aim of nutrition labeling is to provide information that can enable consumers...... to make healthier choices when choosing food products. Nutrition labeling is thus closely linked to the notion of the informed consumer, that chooses products according to their aims, on the basis of the information at their disposal. Because many consumers are assumed to be interested in making healthy...

  3. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with western corn rootworm midgut membrane binding sites.

    Directory of Open Access Journals (Sweden)

    Huarong Li

    Full Text Available BACKGROUND: Bacillus thuringiensis (Bt Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interactions are one line of evidence that Bt protein mechanisms of action differ and that the probability of receptor-mediated cross-resistance is low. METHODOLOGY/PRINCIPAL FINDINGS: Binding site interactions were investigated between Cry34Ab1/Cry35Ab1 and coleopteran active insecticidal proteins Cry3Aa, Cry6Aa, and Cry8Ba on western corn rootworm midgut brush border membrane vesicles (BBMV. Competitive binding of radio-labeled proteins to western corn rootworm BBMV was used as a measure of shared binding sites. Our work shows that (125I-Cry35Ab1 binds to rootworm BBMV, Cry34Ab1 enhances (125I-Cry35Ab1 specific binding, and that (125I-Cry35Ab1 with or without unlabeled Cry34Ab1 does not share binding sites with Cry3Aa, Cry6Aa, or Cry8Ba. Two primary lines of evidence presented here support the lack of shared binding sites between Cry34Ab1/Cry35Ab1 and the aforementioned proteins: 1 No competitive binding to rootworm BBMV was observed for competitor proteins when used in excess with (125I-Cry35Ab1 alone or combined with unlabeled Cry34Ab1, and 2 No competitive binding to rootworm BBMV was observed for unlabeled Cry34Ab1 and Cry35Ab1, or a combination of the two, when used in excess with (125I-Cry3Aa, or (125I-Cry8Ba. CONCLUSIONS/SIGNIFICANCE: Combining two or more insecticidal proteins active against the same target pest is one tactic to delay the onset of resistance to either protein. We conclude that Cry34Ab1/Cry35Ab1 are compatible with Cry3Aa, Cry6Aa, or Cry8Ba

  4. Is EIA part of the wind power planning problem?

    International Nuclear Information System (INIS)

    This research evaluates the importance and effectiveness of Environmental Impact Assessment (EIA) within wind farm planning debates, drawing on insights from case studies in Scotland. Despite general public support for renewable energy on the grounds that it is needed to tackle climate change and implement sustainable development, many proposed wind farms encounter significant resistance. The importance of planning issues and (EIA) processes has arguably been overlooked within recent wind farm social acceptability discourse. Through semi-structured interviews with key stakeholders and textual analysis of EIA documents, the characteristics of EIA are assessed in terms of its perceived purpose and performance. The data show that whilst respondents perceive EIA to be important, they express concerns about bias and about the inability of EIA to address climate change and wind farm decommissioning issues adequately. Furthermore, the research identifies key issues which impede the effectiveness of EIA, and reveals differences between theoretical and practical framings of EIA. The paper questions the assumption that EIA is a universally applicable tool, and argues that its effectiveness should be analysed in the context of specific development sectors. The article concludes by reviewing whether the recently amended EIA Directive (2014/52/EU) could resolve identified problems within national EIA practice. - Highlights: • Evaluation of EIA for onshore wind farm planning in Scotland. • EIA is important for multiple aspects of onshore wind farm planning. • Multiple substantive deficiencies of relevance to wind farm planning exist in EIA. • Further research into EIA effectiveness for specific development types is required. • Directive 2014/52/EU may improve EIA effectiveness within wind farm planning

  5. Is EIA part of the wind power planning problem?

    Energy Technology Data Exchange (ETDEWEB)

    Smart, Duncan Ewan; Stojanovic, Timothy A., E-mail: tas21@st-andrews.ac.uk; Warren, Charles R.

    2014-11-15

    This research evaluates the importance and effectiveness of Environmental Impact Assessment (EIA) within wind farm planning debates, drawing on insights from case studies in Scotland. Despite general public support for renewable energy on the grounds that it is needed to tackle climate change and implement sustainable development, many proposed wind farms encounter significant resistance. The importance of planning issues and (EIA) processes has arguably been overlooked within recent wind farm social acceptability discourse. Through semi-structured interviews with key stakeholders and textual analysis of EIA documents, the characteristics of EIA are assessed in terms of its perceived purpose and performance. The data show that whilst respondents perceive EIA to be important, they express concerns about bias and about the inability of EIA to address climate change and wind farm decommissioning issues adequately. Furthermore, the research identifies key issues which impede the effectiveness of EIA, and reveals differences between theoretical and practical framings of EIA. The paper questions the assumption that EIA is a universally applicable tool, and argues that its effectiveness should be analysed in the context of specific development sectors. The article concludes by reviewing whether the recently amended EIA Directive (2014/52/EU) could resolve identified problems within national EIA practice. - Highlights: • Evaluation of EIA for onshore wind farm planning in Scotland. • EIA is important for multiple aspects of onshore wind farm planning. • Multiple substantive deficiencies of relevance to wind farm planning exist in EIA. • Further research into EIA effectiveness for specific development types is required. • Directive 2014/52/EU may improve EIA effectiveness within wind farm planning.

  6. Climate change in EIA - Inspiration from practice

    DEFF Research Database (Denmark)

    Larsen, Sanne Vammen

    2013-01-01

    taking place. For exploring the praxis of integrating climate change in practice a document study of 100 Danish EIA reports is carried out. From these reports, statistics and examples are drawn. The study shows an emphasis on integration of climate change mitigation, using various quantitative tools......Climate change integration has been a topic of much interest in the field of impact assessment for a period, and thus far quite some emphasis has been put on discussions of purpose, relevance and overall approaches in both Environmental Impact Assessment of projects (EIA) and Strategic...... Environmental Assessments of plans and programmes (SEA). However, EIAs and SEAs are already being made, which integrate climate change, and for some aspects this practice has evolved over a long period. This paper seeks to explore this practice and find inspiration from the work with climate change already...

  7. End-use taxes: Current EIA practices

    Energy Technology Data Exchange (ETDEWEB)

    1994-08-17

    There are inconsistencies in the EIA published end-use price data with respect to Federal, state, and local government sales and excise taxes; some publications include end-use taxes and others do not. The reason for including these taxes in end-use energy prices is to provide consistent and accurate information on the total cost of energy purchased by the final consumer. Preliminary estimates are made of the effect on prices (bias) reported in SEPER (State Energy Price and Expenditure Report) resulting from the inconsistent treatment of taxes. EIA has undertaken several actions to enhance the reporting of end-use energy prices.

  8. Food labeling

    Science.gov (United States)

    ... per serving to the right of the nutrient. Vitamins and minerals: Only two vitamins (A and C) and two ... are required on the food label. But, when vitamins or minerals are added to the food, or when a ...

  9. Suboptimal Detection of Influenza Virus in Adults by the Directigen Flu A+B Enzyme Immunoassay and Correlation of Results with the Number of Antigen-Positive Cells Detected by Cytospin Immunofluorescence

    Science.gov (United States)

    Landry, Marie L.; Ferguson, David

    2003-01-01

    To provide 24-h influenza diagnosis for adults presenting to the emergency department, the Directigen Flu A+B enzyme immunoassay (EIA) was performed in the chemistry laboratory during the night shift. Nasopharyngeal swabs were retested by cytospin-enhanced direct immunofluorescence (DFA; SimulFluor respiratory screen) when the virology laboratory opened. The influenza EIA detected 16 influenza A virus infections, whereas cytospin-enhanced DFA detected 31 influenza A virus infections as well as 3 respiratory syncytial virus, 2 adenovirus, and 1 parainfluenza virus infections. A positive EIA result usually correlated with 50 or more influenza virus cells positive by DFA. PMID:12843105

  10. Dutch Energy Investment Allowance (EIA). Annual report 2012; Energie-Investeringsaftrek (EIA). Jaarverslag 2012

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-07-15

    By means of the Energy Investment Allowance (EIA) the Ministry of Economic Affairs supports investments of businesses, industrial associations and other parties in accelerating innovative, energy saving sustainable initiatives and technologies. In this report the results for 2012 are presented [Dutch] Met de EIA ondersteunt het Ministerie van Economische Zaken bedrijven bij het investeren in innovatieve, energiebesparende en duurzame technieken. In dit verslag over 2012 worden resultaten weergegeven.

  11. EIA and green procurement: Opportunities for strengthening their coordination

    International Nuclear Information System (INIS)

    EIA plays an important role in enhancing the environmental performance of the construction sector. In recent years, the construction sector has been developing green procurement practices. Green procurement is a process that involves the incorporation of environmental requirements during the procurement of services and products. However, discussion on green procurement is rarely seen during the EIA phase. This paper addresses possible opportunities for improving the coordination between EIA and green procurement within the construction sector. The linking of EIA and green procurement has been postulated in the paper as an aid to strengthen the coordination between project planning and implementation. The paper is based on a literature review and is an outcome of an on-going research project concerning EIA and green procurement. This study indicated that it would be appropriate to introduce green procurement during the pre-decision phase of an EIA. In the present study, the opportunities for integrating green procurement at the stage of EIA are associated with the integration of project planning and EIA. Future research should investigate the mechanism through which the link can be established. - Highlights: ► This paper identifies opportunities to link EIA and green procurement. ► Pre-decision phase of EIA could be appropriate for planning green procurement. ► Future research should investigate the mechanism for establishing the link.

  12. ABS 497 ASH Tutorial/Uoptutorial

    OpenAIRE

    Kathi

    2015-01-01

    ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 DQ 2 Problems of Adolescence ABS 497 Week 5 DQ Macro Social Systems...

  13. The AB Staff Plan

    CERN Document Server

    Boillot, J; Delahaye, J P; Myers, S; CERN. Geneva. AB Department

    2003-01-01

    The present report summarises the staff plan of the newly created Accelerators and Beams (AB) Division following the restructuring of the Accelerator Sector and covering the period 2003 to 2010. It underlines the refocusing of the staff on priority work, especially the LHC Project and is coherent with the recently adopted CERN Long Term Plan (LTP). It compares the requested and available manpower (both staff and industrial support) for each Project, Programme and Activity (PPA) split in work packages and highlights the missing manpower for each category of personnel.

  14. Food labels

    DEFF Research Database (Denmark)

    Selsøe Sørensen, Henrik; Clement, Jesper; Gabrielsen, Gorm

    2012-01-01

    The food industry develops tasty and healthy food but fails to deliver the message to all consumers. The consumers’ background knowledge is essential for how they find and decode relevant elements in the cocktail of signs which fight for attention on food labels. In this exploratory study, we find...... evidence for dividing consumers into two profiles: one relying on general food knowledge and another using knowledge related to signpost labels. In a combined eyetracking and questionnaire survey we analyse the influence of background knowledge and identify different patterns of visual attention...... for the two consumer profiles. This underlines the complexity in choosing and designing the ‘right’ elements for a food package that consumers actually look at and are able to make rational use of. In spite of any regulation of food information provided by authorities, consumers will still be confronted...

  15. A MULTI-VIEW EVALUATION OF THE FINNISH EIA SYSTEM: AN 18-YEAR SUCCESS STORY?

    OpenAIRE

    PEKKA HOKKANEN; JORMA JANTUNEN

    2012-01-01

    This article reviews how the Finnish EIA legislation and procedures are performing in practice, and how the goals of the EIA Act are reached. The role of EIA in planning and decision-making, and the relationship between the EIA legislation and other pieces of legislation is also evaluated. Overall, the goals of the Finnish EIA legislation have been successfully reached: EIA has achieved a meaningful role as a preventive and participatory environmental management tool. In addition, stakeholder...

  16. AB Manpower Plan 2007

    CERN Document Server

    Myers, Stephen

    2007-01-01

    The present exercise is not as such a "manpower plan" but a purely budgetary comparison of known plus requested resources with the known commitments over the period 2007-2012. From a purely budgetary point of view, AB will have the capacity to maintain all those recently hired staff who fulfill the criteria for long term employment at CERN. Following this budgetary exercise, AB proposes to perform a CERN-wide staff work plan so as to compare the manpower available to the quantity of work to be done in the totality of the work-packages. If there is a significant mismatch between these two quantities then we propose the following measures which would create personnel economies and allow us to redress the mismatch by increased recruitment: a new job severance scheme; CERN restructuring; use of the new CERN-ITER agreement; more flexibility in transfers from Materials to Personnel budgets. Failing this a re-examination of possible closure of lower priority facilities may be needed.

  17. ABS 497 ASH Tutorial Course/Uoptutorial

    OpenAIRE

    thanu

    2015-01-01

    For More Course Tutorials Visit www.uoptutorial.com   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 ...

  18. A multicenter evaluation of the Biotest legionella urinary antigen EIA

    DEFF Research Database (Denmark)

    Harrison, Timothy; Uldum, Søren; Alexiou-Daniel, Stella;

    1998-01-01

    patients with pneumonia of microbiologically proven cause other than LD; and urine samples submitted for routine examination. Thus, the performance of the Biotest assay (in comparison with current EIAs), its specificity and utility, and the inter-laboratory agreement were assessed. RESULTS: Inter...... in the laboratories' current EIAs, and in 94.6% of those specimens which were positive for Legionella pneumophila serogroup 1. CONCLUSION: The Biotest EIA is simple to use and specific and the results obtained in different laboratories show excellent agreement. The assay compares well existing EIAs, at least for L...

  19. Analysis of environmental impact assessment (EIA) system in Turkey.

    Science.gov (United States)

    Coşkun, Aynur Aydın; Turker, Ozhan

    2011-04-01

    The Environmental Impact Assessment (EIA) System, which embodies the "prevention principle" of the environmental law, is an important tool for environmental protection. This tool has a private importance for Turkey since it is a developing country, and it entered the Turkish law in 1983 with the Environmental Law. Besides, the EIA Regulation, which shows the application principles, became effective in 1993. Because Turkey is a candidate for European Union (EU), the EIA Regulation has been changed due to the EU compliance procedure, and its latest version became valid in 2008. This study aims to emphasize The EIA system in Turkey to supervise the efficiency of this procedure and point the success level. In the introduction part, general EIA concept, its importance, and some notations are mentioned. Following that, the legislation, which builds the EIA system, has been analyzed starting from the 1982 Turkish Constitution. Then, the legislation rules are explained due to the basic steps of the EIA procedure. In order to shed light upon the application, the EIA final decisions given until today, the results, and their distributions to the industries are assessed. In the final part of the study, a SWOT analysis is made to mention the weaknesses, strengths, opportunities, and threats of the EIA system in Turkey.

  20. EIA modelling for coastal zone management. Part 2

    Digital Repository Service at National Institute of Oceanography (India)

    Babu, M.T.; Vethamony, P.

    stream_size 15 stream_content_type text/plain stream_name Summer_Sch_EIA_Manage_Coast_Zone_2001_95.pdf.txt stream_source_info Summer_Sch_EIA_Manage_Coast_Zone_2001_95.pdf.txt Content-Encoding ISO-8859-1 Content-Type text...

  1. Newly released EIA-law. A palette of wishes?

    International Nuclear Information System (INIS)

    The EU-directive on Environmental Impact Assessment (EIA) for certain public and private projects was once again amended in 2014 after controversial discussions, three previous modifications during 1985 and 2010 and an aggregation of all amendments within the EU-EIA-2011/92 directive. This newly released EU-EIA-directive 2014/52/EU (hereinafter RL 2014/52) is published within the EU-official journal EU L 124 p. 1 from 25.04.2014, came into force on 15. May 2014 and has to be adopted into international law until 16.05.2017. The modifications made are also valid, apart from certain exceptions, for licensing procedures (including decommissioning of nuclear power plants) in the field of nuclear energy, as far as they might have possible, significant environmental effects. The European EIA directive's 30th ''anniversary'' on 27.06.2015 raises the question, which substantial changes will come soon along with the newly released EU-EIA law. All in all it seems like if authorities and industry might get along with the newly released EU-EIA regulations. The responsible Federal Ministry for the Environment is already working on a first preliminary draft. It is under consideration if the EIA-regulation should be submitted additionally, beyond required amendments by EU-law, to a general revision. EIA-law remains exciting.

  2. SIB-DOTA: A trifunctional prosthetic group potentially amenable for multi-modal labeling that enhances tumor uptake of internalizing monoclonal antibodies

    OpenAIRE

    Vaidyanathan, G.; White, B. J.; Affleck, D.J.; Zhao, X. G.; Welsh, P. C.; McDougald, D; Choi, J.; Zalutsky, M. R.

    2012-01-01

    A major drawback of internalizing monoclonal antibodies (mAbs) radioiodinated with direct electrophilic approaches is that tumor retention of radioactivity is compromised by the rapid washout of iodo-tyrosine, the primary labeled catabolite for mAbs labeled via this strategy. In our continuing efforts to develop more versatile residualizing labels that could overcome this problem, we have designed SIB-DOTA, a prosthetic labeling template that combines the features of the prototypical, dehalog...

  3. abs417ashcoursesTutorial /uophelp

    OpenAIRE

    smith

    2015-01-01

    For more course tutorials visit www.uophelp.com     ABS 417 Week 1 DQ 1 ( The Power of Many )    ABS 417 Week 1 DQ 2 ( Social Change Model )    ABS 417 Week 2 DQ 1 ( Empowerment, Disempowerment and Social Change )   ABS 417 Week 2 DQ 2 ( Non-Profit vs. For-Profit Organizations )    ABS 417 Week 2 Assignment ( Reflection Paper )    ABS 417 Week 3 DQ 1 ( Social Problems )  &nb...

  4. Opstellen Aaltjes Beheersing Strategie (ABS)

    NARCIS (Netherlands)

    Beers, van T.G.

    2009-01-01

    Dit artikel gaat dieper in op het opstellen van een Aaltjes Beheersing Strategie (ABS): inventarisatie, preventie, vruchtwisseling en aanvullende maatregelen. Per onderdeel worden aandachtspunten genoemd en er worden tips gegeven.

  5. EIA directory of electronic products. Third quarter 1994

    Energy Technology Data Exchange (ETDEWEB)

    1994-09-01

    The Energy Information Administration (EIA) makes available for public use a series of machine-readable data files and computer models. The data files and models are made available to the public on magnetic tapes. In addition, selected data files/models are available on diskette for IBM-compatible personal computers. EIA, as the independent statistical and analytical branch of the Department of Energy, provides assistance to the general public through the National Energy Information Center (NEIC). Inquirers may telephone NEIC`s information specialists at (202) 586-8800 with any data questions relating to the content of EIA Directory of Electronic Products.

  6. Observation of EIA in closed and open caesium atomic system

    Institute of Scientific and Technical Information of China (English)

    Zhao Jian-Ming; Zhao Yan-Ting; Huang Tao; Xiao Lian-Tuan; Jia Suo-Tang

    2005-01-01

    We present an experimental study on electromagnetically induced absorption (EIA) in the closed transition of a degenerate two-level Cs atomic system. The coupling and probe lasers coupled with the transition 6S1/2F=4 →6P3/2F'=5 of caesium atom. The signal of EIA was obtained and the frequency detuning and intensity effect of the pumping laser were experimentally investigated. The EIA signal in 6S1/2 F=4 → 6P3/2 F'=4 and 6S1/2 F=4 → 6P3/2F'=3 open transitions was also obtained. As the repumping laser couples with the transition of 6S1/2 F=3 → 6P3/2F'=4, the EIA signal is increased due to the hyperfine optical pumping.

  7. Issues in Data Labelling

    NARCIS (Netherlands)

    Cowie, Roddy; Cox, Cate; Martin, Jeam-Claude; Batliner, Anton; Heylen, Dirk; Karpouzis, Kostas; Cowie, Roddy; Pelachaud, Catherine; Petta, Paolo

    2011-01-01

    Labelling emotion databases is not a purely technical matter. It is bound up with theoretical issues. Different issues affect labelling of emotional content, labelling of the signs that convey emotion, and labelling of the relevant context. Linked to these are representational issues, involving time

  8. 78 FR 57808 - Rules and Regulations Under the Wool Products Labeling Act of 1939

    Science.gov (United States)

    2013-09-20

    ... Act and rules and regulations issued under the Act during the duration of the guaranty.'' 78 FR at... CFR Part 300 RIN 3084-AB29 Rules and Regulations Under the Wool Products Labeling Act of 1939 AGENCY... ``FTC'') proposes amending its rules and regulations under the Wool Products Labeling Act of...

  9. Radioimmunotherapy of carcinoma of colon with [131I]-labeled recombinant chimeric monoclonal antibodies to carcinoembryonic antigen

    Institute of Scientific and Technical Information of China (English)

    Qiu-jun LU; Guang-xing BIAN; Yuan-yuan CHEN; Min ZHANG; Shao-ming GUO; Li-qing WEN

    2005-01-01

    Aim: To study the distribution of [131I]-labeled anti-CEA MoAbs and its therapeutic effect on the human colonic cancer model in nude mice. Methods: A nude mice model of human colonic cancer was established. [131I]-labeled anti-CEA MoAbs were injected intravenously into mice. The distribution of the MoAbs was then determined and the effect of RIT on human colonic cancer was observed. Results:The [131I]-labeled anti-CEA MoAbs had a specific distribution after injection.Tumor/non-tumor ratios for [131I]-labeled anti-CEA MoAbs were 10-20 times higher than [131I]-labeled IgG 96 h after injection. Thirty days after injection, significant inhibition of the volume and weight of tumor was observed in the treated mice compared with the control. The tumor growth inhibition rate of 3.1 mCi/kg CEA MoAbs group (LS 180, LS 174T, SW1116) was 47.8%-64.0%. This was 69.6%-78.6%in the 6.25 mCi/kg CEA MoAbs group, and 81.8%-86.2% in the 12.5 mCi/kg [131I]-labeled anti-CEA MoAbs group. The plasma CEA level was also lower in treated mice. Conclusion: The results indicate that [131I]-labeled anti-CEA MoAbs can be effective in RIT on colonic cancers.

  10. Pesticide Product Label System

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Pesticide Product Label System (PPLS) provides a collection of pesticide product labels (Adobe PDF format) that have been approved by EPA under Section 3 of the...

  11. Mental Labels and Tattoos

    Science.gov (United States)

    Hyatt, I. Ralph

    1977-01-01

    Discusses the ease with which mental labels become imprinted in our system, six basic axioms for maintaining negative mental tattoos, and psychological processes for eliminating mental tattoos and labels. (RK)

  12. Semiotic labelled deductive systems

    Energy Technology Data Exchange (ETDEWEB)

    Nossum, R.T. [Imperial College of Science, Technology and Medicine, London (United Kingdom)

    1996-12-31

    We review the class of Semiotic Models put forward by Pospelov, as well as the Labelled Deductive Systems developed by Gabbay, and construct an embedding of Semiotic Models into Labelled Deductive Systems.

  13. Equity valuation : Atlas Copco AB

    OpenAIRE

    Santos, Ricardo Manuel Castro Lopes Alba

    2016-01-01

    This Dissertation presents a literature review of some of the most appraised theories on equity valuation models. A thoughtful analysis is made, presenting the main advantages and restrictions of each model and setting the path for a discussion about improvements to be made on this field of study. A practical implementation follows, proposing a fair value estimation of Atlas Copco AB shares. Atlas Copco is a Swedish-based capital goods company, operating across four differen...

  14. Thermonuclear Reflect AB-Reactor

    CERN Document Server

    Bolonkin, Alexander

    2008-01-01

    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  15. AB Levitator and Electricity Storage

    CERN Document Server

    Bolonkin, A

    2007-01-01

    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative weight ratio of this engine is 0.01 - 0.1 (from thrust). For some types of AB engine (toroidal form) the thrust easily may be changed in any direction without turning of engine. The author computed many projects using different versions of offered AB engine: small device for levitation-flight of a human (including flight from Earth to Outer Space), fly VTOL car (track), big VTOL aircrat, suspended low altitude stationary satellite, powerful Space Shuttle-like booster for travel to the Moon and Mars without spending energ...

  16. Appraising the value of independent EIA follow-up verifiers

    Energy Technology Data Exchange (ETDEWEB)

    Wessels, Jan-Albert, E-mail: janalbert.wessels@nwu.ac.za [School of Geo and Spatial Sciences, Department of Geography and Environmental Management, North-West University, C/O Hoffman and Borcherd Street, Potchefstroom, 2520 (South Africa); Retief, Francois, E-mail: francois.retief@nwu.ac.za [School of Geo and Spatial Sciences, Department of Geography and Environmental Management, North-West University, C/O Hoffman and Borcherd Street, Potchefstroom, 2520 (South Africa); Morrison-Saunders, Angus, E-mail: A.Morrison-Saunders@murdoch.edu.au [School of Geo and Spatial Sciences, Department of Geography and Environmental Management, North-West University, C/O Hoffman and Borcherd Street, Potchefstroom, 2520 (South Africa); Environmental Assessment, School of Environmental Science, Murdoch University, Australia. (Australia)

    2015-01-15

    Independent Environmental Impact Assessment (EIA) follow-up verifiers such as monitoring agencies, checkers, supervisors and control officers are active on various construction sites across the world. There are, however, differing views on the value that these verifiers add and very limited learning in EIA has been drawn from independent verifiers. This paper aims to appraise how and to what extent independent EIA follow-up verifiers add value in major construction projects in the developing country context of South Africa. A framework for appraising the role of independent verifiers was established and four South African case studies were examined through a mixture of site visits, project document analysis, and interviews. Appraisal results were documented in the performance areas of: planning, doing, checking, acting, public participating and integration with other programs. The results indicate that independent verifiers add most value to major construction projects when involved with screening EIA requirements of new projects, allocation of financial and human resources, checking legal compliance, influencing implementation, reporting conformance results, community and stakeholder engagement, integration with self-responsibility programs such as environmental management systems (EMS), and controlling records. It was apparent that verifiers could be more creatively utilized in pre-construction preparation, providing feedback of knowledge into assessment of new projects, giving input to the planning and design phase of projects, and performance evaluation. The study confirms the benefits of proponent and regulator follow-up, specifically in having independent verifiers that disclose information, facilitate discussion among stakeholders, are adaptable and proactive, aid in the integration of EIA with other programs, and instill trust in EIA enforcement by conformance evaluation. Overall, the study provides insight on how to harness the learning opportunities

  17. Appraising the value of independent EIA follow-up verifiers

    International Nuclear Information System (INIS)

    Independent Environmental Impact Assessment (EIA) follow-up verifiers such as monitoring agencies, checkers, supervisors and control officers are active on various construction sites across the world. There are, however, differing views on the value that these verifiers add and very limited learning in EIA has been drawn from independent verifiers. This paper aims to appraise how and to what extent independent EIA follow-up verifiers add value in major construction projects in the developing country context of South Africa. A framework for appraising the role of independent verifiers was established and four South African case studies were examined through a mixture of site visits, project document analysis, and interviews. Appraisal results were documented in the performance areas of: planning, doing, checking, acting, public participating and integration with other programs. The results indicate that independent verifiers add most value to major construction projects when involved with screening EIA requirements of new projects, allocation of financial and human resources, checking legal compliance, influencing implementation, reporting conformance results, community and stakeholder engagement, integration with self-responsibility programs such as environmental management systems (EMS), and controlling records. It was apparent that verifiers could be more creatively utilized in pre-construction preparation, providing feedback of knowledge into assessment of new projects, giving input to the planning and design phase of projects, and performance evaluation. The study confirms the benefits of proponent and regulator follow-up, specifically in having independent verifiers that disclose information, facilitate discussion among stakeholders, are adaptable and proactive, aid in the integration of EIA with other programs, and instill trust in EIA enforcement by conformance evaluation. Overall, the study provides insight on how to harness the learning opportunities

  18. EIA directory of electronic products, first quarter 1995

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-06-01

    The Energy Information Administration (EIA) makes available for public use a series of machine-readable data files and computer models. The data files and models are made available to the public on magnetic tapes. In addition, selected data files/models are available on diskette for IBM-compatible personal computers. EIA, as the independent statistical and analytical branch of the Department of Energy, provides assistance to the general public through the National Energy Information Center (NEIC). For each product listed in this directory, a detailed abstract is provided which describes the data published. Specific technical questions may be referred to the appropriate contact person.

  19. ABS: Sequence alignment by scanning

    KAUST Repository

    Bonny, Mohamed Talal

    2011-08-01

    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  20. AP calculus AB/BC

    CERN Document Server

    Schwartz, Stu

    2013-01-01

    All Access for the AP® Calculus AB & BC Exams Book + Web + Mobile Everything you need to prepare for the Advanced Placement® exam, in a study system built around you! There are many different ways to prepare for an Advanced Placement® exam. What's best for you depends on how much time you have to study and how comfortable you are with the subject matter. To score your highest, you need a system that can be customized to fit you: your schedule, your learning style, and your current level of knowledge. This book, and the free online tools that come with it, will help you personalize your AP® Cal

  1. EIA: A splintering, exploding discipline with a massive new constituency

    International Nuclear Information System (INIS)

    After serving 18 years as Editor-in-Chief of Environmental Impact Assessment Review, the author observes that the period 1997–2014, the discipline of EIA: splintered, exploded and saw the rise of the developing-world authors. Publishing has also changed, with shifts from quantity to quality, the rise of open access, and an ever-increasing shortage of reviewers

  2. EIA model documentation: Electricity market module - electricity fuel dispatch

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-01-01

    This report documents the National Energy Modeling System Electricity Fuel Dispatch Submodule (EFD), a submodule of the Electricity Market Module (EMM) as it was used for EIA`s Annual Energy Outlook 1997. It replaces previous documentation dated March 1994 and subsequent yearly update revisions. The report catalogues and describes the model assumptions, computational methodology, parameter estimation techniques, model source code, and forecast results generated through the synthesis and scenario development based on these components. This document serves four purposes. First, it is a reference document providing a detailed description of the model for reviewers and potential users of the EFD including energy experts at the Energy Information Administration (EIA), other Federal agencies, state energy agencies, private firms such as utilities and consulting firms, and non-profit groups such as consumer and environmental groups. Second, this report meets the legal requirement of the Energy Information Administration (EIA) to provide adequate documentation in support of its statistical and forecast reports. Third, it facilitates continuity in model development by providing documentation which details model enhancements that were undertaken for AE097 and since the previous documentation. Last, because the major use of the EFD is to develop forecasts, this documentation explains the calculations, major inputs and assumptions which were used to generate the AE097.

  3. EIA directory of electronic products. Fourth quarter 1995

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-08-01

    The Energy Information Administration (EIA) makes available for public use a series of machine-readable data files and computer models. The data files and models are made available to the public on magnetic tapes. In addition, selected data files/models are available on diskette for IBM-compatible personal computers.

  4. EIA directory of electronic products, Third quarter 1995

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-02-01

    EIA makes available for public use a series of machine-readable data files and computer models on magnetic tapes. Selected data files/models are also available on diskette for IBM-compatible personal computers. For each product listed in this directory, a detailed abstract is provided which describes the data published. Ordering information is given in the preface. Indexes are included.

  5. EIA directory of electronic products. First quarter 1994

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The Energy Information Administration (EIA) makes available for public use a series of machine-readable data files and computer models. The data files and models are made available to the public on magnetic tapes. In addition, selected data files/models are available on diskette for IBM-compatible personal computers.

  6. A Novel PET Imaging Using 64Cu-Labeled Monoclonal Antibody against Mesothelin Commonly Expressed on Cancer Cells

    Directory of Open Access Journals (Sweden)

    Kazuko Kobayashi

    2015-01-01

    Full Text Available Mesothelin (MSLN is a 40-kDa cell differentiation-associated glycoprotein appearing with carcinogenesis and is highly expressed in many human cancers, including the majority of pancreatic adenocarcinomas, ovarian cancers, and mesotheliomas, while its expression in normal tissue is limited to mesothelial cells lining the pleura, pericardium, and peritoneum. Clone 11-25 is a murine hybridoma secreting monoclonal antibody (mAb against human MSLN. In this study, we applied the 11-25 mAb to in vivo imaging to detect MSLN-expressing tumors. In in vitro and ex vivo immunochemical studies, we demonstrated specificity of 11-25 mAb to membranous MSLN expressed on several pancreatic cancer cells. We showed the accumulation of Alexa Fluor 750-labeled 11-25 mAb in MSLN-expressing tumor xenografts in athymic nude mice. Then, 11-25 mAb was labeled with 64Cu via a chelating agent DOTA and was used in both in vitro cell binding assay and in vivo positron emission tomography (PET imaging in the tumor-bearing mice. We confirmed that 64Cu-labeled 11-25 mAb highly accumulated in MSLN-expressing tumors as compared to MSLN-negative ones. The 64Cu-labeled 11-25 mAb is potentially useful as a PET probe capable of being used for wide range of tumors, rather than 18F-FDG that occasionally provides nonspecific accumulation into the inflammatory lesions.

  7. Labelling Fashion Markets

    OpenAIRE

    Aspers, P.

    2008-01-01

    The present article discusses how an ethical and environmental labelling system can be implemented in fashion garment markets. Consumers act in markets that provide them with more information than their limited cognitive capacity allows them to handle. Ethical and environmental labelling in markets characterized by change, such as the fashion garment market, makes decision-making even more complicated. The ethical and environmental labelling system proposed here is designed to alleviate firms...

  8. Deuterium labeled cannabinoids

    International Nuclear Information System (INIS)

    Complex reactions involving ring opening, ring closure and rearrangements hamper complete understanding of the fragmentation processes in the mass spectrometric fragmentation patterns of cannabinoids. Specifically labelled compounds are very powerful tools for obtaining more insight into fragmentation mechanisms and ion structures and therefore the synthesis of specifically deuterated cannabinoids was undertaken. For this, it was necessary to investigate the preparation of cannabinoids, appropriately functionalized for specific introduction of deuterium atom labels. The results of mass spectrometry with these labelled cannabinoids are described. (Auth.)

  9. Microwave Study of Recycled ABS Resins

    Institute of Scientific and Technical Information of China (English)

    A; M; Hasna

    2002-01-01

    This article provides a review of the research unde rt aken in order to determine the suitability of utilizing microwave technology in the production of Recycled ABS Acrylonitrile Butadiene Styrene resin for mouldin gs. The experimental investigation determined the suitability of the existing re cycled ABS material, the mould material used with respect to performance and lon gevity, potential commercial plant and equipment, end mould compression. Introduction Frequency Characterization of ABS The first ...

  10. abs497ashcoursesTutorial /uophelp

    OpenAIRE

    davids

    2015-01-01

    For more course tutorials visit www.uophelp.com       I.        ABS 497 Week 1 Assignment Community Change   II.        ABS 497 Week 1 DQ 1 Fabian's Story III.        ABS 497 Week 1 DQ 2 Doug's Story IV.        ABS 497 Week 2 DQ 1 Parenting Styles   V.      &nb...

  11. Stable isotopes labelled compounds

    International Nuclear Information System (INIS)

    The catalogue on stable isotopes labelled compounds offers deuterium, nitrogen-15, and multiply labelled compounds. It includes: (1) conditions of sale and delivery, (2) the application of stable isotopes, (3) technical information, (4) product specifications, and (5) the complete delivery programme

  12. ABS test equipment design%ABS 测试设备设计

    Institute of Scientific and Technical Information of China (English)

    王宇鹏

    2013-01-01

      This article simply introduces the structure and operating principle of ABS. and a new equipment for ABS signal testing is designed and put into use.%  简要介绍了 ABS 的组成及其工作原理,并结合自身情况,设计了测试 ABS 信号的设备,并投入使用。

  13. Ab-Initio Molecular Dynamics

    CERN Document Server

    Kühne, Thomas D

    2012-01-01

    Computer simulations and molecular dynamics in particular, is a very powerful method to provide detailed and essentially exact informations of classical many-body problems. With the advent of \\textit{ab-initio} molecular dynamics, where the forces are computed on-the-fly by accurate electronic structure calculations, the scope of either method has been greatly extended. This new approach, which unifies Newton's and Schr\\"odinger's equations, allows for complex simulations without relying on any adjustable parameter. This review is intended to outline the basic principles as well as a survey of the field. Beginning with the derivation of Born-Oppenheimer molecular dynamics, the Car-Parrinello method as well as novel hybrid scheme that unifies best of either approach are discussed. The predictive power is demonstrated by a series of applications ranging from insulators to semiconductors and even metals in condensed phases.

  14. Label Fusion Strategy Selection

    Directory of Open Access Journals (Sweden)

    Nicolas Robitaille

    2012-01-01

    Full Text Available Label fusion is used in medical image segmentation to combine several different labels of the same entity into a single discrete label, potentially more accurate, with respect to the exact, sought segmentation, than the best input element. Using simulated data, we compared three existing label fusion techniques—STAPLE, Voting, and Shape-Based Averaging (SBA—and observed that none could be considered superior depending on the dissimilarity between the input elements. We thus developed an empirical, hybrid technique called SVS, which selects the most appropriate technique to apply based on this dissimilarity. We evaluated the label fusion strategies on two- and three-dimensional simulated data and showed that SVS is superior to any of the three existing methods examined. On real data, we used SVS to perform fusions of 10 segmentations of the hippocampus and amygdala in 78 subjects from the ICBM dataset. SVS selected SBA in almost all cases, which was the most appropriate method overall.

  15. The use of radiolabeled monoclonal antibodies for cell labeling in vivo

    International Nuclear Information System (INIS)

    The authors have evaluated the potential of in vivo cell surface labeling using radiolabeled monoclonal antibodies (MoAbs) directed against their surface antigens. Two MoAbs, a specific antibody (anti-Thy-1 OX7) and a nonspecific control antibody (anti-CEA) were coupled with DTPA, labeled with /sup 111/In and evaluated against rat thymocytes, marrow cells, and lymphoma cells (all known to be Thy-1 positive) both in vitro and in vivo. Enumeration of the cells which bound the radiolabeled MoAb was done by detecting the antibody on the cell surface with a Fl-F(ab')/sub 2/ goat anti-mouse IgG and analyzing fluorescence (F1) in a flow cytometer (FACS). The thymocytes, which could be labeled in whole blood, showed a labeling efficiency of 80-100%. The labeling, which could be inhibited by cold antibody, was stable up to 72 hours and did not interfere with either cell viability or functional integrity. Following IV injection of the MoAbs in normal rats, there was very good visualization of the bone marrow not seen with the control. Analysis of the marrow cells on the FACS showed that at two hours over 60% of the marrow cells were specifically labeled as against 2% for the control. Within 15 minutes of injecting /sup 111/In-OX7 into rats with lymphoma, 70% of the activity in blood was bound to circulating lymphoma cells. The ability to stably label, rapidly target, and image specific cell populations in vivo has wide ranging diagnostic and therapeutic implications

  16. Radioiodine and its labelled compounds

    International Nuclear Information System (INIS)

    Chemical characteristics and their nuclear characteristics, types of labelled molecules,labelling procedures, direct labelling with various oxidizing agents, indirect labelling with various conjugates attached to protein molecules, purification and quality control. Iodination damage.Safe handling of labelling procedures with iodine radioisotopes.Bibliography

  17. Ultrasound Biomicroscopy Comparison of Ab Interno and Ab Externo Intraocular Lens Scleral Fixation.

    Science.gov (United States)

    Horiguchi, Lie; Garcia, Patricia Novita; Malavazzi, Gustavo Ricci; Allemann, Norma; Gomes, Rachel L R

    2016-01-01

    Purpose. To compare ab interno and ab externo scleral fixation of posterior chamber intraocular lenses (PCIOL) using ultrasound biomicroscopy (UBM). Methods. Randomized patients underwent ab externo or ab interno scleral fixation of a PCIOL. Ultrasound biomicroscopy was performed 3 to 6 months postoperatively, to determine PCIOL centration, IOL distance to the iris at 12, 3, 6, and 9 hours, and haptics placement in relation to the ciliary sulcus. Results. Fifteen patients were enrolled in the study. The ab externo technique was used in 7 eyes (46.6%) and the ab interno in 8 eyes (53.3%). In the ab externo technique, 14 haptics were located: 4 (28.57%) in the ciliary sulcus; 2 (14.28%) anterior to the sulcus; and 8 (57.14%) posterior to the sulcus, 6 in the ciliary body and 2 posterior to the ciliary body. In the ab interno group, 4 haptics (25.0%) were in the ciliary sulcus, 2 (12.50%) anterior to the sulcus, and 10 (75.0%) posterior to the sulcus, 4 in the ciliary body and 6 posterior to the ciliary body. Conclusions. Ab externo and ab interno scleral fixation techniques presented similar results in haptic placement. Ab externo technique presented higher vertical tilt when compared to the ab interno.

  18. Ultrasound Biomicroscopy Comparison of Ab Interno and Ab Externo Intraocular Lens Scleral Fixation

    Directory of Open Access Journals (Sweden)

    Lie Horiguchi

    2016-01-01

    Full Text Available Purpose. To compare ab interno and ab externo scleral fixation of posterior chamber intraocular lenses (PCIOL using ultrasound biomicroscopy (UBM. Methods. Randomized patients underwent ab externo or ab interno scleral fixation of a PCIOL. Ultrasound biomicroscopy was performed 3 to 6 months postoperatively, to determine PCIOL centration, IOL distance to the iris at 12, 3, 6, and 9 hours, and haptics placement in relation to the ciliary sulcus. Results. Fifteen patients were enrolled in the study. The ab externo technique was used in 7 eyes (46.6% and the ab interno in 8 eyes (53.3%. In the ab externo technique, 14 haptics were located: 4 (28.57% in the ciliary sulcus; 2 (14.28% anterior to the sulcus; and 8 (57.14% posterior to the sulcus, 6 in the ciliary body and 2 posterior to the ciliary body. In the ab interno group, 4 haptics (25.0% were in the ciliary sulcus, 2 (12.50% anterior to the sulcus, and 10 (75.0% posterior to the sulcus, 4 in the ciliary body and 6 posterior to the ciliary body. Conclusions. Ab externo and ab interno scleral fixation techniques presented similar results in haptic placement. Ab externo technique presented higher vertical tilt when compared to the ab interno.

  19. Ultrasound Biomicroscopy Comparison of Ab Interno and Ab Externo Intraocular Lens Scleral Fixation

    Science.gov (United States)

    Horiguchi, Lie; Garcia, Patricia Novita; Malavazzi, Gustavo Ricci; Allemann, Norma

    2016-01-01

    Purpose. To compare ab interno and ab externo scleral fixation of posterior chamber intraocular lenses (PCIOL) using ultrasound biomicroscopy (UBM). Methods. Randomized patients underwent ab externo or ab interno scleral fixation of a PCIOL. Ultrasound biomicroscopy was performed 3 to 6 months postoperatively, to determine PCIOL centration, IOL distance to the iris at 12, 3, 6, and 9 hours, and haptics placement in relation to the ciliary sulcus. Results. Fifteen patients were enrolled in the study. The ab externo technique was used in 7 eyes (46.6%) and the ab interno in 8 eyes (53.3%). In the ab externo technique, 14 haptics were located: 4 (28.57%) in the ciliary sulcus; 2 (14.28%) anterior to the sulcus; and 8 (57.14%) posterior to the sulcus, 6 in the ciliary body and 2 posterior to the ciliary body. In the ab interno group, 4 haptics (25.0%) were in the ciliary sulcus, 2 (12.50%) anterior to the sulcus, and 10 (75.0%) posterior to the sulcus, 4 in the ciliary body and 6 posterior to the ciliary body. Conclusions. Ab externo and ab interno scleral fixation techniques presented similar results in haptic placement. Ab externo technique presented higher vertical tilt when compared to the ab interno. PMID:27293878

  20. Walking the sustainability assessment talk — Progressing the practice of environmental impact assessment (EIA)

    International Nuclear Information System (INIS)

    Internationally there is a growing demand for environmental impact assessment (EIA) to move away from its traditional focus towards delivering more sustainable outcomes. South Africa is an example of a country where the EIA system seems to have embraced the concept of sustainability. In this paper we test the existing objectives for EIA in South Africa against sustainability principles and then critique the effectiveness of EIA practice in delivering these objectives. The outcome of the research suggests that notwithstanding a strong and explicit sustainability mandate through policy and legislation, the effectiveness of EIA practice falls far short of what is mandated. This shows that further legislative reform is not required to improve effectiveness but rather a focus on changing the behaviour of individual professionals. We conclude by inviting further debate on what exactly practitioners can do to give effect to sustainability in EIA practice.

  1. EIA practice in India and its evaluation using SWOT analysis

    International Nuclear Information System (INIS)

    In India Environmental Impact Assessment (EIA) has been formally introduced in 1994. It relied on the institutional framework that has a strong supporting legislative, administrative and procedural set-up. Both central and state authorities together are sharing the responsibility of its development and management. A Strength, Weakness, Opportunity and Threat (SWOT) analysis taken up in this article has suggested that there are several issues that need to be readdressed. It highlights several constraints, ranging from improper screening and scoping guidelines to ineffective monitoring and post project evaluation. The opportunities are realised as increasing public awareness, initiatives of environmental groups and business community and forward thinking to integrate environmental consideration into plans and policies. Poor governance, rapid economic reforms, and favours to small-scale units are some of the foreseen threats to the system. This article concludes with some suggestions to improve EIA process in India

  2. Nutrition Facts: Reading the Label

    Science.gov (United States)

    ... My Go4Life Get Free Stuff Be a Partner Nutrition Facts: Reading the Label Reading labels can help ... of information on their labels or packaging about nutrition and food safety. Product dates . You might see ...

  3. EIA directory of electronic products fourth quarter 1993

    Energy Technology Data Exchange (ETDEWEB)

    1994-02-23

    The Energy Information Administration (EIA) makes available for public use a series of machine-readable data files and computer models. The data files and models are made available to the public on magnetic tapes. In addition, selected data files/models are available on diskette for IBM-compatible personal computers. For each product listed in this directory, a detailed abstract is provided which describes the data published.

  4. The Rationality of EIA Forecasts under Symmetric and Asymmetric Loss

    OpenAIRE

    Auffhammer, Maximilian

    2005-01-01

    The United States Energy Information Administration publishes annual forecasts of nationally aggregated energy consumption, production, prices, intensity and GDP. These government issued forecasts often serve as reference cases in the calibration of simulation and econometric models, which climate and energy policy are based on. This study tests for rationality of published EIA forecasts under symmetric and asymmetric loss. We find strong empirical evidence of asymmetric loss for oil, coal a...

  5. Editing of EIA coded, numerically controlled, machine tool tapes

    Science.gov (United States)

    Weiner, J. M.

    1975-01-01

    Editing of numerically controlled (N/C) machine tool tapes (8-level paper tape) using an interactive graphic display processor is described. A rapid technique required for correcting production errors in N/C tapes was developed using the interactive text editor on the IMLAC PDS-ID graphic display system and two special programs resident on disk. The correction technique and special programs for processing N/C tapes coded to EIA specifications are discussed.

  6. EIA THEORIES — ALL CHINESE WHISPERS AND NO CRITICAL THEORY

    OpenAIRE

    JOE WESTON

    2010-01-01

    There have been a large number of attempts to develop a theory or theories of Environmental Impact Assessment in order to justify its use in environmental decision-making. A review of academic articles demonstrates that these theories are largely drawn from planning theories. Planning theories are themselves a development of sociological theories of decision-making and from one particular strand of sociological theory. In this review of the theories of EIA it is argued that an understanding o...

  7. From Label to Practice

    DEFF Research Database (Denmark)

    Byrkjeflot, Haldor; Strandgaard, Jesper; Svejenova, Silviya

    2013-01-01

    This article examines the process of creation of new Nordic cuisine (NNC) as a culinary innovation, focusing on the main stages, actors, and mechanisms that shaped the new label and its practices and facilitated its diffusion in the region and internationally. Fast-paced diffusion was possible...... because NNC was conceived as an identity movement, triggered by active involvement of entrepreneurial leaders from the culinary profession, high-profile political supporters, legitimating scientists, disseminating media, and interpreting audiences. It was facilitated by three mechanisms: First, the use...... actors and institutions to develop practices associated with the NNC label. Third, organized dissemination allowed the excitement and engagement with the new label to spread quickly....

  8. EIA model documentation: Electricity market module - electricity fuel dispatch

    International Nuclear Information System (INIS)

    This report documents the National Energy Modeling System Electricity Fuel Dispatch Submodule (EFD), a submodule of the Electricity Market Module (EMM) as it was used for EIA's Annual Energy Outlook 1997. It replaces previous documentation dated March 1994 and subsequent yearly update revisions. The report catalogues and describes the model assumptions, computational methodology, parameter estimation techniques, model source code, and forecast results generated through the synthesis and scenario development based on these components. This document serves four purposes. First, it is a reference document providing a detailed description of the model for reviewers and potential users of the EFD including energy experts at the Energy Information Administration (EIA), other Federal agencies, state energy agencies, private firms such as utilities and consulting firms, and non-profit groups such as consumer and environmental groups. Second, this report meets the legal requirement of the Energy Information Administration (EIA) to provide adequate documentation in support of its statistical and forecast reports. Third, it facilitates continuity in model development by providing documentation which details model enhancements that were undertaken for AE097 and since the previous documentation. Last, because the major use of the EFD is to develop forecasts, this documentation explains the calculations, major inputs and assumptions which were used to generate the AE097

  9. Field validation of an EIA kit for progesterone measurement in milk and blood plasma

    International Nuclear Information System (INIS)

    An EIA kit for the measurement of progesterone in blood plasma and skim milk was validated and compared with the FAO/IAEA RIA kit at the FAO/IAEA Agricultural Laboratory at Seibersdorf and 9 other laboratories in developed and developing countries. The EIA kit performed well at the FAO/IAEA Laboratory. In the other laboratories high intra-assay variations and poor colour development were observed. The RIA kit performed satisfactory in all participating laboratories. It was concluded that the EIA kit should not be routinely supplied to FAO/IAEA counterpart staff. Some recommendations for further development of the EIA kit were given. (author). 3 refs, 5 tabs

  10. Developing guidelines for economic evaluation of environmental impacts in EIAs. Part I

    International Nuclear Information System (INIS)

    Is the time right to introduce environmental evaluation into the Environmental Impact Assessment (EIA) system for large construction projects in China? The report analyses gaps to introducing environmental evaluation into EIAs and recommend how to bridge the gaps. The report also provides suggestions to the State Environmental Protection Administration on core elements of a guideline for environmental evaluation to include in the existing EIA guidelines. The report draws on international and Chinese research and best practice and conducts four case studies of environmental evaluation based on EIAs of investment projects e.g. a power plant, a waste water treatment plant, regional waste water irrigation, and a road construction project

  11. Developing guidelines for economic evaluation of environmental impacts in EIAs. Part I

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    Is the time right to introduce environmental evaluation into the Environmental Impact Assessment (EIA) system for large construction projects in China? The report analyses gaps to introducing environmental evaluation into EIAs and recommend how to bridge the gaps. The report also provides suggestions to the State Environmental Protection Administration on core elements of a guideline for environmental evaluation to include in the existing EIA guidelines. The report draws on international and Chinese research and best practice and conducts four case studies of environmental evaluation based on EIAs of investment projects e.g. a power plant, a waste water treatment plant, regional waste water irrigation, and a road construction project.

  12. The labelling of antibody anti-PBP2a with 99mTc

    International Nuclear Information System (INIS)

    Staphylococcus aureus is a major cause of life-threatening infections such as bacteraemia and endocarditis. Unfortunately, many strains of this bacterial species have become resistant to certain antibiotics, including methicillin and amoxicillin. These strains are known as methicillin-resistant S. aureus (MRSA). The penicillin binding protein 2a (PBP2a) is the enzyme responsible for conferring resistance p-lactams antibiotics for MRSA, being one promising molecule for therapy with mAb. However, besides the therapy, the methods of diagnosis are also inefficient because the diagnosis currently takes several days to produce a reliable result. Taking into account, the objective of this research was radiolabeling one anti-PBP2a mAb developed by Bio-Manguinhos/FioCruz-RJ, utilizing 99mTc, for in situ diagnostic of the infectious caused by MRSA. First, anti-PBP2a mAb was reduced utilizing 2-mecaptoethanol (2-ME) for generate sulphydryl groups (-SH) and after to be labeled with 99mTc. In this work, were utilized two techniques of direct method: Method 1, using tartrate and gentisic acid reagents, acting like transchelant and stabilizer agents, respectively; and Method 2, using one commercial kit of MDP. Besides the radiolabeling, the mAb reduced and mAb labeled with 99mTc were submitted to immunoreactivity analysis, with SDS-PAGE non-reducing, Immunoblotting, ELISA and neutralization assay in vitro methods. The quantity produced of sulphydryl groups by mAb was satisfactory, approximately 5 per mAb, utilizing 6.500:1 of 2-ME:mAb molar ratio. The better labeling method was Method 2, with labeling yield of 73.5%, and showed a good stability after 2 hours (73.2%). The better formulation was: 0.5 mg of mAb anti- PBP2a, 10 μU of MDP kit, after resuspended with 5 mL of saline, and 75.48 MBq (2.04 mCi) of 99mTc, reacting by 15 minutes. The labeled mAb maintained the immunoreactivity, utilizing immunologic and in vitro experiments. (author)

  13. Clinical applications of cells labelling

    International Nuclear Information System (INIS)

    Blood cells labelled with radionuclides are reviewed and main applications are described. Red blood cell labelling by both random and specific principle. A table with most important clinical uses, 99mTc labelling of RBC are described pre tinning and in vivo reduction of Tc, in vitro labelling and administration of labelled RBC and in vivo modified technique. Labelled leucocytes with several 99mTc-complex radiopharmaceuticals by in vitro technique and specific monoclonal s for white cells(neutrofiles). Labelled platelets for clinical use and research by in vitro technique and in vivo labelling

  14. Like your labels?

    Science.gov (United States)

    Field, Michele

    2010-01-01

    The descriptive “conventions” used on food labels are always evolving. Today, however, the changes are so complicated (partly driven by legislation requiring disclosures about environmental impacts, health issues, and geographical provenance) that these labels more often baffle buyers than enlighten them. In a light-handed manner, the article points to how sometimes reading label language can be like deciphering runes—and how if we are familiar with the technical terms, we can find a literal meaning, but still not see the implications. The article could be ten times longer because food labels vary according to cultures—but all food-exporting cultures now take advantage of our short attention-span when faced with these texts. The question is whether less is more—and if so, in this contest for our attention, what “contestant” is voted off. PMID:21539053

  15. Succesful labelling schemes

    DEFF Research Database (Denmark)

    Juhl, Hans Jørn; Stacey, Julia

    2001-01-01

    labelling schemes. Mass communication such as TV commercials will have very different impact on each of the four segments. It might be possible to increase the knowledge of 'the labelling blind' from 52% to 75%, but the use of the label would only rise from 16% to 18%. The awareness percentage of 'the...... to carry out a campaign targeted at this segment. The awareness percentage is already 92 % and 67% of the respondents believe they know the meaning of the scheme. But it stands to reason to study whether the respondents actually know what the labelling scheme stands for or if they just think they do....... If there is discrepancy between their perceptions of the contents of the schemes, this might be the reason why the scheme is not observed when they shop....

  16. Behind the Label "Alcoholic."

    Science.gov (United States)

    Wright, Deborah M.

    1989-01-01

    Relates individual's personal story of her childhood influenced by her parent's alcoholism, her own alcoholism as a young adult, and her experiences with counseling. Asks others not to reject her because of the label "alcoholic." (ABL)

  17. FDA Online Label Repository

    Data.gov (United States)

    U.S. Department of Health & Human Services — The drug labels and other drug-specific information on this Web site represent the most recent drug listing information companies have submitted to the Food and...

  18. Multiwavelength Observations of AB Doradus

    CERN Document Server

    Slee, O B; Johnston-Hollitt, M; Budding, E

    2014-01-01

    We have observed the bright, magnetically active multiple star AB Doradus in a multiwavelength campaign centring around two large facility allocations in November 2006 and January, 2007. Our observations have covered at least three large flares. These flares were observed to produce significant hardening of the X-ray spectra during their very initial stages. We monitored flare-related effects using the Suzaku X-ray satellite and the Australia Telescope Compact Array at 3.6 and 6 cm. Observations at 11 and 21 cm were also included, but they were compromised by interference. From our multiwavelength coverage we find that the observed effects can be mainly associated with a large active region near longitude zero. The second major X-ray and microwave flare of Jan 8, 2007 was observed with a favourable geometry that allowed its initial high-energy impulsive phase to be observed in the higher frequency range of Suzaku's XIS detectors. The fractional circular polarisation was measured for the complete runs, for 25 ...

  19. GINGA Observations of AB Doradus

    Science.gov (United States)

    Vilhu, O.; Tsuru, T.; Collier Cameron, A.

    We report GINGA observations of the pre main sequence star AB Doradus (HD 36705), performed during 8 - 12 January, 1990. Some rotational modulation might be present. four X-ray flares were detected. Three of these events were similar to the EINSTEIN HRI-flare (Vilhu and Linsky, 1987), with decay times around 25 min. The last flare had long rise and decay times (100 min), resembling the EXOSAT flares observed by Collier Cameron et.al. (1988). The mean flare spectrum can be fitted by a thermal bremstrahlung with temperature 5.0 keV, or by a power-law model with photon index 2.2. The 3 upper limit of the Iron line equivalent width in the flare spectrum is 1 keV, weaker than predicted by thermal models. This Iron line anomaly was first discussed in the case of UX Ari by Tsuru et. al. (1989). However, normal equivalent widths can be derived from several EXOSAT spectra of active cool stars (Pallavicini and Tagliaferri, 1990). We discuss the possibility that the continuum from non-thermal electrons (producing also the microwave emission) could occasionally lower the apparent equivalent width. The mechanism works for reasonably low magnetic field strengths and electon power-law indexes. However, a large population of non-thermal electrons is needed (comparable to the thermal one). Stronger magnetic fields could explain the radio emission with less electrons, but then the non-thermal X-ray continuum remains small.

  20. Certified Rule Labeling

    OpenAIRE

    Nagele, Julian; Zankl, Harald

    2015-01-01

    The rule labeling heuristic aims to establish confluence of (left-)linear term rewrite systems via decreasing diagrams. We present a formalization of a confluence criterion based on the interplay of relative termination and the rule labeling in the theorem prover Isabelle. Moreover, we report on the integration of this result into the certifier CeTA, facilitating the checking of confluence certificates based on decreasing diagrams for the first time. The power of the method is illustrated by ...

  1. Labelling of electricity

    International Nuclear Information System (INIS)

    This comprehensive report for the Swiss Federal Office of Energy (SFOE) presents a possible course of action to be taken to provide a means of declaring the sources of electrical power, as is foreseen in the draft of new Swiss electricity market legislation. The report presents the basic ideas behind the idea and defines the terms used such as labelling, certificates and declarations. Also, the legal situation in the European Union and in Switzerland is examined and a quantitative overview of electricity production and consumption is presented. Suggestions for a labelling scheme are made and some of the problems to be expected are looked at. The report also presents a series of examples of labelling schemes already implemented in other countries, such as Austria, Great Britain, Sweden and Germany. Tradable certificates and tracking systems are discussed as are initial quality labels like the Swiss 'Naturemade' label for green power. A concrete recommendation for the declaration and labelling of electricity in Switzerland is presented and various factors to be considered such as import/export, pumped storage, distribution losses, small-scale producers as well as the time-scales for introduction are discussed

  2. Collective rotation from ab initio theory

    CERN Document Server

    Caprio, M A; Vary, J P; Smith, R

    2015-01-01

    Through ab initio approaches in nuclear theory, we may now seek to quantitatively understand the wealth of nuclear collective phenomena starting from the underlying internucleon interactions. No-core configuration interaction (NCCI) calculations for p-shell nuclei give rise to rotational bands, as evidenced by rotational patterns for excitation energies, electromagnetic moments, and electromagnetic transitions. In this review, NCCI calculations of 7-9Be are used to illustrate and explore ab initio rotational structure, and the resulting predictions for rotational band properties are compared with experiment. We highlight the robustness of ab initio rotational predictions across different choices for the internucleon interaction.

  3. AP calculus AB & BC crash course

    CERN Document Server

    Rosebush, J

    2012-01-01

    AP Calculus AB & BC Crash Course - Gets You a Higher Advanced Placement Score in Less Time Crash Course is perfect for the time-crunched student, the last-minute studier, or anyone who wants a refresher on the subject. AP Calculus AB & BC Crash Course gives you: Targeted, Focused Review - Study Only What You Need to Know Crash Course is based on an in-depth analysis of the AP Calculus AB & BC course description outline and actual AP test questions. It covers only the information tested on the exams, so you can make the most of your valuable study time. Written by experienced math teachers, our

  4. Evaluation of {sup 111}In labeled antibodies for SPECT imaging of mesothelin expressing tumors

    Energy Technology Data Exchange (ETDEWEB)

    Misri, Ripen; Saatchi, Katayoun [Faculty of Pharmaceutical Sciences, University of British Columbia, Vancouver, BC, V6T 1Z3 (Canada); Ng, Sylvia S.W. [Faculty of Pharmaceutical Sciences, University of British Columbia, Vancouver, BC, V6T 1Z3 (Canada); Advanced Therapeutics, British Columbia Cancer Agency, Vancouver BC V5Z 1G1 (Canada); Kumar, Ujendra [Faculty of Pharmaceutical Sciences, University of British Columbia, Vancouver, BC, V6T 1Z3 (Canada); Haefeli, Urs O., E-mail: uhafeli@interchange.ubc.ca [Faculty of Pharmaceutical Sciences, University of British Columbia, Vancouver, BC, V6T 1Z3 (Canada)

    2011-08-15

    Introduction: Mesothelin is expressed in many cancers, especially in mesothelioma and lung, pancreatic and ovarian cancers. In the present study, we evaluate {sup 111}In labeled antimesothelin antibodies as an imaging bioprobe for the SPECT imaging of mesothelin-expressing tumors. Methods: We radiolabeled the antimesothelin antibodies mAbMB and mAbK1 with {sup 111}In using the p-SCN-bn-DTPA chelator. The immunoreactivity, affinity (K{sub d}) and internalization properties of the resulting two {sup 111}In labeled antibodies were evaluated in vitro using mesothelin-expressing A431K5 cells. The biodistribution and microSPECT/CT imaging studies with {sup 111}In labeled antibodies were performed in mice bearing both mesothelin positive (A431K5) and mesothelin negative (A431) tumors. Results: In vitro studies demonstrated that {sup 111}In-mAbMB bound with a higher affinity (K{sub d}=3.6{+-}1.7 nM) to the mesothelin-expressing A431K5 cells than did the {sup 111}In-mAbK1 (K{sub d}=29.3{+-}2.3 nM). {sup 111}In-mAbMB was also internalized at a greater rate and extent into the A431K5 cells than was the {sup 111}In-mAbK1. Biodistribution studies showed that {sup 111}In-mAbMB was preferentially localized in A431K5 tumors when compared to A431 tumors. At the low dose, the peak A431K5 tumor uptake of 9.65{+-}2.65% ID/g (injected dose per gram) occurred at 48 h, while at high dose tumor uptake peaked with 14.29{+-}6.18% ID/g at 72 h. Non-specific localization of {sup 111}In-mAbMB was mainly observed in spleen.{sup 111}In-mAbK1 also showed superior localization in A431K5 tumors than in A431 tumors, but the peak uptake was only 3.04{+-}0.68% ID/g at 24 h. MicroSPECT/CT studies confirmed better visualization of A431K5 tumors with {sup 111}In-mAbMB, than with {sup 111}In-mAbK1. Conclusion: SPECT imaging of mesothelin expressing tumors was demonstrated successfully. Our findings indicate that the antimesothelin antibody mAbMB has the potential to be developed into a diagnostic agent

  5. Off-Label Drug Use

    Science.gov (United States)

    ... Your Local Offices Close + - Text Size Off-label Drug Use What is off-label drug use? In the United States new drugs are ... unapproved use of a drug. Is off-label drug use legal? The off-label use of FDA- ...

  6. Genetic algorithms for map labeling

    NARCIS (Netherlands)

    Dijk, Steven Ferdinand van

    2002-01-01

    Map labeling is the cartographic problem of placing the names of features (for example cities or rivers) on the map. A good labeling has no intersections between labels. Even basic versions of the problem are NP-hard. In addition, realistic map-labeling problems deal with many cartographic constr

  7. European consumers and nutrition labelling

    DEFF Research Database (Denmark)

    Wills, Josephine M.; Grunert, Klaus G.; Celemín, Laura Fernández;

    2009-01-01

    Nutrition labelling of food in Europe is not compulsory, unless a nutrition or health claim is made for the product. The European Commission is proposing mandatory nutrition labelling, even front of pack labelling with nutrition information. Yet, how widespread is nutrition labelling in the EU...

  8. Main: DREDR1ATRD29AB [PLACE

    Lifescience Database Archive (English)

    Full Text Available DREDR1ATRD29AB S000152 23-June-2006 (last modified) kehi Related to responsiveness ...dependent in the ABA-responsive expression of the rd29A in Arabidopsis; DRE; drought; water stress; oxidativ

  9. Reference: DREDR1ATRD29AB [PLACE

    Lifescience Database Archive (English)

    Full Text Available ization and expression of two Arabidopsis DREB2 genes encoding DRE-binding proteins...DREDR1ATRD29AB Nakashima K, Shinwari ZK, Sakuma Y, Seki M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K Organ

  10. 78 FR 36693 - Rules and Regulations Under the Fur Products Labeling Act

    Science.gov (United States)

    2013-06-19

    ... CFR Part 301 RIN 3084-AB27 Rules and Regulations Under the Fur Products Labeling Act AGENCY: Federal.... SUMMARY: To promote consistency between the guaranty provisions in its Rules and Regulations under the Fur... Regulations (``Textile Rules'') under the Textile Fiber Products Identification Act (``Textile Act'')....

  11. Radioactive labelling of peptidic hormones

    International Nuclear Information System (INIS)

    The labelling of peptidic hormones requires stability, specificity and sensitivity of the label. Introduction of a radioactive atome is one way to satisfy these criteria. Several processes have been described to prepare radioactive TRF: synthesis of the peptide with labelled aminoacids or introduction of the label into the hormone. In that approach, tritium can be substituted in the imidazole ring, via precursors activating the proper carbon. Monoiodo TRF leads essentially to tritium labelling of the 5 positions whereas monoazo TRF allows the preparation of 3H TRF labelled in the 2 positions. Di-substituted TRF leads to labelling into the 2 and 5 carbons. Labelled analogs of TRF can be prepared with labelled iodine; further developments of peptide labelling, will be presented. In particular, the homolytic scission of the C-iodine, bond by photochemical activation. The nascent carbon radical can be stabilized by a tritiated scavenger. This approach eliminates the use of heavy metal catalysts

  12. Imaging endocarditis with Tc-99m-labeled antibody--an experimental study: concise communication

    Energy Technology Data Exchange (ETDEWEB)

    Wong, D.W.; Dhawan, V.K.; Tanaka, T.; Mishkin, F.S.; Reese, I.C.; Thadepalli, H.

    1982-03-01

    The sensitivity and specificity of Tc-99m-labeled antibacterial antibody (Tc-99m Ab) for detecting bacterial endocarditis were evaluated in an experimental model. Rabbit-produced antistaphylococcal antibody was extracted using Rivanol and chemically labeled with Tc-99m. This Tc-99m Ab was injected intravenously in New Zealand rabbits 24 hr after producing Staphylococcus aureus endocarditis of the aortic valve. Imaging and tissue analyses were performed on the following day. All 11 animals developed S. aureus aortic-valve vegetations and showed increased uptake of Tc-99m Ab at the aortic valve, 118 times higher than at the uninfected tricuspid valve. Although high hepatic radioactivity and anatomic uncertainties interfered with in vivo delineation of these lesions, images of the excised hearts showed all affected valves. Two rabbits inoculated with Escherichia coli did not develop endocarditis and had little uptake of Tc-99m Ab, while six rabbits with enterococcal endocarditis had no uptake of the Tc-99m Ab in their vegetations. The findings suggest potential value of Tc-99m Ab on the rapid diagnosis of endocarditis.

  13. Newly released EIA-law. A palette of wishes?; Das neue UVP-Recht. Ein Wunschkonzert?

    Energy Technology Data Exchange (ETDEWEB)

    Feldmann, Ulrike

    2015-05-15

    The EU-directive on Environmental Impact Assessment (EIA) for certain public and private projects was once again amended in 2014 after controversial discussions, three previous modifications during 1985 and 2010 and an aggregation of all amendments within the EU-EIA-2011/92 directive. This newly released EU-EIA-directive 2014/52/EU (hereinafter RL 2014/52) is published within the EU-official journal EU L 124 p. 1 from 25.04.2014, came into force on 15. May 2014 and has to be adopted into international law until 16.05.2017. The modifications made are also valid, apart from certain exceptions, for licensing procedures (including decommissioning of nuclear power plants) in the field of nuclear energy, as far as they might have possible, significant environmental effects. The European EIA directive's 30th ''anniversary'' on 27.06.2015 raises the question, which substantial changes will come soon along with the newly released EU-EIA law. All in all it seems like if authorities and industry might get along with the newly released EU-EIA regulations. The responsible Federal Ministry for the Environment is already working on a first preliminary draft. It is under consideration if the EIA-regulation should be submitted additionally, beyond required amendments by EU-law, to a general revision. EIA-law remains exciting.

  14. The influence of actor capacities on EIA system performance in low and middle income countries -Cases from Georgia and Ghana

    NARCIS (Netherlands)

    Kolhoff, A.J.; Runhaar, H.A.C.; Gugushvili, Tamar; Sonderegger, Gabi; Leest, Van der Bart; Driessen, P.P.J.

    2016-01-01

    In this paper, we aim to better understand the factors that contribute to the substantive performance of EIA systems in low and middle income countries. Substantive performance is defined as the extent to which the EIA process contributes to the EIA objectives for the long term, namely environmen

  15. The influence of actor capacities on EIA system performance in low and middle income countries -Cases from Georgia and Ghana

    NARCIS (Netherlands)

    Kolhoff, Arend J.; Runhaar, Hens A C; Gugushvili, Tamar; Sonderegger, Gabi; Van der Leest, Bart; Driessen, Peter

    2016-01-01

    In this paper, we aim to better understand the factors that contribute to the substantive performance of EIA systems in low and middle income countries. Substantive performance is defined as the extent to which the EIA process contributes to the EIA objectives for the long term, namely environmental

  16. Synthesis of labeled compounds

    International Nuclear Information System (INIS)

    Intermediate compounds labeled with 13C included methane, sodium cyanide, methanol, ethanol, and acetonitrile. A new method for synthesizing 15N-labeled 4-ethylsulfonyl-1-naphthalene-sulfonamide was developed. Studies were conducted on pathways to oleic-1-13C acid and a second pathway investigated was based on carbonation of 8-heptadecynylmagnesium bromide with CO2 to prepare sterolic acid. Biosynthetic preparations included glucose-13C from starch isolated from tobacco leaves following photosynthetic incubation with 13CO2 and galactose-13C from galactosylglycerol-13C from kelp. Research on growth of organisms emphasized photosynthetic growth of algae in which all cellular carbon is labeled. Preliminary experiments were performed to optimize the growth of Escherichia coli on sodium acetate-13C

  17. Alliance opens for business boosted by EIA forecast

    International Nuclear Information System (INIS)

    The Energy Information Administration (EIA) of the US Department of Energy recently released a new forecast showing US requirements for natural gas growing at a steady pace. By 2020, EIA says, pipeline imports will have climbed by 70 per cent to 5.8 Tcf per year. Tanker imports of natural gas liquids are also set to grow at the rate of 700 bcf annually by 2020. Much of the demand growth is expected to continue to be driven by the expanding use of natural gas in electricity generation, but there are across-the-board increases forecast in US residential, commercial and industrial gas consumption as well, thanks to a predicted overall economic growth of an average three per cent annually. If these predictions materialize, the initial excess pipeline capacity created by the Alliance Pipeline will shrink very quickly. Accordingly, the next major development spawned by Alliance, the Millenium Pipeline Project, an international effort which involves TransCanada Pipelines and Union Gas, as well as the Columbia Energy Group in the US, is expected to move ahead. A target of 2002 is set for the proposed 700 mmcf per day route across Lake Erie to New York State to New York City. In addition to Alliance, there is TransCanada Pipelines' 1.1 bcf per day new capacity added by the Foothills-Northern Border export route. Overall, an average of 1.0 bcf per day of excess capacity is predicted which will, however, last no more than two to five years. The EIA expects that new projects in Alaska and the Northwest Territories will soak up the excess capacity and set off a new round of expansion by the Canadian pipeline system

  18. Semantic Role Labeling

    CERN Document Server

    Palmer, Martha; Xue, Nianwen

    2011-01-01

    This book is aimed at providing an overview of several aspects of semantic role labeling. Chapter 1 begins with linguistic background on the definition of semantic roles and the controversies surrounding them. Chapter 2 describes how the theories have led to structured lexicons such as FrameNet, VerbNet and the PropBank Frame Files that in turn provide the basis for large scale semantic annotation of corpora. This data has facilitated the development of automatic semantic role labeling systems based on supervised machine learning techniques. Chapter 3 presents the general principles of applyin

  19. EIA Directory of Electronic Products, Second quarter 1994

    Energy Technology Data Exchange (ETDEWEB)

    1994-07-26

    EIA makes available for public use a series of machine-readable data files and computer models, on magnetic tapes; selected data files/models are also available on PC diskettes. The data files include: petroleum, natural gas, electricity, coal, integrated statistics, and consumption. Models include: petroleum, natural gas, electricity, coal, nuclear, and multifuel. On-line files and compact discs include: electronic publishing system, federal bulletin board, economic bulletin board, national trade data bank, national economic/social/environmental data bank, and FedWorld Gateway. For each product listed in this directory, an abstract describes the data published. Contact persons are provided, as are indexes.

  20. Development of EIA Issues in Canada and Practices in China

    Institute of Scientific and Technical Information of China (English)

    Dr. Robert C. Lao

    2004-01-01

    @@ 1 Introduction The requirement for conducting environmental impact assessment (EIA) for all economic and construction development projects and activities in Canada is based on the law. The federal government of Canada, and all provincial and territorial governments have developed relevant processes and procedures to meet this legal obligation. As early as in 1973, the federal Environmental Assessment and Review Process (EARP) was established, and in 1984 the Guidelines Order issued was by the federal cabinet which clarified roles and responsibilities of various parties and stakeholders for participating and/or implementing EARP.

  1. Comparison of DOTA and NODAGA as chelators for 64Cu-labeled immunoconjugates

    International Nuclear Information System (INIS)

    Introduction: Bifunctional chelators have been shown to impact the biodistribution of monoclonal antibody (mAb)-based imaging agents. Recently, radiolabeled 1,4,7-triazacyclononane,1-glutaric acid-4,7-acetic acid (NODAGA)-peptide complexes have demonstrated improved in vivo stability and performance compared to their 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) counterparts. Here, we investigated if similar utility could be achieved with mAbs and compared 64Cu-labeled DOTA and NODAGA-immunoconjugates for the detection of epithelial cell adhesion molecule (EpCAM) in a prostate cancer model. Methods: DOTA and NODAGA-immunoconjugates of an EpCAM targeting mAb (mAb7) were synthesized and radiolabeled with 64Cu (DOTA: 40 °C for 1 hr; NODAGA: 25 °C for 1 hr). The average number of chelators per mAb was quantified by isotopic dilution, and the biological activity of the immunoconjugates was evaluated by flow cytometry and ELISA. Radioligand assays were performed to compare cellular uptake and determine the dissociation constant (Kd) and maximum number of binding sites (Bmax) for the immunoconjugates using DsRed-transfected PC3-cells. A PC3-DsRed xenograft tumor model was established in nude mice and used to perform biodistribution studies to compare organ uptake and pharmacokinetics. Results: 64Cu-DOTA-mAb7 and 64Cu-NODAGA-mAb7 were prepared with chelator/protein ratios of 2–3 and obtained in comparable radiochemical yields ranging from 59 to 71%. Similar immunoreactivity was observed with both agents, and mock labeling studies indicated that incubation at room temperature or 40 °C did not affect potency. 64Cu-NODAGA-mAb7 demonstrated higher in vitro cellular uptake while 64Cu-DOTA-mAb7 had higher Kd and Bmax values. From the biodistribution data, we found similar tumor uptake (13.44 ± 1.21%ID/g and 13.24 ± 4.86%ID/g for 64Cu-DOTA-mAb7 and 64Cu-NODAGA-mAb7, respectively) for both agents at 24 hr, although normal prostate tissue was significantly

  2. A totally magic cordial labeling of one-point union of n copies of a graph

    Directory of Open Access Journals (Sweden)

    P. Jeyanthi

    2014-01-01

    Full Text Available A graph \\(G\\ is said to have a totally magic cordial (TMC labeling with constant \\(C\\ if there exists a mapping \\(f: V(G\\cup E(G\\rightarrow \\left\\{0,1\\right\\}\\ such that \\(f(a + f(b + f(ab \\equiv C(\\mbox{mod 2}\\ for all \\(ab\\in E(G\\ and \\(\\left|n_f(0-n_f(1\\right|\\leq1\\, where \\(n_f(i\\ \\((i = 0, 1\\ is the sum of the number of vertices and edges with label \\(i\\. In this paper, we establish the totally magic cordial labeling of one-point union of \\(n\\-copies of cycles, complete graphs and wheels.

  3. Multi-label

    Directory of Open Access Journals (Sweden)

    Neda Abdelhamid

    2015-01-01

    Full Text Available Generating multi-label rules in associative classification (AC from single label data sets is considered a challenging task making the number of existing algorithms for this task rare. Current AC algorithms produce only the largest frequency class connected with a rule in the training data set and discard all other classes even though these classes have data representation with the rule’s body. In this paper, we deal with the above problem by proposing an AC algorithm called Enhanced Multi-label Classifiers based Associative Classification (eMCAC. This algorithm discovers rules associated with a set of classes from single label data that other current AC algorithms are unable to induce. Furthermore, eMCAC minimises the number of extracted rules using a classifier building method. The proposed algorithm has been tested on a real world application data set related to website phishing and the results reveal that eMCAC’s accuracy is highly competitive if contrasted with other known AC and classic classification algorithms in data mining. Lastly, the experimental results show that our algorithm is able to derive new rules from the phishing data sets that end-users can exploit in decision making.

  4. Labeling of herbicide femesafen

    International Nuclear Information System (INIS)

    5-[2-chroo-4-(trifluoromethyl ) phenoxy]-N-(methyl sulphonyl )-2-niorobenzamide [femesafen] was labeled by six steps. Radio-chemical yield was 19.15%. TLC analysis of the final product showed that the radiochemical purity is not less than 99%. (authors)

  5. Waisda?: video labeling game

    NARCIS (Netherlands)

    Hildebrand, M.; Brinkerink, M.; Gligorov, R.; Steenbergen, M. van; Huijkman, J.; Oomen, J.

    2013-01-01

    The Waisda? video labeling game is a crowsourcing tool to collect user-generated metadata for video clips. It follows the paradigm of games-with-a-purpose, where two or more users play against each other by entering tags that describe the content of the video. Players score points by entering the sa

  6. Genetic algorithms for map labeling

    OpenAIRE

    Dijk, Steven Ferdinand van

    2002-01-01

    Map labeling is the cartographic problem of placing the names of features (for example cities or rivers) on the map. A good labeling has no intersections between labels. Even basic versions of the problem are NP-hard. In addition, realistic map-labeling problems deal with many cartographic constraints, which pose more demands on how the labels should be placed in relation to their surroundings. For example, a label is preferably placed above and to the right of a city. These two aspects (comb...

  7. Positively charged templates for labeling internalizing antibodies: comparison of N-succinimidyl 5-iodo-3-pyridinecarboxylate and the D-amino acid peptide KRYRR

    Energy Technology Data Exchange (ETDEWEB)

    Foulon, Catherine F.; Welsh, Philip C.; Bigner, Darell D.; Zalutsky, Michael R. E-mail: zalut001@mc.duke.edu

    2001-10-01

    Receptor-mediated internalization of monoclonal antibodies (mAbs), such as those specific for the epidermal growth factor receptor variant III (EGFRvIII), can lead to rapid loss of radioactivity from the target cell. In the current study, the anti-EGFRvIII mAb L8A4 was radioiodinated using two methods -N-succinimidyl 5-iodo-3-pyridinecarboxylate (SIPC) and via a D-amino acid peptide LysArgTyrArgArg (D-KRYRR). Paired-label internalization assays performed on EGFRvIII-expressing U87{delta}EGFR cells in vitro demonstrated that labeling L8A4 using D-KRYRR resulted in significantly higher retention of radioiodine in the intracellular compartment. In athymic mice with D256 human glioma xenografts, tumor uptake was similar for both labeling methods through 24 hr. However, an up to fourfold higher tumor retention was observed for mAb labeled with the D-amino acid peptide at later time points. Radiation absorbed dose calculations based on these biodistribution data indicated that L8A4 labeled using D-KRYRR exhibited better tumor-to-normal-organ radiation dose ratios, suggesting that this labeling method may be of particular value for labeling internalizing mAbs.

  8. Use the Nutrition Facts Label

    Science.gov (United States)

    ... Features Spokespeople News Archive eNewsletters Calendar Use the Nutrition Facts Label You can help your family eat ... to some of their favorite foods. Use the Nutrition Facts label found on food packages to make ...

  9. Ab initio valence calculations in chemistry

    CERN Document Server

    Cook, D B

    1974-01-01

    Ab Initio Valence Calculations in Chemistry describes the theory and practice of ab initio valence calculations in chemistry and applies the ideas to a specific example, linear BeH2. Topics covered include the Schrödinger equation and the orbital approximation to atomic orbitals; molecular orbital and valence bond methods; practical molecular wave functions; and molecular integrals. Open shell systems, molecular symmetry, and localized descriptions of electronic structure are also discussed. This book is comprised of 13 chapters and begins by introducing the reader to the use of the Schrödinge

  10. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    Energy Technology Data Exchange (ETDEWEB)

    Souto, F.J.; Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Kmetyk, L.N. [Sandia National Labs., Albuquerque, NM (United States)

    1994-10-01

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS.

  11. Auditing and control programs: putting EIA recommendations for ecological impacts prevention in practice

    OpenAIRE

    Arce-Ruiz, Rosa M.

    2003-01-01

    If we examine the EIA process in different countries, it seems that it is linked to a previous phase of discussion of projects, through the administrative process.This previous stage is, in fact, one in which the project can be publicly discussed and the decisions about location, design, etc., are made, and one in which the preventive focus of the EIA can be applied. In consequence, the EIA process looks as if it were linked to the pre-construction period, although, in fact, it must be a cycl...

  12. Labelling GM-free Products

    DEFF Research Database (Denmark)

    Punt, Maarten; Venus, Thomas; Wesseler, Justus

    2016-01-01

    Food suppliers in the EU must comply with labelling regulations for genetically modified organisms (GMOs). However, excluded from mandatory labelling are food products derived from animals fed with GM feed (mainly GM soybean in the EU). Because of this labelling exemption, consumers are unable to...

  13. Food Labels Tell the Story!

    Science.gov (United States)

    ... My World From the Label to the Table! Food Labels Tell the Story! What is in food? Food provides your body with all of the ... your food choices. Nutrition Facts—the Labels on Food Products Beginning in 1994, the US government began ...

  14. Myocardial arterial spin labeling

    OpenAIRE

    Kober, Frank; Jao, Terrence; Troalen, Thomas; Nayak, Krishna S.

    2016-01-01

    Arterial spin labeling (ASL) is a cardiovascular magnetic resonance (CMR) technique for mapping regional myocardial blood flow. It does not require any contrast agents, is compatible with stress testing, and can be performed repeatedly or even continuously. ASL-CMR has been performed with great success in small-animals, but sensitivity to date has been poor in large animals and humans and remains an active area of research. This review paper summarizes the development of ASL-CMR techniques, c...

  15. Ab interno trabeculectomy: A comprehensive review

    Directory of Open Access Journals (Sweden)

    Ting Ting Liu

    2013-07-01

    Full Text Available PURPOSE To summarize the original literature on ab interno trabeculectomy with the Trabectome system and to review its efficacy and safety in the treatment of glaucoma. METHOD A literature search in PubMed was performed on ab interno trabeculectomy with the Trabectome system, and clinical relevant information was reviewed and summarized. RESULTS Ab interno trabeculectomy with the Trabectome system on average lowered intraocular pressure (IOP to the mid-teens, and decreased the number of required glaucoma medications. Greater preoperative IOP correlated to a greater percent reduction in IOP. The success rates varied among studies, and the definition of success differed by authors. Intraoperative blood reflux was found in nearly all cases. Incidences of early hypotony and IOP spikes were low. No cases of endophthalmitis, wound leak, aqueous misdirection, choroidal hemorrhage or effusions, and irreversible visual acuity decrease (≥2 Snellen lines have been reported. Available studies had a significant amount of data overlap. Only limited data on long-term results was available. There was no randomized controlled trial to date. CONCLUSIONS Ab interno trabeculectomy with the Trabectome system is an effective and safe surgical approach for patients with various types of open angle glaucoma. On average, the procedure at least in the short term lowers IOP to the mid teens regardless of preoperative IOP with or without the aid of topical medications.

  16. Reference: DREDR1ATRD29AB [PLACE

    Lifescience Database Archive (English)

    Full Text Available DREDR1ATRD29AB Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, N... ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590; ...

  17. EIA directory of electronic products. Second quarter 1995

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-10-04

    The Energy Information Administration (EIA) makes available for public use a series of machine-readable data files and computer models. They are available to the public on magnetic tapes; selected data files/models are available on diskette for IBM-compatible personal computers. This directory first presents the on-line files and compact discs. This is followed by descriptions and technical contacts and ordering and other information on the data files and models. An index by energy source is included. Additional ordering information is in the preface. The data files cover petroleum, natural gas, electricity, coal, integrated statistics, and consumption; the models cover petroleum, natural gas, electricity, coal, nuclear, and multifuel.

  18. Linerless label device and method

    KAUST Repository

    Binladen, Abdulkari

    2016-01-14

    This apparatus and method for applying a linerless label to an end user product includes a device with a printer for printing on a face surface of a linerless label, and a release coat applicator for applying a release coat to the face surface of the label; another device including an unwinder unit (103) to unwind a roll of printed linerless label; a belt (108); a glue applicator (102) for applying glue to the belt; a nip roller (106) for contacting and applying pressure to the face surface of the linerless label such that the glue on the belt transfers to the back surface of the linerless label; at least one slitting knife 105) positioned downstream the belt and a rewinder unit (104) positioned downstream the slitting knife; and a third device which die cuts and applies the linerless label to an end user object.

  19. Label-Guided Graph Exploration with Adjustable Ratio of Labels

    CERN Document Server

    Zhang, Meng; Tang, Jijun

    2012-01-01

    The graph exploration problem is to visit all the nodes of a connected graph by a mobile entity, e.g., a robot. The robot has no a priori knowledge of the topology of the graph or of its size. Cohen et al. \\cite{Ilcinkas08} introduced label guided graph exploration which allows the system designer to add short labels to the graph nodes in a preprocessing stage; these labels can guide the robot in the exploration of the graph. In this paper, we address the problem of adjustable 1-bit label guided graph exploration. We focus on the labeling schemes that not only enable a robot to explore the graph but also allow the system designer to adjust the ratio of the number of different labels. This flexibility is necessary when maintaining different labels may have different costs or when the ratio is pre-specified. We present 1-bit labeling (two colors, namely black and white) schemes for this problem along with a labeling algorithm for generating the required labels. Given an $n$-node graph and a rational number $\\rh...

  20. Application of EIA/SEA system in land use planning: Experience from Serbia

    Directory of Open Access Journals (Sweden)

    Stojanović Božidar

    2005-01-01

    Full Text Available This paper discusses the experience and current status of EIA/SEA procedures and assessment methodologies in Serbia, aiming to propose strategies that can lead to effective integration of the SEA in spatial planning. Institutional and practical problems with regard to the regulations of EIA/SEA were considered. Experience from the past decade shows that implementation of EIA system in Serbia has not been effective as expected. New legislation on EIA and SEA is harmonized with corresponding EU Directives. First steps in the application of the SEA show that the main issues are screening, scooping and decision making. According to the research results, it is suggested that extra evaluation processes should be incorporated into current assessment procedures to improve their scientific validity and integrity.

  1. KINETIC ANALYSIS OF CO-CONDENSATION POLYMERIZATION OF AB2 AND AB MONOMERS

    Institute of Scientific and Technical Information of China (English)

    Min-qiang Yu; Zhi-ping Zhou; De-yue Yan

    2004-01-01

    This work deals with the kinetics of co-condensation polymerization of AB2 and AB monomers, giving expressions of the two-dimensional molecular weight distribution function and the number/weight average molecular weights of the resulting copolymers. The two-dimensional molecular weight distribution depends on two indices, n and l, which are the respective numbers of AB2 and AB units in a copolymer species. The evolution of the two-dimensional weight and z distributions during the co-condensation polymerization has been evaluated systematically. Finally, the two-dimensional distribution was transformed into a one-dimensional molecular weight distribution with only one variable (the molecular weight of the products instead of the degree of polymerization). The calculated results show that the highly branched copolymer has a very broad molecular weight distribution when the co-condensation polymerization approaches completion.

  2. On the Strain Rate Sensitivity of Abs and Abs Plus Fused Deposition Modeling Parts

    Science.gov (United States)

    Vairis, A.; Petousis, M.; Vidakis, N.; Savvakis, K.

    2016-06-01

    In this work the effect of strain rate on the tensile strength of fused deposition modeling parts built with Acrylonitrile-butadiene-styrene (ABS) and ABS plus material is presented. ASTM D638-02a specimens were built with ABS and ABS plus and they were tested on a Schenck Trebel Co. tensile test machine at three different test speeds, equal, lower, and higher to the test speed required by the ASTM D638-02a standard. The experimental tensile strength results were compared and evaluated. The fracture surfaces of selected specimens were examined with a scanning electron microscope, to determine failure mode of the filament strands. It was found that, as the test speed increases, specimens develop higher tensile strength and have higher elastic modulus. Specimens tested in the highest speed of the experiment had on average about 10% higher elastic modulus and developed on average about 11% higher tensile strength.

  3. Quality of environmental impact assessment (EIA) reports on biological pest control / Thea Henriette Carroll

    OpenAIRE

    Carroll, Thea Henriette

    2006-01-01

    Decision making regarding the release of biological control agents for invasive species such as lantana, Lantana camara, requires the consideration and evaluation of environmental impact assessment (EIA) reports by a competent authority. Although various biological control agents have been authorised for release into the environment for the control of lantana, the quality of the EIA reports that form the basis for decision making has never been evaluated. The evaluation of the ...

  4. Labelled compounds. (Pt. B)

    International Nuclear Information System (INIS)

    Since the end of World War II there has been a tremendous increase in the number of compounds that have been synthesized with radioactive or stable isotopes. They have found application in many diverse fields, so much so, that hardly a single area in pure and applied science has not benefited. Not surprisingly it has been reflected in appearance of related publications. The early proceedings of the Symposia on Advances in Trace Methodology were soon followed by various Euratom sponsored meetings in which methods of preparing and storing labelled compounds featured prominently. In due course a resurgence of interest in stable isotopes, brought about by their greater availability (also lower cost) and partly by development of new techniques such as gas chromatography - mass spectrometry (gc-ms), led to the publication of proceedings of several successful conferences. More recently conferences dealing with the synthesis and applications of isotopes and isotopically labelled compounds have been established on a regular basis. In addition to the proceedings of conferences and journal publications individuals left their mark by producing definitive texts, usually on specific nuclides. Only the classic two volume publication of Murray and Williams (Organic syntheses with isotopes, New York 1985), now over 30 years old and out of print, attempted to do justice to several nuclides. With the large amount of work that has been undertaken since then it seems unlikely that an updated edition could be produced. The alternative strategy was to ask scientists currently active to review specific areas and this is the approach adopted in the present series of monographs. In this way it is intended to cover the broad advances that have been made in the synthesis and applications of isotopes and isotopically labelled compounds in the physical and biomedical sciences. (author). refs.; figs.; tabs

  5. Leaching behaviour of the Swedish KBS-glasses ABS 39 and ABS 41

    International Nuclear Information System (INIS)

    The planned Swedish KBS glass corrosion investigation program comprises experiments with inactive glasses containing simulated waste, prolonged in-situ tests, the characterization of corrosion products, immiscibility studies, and corrosion experiments with hot glass. This presentation gives a short description of the entire program. It focuses thereafter on some recent leaching results with the inactive KBS glass qualities ABS 39 and ABS 41, which were leached in a manner similar to the PNL MCC-1 test procedure. 5 figures, 9 tables

  6. Thermomechanical properties of ABS/PA AND ABS/PC blends

    OpenAIRE

    GUINAULT, Alain; Sollogoub, Cyrille

    2009-01-01

    International audience The significant increase of Waste Electric and Electronic Equipment (WEEE) has led to an important research in upgrading recycled engineering plastics by means of a blending technique. Classical twin-screw extrusion is compared to a new blending technique, where two polymers are combined together and then flow in several static mixers. This technique allows to obtain different morphologies of compatibilized ABS/PA or ABS/PC blends and the aim of this work is to evalu...

  7. Waisda?: video labeling game

    OpenAIRE

    Hildebrand, Michiel; Brinkerink, M.; Gligorov, R.; Steenbergen, Van; Huijkman, J.; Oomen, J.

    2013-01-01

    The Waisda? video labeling game is a crowsourcing tool to collect user-generated metadata for video clips. It follows the paradigm of games-with-a-purpose, where two or more users play against each other by entering tags that describe the content of the video. Players score points by entering the same tags as one of the other players. As a result each video that is played in the game is annotated with tags that are anchored to a time point in the video. Waisda? has been deployed in two projec...

  8. A Food Labeling

    Science.gov (United States)

    ... " ﻗﺎﻧﻮن اﻟﺒﻄﺎﻗﺎت واﻟﺘﻮﻋﻴﺔ اﻟﻐﺬاﺋﻴﺔ " [ Nutrition Labeling and Education Act ... ﻟﻠﻌﺼﻴﺮ اﻟﻤﻜﻮن ﺑﺈﺿﺎﻓﺔ اﻟﻤﺎء إﻟﻰ ﺧﻼﺻﺔ ﻣﺮآﺰة : ﻳﺠﺮى اﻟﺤﺴﺎب ﻣﻦ ﺟﺪول Brix ﻓﻲ 21 CFR 101.30(h)(1) ...

  9. Towards Multi Label Text Classification through Label Propagation

    Directory of Open Access Journals (Sweden)

    Shweta C. Dharmadhikari

    2012-06-01

    Full Text Available Classifying text data has been an active area of research for a long time. Text document is multifaceted object and often inherently ambiguous by nature. Multi-label learning deals with such ambiguous object. Classification of such ambiguous text objects often makes task of classifier difficult while assigning relevant classes to input document. Traditional single label and multi class text classification paradigms cannot efficiently classify such multifaceted text corpus. Through our paper we are proposing a novel label propagation approach based on semi supervised learning for Multi Label Text Classification. Our proposed approach models the relationship between class labels and also effectively represents input text documents. We are using semi supervised learning technique for effective utilization of labeled and unlabeled data for classification. Our proposed approach promises better classification accuracy and handling of complexity and elaborated on the basis of standard datasets such as Enron, Slashdot and Bibtex.

  10. The importance of context in delivering effective EIA: Case studies from East Africa

    International Nuclear Information System (INIS)

    This paper reviews and compares the condition of the environmental impact assessment (EIA) system in three countries in the East Africa region: Kenya, Rwanda and Tanzania. The criteria used for the evaluation and the comparison of each system are based on the elements of the legal, administrative and procedural frameworks, as well as the context in which they operate. These criteria are adapted from the evaluation and quality control criteria derived from a number of literature sources. The study reveals that the EIA systems of Kenya and Tanzania are at a similar stage in their development. The two countries, the first to introduce the EIA concept into their jurisdiction in this part of Africa, therefore have more experience than Rwanda in the practice of environmental impact assessment, where the legislation and process requires more time to mature both from the governmental and societal perspective. The analysis of the administrative and procedural frameworks highlights the weakness in the autonomy of the competent authority, in all three countries. Finally a major finding of this study is that the contextual set up i.e. the socio-economic and political situation plays an important role in the performance of an EIA system. The context in developing countries is very different from developed countries where the EIA concept originates. Interpreting EIA conditions in countries like Kenya, Rwanda and Tanzania requires that the analysis for determining the effectiveness of their systems should be undertaken within a relevant framework, taking into account the specific requirements of those countries.

  11. Institutional challenges for EIA implementation in China: a case study of development versus environmental protection.

    Science.gov (United States)

    Gu, Lixin; Sheate, William R

    2005-07-01

    This paper provides a complete case study analysis of environmental impact assessment (EIA) implementation in China from planning to legal challenge, which is typical but rarely reported. The analysis takes an historical perspective on the regulatory and institutional structures through which EIA has been implemented in China, in order to evaluate the extent to which EIA has matured over the last 10 years. The case study relates to a proposed recreation/tourist development at Dianshan Lake, a protected water resource for Shanghai. Legal and administrative challenge began in 1993, when the case was initiated with a letter from the public, and concluded in 1996, when the case was decided in a court judgment. More recent follow-up research indicates that many issues have continued to be problems for EIA implementation in China. Policy implications in terms of regulatory structure, institutional arrangement, EIA procedure, EIA practitioners, and public participation can be drawn, and lessons learned for both the government and the developers. The study emphasizes the problem of relying on reorientation of existing institutions to promote new (environmental) priorities. PMID:15983862

  12. Anti-CEA monoclonal antibody: technetium-99m labeling and the validation process of a scintigraphic animal model with a non-cellular antigenic implant.

    Science.gov (United States)

    Sapienza, Marcelo Tatit; Marques, Fabio Luiz Navarro; Okamoto, Miriam Roseli Yoshie; Hironaka, Fausto Haruki; Buchpiguel, Carlos Alberto

    2002-07-01

    Animal models are currently used to verify the biodistribution of different radiopharmaceuticals before its clinical application in Nuclear Medicine; however, there may be some limitations. The utilization of labelled anti-tumor monoclonal antibodies (MoAb) in experimental models often requires implant of human antigens (usually a cellular implant), which cannot be achieved in immunocompetent animals. Our purpose was to label an anti-CEA MoAb with technetium-99m (99Tc) and to validate a simplified animal model using a noncellular antigenic implant. MoAb was directly labelled with 99mTc, after reduction with 2-mercaptoethanol. Labeling efficiency was checked by ascending chromatography and immunoreactive fraction was measured in plastic wells sensitized with the antigen. Radiopharmaceutical biodistribution was evaluated by dissection and scintigraphy in 5 mice groups; following the subcutaneous administration of Al(OH)3, CEA adsorbed Al(OH)2 and a control group evaluation. Labeling efficiency was 94+/-3%, which showed to be stable for 24 hr, with immunoreactive fraction above 50%. Invasive biodistribution evaluation showed prolonged blood retention, hepatic and renal uptake. A significant increase in uptake was observed in scintigraphic studies of animals with CEA-adsorbed Al(OH)3 implants compared with the other groups (p<0.05). The non-cellular antigenic implant model simplifies the pre-clinical evaluation of labelled MoAb. PMID:12146705

  13. Label and Label-Free Detection Techniques for Protein Microarrays

    Directory of Open Access Journals (Sweden)

    Amir Syahir

    2015-04-01

    Full Text Available Protein microarray technology has gone through numerous innovative developments in recent decades. In this review, we focus on the development of protein detection methods embedded in the technology. Early microarrays utilized useful chromophores and versatile biochemical techniques dominated by high-throughput illumination. Recently, the realization of label-free techniques has been greatly advanced by the combination of knowledge in material sciences, computational design and nanofabrication. These rapidly advancing techniques aim to provide data without the intervention of label molecules. Here, we present a brief overview of this remarkable innovation from the perspectives of label and label-free techniques in transducing nano‑biological events.

  14. 76 FR 3584 - Disclosure of Cochineal Extract and Carmine in the Labeling of Wines, Distilled Spirits, and Malt...

    Science.gov (United States)

    2011-01-20

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF THE TREASURY Alcohol and Tobacco Tax and Trade Bureau 27 CFR Parts 5 RIN 1513-AB79 Disclosure of Cochineal Extract and Carmine in the Labeling of Wines, Distilled Spirits, and Malt Beverages Correction In proposed...

  15. Genetic labelling and application of the isoproturon-mineralizing Sphingomonas sp. strain SRS2 in soil and rhizosphere

    DEFF Research Database (Denmark)

    Kristensen, K.E.; Jacobsen, C.S.; Hansen, L.H.;

    2006-01-01

    into strain SRS2 using conjugational mating. In the transconjugant mutants luciferase was produced in varying levels. The mutants showed significant differences in their ability to degrade isoproturon. One luxAB-labelled mutant maintained the ability to mineralize isoproturon and was therefore selected...

  16. Genetics Home Reference: GM2-gangliosidosis, AB variant

    Science.gov (United States)

    ... of GM2-gangliosidosis, AB variant: Genetic Testing Registry: Tay-Sachs disease, variant AB These resources from MedlinePlus offer ... AB variant Activator Deficiency/GM2 Gangliosidosis Activator-deficient Tay-Sachs disease GM2 Activator Deficiency Disease GM2 gangliosidosis, type ...

  17. Investigation of high level of AsAb, EmAb in fertility female serum infected by chlamydia trachomatis

    International Nuclear Information System (INIS)

    Objective: To investigate the mechanism of chlamydia trachomatis. AsAb, EmAb in female fertility. Methods: LPS antigen of chlamydia in reproduction tract of fertility female was detected by monoclonal antibody and immunology chromatography; the content of AsAb, EmAb in serum of fertility female was detected by ELISA. Results: Infections rate of chlamydia trachomatis in fertility female was higher than that in the control AsAb, EmAb in serum of the fertility patients who were infected with chlamydia trachomatis showed a significant difference from that in the control group. Conclusion: The level of AsAb, EmAb increases in patients who have been infected with chlamydia trachomatis and these cytokines is involved in the course of female fertility

  18. Edge colouring by total labellings

    DEFF Research Database (Denmark)

    Brandt, Stephan; Rautenbach, D.; Stiebitz, M.;

    2010-01-01

    We introduce the concept of an edge-colouring total k-labelling. This is a labelling of the vertices and the edges of a graph G with labels 1, 2, ..., k such that the weights of the edges define a proper edge colouring of G. Here the weight of an edge is the sum of its label and the labels of its...... two endvertices. We define χ (G) to be the smallest integer k for which G has an edge-colouring total k-labelling. This parameter has natural upper and lower bounds in terms of the maximum degree Δ of G : ⌈ (Δ + 1) / 2 ⌉ ≤ χ (G) ≤ Δ + 1. We improve the upper bound by 1 for every graph and prove χ (G...

  19. A Better Carbon Footprint Label

    DEFF Research Database (Denmark)

    Thøgersen, John; Nielsen, Kristian S.

    2016-01-01

    Based on insights from behavioral economics, it is suggested to extend carbon footprint labeling with information about relative performance, using the well-known “traffic light” color scheme to communicate relative performance. To test this proposition, the impact of a carbon footprint label......, participants saw the original Carbon Trust label and in the other condition they saw the same label, but with traffic light colors added to communicate the product's relative performance in terms of carbon footprint. All included attributes were found to have a significant impact on consumer choices...... to indicate relative carbon footprint significantly increases carbon label effectiveness. Hence, a carbon footprint label is more effective if it uses traffic light colors to communicate the product's relative performance....

  20. Modeling the effects of labeling

    DEFF Research Database (Denmark)

    Juhl, Hans Jørn; Fjord, Thomas Ahle; Poulsen, Carsten Stig

    A new approach to evaluate the consequences of labeling is presented and applied to test the potential effect of a label on fresh fish. Labeling effects on quality perceptions and overall quality are studied. The empirical study is based on an experimental design and nearly 500 respondents partic...... participated in an in home test. The results indicate that catch time alone is not enough to work as an efficient predictor of actual perceived quality.......A new approach to evaluate the consequences of labeling is presented and applied to test the potential effect of a label on fresh fish. Labeling effects on quality perceptions and overall quality are studied. The empirical study is based on an experimental design and nearly 500 respondents...

  1. Classification and Labelling for Biocides

    OpenAIRE

    Rubbiani, Maristella

    2015-01-01

    CLP and biocides The EU Regulation (EC) No 1272/2008 on Classification, Labelling and Packaging of Substances and Mixtures, the CLP-Regulation, entered into force on 20th January, 2009. Since 1st December, 2010 the classification, labelling and packaging of substances has to comply with this Regulation. For mixtures, the rules of this Regulation are mandatory from 1st June, 2015; this means that until this date classification, labelling and packaging could either be carried out according to D...

  2. Aggregating Labels in Crowdsourcing Data

    OpenAIRE

    Priisalu, Maria; Grey, Francois; Segal, Ben

    2015-01-01

    Project Specification Crowdsourcing is gaining popularity in academia with the launch of crowdsourcing platforms such as Crowdcrafting [Lombraña, 2015] and GeoTagX [UNOSAT, 2015]. There have been a number of proposed algorithms for the aggregation of true labels and a confusion matrix from crowdsourced labels for ordinal, nominal and binary labels. The work here consists of an implementation of the Dawid Skene [Dawid 1979] adaptation of the Expectation Maximization algorithm [D...

  3. Ab initio mass tensor molecular dynamics

    OpenAIRE

    Tsuchida, Eiji

    2010-01-01

    Mass tensor molecular dynamics was first introduced by Bennett [J. Comput. Phys. 19, 267 (1975)] for efficient sampling of phase space through the use of generalized atomic masses. Here, we show how to apply this method to ab initio molecular dynamics simulations with minimal computational overhead. Test calculations on liquid water show a threefold reduction in computational effort without making the fixed geometry approximation. We also present a simple recipe for estimating the optimal ato...

  4. Reciprocity Theorems for Ab Initio Force Calculations

    CERN Document Server

    Wei, C; Mele, E J; Rappe, A M; Lewis, Steven P.; Rappe, Andrew M.

    1996-01-01

    We present a method for calculating ab initio interatomic forces which scales quadratically with the size of the system and provides a physically transparent representation of the force in terms of the spatial variation of the electronic charge density. The method is based on a reciprocity theorem for evaluating an effective potential acting on a charged ion in the core of each atom. We illustrate the method with calculations for diatomic molecules.

  5. Ab interno trabeculectomy: patient selection and perspectives

    Science.gov (United States)

    Vinod, Kateki; Gedde, Steven J

    2016-01-01

    Ab interno trabeculectomy is one among several recently introduced minimally invasive glaucoma surgeries that avoid a conjunctival incision and full-thickness sclerostomy involved in traditional glaucoma surgery. Ablation of the trabecular meshwork and inner wall of Schlemm’s canal is performed in an arcuate fashion via a clear corneal incision, alone or in combination with phacoemulsification cataract surgery. Intraocular pressure reduction following ab interno trabeculectomy is limited by resistance in distal outflow pathways and generally stabilizes in the mid-to-high teens. Relief of medication burden has been demonstrated by some studies. A very low rate of complications, most commonly transient hyphema and intraocular pressure elevations in the immediate postoperative period, have been reported. However, available data are derived from small retrospective and prospective case series. Randomized, controlled trials are needed to better elucidate the potential merits of ab interno trabeculectomy in the combined setting versus phacoemulsification cataract surgery alone and to compare it with other minimally invasive glaucoma surgeries. PMID:27574396

  6. Highly scalable Ab initio genomic motif identification

    KAUST Repository

    Marchand, Benoît

    2011-01-01

    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  7. Sustainability labels on food products

    DEFF Research Database (Denmark)

    Grunert, Klaus G; Hieke, Sophie; Wills, Josephine

    2014-01-01

    This study investigates the relationship between consumer motivation, understanding and use of sustainability labels on food products (both environmental and ethical labels), which are increasingly appearing on food products. Data was collected by means of an online survey implemented in the UK......, human values as measured by the Schwartz value domains, and country differences. The results imply that sustainability labels currently do not play a major role in consumers’ food choices, and future use of these labels will depend on the extent to which consumers’ general concern about sustainability...

  8. The radioactive labeling of monocytes

    International Nuclear Information System (INIS)

    With the aim of studying a possible relationship between circulating monocytes and Sternberg-Reed cells investigations were started on the specific labeling of monocytes. In this thesis the literature on the pertinent data has been reviewed and a series of experiments on the monocyte labeling procedure has been described. The principles of cell labeling with radioactive compounds were discussed. 1. Total separation of the particular cell population to be labeled and subsequent labeling with a non-specific radiopharmaceutical. 2. Specific cell labeling in a mixture of cell types based on a well defined affinity of the cell under study for the radiopharmaceutical used. Next the radionuclides that can be used for cell labeling purposes were discussed with special attention for 111In and its chelates. The principles of radiodosimetry were also discussed shortly. This section was focussed on the radiation dose the labeled cells receive because of the intracellular localized radioactivity. The radiation burden is high in comparison to amounts of radiation known to affect cell viability. A newly developed method for labeling monocytes specifically by phagocytosis of 111In-Fe-colloid without apparent loss of cells was described in detail. (Auth.)

  9. A computer-based system for environmental impact assessment (EIA) applications to energy power stations in Turkey: CEDINFO

    Energy Technology Data Exchange (ETDEWEB)

    Say, Nuriye Peker; Yuecel, Muzaffer [Cukurova University, Adana (Turkey). Department of Landscape Architecture; Yilmazer, Mehmet [Bogazici University, Kandilli, Istanbul (Turkey). Kandilli Observatory and Earthquake Research Institute

    2007-12-15

    Environmental impact assessment (EIA) is a tool for decision makers to take into account the possible effects of a proposed project on the environment and is also a process for collecting the data related to a project design and project area. Different techniques are used for the EIA process. In recent years, including the design and development of databases, classification systems, computer models and expert systems have been used extensively in impact assessment studies. Knowledge-based systems referred to as expert systems and different computer-based systems are an emerging technology in information processing and are becoming increasingly useful tools in different applications areas including EIA studies. Their use for EIA has been quite limited in developing countries, because of the constraints on resources, particularly in expertise and data. In this study, a knowledge-based software - CEDINFO - developed by authors was introduced. CEDINFO to be used for EIA practices on energy-generating stations was designed based on the legal EIA process in Turkey. According to the EIA Regulation enacted in Turkey in 1993, energy-generating stations (thermal power station, hydraulic station, nuclear station) in different categories require mandatory EIA reports duly approved by The Ministry of Environment and Forestry before their construction. CEDINFO primarily aims to provide educational support for EIA practices and decision-makers on energy-generating stations. (author)

  10. A computer-based system for environmental impact assessment (EIA) applications to energy power stations in Turkey: CEDINFO

    Energy Technology Data Exchange (ETDEWEB)

    Nuriye Peker Say; Muzaffer Yucel; Mehmet Yilmazer [Cukurova University, Adana (Turkey). Department of Landscape Architecture

    2007-12-15

    Environmental impact assessment (EIA) is a tool to enable decision makers to account for the possible effects of a proposed project on the environment and is also a process for collecting the data related to a project design and project area. Different techniques are used for the EIA process. In recent years, including the design and development of databases, classification systems, computer models and expert systems have been used extensively in impact assessment studies. Knowledge-based systems referred to as expert systems and different computer-based systems are an emerging technology in information processing and are becoming increasingly useful tools in different applications areas including EIA studies. Their use for EIA has been quite limited in developing countries, because of the constraints on resources, particularly in expertise and data. In this study, a knowledge-based software CEDINFO developed by authors was introduced. CEDINFO to be used for EIA practices on energy-generating stations was designed based on the legal EIA process in Turkey. According to the EIA Regulation enacted in Turkey in 1993, energy-generating stations (thermal power stations, hydroelectric power stations, nuclear power stations) in different categories require mandatory EIA reports duly approved by The Ministry of Environment and Forestry before their construction. CEDINFO primarily aims to provide educational support for EIA practices and decision-makers on energy-generating stations. 23 refs., 5 figs., 2 tabs.

  11. p-carboxyethyl-phenylglyoxal bis(n-methylthiosemicarbazone) (CE-DTS), a bifunctional chelating agent for Tc-99m labeled monoclonal antibody

    Energy Technology Data Exchange (ETDEWEB)

    Arano, Y.; Yokoyama, A.; Furukawa, T.; Saji, H.; Endo, K.; Torizaka, K.

    1985-05-01

    In the search for bifunctional chelating agents (BCA) with better affinity, selectivity and stability as for Tc-99m, synthesis of a novel BCA containing di-thio-semicarbazone as for Tc-99m chelating site has offered interesting characteristics for the labeling of macromolecules. In the present paper, monoclonal IgG (MoAb) against human thyroglobulin was selected as a model and conditions for coupling, labeling reactions were tested along with immunological reactivity. CE-DTS was coupled to MoAb by the azido method and effect of conjugation on the MoAb immunoreactivity was followed by RIA. When CE-DTS was coupled to MoAb at the molar ratio of 1:1, no loss of its original immunoreactivity was observed. Tc-99m labeling, using the stannous ion reducing method, indicated the reaction pH as being a determinant parameter. The reducing agent prepared in tartrate buffer (pH 3) offered high yield and stable Tc-99m-CE-DTS-MoAb, as evidence by HPLC. In vivo studies in mice indicated percent of injected dose and blood clearance alike the I-131-MoAb. This good labeled state of Tc-99m-CE-DTS-MoAb was also demonstrated by using second antibody reaction in serum of mice. The newly synthesized CE-DTS offered good basis for the Tc-99m labeling of monclonal antibodies with preserved immunological properties, as desirable for the radioimmunodetection. Work with tumor related monoclonal antibodies is under progress.

  12. Laser labeling, a safe technology to label produce

    Science.gov (United States)

    Laser labeling of fruits and vegetables is an alternative means to label produce. Low energy CO2 laser beams etch the surface showing the contrasting underlying layer. These etched surfaces can promote water loss and potentially allow for entry of decay organisms. The long-term effects of laser labe...

  13. 76 FR 75809 - Prior Label Approval System: Generic Label Approval

    Science.gov (United States)

    2011-12-05

    ... the type of packaging material on which the label is printed; n. Brand name changes, provided that... poultry products will take effect January 1, 2012 (75 FR 82148, Dec. 29, 2010). These mandatory features..., location, and indication of final color. To obtain sketch label approval, domestic meat and...

  14. Biodistribution of anti-CEA F(ab')[sub 2] fragments conjugated with chelating polymers: influence of conjugate electron charge on tumor uptake and blood clearance

    Energy Technology Data Exchange (ETDEWEB)

    Slinkin, M.A.; Curtet, C.; Faivre-Chauvet, A.; Sai-Maurel, C.; Gestin, J.F.; Chatal, J.F. (INSERM U.211, Nantes (France)); Torchilin, V.P. (Massachusetts General Hospital, Boston, MA (United States))

    1993-05-01

    F(ab')[sub 2] fragments of anti-carcinoembryonic antigen (CEA) monoclonal antibody (mAb) were modified with three chain-terminal polysine-based chelating polymers so as to carry different electron charges. Immunoreactive conjugates labeled with [sup 111]In up to a specific radioactivity of 120-140 [mu]Ci/[mu]g were injected into nude mice bearing humans colorectal carcinoma, and the biodistribution patterns were compared with each other and with that of an anti-CEA F(ab')[sub 2]-DTPA control. Immunoconjugate modified with positively-charged polymer produced the highest tumor uptake [up to 20% injected dose per gram (ID/g)], with very significant non-specific radioactivity in normal organs (particularly kidneys). When modified with a polymer carrying only a slight negative charge, the immunoconjugate also produced fairly high tumor uptake (up to 18% ID/g), with much lower non-specific radioactivity in normal organs. Highly negatively-charged conjugate produced the lowest tumor uptake (up to 8% ID/g), whereas blood and whole-body clearances were the fastest but slower than those of conventionally labeled F(ab')[sub 2] mAb. The possible mechanisms for the effects described are discussed. (author).

  15. Addendum to report of the research co-ordination meeting on labelling techniques of biomolecules for targeted radiotherapy. Country report: Hungary. Preparation, quality control and animal testing of 125I and 131I labelled monoclonal antibody for radiotherapy

    International Nuclear Information System (INIS)

    Radiolabelled monoclonal antibodies (MoAbs) against tumour-associated antigens have been used to detect tumour deposits. Since gamma camera imaging of patients injected with radiolabelled MoAbs has demonstrated, selective tumour uptake of MoAbs, antibody-directed radiotherapy has gained greater interest. Prior to employing antibodies for radioimmunotherapy, their tumour and normal tissue uptake and pharmacokinetics as well as therapeutic efficacy in the animal tumour model must be determined. The therapeutic radiopharmaceuticals consist of two components the radionuclide (beta, alpha, Anger and conversion electron emitters) and the biological carrier (from peptide- to antibody). In the first step of our research program anti CEA MoAb inj. labelled with iodine-125 and 131I isotopes were used to study therapeutic efficacy in nude mice bearing human gastric adenocarcinoma xenografts

  16. Oxygen labelled CO2

    International Nuclear Information System (INIS)

    Tests were carried out as to whether additional information concerning pulmonary gas exchange could be obtained from the application of oxygen labelled carbon dioxide. Single breath experiments were performed on two healthy subjects with 0.1 percent C16O18O and 2.8 percent C18O2 in the inspiratory gas. Breath-hold time was varied between 0.5-20s in different experiments. The 18O-concentration of the end-expired gas bi-exponentially decreased with increasing breath-hold time. The high and low rate constants 4s-1 and 0.12s-1 for C18O2 and 2.5s-1 and 0.87s-1 for C16O18O were derived, respectively. These results, together with model calculations, suggest: 1) the rapid disappearance of C18O2 from the alveolar space is primarily limited by diffusion, so that this isotopic species can be applied to quantify pulmonary diffusing conditions; 2) the lower disappearance rate of C16O18O is caused by a lower equilibration kinetics in blood, so that this isotopic species offers a possibility to study carbonic anhydrase activity of the red cells in vivo; 3) the slow phase of label decay is influenced by both alveolar dead space and carbonic anhydrase activity of the pulmonary tissues. Pathological dead spaces are expected to be sensitively detectable by C16O18O as well as by C18O2. (author). 4 refs.; 4 figs

  17. Preparation and preclinical evaluation of 211At-labelled compounds for α-particle radiotherapy

    International Nuclear Information System (INIS)

    The present work demonstrate that significant therapeutic gain can be achieved with 211At-labelled MoAbs on single tumour cells and microscopic disease. Β-emitters are less effective on microscopic disease because of radiation dispersion, while longer halflives (e.g., 90Y and 131I) allow favourable therapeutic ratios to be reached in larger tumors. 211At-labelled MoAbs may therefore possibly be used in combination with β-emitting RIC in systemically delivered radioimunnotherapy. Larger tumor nodules are then irradiated effectively due to cross-fire of the longer ranged β-particles while the fraction of tumour cells distributed as single cells and micrometastases may be more effectively radiated with 211At-RIC. 76 refs

  18. Nutrition Marketing on Food Labels

    Science.gov (United States)

    Colby, Sarah E.; Johnson, LuAnn; Scheett, Angela; Hoverson, Bonita

    2010-01-01

    Objective: This research sought to determine how often nutrition marketing is used on labels of foods that are high in saturated fat, sodium, and/or sugar. Design and Setting: All items packaged with food labels (N = 56,900) in all 6 grocery stores in Grand Forks, ND were surveyed. Main Outcome Measure(s): Marketing strategy, nutrient label…

  19. Meat and Poultry Labeling Terms

    Science.gov (United States)

    ... Food Standards and Labels: The Facts Labeling and Marketing Information [ Top of Page ] OVEN PREPARED: Product is fully cooked and ready to eat. [ Top of Page ] YOUNG TURKEY: Turkeys of either sex that are less than 8 months of age according to present regulations. [ Top of Page ] Last ...

  20. Dead cells in melanoma tumors provide abundant antigen for targeted delivery of ionizing radiation by a mAb to melanin

    OpenAIRE

    Dadachova, Ekaterina; Nosanchuk, Joshua D.; Shi, Li; Schweitzer, Andrew D.; Frenkel, Annie; Nosanchuk, Jerome S.; Casadevall, Arturo

    2004-01-01

    Melanoma is a cancer with a rising incidence, and metastatic disease is almost always lethal. We investigated the feasibility of targeting melanin, an intracellular melanocyte pigment, to deliver cytotoxic radiation to human melanoma cells in vivo by using a melanin-binding mAb (6D2). Nude mice bearing MNT1 pigmented human melanoma tumors were treated with mAb 6D2 labeled with 1.5 mCi (1 Ci = 37 GBq) of the β-emitter 188-Rhenium (188Re) and manifested inhibition of tumor growth and prolonged ...

  1. Tumor immunolocalization using {sup 124}I-iodine-labeled JAA-F11 antibody to Thomsen-Friedenreich alpha-linked antigen

    Energy Technology Data Exchange (ETDEWEB)

    Chaturvedi, Richa [Department of Biotechnical and Clinical Laboratory Sciences, University at Buffalo, StateUniversity of New York, Buffalo, NY 14214 (United States); Heimburg, Jamie [Department of Microbiology and Immunology, University at Buffalo, StateUniversity of New York, Buffalo, NY 14214 (United States); Yan, Jun; Koury, Stephen [Department of Biotechnical and Clinical Laboratory Sciences, University at Buffalo, StateUniversity of New York, Buffalo, NY 14214 (United States); Sajjad, Munawwar; Abdel-Nabi, Hani H. [Department of Nuclear Medicine, University at Buffalo, StateUniversity of New York, Buffalo, NY 14214 (United States); Rittenhouse-Olson, Kate [Department of Biotechnical and Clinical Laboratory Sciences, University at Buffalo, StateUniversity of New York, Buffalo, NY 14214 (United States); Department of Microbiology and Immunology, University at Buffalo, StateUniversity of New York, Buffalo, NY 14214 (United States)], E-mail: krolson@buffalo.edu

    2008-03-15

    Clinical immunolocalization has been attempted by others with an anti-Thomsen-Friedenreich antigen (TF-Ag) mAb that bound both alpha- and beta-linked TF-Ag. In this report, {sup 124}I-labeled mAb JAA-F11 specific for alpha-linked TF-Ag showed higher tumor specificity in in vivo micro-positron emission tomography (micro-PET) of the mouse mammary adenocarcinoma line, 4T1, showing no preferential uptake by the kidney. Labeled product remained localized in the tumor for at least 20 days. Glycan array analysis showed structural specificity of the antibody.

  2. 21 CFR 610.60 - Container label.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Container label. 610.60 Section 610.60 Food and... GENERAL BIOLOGICAL PRODUCTS STANDARDS Labeling Standards § 610.60 Container label. (a) Full label. The following items shall appear on the label affixed to each container of a product capable of bearing a...

  3. Comparative studies of antibody anti-CD20 labeled with 188Re

    International Nuclear Information System (INIS)

    Nuclear Medicine is an unique and important modality in oncology and the development of new tumor-targeted radiopharmaceuticals for both diagnosis and therapy is an area of interest for researchers. Rituximab (RTX) is a quimeric monoclonal antibody (mAb) (IgG 1) that specifically binds to CD20 antigen with high affinity and has been successfully used for the treatment of Non-Hodgkin Lymphoma (NHL) of cell B. The CD20 antigen is expressed over more than 90% of cell B NHL. Technetium-99m (99mTc) and rhenium-188 (188Re) are an attractive radionuclide pair for clinical use due to their favorable decay properties for diagnosis (99mTc: T1/2 = 6 h, γ radiation = 140 keV) and therapy (188Re: T1/2 = 17 h, maximum β energy = 2.12 MeV) and to their availability in the form of 99Mo/99mTc and 188W/188Re generators. The radionuclides can be conjugated to mAb using similar chemical procedures. The aim of this work was to study the labeling of anti-CD20 mAb (RTX) with 188Re using two techniques: the direct labeling method [188Re(V)] and the labeling method via the carbonyl nucleus [188Re(I)]. Besides the quality control, the radiolabeled mAb was submitted to in vivo, in vitro and ex vivo biological studies. For the direct labeling, RTX was reducing by incubation with 2-mercaptoethanol for generating sulphydryl groups (-SH) and further labeled with 188Re(V), in a study of several parameters in order to reach an optimized formulation. The labeling via the carbonyl nucleus both 99mTc and 188Re were employed through 2 different procedures: (1) labeling of intact RTX with 99mTc(I) and (2) reduced RTX (RTXred) labeled with 99mTc(I)/188Re(I). Also a parameter study was performed to obtain an optimized formulation. The quality control method for evaluating the radiochemical purity showed a good labeling yield (93%) for the direct method. The labeling method via carbonyl group, the results showed that the - SH groups of RTXred are a possible way of labeling. The formulation of 99m

  4. Reform of the EIA process in Indonesia: improving the role of public involvement

    International Nuclear Information System (INIS)

    The implementation of Environmental Impact Assessment (EIA) as a planning tool has been utilised for a relatively long time in Indonesia. It was introduced formally through the Act No. 4/1982. Supporting regulation was established in 1986 when Government Regulation No. 29 was enacted. After developing the EIA system for 14 years, Indonesia finally recognized the importance of emphasizing public involvement in the EIA guidelines of 2000. EIA in the previous Indonesian regulations, i.e. Regulation No. 29/1986 and No. 51/1993, did not have provisions for direct public involvement. The Indonesian Government Regulation No. 27/1999 is currently accommodating the above issue. Guidelines for public announcement and public involvement have been introduced in a decree issued by the Head of Indonesia's Environmental Impact Management Agency No. KepDal 08/2000. This was officially enacted on 7 November 2000 in response to the demand for more public involvement, an issue that was ambiguous in the previous legislation. This paper discusses: the implementation of the new guidelines; what has been achieved; and the challenges during implementation. While the paper focuses its review on the Indonesian EIA system, Indonesia's experience is relevant to many other developing countries that are starting to adopt public involvement in their decision-making processes

  5. 汽车ABS/ASR/ACC集成化系统%Integrated ABS/ASR/ACC System for the Car

    Institute of Scientific and Technical Information of China (English)

    刘昭度; 卢江; 时开斌; 安巍

    2001-01-01

    叙述了ACC系统和ABS/ASR系统在改善汽车高速行驶主动安全性方面的功用,阐述了ACC系统是ABS/ASR系统功能的延伸、逻辑的发展及它们之间的内在联系,指出了在ABS/ASR的基础上只需增加测距装置和添加巡航控制子程序,就可方便地实现ABS/ASR/ACC集成化系统,并给出了集成化系统的控制框图和控制方法,论述了ABS/ASR/ACC集成化系统比孤立的ABS/ASR和ACC系统的优越性.%The individual functions of ACC and ABS/ASR are described in the improvements of active safety while the road vehicles travel at a high speed. Being a logic extension of and many inherent connections with ABS/BSR, ACC is easily integrated with ABS/ASR to form an integrated system by adding the headway distance*$-detecting device to the existing ABS/ASR system and expanding the ABS/ASR software. The algorithm flowcharts and control methods of the ABS/ASR/ACC are given. The advantages of the ABS/ASR/ACC system compared with those using the stand alone systems ABS, ASR and ACC are mentioned in details.

  6. Ab Initio Molecular Dynamics: A Virtual Laboratory

    OpenAIRE

    Hobbi Mobarhan, Milad

    2014-01-01

    In this thesis, we perform ab initio molecular dynamics (MD) simulations at the Hartree-Fock level, where the forces are computed on-the-fly using the Born-Oppenheimer approximation. The theory behind the Hartree-Fock method is discussed in detail and an implementation of this method based on Gaussian basis functions is explained. We also demonstrate how to calculate the analytic energy derivatives needed for obtaining the forces acting on the nuclei. Hartree-Fock calculations on the ground s...

  7. Asiakassuhdehallinnan kehityssuunnitelma : Case: Oy Combi Cool Ab

    OpenAIRE

    Puikkonen, Touko

    2011-01-01

    Tässä insinöörityössä tutustuttiin Oy Combi Cool Ab:n asiakassuhdehallintaan ja siinä havaittuihin puutteisiin ja kehitystarpeisiin. Työn tarkoituksena oli luoda yritykselle ajan tasalla oleva asiakasrekisteri ja sen pohjalta kehittää asiakassuhdehallintaa etenkin myynnin, oston ja johdon henkilöstön tarpeita ajatellen muovaamalla siitä henkilöstön myynti- ja asiakaspalvelutyöskentelyä tehostava toimiva kokonaisuus. Combi Cool on vuonna 1985 perustettu kylmäalan tukkuliike, joka on vajaan 30 ...

  8. Ab Initio Study on Hypothetical Silver Nitride

    Institute of Scientific and Technical Information of China (English)

    DELIGOZ Engin; COLAKOGLU Kemal; CIFTCI Yasemin Oztekin

    2008-01-01

    We perform the ab initio calculations based on norm-conserving pseudopotentials and density functional theory to investigate the structural, elastic, and thermodynamical properties for silver nitride (AgN) compound that is a member of the 4d transition metal group and has not been synthesized yet. The obtained results are compared with the other available theoretical data, and the agreement is, generally, quite good. We also present the pressure-dependent behaviour of some mechanical and thermodynamical properties for the same compounds.

  9. Testing Distributed ABS System with Fault Injection

    Science.gov (United States)

    Trawczyński, Dawid; Sosnowski, Janusz; Gawkowski, Piotr

    The paper deals with the problem of adapting software implemented fault injection technique (SWIFI) to evaluate dependability of reactive microcontroller systems. We present an original methodology of disturbing controller operation and analyzing fault effects taking into account reactions of the controlled object and the impact of the system environment. Faults can be injected randomly (in space and time) or targeted at the most sensitive elements of the controller to check it at high stresses. This approach allows identifying rarely encountered problems, usually missed in classical approaches. The developed methodology has been used successfully to verify dependability of ABS system. Experimental results are commented in the paper.

  10. Labeled Cocaine Analogs

    Science.gov (United States)

    Goodman, Mark M.; Shi, Bing Zhi; Keil, Robert N.

    1999-01-26

    Novel compounds having the structure: ##STR1## where X in .beta. configuration is phenyl, naphthyl; 2,3 or 4-iodophenyl; 2,3 or 4-(trimethylsilyl)phenyl; 3,4,5 or 6-iodonaphthyl; 3,4,5 or 6-(trimethylsilyl)naphthyl; 2,3 or 4-(trialkylstannyl)phenyl; or 3,4,5 or 6-(trialkylstannyl)naphthyl Y in .beta. configuration is Y.sub.1 or Y.sub.2, where Y.sub.1 is 2-fluoroethoxy, 3-fluoropropoxy, 4-fluorobutoxy, 2-fluorocyclopropoxy, 2 or 3-fluorocyclobutoxy, R,S 1'-fluoroisopropoxy, R 1'-fluoroisopropoxy, S 1'-fluoroisopropoxy, 1',3'-difluoroisopropoxy, R,S 1'-fluoroisobutoxy, R 1'-fluoroisobutoxy, S 1'-fluoroisobutoxy, R,S 4'-fluoroisobutoxy, R 4'-fluoroisobutoxy, S 4'-fluoroisobutoxy, or 1',1'-di(fluoromethyl)isobutoxy, and Y.sub.2 is 2-methanesulfonyloxy ethoxy, 3-methanesulfonyloxy propoxy, 4-methanesulfonyloxy butoxy, 2-methanesulfonyloxy cyclopropoxy, 2 or 3-methanesulfonyloxy cyclobutoxy, 1'methanesulfonyloxy isopropoxy, 1'-fluoro, 3'-methanesulfonyloxy isopropoxy, 1'-methanesulfonyloxy, 3'-fluoro isopropoxy, 1'-methanesulfonyloxy isobutoxy, or 4'-methanesulfonyloxy isobutoxy bind dopamine transporter protein and can be labeled with .sup.18 F or .sup.123 I for imaging.

  11. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... Under Control Figuring Out Food Labels Healthy Food Shopping If My Child Has Food Allergies, What Should ... for Parents Figuring Out Food Labels Smart Supermarket Shopping Figuring Out Fat and Calories Food Labels Contact ...

  12. Divergent practice in a converging system? The case of EIA in France and the UK

    International Nuclear Information System (INIS)

    This paper seeks to clarify the harmonisation objective of the European Union (EU) Environmental Impact Assessment (EIA) Directives and to highlight some of the implicit tensions and differing interpretations. It first provides an overview of Member States' (MSs) practice in EIA, in the context of the harmonisation objective, before focusing on the particular cases of the UK and France. The latter include studies of the legal context and practice of EIA. There are significant variations in legal harmonisation and in the 'spirit' of legislation and guidance, nor does the existence of common legal requirements necessarily equate with 'harmonised practice'. There are considerable variations in UK and French practice, reflecting a number of underlying factors--including attitude to the environment, institutional factors and the nature and perceptions of practitioners. Yet, while practice may be divergent, it may not be diverging, and recent actions such as the amended Directive are designed to encourage more convergence

  13. Environmental agreements, EIA follow-up and aboriginal participation in environmental management: The Canadian experience

    International Nuclear Information System (INIS)

    During the last decade a number of environmental agreements (EAs) have been negotiated in Canada involving industry, government and Aboriginal peoples. This article draws on the Canadian experience to consider the potential of such negotiated agreements to address two issues widely recognised in academic and policy debates on environmental impact assessment (EIA) and environmental management. The first relates to the need to secure indigenous participation in environmental management of major projects that affect indigenous peoples. The second and broader issue involves the necessity for specific initiatives to ensure effective follow-up of EIA. The Canadian experience indicates that negotiated environmental agreements have considerable potential to address both issues. However, if this potential is to be realized, greater effort must be made to develop structures and processes specifically designed to encourage Aboriginal participation; and EAs must themselves provide the financial and other resource required to support EIA follow-up and Aboriginal participation

  14. Quantum phases of AB 2 fermionic chains

    Science.gov (United States)

    Murcia-Correa, L. S.; Franco, R.; Silva-Valencia, J.

    2016-02-01

    A fermionic chain is a one-dimensional system with fermions that interact locally and can jump between sites in the lattice, in particular an AB n chain type, where A and B are sites that exhibit a difference in energy level of Δ and site B is repeated n-times, such that the unit cell has n +1 sites. A limit case of this model, called the ionic Hubbard model (n = 1), has been widely studied due to its interesting physics and applications. In this paper, we study the ground state of an AB 2 chain, which describes the material R 4[Pt 2(P 2O5H2)4X] · nH 2 O. Specifically, we consider a filling with two electrons per unit cell, and using the density matrix renormalization group method we found that the system exhibits the band insulator and Mott correlated insulator phases, as well as an intermediate phase between them. For couplings of Δ = 2,10 and 20, we estimate the critical points that separate these phases through the structure factor and the energy gap in the sector of charge and spin, finding that the position of the critical point rises as a function of Δ.

  15. New labels for radiation therapy

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Susumu; Mukai, Minoru; Kato, Hirotoshi (National Inst. of Radiological Sciences, Chiba (Japan))

    1992-12-01

    In simulating radiotherapy, the bone and trachea identified by plain X-P and the other organs, such as the esophagus and bladder, outlined by contrast medium have so far been used as labels. However, irradiation with a high therapeutic ratio is required for an intracorporeal insertion of artificial labels that are identified by X-ray fluoroscopy. For this purpose, metal clips and seed dummies are available, although they cause artifacts in CT scans. Therefore, the authors are using an acupuncture needle and lipiodol for tracing as new artificial labels, since both are identified by X-ray fluoroscopy and CT scan and create few artifacts. (J.P.N.).

  16. Biosorption of Acid Blue 290 (AB 290) and Acid Blue 324 (AB 324) dyes on Spirogyra rhizopus

    International Nuclear Information System (INIS)

    In this study, the biosorption of Acid Blue 290 and Acid Blue 324 on Spirogyra rhizopus, a green algae growing on fresh water, was studied with respect to initial pH, temperature, initial dye concentration and biosorbent concentration. The optimum initial pH and temperature values for AB 290 and AB 324 biosorption were found to be 2.0, 30 deg. C and 3.0, 25 deg. C, respectively. It was observed that the adsorbed AB 290 and AB 324 amounts increased with increasing the initial dye concentration up to 1500 and 750 mg/L, respectively. The Langmuir, Freundlich, Redlich-Peterson and Koble-Corrigan isotherm models were applied to the experimental equilibrium data and the isotherm constants were determined by using Polymath 4.1 software. The monolayer coverage capacities of S. rhizopus for AB 290 and AB 324 dyes were found as 1356.6 mg/g and 367.0 mg/g, respectively. The intraparticle diffusion model and the pseudo-second order kinetic model were applied to the experimental data in order to describe the removal mechanism of these acidic dyes by S. rhizopus. The pseudo-second order kinetic model described very well the biosorption kinetics of AB 290 and AB 324 dyes. Thermodynamic studies showed that the biosorption of AB 290 and AB 324 on S. rhizopus was exothermic in nature

  17. Workshop on automated beam steering and shaping (ABS). Proceedings

    International Nuclear Information System (INIS)

    A workshop on Automated Beam Steering and Shaping (ABS) was held at CERN in December 1998. This was the first workshop dedicated to this subject. The workshop had two major goals: to review the present status of ABS algorithms and systems around the world and to create a worldwide ABS community. These proceedings contain summary reports from all sessions, contributions from several presentations held at the workshop, and a complete set of abstracts for all presentations. (orig.)

  18. Homosexual Labeling by University Youths

    Science.gov (United States)

    Nyberg, Kenneth L.; Alston, Jon P.

    1977-01-01

    Details the responses of young, urban, college-educated people on their attitudes toward homosexuals, specifically focusing on issues of public identification and negative labeling as it effects homosexual persons and their behaviors. (Author/RK)

  19. Quality control of labelled compounds

    International Nuclear Information System (INIS)

    Some advantages and disadvantages of methods used for quality control of organic labelled compounds (131I, 14C) are shortly discussed. The methods used are electrophoresis, ultraviolet and infrared spectrometry, radiogas and thin-layer chromatography. (author)

  20. Environmental impact assessment (EIA) in development cooperation. A presentation of development challenges and research issues in developing countries and donor agencies

    Energy Technology Data Exchange (ETDEWEB)

    Kristoffersen, Harald

    1997-12-31

    This document discusses some development challenges and research needs related to environmental impact assessment (EIA) in development cooperation. After a general introduction to basic principles of EIA, the document deals with some general conditions for EIA in developing countries and in donor agencies. Through a presentation of experiences with EIA from selected donor agencies (with emphasis on NORAD) the report ends up with focusing on some research issues that may come up with recommendations for improving EIA practices in developing countries and donor agencies. 37 refs., 6 figs., 3 refs.

  1. Singularities of Type-Q ABS Equations

    Directory of Open Access Journals (Sweden)

    James Atkinson

    2011-07-01

    Full Text Available The type-Q equations lie on the top level of the hierarchy introduced by Adler, Bobenko and Suris (ABS in their classification of discrete counterparts of KdV-type integrable partial differential equations. We ask what singularities are possible in the solutions of these equations, and examine the relationship between the singularities and the principal integrability feature of multidimensional consistency. These questions are considered in the global setting and therefore extend previous considerations of singularities which have been local. What emerges are some simple geometric criteria that determine the allowed singularities, and the interesting discovery that generically the presence of singularities leads to a breakdown in the global consistency of such systems despite their local consistency property. This failure to be globally consistent is quantified by introducing a natural notion of monodromy for isolated singularities.

  2. Ab initio alpha-alpha scattering

    CERN Document Server

    Elhatisari, Serdar; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-01-01

    Processes involving alpha particles and alpha-like nuclei comprise a major part of stellar nucleosynthesis and hypothesized mechanisms for thermonuclear supernovae. In an effort towards understanding alpha processes from first principles, we describe in this letter the first ab initio calculation of alpha-alpha scattering. We use lattice effective field theory to describe the low-energy interactions of nucleons and apply a technique called the adiabatic projection method to reduce the eight-body system to an effective two-cluster system. We find good agreement between lattice results and experimental phase shifts for S-wave and D-wave scattering. The computational scaling with particle number suggests that alpha processes involving heavier nuclei are also within reach in the near future.

  3. Ab initio molar volumes and Gaussian radii.

    Science.gov (United States)

    Parsons, Drew F; Ninham, Barry W

    2009-02-12

    Ab initio molar volumes are calculated and used to derive radii for ions and neutral molecules using a spatially diffuse model of the electron distribution with Gaussian spread. The Gaussian radii obtained can be used for computation of nonelectrostatic ion-ion dispersion forces that underlie Hofmeister specific ion effects. Equivalent hard-sphere radii are also derived, and these are in reasonable agreement with crystalline ionic radii. The Born electrostatic self-energy is derived for a Gaussian model of the electronic charge distribution. It is shown that the ionic volumes used in electrostatic calculations of strongly hydrated cosmotropic ions ought best to include the first hydration shell. Ionic volumes for weakly hydrated chaotropic metal cations should exclude electron overlap (in electrostatic calculations). Spherical radii are calculated as well as nonisotropic ellipsoidal radii for nonspherical ions, via their nonisotropic static polarizability tensors. PMID:19140766

  4. Ab Initio Path to Heavy Nuclei

    CERN Document Server

    Binder, Sven; Calci, Angelo; Roth, Robert

    2014-01-01

    We present the first ab initio calculations of nuclear ground states up into the domain of heavy nuclei, spanning the range from 16-O to 132-Sn based on two- plus three-nucleon interactions derived within chiral effective field theory. We employ the similarity renormalization group for preparing the Hamiltonian and use coupled-cluster theory to solve the many-body problem for nuclei with closed sub-shells. Through an analysis of theoretical uncertainties resulting from various truncations in this framework, we identify and eliminate the technical hurdles that previously inhibited the step beyond medium-mass nuclei, allowing for reliable validations of nuclear Hamiltonians in the heavy regime. Following this path we show that chiral Hamiltonians qualitatively reproduce the systematics of nuclear ground-state energies up to the neutron-rich Sn isotopes.

  5. Ab initio alpha-alpha scattering

    Science.gov (United States)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.

    2015-12-01

    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  6. Ablation dynamics in laser sclerotomy ab externo

    Science.gov (United States)

    Brinkmann, Ralf; Droege, Gerit; Mohrenstecher, Dirk; Scheu, M.; Birngruber, Reginald

    1996-01-01

    Laser sclerostomy ab externo with flashlamp excited mid-IR laser systems emitting in the 2-3 micrometer spectral range is in phase II clinical trials. Although acutely high success rates were achieved, the restenosis rate after several months is about 40%. Laser pulses of several hundreds of microseconds, known to induce thermo-mechanical explosive evaporation were used for this procedure. We investigated the ablation dynamics in tissue and the cavitation bubble dynamics in water by means of an Er:YAG laser system to estimate the extent of mechanical damage zones in the sclera and in the anterior chamber, which may contribute to the clinical failure. We found substantial mechanical tissue deformation during the ablation process caused by the cavitation effects. Stress waves up to several bar generated by explosive evaporization were measured. The fast mechanical stretching and collapsing of the scleral tissue induced by cavitation resulted in tissue dissection as could be proved by flash photography and histology. The observed high restenosis might be a result of a subsequent enhanced wound healing process. Early fistula occlusions due to iris adherences, observed in about 20% of the clinical cases may be attributed to intraocular trauma induced by vapor bubble expansion through the anterior chamber after scleral perforation. An automatic feedback system minimizing adverse effects by steering and terminating the laser process during scleral fistulization is demonstrated. Moreover, a new approach in laser sclerostomy ab externo is presented using a cw-IR laser diode system emitting at the 1.94 micrometer mid-IR water absorption peak. This system was used in vitro and showed smaller damage zones compared to the pulsed laser radiation.

  7. Ab initio alpha-alpha scattering.

    Science.gov (United States)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  8. Dicty_cDB: FCL-AB06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AB06 (Link to dictyBase) - - - Contig-U15603-1 FCL-AB06P ...(Link to Original site) FCL-AB06F 694 FCL-AB06Z 573 FCL-AB06P 1267 - - Show FCL-AB06 Library FCL (Link to library) Clone ID FCL-...3-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB06Q....Seq.d/ Representative seq. ID FCL-AB06P (Link to Original site) Representative DNA sequence >FCL-AB06 (FCL-AB06Q) /CSM/FCL/FCL-...AB/FCL-AB06Q.Seq.d/ CAATTTTATCGGAACCATCAATTCATGCAGGTTCTGTATTTAGTATTAATTTAACCAAAT CTAGACA

  9. Kopplung von Dichtefunktional- und ab-initio-Methoden

    OpenAIRE

    Goll, Erich

    2008-01-01

    Im Rahmen der Doktorarbeit wurde untersucht, inwieweit die Kopplung von Dichtefunktionalmethoden und ab-initio-Korrelationsmethoden der Quantenchemie eine Verbesserung bezüglich beider Grenzmethoden erbringt. Die Kopplung erfolgt durch eine Aufspaltung des interelektronischen Hamiltonoperators (abstoßende Coulombwechselwirkung). Die kurzreichweitige Wechselwirkung wird mit Dichtefunktionaltheorie behandelt, die langreichweitige mit Hilfe von ab-initio-Methoden. Diese Aufteilung soll dazu dien...

  10. A Case of Laptop Computer-Induced Erythema Ab Igne

    Directory of Open Access Journals (Sweden)

    Nurettin Özgür Doğan

    2014-12-01

    Full Text Available Erythema ab igne, also known as toasted skin syndrome, is a skin reaction characterized by reticulate erythema, brown pigmentation, and telangiectasia. In some cases, epidermal atrophy and scaling are also identified. The condition is usually caused by prolonged exposure to a source of heat or infrared radiation. Here, we report a case of erythema ab igne associated with laptop computer use.

  11. ABS, MBS and CDO compared : An empirical analysis

    NARCIS (Netherlands)

    Vink, D.; Thibeault, A.

    2008-01-01

    The capital market in which the asset-backed securities are issued and traded is composed of three main categories: ABS, MBS and CDOs. We were able to examine a total number of 3,951 loans (worth €730.25 billion) of which 1,129 (worth €208.94 billion) have been classified as ABS. MBS issues represen

  12. ABS, MBS and CDO pricing comparisons : An empirical analysis

    NARCIS (Netherlands)

    Vink, D.; Thibeault, A.

    2008-01-01

    The capital market in which asset-backed securities are issued and traded is composed of three main categories: ABS, MBS and CDOs. The authors examined a total of 3,466 loans (worth €548.51 billion) of which 1,102 (worth €163.90 billion) have been classified as ABS. MBS issues represent 1,782 issues

  13. 75 FR 43823 - Safety Zone; He'eia Kea Small Boat Harbor, Kaneohe Bay, Oahu, HI

    Science.gov (United States)

    2010-07-27

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; He'eia Kea Small Boat Harbor, Kaneohe Bay, Oahu, HI AGENCY: Coast Guard, DHS. ACTION: Temporary Final Rule. SUMMARY: The Coast Guard...

  14. Screening for EIA in India: enhancing effectiveness through ecological carrying capacity approach.

    Science.gov (United States)

    Rajaram, T; Das, Ashutosh

    2011-01-01

    Developing countries across the world have embraced the policy of high economic growth as a means to reduce poverty. This economic growth largely based on industrial output is fast degrading the ecosystems, jeopardizing their long term sustainability. Environmental Impact Assessment (EIA) has long been recognized as a tool which can help in protecting the ecosystems and aid sustainable development. The Screening guidelines for EIA reflect the level of commitment the nation displays towards tightening its environmental protection system. The paper analyses the screening process for EIA in India and dissects the rationale behind the exclusions and thresholds set in the screening process. The screening process in India is compared with that of the European Union with the aim of understanding the extent of deviations from a screening approach in the context of better economic development. It is found that the Indian system excludes many activities from the purview of screening itself when compared to the EU. The constraints responsible for these exclusions are discussed and the shortcomings of the current command and control system of environmental management in India are also explained. It is suggested that an ecosystem carrying capacity based management system can provide significant inputs to enhance the effectiveness of EIA process from screening to monitoring.

  15. A brief history of cell labelling

    Energy Technology Data Exchange (ETDEWEB)

    Peters, A.M. [Royal Sussex Country Hospital, Brighton (United Kingdom)

    2005-12-15

    The term cell labelling is usually used in the context of labelled leukocytes for imaging inflammation and labelled platelets for imaging thrombosis. Erythrocyte labelling for in vitro measurements of red cell life span, in vivo measurements of splenic red cell pooling, radionuclide ventriculography and imaging sites of bleeding has developed rather separately and has a different history. Labelled platelets and leukocytes were originally developed for cell kinetic studies. Since the current-day applications of labelled platelets and leukocytes depend on a clear understanding of cell kinetics, these classical studies are important and relevant to the history of cell labelling.

  16. 49 CFR 172.430 - POISON label.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false POISON label. 172.430 Section 172.430... SECURITY PLANS Labeling § 172.430 POISON label. (a) Except for size and color, the POISON label must be as follows: EC02MR91.029 (b) In addition to complying with § 172.407, the background on the POISON label...

  17. A new monoclonal antibody radiopharmaceutical for radioimmunoscintigraphy of breast cancer: direct labeling of antibody and its quality control

    Directory of Open Access Journals (Sweden)

    Mojtaba Salouti

    2006-03-01

    Full Text Available Radioimmunoscintigraphy (RIS has found widespread clinical application in tumor diagnosis. The antibody (Ab PR81 is a new murine anti-MUC1 monoclonal antibody (MAb against human breast carcinoma. In this study a very simple, rapid and efficient method for labeling of this MAb with 99mTc, particularly suitable for development of a ‘kit’is described. The reduction of Ab was performed with 2-mercaptoethanol (2-ME at a molar ratio of 2000:1 (2-ME:MAb and the reduced Ab was labeled with 99mTc via methylene diphosphonate (MDP as a transchelator. The labeling efficiency which was determined by instant thin layer chromatography (ITLC was 94.2%±2.3. Radiocolloides measured by cellulose nitrate electrophoresis were 2.5%±1.7. In vitro stability of the labeled product in human serum which was measured by gel filtration chromatography (FPLC was 70%±5.7 over 24 hr. The integrity of labeled MAb was checked by means of SDS-PAGE and no significant fragmentation was observed. The results of the cell-binding studies showed that both labeled and unlabeled PR81 were able to compete for binding to MCF 7 cells. Biodistribution studies were performed in normal BALB/c mice at 4 and 24 hrs post-injection and no important accumulation was observed in vital organs. These results show that the new radiopharmaceutical may be considered as a promising candidate for imaging of breast cancer.

  18. Fibrinogen labelling with I-131

    Energy Technology Data Exchange (ETDEWEB)

    Seminario, C.; Capillo, T.; Montanez, J. (Instituto Peruano de Energia Nuclear, Lima)

    1983-05-01

    Of the different techniques of labelling liophylized human fibrinogen, the technique of mono-chloride with modified iodine was selected. The labelling of the molecule was performed in alkali media of buffalo glycine in which the solution of stable iodine will react as well as on a later stage will the radioactive isotope. The labelling processes which were undertaken with different activities had an efficiency of over 40%; when purification with resins amberlite was carried through, in none of the cases were the impurities over 5%. Daily controls till the seventh day showed that the average values of radiochemical purity decrease were lower than 1%. The specific activity as well as the concentration of I/sup 131/, the fibrinogen and other characteristics come up to the norms of the pharmacopoeia which are applied.

  19. Denture labeling: A new approach

    Directory of Open Access Journals (Sweden)

    Pardeep K Bansal

    2011-01-01

    Full Text Available The need for denture labeling is important for forensic and social reasons in case patients need to be identified individually. The importance of denture marking has long been acknowledged by the dental profession. Over the years, various denture marking systems have been reported in the literature, but none till date fulfills all the prescribed ADA specifications. A simple, easy, inexpensive procedure for marking accurate identification marks on dentures with a lead foil is described here. The label caring the patient information is incorporated in the acrylic resin during the denture processing.

  20. Configuration spaces with summable labels

    OpenAIRE

    Salvatore, Paolo

    1999-01-01

    Let M be an n-manifold, and let A be a space with a partial sum behaving as an n-fold loop sum. We define the space C(M;A) of configurations in M with summable labels in A via operad theory. Some examples are symmetric products, labelled configuration spaces, and spaces of rational curves. We show that C(I^n,dI^n;A) is an n-fold delooping of C(I^n;A), and for n=1 it is the classifying space by Stasheff. If M is compact, parallelizable, and A is path connected, then C(M;A) is homotopic to the ...

  1. Preparation of grafted ABS and compatibilization of r-PET/ABS blends by the grafted ABS%ABS接枝物的制备及其对r-PET/ABS的增容作用

    Institute of Scientific and Technical Information of China (English)

    陈智军; 王益龙; 郑辰

    2012-01-01

    Two kinds of grafted acrylonitrile-butadiene-styrene copolymer(ABS), i.e. maleic anhydride (MAH) grafted ABS(ABS-g-MAH) and glycidyl methacrylate (GMA) grafted ABS (ABS-g-GMA), were prepared via reactive extrusion and were used as compatibilizer for recycled polyethylene glycol terephthalate (r-PET)/ABS blends. The results show that ABS-g-MAH and ABS-g-GMA can greatly improve the impact strength of the blends. ABS-g-MAH is superior to ABS-g-GMA in compatibilization effect. The optimal compatibilization effect is acquired when the grafting ratio of ABS-g-MAH is 1.35% and the mass content of the copolymer is 5%. Under such conditions, the notched and unnotched *Charpy impact strength of the r-PET/ABS/ABS-g--MAH blends rise by 42% and 23%, respectively, in comparison with those of r-PET/ ABS. The observation by scanning electron microscope(SEM) shows that adding grafted ABS can make ABS be dispersed more homogeneously in the r-PET continuous phase and make particle size more even.%通过反应挤出法制备马来酸酐(MAH)接枝丙烯腈-丁二烯-苯乙烯三元共聚物(ABS)(ABS-g-MAH)和甲基丙烯酸缩水甘油酯(GMA)接枝ABS(ABS-g-GMA),将其用于增容回收聚对苯二甲酸乙二酯(PET)瓶片(r-PET)/ABS共混物,发现能显著提高其混物的冲击强度.ABS-g-MAH的增容效果优于ABS-g-GMA;ABS-g-MAH的接枝率为1.35%,w(ABS-g-MAH)为5%时对r-PET/ABS的增容作用最佳,此时r-PET/ABS/ABS-g-MAH的简支梁缺口冲击强度和无缺口冲击强度比r-PET/ABS分别提高了42%和23%.扫描电子显微镜观察表明,加入ABS接枝物能使ABS在r-PET连续相中的分散更均匀,粒径尺寸更均一.

  2. Structural and biophysical characterization of Bacillus thuringiensis insecticidal proteins Cry34Ab1 and Cry35Ab1.

    Directory of Open Access Journals (Sweden)

    Matthew S Kelker

    Full Text Available Bacillus thuringiensis strains are well known for the production of insecticidal proteins upon sporulation and these proteins are deposited in parasporal crystalline inclusions. The majority of these insect-specific toxins exhibit three domains in the mature toxin sequence. However, other Cry toxins are structurally and evolutionarily unrelated to this three-domain family and little is known of their three dimensional structures, limiting our understanding of their mechanisms of action and our ability to engineer the proteins to enhance their function. Among the non-three domain Cry toxins, the Cry34Ab1 and Cry35Ab1 proteins from B. thuringiensis strain PS149B1 are required to act together to produce toxicity to the western corn rootworm (WCR Diabrotica virgifera virgifera Le Conte via a pore forming mechanism of action. Cry34Ab1 is a protein of ∼14 kDa with features of the aegerolysin family (Pfam06355 of proteins that have known membrane disrupting activity, while Cry35Ab1 is a ∼44 kDa member of the toxin_10 family (Pfam05431 that includes other insecticidal proteins such as the binary toxin BinA/BinB. The Cry34Ab1/Cry35Ab1 proteins represent an important seed trait technology having been developed as insect resistance traits in commercialized corn hybrids for control of WCR. The structures of Cry34Ab1 and Cry35Ab1 have been elucidated to 2.15 Å and 1.80 Å resolution, respectively. The solution structures of the toxins were further studied by small angle X-ray scattering and native electrospray ion mobility mass spectrometry. We present here the first published structure from the aegerolysin protein domain family and the structural comparisons of Cry34Ab1 and Cry35Ab1 with other pore forming toxins.

  3. Connected Component Labeling Using Components Neighbors-Scan Labeling Approach

    Directory of Open Access Journals (Sweden)

    Akmal Rakhmadi

    2010-01-01

    Full Text Available Problem statement: Many approaches have been proposed in previous such as the classic sequential connected components labeling algorithm which is relies on two subsequent raster-scans of a binary image. This method produced good performance in terms of accuracy, but because of the implementation of the image processing systems now requires faster process of the computer, the speed of this technique’s process has become an important issue. Approach: A computational approach, called components neighbors-scan labeling algorithm for connected component labeling was presented in this study. This algorithm required scanning through an image only once to label connected components. The algorithm started by scanning from the head of the component’s group, before tracing all the components neighbors by using the main component’s information. This algorithm had desirable characteristics, it is simple while promoted accuracy and low time consuming. By using a table of components, this approach also gave other advantages as the information for the next higher process. Results: The approach had been tested with a collection of binary images. In practically all cases, the technique had successfully given the desired result. Averagely, from the results the algorithm increased the speed around 67.4% from the two times scanning method. Conclusion: Conclusion from the comparison with the previous method, the approach of components neighbors-scan for connected component labeling promoted speed, accuracy and simplicity. The results showed that the approach has a good performance in terms of accuracy, the time consumed and the simplicity of the algorithm.

  4. Ab interno trabeculectomy in the adult patient.

    Science.gov (United States)

    SooHoo, Jeffrey R; Seibold, Leonard K; Kahook, Malik Y

    2015-01-01

    Glaucoma is a potentially blinding disease that affects millions of people worldwide. The mainstay of treatment is lowering of intraocular pressure (IOP) through the use of medications, laser and/or incisional surgery. The trabecular meshwork (TM) is thought to be the site of significant resistance to aqueous outflow in open angle glaucoma. Theoretically, an incision through TM or TM removal should decrease this resistance and lead to a significant reduction in IOP. This approach, commonly referred to as goniotomy or trabeculotomy, has been validated in the pediatric population and has been associated with long-term IOP control. In adults, however, removal of TM tissue has been historically associated with more limited and short-lived success. More recent evidence, reveals that even adult patients may benefit significantly from removal of diseased TM tissue and can lead to a significant reduction in IOP that is long-lasting and safe. In this review, we discuss current evidence and techniques for ab interno trabeculectomy using various devices in the adult patient.

  5. Ab initio calculation of the Hoyle state

    CERN Document Server

    Epelbaum, Evgeny; Lee, Dean; Meißner, Ulf-G

    2011-01-01

    The Hoyle state plays a crucial role in the hydrogen burning of stars heavier than our sun and in the production of carbon and other elements necessary for life. This excited state of the carbon-12 nucleus was postulated by Hoyle^{1} as a necessary ingredient for the fusion of three alpha particles to produce carbon at stellar temperatures. Although the Hoyle state was seen experimentally more than a half century ago^{2,3}, nuclear theorists have not yet uncovered the nature of this state from first principles. In this letter we report the first ab initio calculation of the low-lying states of carbon-12 using supercomputer lattice simulations and a theoretical framework known as effective field theory. In addition to the ground state and excited spin-2 state, we find a resonance at -85(3) MeV with all of properties of the Hoyle state and in agreement with the experimentally observed energy. These lattice simulations provide insight into the structure of this unique state and new clues as to the amount of fine...

  6. A comparison of the biodistribution and biokinetics of {sup 99m}Tc-anti-CD66 mAb BW 250/183 and {sup 99m}Tc-anti-CD45 mAb YTH 24.5 with regard to suitability for myeloablative radioimmunotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Buchmann, Inga [Department of Nuclear Medicine, University Hospital, Ulm (Germany); Klinik und Poliklinik fuer Nuklearmedizin, Gebaeude 210, Johannes-Gutenberg-Universitaet Mainz, 55101, Mainz (Germany); Kull, Thomas; Glatting, Gerhard; Kotzerke, Jorg; Rattat, Dirk; Reske, Sven N. [Department of Nuclear Medicine, University Hospital, Ulm (Germany); Bunjes, Donald; Dohner, Hartmut [Department of Hematology, University Hospital, Ulm (Germany); Hale, Geoffrey [Sir William Dunn School of Pathology, Oxford (United Kingdom)

    2003-05-01

    Radioimmunotherapy (RIT) with radiolabelled monoclonal antibodies (mAbs) is an effective method of achieving myeloablation in leukaemia patients prior to stem cell transplantation (SCT). We wished to compare the approaches of specific binding to leukaemic blasts and non-specific binding to benign red marrow cells, which results in a myeloablative ''cross-fire'' effect. Therefore, we prospectively evaluated the biodistribution and biokinetics of the anti-CD45 mAb YTH 24.5 and the anti-CD66 mAb BW 250/183 with regard to their suitability for myeloablative RIT. The red marrow selective anti-CD66 mAb BW 250/183 (IgG1) binds to normal granulopoietic cells. In contrast, the anti-CD45 mAb YTH 24.5 (IgG2b) binds to 85-90% of acute leukaemic blasts and almost all haematopoietic white cells. Patients with leukaemic blast infiltration of the marrow <25% and assigned for RIT and SCT were included. Twelve patients (eight male, four female; median age 46{+-}7 years) with AML (5), CML (5) or ALL (2) were examined. Both mAbs were labelled with technetium-99m. Within 48 h, 906{+-}209 MBq {sup 99m}Tc-anti-CD66 mAb and 760{+-}331 MBq {sup 99m}Tc-anti-CD45 mAb were injected consecutively. Scintigraphic and urinary measurements were performed 1, 2, 4 and 24 h after injection. Serum activities were evaluated 2, 5, 10, 15, 30 and 60 min and 2, 4 and 24 h after injection. Compared with the anti-CD45 mAb, the anti-CD66 mAb showed an approximately fourfold higher accumulation in the red marrow, a 2.5-fold lower accumulation in the liver and similar accumulation in the kidneys. The serum activity (% of the injected dose) initially decreased faster for the anti-CD45 mAb but was similar for the two mAbs 24 h after injection: 3.3%{+-}1.2% (anti-CD66 mAb) and 2.4%{+-}1.1% (anti-CD45 mAb). The cumulated urinary excretion was 17%{+-}6.6% (anti-CD66 mAb) and 27.3%{+-}7.9% (anti-CD45 mAb) 24 h after application. In these patients with low tumour load, the anti-CD66 mAb BW 250

  7. Current techniques for AB0-incompatible living donor liver transplantation

    Science.gov (United States)

    Rummler, Silke; Bauschke, Astrid; Bärthel, Erik; Jütte, Heike; Maier, Katrin; Ziehm, Patrice; Malessa, Christina; Settmacher, Utz

    2016-01-01

    For a long time, it was considered medical malpractice to neglect the blood group system during transplantation. Because there are far more patients waiting for organs than organs available, a variety of attempts have been made to transplant AB0-incompatible (AB0i) grafts. Improvements in AB0i graft survival rates have been achieved with immunosuppression regimens and plasma treatment procedures. Nevertheless, some grafts are rejected early after AB0i living donor liver transplantation (LDLT) due to antibody mediated rejection or later biliary complications that affect the quality of life. Therefore, the AB0i LDLT is an option only for emergency situations, and it requires careful planning. This review compares the treatment possibilities and their effect on the patients’ graft outcome from 2010 to the present. We compared 11 transplant center regimens and their outcomes. The best improvement, next to plasma treatment procedures, has been reached with the prophylactic use of rituximab more than one week before AB0i LDLT. Unfortunately, no standardized treatment protocols are available. Each center treats its patients with its own scheme. Nevertheless, the transplant results are homogeneous. Due to refined treatment strategies, AB0i LDLT is a feasible option today and almost free of severe complications. PMID:27683633

  8. Nutrition Marketing on Food Labels

    Science.gov (United States)

    Nutrition marketing may influence purchasing behavior and thereby be a factor in the obesity epidemic. Very little peer-reviewed research has been published which investigates the relationship between nutrition marketing on food labels and consumer behavior. The purpose of this paper was to give an ...

  9. Psychological effectiveness of carbon labelling

    Science.gov (United States)

    Beattie, Geoffrey

    2012-04-01

    Despite the decision by supermarket-giant Tesco to delay its plan to add carbon-footprint information onto all of its 70,000 products, carbon labelling, if carefully designed, could yet change consumer behaviour. However, it requires a new type of thinking about consumers and much additional work.

  10. Improving the energy labelling scheme

    DEFF Research Database (Denmark)

    Gram-Hanssen, Kirsten; Christensen, Toke Haunstrup

    This report summarises the main results of an EU project on consumer response to energy labels in buildings. This report is mainly directed at Danish policy makers. The main focus is therefore on results that are relevant from a Danish point of view and on how they can be used to further strengthen...

  11. On Labeled Traveling Salesman Problems

    DEFF Research Database (Denmark)

    Couetoux, Basile; Gourves, Laurent; Monnot, Jerome;

    2008-01-01

    We consider labeled Traveling Salesman Problems, defined upon a complete graph of n vertices with colored edges. The objective is to find a tour of maximum (or minimum) number of colors. We derive results regarding hardness of approximation, and analyze approximation algorithms for both versions...

  12. On the hierarchical parallelization of ab initio simulations

    CERN Document Server

    Ruiz-Barragan, Sergi; Shiga, Motoyuki

    2016-01-01

    A hierarchical parallelization has been implemented in a new unified code PIMD-SMASH for ab initio simulation where the replicas and the Born-Oppenheimer forces are parallelized. It is demonstrated that ab initio path integral molecular dynamics simulations can be carried out very efficiently for systems up to a few tens of water molecules. The code was then used to study a Diels-Alder reaction of cyclopentadiene and butenone by ab initio string method. A reduction in the reaction energy barrier is found in the presence of hydrogen-bonded water, in accordance with experiment.

  13. Ab initio derivation of model energy density functionals

    Science.gov (United States)

    Dobaczewski, Jacek

    2016-08-01

    I propose a simple and manageable method that allows for deriving coupling constants of model energy density functionals (EDFs) directly from ab initio calculations performed for finite fermion systems. A proof-of-principle application allows for linking properties of finite nuclei, determined by using the nuclear nonlocal Gogny functional, to the coupling constants of the quasilocal Skyrme functional. The method does not rely on properties of infinite fermion systems but on the ab initio calculations in finite systems. It also allows for quantifying merits of different model EDFs in describing the ab initio results.

  14. English in Action (EIA) programme, Bangladesh: What’s this about using mobile phones in the classroom?

    OpenAIRE

    Perez-Gore, Isabelle; Burton, Sonia

    2014-01-01

    This workshop presents an overview of English in Action’s (EIA) schools component, implemented by the Government of Bangladesh. EIA is a large-scale UKaid-funded English language development project, aiming to provide learning opportunities to 25 million people in Bangladesh. The project looks to enhance social and economic opportunities, including better access to jobs. The schools component is a professional development programme for Government teachers, introducing communicative teachi...

  15. The labeling debate in the United States.

    Science.gov (United States)

    Marchant, Gary E; Cardineau, Guy A

    2013-01-01

    The mandatory labeling of genetically modified (GM) food has become the predominant policy issue concerning biotechnology in the United States. The controversy over GM labeling is being debated at several different levels and branches of government. At the federal level, the Food and Drug Administration, which has primary jurisdiction over food safety and labeling, has steadfastly refused to require labeling of GM foods since 1992 based on its conclusion that GM foods as a category present no unique or higher risks than other foods. Proposed legislation has been repeatedly introduced in the US. Congress over the years to mandate GM labeling, but has made very little progress. With federal labeling requirements apparently stalled, the main activity has switched to the state level, where numerous individual states are considering mandatory GM labeling, either through legislation or proposition. The debate over GM labeling, at both the federal and state levels, has focused on five issues: (1) public opinion; (2) the legality of labeling requirements; (3) the risks and benefits of GM foods; (4) the costs and burdens of GM labeling; and (5) consumer choice. While the pro-labeling forces argue that all of these factors weigh in favor of mandatory GM labeling, a more careful evaluation of the evidence finds that all five factors weigh decisively against mandatory GM labeling requirements.

  16. Quantitation of imaging with I-131-F(ab')/sub 2/ fragments of monoclonal antibody in patients

    International Nuclear Information System (INIS)

    Iodine-131 labeled F(ab')/sub 2/ fragments of monoclonal antibody (IgG/sub 2a/ immunoglobulin with specificity for a cell surface antigen of colon carcinoma) have been used for quantitative imaging of tumor in 27 patients. Activity of I-131 F(ab')/sub 2/ fragments localized in tumor and in liver was quantitated using a modification of the method of Thomas SR, employing computer-acquired conjugate views (i.e. 180 opposed) to eliminate need for tumor or organ depth and tissue attenuation. The method was validated with an abdominal imaging phantom showing accuracy of +/- 10%. Quantitation indicates that activity reaches a peak in tumor at 48-72 hours and the ratio of activity in hepatic metastases to activity in liver peaks at approximately 72 hours. Mean activity in tumor was less than 0.01% of the administered dose per gram of tumor at any imaging time from 24 to 168 hours, while mean activity in surrounding liver was less than .002% of administered dose per gram of liver at any imaging time. Liver activity decreased monotonically with time, showing no peak activity. This non-invasive method of quantitating the distribution of F(ab')/sub 2/ fragments of monoclonal antibody in patients has proven accurate by comparison with phantom simulation. This type of quantitation is necessary for evaluating optimal imaging time, comparing relative utility of various antibodies and has use for therapeutic applications of monoclonal antibody fragments

  17. Eritema ab igne: relato de um caso Erythema ab igne: a case report

    Directory of Open Access Journals (Sweden)

    Magda Blessmann Weber

    2005-04-01

    Full Text Available A lesão cutânea do eritema ab igne é caracterizada por eritema reticulado, hiperpigmentação, descamação fina, atrofia epidérmica e telangiectasias. Atualmente, a região lombar é a mais atingida, devido ao uso de bolsas de água quente, para alívio de dores crônicas, e por constantes exposições a calor profundo em sessões de fisioterapia. Os autores alertam sobre uma dermatose pouco diagnosticada e que talvez seja mais prevalente pela alta freqüência com que são realizados tratamentos fisioterápicos.The cutaneous lesion of erythema ab igne is characterized by a reticulate erythema, hyperpigmentation, fine scaling, epidermal atrophy and telangiectasis. Currently the lumbar region is the most affected, due to the use of hot water bottles to relieve chronic pains, and by constant exposure to deep heat in physiotherapy sessions. The authors call attention to a dermatosis that is not often diagnosed, and that may be more prevalent, because of the high frequency with which such physiotherapeutic treatments are performed.

  18. Treatment of HER2-positive breast carcinomatous meningitis with intrathecal administration of α-particle-emitting 211At-labeled trastuzumab

    International Nuclear Information System (INIS)

    Introduction: Carcinomatous meningitis (CM) is a devastating disease characterized by the dissemination of malignant tumor cells into the subarachnoid space along the brain and spine. Systemic treatment with monoclonal antibody (mAb) trastuzumab can be effective against HER2-positive systemic breast carcinoma but, like other therapies, is ineffective against CM. The goal of this study was to evaluate the therapeutic effect of α-particle emitting 211At-labeled trastuzumab following intrathecal administration in a rat model of breast carcinoma CM. Methods: Athymic rats were injected intrathecally with MCF-7/HER2-18 breast carcinoma cells through a surgically implanted indwelling intrathecal catheter. In Experiment 1, animals received 33 or 66 μCi 211At-labeled trastuzumab, cold trastuzumab or saline. In Experiment 2, animals were inoculated with a lower tumor burden and received 46 or 92 μCi 211At-labeled trastuzumab or saline. In Experiment 3, animals received 28 μCi 211At-labeled trastuzumab, 30 μCi 211At-labeled TPS3.2 control mAb or saline. Histopathological analysis of the neuroaxis was performed at the end of the study. Results: In Experiment 1, median survival increased from 21 days for the saline and cold trastuzumab groups to 45 and 48 days for 33 and 66 μCi 211At-labeled trastuzumab, respectively. In Experiment 2, median survival increased from 23 days for saline controls to 68 and 92 days for 46 and 92 μCi 211At-labeled trastuzumab, respectively. In Experiment 3, median survival increased from 20 days to 29 and 36 days for animals treated with 211At-labeled TPS3.2 and 211At-labeled trastuzumab, respectively. Long-term survivors were observed exclusively in the 211At-trastuzumab-treated groups. Conclusion: Intrathecal 211At-labeled trastuzumab shows promise as a treatment for patients with HER2-positive breast CM.

  19. Energy conservation campaign at Sandvik AB in Sandviken

    Energy Technology Data Exchange (ETDEWEB)

    Larsson, Rune

    1979-07-01

    Sandvik AB's performed an analysis showing oil consumption for steam production was increasing considerably. Energy conservation measures were implemented to decrease the oil consumption and to make lasting changes.

  20. Tensile deformation mechanisms of ABS/PMMA/EMA blends

    Science.gov (United States)

    Wang, S. H.; Gao, J.; Lin, S. X.; Zhang, P.; Huang, J.; Xu, L. L.

    2014-08-01

    The tensile deformation mechanisms of acrylonitrile - butadiene - styrene (ABS) / polymethyl methacrylate (PMMA) blends toughened by ethylene methacrylate (EMA) copolymer was investigated by analysing the fracture morphology. ABS/PMMA was blended with EMA copolymer by melt mixing technique using co-rotating twin extruder. Tensile tests show that the elongation at break of ABS/PMMA blends can be efficiently improved with the increase in EMA content. Fracture morphology of ABS/PMMA/EMA blends reveals that the material yield induced by hollowing-out of EMA particles and its propagation into yield zone is the main toughening mechanism. Moreover, the appearance that EMA particles in the central area are given priority to hollowing-out may be related to the skin-core structure of the injection moulded parts caused by the different cooling rate between surface and inside in the process of injection moulding.

  1. Ivabradine: A Review of Labeled and Off-Label Uses.

    Science.gov (United States)

    Oliphant, Carrie S; Owens, Ryan E; Bolorunduro, Oluwaseyi B; Jha, Sunil K

    2016-10-01

    Ivabradine is a unique medication recently approved in the USA for the treatment of select heart failure patients. It was first approved for use in several countries around the world over a decade ago as an anti-anginal agent, with subsequent approval for use in heart failure patients. Since ivabradine has selective activity blocking the I f currents in the sinus node, it can reduce heart rate without appreciable effects on blood pressure. Given this heart-rate-specific effect, it has been investigated in many off-label indications as an alternative to traditional heart-rate-reducing medications such as beta blockers and calcium channel blockers. We conducted searches of PubMed and Google Scholar for ivabradine, heart failure, HFrEF, HFpEF, angina, coronary artery disease, inappropriate sinus tachycardia, postural orthostatic hypotension, coronary computed tomography angiography and atrial fibrillation. We reviewed and included studies, case reports, and case series published between 1980 and June 2016 if they provided information relevant to the practicing clinician. In many cases, larger clinical trials are needed to solidify the benefit of ivabradine, although studies indicate benefit in most therapeutic areas explored to date. The purpose of this paper is to review the current labeled and off-label uses of ivabradine, with a focus on clinical trial data. PMID:27405864

  2. A Multi-Label Classification Approach Based on Correlations Among Labels

    Directory of Open Access Journals (Sweden)

    Raed Alazaidah

    2015-02-01

    Full Text Available Multi label classification is concerned with learning from a set of instances that are associated with a set of labels, that is, an instance could be associated with multiple labels at the same time. This task occurs frequently in application areas like text categorization, multimedia classification, bioinformatics, protein function classification and semantic scene classification. Current multi-label classification methods could be divided into two categories. The first is called problem transformation methods, which transform multi-label classification problem into single label classification problem, and then apply any single label classifier to solve the problem. The second category is called algorithm adaptation methods, which adapt an existing single label classification algorithm to handle multi-label data. In this paper, we propose a multi-label classification approach based on correlations among labels that use both problem transformation methods and algorithm adaptation methods. The approach begins with transforming multi-label dataset into a single label dataset using least frequent label criteria, and then applies the PART algorithm on the transformed dataset. The output of the approach is multi-labels rules. The approach also tries to get benefit from positive correlations among labels using predictive Apriori algorithm. The proposed approach has been evaluated using two multi-label datasets named (Emotions and Yeast and three evaluation measures (Accuracy, Hamming Loss, and Harmonic Mean. The experiments showed that the proposed approach has a fair accuracy in comparison to other related methods.

  3. Preparation of 35S labelled thiosemicarbazone

    International Nuclear Information System (INIS)

    A 35S labelled thiosemicarbazone is prepared, on a millimole scale by reacting labelled thiocyanate with hydrazine sulfate in ethanolic medium. The hydrazine thiocyanate so formed is then condensed with aldehyde to form the thiosemicarbazone

  4. Labelling schemes: From a consumer perspective

    DEFF Research Database (Denmark)

    Juhl, Hans Jørn; Stacey, Julia

    2000-01-01

    . A recent MAPP study has investigated the value consumers attach the Government-controlled labels 'Ø-mærket' and 'Den Blå Lup' and the private supermarket label 'Mesterhakket' when they purchase minced meat. The results reveal four consumer segments that use labelling schemes for food products very......Labelling of food products attracts a lot of political attention these days. As a result of a number of food scandals, most European countries have acknowledged the need for more information and better protection of consumers. Labelling schemes are one way of informing and guiding consumers....... However, initiatives in relation to labelling schemes seldom take their point of departure in consumers' needs and expectations; and in many cases, the schemes are defined by the institutions guaranteeing the label. It is therefore interesting to study how consumers actually value labelling schemes...

  5. Rescue of failed filtering blebs with ab interno trephination.

    Science.gov (United States)

    Shihadeh, Wisam A; Ritch, Robert; Liebmann, Jeffrey M

    2006-06-01

    We evaluated the effectiveness of ab interno automated trephination as a technique for rescuing failed mature filtering blebs. A retrospective chart review of 40 failed blebs of 38 patients who had a posttrephination follow-up period of at least 3 months was done. With success defined as intraocular pressure (IOP) control with other modalities of management. Complications were few. We believe that ab interno trephination is an excellent option for rescuing selected failed filtering blebs.

  6. Evaluation of the Urotest AB antibacterial substance detection test.

    OpenAIRE

    Blondeau, J. M.; Yaschuk, Y; Galenzoski, D; Hrabok, D; Isaacson, M; Lee, L.(Department of Physics, Yale University, New Haven, CT, USA); Link, H; Walshaw, L

    1994-01-01

    The Urotest AB was used to detect antimicrobial substances in urine samples. Of 1022 urine specimens evaluated, Urotest AB detected inhibitors in 38.9%. Of 159 urine specimens from patients thought to be taking an antibiotic, inhibitors were detected in 80.5%. This test may help to explain culture negative urine samples from symptomatic patients, and could help elucidate treatment failures and the epidemiology of antibiotic resistance.

  7. Young Modulus of Crystalline Polyethylene from ab Initio Molecular Dynamics

    OpenAIRE

    Hageman, J.C.L.; Meier, Robert J.; M. Heinemann; de Groot, R. A.

    1997-01-01

    The Young modulus for crystalline polyethylene is calculated using ab initio molecular dynamics based on density functional theory in the local density approximation (DFT-LDA). This modulus, which can be seen as the ultimate value for the Young modulus of polyethylene fibers, is found to be 334 GPa. For the first time the modulus is evaluated ab initio (no bias from experimental data) with demonstrated basis set convergence.

  8. EIA model documentation: Petroleum Market Model of the National Energy Modeling System

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-12-30

    The purpose of this report is to define the objectives of the Petroleum Market Model (PMM), describe its basic approach, and provide detail on how it works. This report is intended as a reference document for model analysts, users, and the public. Documentation of the model is in accordance with EIA`s legal obligation to provide adequate documentation in support of its models (Public Law 94-385, section 57.b.2). The PMM models petroleum refining activities, the marketing of products, the production of natural gas liquids and domestic methanol, projects petroleum provides and sources of supplies for meeting demand. In addition, the PMM estimates domestic refinery capacity expansion and fuel consumption.

  9. A generic approach to integrate biodiversity considerations in screening and scoping for EIA

    International Nuclear Information System (INIS)

    The Convention on Biological Diversity (CBD) requires parties to apply environmental impact assessment (EIA) to projects that potentially negatively impact on biodiversity. As members of the International Association of Impact Assessment, the authors have developed a conceptual framework to integrate biodiversity considerations in EIA. By defining biodiversity in terms of composition, structure, and key processes, and by describing the way in which human activities affect these so-called components of biodiversity, it is possible to assess the potential impacts of human activities on biodiversity. Furthermore, the authors have translated this conceptual framework in generic guidelines for screening and scoping in impact assessment. Countries can use these generic guidelines to further operationalise the framework within the existing national procedures for impact assessment. This paper is fully coherent and partly overlapping with the guidelines recently adopted by the CBD, but differs in the sense that it provides more scientific background and is less policy-oriented

  10. ANTIMAGIC LABELING OF GENERALIZED SAUSAGE GRAPHS

    Directory of Open Access Journals (Sweden)

    Oudone Phanalasy

    2014-10-01

    Full Text Available An antimagic labeling of a graph with q edges is a bijection from the set of edges to the set of positive integers {1,2,...,q} such that all vertex weights are pairwise distinct, where the vertex weight of a vertex is the sum of the labels of all the edges incident with that vertex. A graph is antimagic if it has an antimagic labeling. In this paper we construct antimagic labeling for the family of generalized sausage graphs.

  11. Do Consumers Really Use Food Labels?

    OpenAIRE

    Ward, Ronald W.; Jauregui, Carlos E.

    2006-01-01

    Ordered Probit models are used to estimate the probabilities of consumers reading food labels for harmful ingredients and for using labels to assist with food purchasing decisions. Demographics, health concerns, attitudes, and eating habits are shown to influence the likelihood of using food labels. Effects from over 25 variables are ranked in terms of their relative impacts on the use of food labels. Dieting, concerns about calories, foreign foods, and many other variable effects on the use ...

  12. 99mTc: Labeling Chemistry and Labeled Compounds

    Science.gov (United States)

    Alberto, R.; Abram, U.

    This chapter reviews the radiopharmaceutical chemistry of technetium related to the synthesis of perfusion agents and to the labeling of receptor-binding biomolecules. To understand the limitations of technetium chemistry imposed by future application of the complexes in nuclear medicine, an introductory section analyzes the compulsory requirements to be considered when facing the incentive of introducing a novel radiopharmaceutical into the market. Requirements from chemistry, routine application, and market are discussed. In a subsequent section, commercially available 99mTc-based radiopharmaceuticals are treated. It covers the complexes in use for imaging the most important target organs such as heart, brain, or kidney. The commercially available radiopharmaceuticals fulfill the requirements outlined earlier and are discussed with this background. In a following section, the properties and perspectives of the different generations of radiopharmaceuticals are described in a general way, covering characteristics for perfusion agents and for receptor-specific molecules. Technetium chemistry for the synthesis of perfusion agents and the different labeling approaches for target-specific biomolecules are summarized. The review comprises a general introduction to the common approaches currently in use, employing the N x S4-x , [3+1] and 2-hydrazino-nicotinicacid (HYNIC) method as well as more recent strategies such as the carbonyl and the TcN approach. Direct labeling without the need of a bifunctional chelator is briefly reviewed as well. More particularly, recent developments in the labeling of concrete targeting molecules, the second generation of radiopharmaceuticals, is then discussed and prominent examples with antibodies/peptides, neuroreceptor targeting small molecules, myocardial imaging agents, vitamins, thymidine, and complexes relevant to multidrug resistance are given. In addition, a new approach toward peptide drug development is described. The section

  13. 基于ABS的ABS/ASR集成液压系统设计%ABS/ASR Integrated Hydraulic System Based on ABS

    Institute of Scientific and Technical Information of China (English)

    马岳峰; 刘昭度; 吴利军; 王国业

    2004-01-01

    介绍一种基于JETTA GTX轿车ABS液压系统的ABS/ASR集成液压系统改造方案,该ABS/ASR集成液压系统在原有ABS液压系统的基础上增加较少的液压元件实现全部ABS功能和ASR制动干预控制功能,改造后的集成系统工作可靠,不影响原有的常规制动和ABS制动过程.

  14. 金标法和ELISA法检测乙型肝炎病毒血清标志物的比较%Comparative Study on Colloidal Gold-labeled Method and ELISA of Testing Five Serological Markers of HBV

    Institute of Scientific and Technical Information of China (English)

    丁邦胜; 潘健

    2012-01-01

    目的 探讨金标法检测乙型肝炎病毒(HBV)HBsAg、HBsAb、HBeAg、HBeAb、HBcAb五项血清标志物的敏感性、特异性.方法 采用ELISA法和金标法对256例血清样本同时进行HBV五项血清标志物的检测,并且对结果进行对比分析.结果 256例样本中:ELISA法“全阴性”(HBsAg,HBsAb,HBeAg,HBeAb,HBcAb均阴性)结果模式,金标法结果相同;ELISA法HBsAg、HBeAb、HBcAb阳性,HBsAb、HBeAg阴性(简称模式1);HBsAg、HBeAg、HBcAb阳性,HBeAb、HBsAb阴性(简称模式2)结果模式,金标法检测样本的结果模式发生改变.256例样本两法各单项指标检测结果经x2检验:HBsAb和HBeAg两项结果的差异无统计学意义(P>0.05);HB-sAg,HBeAb,HBcAb三项结果的差异有统计学意义(P<0.05),少数ELISA法阳性或OD为临界值的样本金标法检测结果为阴性;无ELISA法阴性而金标法为阳性的标本.结论 两种方法对HBV五项血清标志物测定的特异性相近,但是金标法敏感性不如ELISA法.%Objective To investigate the sensitivity and specificity of testing HBsAg. HBsAb, HBeAg, HBeAb and HBcAb with colloidal gold-labeled method. Methods 256 serological cases were tested with both colloidal gold-labeled method and ELISA. The results of two methods were analyzed. Results All five negative results samples by ELISA were the same with colloidal gold-labeled method.but for the results HBsAg. HBeAb, HBcAb are positive)HBsAb,HBeAg are negative and HBsAg.HBeAg. HBcAb are positive; HBeAb.HBsAb are negative by ELISA. some were changed by colloidal gold-labeled method. The chi-aquare test(x2) showed that the result differences of HBsAb and HBeAg were not statistically significant with two methods (P>0.05 ). But X2 test showed the differences were significant on HBsAg,HBeAb and HBcAb with two methods. The weak positive results by ELISA always were negative by colloidal gold-labeled method. but no negative results by ELISA were found positive tested by colloidal gold-labeled

  15. Lymphoma imaging with a new technetium-99m labelled antibody, LL2

    Energy Technology Data Exchange (ETDEWEB)

    Murthy, S.; Sharkey, R.M.; Goldenberg, D.M.; Lee, R.E.; Pinsky, C.M.; Hansen, H.J.; Burger, K.; Swayne, L.C. (Center for Molecular Medicine and Immunology, Newark, NJ (United States) Garden State Cancer Center, Newark, NJ (United States) Immunomedics, Inc., Warren, NJ (United States) University Hospital, UMDNJ, Newark, NJ (United States). Dept. of Radiology Morristown Memorial Hospital, NJ (United States))

    1992-06-01

    The lesion detection capability of a new technetium-99m labelled B-cell lymphoma monoclonal antibody (MoAb) imaging agent, LL2, was evaluated in 8 patients with non-Hodgkin's lymphoma and 1 patient with chronic lymphocytic leukaemia. The MoAb kit consists of a 1-vial, 1-mg Fab' form of LL2 ready for instant labelling with technetium. The patients were injected with {proportional to}925 MBq (25 mCi) of {sup 99m}Tc-LL2 Fab' (1 mg), and planar and single photon emission tomography (SPET) studies were performed at 3-4 h post injection and at 24 h. There was no evidence of thyroid or stomach activity up to 24 h. Uniform splenic uptake was seen in all patients. Two non-lymphoma patients were also administered with the same agent and demonstrated a similar splenic distribution; therefore, splenic targeting was not scored as tumour-specific. A total of 29 from 48 tumour sites were detected by scintigraphy, including tumours of various grades and histological types. Excluding 1 patient who had a large tumour burden of over 500 g, 29 of 33 lesions were detected. One patient was free of disease at the time of the study and had a negative scan. Another patient showed excellent targeting of gallium-negative sites in the liver and bone. The bone involvement was not known prior to the antibody study and was subsequently confirmed by a bone scan. Additional sites of MoAb localization could not be followed in this group, since most patients went on to radioimmunotherapy immediately following the {sup 99m}Tc-LL2 study. However, these initial results suggest that this new {sup 99m}Tc-labelled antibody imaging kit should be further investigated for its potential role in the staging and follow-up of lymphoma patients. (orig.).

  16. 21 CFR 225.80 - Labeling.

    Science.gov (United States)

    2010-04-01

    ... CURRENT GOOD MANUFACTURING PRACTICE FOR MEDICATED FEEDS Packaging and Labeling § 225.80 Labeling. (a... adhered to, will assure that the article is safe and effective for its intended purposes. (b)(1) Labels... medicated feed and includes adequate information for the safe and effective use of the medicated feed....

  17. What determines consumer attention to nutrition labels?

    NARCIS (Netherlands)

    Bialkova, S.E.; Trijp, van J.C.M.

    2010-01-01

    To identify the key determinants of consumer attention to nutrition labels, visual search tasks (present – absent; one – two targets) were used as an effective experimental tool. The main manipulation concerned: set size (number of labels on front of pack); label characteristics (display size, posit

  18. Ab Initio No-Core Shell Model

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, B R; Navratil, P; Vary, J P

    2011-04-11

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory ({chi}EFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The

  19. Ab Initio No-Core Shell Model

    International Nuclear Information System (INIS)

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory (χEFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The resulting NN

  20. Pharmaceuticals labelled with stable isotopes

    International Nuclear Information System (INIS)

    The relatively new field of pharmaceuticals labelled with stable isotopes is reviewed. Scientific, juridical, and ethical questions are discussed concerning the application of these pharmaceuticals in human medicine. 13C, 15N, and 2H are the stable isotopes mainly utilized in metabolic function tests. Methodical contributions are given to the application of 2H, 13C, and 15N pharmaceuticals showing new aspects and different states of development in the field under discussion. (author)

  1. An Investigation of the Factors Affecting Performance of Environmental Impact Assessment Practices (EIA in Pakistan

    Directory of Open Access Journals (Sweden)

    Shahbaz Hussain

    2015-01-01

    Full Text Available Environmental Impact Assessment is used to detect changes that a proposed project may have on environment. The intent of present study is to investigate impact of institutional capacity and legal framework on performance of Environmental Impact Assessment practices in Pakistan such as screening, scoping and mitigation, environmental management plan and reporting. Sample of 200 EIA professionals have been selected by using random sampling approach from all provinces of Pakistan. Data has been collected through structured questionnaire and analysed by using AMOS 19 (Analysis of Moment Structures software. Results of path analysis indicated that institutional capacity and legal framework have significant direct impact on performance of all EIA practices in Pakistan. Model fit statistics such as GFI, RMR, NFI, IFI, TLI, RFI, CFI indicate the fitness of research model in this context. It has been suggested that there must be relevant and sufficient human resources that can uplift institutional capacity and legal framework must be well implemented because it will lead to enhanced performance of EIA practices in Pakistan.

  2. Public hearings for EIAs in post-communist Bulgaria: do they work?

    International Nuclear Information System (INIS)

    The participatory practices required as part of the established systems of Environmental Impact Assessment (EIA) practiced in the United States, Canada, Western Europe as well as several international agencies are more recent to the countries of Eastern Europe. The most common official forum for citizen participation in EIAs is the public hearing, which can provide important benefits. However, public hearings have been criticized as exhibiting several problems that preclude meaningful citizen input. This research explores three cases of public hearings held for EIA projects in Bulgaria. It argues that the public participation process and the public hearing in particular share the same problems that have been observed in other countries (including the United States and Canada). At the same time, however, Bulgarian public hearings do provide important indirect benefits that can contribute to the capacity for democratic governance and an active civil society. In the face of substantial economic obstacles and dramatic governmental reforms the country has endured since the end of communism, forums such as the public hearing are important means to foster institutional restructuring of a newly democratized country

  3. Social Impact Assessment: The lesser sibling in the South African EIA process?

    Energy Technology Data Exchange (ETDEWEB)

    Hildebrandt, L., E-mail: Leandri.hildebrandt@nwu.ac.za [African Centre for Disaster Studies, Research Focus Area: Social Transformation, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa); Sandham, L.A., E-mail: luke.sandham@nwu.ac.za [Environmental Assessment Research Group, School of Geo and Spatial Sciences, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa)

    2014-09-15

    Social Impact Assessment has developed as an integral but neglected component of EIA in South Africa since it became mandatory in 1997, and has therefore been referred to as the “orphan” or “lesser sibling” of EIA, as has SIA in the UK and the US. The aim of this paper is to test this claim by reviewing the quality of a sample of SIA reports, and also to establish whether there has been any improvement in quality following the introduction of revised EIA regulations in 2006. The results confirm that SIA can be called “the lesser sibling” due to the weak grades achieved in the quality review, but also reveal that there has been a slight and consistent improvement in quality, most likely driven by best practice considerations in the absence of prescriptive regulations for SIA. Suggestions and recommendations for addressing observed weakness in SIA performance are advanced. - Highlights: • The quality of a sample of SIA reports was evaluated using a review package. • SIA reports received mostly weak grades. • Limited improvement observed from first to second regulatory regime. • Improvements most likely due to best practice considerations.

  4. Social Impact Assessment: The lesser sibling in the South African EIA process?

    International Nuclear Information System (INIS)

    Social Impact Assessment has developed as an integral but neglected component of EIA in South Africa since it became mandatory in 1997, and has therefore been referred to as the “orphan” or “lesser sibling” of EIA, as has SIA in the UK and the US. The aim of this paper is to test this claim by reviewing the quality of a sample of SIA reports, and also to establish whether there has been any improvement in quality following the introduction of revised EIA regulations in 2006. The results confirm that SIA can be called “the lesser sibling” due to the weak grades achieved in the quality review, but also reveal that there has been a slight and consistent improvement in quality, most likely driven by best practice considerations in the absence of prescriptive regulations for SIA. Suggestions and recommendations for addressing observed weakness in SIA performance are advanced. - Highlights: • The quality of a sample of SIA reports was evaluated using a review package. • SIA reports received mostly weak grades. • Limited improvement observed from first to second regulatory regime. • Improvements most likely due to best practice considerations

  5. Fluorescent Labeling of Nanometer Hydroxyapatite

    Institute of Scientific and Technical Information of China (English)

    Yuan ZHANG; Yuan YUAN; Changsheng LIU

    2008-01-01

    A novel surface treatment method using 3-aminopropyltriethoxysilane (AMPTES), was developed to immobilize the fluorescein molecule on nano-HAP (nanometer hydroxyapatite) powders. By pretreating the nano-HAP powders surface with AMPTES, fluorescein, chosen on the basis of the chemical structure of the nano- HAP powders, could be bound to the nano-HAP powders surface. The chemical compositions of nano-HAP before and after being labeled were characterized by Fourier transform infrared spectroscopy (FTIR) and X-ray photoelectron spectroscopy (XPS). The morphology, phase composition, and the fluorescence characteristics of the nano-HAP powders with and without staining were also investigated. The FTIR and XPS results revealed that fiuorescein had been successfully immobilized on the surface of AMPTES-bound nano-HAP powders via the acylamide bond formation between the -COOH of fluorescein and the -NH2 of AMPTES. The labeled nano-HAP powders possessed strong fluorescent intensity with a little deviation from the maximum emission wavelength of fluorescein. But the morphology and phase composition had no obvious alteration. Under fluorescence microscopy, the labeled nano-HAP powders., even after 24 h cell incubation, exhibited strong fluorescence.

  6. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 Interactions with Western Corn Rootworm Midgut Membrane Binding Sites

    OpenAIRE

    Huarong Li; Monica Olson; Gaofeng Lin; Timothy Hey; Sek Yee Tan; Narva, Kenneth E.

    2013-01-01

    BACKGROUND: Bacillus thuringiensis (Bt) Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry) proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interact...

  7. The labelling of antibody anti-PBP2a with {sup 99m}Tc; Estudo de marcacao do anticorpo monoclonal anti-PBP2a com {sup 99m}Tc

    Energy Technology Data Exchange (ETDEWEB)

    Mororo, Janio da Silva

    2012-07-01

    Staphylococcus aureus is a major cause of life-threatening infections such as bacteraemia and endocarditis. Unfortunately, many strains of this bacterial species have become resistant to certain antibiotics, including methicillin and amoxicillin. These strains are known as methicillin-resistant S. aureus (MRSA). The penicillin binding protein 2a (PBP2a) is the enzyme responsible for conferring resistance p-lactams antibiotics for MRSA, being one promising molecule for therapy with mAb. However, besides the therapy, the methods of diagnosis are also inefficient because the diagnosis currently takes several days to produce a reliable result. Taking into account, the objective of this research was radiolabeling one anti-PBP2a mAb developed by Bio-Manguinhos/FioCruz-RJ, utilizing {sup 99m}Tc, for in situ diagnostic of the infectious caused by MRSA. First, anti-PBP2a mAb was reduced utilizing 2-mecaptoethanol (2-ME) for generate sulphydryl groups (-SH) and after to be labeled with {sup 99m}Tc. In this work, were utilized two techniques of direct method: Method 1, using tartrate and gentisic acid reagents, acting like transchelant and stabilizer agents, respectively; and Method 2, using one commercial kit of MDP. Besides the radiolabeling, the mAb reduced and mAb labeled with {sup 99m}Tc were submitted to immunoreactivity analysis, with SDS-PAGE non-reducing, Immunoblotting, ELISA and neutralization assay in vitro methods. The quantity produced of sulphydryl groups by mAb was satisfactory, approximately 5 per mAb, utilizing 6.500:1 of 2-ME:mAb molar ratio. The better labeling method was Method 2, with labeling yield of 73.5%, and showed a good stability after 2 hours (73.2%). The better formulation was: 0.5 mg of mAb anti- PBP2a, 10 {mu}U of MDP kit, after resuspended with 5 mL of saline, and 75.48 MBq (2.04 mCi) of {sup 99m}Tc, reacting by 15 minutes. The labeled mAb maintained the immunoreactivity, utilizing immunologic and in vitro experiments. (author)

  8. Study of the viability of technetium-99m labeling of whole antimyosin antibody and its fragment: development of radiopharmaceutical for cardiac survey

    International Nuclear Information System (INIS)

    In the acute myocardium infarction, the myocytes cell membrane loses its integrity, allowing the influx of extracellular macromolecules such as circulating antibody into the damaged cell. The use of the specific antibodies against cardiac myosin labeled with 99mTc allows to determine the localization and extension of myocardial infarction. The purpose of this work was to study the viability of labeling of the antimyosin monoclonal antibody and its fragment F(ab')2 with 99mTc. Because of the high cost of antimyosin antibody, others antibodies were used to optimize the methodology and the best condition was used for antimyosin antibody. The intact antibody was cleaved by pepsin to produce F(ab')2 fragment. The F(ab')2 and the intact antibody were reduced by treatment with Dithiothreitol (DTT) and 2-Mercaptoethanol (2-ME) and labeled with 99mTc by direct method. Different concentrations of reductant, mixing conditions and incubation times were studied. In the standard condition, incubation at molar ratio 1:1000 (antibody:reducing agent) at room temperature for 30 minutes with continuous rotation (850 rpm), 13.28 - SH groups were formed per molecule. It was studied the influence of p H, of the concentration of stannous chloride (Sn2+) and incubation time in the labeling condition. The better radiochemical yield (90.06 +- 1.53%) was obtained using 2.5 μg of Sn2+ in p H 4.5 for 60 minutes. The labeling of the fragment F(ab')2 did not present satisfactory results because of the low yield of the digestion. After purification by PD-10, the biodistribution study was performed and showed that the intact antimyosin antibody labeled with 99mTc presented fast kinetic compatible with the biodistribution of an intact antibody labeled with 99mTc. Scintigraphy image of the animal with myocardial infarction was obtained and compared with the image of a normal animal. The studies allow to conclude that the use of fragment F(ab')2 are not viable, but the use of the labeled antimyosin

  9. A comparison of 67Cu- and 131I-labelled forms of monoclonal antibodies SEN7 and SWA20 directed against small-cell lung cancer.

    Science.gov (United States)

    Smith, A; Zangemeister-Wittke, U; Waibel, R; Schenker, T; Schubiger, P A; Stahel, R A

    1994-01-01

    The intact anti-SCLC monoclonal antibody (MAb) SEN7 and its F(ab')2 were labelled with the beta-emitting isotope 67Cu. Both materials retained their biological activity in vitro as determined by the Lindmo assay. In a direct comparison of in vivo distribution in a xenograph model, 131I- and 67Cu-labelled intact SEN7 showed similar absolute tumour accumulation. Blood levels were markedly lower in the case of the 67Cu-labelled antibody, resulting in improved tumour:blood ratios which reached a maximum of 13:1 compared with only 4.5:1 for 131I-SEN7. In the case of the 67Cu-labelled F(ab')2, very high accumulation of the nuclide was observed in the kidney. Levels of radio copper in liver and spleen were also found to be significantly raised when compared with radio iodine. SWA20, a MAb which had previously failed to show any selective in vivo accumulation in tumour xenografts when labelled with radio iodine showed higher and more stable tumour accumulation when labelled with 67Cu.

  10. Use of Symbols in Labeling. Final rule.

    Science.gov (United States)

    2016-06-15

    The Food and Drug Administration (FDA or the Agency) is issuing this final rule revising its medical device and certain biological product labeling regulations to explicitly allow for the optional inclusion of graphical representations of information, or symbols, in labeling (including labels) without adjacent explanatory text (referred to in this document as "stand-alone symbols") if certain requirements are met. The final rule also specifies that the use of symbols, accompanied by adjacent explanatory text continues to be permitted. FDA is also revising its prescription device labeling regulations to allow the use of the symbol statement "Rx only" or "[rx] only" in the labeling for prescription devices. PMID:27311137

  11. Fate of the insecticidal Cry1Ab protein of GM crops in two agricultural soils as revealed by ¹⁴C-tracer studies.

    Science.gov (United States)

    Valldor, Petra; Miethling-Graff, Rona; Martens, Rainer; Tebbe, Christoph C

    2015-09-01

    Insecticidal delta-endotoxins of Bacillus thuringiensis are among the most abundant recombinant proteins released by genetically modified (GM) crops into agricultural soils worldwide. However, there is still controversy about their degradation and accumulation in soils. In this study, (14)C-labelled Cry1Ab protein was applied to soil microcosms at two concentrations (14 and 50 μg g(-1) soil) to quantify the mineralization of Cry1Ab, its incorporation into the soil microbial biomass, and its persistence in two soils which strongly differed in their texture but not in silt or pH. Furthermore, ELISA was used to quantify Cry1Ab and its potential immunoreactive breakdown products in aqueous soil extracts. In both soils, (14)CO2-production was initially very high and then declined during a total monitoring period of up to 135 days. A total of 16 to 23 % of the (14)C activity was incorporated after 29 to 37 days into the soil microbial biomass, indicating that Cry1Ab protein was utilized by microorganisms as a growth substrate. Adsorption in the clay-rich soil was the most important factor limiting microbial degradation; as indicated by higher degradation rates in the more sandy soil, extremely low concentrations of immunoreactive Cry1Ab molecules in the soils' aqueous extracts and a higher amount of (14)C activity bound to the soil with more clay. Ecological risk assessments of Bt-crops should therefore consider that the very low concentrations of extractable Cry1Ab do not reflect the actual elimination of the protein from soils but that, on the other hand, desorbed proteins mineralize quickly due to efficient microbial degradation.

  12. The Inception and Evolution of EIA and Environmental Clearance Process – Laying Emphasis on Sustainable Development and Construction

    Directory of Open Access Journals (Sweden)

    Devarshi Tathagat

    2015-03-01

    Full Text Available EIA which stands for environmental impact assessment is a domain which encompasses almost all areas of environmental engineering. EIA and environmental clearance (EC are two things which MoEF, Govt. Of India has mandated for many categories of project before their commissioning. Buildings with built up area of more than 20000 metre square and townships with area more than 50 Ha or 150000 square metre of built up area comes under it. A thorough report is made for the possible outcomes of the project (i.e..it‟s impact on surrounding environment. If the impact is within the limits as specified by MoEF and SEAC, it is sent for approval otherwise client is suggested to take corrective steps. Scope of the topic trespasses the boundaries of green house gas emissions and global warming, water and energy crises, carbon emission and sequestration, environmental pollution of various kind. It was EIA that brought in an element on environment in all projects. It lead to eco friendly and sustainable construction techniques which paved way for the concept of green building. Today EIA and environmental clearance are the only protectors of environment from the greeds of corporate sector across globe. If applied with stringency it will usher us to an era where any advancement will be apsolutely in tune with nature.This technical paper deals with the birth and growth of EIA in the world and in India. It deals with the processes that are involved in carrying out EIA for a project and subsequently providing it with environmental clearance. Also it emphasizes on how EIA led to a general awareness and paved way for the concept of sustainable construction.

  13. Jatobal virus antigenic characterization by ELISA and neutralization test using EIA as indicator, on tissue culture

    Directory of Open Access Journals (Sweden)

    Luiz Tadeu M. Figueiredo

    1988-06-01

    Full Text Available A virus antigenic characterization methodology using an indirect method of antibody detection ELISA with virus-infected cultured cells as antigen and a micro virus neutralisation test using EIA (NT-EIA as an aid to reading were used for antigenic characterization of Jatobal (BeAn 423380. Jatobal virus was characterized as a Bunyaviridae, Bunyavirus genus, Simbu serogroup virus. ELISA using infected cultured cells as antigen is a sensitive and reliable method for identification of viruses and has many advantages over conventional antibody capture ELISA's and other tests: it eliminates solid phase coating with virus and laborious antigen preparation; it permits screening of large numbers of virus antisera faster and more easily than by CF, HAI, or plaque reduction NT. ELISA and NT using EIA as an aid to reading can be applicable to viruses which do not produce cytopathogenic effect. Both techniques are applicable to identification of viruses which grow in mosquito cells.A caracterização antigênica do vírus Jatobal (BeAn 423380 foi efetuada utilizando uma técnica de ELISA para deteccão de anticorpos que utiliza culturas celulares infectadas como antígeno e um micro teste de neutralização para vírus que utiliza o método imunoenzimático como auxiliar para a leitura dos resultados (NT-EIA. O vírus Jatobal foi caracterizado como um Bunyaviridae, gênero Bunyavirus, pertencente ao sorogrupo Simbu. A técnica de ELISA, utilizando culturas celulares infectadas como antígeno, trata-se de método sensível e confiável na identificação de agentes virais, possuindo muitas vantagens sobre ELISA convencionais e outros testes: elimina a preparação laboriosa de antígenos para o revestimento em fase sólida; permite que se teste de forma mais rápida e fácil que por CF, HAI e neutralização por redução de plaques um grande número de antisoros de vírus. ELISA e NT-EIA podem ser utilizados para a classificação de vírus que não produzem

  14. Research of private label development in Croatia

    Directory of Open Access Journals (Sweden)

    Sandra Horvat

    2009-07-01

    Full Text Available Private labels have been present on the market since 19th century but their intensive market growth began in the last thirty years after retailers realized what their potential could be in the fight against ever-growing competition. Their market growth has not been distributed equally thought the world so Europe became the region with the highest private label market share, which exceeds 40% on some markets. Although the private label market share in Croatia is considerably smaller, it has also increased steadily over the last decade since private labels were introduced on the market. This paper presents the findings of a research conducted for the purpose of identifying trends in private label development on the Croatian market. The research was conducted through in-depth interviews with private label managers in retail companies in Croatia, and with the managers responsible for private label production in manufacturing companies. The research identified three expected trends of private label development in Croatia and these are: an increase in private label quality, the maintenance of a price gap between private labels and manufacturers’ brands and a further increase in the private label market share.

  15. Eye tracking and nutrition label use

    DEFF Research Database (Denmark)

    Graham, Dan J.; Orquin, Jacob Lund; Visschers, Vivianne H.M.

    2012-01-01

    Nutrition labels on food packages are among the most prominent and far-reaching policy measures related to diet and have the capacity to promote healthy eating. Unfortunately, certain nutrition label characteristics may impede consumer detection and comprehension of labels. Research using precise...... cameras monitoring consumer visual attention (i.e., eye tracking) has begun to identify ways in which label design could be modified to improve consumers’ ability to locate and effectively utilize nutrition information. The present paper reviews all published studies of nutrition label use that have...... utilized eye tracking methodology, identifies directions for further research in this growing field, and makes research-based recommendations for ways in which labels could be modified to improve consumers’ ability to use nutrition labels to select healthful foods....

  16. Dicty_cDB: FCL-AB19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AB19 (Link to dictyBase) - - - Contig-U15232-1 FCL-AB19Z ...(Link to Original site) - - FCL-AB19Z 697 - - - - Show FCL-AB19 Library FCL (Link to library) Clone ID FCL-A... http://dictycdb.biol.tsukuba.ac.jp/CSM/FCL/FCL-AB/FCL-AB19Q.Seq.d/ Representative seq. ID FCL-...AB19Z (Link to Original site) Representative DNA sequence >FCL-AB19 (FCL-AB19Q) /CSM/FCL/FCL-AB/FCL-...KLINFSIFQ* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value FCL-

  17. CdSe/ZnS Quantum Dot-Labeled Lateral Flow Strips for Rapid and Quantitative Detection of Gastric Cancer Carbohydrate Antigen 72-4

    Science.gov (United States)

    Yan, Xinyu; Wang, Kan; Lu, Wenting; Qin, Weijian; Cui, Daxiang; He, Jinghua

    2016-03-01

    Carbohydrate antigen 72-4 (CA72-4) is an important biomarker associated closely with diagnosis and prognosis of early gastric cancer. How to realize quick, sensitive, specific, and quantitative detection of CA72-4 in clinical specimens has become a great requirement. Herein, we reported a CdSe/ZnS quantum dot-labeled lateral flow test strip combined with a charge-coupled device (CCD)-based reader was developed for rapid, sensitive, and quantitative detection of CA72-4. Two mouse monoclonal antibodies (mAbs) against CA72-4 were employed. One of them was coated as a test line, while another mAb was labeled with quantum dots and coated onto conjugate pad. The goat anti-mouse IgG was immobilized as a control line. After sample was added, a sandwich structure was formed with CA72-4 and these two mAbs. The fluorescent signal from quantum dots (QD)-labeled mAb in sandwich structure was related to the amount of detected CA72-4. A CCD-based reader was used to realize quantitative detection of CA72-4. Results showed that developed QD-labeled lateral flow strips to detect CA72-4 biomarker with the sensitivity of 2 IU/mL and 10 min detection time. One hundred sera samples from clinical patients with gastric cancer and healthy people were used to confirm specificity of this strip method; results showed that established strip method own 100 % reproducibility and 100 % specificity compared with Roche electrochemiluminescence assay results. In conclusion, CdSe/ZnS quantum dot-labeled lateral flow strips for detection of CA72-4 could realize rapid, sensitive, and specific detection of clinical samples and could own great potential in clinical translation in near future.

  18. CdSe/ZnS Quantum Dot-Labeled Lateral Flow Strips for Rapid and Quantitative Detection of Gastric Cancer Carbohydrate Antigen 72-4.

    Science.gov (United States)

    Yan, Xinyu; Wang, Kan; Lu, Wenting; Qin, Weijian; Cui, Daxiang; He, Jinghua

    2016-12-01

    Carbohydrate antigen 72-4 (CA72-4) is an important biomarker associated closely with diagnosis and prognosis of early gastric cancer. How to realize quick, sensitive, specific, and quantitative detection of CA72-4 in clinical specimens has become a great requirement. Herein, we reported a CdSe/ZnS quantum dot-labeled lateral flow test strip combined with a charge-coupled device (CCD)-based reader was developed for rapid, sensitive, and quantitative detection of CA72-4. Two mouse monoclonal antibodies (mAbs) against CA72-4 were employed. One of them was coated as a test line, while another mAb was labeled with quantum dots and coated onto conjugate pad. The goat anti-mouse IgG was immobilized as a control line. After sample was added, a sandwich structure was formed with CA72-4 and these two mAbs. The fluorescent signal from quantum dots (QD)-labeled mAb in sandwich structure was related to the amount of detected CA72-4. A CCD-based reader was used to realize quantitative detection of CA72-4. Results showed that developed QD-labeled lateral flow strips to detect CA72-4 biomarker with the sensitivity of 2 IU/mL and 10 min detection time. One hundred sera samples from clinical patients with gastric cancer and healthy people were used to confirm specificity of this strip method; results showed that established strip method own 100 % reproducibility and 100 % specificity compared with Roche electrochemiluminescence assay results. In conclusion, CdSe/ZnS quantum dot-labeled lateral flow strips for detection of CA72-4 could realize rapid, sensitive, and specific detection of clinical samples and could own great potential in clinical translation in near future. PMID:26969591

  19. Ab Initio Studies of Stratospheric Ozone Depletion Chemistry

    Science.gov (United States)

    Lee, Timothy J.; Head-Gordon, Martin; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    An overview of the current understanding of ozone depletion chemistry, particularly with regards the formation of the so-called Antarctic ozone hole, will be presented together with an outline as to how ab initio quantum chemistry can be used to further our understanding of stratospheric chemistry. The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of fluorine, chlorine, bromine and nitrogen oxide species will be demonstrated by presentation of some example studies. The ab initio results will be shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the theoretical results are shown to fill in the gaps and to resolve experimental controversies. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of halogen oxide species will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of experimental studies.

  20. Hemoglobin Labeled by Radioactive Lysine

    Science.gov (United States)

    Bale, W. F.; Yuile, C. L.; DeLaVergne, L.; Miller, L. L.; Whipple, G. H.

    1949-12-08

    This paper reports on the utilization of tagged epsilon carbon of DL-lysine by a dog both anemic and hypoproteinemic due to repeated bleeding plus a diet low in protein. The experiment extended over period of 234 days, a time sufficient to indicate an erythrocyte life span of at least 115 days based upon the rate of replacement of labeled red cell proteins. The proteins of broken down red cells seem not to be used with any great preference for the synthesis of new hemoglobin.

  1. UK and Italian EIA systems: A comparative study on management practice and performance in the construction industry

    International Nuclear Information System (INIS)

    This study evaluates and contrasts the management practice and the performance that characterise Environmental Impact Assessments (EIA) in Italy and in the UK. The methodology relies on the investigation of six carefully selected case studies, critically reviewed by referring to EIA and project design information, as well as collecting the opinion of key project participants. The study focuses on the construction industry and on specific key sectors like infrastructure for transport and renewable energy and commercial and tourism development. A main term of reference for the analyses has been established by critically reviewing international literature so as to outline common good practice, requirements for the enhancement of sustainability principles and typically incurred drawbacks. The proposed approach enhances transfer of knowledge and of experiences between the analyzed contexts and allows the provision of guidelines for practitioners. Distinctive differences between the UK and the Italian EIA systems have been detected for pivotal phases and elements of EIA, like screening, scoping, analysis of alternatives and of potential impacts, definition of mitigation strategies, review, decision making, public participation and follow up. - Highlights: ► The Italian and the UK Environmental Impact Assessment systems are compared. ► The research is centred on the construction industry. ► Issues and shortcomings are analysed by investigating six case studies. ► Integration of EIA with sustainability principles is appraised. ► General guidelines are provided to assist practitioners in the two national contexts.

  2. UK and Italian EIA systems: A comparative study on management practice and performance in the construction industry

    Energy Technology Data Exchange (ETDEWEB)

    Bassi, Andrea, E-mail: ab395@bath.co.uk [University of Bath, Faculty of Engineering and Design, Claverton Down, Bath BA2 7AY (United Kingdom); Howard, Robert, E-mail: robhoward@constcom.demon.co.uk [Construction Communications, 8 Cotton& #x27; s Field, Dry Drayton, Cambridge CB23 8DG (United Kingdom); Geneletti, Davide, E-mail: davide.geneletti@ing.unitn.it [Sustainability Science Program, Harvard University, 79 JFK Street, Cambridge, MA 02138 (United States); Dept. of Civil and Environmental Engineering, University of Trento, Via Mesiano, 77 38123 Trento (Italy); Ferrari, Simone, E-mail: simone.ferrari@polimi.it [Dept. BEST, Building Environment Science and Technology, Politecnico di Milano, Via Bonardi, 3 20133 Milano (Italy)

    2012-04-15

    This study evaluates and contrasts the management practice and the performance that characterise Environmental Impact Assessments (EIA) in Italy and in the UK. The methodology relies on the investigation of six carefully selected case studies, critically reviewed by referring to EIA and project design information, as well as collecting the opinion of key project participants. The study focuses on the construction industry and on specific key sectors like infrastructure for transport and renewable energy and commercial and tourism development. A main term of reference for the analyses has been established by critically reviewing international literature so as to outline common good practice, requirements for the enhancement of sustainability principles and typically incurred drawbacks. The proposed approach enhances transfer of knowledge and of experiences between the analyzed contexts and allows the provision of guidelines for practitioners. Distinctive differences between the UK and the Italian EIA systems have been detected for pivotal phases and elements of EIA, like screening, scoping, analysis of alternatives and of potential impacts, definition of mitigation strategies, review, decision making, public participation and follow up. - Highlights: Black-Right-Pointing-Pointer The Italian and the UK Environmental Impact Assessment systems are compared. Black-Right-Pointing-Pointer The research is centred on the construction industry. Black-Right-Pointing-Pointer Issues and shortcomings are analysed by investigating six case studies. Black-Right-Pointing-Pointer Integration of EIA with sustainability principles is appraised. Black-Right-Pointing-Pointer General guidelines are provided to assist practitioners in the two national contexts.

  3. An analysis framework for characterizing and explaining development of EIA legislation in developing countries-Illustrated for Georgia, Ghana and Yemen

    Energy Technology Data Exchange (ETDEWEB)

    Kolhoff, Arend J., E-mail: akolhoff@eia.nl [Netherlands Commission for Environmental Assessment, P.O. Box 2345, 3500 GH Utrecht (Netherlands); Driessen, Peter P.J., E-mail: p.driessen@uu.nl [Copernicus Institute of Sustainable Development, Utrecht University, P.O. Box 80115, 3508 TC (Netherlands); Runhaar, Hens A.C., E-mail: h.a.c.runhaar@uu.nl [Copernicus Institute of Sustainable Development, Utrecht University, P.O. Box 80115, 3508 TC (Netherlands)

    2013-01-15

    Actors in the field of international development co-operation supporting the development of EIA legislation in developing countries often do not achieve the results envisaged. The performance of EIA in these countries often remains weak. One reason, we assume, is that often those actors support the establishment of overly ambitious EIA legislation that cannot achieve its objectives in the light of constraining contexts. To provide more effective support we need to better understand the enabling and constraining contextual factors that influence the development of EIA legislation and to which support actors should align itself. In this article a new analysis framework for classifying, characterizing and explaining the development of EIA legislation is described, measured in terms of ambition levels. Ambitions are defined as intentions the EIA authorities aim to fulfill, expressed in formal EIA legislation. Three country cases, Yemen, Georgia and Ghana are used to illustrate the usefulness of our framework and as a first test to refine the framework. We have formulated the following five hypotheses that complement and refine our analysis framework. One, EIA legislation may develop multilinearly in terms of ambition levels. Two, ambitions in EIA legislation seem to be influenced to a great extent by the power and capacity of, on the one hand, the environmental authorities supporting EIA and, on the other hand, the sector authorities hindering the development of EIA. Three, the political system is the most important context factor influencing the rules of policy-making and the power of the different actors involved. Four, the importance of context factors on the development of ambitions is dependent on the phase of EIA system development. Five, some ambitions seem to be influenced by particular factors; for instance the ambitions for the object of study seem to be influenced by the level of environmental awareness of the sector ministries and parliament. The analysis

  4. The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves.

    Directory of Open Access Journals (Sweden)

    Rui An

    Full Text Available Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues. We are interested in dissecting these regulatory circuits genetically and report here the isolation of two Arabidopsis dominant mutants, abnormal shoot5-1D (abs5-1D and abs7-1D identified through activation tagging screens. Both abs5-1D and abs7-1D display an intriguing upwardly curly leaf phenotype. Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively. Protoplast transient expression assays confirmed that both ABS5/T5L1 and ABS7/MYB101 are targeted to the nucleus. Interestingly, the expression domains of auxin response reporter DR5::GUS were abnormal in leaves of abs5-1D and ABS5/T5L1 over-expression lines. Moreover, cotyledon venation analysis showed that more areoles and free-ending veins are formed in abs5-1D. We found that the epidermis-specific expressions of ABS5/T5L1 or ABS7/MYB101 driven by the Arabidopsis Meristem Layer 1 promoter (PAtML1 were sufficient to recapitulate the curly leaf phenotype of abs5-1D or abs7-1D. In addition, PAtML1::ABS5 lines exhibited similar changes in DR5::GUS expression patterns as those found in 35S-driven ABS5/T5L1 over-expression lines. Our work demonstrated that enhanced expressions of two transcription factors, ABS5/T5L1 and ABS7/MYB101, are able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis.

  5. Ab initio simulation of transport phenomena in rarefied gases.

    Science.gov (United States)

    Sharipov, Felix; Strapasson, José L

    2012-09-01

    Ab initio potentials are implemented into the direct simulation Monte Carlo (DSMC) method. Such an implementation allows us to model transport phenomena in rarefied gases without any fitting parameter of intermolecular collisions usually extracted from experimental data. Applying the method proposed by Sharipov and Strapasson [Phys. Fluids 24, 011703 (2012)], the use of ab initio potentials in the DSMC requires the same computational efforts as the widely used potentials such as hard spheres, variable hard sphere, variable soft spheres, etc. At the same time, the ab initio potentials provide more reliable results than any other one. As an example, the transport coefficients of a binary mixture He-Ar, viz., viscosity, thermal conductivity, and thermal diffusion factor, have been calculated for several values of the mole fraction. PMID:23030889

  6. Simplest AB-Thermonuclear Space Propulsion and Electric Generator

    CERN Document Server

    Bolonkin, A

    2007-01-01

    The author applies, develops and researches mini-sized Micro- AB Thermonuclear Reactors for space propulsion and space power systems. These small engines directly convert the high speed charged particles produced in the thermonuclear reactor into vehicle thrust or vehicle electricity with maximum efficiency. The simplest AB-thermonuclear propulsion offered allows spaceships to reach speeds of 20,000 50,000 km/s (1/6 of light speed) for fuel ratio 0.1 and produces a huge amount of useful electric energy. Offered propulsion system permits flight to any planet of our Solar system in short time and to the nearest non-Sun stars by E-being or intellectual robots during a single human life period. Key words: AB-propulsion, thermonuclear propulsion, space propulsion, thermonuclear power system.

  7. Surface Modification of AB2. and AB5 Hydrogen Storage Alloy Electrodes by the Hot-Charging Treatment

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The effect of the hot-charging treatment on the performance ofAB2 and AB5 hydrogen storage alloy electrodes was investigated. The result showed that the treatment can markedly improve the voltage plateau ratio (VPR), the high rate discharge ability (HRDA), the diffusion coefficient of hydrogen DH and the discharge capacity of the AB2 hydrogen storage alloy electrode. The SEM analysis showed that the hot-charging treatment brings about a Ni-rich surface due to the dissolution of Zr oxides. It is also very helpful for the improvement of the kinetic properties of AB2 hydrogen storage alloy electrode because the microcracking o.f the surface results in fresh surface. This can be the basic modification treatment for NiMH battery used in electric vehicles (EVs) in the future. But for AB5 type alloys, the treatment has the disadvantage of impairing the comprehensive electrochemical properties, because the surface of the alloy may be corroded during the treatment. The mechanism of the surface modification of the electrode is also proposed.

  8. Stimulation of UvrD helicase by UvrAB.

    Science.gov (United States)

    Atkinson, John; Guy, Colin P; Cadman, Chris J; Moolenaar, Geri F; Goosen, Nora; McGlynn, Peter

    2009-04-01

    Helicases play critical roles in all aspects of nucleic acid metabolism by catalyzing the remodeling of DNA and RNA structures. UvrD is an abundant helicase in Escherichia coli with well characterized functions in mismatch and nucleotide excision repair and a possible role in displacement of proteins such as RecA from single-stranded DNA. The mismatch repair protein MutL is known to stimulate UvrD. Here we show that the nucleotide excision repair proteins UvrA and UvrB can together stimulate UvrD-catalyzed unwinding of a range of DNA substrates containing strand discontinuities, including forked DNA substrates. The stimulation is specific for UvrD, as UvrAB failed to stimulate Rep helicase, a UvrD homologue. Moreover, although UvrAB can promote limited strand displacement, stimulation of UvrD did not require the strand displacement function of UvrAB. We conclude that UvrAB, like MutL, modulate UvrD helicase activity. This stimulation likely plays a role in DNA strand and protein displacement by UvrD in nucleotide excision repair. Promotion of UvrD-catalyzed unwinding of nicked duplexes by UvrAB may also explain the need for UvrAB and UvrD in Okazaki fragment processing in cells lacking DNA polymerase I. More generally, these data support the idea that helicase activity is regulated in vivo, with helicases acting as part of multisubunit complexes rather than in isolation. PMID:19208629

  9. Immunoscintigraphy using /sup 111/In-DTPA labeled monoclonal antibodies: Comparison between ETC and planar imaging

    Energy Technology Data Exchange (ETDEWEB)

    Happ, J.; Baum, R.P.; Frohn, J.; Weimer, B.; Hoer, G.; Halbsguth, A.; Lochner, B.; Brandhorst, I.

    1987-12-01

    The present study was done in order to examine if the use of /sup 111/In-DTPA-labeled MAb fragments in place of /sup 131/I-labeled MAb fragments increases the sensitivity of tomographic immunoscintigraphy to reach the level of that of planar imaging techniques. In 11 patients with various primary tumors, local recurrences or metastases (colorectal carcinoma (n=7), ovarian carcinoma (n=2), papillary thyroid carcinoma (n=1), undifferentiated carcinoma of the lung (n=1)), immuniscintigraphy (IS) was carried out using /sup 111/In-DTPA-labeled F(ab')/sub 2/ fragments of various MAbs (anti-CEA, OC 125, anti-hTG) and planar and tomographic imaging were compared intraindividually. By conventional diagnostic procedures, the presence of a tumor mass was confirmed (transmission computer tomography, ultrasound) or verified (/sup 131/I whole-body scintigraphy, histology) in all cases. Immunoscintigraphy was positive in 9 out of 11 cases by ECT and in 10 out of 11 cases by planar imaging. When using /sup 111/In-labeled MAb fragments, intraindividual comparison of ECT and planar imaging resulted in a similar sensitivity. The increased sensitivity of ECT using this tracer in contrast to /sup 131/I-labeled MAb fragments may be attributed to the fact that the physical properties of /sup 111/In are much more suitable for the gamma cameras most commonly used (single detector, 38'' crystal); using /sup 111/In-labelled MAb fragments, count rates sufficient for ECT can be obtained within a reasonable acquisition time. This allows to combine IS with the advantages of ECT regarding tumour localization and prevention of artefacts due to superposition of background.

  10. Link Label Prediction in Signed Citation Network

    KAUST Repository

    Akujuobi, Uchenna

    2016-04-12

    Link label prediction is the problem of predicting the missing labels or signs of all the unlabeled edges in a network. For signed networks, these labels can either be positive or negative. In recent years, different algorithms have been proposed such as using regression, trust propagation and matrix factorization. These approaches have tried to solve the problem of link label prediction by using ideas from social theories, where most of them predict a single missing label given that labels of other edges are known. However, in most real-world social graphs, the number of labeled edges is usually less than that of unlabeled edges. Therefore, predicting a single edge label at a time would require multiple runs and is more computationally demanding. In this thesis, we look at link label prediction problem on a signed citation network with missing edge labels. Our citation network consists of papers from three major machine learning and data mining conferences together with their references, and edges showing the relationship between them. An edge in our network is labeled either positive (dataset relevant) if the reference is based on the dataset used in the paper or negative otherwise. We present three approaches to predict the missing labels. The first approach converts the label prediction problem into a standard classification problem. We then, generate a set of features for each edge and then adopt Support Vector Machines in solving the classification problem. For the second approach, we formalize the graph such that the edges are represented as nodes with links showing similarities between them. We then adopt a label propagation method to propagate the labels on known nodes to those with unknown labels. In the third approach, we adopt a PageRank approach where we rank the nodes according to the number of incoming positive and negative edges, after which we set a threshold. Based on the ranks, we can infer an edge would be positive if it goes a node above the

  11. Label Space Reduction in MPLS Networks: How Much Can A Single Stacked Label Do?

    DEFF Research Database (Denmark)

    Solano, Fernando; Stidsen, Thomas K.; Fabregat, Ramon;

    2008-01-01

    Most network operators have considered reducing LSR label spaces (number of labels used) as a way of simplifying management of underlaying virtual private networks (VPNs) and therefore reducing operational expenditure (OPEX). The IETF outlined the label merging feature in MPLS-allowing the config......Most network operators have considered reducing LSR label spaces (number of labels used) as a way of simplifying management of underlaying virtual private networks (VPNs) and therefore reducing operational expenditure (OPEX). The IETF outlined the label merging feature in MPLS...

  12. A few viewpoints on an EIA in connection with the siting of an encapsulation facility and a repository for spent nuclear fuel

    International Nuclear Information System (INIS)

    It is argued that the EIA can not be performed by the proponent (in this case SKB), but rather by a body that does not represent a main party of the project scrutinized. Also, the EIA process must fulfill the demands on insight and participation that different parties are entitled to make. Adequate time and funding must be available to facilitate a serious participation

  13. A few viewpoints on an EIA in connection with the siting of an encapsulation facility and a repository for spent nuclear fuel

    Energy Technology Data Exchange (ETDEWEB)

    Toernqvist, M. [People`s Campaign against Nuclear Power - Nuclear Weapons (Sweden)

    1995-12-01

    It is argued that the EIA can not be performed by the proponent (in this case SKB), but rather by a body that does not represent a main party of the project scrutinized. Also, the EIA process must fulfill the demands on insight and participation that different parties are entitled to make. Adequate time and funding must be available to facilitate a serious participation.

  14. AB Levitrons and their Applications to Earth's Motionless Satellites

    CERN Document Server

    Bolonkin, Alexander

    2007-01-01

    Author offers the new and distinctly revolutionary method of levitation in artificial magnetic field. It is shown that a very big space station and small satellites may be suspended over the Earth's surface and used as motionless radio-TV translators, telecommunication boosters, absolute geographic position locators, personal and mass entertainment and as planet-observation platforms. Presented here is the theory of big AB artificial magnetic field and levitation in it is generally developed. Computation of three macro-projects: space station at altitude 100 km, TV-communication antenna at height 500 m, and multi-path magnetic highway. Key words: levitation, AB Levitrons, motionless space satellite.

  15. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    International Nuclear Information System (INIS)

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1962. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses (≥ 100 mrem/quarter) is for the whole of AB Atomenergi during this year 74. 2 manrem corresponding to about 50 mrem/year and person or 1 % of the maximum permissible dose. 32500 gamma films and 6200 neutron films have been evaluated. The total number of urine analyses is 2700 and of whole body measurements 10

  16. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    International Nuclear Information System (INIS)

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1963. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses during the year is for AB Atomenergi 64.2 manrem which, distributed over the whole company personnel, corresponds to about 40 mrem per year and person or about 1 % of the maximum permissible dose. 37800 gamma films and 6700 neutron films have been evaluated. The total number of urine analyses is 3603 and of whole body measurements 211

  17. Intern kontroll : - En studie om Schroff Scandinavia ABs interna kontroll

    OpenAIRE

    Huldt, Martin; Björksved, Patrick

    2014-01-01

    Sammanfattning: ”Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll” Datum:  2014-06-11 Nivå: Kandidatuppsats i företagsekonomi, 15 ECTS Institution: Akademin för Ekonomi, Samhälle och Teknik, EST,                 Mälardalen Högskola Författare: Patrick Björksved, Martin Huldt Titel: Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll Handledare : Magnus Linderström Nyckelord: Intern kontroll, intern revision, intern styrning, COSO-modellen, Lean product...

  18. Utveckling av ergoterapitjänster vid Helsingfors ergoterapi Ab

    OpenAIRE

    Sandells, Linn

    2015-01-01

    Syftet med examensarbetet är att ta fram kvalitativa rekommendationer på ergoterapitjänster för barn i behov av särskilt stöd. Det har gjorts genom en processinriktad metod, rekommendationerna på ergoterapitjänster har tagits fram för Helsingfors ergoterapi Ab. Aktivitetsrättvisa är den teoretiska referensramen i arbetet. Den frågeställning som besvarats är vilka ergoterapitjänster kan rekommenderas till Helsingfors ergoterapi Ab. För att uppnå resultatet har materialinsamling och intervjuer ...

  19. Bruksmakt och maktbruk : Robertsfors AB 1897-1968

    OpenAIRE

    Holmström, Per

    1988-01-01

    This thesis studies seven strategic decisions made in the family-owned forestry company Robertsfors AB, in Northern Sweden. During the present century Ro­bertsfors AB has developed from a patriarchally concern controlled into a capi­talistic industrial company. This also meant a radical change in the decision­making process. Two factors were decisive in this process: the managing direc­tor's values, and altered power relationships both within the company and exter­nally in relation to e g sta...

  20. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    Directory of Open Access Journals (Sweden)

    G. Misra

    2011-01-01

    Full Text Available Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P, volume (V and temperature (T that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This ab initio method is extended to derive the equation of state for Mercuric Calcogenides. The present equation of state has also been tested for the prediction of End Point. The computed results compare well with Quantum statistical data.

  1. Towards new horizons in ab initio nuclear structure theory

    International Nuclear Information System (INIS)

    We review recent advances in ab initio nuclear structure theory, which have changed the horizons of this field. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to further soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative QCD-based predictions are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (authors)

  2. Recent achievements in ab initio modelling of liquid water

    CERN Document Server

    Khaliullin, Rustam Z

    2013-01-01

    The application of newly developed first-principle modeling techniques to liquid water deepens our understanding of the microscopic origins of its unusual macroscopic properties and behaviour. Here, we review two novel ab initio computational methods: second-generation Car-Parrinello molecular dynamics and decomposition analysis based on absolutely localized molecular orbitals. We show that these two methods in combination not only enable ab initio molecular dynamics simulations on previously inaccessible time and length scales, but also provide unprecedented insights into the nature of hydrogen bonding between water molecules. We discuss recent applications of these methods to water clusters and bulk water.

  3. Use of ab initio quantum chemical methods in battery technology

    Energy Technology Data Exchange (ETDEWEB)

    Deiss, E. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-06-01

    Ab initio quantum chemistry can nowadays predict physical and chemical properties of molecules and solids. An attempt should be made to use this tool more widely for predicting technologically favourable materials. To demonstrate the use of ab initio quantum chemistry in battery technology, the theoretical energy density (energy per volume of active electrode material) and specific energy (energy per mass of active electrode material) of a rechargeable lithium-ion battery consisting of a graphite electrode and a nickel oxide electrode has been calculated with this method. (author) 1 fig., 1 tab., 7 refs.

  4. Radiopharmaceutical potential of I-131 labelled diazepam

    International Nuclear Information System (INIS)

    In this study, diazepam is a derivative of the 1.4 benzodiazepine family that the most widely used drug as anticonvulsant agent has been labeled with I-131, as a new radiopharmaceutical and its radiopharmaceutical potential has been determined. Labeling of diazepam has been performed by iodogen method and optimum labeling conditions have been determined. Optimum reaction conditions are 1 mg for iodogen amount; 1-5 mg for diazepam amount, 15-20 minutes for reaction time and room temperature for reaction temperature. Specific activity of labeled compound was 0,15 Ci/mmol level. N-octanol/water ratio was found 1.9 for 131IDZ (131I labeled diazepam). In vivo experiments have been carried out to determine radiopharmaceutical potentials of labeled compound. Biodistribution studies on rats showed that 131IDZ have accumulated in kidneys, liver, lungs and brain tissues. Scintigraphic results taken with gamma camera on rabbits agree with biodistribution results of rats. (author)

  5. Irradiation test of bar code label

    International Nuclear Information System (INIS)

    The irradiation test of bar code label tagged on radioactive waste container was done to determine the effect of radiation. Low and medium radioactive waste is that below total activity of 4,000Bq/g according to the Korean nuclear law. The irradiation amount to radiate bar code label tagged on radioactive waste container was calculated by MCNP-4b computer code. The nuclide such as Co-60 and Cs-137 was assumed to contribute 50 % of total activity. Real irradiation amount for bar code label was finally calculated by the dimensions of the container and the bar code label. The identification of post and the physical deflection of irradiated bar code label was tested by the bar code reader. The coated bar code label was suitable to use on low and medium radioactive waste container

  6. Improving Recurrent Neural Networks For Sequence Labelling

    OpenAIRE

    Dinarelli, Marco; Tellier, Isabelle

    2016-01-01

    In this paper we study different types of Recurrent Neural Networks (RNN) for sequence labeling tasks. We propose two new variants of RNNs integrating improvements for sequence labeling, and we compare them to the more traditional Elman and Jordan RNNs. We compare all models, either traditional or new, on four distinct tasks of sequence labeling: two on Spoken Language Understanding (ATIS and MEDIA); and two of POS tagging for the French Treebank (FTB) and the Penn Treebank (PTB) corpora. The...

  7. Alternative ways for private label manufacturing

    OpenAIRE

    Kelemen, Zita; Némethné Tömő, Zsuzsa

    2010-01-01

    Private labels are a growing phenomenon globaly. retatlers become stronger and stronger by offering their own quality private label product for customers in all segments. Certainly they do not open factories to produce these items but rather search for dedicated private label producers or pressure branded goods manufacturers to produce it for them. The article deals with the strategic choiches manufacturers can have and suggest the necessary factors that need to be evaluated to decide on the ...

  8. Extending Modal Transition Systems with Structured Labels

    DEFF Research Database (Denmark)

    Bauer, Sebastian S.; Juhl, Line; Larsen, Kim Guldstrand;

    2012-01-01

    We introduce a novel formalism of label-structured modal transition systems that combines the classical may/must modalities on transitions with structured labels that represent quantitative aspects of the model. On the one hand, the specification formalism is general enough to include models like...... study modal and thorough refinement, determinization, parallel composition, conjunction, quotient, and logical characterization of label-structured modal transition systems....

  9. Comparison between the Chinese EIA Guidelines for Air Dispersion Modelling and the Advanced Air Dispersion Model ADMS

    Institute of Scientific and Technical Information of China (English)

    David Carruthers; Sheng Xiangyu; Christine McHugh

    2005-01-01

    This paper makes comparisons between Chinese Environmental Impact Assessment (EIA)Guidelines for Air dispersion modelling and the advanced air dispersion model ADMS. Since 2001 the ADMS model has been the first and only foreign model that has been approved by the Appraisal Center for Environment and Engineering (ACEE) to be used in EIA projects in China (http://www. china-eia.com/inden_content/rjrz/rjrz_ADMS/htm). In the paper the following sections provide brief descriptions of the main features of the Chinese Guidelines for Air Dispersion (Section 2) and ADMS (Section 3);Section 4 provides a comparison of the two modelling methods for some simple cases and conclusions and discussion are given in Section 5.

  10. ML-MG: Multi-label Learning with Missing Labels Using a Mixed Graph

    KAUST Repository

    Wu, Baoyuan

    2015-12-07

    This work focuses on the problem of multi-label learning with missing labels (MLML), which aims to label each test instance with multiple class labels given training instances that have an incomplete/partial set of these labels (i.e. some of their labels are missing). To handle missing labels, we propose a unified model of label dependencies by constructing a mixed graph, which jointly incorporates (i) instance-level similarity and class co-occurrence as undirected edges and (ii) semantic label hierarchy as directed edges. Unlike most MLML methods, We formulate this learning problem transductively as a convex quadratic matrix optimization problem that encourages training label consistency and encodes both types of label dependencies (i.e. undirected and directed edges) using quadratic terms and hard linear constraints. The alternating direction method of multipliers (ADMM) can be used to exactly and efficiently solve this problem. To evaluate our proposed method, we consider two popular applications (image and video annotation), where the label hierarchy can be derived from Wordnet. Experimental results show that our method achieves a significant improvement over state-of-the-art methods in performance and robustness to missing labels.

  11. Modified procedure for labelling target cells in a europium release assay of natural killer cell activity.

    Science.gov (United States)

    Pacifici, R; Di Carlo, S; Bacosi, A; Altieri, I; Pichini, S; Zuccaro, P

    1993-05-01

    Lanthanide europium chelated to diethylenetriaminopentaacetate (EuDTPA) can be used to label target cells such as tumor cells and lymphocytes (Blomberg et al., 1986a,b; Granberg et al., 1988). This procedure has permitted the development of new non-radioactive methods for the detection of target cell cytolysis by natural killer (NK) cells (Blomberg et al., 1986a,b), cytotoxic T lymphocytes (CTL) (Granberg et al., 1988) or complement-mediated cytolysis (Cui et al., 1992). However, we had no success with this method because of a lack of comparability between human NK cell activity simultaneously measured by a classical 51Cr release assay (Seaman et al., 1981) and EuDTPA release assay (Blomberg et al., 1986a). Furthermore, cell division and cell viability were significantly impaired by the suggested concentrations of EuCl3. In this paper, we present a modified non-cytotoxic method for target cell labelling with EuDTPA while cells are growing in culture medium. PMID:8486925

  12. Environmental Impact Assessment (EIA of Gas Pipeline Transmission (Case Study: Duzduzan – Ahar

    Directory of Open Access Journals (Sweden)

    Saeed Karimi

    2014-12-01

    Full Text Available The national gas transmission Ahar – Duzduzan, transmit fresh gas in the West north of Iran. According to Iran’s environmental regulation, construction and operation of pipelines is required EIA studies. Due to this linear project it is required to develop a particular EIA methodology on this kind of projects. Therefore at first we attempted to get a real knowledge about environmental endnotes of project with library and field studies. Along with reviewing the technical resources of the project, attempted to identify all of the construction and operation activities. Finally two methods of explanatory checklist and simplified matrix selected for EIA. In The construction phase 19 micro activities have evaluated in front of about 12 environmental factors (in the various environments. In the construction phase, activities such as; excavation, embankment and excavation show the greatest negative impact on the whole environment of area. And the most important activity with positive effects on the aforementioned factors is manpower recruitment. Also In the operation phase 15 micro activities have evaluated in front of about 15 environmental factors (in the various environments. In the Operation phase activities such as; grazing, vehicle traffic and wastewater production can have negative effects. Most positive impacts on environmental factors are revenue and welfare, employment levels, commerce and manning activities, immigration control and air quality. Most of the Operation phase effects are positive which involve; exploitation of gas or natural gas transportation and gas pipeline monitoring. According to the developed methodology it is necessary to use RS and GIS tools in the study current environment situation, routing environmental alternatives and make land use maps of transmission path. With regard to all issues presented in explanatory checklist of this project and also previous clauses from the standpoint of environmental compliance

  13. GJ 282 AB (WDS 07400-0336 AB = BGH 3 AB) and GICLAS 112-29: A Very Wide System in Process of Dissociation

    Science.gov (United States)

    Rica, F. M.; Benavides, R.

    2016-04-01

    Very wide binaries are interesting objects that shed light on the binary formation process and their dynamical evolution. Poveda et al. (2009) studied the possible physical relation of the near (14.2 pc) and wide (~58") binary star GJ 282 AB and the extremely wide (1.09º; ~55,000 AU) companion, NLTT 18149, and they concluded that this very wide system is in the process of dynamical disintegration. In this work, we confirm the same conclusion but using a different method. We first study dynamically GJ 282 AB, confirmed that it is a bound system and then we determine possible orbital solutions. Later, we calculate the relative velocity of NLTT 18149 with respect to the GJ 282 AB's center mass using their (U, V, W) galactocentric velocity. The relative velocity, Vrel = 1.98 ± 0.16 km s-1, is much larger than the escape velocity (0.25 ± 0.01 km s-1). Therefore, with a significance level of 11s, we also conclude that this very wide system is in a process of dynamical disintegration.

  14. Synthesis of tritium labelled 24-epibrassinolide

    Energy Technology Data Exchange (ETDEWEB)

    Kolbe, A.; Marquardt, V.; Adam, G. (Inst. of Plant Biochemistry Halle, Halle/Saale (Germany))

    1992-10-01

    Deuterium and tritium 5,7,7-tris-labelled 24-epibrassinolide were prepared by base catalyzed exchange reaction using 24-epicastasterone tetraacetate 1 or bis-isopropylidenedioxy-24-epicastasterone 8 and labelled water. Baeyer-Villiger oxidation of the obtained labelled 6-ketones 2 and 3 with CF[sub 3]CO[sub 3]H gave after alkaline deacetylation of the resulting 4 and 5 the desired tris-labelled 24-epibrassinolides 6 and 7, respectively, or starting from 9 under simultaneous oxidation and deprotection in one step the same final products. (author).

  15. Novel Properties of Fuzzy Labeling Graphs

    OpenAIRE

    Nagoor Gani, A.; Muhammad Akram; D. Rajalaxmi (a) Subahashini

    2014-01-01

    The concepts of fuzzy labeling and fuzzy magic labeling graph are introduced. Fuzzy magic labeling for some graphs like path, cycle, and star graph is defined. It is proved that every fuzzy magic graph is a fuzzy labeling graph, but the converse is not true. We have shown that the removal of a fuzzy bridge from a fuzzy magic cycle with odd nodes reduces the strength of a fuzzy magic cycle. Some properties related to fuzzy bridge and fuzzy cut node have also been discussed.

  16. Simultaneous segmentation and statistical label fusion

    Science.gov (United States)

    Asman, Andrew J.; Landman, Bennett A.

    2012-02-01

    Labeling or segmentation of structures of interest in medical imaging plays an essential role in both clinical and scientific understanding. Two of the common techniques to obtain these labels are through either fully automated segmentation or through multi-atlas based segmentation and label fusion. Fully automated techniques often result in highly accurate segmentations but lack the robustness to be viable in many cases. On the other hand, label fusion techniques are often extremely robust, but lack the accuracy of automated algorithms for specific classes of problems. Herein, we propose to perform simultaneous automated segmentation and statistical label fusion through the reformulation of a generative model to include a linkage structure that explicitly estimates the complex global relationships between labels and intensities. These relationships are inferred from the atlas labels and intensities and applied to the target using a non-parametric approach. The novelty of this approach lies in the combination of previously exclusive techniques and attempts to combine the accuracy benefits of automated segmentation with the robustness of a multi-atlas based approach. The accuracy benefits of this simultaneous approach are assessed using a multi-label multi-atlas whole-brain segmentation experiment and the segmentation of the highly variable thyroid on computed tomography images. The results demonstrate that this technique has major benefits for certain types of problems and has the potential to provide a paradigm shift in which the lines between statistical label fusion and automated segmentation are dramatically blurred.

  17. (d,1)-total labelling of graphs

    OpenAIRE

    Havet, Frédéric; Yu, Min-Li

    2002-01-01

    A $(d,1)$-total labelling of a graph $G$ is an assignment of integers to $V(G)\\cup E(G)$ such that: (i) any two adjacent vertices of $G$ receive distinct integers, (ii) any two adjacent edges of $G$ receive distinct integers, and (iii) a vertex and its incident edge receive integers that differ by at least $d$ in absolute value. The {\\it span} of a $(d,1)$-total labelling is the maximum difference between two labels. The minimum span of a $(d,1)$-total labelling of $G$ is denoted by $\\lambda_...

  18. Classifier Risk Estimation under Limited Labeling Resources

    OpenAIRE

    Kumar, Anurag; Raj, Bhiksha

    2016-01-01

    In this paper we propose strategies for estimating performance of a classifier when labels cannot be obtained for the whole test set. The number of test instances which can be labeled is very small compared to the whole test data size. The goal then is to obtain a precise estimate of classifier performance using as little labeling resource as possible. Specifically, we try to answer, how to select a subset of the large test set for labeling such that the performance of a classifier estimated ...

  19. Comparison of IgG and F(ab'){sub 2} fragments of bispecific anti-RCC x anti-DTIn-1 antibody for pretargeting purposes

    Energy Technology Data Exchange (ETDEWEB)

    Schaijk, Frank G. van; Boerman, Otto C.; Soede, Annemieke C.; Corstens, Frans H.M. [Radboud University Nijmegen Medical Centre, Department of Nuclear Medicine, P.O. Box 9101, Nijmegen (Netherlands); McBride, William J. [Immunomedics, Inc., Morris Plains, NJ (United States); Goldenberg, David M. [Immunomedics, Inc., Morris Plains, NJ (United States); Center for Molecular Medicine and Immunology, Garden State Cancer Center, Belleville, NJ (United States); Oosterwijk, Egbert [Radboud University Nijmegen Medical Center, Department of Urology, Nijmegen (Netherlands); Ludwig Institute for Cancer Research, New York, NY (United States)

    2005-09-01

    An effective pretargeting strategy was developed for renal cell carcinoma (RCC) based on a biologically produced bispecific monoclonal antibody: anti-RCC x anti-DTPA(In) (bsMAb: G250 x DTIn-1). Tumour uptake of a {sup 111}In-labelled bivalent peptide after pretargeting with bsMAb G250 x DTIn-1 was relatively high compared with that in other pretargeting systems using chemically coupled F(ab'){sub 2} fragments. Here, we investigated the effect of the bsMAb form in the pretargeting strategy. To determine the optimal interval between the administration of each of the bsMAb forms and the {sup 111}In-labelled bivalent peptide, the biodistribution of the radioiodinated bsMAb forms was studied in athymic mice with subcutaneous SK-RC-1 RCC tumours. Since tumour targeting of the radiolabelled peptide depends on the bsMAb form and dose, a bsMAb dose escalation study was carried out for both bsMAb forms. Under optimised conditions, the biodistribution of the {sup 111}In label in mice with pretargeted RCC was determined from 4 h up to 7 days p.i. The optimal interval between the two administrations was 72 h for the bsMAb IgG and 4 h for the bsMAb F(ab'){sub 2}. The optimal bsMAb dose for intact IgG was 67 pmol and the optimal bsMAb F(ab'){sub 2} dose was 200 pmol. Targeting of the pretargeted RCC with 4 pmol {sup 111}In-labelled bivalent peptide revealed high tumour uptake with both bsMAb forms. With the pretargeting strategy, using either bsMAb IgG or bsMAb F(ab'){sub 2}, very efficient peptide targeting of the tumour was obtained. Uptake and retention of the radiolabel in the tumour with the pretargeting approach are not affected by the bsMAb form used. (orig.)

  20. Principles of food product labelling

    Directory of Open Access Journals (Sweden)

    Krystyna Krysztofiak

    2011-09-01

    Full Text Available The purpose of the label of the food product is to provide information on ingredients and additionally on its origin, production method, storage conditions, date tagging, as well as to enable to identify the producer or distributor of this product. Legal regulations precisely give instructions on the range and the way of the presentation of these data, so they could be clear and understandable for the average consumer. Since 25th of November 2005, the information about allergens’ presence must be placed on the label, regardless of their content in the product (Directive 2003/89/WE... 2003 – Off. J. L 308: 15-18. The Regulation (WE No 1924/2006 about placing the nutritional information and medicinal claims concerning foods (Regulation (WE No 1924/2006... 2006 a is valid in all countries of European Union since 1st of July 2007 (Off. J. L 404: 9-25. It coordinates the legislative, executive and administrative regulations connected with this labelling. According to these regulations, “nutritional information” states, suggests or gives to understand that the food product has special properties concerning its ingredients. Those statements are of type: “the source of...”, “no... content”, “high content of...”, “low content of...”, “reduced content of...” with reference to calorie or selected ingredients’ content. “Medicinal claims” state, suggest or give to understand, that there is a connection between the food product or one of its ingredients and the health condition of the consumer. First type of these medicinal claims refers to the influence of the ingredient on the physiology. Such a statement is based on generally accepted scientific conclusions and could be properly understood by the average consumer, e.g. “calcium takes part in the process of building of strong bones”. “Statements about decreasing the risk of a disease” give information, that food product or one of its ingredients efficiently

  1. Synthesis and labelling of epidepride

    International Nuclear Information System (INIS)

    S-(-)-N-[(1-ethyl-2-pyrrolidinyl) methyl]-5-iodo-2,3-dimethoxybenzamide (proposed generic name, epidepride) is a very potent dopamine D2 antagonist. It was synthesized by five steps from 3-methoxysalicylic acid. [131I]epidepride was obtained in 97.3% radiochemical yields from the corresponding 5-(tributyltin) derivative using hydrogen peroxide as the oxidant. The aryltin precursor was prepared from non-labelled epidepride by palladium-catalyzed stannylene using bis (tri-n-butyltin) in triethylamine. [131I] epidepride was stable under 4 degree C, and partition coefficient was 72.3 at pH 7.40. The biodistribution study in rats exhibited high localization in the striatum of the brain with the striatum/cerebellum ratio reaching 237/1 at 320 min postinjection. All these results suggest that [131I] epidepride may be used widely as a useful dopamine D2 receptor imaging agent for SPECT

  2. Synthesis and labelling of epidepride

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    S-(-)-N-[(1-ethyl-2-pyrrolidinyl)methyl]-5-iodo-2,3-dimethoxybenzamide (proposed generic name, epidepride) is a very potent dopamine D2 antagonist. It was synthesized by five steps from 3-methoxysalicylic acid. [131I]epidepride was obtained in 97.3% radiochemical yields from the corresponding 5-(tributyltin) derivative using hydrogen peroxide as the oxidant. The aryltin precursor was prepared from non-labelled epidepride by palladium-catalyzed stannylation using bis(tri-n-butyltin) in triethylamine. [131I]epidepride was stable under 4℃, and partition coefficient was 72.3 at pH 7.40. The biodistribution study in rats exihibited high localization in the striatum of the brain with the striatum/cerebellum ratio reaching 237/1 at 320 min postinjection.All these results suggest that[131I]epidepride may be usedd widely as a useful dopamineD2 receptor imaging agent for SPECT.

  3. 21 CFR 1302.04 - Location and size of symbol on label and labeling.

    Science.gov (United States)

    2010-04-01

    ... AND PACKAGING REQUIREMENTS FOR CONTROLLED SUBSTANCES § 1302.04 Location and size of symbol on label... substance. The symbol on labels shall be clear and large enough to afford easy identification of...

  4. 7 CFR Exhibits A-B to Subpart G... - [Reserved

    Science.gov (United States)

    2010-01-01

    ... PRIMARILY FOR REAL ESTATE PURPOSES RURAL HOUSING LOANS AND GRANTS Rural Housing Site Loan Policies... 7 Agriculture 12 2010-01-01 2010-01-01 false A Exhibits A-B to Subpart G to Part 1822 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL...

  5. Move of Purchasing Offices TS – AB* – AT*

    CERN Multimedia

    FI Department

    2008-01-01

    The TS – AB* - AT* Purchasing Offices and the Purchasing Pool have moved to Building 5 – 2nd and *3rd floors. The phone and fax numbers are unchanged. We apologize for any inconvenience caused by the move. Thank you for your understanding. Finance Department – Purchasing Service.

  6. Ab initio molecular dynamics simulation of laser melting of silicon

    NARCIS (Netherlands)

    Silvestrelli, P.-L.; Alavi, A.; Parrinello, M.; Frenkel, D.

    1996-01-01

    The method of ab initio molecular dynamics, based on finite temperature density functional theory, is used to simulate laser heating of crystal silicon. We have found that a high concentration of excited electrons dramatically weakens the covalent bond. As a result, the system undergoes a melting tr

  7. Food for Thought on the "ABS Academic Journal Quality Guide"

    Science.gov (United States)

    Hussain, Simon

    2011-01-01

    This paper discusses issues relating to the use of the Association of Business Schools' (ABS) "Academic Journal Quality Guide" within UK business schools. It also looks at several specific issues raised by the Chair of the British Accounting Association/British Accounting and Finance Association regarding the ratings for top…

  8. Discovery of New Substrates for LuxAB Bacterial Bioluminescence.

    Science.gov (United States)

    Jiang, Tianyu; Wang, Weishan; Wu, Xingkang; Wu, Wenxiao; Bai, Haixiu; Ma, Zhao; Shen, Yuemao; Yang, Keqian; Li, Minyong

    2016-08-01

    In this article, four novel substrates with long halftime have been designed and synthesized successfully for luxAB bacterial bioluminescence. After in vitro and in vivo biological evaluation, these molecules can emit obvious bioluminescence emission with known bacterial luciferase, thus indicating a new promising approach to developing the bacterial bioluminescent system. PMID:26896339

  9. 78 FR 33010 - Airworthiness Directives; Saab AB, Saab Aerosystems Airplanes

    Science.gov (United States)

    2013-06-03

    ... in an aircraft maintenance manual is incorrect for Saab 340B airplane. This proposed AD would require... information identified in this proposed AD, contact Saab AB, Saab Aeronautics, SE-581 88, Link ping, Sweden... Aircraft Maintenance Manual (AMM), which quotes an elevator position of 4 degrees trailing edge down...

  10. Discovery of New Substrates for LuxAB Bacterial Bioluminescence.

    Science.gov (United States)

    Jiang, Tianyu; Wang, Weishan; Wu, Xingkang; Wu, Wenxiao; Bai, Haixiu; Ma, Zhao; Shen, Yuemao; Yang, Keqian; Li, Minyong

    2016-08-01

    In this article, four novel substrates with long halftime have been designed and synthesized successfully for luxAB bacterial bioluminescence. After in vitro and in vivo biological evaluation, these molecules can emit obvious bioluminescence emission with known bacterial luciferase, thus indicating a new promising approach to developing the bacterial bioluminescent system.

  11. Ultra-Low Voltage Class AB Switched Current Memory Cell

    DEFF Research Database (Denmark)

    Igor, Mucha

    1996-01-01

    This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with...

  12. Cyanogen Azide. Ionization Potentials and Ab Initio SCF MO Calculation

    DEFF Research Database (Denmark)

    Bak, Börge; Jansen, Peter; Stafast, Herbert

    1975-01-01

    The Ne(I) and He(I) photoelectron(PE) spectra of cyanogen azide, NCN3, have been recorded at high resolution. Their interpretation is achieved by comparison with the PE spectrum of HN3 and an ab initio LCGO SCF MO calculation. Deviations from Koopmans' theorem of quite different magnitudes are fo...

  13. Relaxation of Small Molecules: an ab initio Study

    Institute of Scientific and Technical Information of China (English)

    CAO Yi-Gang; JIAO Zheng-Kuan; A. Antons; K. Schroeder; S. Blügel2

    2002-01-01

    Using an ab initio total energy and force method, we have relaxed several group IV and group V elementalclusters, in detail the arsenic and antimony dimers, silicon, phosphorus, arsenic and antimony tetramers. The obtainedbond lengths and cohesive energies are more accurate than other calculating methods, and in excellent agreement withthe experimental results.

  14. Relaxation of Small Molecules:an ab initio Study

    Institute of Scientific and Technical Information of China (English)

    CAOYi-Gang; A.Antons; 等

    2002-01-01

    Using an ab inito total energy and force method,we have relaxed several group IV and group V elemental clusters,in detail the arsenic and antimony dimers,silicon,phosphorus,arsenic and antimony tetraners,The obtained bond lengths and cohesive energies are more accurate than other calculating methods,and in excellent agreement with the experimental results.

  15. Young Modulus of Crystalline Polyethylene from ab Initio Molecular Dynamics

    NARCIS (Netherlands)

    Hageman, J.C.L.; Meier, Robert J.; Heinemann, M.; Groot, R.A. de

    1997-01-01

    The Young modulus for crystalline polyethylene is calculated using ab initio molecular dynamics based on density functional theory in the local density approximation (DFT-LDA). This modulus, which can be seen as the ultimate value for the Young modulus of polyethylene fibers, is found to be 334 GPa.

  16. AB 1725 Model Accountability System. California Community Colleges. Revised.

    Science.gov (United States)

    California Community Colleges, Sacramento. Board of Governors.

    This report proposes a model accountability system for the California community colleges to comply with the directives of Assembly Bill 1725 (AB 1725). The purpose of the accountability system is to provide colleges and districts, the board of governors, and the California legislature with information that will allow for the continued improvement…

  17. Perceived barriers and motives to reading nutrition label among label ‘non-users’ in Croatia

    OpenAIRE

    Ranilović, Jasmina; Colić Barić, Irena

    2013-01-01

    The purpose of this paper is to examine barriers and motives associated with reading nutrition information among label ‘non-users’ in Croatia and relationship with demographic and health factors of recruited sample.Label ‘non-users’ are subjects reported that had never or do not know or wish to tell aboutreading nutrition label during food purchasing (n=375) and were recruited from representative sample telephone interviewed Croatian, for assessing nutrition label attitudes. It is found that ...

  18. (90) Y/(177) Lu-labelled Cetuximab immunoconjugates: radiochemistry optimization to clinical dose formulation.

    Science.gov (United States)

    Chakravarty, Rubel; Chakraborty, Sudipta; Sarma, Haladhar Dev; Nair, K V Vimalnath; Rajeswari, Ardhi; Dash, Ashutosh

    2016-07-01

    Radiolabelled monoclonal antibodies (mAbs) are increasingly being utilized in cancer theranostics, which is a significant move toward tailored treatment for individual patients. Cetuximab is a recombinant, human-mouse chimeric IgG1 mAb that binds to the epidermal growth factor receptor with high affinity. We have optimized a protocol for formulation of clinically relevant doses (~2.22 GBq) of (90) Y-labelled Cetuximab and (177) Lu-labelled Cetuximab by conjugation of the mAb with a suitable bifunctional chelator, N-[(R)-2-amino-3-(paraisothiocyanato-phenyl)propyl]-trans-(S,S)-cyclohexane-1,2-diamine-N,N,N',N″,N″-pentaacetic acid (CHX-A″-DTPA). The radioimmunoconjugates demonstrated reasonably high specific activity (1.26 ± 0.27 GBq/mg for (90) Y-CHX-A″-DTPA-Cetuximab and 1.14 ± 0.15 GBq/mg for (177) Lu-CHX-A″-DTPA-Cetuximab), high radiochemical purity (>95%) and appreciable in vitro stability under physiological conditions. Preliminary biodistribution studies with both (90) Y-CHX-A″-DTPA-Cetuximab and (177) Lu-CHX-A″-DTPA-Cetuximab in Swiss mice bearing fibrosarcoma tumours demonstrated significant tumour uptake at 24-h post-injection (p.i.) (~16%ID/g) with good tumour-to-background contrast. The results of the biodistribution studies were further corroborated by ex vivo Cerenkov luminescence imaging after administration of (90) Y-CHX-A″-DTPA-Cetuximab in tumour-bearing mice. The tumour uptake at 24 h p.i. was significantly reduced with excess unlabelled Cetuximab, suggesting that the uptake was receptor mediated. The results of this study hold promise, and this strategy should be further explored for clinical translation. PMID:27264196

  19. Chain store management through private labels strategy

    Directory of Open Access Journals (Sweden)

    Martina Sopta

    2007-07-01

    Full Text Available The purpose of this paper is to examine the market shares of private labels in the European Union and on the global market, and to compare the results of the analysis with the level of presence of private labels on the Croatian market. Moreover, through the application of macro and microeconomic tools, the author tried to estimate the future trends of private labels in Croatia.For the purpose of the paper secondary and primary data was used in the research. Relevant scientific and professional literature of local and foreign authors was analyzed. In addition, a few recent research studies were analyzed and their results compared. Field research has been conducted by the survey method, with 225 respondents included in the intentional sample.The main hypothesis of the paper based on research is that, in total sales, private labels are gaining a growing share in all markets, regardless of the development level of those markets. Alongside the main hypothesis of the work, three supporting hypotheses were tested to see which private labels are a good alternative to other brands on the world market. Private labels are generally developed on generic products. The third supporting hypothesis starts from the assumption that the investments in the promotion of private labels are negligible, resulting in lower prices of thoseproducts. The results of research and analyses in the work indicate that the position of private labels will strengthen internationally, as part of the process of liberalization and globalization of trade flows. In the process of purchase of private labels the positioning of the point of sale and price have an increasing contribution. With the concentration of commerce in chain stores, the share of private labels grows, approaching a half of the total sales in some countries. Considering the Croatian market, according to the international product life cycle theory, the share of private labels in the total sales will grow in the future

  20. Portion Size Labeling and Intended Soft Drink Consumption: The Impact of Labeling Format and Size Portfolio

    Science.gov (United States)

    Vermeer, Willemijn M.; Steenhuis, Ingrid H. M.; Leeuwis, Franca H.; Bos, Arjan E. R.; de Boer, Michiel; Seidell, Jacob C.

    2010-01-01

    Objective: To assess what portion size labeling "format" is most promising in helping consumers selecting appropriate soft drink sizes, and whether labeling impact depends on the size portfolio. Methods: An experimental study was conducted in fast-food restaurants in which 2 labeling formats (ie, reference portion size and small/medium/large…

  1. Radioimmunoimaging of non-small cell lung cancer with [sup 111]In- and [sup 99m]Tc-labeled monoclonal anti-CEA antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Kairemo, K.J.A. (Dept. of Clinical Chemistry, Helsinki Univ. Central Hospital (Finland)); Aronen, H.J. (Dept. of Radiology, Helsinki Univ. Central Hospital (Finland)); Liewendahl, K. (Dept. of Clinical Chemistry, Helsinki Univ. Central Hospital (Finland)); Paavonen, T. (Dept. of Pathology, Helsinki Univ. Central Hospital (Finland)); Heikkonen, J.J. (Dept. of Radiotherapy and Oncology, Helsinki Univ. Central Hospital (Finland)); Virkkunen, P. (Dept. of Radiotherapy and Oncology, Helsinki Univ. Central Hospital (Finland)); Maeki-Hokkonen, H. (Dept. of Radiotherapy and Oncology, Helsinki Univ. Central Hospital (Finland)); Karonen, S.L. (Dept. of Clinical Chemistry, Helsinki Univ. Central Hospital (Finland)); Brownell, A.L. (Dept. of Clinical Chemistry, Helsinki Univ. Central Hospital (Finland)); Maentylae, M.J. (Dept. of Radiotherapy and Oncology, Helsinki Univ. Central Hospital (Finland))

    1993-01-01

    Radiolabeled monoclonal anti-CEA antibodies were used for radioimmunolocalization (RIL) of non-small cell lung cancer; in 30 patients with [sup 111]In labeled anti CEA F(ab')[sub 2] fragment (BW 431/31) and in 16 with [sup 99m]Tc-labeled intact MoAb (BW 431/26). RIL results were compared with those of other imaging modalities. Paraffin sections from some patients were also studied immunohistochemically using anti-CEA antibody. Patients with [sup 111]In labeled MoAB were imaged twice 1-4 days after injection and for image enhancement pulmonary and liver/spleen subtraction were performed. Twenty-seven of 28 primary tumors were positive and metastases were detected in all patients. The total number of lesions was 78 of which 61 (78%) could be detected by RIL. For verification CT was applied to the study of 46 lesions detected by RIL. We found 6 unknown lesions subsequently verified histologically. Using subtraction techniques we detected 9 lesions in 4 patients, later verified as plumonary metastases, not detected in unprocessed images. Pleural, mediastinal and pericardial lesions were also better delineated in subtracted images than in unprocessed images. Imaging of non-small cell lung cancer with [sup 99m]Tc-labeled MoAB was performed twice 4-24 h after injection. RIL results were compared with other imaging methods; CT US, conventional radiography, and immunohistochemistry. Twelve out of 16 patients with suspected or known lung cancer had positive immunoscintigrams; 19 of 25 lesions could be detected by RIL. There were 5 false positive and 2 true negative findings. Immunoperoxidase (IP) stainings of paraffin sections of the tumours from 7 patients were performed using two different anti-CEA antibodies; BW 431/26 and ZCEA[sub 1]. None of the seven tumors examined by immunohistochemistry were negative when stained by BW 431/26, which was the antibody used for immunoscintigraphy. (orig.).

  2. Traffic light labelling: traduzindo a rotulagem de alimentos Traffic light labeling: translating food labeling

    OpenAIRE

    Giovana Longo-Silva; Maysa Helena de Aguiar Toloni; José Augusto de Aguiar Carrazedo Taddei

    2010-01-01

    OBJETIVO: Apresentar uma adaptação do Traffic Light Labelling, ou "Semáforo Nutricional", adotado no Reino Unido e outros países da Europa, às normas vigentes no Brasil e classificar produtos industrializados comercializados no país. MÉTODOS: Esta ferramenta baseia-se na utilização das cores do semáforo para valorar concentrações de gorduras total, saturada e trans, açúcar, sódio e fibra correspondente a 100g ou 100mL do produto. O sinal vermelho indica que o nutriente está presente em quanti...

  3. China Cotton label to be generalized

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    "China Cotton"authorization press conference was held in Beijing on October 11. China Cotton Association granted authorization to the first four enterprises, allowing them to use the label of China Cotton on their qualified products. Shandong Lanyan Group, Beijing Miantian Textile Co., Ltd are among the fi rst companies authorized to use China Cotton label.

  4. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... Lessons? Visit KidsHealth in the Classroom What Other Parents Are Reading Upsetting News Reports? What to Say ... Read a Nutrition Facts Label (Video) KidsHealth > For Parents > How to Read a Nutrition Facts Label (Video) ...

  5. Synthesis of deuterium labeled plant ethylene precursor

    Energy Technology Data Exchange (ETDEWEB)

    Nam, K.C. [Chonnam National Univ., Kwangju (Korea, Republic of). Dept. of Chemistry; Rapoport, H. [California Univ., Berkeley, CA (United States). Dept. of Chemistry

    1995-12-31

    Synthetic methods for the preparation of {beta}-deuterium labeled 2-keto-4-methylbutyric acid were investigated. Vinyl chloride was first reacted with the ethyl oxalyl chloride moiety using aluminum chloride as condensing agent and the addition of methyl mercaptan followed. Deuterium labeling was achieved by using NaBD{sub 4} reduction in pyridine. (author).

  6. Valuing labelling attributes with hedonic price analysis:

    DEFF Research Database (Denmark)

    Steiner, Bodo

    2004-01-01

    that consumers consider regions jointly with grape varieties as proxies for brands. This contrasts with the general observation that grape varietal labeling is the distinctive feature of New World wines. Marketing implications are examined by considering the revenue impact of changes in labeling at the retail...

  7. 7 CFR 65.400 - Labeling.

    Science.gov (United States)

    2010-01-01

    ... AGRICULTURAL MARKETING ACT OF 1946 AND THE EGG PRODUCTS INSPECTION ACT (CONTINUED) COUNTRY OF ORIGIN LABELING..., PEANUTS, AND GINSENG General Provisions Country of Origin Notification § 65.400 Labeling. (a) Country of... tag, or other format that allows consumers to identify the country of origin. The declaration of...

  8. On the Complexity of Labeled Oriented Trees

    Indian Academy of Sciences (India)

    Stephan Rosebrock

    2010-02-01

    We define a notion of complexity for labeled oriented trees (LOTs) related to the bridge number in knot theory and prove that LOTs of complexity 2 are aspherical. We also present a class of LOTs of higher complexity which is aspherical, give an upper bound for the complexity of labeled oriented intervals and study the complexity of torus knots.

  9. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... Growth How to Read a Nutrition Facts Label (Video) KidsHealth > For Parents > How to Read a Nutrition Facts Label (Video) Print A A A Text Size en español Cómo leer las etiquetas de datos nutricionales (video) For Teens For Kids For Parents MORE ON ...

  10. 78 FR 2200 - Energy Labeling Rule

    Science.gov (United States)

    2013-01-10

    ... ensure consumers can view the labels when they are shopping online. In particular, it will provide retail... From the Federal Register Online via the Government Publishing Office FEDERAL TRADE COMMISSION 16..., clarifying testing requirements and enforcement provisions, improving online energy label disclosures,...

  11. 10 CFR 20.1904 - Labeling containers.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Labeling containers. 20.1904 Section 20.1904 Energy....1904 Labeling containers. (a) The licensee shall ensure that each container of licensed material bears... handling or using the containers, or working in the vicinity of the containers, to take precautions...

  12. 9 CFR 112.3 - Diluent labels.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Diluent labels. 112.3 Section 112.3 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS PACKAGING AND LABELING § 112.3...

  13. Synthesis of tritium-labeled fosfomycin

    Energy Technology Data Exchange (ETDEWEB)

    Mertel, H.E.; Meriwether, H.T. (Merck Sharp and Dohme Research Labs., Rahway, NJ (USA))

    1982-03-01

    Tritium gas was used as a labeling agent for the preparation of (1,2-/sup 3/H)fosfomycin. Introduction of tritium into a precursor, the synthesis including resolution of the intermediate racemic 1,2-epoxypropylphosphonic acid, and preparation of both amine and calcium salts of the labeled antibiotic are described.

  14. The anatomy of a laser label

    Science.gov (United States)

    Laser labeling of fruits and vegetables is an efficient alternative to adhesive tags. The advantages of this system are numerous. In general the label consists of alphanumerical characters formed by laser generated pinhole depressions that penetrate the produce’s surface creating visible markings. H...

  15. Do European consumers use nutrition labels?

    DEFF Research Database (Denmark)

    Wills, Josephine M.; Grunert, Klaus G.; Celemín, Laura Fernández;

    2009-01-01

    Nutrition labelling on food packages becomes more and more widespread in the European Union. Such information is not compulsory, unless a nutrition or health claim is made. However, how do consumers use nutrition information? Two European studies are currently assessing whether nutrition...... knowledge about nutrition and are able to use nutrition labels to identify healthier products within a category....

  16. Alternatives to radioimmunoassay: labels and methods

    Energy Technology Data Exchange (ETDEWEB)

    Schall, R.F. Jr.; Tenoso, H.J.

    1981-07-01

    The following labels used as substitutes for radioisotopes in immunoassay systems are reviewed bacteriophages, chemiluminescence precursors, fluorochromes, fluorogens, fluorescence quenchers, enzymes, coenzymes, inhibitors, substrates, various particulates, metal atoms, and stable free radicals. New methods for performing immunoassays with these labels are described where appropriate. Methods that require no separation steps and offer special promise for easy automation are noted. 69 references cited.

  17. A sandwich-type immunosensor using Pd–Pt nanocrystals as labels for sensitive detection of human tissue polypeptide antigen

    International Nuclear Information System (INIS)

    A sandwich-type immunosensor was developed for the detection of human tissue polypeptide antigen (hTPA). In this work, a graphene sheet (GS) was synthesized to modify the surface of a glassy carbon electrode (GCE), and Pd–Pt bimetallic nanocrystals were used as secondary-antibody (Ab2) labels for the fabrication of the immunosensor. The amperometric response of the immunosensor for catalyzing hydrogen peroxide (H2O2) was recorded. And electrochemical impedance spectroscopy was used to characterize the fabrication process of the immunosensor. The anti-human tissue polypeptide antigen primary antibody (Ab1) was immobilized onto the GS modified GCE via cross-linking with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and N-hydroxysuccinimide (EDC/NHS). With Ab1 immobilized onto the GS modified GCE and Ab2 linked on Pd–Pt bimetallic nanocrystals, the immunosensor demonstrated a wide linear range (0.0050–15 ng ml−1), a low detection limit (1.2 pg ml−1), good reproducibility, good selectivity and acceptable stability. This design strategy may provide many potential applications in the detection of other cancer biomarkers. (paper)

  18. Protective mAbs and Cross-Reactive mAbs Raised by Immunization with Engineered Marburg Virus GPs.

    Directory of Open Access Journals (Sweden)

    Marnie L Fusco

    2015-06-01

    Full Text Available The filoviruses, which include the marburg- and ebolaviruses, have caused multiple outbreaks among humans this decade. Antibodies against the filovirus surface glycoprotein (GP have been shown to provide life-saving therapy in nonhuman primates, but such antibodies are generally virus-specific. Many monoclonal antibodies (mAbs have been described against Ebola virus. In contrast, relatively few have been described against Marburg virus. Here we present ten mAbs elicited by immunization of mice using recombinant mucin-deleted GPs from different Marburg virus (MARV strains. Surprisingly, two of the mAbs raised against MARV GP also cross-react with the mucin-deleted GP cores of all tested ebolaviruses (Ebola, Sudan, Bundibugyo, Reston, but these epitopes are masked differently by the mucin-like domains themselves. The most efficacious mAbs in this panel were found to recognize a novel "wing" feature on the GP2 subunit that is unique to Marburg and does not exist in Ebola. Two of these anti-wing antibodies confer 90 and 100% protection, respectively, one hour post-exposure in mice challenged with MARV.

  19. EIA model documentation: Petroleum market model of the national energy modeling system

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-12-28

    The purpose of this report is to define the objectives of the Petroleum Market Model (PMM), describe its basic approach, and provide detail on how it works. This report is intended as a reference document for model analysts, users, and the public. Documentation of the model is in accordance with EIA`s legal obligation to provide adequate documentation in support of its models. The PMM models petroleum refining activities, the marketing of petroleum products to consumption regions, the production of natural gas liquids in gas processing plants, and domestic methanol production. The PMM projects petroleum product prices and sources of supply for meeting petroleum product demand. The sources of supply include crude oil, both domestic and imported; other inputs including alcohols and ethers; natural gas plant liquids production; petroleum product imports; and refinery processing gain. In addition, the PMM estimates domestic refinery capacity expansion and fuel consumption. Product prices are estimated at the Census division level and much of the refining activity information is at the Petroleum Administration for Defense (PAD) District level.

  20. Preclinical evaluation of copper-67 labelled anti-MUC1 mucin antibody C595 for therapeutic use in bladder cancer

    International Nuclear Information System (INIS)

    Transitional cell carcinoma of the bladder is the fifth commonest cause of death from cancer in men in the United Kingdom. Most patients present early with superficial disease, though with current treatment up to 20% progress to invasive disease, which has a poor prognosis. Better local treatments are required to limit this tumour progression. The ease of access to the bladder via a catheter provides the ideal opportunity for antibody (Ab) targeted therapy. We have previously shown that indium-111 labelled anti-MUC1 mucin Ab C595 selectively localises to bladder tumours after intravesical administration. We have selected copper-67 as an alternative radiolabel with suitable physical characteristics for radioimmunotherapy. This communication demonstrates that C595 can be reproducibly labelled with 67Cu and that the radioimmunoconjugate is both stable and maintains high immunoreactivity. Pilot studies on cystectomy specimens in a novel ex vivo system and in one patient confirmed the ability of this conjugate to localise to tumour after intravesical administration. On the basis of these studies we are now in a position to study the intravesical administration of 67Cu-labelled C595 in patients with bladder cancer with a view to a therapeutic trial. (orig.). With 4 figs., 1 tab

  1. A network signal amplification strategy of ultrasensitive photoelectrochemical immunosensing carcinoembryonic antigen based on CdSe/melamine network as label.

    Science.gov (United States)

    Li, Jiaojiao; Zhang, Yong; Kuang, Xuan; Wang, Zhiling; Wei, Qin

    2016-11-15

    Taking advantage of CdSe/melamine network as label and Au-TiO2 as substrate, this work developed a novel kind of signal amplification strategy for fabricating photoelectrochemical (PEC) immunoassay. The melamine, a star-shaped triamino molecule, was firstly used for readily capturing CdSe QDs and forming a CdSe/melamine network, which was formed through strong interactions between the carboxyl groups of TGA-stabilized CdSe QDs and the three amino groups of each melamine molecule. In this strategy, the primary antibody (Ab1) was immobilized onto Au-TiO2 substrate, which made the photoelectric conversion efficiency increase significantly. After the formed Ab2-CdSe/melamine network labels were captured onto the electrode surface via the specific antibody-antigen interaction, the photoelectric activity could be further enhanced via the interaction between the Au-TiO2 substrate and CdSe/melamine network. Due to this amplification of PEC signals and the special structure of the label, the fabricated PEC immunosensor was applied for sensitive and specific detection of cancer biomarker carcinoembryonic antigen (CEA), and displayed a wide linear range (0.005-1000ngmL(-1)) and low detection limit (5pgmL(-1)). In addition, the immunosensor was performed with good stability and reproducibility, and the results to analyze human serum samples were satisfactory. PMID:27281106

  2. Labeling of creatinine with technetium-99m

    Energy Technology Data Exchange (ETDEWEB)

    Yurt Lambrecht, F. [Ege Univ., Bornova, Izmir (Turkey). Dept. of Nuclear Applications, Inst. of Nuclear Sciences; Durkan, K. [Dokuz Eylul Univ., Buca, Izmir (Turkey). Chemistry Technicianship Program, Izmir Vocational School; Soylu, A. [Dokuz Eylul Univ., Narlidere, Izmir (Turkey). Dept. of Pediatrics, Medical Faculty

    2004-07-01

    Creatinine is a clinically important index of renal glomerular filtration rate. Urine creatinine levels can be used as a screening test to evaluate kidney function or can be part of the creatinine clearance test. In case of kidney dysfunction or muscle disorders the creatinine concentration in serum/plasma may rise to a higher value than in healthy body. Technetium- 99m has been used in nuclear medicine and in biomedical research to label molecular and cellular structures employed as radiotracers. {sup 99m}Tc is utilized to label molecules and cells, used as radiopharmaceuticals, and also to label biological species. It presents many desirable characteristics. SnCl{sub 2} method is frequently used as a reducing agent in the {sup 99m}Tc- labeling process. Creatinine metabolism might be investigated by using labeled {sup 99m}Tc- creatinine in healthy or uremic rats. (orig.)

  3. Energy labeling for electric fans in Malaysia

    International Nuclear Information System (INIS)

    To reduce energy consumption in the residential sector, Malaysia Energy Commission is considering implementing energy labels for household electrical appliances including electric fans in 2005. The purpose of the energy labels is to provide the consumers a guideline to compare the size, features, price and efficiency of the appliance. This paper discusses the energy label for electric fans in this country based on Malaysian Standards developed by a technical committee that reviewed the performance of household electrical appliances. This study includes methodology for the calculation of the energy efficiency star rating and projected energy usage, performance requirements, details of the energy label and the requirements for the valid application in Malaysia. The label also can be adopted for other household electrical appliances with only slight modifications

  4. Tritium labelling of two new analgesic drugs

    International Nuclear Information System (INIS)

    The labelling with tritium of two arylpropionic esters was studied. The synthesis between 3H-Ibuprofen and the two unlabelled alcoholic moieties (Cl-Alkanol and CF3-Alkanol) was performed. Assuming that we got ready the acidic moiety, 3H-Ibuprofen, in our Laboratory, we attempted to label with tritium the alcoholic moiety and then go on to its esterification. Prior to labelling, thermic stability of 2-(4-(3-chlorophenyl)-1-piperazinyl) ethanol (Cl-Alkanol) was studied. As result of this study we had to change the labelling method, so that the Cl-Alkanol was unstable at 700C. Purification was accomplished through thin layer chromatography (TLC) and high performance liquid chromatography (HPLC). Concentration, purity and specific activities of the two labelled compounds were determined by ultraviolet, HPLC and liquid scintillation techniques. (author)

  5. Learning Hypergraph Labeling for Feature Matching

    CERN Document Server

    Parag, Toufiq; Elgammal, Ahmed

    2011-01-01

    This study poses the feature correspondence problem as a hypergraph node labeling problem. Candidate feature matches and their subsets (usually of size larger than two) are considered to be the nodes and hyperedges of a hypergraph. A hypergraph labeling algorithm, which models the subset-wise interaction by an undirected graphical model, is applied to label the nodes (feature correspondences) as correct or incorrect. We describe a method to learn the cost function of this labeling algorithm from labeled examples using a graphical model training algorithm. The proposed feature matching algorithm is different from the most of the existing learning point matching methods in terms of the form of the objective function, the cost function to be learned and the optimization method applied to minimize it. The results on standard datasets demonstrate how learning over a hypergraph improves the matching performance over existing algorithms, notably one that also uses higher order information without learning.

  6. Simplified labeling process for medical image segmentation.

    Science.gov (United States)

    Gao, Mingchen; Huang, Junzhou; Huang, Xiaolei; Zhang, Shaoting; Metaxas, Dimitris N

    2012-01-01

    Image segmentation plays a crucial role in many medical imaging applications by automatically locating the regions of interest. Typically supervised learning based segmentation methods require a large set of accurately labeled training data. However, thel labeling process is tedious, time consuming and sometimes not necessary. We propose a robust logistic regression algorithm to handle label outliers such that doctors do not need to waste time on precisely labeling images for training set. To validate its effectiveness and efficiency, we conduct carefully designed experiments on cervigram image segmentation while there exist label outliers. Experimental results show that the proposed robust logistic regression algorithms achieve superior performance compared to previous methods, which validates the benefits of the proposed algorithms. PMID:23286072

  7. 49 CFR 172.416 - POISON GAS label.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false POISON GAS label. 172.416 Section 172.416... SECURITY PLANS Labeling § 172.416 POISON GAS label. (a) Except for size and color, the POISON GAS label... POISON GAS label and the symbol must be white. The background of the upper diamond must be black and...

  8. Near-optimal labeling schemes for nearest common ancestors

    DEFF Research Database (Denmark)

    Alstrup, Stephen; Halvorsen, Esben Bistrup; Larsen, Kasper Green

    2013-01-01

    We consider NCA labeling schemes: given a rooted tree $T$, label the nodes of $T$ with binary strings such that, given the labels of any two nodes, one can determine, by looking only at the labels, the label of their nearest common ancestor. For trees with $n$ nodes we present upper and lower bou...

  9. Comparative studies of antibody anti-CD20 labeled with {sup 188}Re; Estudo comparativo da marcacao do anticorpo anti-CD20 com {sup 188}Re

    Energy Technology Data Exchange (ETDEWEB)

    Dias, Carla Roberta de Barros Rodrigues

    2010-07-01

    Nuclear Medicine is an unique and important modality in oncology and the development of new tumor-targeted radiopharmaceuticals for both diagnosis and therapy is an area of interest for researchers. Rituximab (RTX) is a quimeric monoclonal antibody (mAb) (IgG 1) that specifically binds to CD20 antigen with high affinity and has been successfully used for the treatment of Non-Hodgkin Lymphoma (NHL) of cell B. The CD20 antigen is expressed over more than 90% of cell B NHL. Technetium-99m ({sup 99m}Tc) and rhenium-188 ({sup 188}Re) are an attractive radionuclide pair for clinical use due to their favorable decay properties for diagnosis ({sup 99m}Tc: T{sub 1/2} = 6 h, {gamma} radiation = 140 keV) and therapy ({sup 188}Re: T{sub 1/2} = 17 h, maximum {beta} energy = 2.12 MeV) and to their availability in the form of {sup 99}Mo/{sup 99}mTc and {sup 188}W/{sup 188}Re generators. The radionuclides can be conjugated to mAb using similar chemical procedures. The aim of this work was to study the labeling of anti-CD20 mAb (RTX) with {sup 188}Re using two techniques: the direct labeling method [{sup 188}Re(V)] and the labeling method via the carbonyl nucleus [{sup 188}Re(I)]. Besides the quality control, the radiolabeled mAb was submitted to in vivo, in vitro and ex vivo biological studies. For the direct labeling, RTX was reducing by incubation with 2-mercaptoethanol for generating sulphydryl groups (-SH) and further labeled with {sup 188}Re(V), in a study of several parameters in order to reach an optimized formulation. The labeling via the carbonyl nucleus both {sup 99}mTc and {sup 188}Re were employed through 2 different procedures: (1) labeling of intact RTX with {sup 99}mTc(I) and (2) reduced RTX (RTX{sub red}) labeled with {sup 99}mTc(I)/{sup 188}Re(I). Also a parameter study was performed to obtain an optimized formulation. The quality control method for evaluating the radiochemical purity showed a good labeling yield (93%) for the direct method. The labeling method

  10. ORGANIC FOOD LABELING AND CERTIFICATION

    Directory of Open Access Journals (Sweden)

    NICOLETA-ANDREEA NEACSU

    2011-04-01

    Full Text Available In the rush to produce more and more crops to satisfy growing demand producers have had to resort to using a lethal cocktail of pesticides to control disease and insect attack. This has lead to numerous international debates about unhealthy food, the effects of it and the measures that must be taken in order to avoid the harmful effects of genetically modified food consumption demonstrated by specialists. These debates evolve around the benefits of the organic products versus the pure trade trick outlined by some. The organic food movement has earned its well deserved place in many markets around the world. Its prestige is lately being widespread to vast parts of Eastern-Europe as well. Based on data collected from specialized reports and articles on organic products, the aim of this paper is to present the importance of organic products, the regulations on organic food and different labels used around the world in order to certify the organic food products.

  11. Immune status of health care workers to measles virus: evaluation of protective titers in four measles IgG EIAs

    NARCIS (Netherlands)

    Dorigo-Zetsma, J.W.; Hall, M.A.; Vreeswijk, J.; Vries, J.J. de; Vossen, A.C.; Hulscher, H.I. Ten; Kerkhof, J.; Smits, G.P.; Ruijs, W.L.M.; Koopmans, M.P.; Binnendijk, R.S. van

    2015-01-01

    BACKGROUND: Following the recognition of a measles case in a hospital in The Netherlands, health care workers (HCW) from the premises were screened by a commercial enzyme immunoassay (EIA) for measles IgG to identify persons at risk for measles. At least 10% of the HCW were tested measles IgG-negati

  12. Seasonal dependence of the "forecast parameter" based on the EIA characteristics for the prediction of Equatorial Spread F (ESF

    Directory of Open Access Journals (Sweden)

    S. V. Thampi

    2008-06-01

    Full Text Available In an earlier study, Thampi et al. (2006 have shown that the strength and asymmetry of Equatorial Ionization Anomaly (EIA, obtained well ahead of the onset time of Equatorial Spread F (ESF have a definite role on the subsequent ESF activity, and a new "forecast parameter" has been identified for the prediction of ESF. This paper presents the observations of EIA strength and asymmetry from the Indian longitudes during the period from August 2005–March 2007. These observations are made using the line of sight Total Electron Content (TEC measured by a ground-based beacon receiver located at Trivandrum (8.5° N, 77° E, 0.5° N dip lat in India. It is seen that the seasonal variability of EIA strength and asymmetry are manifested in the latitudinal gradients obtained using the relative TEC measurements. As a consequence, the "forecast parameter" also displays a definite seasonal pattern. The seasonal variability of the EIA strength and asymmetry, and the "forecast parameter" are discussed in the present paper and a critical value for has been identified for each month/season. The likely "skill factor" of the new parameter is assessed using the data for a total of 122 days, and it is seen that when the estimated value of the "forecast parameter" exceeds the critical value, the ESF is seen to occur on more than 95% of cases.

  13. Synthesis of carbon-13-labeled tetradecanoic acids.

    Science.gov (United States)

    Sparrow, J T; Patel, K M; Morrisett, J D

    1983-07-01

    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines. PMID:6631228

  14. Tritium labeling for bio-med research

    International Nuclear Information System (INIS)

    A very large fraction of what we know about biochemical pathways in the living cell has resulted from the use of radioactively-labeled tracer compounds; the use of tritium-labeled compounds has been particularly important. As research in biochemistry and biology has progressed the need has arisen to label compounds of higher specific activity and of increasing molecular complexity - for example, oligo-nucleotides, polypeptides, hormones, enzymes. Our laboratory has gradually developed special facilities for handling tritium at the kilocurie level. These facilities have already proven extremely valuable in producing labeled compounds that are not available from commercial sources. The principal ways employed for compound labeling are: (1) microwave discharge labeling, (2) catalytic tritio-hydrogenation, (3) catalytic exchange with T2O, and (4) replacement of halogen atoms by T. Studies have also been carried out on tritiation by the replacement of halogen atoms with T atoms. These results indicate that carrier-free tritium-labeled products, including biomacromolecules, can be produced in this way

  15. Augmented wave ab initio EFG calculations: some methodological warnings

    Energy Technology Data Exchange (ETDEWEB)

    Errico, Leonardo A. [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Renteria, Mario [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Petrilli, Helena M. [Instituto de Fisica-DFMT, Universidade de Sao Paulo, C.P. 66318, 05315-970 Sao Paulo, SP (Brazil)]. E-mail: hmpetril@macbeth.if.usp.br

    2007-02-01

    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO{sub 2}. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects.

  16. Understanding phonon transport in thermoelectric materials using ab initio approaches

    Science.gov (United States)

    Broido, David

    Good thermoelectric materials have low phonon thermal conductivity, kph. Accurate theories to describe kph are important components in developing predictive models of thermoelectric efficiency that can help guide synthesis and measurement efforts. We have developed ab initio approaches to calculate kph, in which phonon modes and phonon scattering rates are computed using interatomic force constants determined from density functional theory, and a full solution of the Boltzmann transport equation for phonons is implemented. A recent approach to calculate interatomic force constants using ab initio molecular dynamics has yielded a good description of the thermal properties of Bi2Te3. But, the complexity of new promising candidate thermoelectric materials introduces computational challenges in assessing their thermal properties. An example is germanane, a germanium based hydrogen-terminated layered semiconductor, which we will discuss in this talk.

  17. Chemical and Electrochemical Metallic Covering of ABS polymers

    Directory of Open Access Journals (Sweden)

    Florentina Cziple

    2009-10-01

    Full Text Available The aim of this paper is the deposition of metallic layers on the surface of ABS plastic material, by means of two consecutive procedures, namely: the first is represented by the conductibility through chemical or electro-chemical metallic covering of the polymeric support and the second procedure is the electrodeposition of the metal through galvanization. The chemical mehtod consists in the submission of ABS polymers to some conductibility operations of the plastic material surface through chemical copper plating (chemical roughing, degreasing with ultra-sounds, chemical sensitivation, activation and proper conductibility of the material surface. The electrochemical deposition of nickel was made on the plastic material activated in the mixture solution of graphite with potassium carbonate.

  18. The density matrix renormalization group for ab initio quantum chemistry

    CERN Document Server

    Wouters, Sebastian

    2014-01-01

    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. Its underlying wavefunction ansatz, the matrix product state (MPS), is a low-rank decomposition of the full configuration interaction tensor. The virtual dimension of the MPS, the rank of the decomposition, controls the size of the corner of the many-body Hilbert space that can be reached with the ansatz. This parameter can be systematically increased until numerical convergence is reached. The MPS ansatz naturally captures exponentially decaying correlation functions. Therefore DMRG works extremely well for noncritical one-dimensional systems. The active orbital spaces in quantum chemistry are however often far from one-dimensional, and relatively large virtual dimensions are required to use DMRG for ab initio quantum chemistry (QC-DMRG). The QC-DMRG algorithm, its computational cost, and its properties are discussed. Two important aspects to reduce the computational co...

  19. Toward the Ab-initio Description of Medium Mass Nuclei

    CERN Document Server

    Barbieri, C; Soma, V; Duguet, T; Navratil, P

    2012-01-01

    As ab-initio calculations of atomic nuclei enter the A=40-100 mass range, a great challenge is how to approach the vast majority of open-shell (degenerate) isotopes. We add realistic three-nucleon interactions to the state of the art many-body Green's function theory of closed-shells, and find that physics of neutron driplines is reproduced with very good quality. Further, we introduce the Gorkov formalism to extend ab-initio theory to semi-magic, fully open-shell, isotopes. Proof-of-principle calculations for Ca-44 and Ni-74 confirm that this approach is indeed feasible. Combining these two advances (open-shells and three-nucleon interactions) requires longer, technical, work but it is otherwise within reach.

  20. Ab-initio calculations on melting of thorium

    Science.gov (United States)

    Mukherjee, D.; Sahoo, B. D.; Joshi, K. D.; Kaushik, T. C.; Gupta, Satish C.

    2016-05-01

    Ab-initio molecular dynamics study has been performed on face centered cubic structured thorium to determine its melting temperature at room pressure. The ion-electron interaction potential energy calculated as a function of temperature for three volumes (a0)3 and (1.02a0)3 and (1.04a0)3 increases gradually with temperature and undergoes a sharp jump at ~2200 K, ~2100 K and ~1800 K, respectively. Here, a0 = 5.043 Å is the equilibrium lattice parameter at 0 K obtained from ab-initio calculations. These jumps in interaction energy are treated as due to the onset of melting and corresponding temperatures as melting point. The melting point of 2100 K is close to the experimental value of 2023K. Further, the same has been verified by plotting the atomic arrangement evolved at various temperatures and corresponding pair correlation functions.

  1. Serine Proteases an Ab Initio Molecular Dynamics Study

    CERN Document Server

    De Santis, L

    1999-01-01

    In serine proteases (SP's), the H-bond between His-57 and Asp-102, and that between Gly-193 and the transition state intermediate play a crucial role for enzymatic function. To shed light on the nature of these interactions, we have carried out ab initio molecular dynamics simulations on complexes representing adducts between the reaction intermediate and elastase (one protein belonging to the SP family). Our calculations indicate the presence of a low--barrier H-bond between His-57 and Asp-102, in complete agreement with NMR experiments on enzyme--transition state analog complexes. Comparison with an ab initio molecular dynamics simulation on a model of the substrate--enzyme adduct indicates that the Gly-193--induced strong stabilization of the intermediate is accomplished by charge/dipole interactions and not by H-bonding as previously suggested. Inclusion of the protein electric field in the calculations does not affect significantly the charge distribution.

  2. 7 CFR 205.306 - Labeling of livestock feed.

    Science.gov (United States)

    2010-01-01

    ... Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Labels, Labeling, and Market Information § 205.306 Labeling of...

  3. 21 CFR 1230.13 - Labeling of “poison”.

    Science.gov (United States)

    2010-04-01

    ... FEDERAL CAUSTIC POISON ACT Labeling § 1230.13 Labeling of “poison”. The following are styles of...-point size are required on a label in stating the word “poison” they must not be smaller than...

  4. "Why Mama and Papa?" The Development of Social Labels.

    Science.gov (United States)

    Brooks-Gunn, Jeanne; Lewis, Michael

    1979-01-01

    Examined social labels first used for parents, differentiation of parents and others on the basis of labeling behavior, and overgeneralization of social labels in 71 infants ranging in age from 9 to 24 months. (JMB)

  5. 27 CFR 16.21 - Mandatory label information.

    Science.gov (United States)

    2010-04-01

    ... the brand label or separate front label, or on a back or side label, separate and apart from all other... of alcoholic beverages impairs your ability to drive a car or operate machinery, and may cause...

  6. 99Tcm direct labeling of angiostatin

    Institute of Scientific and Technical Information of China (English)

    张金赫; 徐海峰; 邵秋菊; 袁梦晖; 周润锁; 周亮飞

    2004-01-01

    Objective: To explore the method of 99Tcm direct labeling of angiostatin (AS) and investigate the stability and bioactivity of the 99Tcm-labeled AS in vitro. Methods: AS was extracted, validated, and then labeled with 99Tcm after having been reduced by 2-ME or SnCl2. The best labeling condition was screened by cross design. The labeling efficiency was measured by TLC and column chromatography. The stability of 99Tcm-AS was observed and compared when BSA, saline and different molar ratios of Cys∶AS were separately added. The bioactivity of 99Tcm-AS was observed in human umbilical vein endothelial cell (CEV304). Results: The labeling efficiency can reach (97±1.5)% for the 2-ME-reducing approach. Its best experimental condition was as follows: AS 100 μg,PB(0.5 mol/L, pH 7.3)1 ml, 2-ME 100 μg, MDP (dissolved in 1 ml saline) 10 μl, and 99TcmO4- 185 MBq. The labeling efficiency using SnCl2-reducing method can reach (90±3.0)%. The best experimental procedure was as follows: AS 100 μg,boric acid buffer(0.1 mol/L, pH 9.0)1 ml, 2%SnCl2 (dissolved in 1 mol/L hydrochloric acid) 20 μl, was added into MDP, which was diluted with 1 ml deoxygenized water, and then 20 μl, 99TcmO4- 185 MBq was added. The product of 99Tcm labeled AS was stable in vitro and had the same bioactivity as AS. Conclusion: 99Tcm direct labeling of AS is simple and efficient. And the bioactivity of 99Tcm-AS has no significant change compared with AS.

  7. Ultrasensitive Nanoimmunosensor by coupling non-covalent functionalized graphene oxide platform and numerous ferritin labels on carbon nanotubes.

    Science.gov (United States)

    Akter, Rashida; Jeong, Bongjin; Choi, Jong-Soon; Rahman, Md Aminur

    2016-06-15

    An ultrasensitive electrochemical nanostructured immunosensor for a breast cancer biomarker carbohydrate antigen 15-3 (CA 15-3) was fabricated using non-covalent functionalized graphene oxides (GO/Py-COOH) as sensor probe and multiwalled carbon nanotube (MWCNTs)-supported numerous ferritin as labels. The immunosensor was constructed by immobilizing a monoclonal anti-CA 15-3 antibody on the GO modified cysteamine (Cys) self-assembled monolayer (SAM) on an Au electrode (Au/Cys) through the amide bond formation between the carboxylic acid groups of GO/Py-COOH and amine groups of anti-CA 15-3. Secondary antibody conjugated MWCNT-supported ferritin labels (Ab2-MWCNT-Ferritin) were prepared through the amide bond formation between amine groups of Ab2 and ferritin and carboxylic acid groups of MWCNTs. The detection of CA 15-3 was based on the enhanced bioelectrocatalytic reduction of hydrogen peroxide mediated by hydroquinone (HQ) at the GO/Py-COOH-based sensor probe. The GO/Py-COOH-based sensor probe and Ab2-MWCNT-Ferritin labels were characterized using cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), scanning electron microscope (SEM), transmission electron microscope (TEM), and x-ray photoelectron spectroscopy (XPS) techniques. Using differential pulse voltammetry (DPV) technique, CA 15-3 can be selectively detected as low as 0.01 ± 0.07 U/mL in human serum samples. Additionally, the proposed CA 15-3 immunosensor showed excellent selectivity and better stability in human serum samples, which demonstrated that the proposed immunosensor has potentials in proteomic researches and diagnostics. PMID:26820360

  8. The density matrix renormalization group for ab initio quantum chemistry

    OpenAIRE

    Wouters, Sebastian

    2015-01-01

    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. It is used as a numerically exact solver for highly correlated regions in molecules. While the method works extremely well for one-dimensional systems, the correlated regions of interest are often far from one-dimensional. In this introductory talk, I will discuss the DMRG algorithm from a quantum information perspective, how quantum information theory h...

  9. Molexpl: a tool for ab initio data exploration and visualization

    OpenAIRE

    Wang, Xueying; Onofrio, Nicolas,; Strachan, Alejandro

    2015-01-01

    Density functional theory (DFT) based on ab initio theory, is a powerful method to resolve the electronic structure of atoms, molecules and solids. However, in practical, DFT is limited to few hundreds of atoms. To overcome this limitation, researchers have developed empirical interatomic potentials implemented in molecular dynamics (MD) simulations. MD ignores the movements of electrons and describes bonding and non-bonding interaction as a function of the distance between atoms called force...

  10. Ab initio calculation of tight-binding parameters

    Energy Technology Data Exchange (ETDEWEB)

    McMahan, A.K.; Klepeis, J.E.

    1997-12-01

    We calculate ab initio values of tight-binding parameters for the f- electron metal Ce and various phases of Si, from local-density functional one-electron Hamiltonian and overlap matrix elements. Our approach allows us to unambiguously test the validity of the common minimal basis and two-center approximations as well as to determine the degree of transferability of both nonorthogonal and orthogonal hopping parameters in the cases considered.

  11. Social Media Marketing : CASE: OY SUOMEN LYYRA AB

    OpenAIRE

    Eriksson, Irene

    2012-01-01

    This bachelor thesis was commissioned by Oy Suomen Lyyra Ab, the largest student online media and student card producer for higher education students in Finland. The the-sis objective was to understanding the current social media situation and activity among the students of higher education in Finland, the social media networks that the case company currently uses as well as understanding how to use these networks for successful marketing activities. The quantitative research was conducted in...

  12. Integrated Design of Antibodies for Systems Biology Using Ab Designer

    OpenAIRE

    Pisitkun, Trairak; Dummer, Patrick; Somparn, Poorichaya; Hirankarn, Nattiya; Kopp, Jeffrey B.; Knepper, Mark A.

    2014-01-01

    In the current era of large-scale biology, systems biology has evolved as a powerful approach to identify complex interactions within biological systems. In addition to high throughput identification and quantification techniques, methods based on high-quality mono-specific antibodies remain an essential element of the approach. To assist the large-scale design and production of peptide-directed antibodies for systems biology studies, we developed a fully integrated online application, AbDesi...

  13. GAUSSIAN 76: an ab initio molecular orbital program

    Energy Technology Data Exchange (ETDEWEB)

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.

    1978-06-01

    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  14. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    OpenAIRE

    G. Misra; S. Tenguria; Gautam, M.

    2011-01-01

    Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P), volume (V) and temperature (T) that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This a...

  15. Preparation of F(ab')2 fragments of immunoglobulin G.

    Science.gov (United States)

    Killion, J J; Holtgrewe, E M

    1983-11-01

    We describe a simple protocol for the preparation of F(ab')2 fragments of immunoglobulin G, based upon the known Fc- binding properties of protein A-Sepharose. The fragment preparations of xenogeneic and allogeneic anti-IgG were noncytotoxic to intact target cells, and were able to block the cytotoxicity of intact antibody. This method should therefore be useful for functional studies not requiring biochemical homogeneity.

  16. Ab-initio calculations for dilute magnetic semiconductors

    OpenAIRE

    Belhadji, Brahim

    2008-01-01

    This thesis focusses on ab-initio calculations for the electronic structure and the magnetic properties of dilute magnetic semiconductors (DMS). In particular we aim at the understanding of the complex exchange interactions in these systems. Our calculations are based on density functional theory, being ideally suited for a description of the material specific properties of the considered DMS. Moreover we use the KKR Green function method in connection with the coherent potential approximatio...

  17. Thermochemical data for CVD modeling from ab initio calculations

    Energy Technology Data Exchange (ETDEWEB)

    Ho, P. [Sandia National Labs., Albuquerque, NM (United States); Melius, C.F. [Sandia National Labs., Livermore, CA (United States)

    1993-12-31

    Ab initio electronic-structure calculations are combined with empirical bond-additivity corrections to yield thermochemical properties of gas-phase molecules. A self-consistent set of heats of formation for molecules in the Si-H, Si-H-Cl, Si-H-F, Si-N-H and Si-N-H-F systems is presented, along with preliminary values for some Si-O-C-H species.

  18. Sublinear distance labeling for sparse graphs

    DEFF Research Database (Denmark)

    Alstrup, Stephen; Dahlgaard, Søren; Knudsen, Mathias Bæk Tejs;

    2015-01-01

    between pairs of nodes that are at distance at least $D$ from each other. In this paper we consider distance labeling schemes for the classical case of unweighted and undirected graphs. We present the first distance labeling scheme of size $o(n)$ for sparse graphs (and hence bounded degree graphs......). This addresses an open problem by Gavoille et. al. [J. Algo. 2004], hereby separating the complexity from general graphs which require $\\Omega(n)$ size Moon [Proc. of Glasgow Math. Association 1965]. As an intermediate result we give a $O(\\frac{n}{D}\\log^2 D)$ $D$-preserving distance labeling scheme, improving...

  19. Private Labels, Price Rivalry, and Public Policy

    OpenAIRE

    Gabrielsen, Tommy Staahl; Sørgard, Lars

    2000-01-01

    The article examines how the existence of a retailer owned brand, private label, aspects the price setting of a national brand. We …nd that the potential for a private label introduction may lead to price concessions from the national brand producer, but that actual private label introduction as such may very well lead to higher retail prices on national brands. We argue that this may have important implications for the interpretation of empirical results and the public policy towards natio...

  20. The antibody approach of labeling blood cells

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, S.C.

    1992-12-31

    Although the science of blood cell labeling using monoclonal antibodies directed against specific cellular antigens is still in its early stages, considerable progress has recently been accomplished in this area. The monoclonal antibody approach offers the promise of greater selectivity and enhanced convenience since specific cell types can be labeled in vivo, thus eliminating the need for complex and damaging cell separation procedures. This article focuses on these developments with primary emphasis on antibody labeling of platelets and leukocytes. The advantages and the shortcomings of the recently reported techniques are critically assessed and evaluated.

  1. Preparation of 11C labelled tamoxifen

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    The syntheses and HPLC analysis of N-desmethyltamoxifen and carbon-11labelled tamoxifen are described. In order to obtain the N-desmethyltamoxifen,tamoxifencitrate was first converted to tamoxifen free base.N-desmethyltamoxifen wasprepared by reacting tamoxifen free base with 1-chloroethyl-chloroformate(ACE.Cl).For 11C labeling, N-desmethyltamoxifen was heated with 11Cmethyl iodide for 10min at 130℃,and the 11Clabelled compound was purifiedby HPLC on a μBonapak TM C18 column.Injectable 11C-tamoxifen was obtained within 50~60min from EOB (end-of-bombardment) with a labeling yield of 60%~70%.

  2. The antibody approach of labeling blood cells

    International Nuclear Information System (INIS)

    Although the science of blood cell labeling using monoclonal antibodies directed against specific cellular antigens is still in its early stages, considerable progress has recently been accomplished in this area. The monoclonal antibody approach offers the promise of greater selectivity and enhanced convenience since specific cell types can be labeled in vivo, thus eliminating the need for complex and damaging cell separation procedures. This article focuses on these developments with primary emphasis on antibody labeling of platelets and leukocytes. The advantages and the shortcomings of the recently reported techniques are critically assessed and evaluated

  3. The antibody approach of labeling blood cells

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, S.C.

    1991-01-01

    Although the science of blood cell labeling using monoclonal antibodies directed against specific cellular antigens is still in its early stages, considerable progress has recently been accomplished in this area. The monoclonal antibody approach offers the promise of greater selectivity and enhanced convenience since specific cell types can be labeled in vivo, thus eliminating the need for complex and damaging cell separation procedures. This article focuses on these developments with primary emphasis on antibody labeling of platelets and leukocytes. The advantages and the shortcomings of the recently reported techniques are criticality assessed and evaluated.

  4. The antibody approach of labeling blood cells

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, S.C.

    1991-12-31

    Although the science of blood cell labeling using monoclonal antibodies directed against specific cellular antigens is still in its early stages, considerable progress has recently been accomplished in this area. The monoclonal antibody approach offers the promise of greater selectivity and enhanced convenience since specific cell types can be labeled in vivo, thus eliminating the need for complex and damaging cell separation procedures. This article focuses on these developments with primary emphasis on antibody labeling of platelets and leukocytes. The advantages and the shortcomings of the recently reported techniques are criticality assessed and evaluated.

  5. Near Resonant Electronic and Rotational Energy Transfer AB(1П, J) + C(slj) → AB(1П, J') + C(slj')

    Institute of Scientific and Technical Information of China (English)

    WANG Wei-Li; SONG Peng; SHEN Yang; MA Feng-Cai

    2005-01-01

    In our previous theoretical study, the theoretical model of the collision-induced electronic and rotational energy transfer of AB(1∑, J) + C(slj) → AB(1∑, J') + C(slj') was presented. To further study the collision-induced electronic and rotational energy transfer theoretically on AB(1∏,J)+C(slj)→AB(1∏,J1)+C(slj') a theoretical model is presented, based on the time-dependent first-order Born approximation, taking into account the anisotropic LennardJones interaction potential and "straight-line" trajectory approximation. The changing tendency of the transitional probabilities with the anisotropic parameter is discussed.

  6. Pressure tracking control of vehicle ABS using piezo valve modulator

    Science.gov (United States)

    Jeon, Juncheol; Choi, Seung-Bok

    2011-03-01

    This paper presents a wheel slip control for the ABS(anti-lock brake system) of a passenger vehicle using a controllable piezo valve modulator. The ABS is designed to optimize for braking effectiveness and good steerability. As a first step, the principal design parameters of the piezo valve and pressure modulator are appropriately determined by considering the braking pressure variation during the ABS operation. The proposed piezo valve consists of a flapper, pneumatic circuit and a piezostack actuator. In order to get wide control range of the pressure, the pressure modulator is desired. The modulator consists of a dual-type cylinder filled with different substances (fluid and gas) and a piston rod moving vertical axis to transmit the force. Subsequently, a quarter car wheel slip model is formulated and integrated with the governing equation of the piezo valve modulator. A sliding mode controller to achieve the desired slip rate is then designed and implemented. Braking control performances such as brake pressure and slip rate are evaluated via computer simulations.

  7. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Draayer, Jerry P. [Louisiana State Univ., Baton Rouge, LA (United States)

    2014-09-28

    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  8. A highly accurate ab initio potential energy surface for methane

    Science.gov (United States)

    Owens, Alec; Yurchenko, Sergei N.; Yachmenev, Andrey; Tennyson, Jonathan; Thiel, Walter

    2016-09-01

    A new nine-dimensional potential energy surface (PES) for methane has been generated using state-of-the-art ab initio theory. The PES is based on explicitly correlated coupled cluster calculations with extrapolation to the complete basis set limit and incorporates a range of higher-level additive energy corrections. These include core-valence electron correlation, higher-order coupled cluster terms beyond perturbative triples, scalar relativistic effects, and the diagonal Born-Oppenheimer correction. Sub-wavenumber accuracy is achieved for the majority of experimentally known vibrational energy levels with the four fundamentals of 12CH4 reproduced with a root-mean-square error of 0.70 cm-1. The computed ab initio equilibrium C-H bond length is in excellent agreement with previous values despite pure rotational energies displaying minor systematic errors as J (rotational excitation) increases. It is shown that these errors can be significantly reduced by adjusting the equilibrium geometry. The PES represents the most accurate ab initio surface to date and will serve as a good starting point for empirical refinement.

  9. Acceleration of the Convergence in ab initio Atomic Relaxations

    Science.gov (United States)

    Zhao, Zhengji; Wang, Lin-Wang; Meza, Juan

    2006-03-01

    Atomic relaxations is often required to accurately describe the properties of nanosystems. In ab initio calculations, a common practice is to use a standard search algorithm, such as BFGS (Broyden-Fletcher-Goldfarb-Shanno) or CG (conjugate gradient) method, which starts the atomic relaxations without any knowledge of the Hessian matrix of the system. For example, the initial Hessian in BFGS method is often set to identity, and there is no preconditioning to CG method. One way to accelerate the convergence of the atomic relaxations is to estimate an approximate Hessian matrix of the system and then use it as the initial Hessian in BFGS method or a preconditioner in CG method. Previous attempts to obtain the approximated Hessian were focused on the use of classical force field models which rely on the existence of good parameters. Here, we present an alternative method to estimate the Hessian matrix of a nanosystem. First, we decompose the system into motifs which consist of a few atoms, then calculate the Hessian matrix elements on different motif types from ab initio calculations for small prototype systems. Then we generate the Hessian Matrix of the whole system by putting together these motif Hessians. We have applied our motif-based Hessian matrix in ab initio atomic relaxations in several bulk (with/without impurity) and quantum dot systems, and have found a speed up factor of 2 to 4 depending on the system size.

  10. Studies on the runaway reaction of ABS polymerization process

    Energy Technology Data Exchange (ETDEWEB)

    Hu, K.-H. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China); Kao, C.-S. [Department of Safety, Health and Environmental Engineering, National United University, Taiwan (China); Duh, Y.-S. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China)], E-mail: yihshingduh@yahoo.com.tw

    2008-11-15

    Taiwan has the largest acrylonitrile-butadiene-styrene (ABS) copolymer production in the world. Preventing on unexpected exothermic reactions and related emergency relief hazard is essential in the safety control of ABS emulsion polymerization. A VSP2 (Vent Sizing Package 2) apparatus is capable of studying both normal and abnormal conditions (e.g., cooling failure, mischarge, etc.) of industrial process. In this study, the scenarios were verified from the following abnormal conditions: loss of cooling, double charge of initiator, overcharge of monomer, without charge of solvent, and external fire. An external fire with constant heating will promote higher self-heat rate and this is recommended as the worst case scenario of emulsion polymerization on butadiene. Cooling failure coupled with bulk system of reactant was determined to be the credible worst case in ABS emulsion polymerization. Finally, the emergency vent sizing based on thermokinetics from VSP associated with DIERS methodology were used for evaluating the vent sizing and compared to that of the industrial plants.

  11. Converting of Matter to Nuclear Energy by AB-Generator

    Directory of Open Access Journals (Sweden)

    Alexander Bolonkin

    2009-01-01

    Full Text Available Problem statement: Researcher offered a new nuclear generator which allowed to convert any matter to nuclear energy in accordance with Einstein equation E = mc2. The method was based upon tapping the energy potential of a Micro Black Hole (MBH and Hawking radiation created by this MBH. Researcher did not meet the idea and its research in literature to develop the method for getting a cheap energy. Approach: As is well-known, vacuum continuously produced virtual pairs of particles and antiparticles, in particular, photons and anti-photons. MBH event horizon allowed separating them. Anti-photons can be moved to MBH and be annihilated, decreasing mass of MBH, resulting photons leave the MBH neighborhood as Hawking radiation. The offered nuclear generator (named by Researcher as AB-generator utilized Hawking radiation and injected the matter into MBH and kept MBH in a stable state with near-constant mass. Results: AB-generator can be produced gigantic energy outputs and should be cheaper than a conventional electric station by a factor of hundreds of times. One also may be used in aerospace as a photon rocket or as a power source for many vehicles. Conclusion: Many scientists expect Large Hadron Collider at CERN may be produced one MBH every second. A technology to capture them may be developed; than they may be used for the AB-generator.

  12. Monte Carlo simulation of AB-copolymers with saturating bonds

    CERN Document Server

    Chertovich, A V; Khokhlov, A R; Bohr, J

    2003-01-01

    Structural transitions in a single AB-copolymer chain where saturating bonds can be formed between A-and B-units are studied by means of Monte Carlo computer simulations using the bond fluctuation model. Three transitions are found, coil-globule, coil-hairpin and globule-hairpin, depending on the nature of a particular AB-sequence: statistical random sequence, diblock sequence and 'random-complementary' sequence (one-half of such an AB-sequence is random with Bernoulli statistics while the other half is complementary to the first one). The properties of random-complementary sequences are closer to those of diblock sequences than to the properties of random sequences. The model (although quite rough) is expected to represent some basic features of real RNA molecules, i.e. the formation of secondary structure of RNA due to hydrogen bonding of corresponding bases and stacking interactions of the base pairs in helixes. We introduce the notation of RNA-like copolymers and discuss in what sense the sequences studie...

  13. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Science.gov (United States)

    Makhov, Dmitry V.; Glover, William J.; Martinez, Todd J.; Shalashilin, Dmitrii V.

    2014-08-01

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as "cloning," in analogy to the "spawning" procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, "trains," as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  14. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Makhov, Dmitry V.; Shalashilin, Dmitrii V. [Department of Chemistry, University of Leeds, Leeds LS2 9JT (United Kingdom); Glover, William J.; Martinez, Todd J. [Department of Chemistry and The PULSE Institute, Stanford University, Stanford, California 94305, USA and SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)

    2014-08-07

    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  15. A Complete and Accurate Ab Initio Repeat Finding Algorithm.

    Science.gov (United States)

    Lian, Shuaibin; Chen, Xinwu; Wang, Peng; Zhang, Xiaoli; Dai, Xianhua

    2016-03-01

    It has become clear that repetitive sequences have played multiple roles in eukaryotic genome evolution including increasing genetic diversity through mutation, changes in gene expression and facilitating generation of novel genes. However, identification of repetitive elements can be difficult in the ab initio manner. Currently, some classical ab initio tools of finding repeats have already presented and compared. The completeness and accuracy of detecting repeats of them are little pool. To this end, we proposed a new ab initio repeat finding tool, named HashRepeatFinder, which is based on hash index and word counting. Furthermore, we assessed the performances of HashRepeatFinder with other two famous tools, such as RepeatScout and Repeatfinder, in human genome data hg19. The results indicated the following three conclusions: (1) The completeness of HashRepeatFinder is the best one among these three compared tools in almost all chromosomes, especially in chr9 (8 times of RepeatScout, 10 times of Repeatfinder); (2) in terms of detecting large repeats, HashRepeatFinder also performed best in all chromosomes, especially in chr3 (24 times of RepeatScout and 250 times of Repeatfinder) and chr19 (12 times of RepeatScout and 60 times of Repeatfinder); (3) in terms of accuracy, HashRepeatFinder can merge the abundant repeats with high accuracy. PMID:26272474

  16. Ab initio nuclear structure - the large sparse matrix eigenvalue problem

    International Nuclear Information System (INIS)

    The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several ab initio methods have now emerged that provide nearly exact solutions for some nuclear properties. The ab initio no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds 1010 and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving this large sparse matrix eigenvalue problem. We also outline the challenges that lie ahead for achieving further breakthroughs in fundamental nuclear theory using these ab initio approaches.

  17. 101 labeled brain images and a consistent human cortical labeling protocol

    Directory of Open Access Journals (Sweden)

    Arno eKlein

    2012-12-01

    Full Text Available We introduce the Mindboggle-101 dataset, the largest and most complete set of free, publicly accessible, manually labeled human brain images. To manually label the macroscopic anatomy in magnetic resonance images of 101 healthy participants, we created a new cortical labeling protocol that relies on robust anatomical landmarks and minimal manual edits after initialization with automated labels. The Desikan-Killiany-Tourville (DKT protocol is intended to improve the ease, consistency, and accuracy of labeling human cortical areas. Given how difficult it is to label brains, the Mindboggle-101 dataset is intended to serve as brain atlases for use in labeling other brains, as a normative dataset to establish morphometric variation in a healthy population for comparison against clinical populations, and contribute to the development, training, testing, and evaluation of automated registration and labeling algorithms. To this end, we also introduce benchmarks for the evaluation of such algorithms by comparing our manual labels with labels automatically generated by probabilistic and multi-atlas registration-based approaches. All data and related software and updated information are available on the http://www.mindboggle.info/data/ website.

  18. Possibilities of implementing progesterone EIA test in the control of reproduction in dairy cows

    Directory of Open Access Journals (Sweden)

    Barna S. Tomislav,

    2013-09-01

    Full Text Available The aim of this study was to implement the progesterone EIA test, developed in our laboratory by using an anti-progesterone antibody (Yamaguchi University, Japan, in order to determine the optimal moment for artificial insemination (AI and to detect pregnancy in Holstein-Friesian cows according to the progesterone concentration in the whole milk. Also, the influence of β-carotene, applied at the day of insemination and human chorionic gonadotrophin applied on day 7 after AI on the progesterone level and the pregnancy rate were evaluated.For the accuracy of oestrus detection, the milk samples from 70 cows were collected on the day of insemination. Milk samples from 148 cows were collected 19-22 days following insemination for pregnancy check.After detection of naturally occurring oestrus (day 0 and AI, cows were divided into the following groups: group A (n = 19 was treated with 200 mg β-carotene (20 ml Carofertin® i.m. Alvetra u. Werfft Gmbh, Austria, group B (n = 17 was treated with 1 500 IU hCG i.m. (Schering-Plough, the Netherlands and control (non treated group C (n = 18. The milk samples for EIA progesterone concentration analysis were collected on the day of AI, the 14th and the 20th day of the oestrus cycle. Oestrus detection errors and inappropriate moments of insemination according to the progesterone concentration were detected in 22.86% animals (16/70. The test accuracy for non-pregnant cows was 90.48% (76/84. The accuracy of the progesterone test in pregnant cows was 75% (48/64. False positive results (high progesterone level, but the cows were not pregnant was detected in 25% of cows (16/64 as a result of a prolonged oestrus cycles, embrional mortality and endomethritis (10/16 cases. The treatment of cows with 1500 IU of hCG, on the day 7 of the oestrus cycle, resulted in statistically significant increase of progesterone concentration in the dioestrus (P 0.05.The EIA test developed in our laboratory could be used for accurate

  19. Enzyme immunoassay of benzyl penicilloyl (BPO) groups using acetylcholinesterase as label. Application to the study of the BPO-binding sites on albumin.

    Science.gov (United States)

    Wal, J M; Yvon, M; Pradelles, P; Grassi, J

    1991-01-01

    Benzyl penicilloyl groups (BPO) derive from penicillin G by cleavage of the beta lactam ring; they covalently bind to proteins to give conjugates which have lost all antibiotic properties but are considered as the major allergenic determinants in penicillin allergy. A solid-phase Enzyme Immuno Assay (EIA) of BPO groups in different biological fluids is described. It is a competitive immunoassay using acetylcholinesterase as label. In all biological fluids, very low non-specific binding values are observed. The sensitivity and the precision of the assay are good since ca. 0.5 ng/ml can be measured with a coefficient of variation less than 10%. Cross reactions between BPO and penicillin or penicillin derivatives are nil or very low. This assay is more sensitive, much more rapid and easier to handle than the other methods available and is thus suitable for routine determinations. In association with reversed-phase high performance liquid chromatography this EIA has allowed an initial investigation of the location of BPO-binding sites on micro quantities of serum albumin (ca. 1 mg) from penicillin treated patients.

  20. Fabrication of mAb G250-SPIO molecular magnetic resonance imaging nanoprobe for the specific detection of renal cell carcinoma in vitro.

    Directory of Open Access Journals (Sweden)

    Cailuan Lu

    Full Text Available Molecular magnetic resonance imaging (mMRI has been paid more and more attention for early diagnosis of cancer. A sensitive and specific mMRI probe plays the most important role in this technique. In this study, superparamagnetic iron oxide (SPIO nanoparticles and mAb G250 were conjugated as mMRI probe for the detection of clear cell renal cell carcinoma (ccRCC using 3.0-Tesla MRI in vitro. mAb G250 could specifically recognize carbonic anhydrase IX (CAIX antigen overexpressed in ccRCC and the SPIO nanoparticles as MRI contrast agent presented excellent MRI response and good biocompatibility. The successful assembly of this nanoprobe was confirmed by UV-vis spectrum, FT-IR spectroscopy and DLS analysis. In vitro MRI study on ccRCC cells and control cells indicated that our fabricated mAb G250-SPIO nanoprobe could be used in the specific labeling of clear cell renal carcinoma cells successfully.

  1. A Study on Standards System of Chinese Environmental Labeling Program

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    @@ Implementing Outlines for the Chinese Environmental Labeling Program By awarding certificates and labels to related manufacturers in accordance with certain environmental labeling standards, environmental labeling,also called "Green Label"or "Eco-label", certifies via governmental departments or public and private organizations that the whole process of producing,using, recalling and disposing of manufacturers'products is in compliance with certain environmental requirements. Many countries are establishing and promoting environmental labeling plans. Environmental labeling, as an important promotion means for prevention and control of pollution in a market-oriented manner, is being extended and developed constantly across the world.

  2. Towards hydrogen metallization: an Ab initio approach; Vers la metallisation de l`hydrogene: approche AB initio

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, St

    1998-12-31

    The quest for metallic hydrogen is a major goal for both theoretical and experimental condensed matter physics. Hydrogen and deuterium have been compressed up to 200 GPa in diamond anvil cells, without any clear evidence for a metallic behaviour. Loubeyere has recently suggested that hydrogen could metallize, at pressures within experimental range, in a new Van der Waals compound: Ar(H{sub 2}){sub 2} which is characterized at ambient pressure by an open and anisotropic sublattice of hydrogen molecules, stabilized by an argon skeleton. This thesis deals with a detailed ab initio investigation, by Car-Parrinello molecular dynamics methods, of the evolution under pressure of this compound. In a last chapter, we go to much higher pressures and temperatures, in order to compare orbital and orbital free ab initio methods for the dense hydrogen plasma. (author) 109 refs.

  3. A ProActive Backend for ABS: from Modelling to Deployment

    OpenAIRE

    Rochas, Justine; Henrio, Ludovic

    2014-01-01

    ABS is an object-oriented modeling language that is based on a concurrent object group model, derived itself from the active object model. Its goal is to describe distributed and concurrent applications in order to verify their properties and make them safer. Thanks to the ABS Tool Suite, ABS programs can be translated into the Java programming language (among others), and executed in the JVM. This paper presents a new ABS backend that translates ABS programs into ProActive programs. ProActiv...

  4. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... Kids for Teens Parents Home General Health Growth & Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & ... Out Food Labels Healthy Food Shopping If My Child Has Food Allergies, What Should I Look for ...

  5. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... Teens Parents Home General Health Growth & Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & ... I Look for When Reading Food Labels? Healthy Eating Kids and Food: 10 Tips for Parents Figuring ...

  6. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family Life First Aid & Safety Doctors & Hospitals Q&A Recipes ... Keeping Portions Under Control Figuring Out Food Labels Healthy Food Shopping If My Child Has Food Allergies, ...

  7. Synthesis of tritium-labelled natural prostaglandins

    International Nuclear Information System (INIS)

    The most suitable method for the preparation of tritium-labelled prostaglandins is the biosynthetic procedure. Polyunsaturated labelled fatty acids are converted into prostaglandins by a prostaglandin synthetase enzyme system produced from sheep seminal vesicule, and the crude product is purified using thin layer chromatography. Polyunsaturated fatty acids are prepared in a reaction series. Tritium is introduced at the very last step. A very little amount (10-20 mg) of tritium-labelled prostaglandin E2 can be converted into A2, B2 and F2 respectively, conversion and separation being carried out simultaneously on the same silica plate. After the separation on thin layer silica gel the obtained tritium-labelled prostaglandin (PC) was chemically and radiochemically pure, its activity was 3700 GBq/mmol (100 Ci/mmol) and it was suitable for RIA kits. (author)

  8. Generating Realistic Labelled, Weighted Random Graphs

    CERN Document Server

    Davis, Michael Charles; Liu, Weiru; Miller, Paul; Hunter, Ruth; Kee, Frank

    2015-01-01

    Generative algorithms for random graphs have yielded insights into the structure and evolution of real-world networks. Most networks exhibit a well-known set of properties, such as heavy-tailed degree distributions, clustering and community formation. Usually, random graph models consider only structural information, but many real-world networks also have labelled vertices and weighted edges. In this paper, we present a generative model for random graphs with discrete vertex labels and numeric edge weights. The weights are represented as a set of Beta Mixture Models (BMMs) with an arbitrary number of mixtures, which are learned from real-world networks. We propose a Bayesian Variational Inference (VI) approach, which yields an accurate estimation while keeping computation times tractable. We compare our approach to state-of-the-art random labelled graph generators and an earlier approach based on Gaussian Mixture Models (GMMs). Our results allow us to draw conclusions about the contribution of vertex labels a...

  9. 9 CFR 317.4 - Labeling approval.

    Science.gov (United States)

    2010-01-01

    ... is a printer's proof or equivalent which clearly shows all labeling features, size, location, and... carcass ink brands and meat food product ink and burning brands, which comply with parts 312 and 316...

  10. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... KidsHealth in the Classroom What Other Parents Are Reading Upsetting News Reports? What to Say Vaccines: Which ... Food Allergies, What Should I Look for When Reading Food Labels? Healthy Eating Kids and Food: 10 ...

  11. Have Food Allergies? Read the Label

    Science.gov (United States)

    ... For Consumers Home For Consumers Consumer Updates Have Food Allergies? Read the Label Share Tweet Linkedin Pin it ... These foods account for 90 percent of all food allergies: milk egg fish, such as bass, flounder, or ...

  12. Labels in PURE - Til gavn eller hindring?

    DEFF Research Database (Denmark)

    Zurcher, Sacha; Sass, Birgitte

    2009-01-01

    Denne artikel er baseret på en usability test af anvendelse af labels i PURE, et vidensregistreringssystem. Formålet var at undersøge om hvorvidt de anvendte labels i PURE understøtter forskernes inddatering af forskellige publikationstyper. Pilot testen viste at man skal være opmærksom på, at de...... anvendte labels ikke nødvendigvis dækker over et kontrolleret fagsprog der modsvarer alle faglige domæner. PURE understøtter således ikke intuitivt alle forskeres forståelse af registrering af publikationstyper. Endvidere kan det skabe forvirring når sproget ikke er konsistent, som det er tilfælde i PURE...... resultaterne kun bruges som en indikator på, hvorvidt de brugte labels i PURE er tydelige og genkendelige for forskere....

  13. Facile labeling of lipoglycans with quantum dots

    International Nuclear Information System (INIS)

    Bacterial endotoxins or lipopolysaccharides (LPS) are among the most potent activators of the innate immune system, yet mechanisms of their action and in particular the role of glycans remain elusive. Efficient non-invasive labeling strategies are necessary for studying interactions of LPS glycans with biological systems. Here we report a new method for labeling LPS and other lipoglycans with luminescent quantum dots. The labeling is achieved by partitioning of hydrophobic quantum dots into the core of various LPS aggregates without disturbing the native LPS structure. The biofunctionality of the LPS-Qdot conjugates is demonstrated by the labeling of mouse monocytes. This simple method should find broad applicability in studies concerned with visualization of LPS biodistribution and identification of LPS binding agents.

  14. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family Life First Aid & Safety Doctors & Hospitals ... Out Food Labels Healthy Food Shopping If My Child Has Food Allergies, What Should I Look for ...

  15. Indirect labeling of proteins with radioiodine

    Energy Technology Data Exchange (ETDEWEB)

    Araujo, Elaine Bortoleti de; Lavinas, Tatiana; Muramoto, Emiko; Pereira, Nilda P.S. de; Silva, Constancia P.G. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil); Tavares, Leoberto C. [Sao Paulo Univ., SP (Brazil). Faculdade de Ciencias Farmaceuticas. Departamento de Tecnologia Bioquimico-Farmaceutica

    2000-07-01

    A procedure is described for the radioiodination of proteins using an iodinated derivative of N succinimidyl 3-(tri-n-butylstannyl)benzoate (ATE), previously described by Zalutsky. ATE was obtained in a high pure form and the iodination has been performed with 131-Iodine in 70-80% yield. Protein labeling studies performed with human IgG indicate that the ATE intermediate is an important alternative to conventional labeling methods. (author)

  16. Improved electrochemiluminescence labels for heterogeneous microbead immunoassay.

    Science.gov (United States)

    Yu, Linpo; Liu, Yang; Zhou, Ming

    2016-10-01

    Ruthenium(II) complexes with carboxylic acid as a bioconjugatable group, i.e., [Ru(bathophenanthroline disulfonate)(2,2'-bipyridine)(4-methyl-4'-(3-carboxypropyl)-2,2'-bipyridine)](0), (C49H38N6O8S2Ru), and [Ru(bathophenanthroline disulfonate)2(4-methyl-4'-(3-carboxypropyl)-2,2'-bipyridine)](2-) · 2Na(+), (C63H44N6O14S4RuNa2) were characterized spectroscopically and electrochemically. As potential labels for electrochemiluminescence (ECL) immunoassays, the ECL intensities of the free labels in homogenous aqueous buffer solutions were compared under a condition that is similar to the one employed by a commercial clinical immunoassay system. The two labels were found to be more emissive and, thus, can be detected at 10(- 12) pM compared with 5× 10(-12) pM of the label currently used in the commercial ECL system. Furthermore, the improved ECL emission of the free labels in homogenous solutions was proven to be translated into more intense ECL signal in heterogeneous sandwich immunoassay and, thus, leading to a lower limit of detection in immunoassay. The data obtained from these ECL labels shed light on the further development of ECL-based clinical immunoassay technology. Graphical abstract Electrochemiluminescence immunoassays were carried out with three different ruthenium(II) complex labels. It was proved that the higher signal intensities found with the novel labels in homogeneous solutions were maintained in heterogeneous sandwich format. PMID:27178555

  17. A method for labeling polyacrylamide gels

    OpenAIRE

    sprotocols

    2015-01-01

    Have you ever struggled with the identification of your polyacrylamide gels after running a few of them at once? Here is a new method for labeling gels which is easy, free and does not interfere with your protein samples. You will be intrigued once you learn how you can add a label to your laboratory-made gels and will have no problem identifying your gels any more.

  18. Labelling of electricity; Kennzeichnung von Elektrizitaet

    Energy Technology Data Exchange (ETDEWEB)

    Dettli, R. [Econcept AG, Zuerich (Switzerland); Markard, J. [Eidgenoessische Anstalt fuer Wasserversorgung, Abwasserreinigung und Gewaesserschutz (EAWAG), Kastanienbaum (Switzerland)

    2001-07-01

    This comprehensive report for the Swiss Federal Office of Energy (SFOE) presents a possible course of action to be taken to provide a means of declaring the sources of electrical power, as is foreseen in the draft of new Swiss electricity market legislation. The report presents the basic ideas behind the idea and defines the terms used such as labelling, certificates and declarations. Also, the legal situation in the European Union and in Switzerland is examined and a quantitative overview of electricity production and consumption is presented. Suggestions for a labelling scheme are made and some of the problems to be expected are looked at. The report also presents a series of examples of labelling schemes already implemented in other countries, such as Austria, Great Britain, Sweden and Germany. Tradable certificates and tracking systems are discussed as are initial quality labels like the Swiss 'Naturemade' label for green power. A concrete recommendation for the declaration and labelling of electricity in Switzerland is presented and various factors to be considered such as import/export, pumped storage, distribution losses, small-scale producers as well as the time-scales for introduction are discussed.

  19. Gold Nanoparticle Labels Amplify Ellipsometric Signals

    Science.gov (United States)

    Venkatasubbarao, Srivatsa

    2008-01-01

    The ellipsometric method reported in the immediately preceding article was developed in conjunction with a method of using gold nanoparticles as labels on biomolecules that one seeks to detect. The purpose of the labeling is to exploit the optical properties of the gold nanoparticles in order to amplify the measurable ellipsometric effects and thereby to enable ultrasensitive detection of the labeled biomolecules without need to develop more-complex ellipsometric instrumentation. The colorimetric, polarization, light-scattering, and other optical properties of nanoparticles depend on their sizes and shapes. In the present method, these size-and-shape-dependent properties are used to magnify the polarization of scattered light and the diattenuation and retardance of signals derived from ellipsometry. The size-and-shape-dependent optical properties of the nanoparticles make it possible to interrogate the nanoparticles by use of light of various wavelengths, as appropriate, to optimally detect particles of a specific type at high sensitivity. Hence, by incorporating gold nanoparticles bound to biomolecules as primary or secondary labels, the performance of ellipsometry as a means of detecting the biomolecules can be improved. The use of gold nanoparticles as labels in ellipsometry has been found to afford sensitivity that equals or exceeds the sensitivity achieved by use of fluorescence-based methods. Potential applications for ellipsometric detection of gold nanoparticle-labeled biomolecules include monitoring molecules of interest in biological samples, in-vitro diagnostics, process monitoring, general environmental monitoring, and detection of biohazards.

  20. Nord Stream’s Extension to the Kurgalsky Peninsula: Implications for an EIA

    Directory of Open Access Journals (Sweden)

    Lott, Alexander

    2016-10-01

    Full Text Available Nord Stream is planning to lay two submarine pipelines in the Baltic Sea in addition to the ones which already enable the export of natural gas from the Russian Arctic to Germany and the European Union (EU. The main difference between the initial Nord Stream project and the extension project is that the Russian landfall is now planned to be located on the southern coast instead of the northern coast of the Gulf of Finland. The location of the Russian landfall is not yet finally determined. According to Nord Stream the landfall will either be stationed in the Kurgalsky Peninsula or in the Soikinsky Peninsula. Unlike the Soikinsky Peninsula, the Kurgalsky Peninsula is a Ramsar wetland of international importance, a coastal and marine Baltic Sea protected area as well as a candidate Emerald site. Its environment is thus protected currently under both the Ramsar and Helsinki conventions. International environmental organisations deem the project as a danger to the protected area. Nonetheless, due to feasibility reasons Nord Stream has considered the Kurgalsky Peninsula advantageous in comparison with the Soikinsky Peninsula as it would significantly reduce onshore and offshore pipeline route length. The aim of this paper is to establish whether Nord Stream and Russia are obligated to applyan EIA procedure in respect of the potential construction activities in and near the Kurgalsky Peninsula under international law and, if so, under which legal instruments it should be done. In particular, the paper aims at mapping some of the interconnections between the environmental impact assessment (EIA procedure and the relevant international conventions in the fields of marine environmental protection, protection of migratory birds and biological diversity.

  1. NGOs Participation in the Swedish EIA Process to Establish a Nuclear Waste Disposal

    International Nuclear Information System (INIS)

    Swedish environmental NGOs have no complete consensus on the issue of nuclear waste management. However, concerning the demands on the the EIA process most of the opinions coincide. The following standpoints generally reflect those represented by MKG as interpreted by the author Continuation of nuclear waste production, also in connection with uranium mining, is inconsistent with sustainable development. The problems of nuclear waste management must be dealt with now and not left to an undecided future. However, this does not automatically mean that any final solution needs be implemented within a short period of time. Irrespective of storage or disposal method nuclear waste is a possible source for nuclear weapons for a very long time and must therefore be subject to long-term safeguards. Any storage or disposal must be designed considering the risk of intention or unintentional intrusion. The management of nuclear waste is a national task. The thus be performed on a national scale, not as now in the municipal and to some extent regional scale. The choice of method should precede the choice of site. The choice of method should be made according to a systematic process and considering functional conditions set up in advance. Different alternatives should be evaluated and compared according to strict long-term environmental standards that comply with sustainable development. This demands extensive information on more than one possible method. The choice of site should also be made according to a systematic process considering functional conditions set up in advance. A clear and understandable sieving process at a national scale should be performed to find the best possible site considering environmental conditions. Changes have to be made so that an independent body supervises the EIA process instead of the nuclear industry. This increases the chance that the choice of method and site gain legitimacy and acceptance in the eyes of ordinary citizens

  2. NGOs Participation in the Swedish EIA Process to Establish a Nuclear Waste Disposal

    Energy Technology Data Exchange (ETDEWEB)

    Holmstrand, Olov [The Waste Network (Avfallskedjan), Lerum (Sweden)

    2006-09-15

    Swedish environmental NGOs have no complete consensus on the issue of nuclear waste management. However, concerning the demands on the the EIA process most of the opinions coincide. The following standpoints generally reflect those represented by MKG as interpreted by the author Continuation of nuclear waste production, also in connection with uranium mining, is inconsistent with sustainable development. The problems of nuclear waste management must be dealt with now and not left to an undecided future. However, this does not automatically mean that any final solution needs be implemented within a short period of time. Irrespective of storage or disposal method nuclear waste is a possible source for nuclear weapons for a very long time and must therefore be subject to long-term safeguards. Any storage or disposal must be designed considering the risk of intention or unintentional intrusion. The management of nuclear waste is a national task. The thus be performed on a national scale, not as now in the municipal and to some extent regional scale. The choice of method should precede the choice of site. The choice of method should be made according to a systematic process and considering functional conditions set up in advance. Different alternatives should be evaluated and compared according to strict long-term environmental standards that comply with sustainable development. This demands extensive information on more than one possible method. The choice of site should also be made according to a systematic process considering functional conditions set up in advance. A clear and understandable sieving process at a national scale should be performed to find the best possible site considering environmental conditions. Changes have to be made so that an independent body supervises the EIA process instead of the nuclear industry. This increases the chance that the choice of method and site gain legitimacy and acceptance in the eyes of ordinary citizens.

  3. Road-corridor planning in the EIA procedure in Spain. A review of case studies

    Energy Technology Data Exchange (ETDEWEB)

    Loro, Manuel, E-mail: manuel.loro@upm.es [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigación del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Arce, Rosa M., E-mail: rosa.arce.ruiz@upm.es [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigación del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Ortega, Emilio, E-mail: e.ortega@upm.es [Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigación del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Department of Construction and Rural Roads, Forestry Engineering School, Universidad Politécnica de Madrid, Ciudad Universitaria s/n, 28040 Madrid (Spain); and others

    2014-01-15

    The assessment of different alternatives in road-corridor planning must be based on a number of well-defined territorial variables that serve as decision making criteria, and this requires a high-quality preliminary environmental assessment study. In Spain the formal specifications for the technical requirements stipulate the constraints that must be considered in the early stages of defining road corridors, but not how they should be analyzed and ranked. As part of the feasibility study of a new road definition, the most common methodology is to establish different levels of Territorial Carrying Capacity (TCC) in the study area in order to summarize the territorial variables on thematic maps and to ease the tracing process of road-corridor layout alternatives. This paper explores the variables used in 22 road-construction projects conducted by the Ministry of Public Works that were subject to the Spanish EIA regulation and published between 2006 and 2008. The aim was to evaluate the quality of the methods applied and the homogeneity and suitability of the variables used for defining the TCC. The variables were clustered into physical, environmental, land-use and cultural constraints for the purpose of comparing the TCC values assigned in the studies reviewed. We found the average quality of the studies to be generally acceptable in terms of the justification of the methodology, the weighting and classification of the variables, and the creation of a synthesis map. Nevertheless, the methods for assessing the TCC are not sufficiently standardized; there is a lack of uniformity in the cartographic information sources and methodologies for the TCC valuation. -- Highlights: • We explore 22 road-corridor planning studies subjected to the Spanish EIA regulation. • We analyze the variables selected for defining territorial carrying capacity. • The quality of the studies is acceptable (methodology, variable weighting, mapping). • There is heterogeneity in the

  4. Hierarchical Label Fusion with Multiscale Feature Representation and Label-Specific Patch Partition

    OpenAIRE

    Wu, Guorong; Shen, Dinggang

    2014-01-01

    Recently, patch-based label fusion methods have achieved many successes in medical imaging area. After registering atlas images to the target image, the label at each target image point can be subsequently determined by checking the patchwise similarities between the underlying target image patch and all atlas image patches. Apparently, the definition of patchwise similarity is critical in label fusion. However, current methods often simply use entire image patch with fixed patch size through...

  5. Background suppression in arterial spin labeling MRI with a separate neck labeling coil

    OpenAIRE

    Shen, Qiang; Duong, Timothy Q.

    2011-01-01

    In arterial spin labeling (ASL) MRI to measure cerebral blood flow (CBF), pair-wise subtraction of temporally adjacent non-labeled and labeled images often can not completely cancel the background static tissue signal because of temporally fluctuating physiological noise. While background suppression (BS) by inversion nulling improves CBF temporal stability, imperfect pulses compromise CBF contrast. Conventional BS techniques may not be applicable in small animals because the arterial transit...

  6. Food Retailers’ Objectives of Developing Private Label Products and their Perspectives to Private Label Products

    Directory of Open Access Journals (Sweden)

    Serkan Kilic

    2011-01-01

    Full Text Available In the intensive competitive environment, retailers incline to develop their own branded products (private label products to make a differentiation over their rivals and to gain a market share. On the other side, retailers’ have some objectives in developing private label products. At this point, this study put forwards the differences between retailers’ some characteristics and objectives of developing private label products and investigates the tendencies and expectations towards private label products. The results of the research present that there are no differences in the objectives of developing private label products according to the food retailers’ ownership of private label. However, it is found that there are some differences in the objectives of developing private label products according to the food retailers’ level of activity, number of branches and scale. In the study, it is also put forward that food retailers expect an increase in the demand of private label products at nearly terms and inclining to develop private labels more than before.

  7. Multi-hop optical label switching with coherent detected spectral amplitude code labels

    Science.gov (United States)

    Cao, Yongsheng

    Based on label stacking principles and coherent detection, we present a two-hop, coherent detected spectral amplitude code (SAC) labeled system to accomplish ultrafast packet forwarding for packet-switched metropolitan area networks. An optical switching network with two forwarding nodes, two 156 Mb/s SAC labels, and 40 Gb/s differential quadrature phase shift keying (DQPSK) payloads is demonstrated by computer simulation. The bit error rate (BER) performances of coherent detected SAC labels and high speed payload over 160 km fiber after two hops transmission are accessed, respectively.

  8. Targeting cancer stem cells with an 131I-labeled anti-AC133 monoclonal antibody in human colorectal cancer xenografts

    International Nuclear Information System (INIS)

    Introduction: Cancer stem cells (CSCs) are a subpopulation within a tumor, which possesses the characteristics of self-renewal, differentiation, tumorigenicity, and drug resistance. The aim of this study was to target the colorectal CSC marker CD133 with an131I-labeled specific monoclonal antibody (AC133 mAb) in a nude mouse xenograft model. Methods: Colorectal adenocarcinoma cells (LoVo cell line) were separated into CD133(+) and CD133(−) cells by magnetic activated cell sorting. CD133(+), CD133(−), and unsorted LoVo cells were cultured and then implanted subcutaneously into the lower limbs of nude mice (n = 5). AC133 mAb was labeled with 131I by the iodogen method. Results: The radiolabeled compound, 131I-AC133 mAb, showed high stability, specificity, and immunoactivity in vitro. Obvious accumulation of 131I-AC133 mAb was seen in nude mice bearing xenografts of CD133(+) and unsorted LoVo cells, but no uptake was found in mice bearing CD133(−) xenografts or specifically blocked xenografts. Biodistribution analysis showed that the tumor uptake of 131I-AC133 mAb was 6.97 ± 1.40, 1.35 ± 0.48, 6.12 ± 1.91, and 1.61 ± 0.44% ID/g (n = 4) at day 7 after injection of 131I-AC133 mAb in CD133(+), CD133(−), unsorted LoVo cell and specifically blocked xenografts, respectively. The results of immunofluorescence, autoradiography, and western blotting further verified the specific binding of 131I-AC133 mAb to CD133(+) tumors. Conclusions: This study demonstrates the possibility of targeting CSCs with a radiolabeled AC133 mAb in colorectal cancer xenografts based on in vitro, ex vivo, and in vivo experiments. Our findings suggest a new method for imaging CSCs non-invasively

  9. Rhenium 188 labelling of peptide conjugates

    Energy Technology Data Exchange (ETDEWEB)

    Melendez-Alafort, Laura

    2001-07-01

    Many human tumours express high levels, of somatostatin receptors. In order to make possible a radiotherapeutic treatment of this kind for tumour a series of somatostatin analogues that can tightly chelate beta emitting isotopes have been developed in recent years. The work carried out for this thesis has been aimed towards development of a new therapeutic radiopharmaceutical for treatment of somatostatin receptor positive tumours. The first chapters describe work with technetium-99m to establish the labelling and analytical conditions for a somatostatin analogue, [Tyr{sup 3}]-octreotide (TOC), as a precursor to undertaking labelling studies with the beta emitter rhenium-188. 6-Hydrazinopyridine-3-carboxylic acid (HYNIC) was conjugated to TOC and labelled with {sup 99m} using different coligands. Then the stability, receptor binding and biodistribution of each complex were assessed. {sup 99m}Tc-HYNIC-TOC using EDDA as coligand showed the best characteristics, and was superior for tumour imaging in humans than the commercially available {sup 111}In-DTPA-octreotide. The conditions for labelling the HYNIC-TOC conjugate with {sup 188}Re were then optimised using tricine as a co-ligand. A labelling yield of {approx}80% was achieved. After purification however, the stability of the complex was low. The use of other coligand systems which had proved useful for {sup 99m}Tc labelling was explored, but yields were very poor. Other chelators such as diethylenetriamine pentaacetic acid (DTPA), dimercaptosuccinic acid (DMSA) and mercaptoacetyltriglycine (MAG{sub 3}) were studied as potential co-ligand agents to label the HYNIC-TOC conjugate with {sup 188}Re but, again low yields of the labelled peptide complexes were achieved. A novel {sup 188}Re-HYNIC complex was prepared in high yields using N-N-disubstituted dithiocarbamates as coligands. However to date, the specific activities achieved with this system are relatively low. The use of the [{sup 99m}Tc(CO){sub 3}(H{sub 2}O

  10. 40 CFR 174.506 - Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. 174.506 Section 174.506 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED...

  11. Treatment of HER2-positive breast carcinomatous meningitis with intrathecal administration of {alpha}-particle-emitting {sup 211}At-labeled trastuzumab

    Energy Technology Data Exchange (ETDEWEB)

    Boskovitz, Abraham; McLendon, Roger E.; Okamura, Tatsunori [Department of Pathology, Duke University Medical Center, Durham, NC 27710 (United States); Sampson, John H. [Department of Surgery, Duke University Medical Center, Durham, NC 27710 (United States); Bigner, Darell D. [Department of Pathology, Duke University Medical Center, Durham, NC 27710 (United States); Zalutsky, Michael R. [Department of Radiology, Duke University Medical Center, Durham, NC 27710 (United States)], E-mail: zalut001@mc.duke.edu

    2009-08-15

    Introduction: Carcinomatous meningitis (CM) is a devastating disease characterized by the dissemination of malignant tumor cells into the subarachnoid space along the brain and spine. Systemic treatment with monoclonal antibody (mAb) trastuzumab can be effective against HER2-positive systemic breast carcinoma but, like other therapies, is ineffective against CM. The goal of this study was to evaluate the therapeutic effect of {alpha}-particle emitting {sup 211}At-labeled trastuzumab following intrathecal administration in a rat model of breast carcinoma CM. Methods: Athymic rats were injected intrathecally with MCF-7/HER2-18 breast carcinoma cells through a surgically implanted indwelling intrathecal catheter. In Experiment 1, animals received 33 or 66 {mu}Ci {sup 211}At-labeled trastuzumab, cold trastuzumab or saline. In Experiment 2, animals were inoculated with a lower tumor burden and received 46 or 92 {mu}Ci {sup 211}At-labeled trastuzumab or saline. In Experiment 3, animals received 28 {mu}Ci {sup 211}At-labeled trastuzumab, 30 {mu}Ci {sup 211}At-labeled TPS3.2 control mAb or saline. Histopathological analysis of the neuroaxis was performed at the end of the study. Results: In Experiment 1, median survival increased from 21 days for the saline and cold trastuzumab groups to 45 and 48 days for 33 and 66 {mu}Ci {sup 211}At-labeled trastuzumab, respectively. In Experiment 2, median survival increased from 23 days for saline controls to 68 and 92 days for 46 and 92 {mu}Ci {sup 211}At-labeled trastuzumab, respectively. In Experiment 3, median survival increased from 20 days to 29 and 36 days for animals treated with {sup 211}At-labeled TPS3.2 and {sup 211}At-labeled trastuzumab, respectively. Long-term survivors were observed exclusively in the {sup 211}At-trastuzumab-treated groups. Conclusion: Intrathecal {sup 211}At-labeled trastuzumab shows promise as a treatment for patients with HER2-positive breast CM.

  12. GQ Lup Ab Visible & Near-Infrared Photometric Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Marois, C; Macintosh, B; Barman, T

    2006-08-07

    We have re-analyzed archival HST R and I band images and Subaru CH{sub 4}, H, Ks and L{prime} data of the recently discovered planetary mass companion (PMC) GQ Lup Ab. With these we produce the first R and I band photometry of the companion and fit a radius and effective temperature using detailed model atmospheres. We find an effective temperature of 2338 {+-} 100K, and a radius of 0.37 {+-} 0.05R{sub {circle_dot}} and luminosity of log(L/L{sub {circle_dot}}) = -2.43 {+-} 0.07 (at 140pc). Since we fit wavelengths that span most of the emitted radiation from GQ Lup this luminosity estimate is robust, with uncertainty dominated by the distance uncertainty. The radius obtained for 140pc (0.37R{sub {circle_dot}}) is significantly larger than the one originally derived. The mass of the object is much more model-dependent than the radiative properties, but for the GAIA dusty models we find a mass between 9-20 M{sub Jup}, in the range of the brown dwarf and PMC deuterium burning boundary. Assuming a distance of 140pc, observations fit to 1{sigma} the Baraffe evolution model for a {approx} 15 M{sub Jup} brown dwarf. Additionally, the F606W photometric band is significantly overluminous compared to model predictions. Such overluminosity could be explained by a bright H{alpha} emission from chromospheric activity, interaction with another undetected companion, or accretion. Assuming that GQ Lup Ab has a bright H{alpha} emission line, its H{alpha} emission strength is 10{sup -1.71 {+-} 0.10} L{sub bol}, significantly larger than field late-type dwarfs. GQ Lup Ab might be strongly accreting and still be in its formation phase.

  13. 30 CFR 47.41 - Requirement for container labels.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Requirement for container labels. 47.41 Section... TRAINING HAZARD COMMUNICATION (HazCom) Container Labels and Other Forms of Warning § 47.41 Requirement for container labels. (a) The operator must ensure that each container of a hazardous chemical has a label. If...

  14. 50 CFR 216.91 - Dolphin-safe labeling standards.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Dolphin-safe labeling standards. 216.91... MAMMALS Dolphin Safe Tuna Labeling § 216.91 Dolphin-safe labeling standards. (a) It is a violation of... include on the label of those products the term “dolphin-safe” or any other term or symbol that claims...

  15. 49 CFR 172.429 - POISON INHALATION HAZARD label.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false POISON INHALATION HAZARD label. 172.429 Section... REQUIREMENTS, AND SECURITY PLANS Labeling § 172.429 POISON INHALATION HAZARD label. (a) Except for size and color, the POISON INHALATION HAZARD label must be as follows: ER22JY97.023 (b) In addition to...

  16. 21 CFR 226.80 - Packaging and labeling.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Packaging and labeling. 226.80 Section 226.80 Food...: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES Packaging and Labeling § 226.80 Packaging and labeling. (a) Packaging and labeling operations shall be adequately controlled: (1) To...

  17. 49 CFR 172.419 - FLAMMABLE LIQUID label.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false FLAMMABLE LIQUID label. 172.419 Section 172.419... SECURITY PLANS Labeling § 172.419 FLAMMABLE LIQUID label. (a) Except for size and color the FLAMMABLE LIQUID label must be as follows: EC02MR91.023 (b) In addition to complying with § 172.407, the...

  18. Near-optimal labeling schemes for nearest common ancestors

    DEFF Research Database (Denmark)

    Alstrup, Stephen; Bistrup Halvorsen, Esben; Larsen, Kasper Green

    2014-01-01

    establishing that labels of size (2 ± ε)log n, ε Bille, and Rauhe (SIDMA'05) showed that ancestor and NCA labeling schemes have labels of size log n + Ω(log log n). Our lower bound increases this to log n + Ω(log n) for NCA labeling schemes. Since Fraigniaud...

  19. 27 CFR 4.32 - Mandatory label information.

    Science.gov (United States)

    2010-04-01

    ... the bottle. (c) There shall be stated on the brand label or on a back label a statement that the..., strip label or neck label, the statement “Contains sulfites” or “Contains (a) sulfiting agent(s)” or...

  20. 21 CFR 341.72 - Labeling of antihistamine drug products.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 5 2010-04-01 2010-04-01 false Labeling of antihistamine drug products. 341.72... OVER-THE-COUNTER HUMAN USE Labeling § 341.72 Labeling of antihistamine drug products. (a) Statement of... product as an “antihistamine.” (b) Indications. The labeling of the product states, under the...

  1. UNDERSTANDING CONSUMERS' ATTITUDE TOWARD MEAT LABELS AND MEAT CONSUMPTION PATTERN

    OpenAIRE

    Rimal, Arbindra; Fletcher, Stanley M.

    2003-01-01

    This paper addressed consumers' attitude toward meat labels and the influence of different aspects of meat labels on beef, poultry and seafood consumption using a national survey data. Nutrition and ingredient information on meat labels were positively related with attitude toward meat labels as well as meat consumption frequency.

  2. Ab initio structure determination via powder X-ray diffraction

    Indian Academy of Sciences (India)

    Digamber G Porob; T N Guru Row

    2001-10-01

    Structure determination by powder X-ray diffraction data has gone through a recent surge since it has become important to get to the structural information of materials which do not yield good quality single crystals. Although the method of structure completion when once the starting model is provided is facile through the Rietveld refinement technique, the structure solution ab initio os still not push-button technology. In this article a survey of the recent development in this area is provided with an illustration of the structure determination of -NaBi3V2O10.

  3. Electrostriction coefficient of ferroelectric materials from ab initio computation

    Directory of Open Access Journals (Sweden)

    Z. Jiang

    2016-06-01

    Full Text Available Electrostriction is an important material property that characterizes how strain changes with the development of polarization inside a material. We show that ab initio techniques developed in recent years can be exploited to compute and understand electrostriction of ferroelectric materials. Here, electrostriction coefficients of ferroelectric BaTiO3, PbTiO3, as well as dielectric BaZrO3, are obtained and analyzed. Possible causes of the difference between experimental and numerical results are discussed. We also identified that relative displacements between certain ions at a given polarization could be a good indicator of a material’s electrostriction property.

  4. Tailoring magnetoresistance at the atomic level: An ab initio study

    KAUST Repository

    Tao, Kun

    2012-01-05

    The possibility of manipulating the tunneling magnetoresistance (TMR) of antiferromagnetic nanostructures is predicted in the framework of ab initio calculations. By the example of a junction composed of an antiferromagnetic dimer and a spin-polarized scanning tunneling microscopy tip we show that the TMR can be tuned and even reversed in sign by lateral and vertical movements of the tip. Moreover, our finite-bias calculations demonstrate that the magnitude and the sign of the TMR can also be tuned by an external voltage. © 2012 American Physical Society.

  5. Magnetoband structures of AB-stacked zigzag nanographite ribbons

    Energy Technology Data Exchange (ETDEWEB)

    Chang, C.P.; Chiu, C.W.; Shyu, F.L.; Chen, R.B.; Lin, M.F

    2002-12-30

    Magnetoband structures of AB-stacked zigzag nanographite ribbons are studied by the tight-binding model. The magnetic field changes band width, energy space, and energy dispersions (the produce of Landau subbands and Landau levels). It causes many zero energy points. Such points and corresponding localized states are studied in detail. There are certain important differences between localized states and edge states. Oscillation period of Landau subbands are determined by these points. The interribbon interactions also affect magnetoband structures, such as energy dispersions, band width, oscillation period of Landau subbands, and flux dependence of Hofstadter butterflies.

  6. Ab initio study of neutron drops with chiral Hamiltonians

    Directory of Open Access Journals (Sweden)

    H.D. Potter

    2014-12-01

    Full Text Available We report ab initio calculations for neutron drops in a 10 MeV external harmonic-oscillator trap using chiral nucleon–nucleon plus three-nucleon interactions. We present total binding energies, internal energies, radii and odd–even energy differences for neutron numbers N=2–18 using the no-core shell model with and without importance truncation. Furthermore, we present total binding energies for N=8,16,20,28,40,50 obtained in a coupled-cluster approach. Comparisons with quantum Monte Carlo results, where available, using Argonne v8′ with three-nucleon interactions reveal important dependences on the chosen Hamiltonian.

  7. Accelerating ab initio molecular dynamics simulations by linear prediction methods

    Science.gov (United States)

    Herr, Jonathan D.; Steele, Ryan P.

    2016-09-01

    Acceleration of ab initio molecular dynamics (AIMD) simulations can be reliably achieved by extrapolation of electronic data from previous timesteps. Existing techniques utilize polynomial least-squares regression to fit previous steps' Fock or density matrix elements. In this work, the recursive Burg 'linear prediction' technique is shown to be a viable alternative to polynomial regression, and the extrapolation-predicted Fock matrix elements were three orders of magnitude closer to converged elements. Accelerations of 1.8-3.4× were observed in test systems, and in all cases, linear prediction outperformed polynomial extrapolation. Importantly, these accelerations were achieved without reducing the MD integration timestep.

  8. Equations of state of heavy metals: ab initio approaches

    International Nuclear Information System (INIS)

    The determination of equations of states of heavy metals through ab initio calculation, i.e. without any adjustable parameter, allows to access to pressure and temperature thermodynamic conditions sometimes inaccessible to experiment. To perform such calculations, density functional theory (DFT) is a good starting point: when electronic densities are homogeneous enough, the local density approximation (LDA) remarkably accounts for thermodynamic properties of heavy metals, such as tantalum, or the light actinides, as well for static properties - equilibrium volume, elastic constants - as for dynamical quantities like phonon spectra. For heavier elements, like neptunium or plutonium, relativistic effects and strong electronic interactions must be taken into account, which requires more sophisticated theoretical approaches. (authors)

  9. Ab initio calculations and modelling of atomic cluster structure

    DEFF Research Database (Denmark)

    Solov'yov, Ilia; Lyalin, Andrey G.; Solov'yov, Andrey V.;

    2004-01-01

    The optimized structure and electronic properties of small sodium and magnesium clusters have been investigated using it ab initio theoretical methods based on density-functional theory and post-Hartree-Fock many-body perturbation theory accounting for all electrons in the system. A new theoretical...... framework for modelling the fusion process of noble gas clusters is presented. We report the striking correspondence of the peaks in the experimentally measured abundance mass spectra with the peaks in the size-dependence of the second derivative of the binding energy per atom calculated for the chain...... of the noble gas clusters up to 150 atoms....

  10. Ab initio Study of He Stability in hcp-Ti

    Institute of Scientific and Technical Information of China (English)

    DAI Yun-Ya; YANG Li; PENG Shu-Ming; LONG Xing-Gui; GAO Fei; ZU Xiao-Tao

    2010-01-01

    @@ The stability of He in hcp-Ti is studied using the ab initio method based on the density functional theory.The results indicate that a single He atom prefers to occupy the tetrahedral site rather than the octahedral site.The interaction of He defects with Ti atoms is employed to explain the relative stabilities of He point defects in hcp-Ti.The relative stability of He defects in hcp-Ti is useful for He clustering and bubble nucleation in metal tritides,which provides the basis for development of improved atomistic models.

  11. Polymeric nitrogen in a graphene matrix: An ab initio study

    Science.gov (United States)

    Timoshevskii, V.; Ji, Wei; Abou-Rachid, Hakima; Lussier, Louis-Simon; Guo, H.

    2009-09-01

    A hybrid material where polymeric nitrogen chains are sandwiched between graphene sheets in the form of a three-dimensional crystal, is predicted by means of ab initio simulations. It is demonstrated that chainlike polymeric nitrogen phase becomes stable at ambient pressure when intercalated in a multilayer graphene matrix. The physical origin of this stabilization is identified by studying the electronic properties of the system. This approach of stabilizing polymeric nitrogen by means of external three-dimensional matrix constitutes a path toward synthesizing different types of nitrogen-based high-energy materials.

  12. Ab-initio study of transition metal hydrides

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Ramesh [Dept. of Physics, Feroze Gandhi Insititute of Engineering and Technology, Raebareli-229001 (India); Shukla, Seema, E-mail: sharma.yamini62@gmail.com; Dwivedi, Shalini, E-mail: sharma.yamini62@gmail.com; Sharma, Yamini, E-mail: sharma.yamini62@gmail.com [Theoretical Condensed Matter Physics Laboratory, Dept. of Physics Feroze Gandhi College, Raebareli-229001 (India)

    2014-04-24

    We have performed ab initio self consistent calculations based on Full potential linearized augmented plane wave (FP-LAPW) method to investigate the optical and thermal properties of yttrium hydrides. From the band structure and density of states, the optical absorption spectra and specific heats have been calculated. The band structure of Yttrium metal changes dramatically due to hybridization of Y sp orbitals with H s orbitals and there is a net charge transfer from metal to hydrogen site. The electrical resistivity and specific heats of yttrium hydrides are lowered but the thermal conductivity is slightly enhanced due to increase in scattering from hydrogen sites.

  13. Ab initio study of phase equilibria in TiCx

    DEFF Research Database (Denmark)

    Korzhavyi, P.A.; Pourovskii, L.V.; Hugosson, H.W.;

    2002-01-01

    The phase diagram for the vacancy-ordered structures in the substoichiometric TiCx (x = 0.5-1.0) has been established from Monte Carlo simulations with the long-range pair and multisite effective interactions obtained from ab initio calculations. Three ordered superstructures of vacancies (Ti2C, Ti......3C2, and Ti6C5) are found to be ground state configurations. Their stability has been verified by full-potential total energy calculations of the fully relaxed structures....

  14. Accelerating Ab Initio Nuclear Physics Calculations with GPUs

    CERN Document Server

    Potter, Hugh; Maris, Pieter; Sosonkina, Masha; Vary, James; Binder, Sven; Calci, Angelo; Langhammer, Joachim; Roth, Robert; Çatalyürek, Ümit; Saule, Erik

    2014-01-01

    This paper describes some applications of GPU acceleration in ab initio nuclear structure calculations. Specifically, we discuss GPU acceleration of the software package MFDn, a parallel nuclear structure eigensolver. We modify the matrix construction stage to run partly on the GPU. On the Titan supercomputer at the Oak Ridge Leadership Computing Facility, this produces a speedup of approximately 2.2x - 2.7x for the matrix construction stage and 1.2x - 1.4x for the entire run.

  15. Traffic light labelling: traduzindo a rotulagem de alimentos Traffic light labeling: translating food labeling

    Directory of Open Access Journals (Sweden)

    Giovana Longo-Silva

    2010-12-01

    Full Text Available OBJETIVO: Apresentar uma adaptação do Traffic Light Labelling, ou "Semáforo Nutricional", adotado no Reino Unido e outros países da Europa, às normas vigentes no Brasil e classificar produtos industrializados comercializados no país. MÉTODOS: Esta ferramenta baseia-se na utilização das cores do semáforo para valorar concentrações de gorduras total, saturada e trans, açúcar, sódio e fibra correspondente a 100g ou 100mL do produto. O sinal vermelho indica que o nutriente está presente em quantidade excessiva; o amarelo, média e o verde, adequada. Para fibras as baixas concentrações têm cor vermelha e as recomendadas, verde. A adaptação e aplicação desses conceitos para consumidores brasileiros fundamentaram-se nas normas do Regulamento Técnico Referente à Informação Nutricional Complementar da Agência Nacional de Vigilância Sanitária e da Food Standards Agency. RESULTADOS: Foram classificados cem produtos industrializados, os quais foram selecionados da página eletrônica de um hipermercado brasileiro, optando pelos primeiros cinco a oito produtos listados na página, para cada uma das 17 categorias. A análise mostra que são altas as quantidades de gordura total, saturada e sódio e baixas as quantidades de gordura trans e fibra. CONCLUSÃO: A adaptação dessa metodologia visa facilitar a escolha de alimentos saudáveis, sensibilizando os consumidores quanto às desvantagens no que se refere a qualidade nutricional dos alimentos industrializados, e estimular as indústrias a melhorar a composição nutricional de seus produtos, sob a perspectiva de receberem maior quantidade de sinais verdes e menor quantidade de sinais vermelhos; assim, contribuindo para a prevenção de erros alimentares, obesidade e doenças crônicas não-transmissíveis, principais causas de incapacidade e mortes precoces no Brasil.OBJECTIVE: This study presented an adaptation of the Traffic Light Labeling or Nutrition Traffic Light adopted

  16. {sup 90}Nb - a potential PET nuclide. Production and labeling of monoclonal antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Radchenko, V.; Roesch, F. [Mainz Univ. (Germany). Inst. of Nuclear Chemistry; Hauser, H.; Eisenhut, M. [German Cancer Research Center, Heidelberg (Germany). Radiopharmaceutical Chemistry; Vugts, D.J.; Dongen, G.A.M.S. van [VU University Medical Center, Amsterdam (Netherlands). Dept. of Nuclear Medicine and PET Research; VU University Medical Center, Amsterdam (Netherlands). Dept. of Otolaryngology/Head and Neck Surgery

    2012-07-01

    Fast progressing immuno-PET gives reasons to develop new potential medium-long and long-lived radioisotopes. One of the promising candidates is {sup 90}Nb. It has a half-life of 14.6 h, which allows visualizing and quantifying processes with medium and slow kinetics, such as tumor accumulation of antibodies and antibodies fragments or polymers and other nanoparticles. {sup 90}Nb exhibits a high positron branching of 53% and an optimal energy of {beta}{sup +} emission of E{sub mean} = 0.35 MeV only. Consequently, efficient radionuclide production routes and Nb{sup V} labeling techniques are required. {sup 90}Nb was produced by the {sup 90}Zr(p,n){sup 90}Nb nuclear reaction on natural zirconium targets. No-carrier-added (n.c.a.) {sup 90}Nb was separated from the zirconium target via a multi-step separation procedure including extraction steps and ion-exchange chromatography. Protein labeling was exemplified using the bifunctional chelator desferrioxamine attached to the monoclonal antibody rituximab. Desferrioxamine was coupled to rituximab via two different routes, by the use of N-succinyl-desferrioxamine (N-suc-Df) and by means of the bifunctional derivative p-isothiocyanatobenzyl-desferrioxamine B (Df-Bz-NCS), respectively. Following antibody modification, labeling with {sup 90}Nb was performed in HEPES buffer at pH 7 at room temperature. In vitro stability of the radiolabeled conjugates was tested in saline buffer at room temperature and in fetal calf serum (FCS) at 37 C. The selected production route led to a high yield of 145 {+-} 10 MBq/{mu}A h of {sup 90}Nb with high radioisotopic purity of > 97%. This yield may allow for large scale production of about 10 GBq {sup 90}Nb. The separation procedure resulted in 76-81% yield. The Zr/{sup 90}Nb decontamination factor reaches 10{sup 7}. Subsequent radiolabeling of the two different conjugates with {sup 90}Nb gave high yields; after one hour incubation at room temperature, more than 90% of {sup 90}Nb-Df-mAb was

  17. Ultrasensitive photoelectrochemical immunoassay for CA19-9 detection based on CdSe@ZnS quantum dots sensitized TiO2NWs/Au hybrid structure amplified by quenching effect of Ab2@V(2+) conjugates.

    Science.gov (United States)

    Zhu, Hua; Fan, Gao-Chao; Abdel-Halim, E S; Zhang, Jian-Rong; Zhu, Jun-Jie

    2016-03-15

    A novel, enhanced photoelectrochemical immunoassay was established for sensitive and specific detection of carbohydrate antigen 19-9 (CA19-9, Ag). In this protocol, TiO2 nanowires (TiO2NWs) were first decorated with Au nanoparticles to form TiO2NWs/Au hybrid structure, and then coated with CdSe@ZnS quantum dots (QDs) via the layer-by-layer method, producing TiO2NWs/Au/CdSe@ZnS sensitized structure, which was employed as the photoelectrochemical matrix to immobilize capture CA19-9 antibodies (Ab1); whereas, bipyridinium (V(2+)) molecules were labeled on signal CA19-9 antibodies (Ab2) to form Ab2@V(2+) conjugates, which were used as signal amplification elements. The TiO2NWs/Au/CdSe@ZnS sensitized structure could adequately absorb light energy and dramatically depress electron-hole recombination, resulting in evidently enhanced photocurrent intensity of the immunosensing electrode. While target Ag were detected, the Ab2@V(2+) conjugates could significantly decrease the photocurrent detection signal because of strong electron-withdrawing property of V(2+) coupled with evident steric hindrance of Ab2. Thanks to synergy effect of TiO2NWs/Au/CdSe@ZnS sensitized structure and quenching effect of Ab2@V(2+) conjugates, the well-established photoelectrochemical immunoassay exhibited a low detection limit of 0.0039 U/mL with a wide linear range from 0.01 U/mL to 200 U/mL for target Ag detection. This proposed photoelectrochemical protocol also showed good reproducibility, specificity and stability, and might be applied to detect other important biomarkers.

  18. 78 FR 24211 - Draft Guidance for Industry on Safety Considerations for Container Labels and Carton Labeling...

    Science.gov (United States)

    2013-04-24

    ... closure design (December 13, 2012, 77 FR 74196), and the third guidance will focus on minimizing risks... Container Labels and Carton Labeling Design To Minimize Medication Errors; Availability AGENCY: Food and... the availability of a draft guidance for industry entitled ``Safety Considerations for...

  19. Selenium as an alternative peptide label - comparison to fluorophore-labelled penetratin

    DEFF Research Database (Denmark)

    Hyrup Møller, Laura; Bahnsen, Jesper Søborg; Nielsen, Hanne Mørck;

    2015-01-01

    In the present study, the impact on peptide properties of labelling peptides with the fluorophore TAMRA or the selenium (Se) containing amino acid SeMet was evaluated. Three differently labelled variants of the cell-penetrating peptide (CPP) penetratin (Pen) were synthesized, PenMSe, TAMRA...

  20. 76 FR 46671 - Food Labeling; Gluten-Free Labeling of Foods; Reopening of the Comment Period

    Science.gov (United States)

    2011-08-03

    ... HUMAN SERVICES Food and Drug Administration 21 CFR Part 101 RIN 0910-ZA26 Food Labeling; Gluten-Free... considers other practical factors related to the needs of individuals with celiac disease and their food... establishing labeling thresholds for gluten (as well as for the major food allergens), including the data...