
Sample records for ab eia label

  1. Pharmacokinetics of radioimmunotherapeutic agent of direct labeling mAb 188Re-HAb18

    Institute of Scientific and Technical Information of China (English)

    Chao Lou; Zhi-Nan Chen; Hui-Jie Bian; Jie Li; Shou-Bo Zhou


    AIM: To labed Anti-hepatoma monoclonal antibody (mAb)fragment HAb18 F (ab')2 was labeled with 188 Re for thepharmacokinetic model of 188 Re-HAb18 F (ab')2 and toevaluate its pharmacokinetic parameters in hepatoma-bearing nude mice.METHODS: HAb18 F(ab')2 was directly labeled with 188Reusing 2-mercaptoethanol (2-ME) as reducing agents.Labeling efficiency and immunoreactivity of 188 Re-HAb18 F( ab')2 were evaluated by Whatman 3MM paperchromatography and live cell assay, respectively.Biodiatribution analysis was also conducted in nude micebearing human hepatoma in which animals were sacrificed atdifferent time points(1, 4, 18, 24 and 24h) after 188Re-HAb18F(ab' )2 was injected through tail-vein into hepatoma-bearingnude mice. The blood and radioactivity of organs and masswere measured. The concentrations of 188 Re-HAb18 F(ab')2were evaluated with a pharmacokinetic 3P97 software.RESULTS: The optimum labeling efficiency andimmunoreactive fraction were 91.7% and 0.78%,respectively. The parameters of 188Re-HAb18 F(ab')2 were:T1/2, 2.29h; Vd, 1.49 × 10-9L@ Bq- 1; AUC, 20.49 × 109Bq@ h@L-1 ;CL, 0.45 × 10-3L@ h- 1. 188Re- HAb18 F(ab')2 could locatespecially in hepatoma with high selective reactivity of HAb18F(ab')2. 188 Re-HAb18 F(ab')2 was mainly eliminated bykidney. The maximal tumor to blood ratio was at 48h, andmaximal tumor to liver ratio was at 18h.CONCLUTION: The pharmacokinetics of 188Re-HAb18 F(ab')2fit a I-compartment model. 188 Re-HAb18 F(ab')2 can beuptaken selectively at the hepatoma site.

  2. Preparation, biodistribution, and dosimetry of 188Re-Labeled MoAb ior cea1 and its f(ab')2 fragments by avidin-biotin strategy

    International Nuclear Information System (INIS)

    The biotinylated monoclonal antibody (MoAb) ior cea1 and its F(ab')2 fragments were labeled with Re-188 by combination of avidin-biotin strategy. 188Re-MoAb, 188Re-MoAb-biotin, 188Re-F(ab')2, and 188Re-F(ab')2-biotin preparations were produced for these studies with specific activities of 1.30±0.18 GBq/mg and from instant freeze-dried kit formulations using ethane-1-hydroxy-1,1-diphosphonic acid (EHDP) as a weak competing ligand. There were no significant differences (p>0.05) between the biodistribution in mice of biotinylated and unbiotinylated 188Re-labeled immunoconjugates. When avidin was injected as a chase after injection of 188Re-MoAb-biotin or 188Re-F(ab')2-biotin, the blood radioactivity level decreased approximately 75% (cumulated activity) and the effective dose decreased almost 25% with respect to that of the radioimmunoconjugates in which the chase effect was not used. Our results suggest that 188Re-labeled biotinylated MoAb ior cea1 and its F(ab')2 fragments prepared by this method are stable complexes in vivo

  3. Labelling of MoAb with 153SmH1ETA: Preliminary results

    International Nuclear Information System (INIS)

    A method to label MoAb with Sm-153 using 1,5,9,13-tetraazacyclohexadecane N,N',N'',N''' tetraacetic acid (H4ETA) as a bifunctional chelator was developed. H4ETA and SmH1ETA were synthesized in our laboratory and characterized by IR spectroscopy, TGA (thermogravimetric analysis), SEM (Scattering Electronic Microscopy), EDAX (Elemental Dispersion Analysis by X-rays) and EPR (Electron Paramagnetic Resonance) at 6 K. The 153SmH1ETAMoAb was prepared by a simple incubation of the MoAb ior cea1, and the 153SmH1ETA complex at neutral pH and at room temperature for 24 h. The specific activity of the labelled antibody was 111 MBq/mg (3 mCi/mg). Sm-153(III) is commercially available with specific activities up to 318.2 GBq/mg. Therefore, under the conditions described above 153SmH1ETA labelled MoAb could be obtained with specific activity up to 1.14 GBq/mg (30.7 mCi/mg). (author)

  4. Preparation of a pure [sup 99m]Tc-F(ab')[sub 2] radioimmunoconjugate by direct labeling methods

    Energy Technology Data Exchange (ETDEWEB)

    Griffiths, G.L.; Jones, A.L.; Hansen, H.J. (Immunomedics Inc., Morris Plains, NJ (United States)); Goldenberg, D.M. (Center for Molecular Medicine and Immunology, Newark, NJ (United States))


    Intact IgG and Fab' can be labeled directly with [sup 99m]Tc to give quantitative incorporation of radioactivity into the protein. With F(ab')[sub 2] the reductive conditions yield a mixture of [sup 99m]Tc-F(ab')[sub 2] and [sup 99m]Tc-Fab'. We now report a direct labeling method to produce only [sup 99m]Tc-F(ab')[sub 2] in quantitative yield and contaminated with [sup 99m]Tc-Fab'. The properties, stability and biodistribution of the [sup 99m]Tc-F(ab')[sub 2] have been compared to [sup 99m]Tc-Fab'. This new technology will allow us to compare technetium direct-labeled IgG, F(ab')[sub 2] and Fab' derivatives of the same antibody for radioimmunodetection. (author).

  5. Investigation of McAb labelling with 99mTc by avidin-biotin system and its biodistribution in mice

    International Nuclear Information System (INIS)

    Anti-melanoma McAb Ng76 was labelled with 99mTc by avidin-biotin system. The labelling conditions and methods, and biodistribution of McAb Ng76 in tumor bearing nude mice had been studied. The results showed that the labelling rate was the highest in pH8 and optimal quantity of SnCl2; T/NT and ID%/g of the two-step method B were higher than the two-step method A. Thereby, labelling McAb with 99mTc by avidin-biotin system could be used in RII

  6. Distribution and dosimetry of indium-111 labeled F(ab')2 fragments in humans

    International Nuclear Information System (INIS)

    The purpose of this study was to obtain quantitative biodistribution data in patients injected with the indium-111 labeled F(ab')2 fragments of mouse monoclonal antibody. From this data dosimetric calculations were made for the individual organs. The authors also evaluated the quantitative properties of SPECT in this application and compared it with the more conventional two view planar technique in both phantom and patient studies. For one antibody (19-9) the mean dose in rads/mCi for the organs of highest accumulation, namely, the liver and kidneys was 3.2 and 2.6 respectively. Preliminary data from another antibody (OC 125) showed much higher blood levels and a significantly lower liver dose of 2.3 indicating that antibody type is another significant determinant in dosimetry. The SPECT approach particularly in the presence of background activity, was more accurate in the phantom studies and resulted in larger estimated doses in the patient studies. Also, SPECT has the added advantage of providing an index of organ volume, which has to be balanced with the fact the planar is more rapid, and does not require special hardware. 24 references, 5 figures, 1 table

  7. In vivo evaluation of an anti-melanoma antibody, F(ab')2, labelled with Tc-99m

    International Nuclear Information System (INIS)

    On the basis of the high specificity of the antigen-antibody reaction, tumor antigens can be recognized in vivo by specific antibodies, labelled with gamma emitting radionuclides (I-131, I-123, In-111, Tc-99m). Immunoscintigraphic detection of different human tumours has been obtained. A further improvement in the technique has been produced by the use of labelled purified FAb fragments, i.e. without Fc, the main cause of aspecific bonds. Divalent fragments, F(ab')2, have a better target/background ratio and show a faster clearance rate from the blood pool. Here we present our experience using Tc-99m-F(ab')2 of the 225.28S monoclonal antibody that recognizes high molecular weight melanoma associated antigens (HMW-MAA). (Auth.)

  8. Detection of thrombi using a Tc-99m labelled antifibrin monoclonal antibody (MoAb)

    International Nuclear Information System (INIS)

    This thesis presents an investigation into the possibility of immunoscintigraphic detection of thrombi using an antifibrin monoclonal antibody, and fragments of the latter. The antifibrin antibody and tis fragments were labelled with Ec-99m, which has excellent characteristics for imaging with a gamma camera. The characterization of the antifibrin antibody and its fragments, the assessment of quality of labelling with Tc-99m, and results of experiments in vitro and in animals, which show the potential of immunoscintigraphic detection, are described. (author). 142 refs.; 44 figs.; 5 tabs

  9. A triglycine linker improves tumor uptake and biodistributions of 67-Cu-Labeled anti-neuroblastoma MAb chCE7 F(ab')2 fragments

    International Nuclear Information System (INIS)

    The peptide-linked copper chelators CPTA-triglycyl-L-p-isothiocyanato-phenylalanine (CPTA-R1-NCS) as well as DOTA-triglycyl-L-p-isocyanato-phenylalanine (DOTA-R1-NCS) were synthesized and coupled to F(ab')2 fragments of the anti-neuroblastoma monoclonal antibody (MAb) chCE7. 67Cu-labeled conjugates were compared with the original CPTA- and DO3A-F(ab')2 in vitro and in vivo in mice bearing neuroblastoma xenografts. With the CPTA-R1-F(ab')2, biodistributions were improved, because radioactivity present in the kidney was reduced. With the DOTA-R1-F(ab')2, clearance from the blood was slower and tumor uptake was higher compared with the other conjugates. DOTA-R1-F(ab')2 achieved the best tumor/tissue ratios

  10. Localization of tumors in vivo by scintigraphic identification of Clostridium butyricum using 131I-labelled antibodies and F(ab')2-antibody fragments

    International Nuclear Information System (INIS)

    Tumor-bearing mice injected with clostridial spores show enrichment and germination of the spores within the tumor. 131I-labelled anti-Clostridium-antibodies and anti-Clostridium-F(ab')2-fragments were used for a possible localization of tumors in vivo by scintiscanning. The application of the antibody revealed increased radioactivity in the tumors of mice pretreated with spores as well as in animals without pretreatment. In using F(ab')2-fragments instead of total antibody neither the apparently unspecific increase of radioactivity in not pretreated mice nor the specific fixation of labelled F(ab')2-fragments to clostridial rods in the tumors of pretreated animals could be demonstrated. The results are discussed with respect to further investigation

  11. Production of the {sup 14}C-labeled insecticidal protein Cry1Ab for soil metabolic studies using a recombinant Escherichia coli in small-scale batch fermentations

    Energy Technology Data Exchange (ETDEWEB)

    Valldor, Petra; Miethling-Graff, Rona; Dockhorn, Susanne; Martens, Rainer; Tebbe, Christoph C. [Federal Research Institute for Rural Areas, Forestry and Fisheries, Braunschweig (Germany). Thuenen Institute (vTI) for Biodiversity


    Insecticidal Cry proteins naturally produced by Bacillus thuringiensis are a major recombinant trait expressed by genetically modified crops. They are released into the soil during and after cropping. The objective of this study was to produce {sup 14}C-labeled Cry1Ab proteins for soil metabolic studies in scope of their environmental risk assessment. Cry1Ab was synthesized as a protoxin by Escherichia coli HB101 pMP in 200-mL liquid batch culture fermentations and purified from inclusion bodies after trypsin digestion. For cultivation, U-{sup 14}C-glycerol was the main carbon source. Inclusion bodies were smaller and Cry1Ab yield was lower when the initial amount of total organic carbon in the cultivation broth was below 6.4 mg C L{sup -1}. Concentrations of 12.6 g {sup 14}C-labeled glycerol L{sup -1} (1 % v/v) resulted in the production of 17.1 mg {sup 14}C-Cry1Ab L{sup -1} cultivation medium. {sup 14}C mass balances showed that approx. 50 % of the label was lost by respiration and 20 % remained in the growth media, while the residual activity was associated with biomass. Depending on the production batch, 0.01 to 0.05 % of the total {sup 14}C originated from Cry1Ab. In the presence of 2.04 MBq {sup 14}C-labeled carbon sources, a specific activity of up to 268 Bq mg{sup -1} {sup 14}C-Cry1Ab was obtained. A more than threefold higher specific activity was achieved with 4.63 MBq and an extended cultivation period of 144 h. This study demonstrates that {sup 14}C-labeled Cry1Ab can be obtained from batch fermentations with E. coli in the presence of a simple {sup 14}C-labeled carbon source. It also provides a general strategy to produce {sup 14}C-labeled proteins useful for soil metabolic studies. (orig.)

  12. Positron Emission Tomography Imaging of Tumor Angiogenesis with a 61/64Cu-Labeled F(ab')2 Antibody Fragment


    Hong, Hao; Zhang, Yin; Orbay, Hakan; Valdovinos, Hector F.; Nayak, Tapas R.; Bean, Jero; Theuer, Charles P.; Barnhart, Todd E.; Cai, Weibo


    The objective of this study was to characterize the in vitro and in vivo properties of the F(ab')2 fragment of TRC105, a human/murine chimeric IgG1 monoclonal antibody that binds with high avidity to human and murine CD105 (i.e. endoglin), and investigate its potential for positron emission tomography (PET) imaging of tumor angiogenesis after 61/64Cu-labeling. TRC105-F(ab')2 of high purity was produced by pepsin digestion of TRC105, which was confirmed by SDS-PAGE, HPLC analysis, and mass spe...

  13. Detection of pulmonary embolism with 99mTc-Labeled F(ab)2 fragment of anti-P-selectin monoclonal antibody in dogs

    International Nuclear Information System (INIS)

    Pulmonary embolism is a common and potentially life-threatening condition, and its correct diagnosis is highly desirable before anticoagulant therapy is initiated. However, the safe and accurate diagnosis of acute pulmonary embolism remains a challenge. Single photon emission computed tomography (SPECT) is a highly sensitive scintigraphic imaging technique. Pulmonary embolism can be detected by SPECT with 99mTc-labeled imaging agents that bind to components present predominantly on thromboemboli. P-selectin is an adhesion glycoprotein that is expressed in platelets and endothelial cells. P-selectin on activated platelets is a suitable biomarker of the active thrombus process. The objective of this study was to evaluate 99mTc-labeled F(ab)2 fragment of anti-P-selectin monoclonal antibody SZ51, 99mTc-SZ51-F(ab)2, for imaging pulmonary embolism in beagle canines. SZ51 was digested to F(ab)2 fragment, named SZ51-F(ab)2, and its specific binding to P-selectin on either human or canine platelets was verified by flow cytometry assay. In each dog, an 18-gauge catheter was inserted into left or right pulmonary artery, and a two-stranded spiral stainless-steel coil (20 mm) was inserted through catheter. At 30 min after coil placement, X-ray angiography was performed to document the pulmonary embolism and the locations of the coil. After intravenous injection of 99mTc-SZ51-F(ab)2, experimental thrombi in dogs could be consistently visualized for 2-3 hours by SPECT. Pulmonary embolism showed higher uptake of 99mTc-SZ51-F(ab)2. The present study suggests that 99mTc-SZ51-F(ab)2 may be a promising agent for detecting pulmonary embolism. (author)

  14. Positron Emission Tomography Imaging of Tumor Angiogenesis with a 61/64Cu-Labeled F(ab')2 Antibody Fragment (United States)

    Hong, Hao; Zhang, Yin; Orbay, Hakan; Valdovinos, Hector F.; Nayak, Tapas R.; Bean, Jero; Theuer, Charles P.; Barnhart, Todd E.; Cai, Weibo


    The objective of this study was to characterize the in vitro and in vivo properties of the F(ab')2 fragment of TRC105, a human/murine chimeric IgG1 monoclonal antibody that binds with high avidity to human and murine CD105 (i.e. endoglin), and investigate its potential for positron emission tomography (PET) imaging of tumor angiogenesis after 61/64Cu-labeling. TRC105-F(ab')2 of high purity was produced by pepsin digestion of TRC105, which was confirmed by SDS-PAGE, HPLC analysis, and mass spectrometry. 61/64Cu-labeling of NOTA-TRC105-F(ab')2 (NOTA denotes 1,4,7-triazacyclononane-1,4,7-triacetic acid) was achieved with yields of > 75% (specific activity: ~115 GBq/μmol). PET imaging revealed rapid tumor uptake of 64Cu-NOTA TRC105-F(ab')2 in the 4T1 murine breast cancer model (5.8 ± 0.8, 7.6 ± 0.6, 5.6 ± 0.4, 5.0 ± 0.6, and 3.8 ± 0.7 %ID/g at 0.5, 3, 16, 24, and 48 h post-injection respectively; n = 4). Since tumor uptake peaked at 3 h post-injection, 61Cu-NOTA-TRC105-F(ab')2 also gave good tumor contrast at 3 and 8 h post-injection. CD105 specificity of the tracers was confirmed by blocking studies and histopathology. In conclusion, the use of a F(ab')2 fragment led to more rapid tumor uptake (which peaked at 3 h post-injection) than radiolabeled intact antibody (which often peaked after 24 h post-injection), which may allow for same day immunoPET imaging in future clinical studies. PMID:23316869

  15. Positron emission tomography imaging of tumor angiogenesis with a (61/64)Cu-labeled F(ab')(2) antibody fragment. (United States)

    Hong, Hao; Zhang, Yin; Orbay, Hakan; Valdovinos, Hector F; Nayak, Tapas R; Bean, Jero; Theuer, Charles P; Barnhart, Todd E; Cai, Weibo


    The objective of this study was to characterize the in vitro and in vivo properties of the F(ab')(2) fragment of TRC105, a human/murine chimeric IgG1 monoclonal antibody that binds with high avidity to human and murine CD105 (i.e., endoglin), and investigate its potential for positron emission tomography (PET) imaging of tumor angiogenesis after (61/64)Cu-labeling. TRC105-F(ab')(2) of high purity was produced by pepsin digestion of TRC105, which was confirmed by SDS-PAGE, HPLC analysis, and mass spectrometry. (61/64)Cu-labeling of NOTA-TRC105-F(ab')(2) (NOTA denotes 1,4,7-triazacyclononane-1,4,7-triacetic acid) was achieved with yields of >75% (specific activity: ∼115 GBq/μmol). PET imaging revealed rapid tumor uptake of (64)Cu-NOTA-TRC105-F(ab')(2) in the 4T1 murine breast cancer model (5.8 ± 0.8, 7.6 ± 0.6, 5.6 ± 0.4, 5.0 ± 0.6, and 3.8 ± 0.7% ID/g at 0.5, 3, 16, 24, and 48 h postinjection respectively; n = 4). Since tumor uptake peaked at 3 h postinjection, (61)Cu-NOTA-TRC105-F(ab')(2) also gave good tumor contrast at 3 and 8 h postinjection. CD105 specificity of the tracers was confirmed by blocking studies and histopathology. In conclusion, the use of a F(ab')(2) fragment led to more rapid tumor uptake (which peaked at 3 h postinjection) than radiolabeled intact antibody (which often peaked after 24 h postinjection), which may allow for same day immunoPET imaging in future clinical studies. PMID:23316869

  16. Choice of labeling and cell line influences interactions between the Fab fragment AbD15179 and its target antigen CD44v6

    International Nuclear Information System (INIS)

    Medical imaging by use of immunotargeting generally relies on a labeled molecule binding to a specific target on the cell surface. It is important to utilize both cell-based and time-resolved binding assays in order to understand the properties of such molecular interactions in a relevant setting. In this report we describe the detailed characterization of the interaction properties for AbD15179, a promising CD44v6-targeting antibody fragment for radio-immunotargeting. Influence of labeling and cell-line model on the protein interaction kinetics was assessed using three different labeling approaches (111In, 125I and FITC) on three different squamous carcinoma cell lines. Interactions were measured using time-resolved assays on living cells, and further analyzed with Interaction Map®. Results demonstrated a general biphasic appearance of a high- and a low-affinity binding event in all cases. The relative contribution from these two interactions differed between conjugates. For 125I-Fab, the population of low-affinity binders could be significantly increased by extending the chloramine T exposure during labeling, whereas the 111In-labeling predominantly resulted in a high-affinity interaction. Interactions were also shown to be cell line dependent, with e.g. SCC-25 cells generally mediating a faster dissociation of conjugates compared to the other cell lines. In conclusion, we report both cell line dependent and labeling associated variations in interaction kinetics for AbD15179 binding to CD44v6. This has implications for cell-based kinetic assays and applications based on labeled conjugates in general, as well as in a clinical setting, where each individual tumor may create different kinetic profiles for the same conjugate

  17. Improved immunoscintigraphy by subcutaneous injection of sup(99m)Tc or 111In labelled F(ab')2 fragments of an anti-melanoma monoclonal antibody

    International Nuclear Information System (INIS)

    Technetium-99m and/or 111In labelled F(ab')2 fragments of a melanoma associated MoAb 225.28S were injected i.v. in 80 patients affected by stage I to IV malignant melanoma. 75% of metastatic lesions already documented by other methods were detected by immunoscintigraphy, which was also capable of detecting a certain number of unknown metastases. The authors observed a lower percentage of positive scans in liver, lung and skin because of the poor tumour to background ratio. In some patients, subcutaneous (s.c.) injection allowed visualization documented metastases undetected by i.v. administration. An equal amount on non-specific F(ab')2 fragments (MoAb 4C4) injected s.c. as a negative control showed no positive scans. Clinical studies and chromatographic patterns of patient serum samples suggest that the s.c. route of administration offers, with respect to the the i.v. route, the advantage of reducing vascular background and aspecific accumulation in liver, probably because of retention of possible contaminants by the lymphatic system. (author)

  18. An automated technique for most-probable-number (MPN) analysis of densities of phagotrophic protists with lux-AB labelled bacteria as growth medium

    DEFF Research Database (Denmark)

    Ekelund, Flemming; Christensen, Søren; Rønn, Regin; Buhl, E.; Jacobsen, C.S.


    An automated modification of the most-probable-number (MPN) technique has been developed for enumeration of phagotrophic protozoa. The method is based on detection of prey depletion in micro titre plates rather than on presence of protozoa. A transconjugant Pseudomonas fluorescens DR54 labelled...... with a luxAB gene cassette was constructed, and used as growth medium for the protozoa in the micro titre plates. The transconjugant produced high amounts of luciferase which was stable and allowed detection for at least 8 weeks. Dilution series of protozoan cultures and soil suspensions were...

  19. Detection of GAD-Ab index in diabetic patients using 35S labeled recombinant human GAD65 antigen

    International Nuclear Information System (INIS)

    Objective: To establish a novel method for measuring glutamic acid decarboxylase autoanti-bodies(GAD-Ab). Methods: Recombinant human GAD65 was used as the antigen, in vitro transcribed and translated 35S-GAD65 as the tracer, a self-designed rotating incubation apparatus as the incubator, protein-A sepharose as the precipitator, and the liquid scintillation counter was used to measure radioactive count value to detect GAD-Ab. The positive cut-off point of GAD-Ab index was determined as > 0.05 by the 99.5% percentile in 109 healthy individuals. GAD-Ab levels were determined in 43 type 1 and 226 type 2 diabetic patients. Results: The optimized working conditions included SJ1515 35S-methionine for in vitro transcription and translation, 20-30 r/min setup of rotating incubation apparatus, test temperature 4-25 degree C, freshly prepared buffer of pH 7.2-7.4, and horizontal rotor centrifuge. The new method was better than original one, with intra-assay CV of 4.9%-8.3% and inter-assay CV of 7.1%-10.8 %, specificity of 98.2%. The results were comparable with the figures issued by an international standardized laboratory (concordance was 98.3%, Kappa value 0.971). The positive rate of GAD-Ab was 58.1% (25 of 43) in type 1 and 10.2%(23 of 226) in type 2 diabetes patients, but only 1.8% (2 of 109) in healthy individuals. Conclusion: The new assay for GAD-Ab is a highly sensitive, accurate, specific and reproducible method for clinical use

  20. Radioimmunoimaging of experimental thrombi in dogs using Tc-99m labeled monoclonal antibody fragments [MAPab-F(ab')/sub 2/] reactive with human platelets

    International Nuclear Information System (INIS)

    Radioimmunoimaging of thrombi could have great clinical value in the management of coronary artery and thromboembolic disease. In-111-oxine-labeled platelets currently used require platelet isolation, delayed imaging, background subtraction and there is also potential for damaging or contaminating platelets during labeling. Murine monoclonal antibody (IgG/sub 2/a) fragments directed against human platelet membrane components (cross-reactive with dog platelets) were labeled with Tc-99m and repurified from ''kits''. After radiolabeling, 91.5-93.3% of the Tc-99m was antibody-associated. The preparations retained immunoreactivity, as determined by the ratio of cell to plasma-associated radioactivity (ratios 54.7-63.8). Tc-99m-MAPAb-F(ab')/sub 2/ were injected i.v. into dogs with thrombi produced in peripheral and pulmonary veins and arteries. About 50% of the radioactivity was cleared from the blood in 3-6 min. and 18-24% was excreted in the urine within 3 hrs. The thrombi were consistently and easily visible within 1-3 hrs. with no need for blood pool subtraction. In some cases, intimal damage along the path of catheters was seen. No adverse side effects were observed. The advantages of this method are: short and simple preparation, no need for blood pool subtraction and early visualization of thrombi. Human studies are warranted to determine its clinical efficacy

  1. Experience in immunoscintigraphy with 131I-labelled OC-125 F(ab')2 in patients with ovarian carcinoma

    International Nuclear Information System (INIS)

    In the specialized postoperative follow-up of patients with epithelial ovarian carcinoma, radioimmunoscintigraphy could usefully complete computed tomography and ultrasound results. Restrictions concerning the use of 131I labelled antibody fragments result, however, from radiation dosimetry and protection aspects: Although not more than 140 MBq of the 131I agent is administered because of the high thyroid and whole-body radiation exposure, for some days substantial excretion of 131I into urine occurs. This prevents us drastically from applying the method to the same extent as recommended in the literature. These limitations are expected to be overcome with 99mTc or 111In antibodies. (author)

  2. EIA screening in Denmark

    DEFF Research Database (Denmark)

    Nielsen, Eskild Holm; Christensen, Per; Kørnøv, Lone


    The article points out that EIA screening is effectively a regulatory instrument and it can be a cost-effective instrument with environmental benefits.......The article points out that EIA screening is effectively a regulatory instrument and it can be a cost-effective instrument with environmental benefits....

  3. EIA publications directory, 1991

    International Nuclear Information System (INIS)

    Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department's independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, and resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the EIA from January through December 1991. This edition supplements EIA Publications Directory 1977--1989 and EIA Publications Directory 1990. The body of the Directory contains citations and abstracts arranged by broad subject categories, such as coal, petroleum, and natural gas and subcategories such as reserves, produces and byproducts, and marketing and economics. All reports are indexed alphabetically by subject and title and numerically by report number

  4. EIA publications directory 1994

    Energy Technology Data Exchange (ETDEWEB)



    Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department`s independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by EIA from January through December 1994. The body of the Directory contains citations and abstracts arranged by broad subject categories: metadata, coal, oil and gas, nuclear, electricity, renewable energy/alternative fuels, multifuel, end-use consumption, models, and forecasts.

  5. 188Re-labelled McAb 3H11 used as preventive for the peritoneal micro-metastasis of gastric cancer

    International Nuclear Information System (INIS)

    In advancing gastric cancer, especially when the serous is invaded, the plantation of cancer cells in peritoneal is common and it affects patients' survival time severely. Based on successfully labelled McAb (monoclonal antibody) 3H11 with 188Re, the authors investigated the effect of RIT (Radio-immuno-Therapy) with 188Re-3H11 on preventing the peritoneal micro-metastasis of gastric cancer cells in nude mice to increase the survival time. After 1 x 106 BGC-823 gastric cancer cells were injected into the peritoneal cavity of each mouse, 45BABL/C nude mice were divided into 9 groups. Each group received different doses of 188Re-3H11 or 188Re-IgG, or saline I.P.16 hours post operation. The injected volume of each mouse was 1.0 mL. The results showed that the survival time depended on the injected dose during 0 to 37 MBq. The survival time was 170 +- 25.3 d after 37 MBq 188Re-3H11 were treated. It was over 5 times more than that for the saline group and about 3 times more than that for 37 MBq 188-Re IgG group (p 188Re-3H11 I.P. is effective and safe for the prevention of intra-peritoneal injected gastric cancer cells from surviving, growing and disseminating in nude mice

  6. EIA publications directory, 1990

    International Nuclear Information System (INIS)

    Enacted in 1977, the Department of Energy (DOE) Organization Act established the Energy Information Administration (EIA) as the Department's independent statistical and analytical agency, with a mandate to collect and publish data and prepare analyses on energy production, consumption, prices, and resources, and projections of energy supply and demand. This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the EIA from January through December 1990. This edition supplements EIA Publications Directory 1977--1989. The body of the Directory contains citations and abstracts arranged by broad subject categories, such as coal, petroleum, and natural gas and subcategories such as reserves, products and byproducts, and marketing and economics. All reports are indexed alphabetically by subject and title and numerically by report number

  7. EIA Publications Directory 1995

    Energy Technology Data Exchange (ETDEWEB)



    This directory contains abstracts and ordering information for individual issues of semiannual, annual, biennial, and triennial Energy Information Administration (EIA) periodicals, analysis reports, Service Reports, and model documentations. This edition covers periodicals and one-time reports produced by EIA from January through December 1995. The citations and abstracts are arranged by broad subject categories: metadata, coal, oil/gas, nuclear, electricity, renewable energy/alternative fuels, multifuel, end-use consumption, models, and forecasts. Indexes are provided.

  8. EIA publications directory 1996

    International Nuclear Information System (INIS)

    This edition of the EIA Publications Directory contains titles and abstracts of periodicals and one-time reports produced by the Energy Information Administration (EIA) from January through December 1996. The body of the Directory contains citations and abstracts arranged by broad subject categories; metadata, coal, oil and gas, nuclear, electricity, renewable and energy/alternative fuels, multifuel, end-use consumption, models, and forecasts

  9. Biodistribution in normal mice of an 111In-labelled prostatic acid phosphatase-specific antibody and its F(ab')2 fragments derivatized site-specifically or via bicyclic diethylenetriaminepentaacetic acid anhydride

    International Nuclear Information System (INIS)

    We examined the optimization of derivatization of monoclonal antibodies and their fragments intended for use as radiopharmaceutical in radioimaging and/or radioimmunotherapy of prostatic cancer. Two different principles were used to conjugate (DTPA) to a monoclonal antibody (Mab, subclass IgG1) raised against human prostatic acid phosphatase (PAP). In addition, the F(ab')2 fragments of this Mab were also derivatized. The biodistribution of the 111In-labelled derivatives was investigated in normal mice. All the derivatives of IgG1 demonstrated a slower blood clearance than the corresponding derivatives of the F(ab')2 fragments. This property was particularly pronounced in the site-specifically conjugated derivatives of IgG1. All the derivatives studied accumulated in the liver, kidney, and spleen. The CA-DTPA derivatives of F(ab')2 fragments showed the highest kidney-to-blood ratios of radioactivity. The derivatives of IgG1 showed a higher percentage of the injected dose in liver and spleen tissues than the derivatives of the F(ab')2 fragments. The F(ab')2 fragments studied also gave rise to site-specific derivatives, which demonstrated that carbohydrates were also present in this part of the molecule. They behaved similarly to the CA-DTPA F(ab')2 derivative in other respects, but the kidney accumulation was lower at 72 and 120 h. The F(ab')2 fragments studied would be better suited for radioimaging than the derivatives of the IgG1 studied. In contrast, the derivatives of IgG1, especially the p-NH2-Bz-DTPA conjugate, might be more suitable candidates for the development of therapeutic agents. (orig.)

  10. Effects of tumour mass and circulating antigen on the biodistribution of 111In-labelled F(ab')2 fragments of human prostatic acid phosphatase monoclonal antibody in nude mice bearing PC-82 human prostatic tumor xenografts

    International Nuclear Information System (INIS)

    We have evaluated the effects of tumour mass and circulating antigen (prostatic acid phosphatase, PAP) on the biodistribution and the incorporation of 111In-labelled F(ab')2 monoclonal antibody (MoAb) fragments directed against human PAP into human prostatic tumours (PC-82; 0.1-8.9 g) growing in nude mice. The radioactivities in the blood, liver, spleen, kidney and tumour were compared at 1, 3, 4 and 6 days after the intravenous administration of the antibody fragments. There was a significant correlation between the tumour size and the serum PAP concentration in the model employed. Even tissue of a small tumour (111In-labelled F(ab')2 fragments. This relationship had levelled off by 72 h and most likely reflected a better vascularisation of the smaller tumours. Our results show that the increase in tumour size and in the concentration of circulating antigen in the blood led to decreased tumour-to-blood ratios, since there was a tendency for higher blood activities in mice with larger tumours and higher serum PAP concentrations. There was no correlation between tumour size and label uptake by the liver during the follow-up over 144 h, although serum PAP concentrations ranged from 3.1 μg/l to 352 μg/l. On the other hand, when compared with our previous data obtained with non-tumour-bearing mice, there was a significant increase in the uptake by the liver and spleen. These results indicate that even a small concentration of circulating antigen was able to trigger an abnormal change in the biodistribution of MoAbs. (orig.)

  11. EIA Publications Directory 1993

    Energy Technology Data Exchange (ETDEWEB)


    This directory contains abstracts and ordering information for EIA publications released in the above time period. The abstracts are arranged by broad subject category such as coal, petroleum, natural gas, and electric power. A comprehensive subject index, a title index, and a report number index are included. Each entry gives the title, report number, publication frequency, date, number of pages, and ordering information.

  12. EIA publications directory, 1992

    Energy Technology Data Exchange (ETDEWEB)


    This directory contains abstracts and ordering information for EIA publications. The abstracts are arranged by broad subject category such as coal, petroleum, natural gas, and electric power. A comprehensive subject index, a title index, and a report number index are included. Each entry gives the title, report number, publication frequency, date, number of pages, and ordering information. Publication began with the 1979 edition.

  13. EIA Publications Directory 1993

    International Nuclear Information System (INIS)

    This directory contains abstracts and ordering information for EIA publications released in the above time period. The abstracts are arranged by broad subject category such as coal, petroleum, natural gas, and electric power. A comprehensive subject index, a title index, and a report number index are included. Each entry gives the title, report number, publication frequency, date, number of pages, and ordering information

  14. EIA publications directory, 1992

    International Nuclear Information System (INIS)

    This directory contains abstracts and ordering information for EIA publications. The abstracts are arranged by broad subject category such as coal, petroleum, natural gas, and electric power. A comprehensive subject index, a title index, and a report number index are included. Each entry gives the title, report number, publication frequency, date, number of pages, and ordering information. Publication began with the 1979 edition

  15. Critical factors for EIA implementation

    DEFF Research Database (Denmark)

    Zhang, Jasmine; Kørnøv, Lone; Christensen, Per


    After decades of development, the gap between expectations of Environment Impact Assessments (EIA) and their practical performance remains significant. Research has been done to identify the critical factors for an effective implementation of EIA. However, this research, to a large extent, has...... between different critical factors and how they relate to different stages in the EIA and thus influence the decision making process. After reviewing 33 refereed journal articles published between 1999 and 2011, we identified 203 notions of critical factors. Of these, 102 related to different stages...... defined in our comprehensive EIA implementation model, and 101 were identified as general factors related to the whole EIA system. The number of notions of stage factors and general factors is thus about equal. An overlap between stage factors and general factors was found, which demonstrates...

  16. Design and preclinical evaluation of a 99mTc-labelled diabody of mAb J591 for SPECT imaging of prostate-specific membrane antigen (PSMA)


    Kampmeier, Florian; Williams, Jennifer D.; Maher, John; Mullen, Gregory E.; Blower, Philip J.


    Background Sensitive and specific detection of nodal status, sites of metastases and low-volume recurrent disease could greatly improve management of patients with advanced prostate cancer. Prostate-specific membrane antigen (PSMA) is a well-established marker for prostate carcinoma with increased levels of expression in high-grade, hormone-refractory and metastatic disease. The monoclonal antibody (mAb) J591 is directed against an extracellular epitope of PSMA and has been shown to efficient...

  17. An assessment of EIA system in India

    International Nuclear Information System (INIS)

    Environmental impact assessment (EIA) was first introduced in India based on the Environmental Protection Act (EPA), 1986. But formally it came in to effect, when Ministry of Environment and Forest (MoEF) has passed a major legislative measure under EPA in January 1994 for Environmental Clearance (EC) known as EIA Notification, 1994. Subsequently, EIA processes have been strengthened by MoEF by a series of amendments. The current practice is adhering to EIA Notification, 2006 and its amendments. The pieces of evidence collected and analysis in the present assessment suggest that, despite a sound legislative, administrative and procedural set-up EIA has not yet evolved satisfactorily in India. An appraisal of the EIA system against systematic evaluation criteria, based on discussions with various stakeholders, EIA expert committee members, approval authorities, project proponents, NGOs and consulting professionals, reveals various drawbacks of the EIA system. These mainly include; inadequate capacity of EIA approval authorities, deficiencies in screening and scoping, poor quality EIA reports, inadequate public participation and weak monitoring. Overall, EIA is used presently as a project justification tool rather than as a project planning tool to contribute to achieving sustainable development. While shortcomings are challenging, Government of India is showing a high degree of commitment. The EIA system in the country is undergoing progressive refinements by steadily removing the constraints. The paper identifies opportunities for taking advantage of the current circumstances for strengthening the EIA process. - Highlights: ► An assessment has been carried out on Environmental Clearance under EIA Notification, 2006, MoEF, Government of India. ► EIA system is appraised against systematic evaluation criteria proposed by Ahmad and Wood (2002), Wood (2003), Fuller (1999). ► The analysis reveals reveals various drawbacks of the EIA system. ► The paper identifies

  18. Fotfavoriten AB


    Søilen, Klaus Solberg; HUBER, Stefan


    Fotfavoriten AB, a foot care company located in Sollefttå in Northern Sweden, is an example of how local government fires staff only to reengage them as entrepreneurs delivering similar service. The case is typical for the social sector and may mark a trend. The result is often felt to be positive both by the entrepreneur, who is now more directly in charge of her or his earnings, and the end consumer. The CEO of Fotfavoriten AB, Eva Wörmann, waited a long time before she dared to take the ne...

  19. Radioimmunodetection of lymph node invasion in prostatic cancer. The use of iodine-123 (123I)-labeled monoclonal anti-prostatic acid phosphatase (PAP) 227 A F(ab')2 antibody fragments in vivo

    International Nuclear Information System (INIS)

    The therapeutic indications in prostatic cancer depend on the regional and distant extension of the cancer and are difficult to assess before lymphadenectomy. Radioimmunodetection of lymph node involvement with monoclonal anti-prostatic acid phosphatase (PAP) antibodies can be proposed as a noninvasive alternative to lymphadenectomy. Fifteen patients with various stages of histologically proven prostatic cancer were examined by immunolymphoscintigraphy (ILS) before treatment to detect lymph node metastases. These patients had Stage A (n = 7), Stage B (n = 3), Stage C (n = 2), and Stage D (n = 3) tumors. They received between 100 and 400 micrograms of monoclonal antibody 227 A in the form of F(ab')2 fragments labeled with iodine-123 (123I). The antibody was injected directly into the periprostatic area. ILS images were obtained after 1, 3, 6, and 24 hours. Three days later, each patient underwent a lymphadenectomy for histologic examination. The results of the histologic examination and ILS were compared. In ten patients, the examination did not show any images capable of being interpreted as lymphadenopathy and histologic examination confirmed the integrity of the nodes examined. In five cases, scintigraphy suggested the presence of lymph node invasion by prostatic cancer and this was confirmed by histologic examination in three of the five cases. Overall, in terms of lymphadenopathy, this examination had a sensitivity of 100% and a specificity of 83%. Therefore, ILS appears to be capable of detecting lymph node metastases in prostatic cancer

  20. Analysis of the Environmental Impact Assessment (EIA) Directive and the EIA decision in Turkey

    International Nuclear Information System (INIS)

    The Environmental Impact Assessment (EIA) Directive first entered into force in the United States in 1969, and began to be implemented in many other countries by 1990. The first Environmental Impact Assessment (EIA) Directive in Turkey was published on February 7, 1993, under the Environmental Law No. 2872. The EIA Directive was revised seven times on June 23, 1997, June 6, 2002, December 16, 2003, July 17, 2008, October 3, 2013, and November 25, 2014. Several amendments were made during this process. The first EIA Directive dated 1993 was narrow in scope and its procedure was long, while the amendments in 2003, 2008, 2013, and 2014 widened the scope of the EIA, and shortened the EIA assessment procedures. In this study, the amendments to the Turkish EIA Directive were analysed, and their effect on the number of EIA decisions made was addressed. It was concluded that the uncertainties in EIA procedures were removed, procedures were shortened, and as a result, the number of EIA decisions increased thanks to the revisions made in line with harmonisation with European Union (EU) acquis. - Highlights: • Demonstrates the Environmental Impact Assessment practices in Turkey. • Demonstrates the application of the EIA in Turkey by sector. • Demonstrates the amendments of the EIA by-laws in Turkey. • Demonstrates the changes in EIA practices and EIA decisions

  1. New fluorimetric assay of horseradish peroxidase using sesamol as substrate and its application to EIA

    Institute of Scientific and Technical Information of China (English)


    Horseradish peroxidase (HRP) is generally used as a label enzyme in enzyme immunoassay (EIA).The procedure used for HRP detection in EIA is critical for sensitivity and precision.This paper describes a novel fluorimetric assay for horseradish peroxidase (HRP) using sesamol as substrate.The principle of the assay is as follow:sesamol (3,4-methylenedioxy phenol) is reacted enzymatically in the presence of hydrogen peroxide to produce dimeric sesamol.The dimer is fluorescent and can be detected sensitively at ...

  2. Dutch Energy Investment Allowance (EIA). Energy List for 2013; Energie-investeringsaftrek (EIA). Energielijst 2013

    Energy Technology Data Exchange (ETDEWEB)



    The Energy Investment Allowance (EIA) is a tax system by means of which the Dutch government supports companies with investments in energy-saving equipment and renewable energy. This brochure explains the assets eligible for EIA and how the scheme works [Dutch] De Energie-investeringsaftrek (EIA) is een fiscale regeling waarmee de overheid ondersteuning biedt voor bedrijven bij investeringen in energiebesparende bedrijfsmiddelen en duurzame energie. In deze brochure wordt uitgelegd welke bedrijfsmiddelen in aanmerking komen voor EIA en hoe de regeling werkt.

  3. Danish experiences on EIA of livestock projects

    International Nuclear Information System (INIS)

    Since its introduction into Danish planning in 1989, Environmental Impact Assessment (EIA) has been widely discussed. At the centre of the debate has been the question of whether EIA actually offered anything new and there has been a great deal of scepticism about the efficacy of the instrument, especially when it comes to livestock projects. In an evaluation of the Danish EIA experience, we have looked more closely at how the EIA instruments function regarding livestock projects. This article addresses both the EIA process as well as the EIA screening. It is demonstrated that the EIA screening in its own right is a kind of regulatory instrument. Examining the assessments made during screening more closely, we conclude that there is still some way to go in order to make the assessment broader and more holistic in accordance with the ambitions set out in the EIA directive to contribute to a more sustainable development. Although the provisions laid down are the same the praxis related to the field has developed at a considerable speed. In order to understand this development we have closely examined how the decisions made by the Nature Protection Board of Appeal (NPBA) have been changed and conclude that these changes definitely address some of the shortcomings found in the evaluation

  4. Danish experiences on EIA of livestock projects

    DEFF Research Database (Denmark)

    Christensen, Per


    Since its introduction into Danish planning in 1989, Environmental Impact Assessment (EIA) has been widely discussed. At the centre of the debate has been the question of whether EIA actually offered anything new and there has been a great deal of scepticism about the efficacy of the instrument...

  5. EIA modelling for CZM applications. Part 1

    Digital Repository Service at National Institute of Oceanography (India)

    Vethamony, P.; Babu, M.T.

    stream_size 12 stream_content_type text/plain stream_name Summer_Sch_EIA_Manage_Coast_Zone_2001_84.pdf.txt stream_source_info Summer_Sch_EIA_Manage_Coast_Zone_2001_84.pdf.txt Content-Encoding ISO-8859-1 Content-Type text...

  6. EIA of anthropogenic activities on marine macrobenthos

    Digital Repository Service at National Institute of Oceanography (India)

    Govindan, K.

    stream_size 12 stream_content_type text/plain stream_name Summer_Sch_EIA_Mgmt_Coastal_Zone_Trg_Manual_158.pdf.txt stream_source_info Summer_Sch_EIA_Mgmt_Coastal_Zone_Trg_Manual_158.pdf.txt Content-Encoding ISO-8859-1 Content...-Type text/plain; charset=ISO-8859-1 ...

  7. EIA data index: an abstract journal

    International Nuclear Information System (INIS)

    The individual tables, graphs, and formatted data presented in the statistical publications of the Energy Information Administration (EIA) are abstracted and indexed. Included are a complete subject index and a report number listing for all EIA publications as well as complete ordering information for these publications. The abstracts of the tables and graphs are arranged by broad subject categories (e.g., coal, petroleum, natural gas, energy analysis and modeling) with further division occurring by subcategories (e.g., reserves, drilling and production, processing). Included here are those publications and their statistical contents which were released by the EIA from its formation in October 1977 through approximately the first half of 1980. Updates will be on a semiannual basis. The EIA Data Index is a companion volume to the EIA Publications Directory: A User's Guide (DOE/EIA-0149), which provides abstracts and indexes to all EIA publications at the document level. Both of these publications are generated from the Federal Energy Data Index (FEDEX) data base which has been developed by the EIA in cooperation with the Technical Information Center of the US Department of Energy

  8. A review of EIAs on trade policy in China: Exploring the way for economic policy EIAs

    International Nuclear Information System (INIS)

    During the discussion on the “Environmental Protection Law Amendment (draft)” in 2011, it was decided to drop the proposed clauses related to environmental impact assessments (EIAs) on policy, which means that there remained no provisions for policy EIAs, and China's strategic environmental assessment system stayed limited to the planning level. However, considering that economic policy making is causing significant direct and indirect environmental problems and that almost every aspect of governmental policy has an economic aspect, EIAs on economic policies are of the utmost urgency. The purpose of this study is to review the EIA work that has been carried out on trade policy in China through four case studies, and illustrate how trade policy EIAs can be helpful in achieving better environmental outcomes in the area of trade. Through the trade policy EIA case studies we try to argue for the feasibility of conducting EIAs on economic policies in China. We also discuss the implications of the case studies from the point of view of how to proceed with EIAs on economic policy and how to promote their practice. - Highlights: • SEA system is incomplete and stays limited to the plan EIA level in China. • EIA on economic policy is of utmost importance for all the developing countries. • Four case studies of trade policy EIA in China are reviewed for policy implications. • Departmental competition for political power impedes economic policy EIAs in China. • Legislative regulation on policy EIA is the first thing needed to overcome barrier

  9. A review of EIAs on trade policy in China: Exploring the way for economic policy EIAs

    Energy Technology Data Exchange (ETDEWEB)

    Mao, Xianqiang, E-mail: [Center for Global Environmental Policy, School of Environment, Beijing Normal University, Beijing 100875 (China); Song, Peng, E-mail: [Center for Global Environmental Policy, School of Environment, Beijing Normal University, Beijing 100875 (China); Kørnøv, Lone, E-mail: [The Danish Centre for Environmental Assessment, Department of Planning, Aalborg University, Skibbrogade 5, B1-04, 9000 Aalborg (Denmark); Corsetti, Gabriel, E-mail: [Center for Global Environmental Policy, School of Environment, Beijing Normal University, Beijing 100875 (China)


    During the discussion on the “Environmental Protection Law Amendment (draft)” in 2011, it was decided to drop the proposed clauses related to environmental impact assessments (EIAs) on policy, which means that there remained no provisions for policy EIAs, and China's strategic environmental assessment system stayed limited to the planning level. However, considering that economic policy making is causing significant direct and indirect environmental problems and that almost every aspect of governmental policy has an economic aspect, EIAs on economic policies are of the utmost urgency. The purpose of this study is to review the EIA work that has been carried out on trade policy in China through four case studies, and illustrate how trade policy EIAs can be helpful in achieving better environmental outcomes in the area of trade. Through the trade policy EIA case studies we try to argue for the feasibility of conducting EIAs on economic policies in China. We also discuss the implications of the case studies from the point of view of how to proceed with EIAs on economic policy and how to promote their practice. - Highlights: • SEA system is incomplete and stays limited to the plan EIA level in China. • EIA on economic policy is of utmost importance for all the developing countries. • Four case studies of trade policy EIA in China are reviewed for policy implications. • Departmental competition for political power impedes economic policy EIAs in China. • Legislative regulation on policy EIA is the first thing needed to overcome barrier.

  10. EIA screening and nature protection in Denmark

    DEFF Research Database (Denmark)

    Christensen, Per; Kørnøv, Lone


    screening practices. In this paper, the demands formulated in the guidelines of local authorities were analysed in order to investigate how the protection of groundwater, coastal waters, lakes and Natura 2000 sites develops through EIA screening. It is concluded that the level of protection has improved......The number of environmental impact assessment (EIA) screenings in Denmark has increased dramatically since 2000. This is a consequence of increased pig production as well as the concentration of production on larger farms. In the same period, EIA rules have developed primarily due to an increased...

  11. He'eia Stream Contaminants Study (United States)

    US Fish and Wildlife Service, Department of the Interior — Potential risk to ecological receptors in He’eia Stream and Wetland was characterized through the use of a food-web model to predict effects to the Hawaiian stilt,...

  12. Food Labels (United States)

    ... How Can I Help a Friend Who Cuts? Food Labels KidsHealth > For Teens > Food Labels Print A ... have at least 95% organic ingredients. continue Making Food Labels Work for You The first step in ...

  13. Is EIA part of the wind power planning problem?

    International Nuclear Information System (INIS)

    This research evaluates the importance and effectiveness of Environmental Impact Assessment (EIA) within wind farm planning debates, drawing on insights from case studies in Scotland. Despite general public support for renewable energy on the grounds that it is needed to tackle climate change and implement sustainable development, many proposed wind farms encounter significant resistance. The importance of planning issues and (EIA) processes has arguably been overlooked within recent wind farm social acceptability discourse. Through semi-structured interviews with key stakeholders and textual analysis of EIA documents, the characteristics of EIA are assessed in terms of its perceived purpose and performance. The data show that whilst respondents perceive EIA to be important, they express concerns about bias and about the inability of EIA to address climate change and wind farm decommissioning issues adequately. Furthermore, the research identifies key issues which impede the effectiveness of EIA, and reveals differences between theoretical and practical framings of EIA. The paper questions the assumption that EIA is a universally applicable tool, and argues that its effectiveness should be analysed in the context of specific development sectors. The article concludes by reviewing whether the recently amended EIA Directive (2014/52/EU) could resolve identified problems within national EIA practice. - Highlights: • Evaluation of EIA for onshore wind farm planning in Scotland. • EIA is important for multiple aspects of onshore wind farm planning. • Multiple substantive deficiencies of relevance to wind farm planning exist in EIA. • Further research into EIA effectiveness for specific development types is required. • Directive 2014/52/EU may improve EIA effectiveness within wind farm planning

  14. Is EIA part of the wind power planning problem?

    Energy Technology Data Exchange (ETDEWEB)

    Smart, Duncan Ewan; Stojanovic, Timothy A., E-mail:; Warren, Charles R.


    This research evaluates the importance and effectiveness of Environmental Impact Assessment (EIA) within wind farm planning debates, drawing on insights from case studies in Scotland. Despite general public support for renewable energy on the grounds that it is needed to tackle climate change and implement sustainable development, many proposed wind farms encounter significant resistance. The importance of planning issues and (EIA) processes has arguably been overlooked within recent wind farm social acceptability discourse. Through semi-structured interviews with key stakeholders and textual analysis of EIA documents, the characteristics of EIA are assessed in terms of its perceived purpose and performance. The data show that whilst respondents perceive EIA to be important, they express concerns about bias and about the inability of EIA to address climate change and wind farm decommissioning issues adequately. Furthermore, the research identifies key issues which impede the effectiveness of EIA, and reveals differences between theoretical and practical framings of EIA. The paper questions the assumption that EIA is a universally applicable tool, and argues that its effectiveness should be analysed in the context of specific development sectors. The article concludes by reviewing whether the recently amended EIA Directive (2014/52/EU) could resolve identified problems within national EIA practice. - Highlights: • Evaluation of EIA for onshore wind farm planning in Scotland. • EIA is important for multiple aspects of onshore wind farm planning. • Multiple substantive deficiencies of relevance to wind farm planning exist in EIA. • Further research into EIA effectiveness for specific development types is required. • Directive 2014/52/EU may improve EIA effectiveness within wind farm planning.

  15. A multicenter evaluation of the Biotest legionella urinary antigen EIA

    DEFF Research Database (Denmark)

    Harrison, Timothy; Uldum, Søren; Alexiou-Daniel, Stella;


    OBJECTIVES: To undertake a multicenter study to evaluate the Biotest legionella urinary antigen enzyme immunoassay (EIA) performance against those EIAs already in use in 14 European laboratories. METHODS: Each laboratory examined urine specimens from appropriate patients using both their current...... laboratories' current EIAs, and in 94.6% of those specimens which were positive for Legionella pneumophila serogroup 1. CONCLUSION: The Biotest EIA is simple to use and specific and the results obtained in different laboratories show excellent agreement. The assay compares well existing EIAs, at least for L...

  16. AB170. Effect of levitra on sustenance of erection (EROS): an open-label, prospective, multicenter, single-arm study to investigate erection duration measured by stopwatch with flexible dose vardenafil administered for 8-week in subjects with erectile dysfunction


    Shin, Yu Seob; Lee, Sung Won; Park, Kwangsung; Chung, Woo Sik; Kim, Sae Woong; Hyun, Jae Seog; Moon, Du Geon; Yang, Sang-Kuk; Ryu, Ji Kan; Yang, Dae Yul; Moon, Ki Hak; Min, Kweon Sik; Park, Jong Kwan


    Introduction To investigate the change of erection duration measured by stopwatch with flexible dose vardenafil administered for 8-week in subjects with erectile dysfunction (ED). Material and methods Effect of levitra on sustenance of erection (EROS) was an open-label, prospective, multicenter, single-arm study designed to measure the duration of erection in men with ED receiving a flexible dose of vardenafil over an 8-week treatment period. Patients were instructed to take vardenafil 10 mg ...

  17. Dutch Energy Investment Allowance (EIA). Annual report 2012; Energie-Investeringsaftrek (EIA). Jaarverslag 2012

    Energy Technology Data Exchange (ETDEWEB)



    By means of the Energy Investment Allowance (EIA) the Ministry of Economic Affairs supports investments of businesses, industrial associations and other parties in accelerating innovative, energy saving sustainable initiatives and technologies. In this report the results for 2012 are presented [Dutch] Met de EIA ondersteunt het Ministerie van Economische Zaken bedrijven bij het investeren in innovatieve, energiebesparende en duurzame technieken. In dit verslag over 2012 worden resultaten weergegeven.

  18. Wasteful Labeling


    Mahenc, Philippe


    The role of labeling is to solve the adverse selection problem caused by unsubstantiated claims from firms. The problem however is likely to remain unsolved if the labeling agency is not trustworthy.The agency can be suspected to divert the fees charged for labeling from their primary purpose of collecting information in order to raise excessive revenue. This paper addresses this issue and shows that labeling may be wasteful if the agency is likely to be untrustworthy. To award firms green la...

  19. EIA and green procurement: Opportunities for strengthening their coordination

    International Nuclear Information System (INIS)

    EIA plays an important role in enhancing the environmental performance of the construction sector. In recent years, the construction sector has been developing green procurement practices. Green procurement is a process that involves the incorporation of environmental requirements during the procurement of services and products. However, discussion on green procurement is rarely seen during the EIA phase. This paper addresses possible opportunities for improving the coordination between EIA and green procurement within the construction sector. The linking of EIA and green procurement has been postulated in the paper as an aid to strengthen the coordination between project planning and implementation. The paper is based on a literature review and is an outcome of an on-going research project concerning EIA and green procurement. This study indicated that it would be appropriate to introduce green procurement during the pre-decision phase of an EIA. In the present study, the opportunities for integrating green procurement at the stage of EIA are associated with the integration of project planning and EIA. Future research should investigate the mechanism through which the link can be established. - Highlights: ► This paper identifies opportunities to link EIA and green procurement. ► Pre-decision phase of EIA could be appropriate for planning green procurement. ► Future research should investigate the mechanism for establishing the link.

  20. Verdivurdering av SAS AB


    Gangås, Silje Garberg


    Formålet med denne mastergradsavhandlingen har vært å beregne den teoretiske verdien på det børsnoterte selskapet SAS AB og på bakgrunn av denne gi en handlingsanbefaling på selskapets aksje. Forskningsspørsmålet for oppgaven er utledet som følger: ”Hva er verdien av SAS AB?” SAS AB er inne i en fundamental omstillingsprosses hvor den nye strategien, 4XNG, ble presentert og påbegynt november 2012. Omstillingsprosessen innebærer blant annet en omfattende omstrukturering i organisasjonen ...

  1. Main Steps in the Dutch SEA and EIA process

    International Nuclear Information System (INIS)

    This is the fifth volume in a series which presents papers in English by the Netherlands Commission for EIA to an international audience of impact assessment practitioners. The Netherlands Commission has gained considerable experience in the execution and management of EIA and SEA (Strategic Environmental Assessments) in The Netherlands and in developing countries as an independent advisor to the relevant competent authorities. This volume contains five papers grouped into two categories: new developments and practical experience. The two papers on new developments deal with sustainability assessment and biodiversity in EIA. The three papers on practical experience focus attention on the added values of EIA in The Netherlands to decision making: transparency of the EIA process, importance of considering alternatives and independent review by the Commission for EIA and following decision making by the judiciary

  2. Suboptimal Detection of Influenza Virus in Adults by the Directigen Flu A+B Enzyme Immunoassay and Correlation of Results with the Number of Antigen-Positive Cells Detected by Cytospin Immunofluorescence (United States)

    Landry, Marie L.; Ferguson, David


    To provide 24-h influenza diagnosis for adults presenting to the emergency department, the Directigen Flu A+B enzyme immunoassay (EIA) was performed in the chemistry laboratory during the night shift. Nasopharyngeal swabs were retested by cytospin-enhanced direct immunofluorescence (DFA; SimulFluor respiratory screen) when the virology laboratory opened. The influenza EIA detected 16 influenza A virus infections, whereas cytospin-enhanced DFA detected 31 influenza A virus infections as well as 3 respiratory syncytial virus, 2 adenovirus, and 1 parainfluenza virus infections. A positive EIA result usually correlated with 50 or more influenza virus cells positive by DFA. PMID:12843105





    This article reviews how the Finnish EIA legislation and procedures are performing in practice, and how the goals of the EIA Act are reached. The role of EIA in planning and decision-making, and the relationship between the EIA legislation and other pieces of legislation is also evaluated. Overall, the goals of the Finnish EIA legislation have been successfully reached: EIA has achieved a meaningful role as a preventive and participatory environmental management tool. In addition, stakeholder...

  4. Nutrition Labeling

    DEFF Research Database (Denmark)

    Grunert, Klaus G


    because consumers will avoid products that the label shows to be nutritionally deficient, but also because food producers will try to avoid marketing products that appear, according to the label, as nutritionally problematic, for example, because of a high content of saturated fat or salt. Nutrition......Nutrition labeling refers to the provision of information on a food product’s nutritional content on the package label. It can serve both public health and commercial purposes. From a public health perspective, the aim of nutrition labeling is to provide information that can enable consumers...... to make healthier choices when choosing food products. Nutrition labeling is thus closely linked to the notion of the informed consumer, that chooses products according to their aims, on the basis of the information at their disposal. Because many consumers are assumed to be interested in making healthy...

  5. Nutrition Labeling (United States)

    Metzger, Lloyd E.

    Nutrition labeling regulations differ in countries around the world. The focus of this chapter is on nutrition labeling regulations in the USA, as specified by the Food and Drug Administration (FDA) and the Food Safety and Inspection Service (FSIS) of the United States Department of Agriculture (USDA). A major reason for analyzing the chemical components of foods in the USA is nutrition labeling regulations. Nutrition label information is not only legally required in many countries, but also is of increasing importance to consumers as they focus more on health and wellness.

  6. An evaluation of current EIA system in Pakistan

    International Nuclear Information System (INIS)

    The challenge of reducing poverty and increasing economic growth has often led Pakistan to overlook environmental sustainability. Consequently, Pakistan, is suffering from severe environmental problems. This has spurred an increasing demand for and effective Environmental Impact Assessment (EIA) System with environmental management tools and techniques that can help the country to adequately diagnose their risks and suggest mitigation options. In the past few years Pakistan has begun implementing EIA' s as a preventive tool. However, given the judiciary, institutional and structural predicament, the outcome of the EIA process has resulted in great disparities. Given the growing regional environmental problems it is now a priority to seek an effective EIA systems, principles, and procedures in the country. This paper seeks to distinguish the Pakistan EIA strengths and weaknesses; it also focuses on identifying common positive and negative characteristics of the Pakistan EIA system. Furthermore, differences between the interested parties of the EIA system in the country were evaluated via a survey to ensure a good understanding of the factors of a comprehensive and effective EIA system. Analytical comparisons were made among the different interested parties of the EIA system in Pakistan. Statistical methods were used to analyze the data received and recommendations were made based on the outcome of the data results. These results will assist: (i) Pakistan to improve its EIA system (ii) other South Asian countries which may have a similar EIA systems in developing policy, planning and reforms and (iii) International organizations that work or invest in the region to enhance the attainment of environ- mental protection objectives on a broader, more cost effective, and realistic scale than current practices. (author)

  7. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with western corn rootworm midgut membrane binding sites.

    Directory of Open Access Journals (Sweden)

    Huarong Li

    Full Text Available BACKGROUND: Bacillus thuringiensis (Bt Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interactions are one line of evidence that Bt protein mechanisms of action differ and that the probability of receptor-mediated cross-resistance is low. METHODOLOGY/PRINCIPAL FINDINGS: Binding site interactions were investigated between Cry34Ab1/Cry35Ab1 and coleopteran active insecticidal proteins Cry3Aa, Cry6Aa, and Cry8Ba on western corn rootworm midgut brush border membrane vesicles (BBMV. Competitive binding of radio-labeled proteins to western corn rootworm BBMV was used as a measure of shared binding sites. Our work shows that (125I-Cry35Ab1 binds to rootworm BBMV, Cry34Ab1 enhances (125I-Cry35Ab1 specific binding, and that (125I-Cry35Ab1 with or without unlabeled Cry34Ab1 does not share binding sites with Cry3Aa, Cry6Aa, or Cry8Ba. Two primary lines of evidence presented here support the lack of shared binding sites between Cry34Ab1/Cry35Ab1 and the aforementioned proteins: 1 No competitive binding to rootworm BBMV was observed for competitor proteins when used in excess with (125I-Cry35Ab1 alone or combined with unlabeled Cry34Ab1, and 2 No competitive binding to rootworm BBMV was observed for unlabeled Cry34Ab1 and Cry35Ab1, or a combination of the two, when used in excess with (125I-Cry3Aa, or (125I-Cry8Ba. CONCLUSIONS/SIGNIFICANCE: Combining two or more insecticidal proteins active against the same target pest is one tactic to delay the onset of resistance to either protein. We conclude that Cry34Ab1/Cry35Ab1 are compatible with Cry3Aa, Cry6Aa, or Cry8Ba

  8. ABS 415 Course Tutorial / tutorialrank




                     For more course tutorials visit Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational...

  9. EIA modelling for coastal zone management. Part 2

    Digital Repository Service at National Institute of Oceanography (India)

    Babu, M.T.; Vethamony, P.

    stream_size 15 stream_content_type text/plain stream_name Summer_Sch_EIA_Manage_Coast_Zone_2001_95.pdf.txt stream_source_info Summer_Sch_EIA_Manage_Coast_Zone_2001_95.pdf.txt Content-Encoding ISO-8859-1 Content-Type text...

  10. Newly released EIA-law. A palette of wishes?

    International Nuclear Information System (INIS)

    The EU-directive on Environmental Impact Assessment (EIA) for certain public and private projects was once again amended in 2014 after controversial discussions, three previous modifications during 1985 and 2010 and an aggregation of all amendments within the EU-EIA-2011/92 directive. This newly released EU-EIA-directive 2014/52/EU (hereinafter RL 2014/52) is published within the EU-official journal EU L 124 p. 1 from 25.04.2014, came into force on 15. May 2014 and has to be adopted into international law until 16.05.2017. The modifications made are also valid, apart from certain exceptions, for licensing procedures (including decommissioning of nuclear power plants) in the field of nuclear energy, as far as they might have possible, significant environmental effects. The European EIA directive's 30th ''anniversary'' on 27.06.2015 raises the question, which substantial changes will come soon along with the newly released EU-EIA law. All in all it seems like if authorities and industry might get along with the newly released EU-EIA regulations. The responsible Federal Ministry for the Environment is already working on a first preliminary draft. It is under consideration if the EIA-regulation should be submitted additionally, beyond required amendments by EU-law, to a general revision. EIA-law remains exciting.

  11. The EIA mixes a US gas cocktail

    International Nuclear Information System (INIS)

    This article examines the US Energy Information Administration's (EIA) assumption that although gas consumption is rising there will still be adequate supplies to meet the demand in the year 2020. The expected increase in the use of gas for electricity generation, and the meeting of future demand by the expected growth in gas production in the deepwaters off the Gulf of Mexico, imports from Canada, and use of unconventional sources such as coalbed methane and natural gas hydrates are discussed, and methods of producing hydrates are outlined. US natural gas production for 1970-1998, US demand and Canadian supplies (1980-1996), and US natural gas hydrate resources are tabulated. (UK)

  12. Observation of EIA in closed and open caesium atomic system

    Institute of Scientific and Technical Information of China (English)

    Zhao Jian-Ming; Zhao Yan-Ting; Huang Tao; Xiao Lian-Tuan; Jia Suo-Tang


    We present an experimental study on electromagnetically induced absorption (EIA) in the closed transition of a degenerate two-level Cs atomic system. The coupling and probe lasers coupled with the transition 6S1/2F=4 →6P3/2F'=5 of caesium atom. The signal of EIA was obtained and the frequency detuning and intensity effect of the pumping laser were experimentally investigated. The EIA signal in 6S1/2 F=4 → 6P3/2 F'=4 and 6S1/2 F=4 → 6P3/2F'=3 open transitions was also obtained. As the repumping laser couples with the transition of 6S1/2 F=3 → 6P3/2F'=4, the EIA signal is increased due to the hyperfine optical pumping.

  13. 75 FR 67663 - Labeling Imported Wines With Multistate Appellations (2008R-265P) (United States)


    ... predecessor agency, the Bureau of Alcohol, Tobacco and Firearms (ATF), in T.D. ATF-53 (43 FR 37675), published... Alcohol and Tobacco Tax and Trade Bureau 27 CFR Part 4 RIN 1513-AB58 Labeling Imported Wines With... the wine labeling regulations to allow the labeling of imported wines with multistate appellations...

  14. The AB Staff Plan

    CERN Document Server

    Boillot, J; Delahaye, J P; Myers, S; CERN. Geneva. AB Department


    The present report summarises the staff plan of the newly created Accelerators and Beams (AB) Division following the restructuring of the Accelerator Sector and covering the period 2003 to 2010. It underlines the refocusing of the staff on priority work, especially the LHC Project and is coherent with the recently adopted CERN Long Term Plan (LTP). It compares the requested and available manpower (both staff and industrial support) for each Project, Programme and Activity (PPA) split in work packages and highlights the missing manpower for each category of personnel.

  15. Food labels

    DEFF Research Database (Denmark)

    Selsøe Sørensen, Henrik; Clement, Jesper; Gabrielsen, Gorm


    The food industry develops tasty and healthy food but fails to deliver the message to all consumers. The consumers’ background knowledge is essential for how they find and decode relevant elements in the cocktail of signs which fight for attention on food labels. In this exploratory study, we find...... evidence for dividing consumers into two profiles: one relying on general food knowledge and another using knowledge related to signpost labels. In a combined eyetracking and questionnaire survey we analyse the influence of background knowledge and identify different patterns of visual attention for the...... two consumer profiles. This underlines the complexity in choosing and designing the ‘right’ elements for a food package that consumers actually look at and are able to make rational use of. In spite of any regulation of food information provided by authorities, consumers will still be confronted with...

  16. AB Manpower Plan 2007

    CERN Document Server

    Myers, Stephen


    The present exercise is not as such a "manpower plan" but a purely budgetary comparison of known plus requested resources with the known commitments over the period 2007-2012. From a purely budgetary point of view, AB will have the capacity to maintain all those recently hired staff who fulfill the criteria for long term employment at CERN. Following this budgetary exercise, AB proposes to perform a CERN-wide staff work plan so as to compare the manpower available to the quantity of work to be done in the totality of the work-packages. If there is a significant mismatch between these two quantities then we propose the following measures which would create personnel economies and allow us to redress the mismatch by increased recruitment: a new job severance scheme; CERN restructuring; use of the new CERN-ITER agreement; more flexibility in transfers from Materials to Personnel budgets. Failing this a re-examination of possible closure of lower priority facilities may be needed.

  17. Environmental Labeling


    Andrea Podhorsky


    This paper studies how information disclosed by voluntary environmental labels creates incentives for firms to invest in environmentally-friendly production technologies. I develop a model with differentiated products and imperfectly-informed consumers. Consumers care about the environmental characteristics of goods (for example, how they were produced), but cannot directly observe these product characteristics. Firms differ in their abilities to develop "clean" technologies, but have no ince...

  18. SIB-DOTA: A trifunctional prosthetic group potentially amenable for multi-modal labeling that enhances tumor uptake of internalizing monoclonal antibodies


    Vaidyanathan, G.; White, B. J.; Affleck, D.J.; Zhao, X. G.; Welsh, P. C.; McDougald, D; Choi, J.; Zalutsky, M. R.


    A major drawback of internalizing monoclonal antibodies (mAbs) radioiodinated with direct electrophilic approaches is that tumor retention of radioactivity is compromised by the rapid washout of iodo-tyrosine, the primary labeled catabolite for mAbs labeled via this strategy. In our continuing efforts to develop more versatile residualizing labels that could overcome this problem, we have designed SIB-DOTA, a prosthetic labeling template that combines the features of the prototypical, dehalog...





    The integration of Environmental Impact Assessment (EIA) and Environmental Management Systems (EMS) has been approached several times in recent years. This article reviews existing conceptual frameworks and specific issues regarding the EIA-EMS integration, and recommends a new conceptual framework which is based on an alternating sequence of EMS and EIA. It also proposes adaptations in key documents of both processes. The recommendations are adaptable to the varied practice of EIA across the...

  20. Understanding errors in EIA projections of energy demand

    International Nuclear Information System (INIS)

    This paper investigates the potential for systematic errors in the Energy Information Administration's (EIA) widely used Annual Energy Outlook, focusing on the near- to mid-term projections of energy demand. Based on analysis of the EIA's 22-year projection record, we find a fairly modest but persistent tendency to underestimate total energy demand by an average of 2 percent per year after controlling for projection errors in gross domestic product, oil prices, and heating/cooling degree days. For 14 individual fuels/consuming sectors routinely reported by the EIA, we observe a great deal of directional consistency in the errors over time, ranging up to 7 percent per year. Electric utility renewables, electric utility natural gas, transportation distillate, and residential electricity show significant biases on average. Projections for certain other sectors have significant unexplained errors for selected time horizons. Such independent evaluation can be useful for validating analytic efforts and for prioritizing future model revisions. (author)

  1. Appraising the value of independent EIA follow-up verifiers

    International Nuclear Information System (INIS)

    Independent Environmental Impact Assessment (EIA) follow-up verifiers such as monitoring agencies, checkers, supervisors and control officers are active on various construction sites across the world. There are, however, differing views on the value that these verifiers add and very limited learning in EIA has been drawn from independent verifiers. This paper aims to appraise how and to what extent independent EIA follow-up verifiers add value in major construction projects in the developing country context of South Africa. A framework for appraising the role of independent verifiers was established and four South African case studies were examined through a mixture of site visits, project document analysis, and interviews. Appraisal results were documented in the performance areas of: planning, doing, checking, acting, public participating and integration with other programs. The results indicate that independent verifiers add most value to major construction projects when involved with screening EIA requirements of new projects, allocation of financial and human resources, checking legal compliance, influencing implementation, reporting conformance results, community and stakeholder engagement, integration with self-responsibility programs such as environmental management systems (EMS), and controlling records. It was apparent that verifiers could be more creatively utilized in pre-construction preparation, providing feedback of knowledge into assessment of new projects, giving input to the planning and design phase of projects, and performance evaluation. The study confirms the benefits of proponent and regulator follow-up, specifically in having independent verifiers that disclose information, facilitate discussion among stakeholders, are adaptable and proactive, aid in the integration of EIA with other programs, and instill trust in EIA enforcement by conformance evaluation. Overall, the study provides insight on how to harness the learning opportunities

  2. Appraising the value of independent EIA follow-up verifiers

    Energy Technology Data Exchange (ETDEWEB)

    Wessels, Jan-Albert, E-mail: [School of Geo and Spatial Sciences, Department of Geography and Environmental Management, North-West University, C/O Hoffman and Borcherd Street, Potchefstroom, 2520 (South Africa); Retief, Francois, E-mail: [School of Geo and Spatial Sciences, Department of Geography and Environmental Management, North-West University, C/O Hoffman and Borcherd Street, Potchefstroom, 2520 (South Africa); Morrison-Saunders, Angus, E-mail: [School of Geo and Spatial Sciences, Department of Geography and Environmental Management, North-West University, C/O Hoffman and Borcherd Street, Potchefstroom, 2520 (South Africa); Environmental Assessment, School of Environmental Science, Murdoch University, Australia. (Australia)


    Independent Environmental Impact Assessment (EIA) follow-up verifiers such as monitoring agencies, checkers, supervisors and control officers are active on various construction sites across the world. There are, however, differing views on the value that these verifiers add and very limited learning in EIA has been drawn from independent verifiers. This paper aims to appraise how and to what extent independent EIA follow-up verifiers add value in major construction projects in the developing country context of South Africa. A framework for appraising the role of independent verifiers was established and four South African case studies were examined through a mixture of site visits, project document analysis, and interviews. Appraisal results were documented in the performance areas of: planning, doing, checking, acting, public participating and integration with other programs. The results indicate that independent verifiers add most value to major construction projects when involved with screening EIA requirements of new projects, allocation of financial and human resources, checking legal compliance, influencing implementation, reporting conformance results, community and stakeholder engagement, integration with self-responsibility programs such as environmental management systems (EMS), and controlling records. It was apparent that verifiers could be more creatively utilized in pre-construction preparation, providing feedback of knowledge into assessment of new projects, giving input to the planning and design phase of projects, and performance evaluation. The study confirms the benefits of proponent and regulator follow-up, specifically in having independent verifiers that disclose information, facilitate discussion among stakeholders, are adaptable and proactive, aid in the integration of EIA with other programs, and instill trust in EIA enforcement by conformance evaluation. Overall, the study provides insight on how to harness the learning opportunities

  3. 99mTc labeling of the scorpion (Tityus serrulatus) antivenom

    International Nuclear Information System (INIS)

    F(ab')2 is the fragment involved in the immunotherapy for scorpion stings and it would be convenient to label it with 99mTc for organ distribution and pharmacokinetics studies. The aim of the present study was to label scorpion antivenom F(ab')2 with 99mTc keeping its biological activity, integrity and stability. High labeling yield was obtained using stannous chloride and sodium borohydride. Stability, immunoreactivity and integrity of 99mTc-F(ab')2 was preserved. It was not observed any difference between potencies of unlabeled and labeled antivenom. 99mTc-F(ab')2 can be a useful tool for use in biodistribution and pharmacokinetics studies on the evaluation of the efficacy of the antivenom against scorpion envenomation. (author)

  4. ABS 415 ASH Course Tutorial / Tutorialrank




    For more course tutorials visit Tutorial Purchased: 4 Times, Rating: A+   ASHFORD ABS 415 Week 1 DQ 1Discovering Strengths in Leadership ASHFORD ABS 415 Week 1 DQ 2 Ethical Leadership ASHFORD ABS 415 Week 2 DQ 1 Developing Emotional Intelligence in Leadership ASHFORD ABS 415 Week 2 DQ 2 Elements of Emotional Intelligence in Leadership ASHFORD ABS 415 Week 3 DQ 1 Motivational Techniques ASHFORD ABS 415 Week 3 DQ 2 Leadership in a Cr...

  5. EIA: A splintering, exploding discipline with a massive new constituency

    International Nuclear Information System (INIS)

    After serving 18 years as Editor-in-Chief of Environmental Impact Assessment Review, the author observes that the period 1997–2014, the discipline of EIA: splintered, exploded and saw the rise of the developing-world authors. Publishing has also changed, with shifts from quantity to quality, the rise of open access, and an ever-increasing shortage of reviewers

  6. EIA model documentation: Electricity market module - electricity fuel dispatch

    Energy Technology Data Exchange (ETDEWEB)



    This report documents the National Energy Modeling System Electricity Fuel Dispatch Submodule (EFD), a submodule of the Electricity Market Module (EMM) as it was used for EIA`s Annual Energy Outlook 1997. It replaces previous documentation dated March 1994 and subsequent yearly update revisions. The report catalogues and describes the model assumptions, computational methodology, parameter estimation techniques, model source code, and forecast results generated through the synthesis and scenario development based on these components. This document serves four purposes. First, it is a reference document providing a detailed description of the model for reviewers and potential users of the EFD including energy experts at the Energy Information Administration (EIA), other Federal agencies, state energy agencies, private firms such as utilities and consulting firms, and non-profit groups such as consumer and environmental groups. Second, this report meets the legal requirement of the Energy Information Administration (EIA) to provide adequate documentation in support of its statistical and forecast reports. Third, it facilitates continuity in model development by providing documentation which details model enhancements that were undertaken for AE097 and since the previous documentation. Last, because the major use of the EFD is to develop forecasts, this documentation explains the calculations, major inputs and assumptions which were used to generate the AE097.

  7. Clinical significance of combined detection of multiple serum antibodies (AsAb, EmAb, AcAb, AoAb, ToxAb) in infertile women

    International Nuclear Information System (INIS)

    Objective: To determine the clinical significance of combined detection of multiple serum antibodies in infertile women. Methods; Serum multiple antibodies were examined in 120 infertile women, including 88 failed to get pregnancy and 32 with repeated spontaneous abortion. The antibodies tested were: (1) anti-sperm antibody (AsAb) (2) endometrial antibody (EmAb) (3) anti-cardiophospholipid antibody (AcAb) (4) Anti-ovarian antibody (AoAb) and Toxoplasmosis antibody (ToxAb). Results: In 48 of the infertile women, none of the five antibodies were positive (40% of 120). The rest were: one antibody positive--38/120 or 31.6%; two antibodies positive--31/120 or 25.83%, three and four antibodies positive--4/120 or 3.33%. None of the women were positive with all five antibodies. Conclusion: Immune factor was the chief cause of infertility in women. (authors)

  8. An evaluation framework for effective public participation in EIA in Pakistan

    International Nuclear Information System (INIS)

    Evaluating the effectiveness of public participation in EIA related decisions is of crucial importance for developing a better understanding of overall EIA effectiveness. This paper aims to contribute to the professional debate by establishing a country specific evaluation framework for Pakistan, which, it is suggested, could also potentially be used in other developing countries. The framework is used to evaluate performance of public participation in EIA in terms of 40 attributes for four selected projects from the province of Punjab. The evaluation is based on interviews with stakeholders, review of EIA reports as well as public hearing proceedings and environmental approval conditions. The evaluation of the selected projects revealed an overall weak influence of public participation on substantive quality of EIA and on the final decision. Overall, EIA public participation has succeeded in providing a more egalitarian environment. Furthermore, it appears fair to say that sufficient time for submitting written comments on EIA reports as well as for raising concerns during public hearings had been given. Also, public consultation was significantly contributing to educating participants. Despite some impediments, it is argued that public participation in EIA is gradually gaining ground in Pakistan. Recommendations to enhance EIA public participation effectiveness in Pakistan include applying a more proactive approach which should take place before EIA is conducted and before site selection for development projects is happening.

  9. Cumulative effects in Swedish EIA practice - difficulties and obstacles

    International Nuclear Information System (INIS)

    The importance of considering cumulative effects (CE) in the context of environmental assessment is manifested in the EU regulations. The demands on the contents of Environmental Impact Assessment (EIA) and Strategic Environmental Assessment (SEA) documents explicitly ask for CE to be described. In Swedish environmental assessment documents CE are rarely described or included. The aim of this paper is to look into the reasons behind this fact in the Swedish context. The paper describes and analyse how actors implementing the EIA and SEA legislation in Sweden perceive the current situation in relation to the legislative demands and the inclusion of cumulative effects. Through semi-structured interviews the following questions have been explored: Is the phenomenon of CE discussed and included in the EIA/SEA process? What do the actors include in and what is their knowledge of the term and concept of CE? Which difficulties and obstacles do these actors experience and what possibilities for inclusion of CE do they see in the EIA/SEA process? A large number of obstacles and hindrances emerged from the interviews conducted. It can be concluded from the analysis that the will to act does seem to exist. A lack of knowledge in respect of how to include cumulative effects and a lack of clear regulations concerning how this should be done seem to be perceived as the main obstacles. The knowledge of the term and the phenomenon is furthermore quite narrow and not all encompassing. They experience that there is a lack of procedures in place. They also seem to lack knowledge of methods in relation to how to actually work, in practice, with CE and how to include CE in the EIA/SEA process. It can be stated that the existence of this poor picture in relation to practice concerning CE in the context of impact assessment mirrors the existing and so far rather vague demands in respect of the inclusion and assessment of CE in Swedish EIA and SEA legislation, regulations, guidelines and

  10. 77 FR 16671 - Labeling Imported Wines With Multistate Appellations (United States)


    ... FR 37672), published August 23, 1978. The preamble of T.D. ATF-53 stated that the regulations... 75 FR 67663 proposing to amend Sec. 4.25 to permit the use of multistate appellations for imported... Alcohol and Tobacco Tax and Trade Bureau 27 CFR Part 4 RIN 1513-AB58 Labeling Imported Wines...

  11. Issues in Data Labelling

    NARCIS (Netherlands)

    Cowie, Roddy; Cox, Cate; Martin, Jeam-Claude; Batliner, Anton; Heylen, Dirk; Karpouzis, Kostas; Cowie, Roddy; Pelachaud, Catherine; Petta, Paolo


    Labelling emotion databases is not a purely technical matter. It is bound up with theoretical issues. Different issues affect labelling of emotional content, labelling of the signs that convey emotion, and labelling of the relevant context. Linked to these are representational issues, involving time

  12. EIA practice in India and its evaluation using SWOT analysis

    International Nuclear Information System (INIS)

    In India Environmental Impact Assessment (EIA) has been formally introduced in 1994. It relied on the institutional framework that has a strong supporting legislative, administrative and procedural set-up. Both central and state authorities together are sharing the responsibility of its development and management. A Strength, Weakness, Opportunity and Threat (SWOT) analysis taken up in this article has suggested that there are several issues that need to be readdressed. It highlights several constraints, ranging from improper screening and scoping guidelines to ineffective monitoring and post project evaluation. The opportunities are realised as increasing public awareness, initiatives of environmental groups and business community and forward thinking to integrate environmental consideration into plans and policies. Poor governance, rapid economic reforms, and favours to small-scale units are some of the foreseen threats to the system. This article concludes with some suggestions to improve EIA process in India

  13. Thrombus imaging with [sup 99m]Tc-HMPAO-labeled platelets and [sup 111]In-labeled monoclonal antifibrin antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Vorne, M.S.; Honkanen, T.T.; Lantto, T.J.; Laitinen, R.O.; Karppinen, K.J.; Jauhola, S.V. (Depts. of Nuclear Medicine and Diagnostic Radiology, Paeijaet-Haeme Central Hospital, Lahti (Finland))


    Eighteen patients with suspicion of deep venous thrombosis (DVT) in the lower extremities were imaged both with autologous [sup 99m]Tc-HMPAO-labeled platelets (Tc-PLT) and [sup 111]In-labeled monoclonal antifibrin antibodies (In-MoAbs) on the same day. Precence or absence of thrombosis was verified by venography. Tc-PLT was given i.v. followed after 30 min by In-MoAbs. Anterior and posterior projections of the lower extremities were obtained with a large field-of-view gamma camera at 5 to 25 min, 2 h, 4 to 6 h, and 20 h after administration of the marker. Both Tc-PLT and In-MoAbs detected DVT well but less frequently than venography. Thrombi were visualized at 2 to 4 h after injection. The quality of images was better with Tc-PLT than with In-MoAbs. In the patients treated during the study, heparin significantly (p< 0.01) inhibited the uptake of Tc-PLT but not of In-MoAbs. We conclude that both Tc-PLT and In-MoAbs are suitable agents for the detection of DVT especially in patients without anticoagulation. (orig.).

  14. Walking the sustainability assessment talk — Progressing the practice of environmental impact assessment (EIA)

    International Nuclear Information System (INIS)

    Internationally there is a growing demand for environmental impact assessment (EIA) to move away from its traditional focus towards delivering more sustainable outcomes. South Africa is an example of a country where the EIA system seems to have embraced the concept of sustainability. In this paper we test the existing objectives for EIA in South Africa against sustainability principles and then critique the effectiveness of EIA practice in delivering these objectives. The outcome of the research suggests that notwithstanding a strong and explicit sustainability mandate through policy and legislation, the effectiveness of EIA practice falls far short of what is mandated. This shows that further legislative reform is not required to improve effectiveness but rather a focus on changing the behaviour of individual professionals. We conclude by inviting further debate on what exactly practitioners can do to give effect to sustainability in EIA practice.

  15. The Rationality of EIA Forecasts under Symmetric and Asymmetric Loss


    Auffhammer, Maximilian


    The United States Energy Information Administration publishes annual forecasts of nationally aggregated energy consumption, production, prices, intensity and GDP. These government issued forecasts often serve as reference cases in the calibration of simulation and econometric models, which climate and energy policy are based on. This study tests for rationality of published EIA forecasts under symmetric and asymmetric loss. We find strong empirical evidence of asymmetric loss for oil, coal a...

  16. Editing of EIA coded, numerically controlled, machine tool tapes (United States)

    Weiner, J. M.


    Editing of numerically controlled (N/C) machine tool tapes (8-level paper tape) using an interactive graphic display processor is described. A rapid technique required for correcting production errors in N/C tapes was developed using the interactive text editor on the IMLAC PDS-ID graphic display system and two special programs resident on disk. The correction technique and special programs for processing N/C tapes coded to EIA specifications are discussed.

  17. EIA model documentation: Electricity market module - electricity fuel dispatch

    International Nuclear Information System (INIS)

    This report documents the National Energy Modeling System Electricity Fuel Dispatch Submodule (EFD), a submodule of the Electricity Market Module (EMM) as it was used for EIA's Annual Energy Outlook 1997. It replaces previous documentation dated March 1994 and subsequent yearly update revisions. The report catalogues and describes the model assumptions, computational methodology, parameter estimation techniques, model source code, and forecast results generated through the synthesis and scenario development based on these components. This document serves four purposes. First, it is a reference document providing a detailed description of the model for reviewers and potential users of the EFD including energy experts at the Energy Information Administration (EIA), other Federal agencies, state energy agencies, private firms such as utilities and consulting firms, and non-profit groups such as consumer and environmental groups. Second, this report meets the legal requirement of the Energy Information Administration (EIA) to provide adequate documentation in support of its statistical and forecast reports. Third, it facilitates continuity in model development by providing documentation which details model enhancements that were undertaken for AE097 and since the previous documentation. Last, because the major use of the EFD is to develop forecasts, this documentation explains the calculations, major inputs and assumptions which were used to generate the AE097

  18. The law concerning the environmental impact assessment. Vol. 1. Collection of regulations with an introduction to EIA law

    International Nuclear Information System (INIS)

    The present book contains all regulations relevant to EIA in compact form: The EU EIA Directive; the Federal Law on the EIA; the Procedural Rules of Atomic Energy Law; the Ninth Ordinance on the Federal Emissions Control Law including the pertinent general administrative regulation; the Federal Mining Law; the Federal Building Law; the Federal Regional Planning Law; and the EIA laws of the Laender such as implementing regulations, the Land EIA Laws, and the Land Planning Laws. There is a basic introduction to EIA law preceding this collection of regulations and laws. (orig./HP)

  19. Developing guidelines for economic evaluation of environmental impacts in EIAs. Part I

    International Nuclear Information System (INIS)

    Is the time right to introduce environmental evaluation into the Environmental Impact Assessment (EIA) system for large construction projects in China? The report analyses gaps to introducing environmental evaluation into EIAs and recommend how to bridge the gaps. The report also provides suggestions to the State Environmental Protection Administration on core elements of a guideline for environmental evaluation to include in the existing EIA guidelines. The report draws on international and Chinese research and best practice and conducts four case studies of environmental evaluation based on EIAs of investment projects e.g. a power plant, a waste water treatment plant, regional waste water irrigation, and a road construction project

  20. Developing guidelines for economic evaluation of environmental impacts in EIAs. Part I

    Energy Technology Data Exchange (ETDEWEB)



    Is the time right to introduce environmental evaluation into the Environmental Impact Assessment (EIA) system for large construction projects in China? The report analyses gaps to introducing environmental evaluation into EIAs and recommend how to bridge the gaps. The report also provides suggestions to the State Environmental Protection Administration on core elements of a guideline for environmental evaluation to include in the existing EIA guidelines. The report draws on international and Chinese research and best practice and conducts four case studies of environmental evaluation based on EIAs of investment projects e.g. a power plant, a waste water treatment plant, regional waste water irrigation, and a road construction project.

  1. Field validation of an EIA kit for progesterone measurement in milk and blood plasma

    International Nuclear Information System (INIS)

    An EIA kit for the measurement of progesterone in blood plasma and skim milk was validated and compared with the FAO/IAEA RIA kit at the FAO/IAEA Agricultural Laboratory at Seibersdorf and 9 other laboratories in developed and developing countries. The EIA kit performed well at the FAO/IAEA Laboratory. In the other laboratories high intra-assay variations and poor colour development were observed. The RIA kit performed satisfactory in all participating laboratories. It was concluded that the EIA kit should not be routinely supplied to FAO/IAEA counterpart staff. Some recommendations for further development of the EIA kit were given. (author). 3 refs, 5 tabs

  2. Succesful labelling schemes

    DEFF Research Database (Denmark)

    Juhl, Hans Jørn; Stacey, Julia


    It is usual practice to evaluate the success of a labelling scheme by looking at the awareness percentage, but in many cases this is not sufficient. The awareness percentage gives no indication of which of the consumer segments that are aware of and use labelling schemes and which do not. In the...... spring of 2001 MAPP carried out an extensive consumer study with special emphasis on the Nordic environmentally friendly label 'the swan'. The purpose was to find out how much consumers actually know and use various labelling schemes. 869 households were contacted and asked to fill in a questionnaire....... 664 households returned a completed questionnaire. There were five answering categories for each label in the questionnaire: * have not seen the label before. * I have seen the label before but I do not know the precise contents of the labelling scheme. * I have seen the label before, I do not know...

  3. Experimental radioimmunotherapy of a xenografted human glioma using 131I-labeled monoclonal antibody to epidermal growth factor receptor

    International Nuclear Information System (INIS)

    131I-labeled F (ab')2 fragments of murine monoclonal antibodies (MAb) 425 specific to the epidermal growth factor receptor expressed on human gliomas were used in experimental human malignant glioma immunotherapy. Two injections of 150 μCi 131I-labeled 425 F(ab')2 achieved growth inhibition of U-87MG human malignant glioma xenografts in nude mice. This radiolabeled specific MAb F(ab')2 was significantly superior to radiolabeled fragments of an anti-hepatitis virus control MAb A5C3 in influencing tumor growth. However, similar treatment of established human malignant glioma xenografts did not inhibit progressive tumor growth significantly. No clear tumor inhibition was produced by unlabeled MAb 425F(ab')2. These studies suggest that 131I-labeled MAbs have a significant antitumor effect where unmodified antibody is ineffective. Multiple doses of antibody may achieve an increase in labeled MAb concentration in tumors. (author)

  4. Synthesizing labeled compounds

    International Nuclear Information System (INIS)

    A metabolic study is presented of the chemical reactions provided by isotopic labeling and NMR spectroscopy. Synthesis of 13C-labeled D-glucose, a 6-carbon sugar, involves adding a labeled nitrile group to the 5-carbon sugar D-arabinose by reaction with labeled hydrogen cyanide. The product of this reaction is then reduced and hydrolyzed to a mixture of the labeled sugars. The two sugars are separated by absorption chromotography. The synthesis of 13C-labeled L-tyrosine, an amino acid, is also presented

  5. Mental Labels and Tattoos (United States)

    Hyatt, I. Ralph


    Discusses the ease with which mental labels become imprinted in our system, six basic axioms for maintaining negative mental tattoos, and psychological processes for eliminating mental tattoos and labels. (RK)

  6. Pesticide Product Label System (United States)

    U.S. Environmental Protection Agency — The Pesticide Product Label System (PPLS) provides a collection of pesticide product labels (Adobe PDF format) that have been approved by EPA under Section 3 of the...

  7. On Online Labeling with Polynomially Many Labels

    DEFF Research Database (Denmark)

    Babka, Martin; Bulánek, Jan; Cunat, Vladimír; Koucky, Michal; Saks, Michael


    In the online labeling problem with parameters n and m we are presented with a sequence of nkeys from a totally ordered universe U and must assign each arriving key a label from the label set {1,2,…,m} so that the order of labels (strictly) respects the ordering on U. As new keys arrive it may be...... necessary to change the labels of some items; such changes may be done at any time at unit cost for each change. The goal is to minimize the total cost. An alternative formulation of this problem is the file maintenance problem, in which the items, instead of being labeled, are maintained in sorted order in...... are known that use O(n logn) relabelings. A matching lower bound was claimed in [7]. That proof involved two distinct steps: a lower bound for a problem they call prefix bucketing and a reduction from prefix bucketing to online labeling. The reduction seems to be incorrect, leaving a (seemingly...

  8. Equity valuation : Atlas Copco AB


    Santos, Ricardo Manuel Castro Lopes Alba


    This Dissertation presents a literature review of some of the most appraised theories on equity valuation models. A thoughtful analysis is made, presenting the main advantages and restrictions of each model and setting the path for a discussion about improvements to be made on this field of study. A practical implementation follows, proposing a fair value estimation of Atlas Copco AB shares. Atlas Copco is a Swedish-based capital goods company, operating across four differen...

  9. AB Levitator and Electricity Storage


    Bolonkin, Alexander


    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative...

  10. Thermonuclear Reflect AB-Reactor

    CERN Document Server

    Bolonkin, Alexander


    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  11. AB Levitator and Electricity Storage

    CERN Document Server

    Bolonkin, A


    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative weight ratio of this engine is 0.01 - 0.1 (from thrust). For some types of AB engine (toroidal form) the thrust easily may be changed in any direction without turning of engine. The author computed many projects using different versions of offered AB engine: small device for levitation-flight of a human (including flight from Earth to Outer Space), fly VTOL car (track), big VTOL aircrat, suspended low altitude stationary satellite, powerful Space Shuttle-like booster for travel to the Moon and Mars without spending energ...

  12. Alliance opens for business boosted by EIA forecast

    International Nuclear Information System (INIS)

    The Energy Information Administration (EIA) of the US Department of Energy recently released a new forecast showing US requirements for natural gas growing at a steady pace. By 2020, EIA says, pipeline imports will have climbed by 70 per cent to 5.8 Tcf per year. Tanker imports of natural gas liquids are also set to grow at the rate of 700 bcf annually by 2020. Much of the demand growth is expected to continue to be driven by the expanding use of natural gas in electricity generation, but there are across-the-board increases forecast in US residential, commercial and industrial gas consumption as well, thanks to a predicted overall economic growth of an average three per cent annually. If these predictions materialize, the initial excess pipeline capacity created by the Alliance Pipeline will shrink very quickly. Accordingly, the next major development spawned by Alliance, the Millenium Pipeline Project, an international effort which involves TransCanada Pipelines and Union Gas, as well as the Columbia Energy Group in the US, is expected to move ahead. A target of 2002 is set for the proposed 700 mmcf per day route across Lake Erie to New York State to New York City. In addition to Alliance, there is TransCanada Pipelines' 1.1 bcf per day new capacity added by the Foothills-Northern Border export route. Overall, an average of 1.0 bcf per day of excess capacity is predicted which will, however, last no more than two to five years. The EIA expects that new projects in Alaska and the Northwest Territories will soak up the excess capacity and set off a new round of expansion by the Canadian pipeline system

  13. The influence of actor capacities on EIA system performance in low and middle income countries -Cases from Georgia and Ghana

    NARCIS (Netherlands)

    Kolhoff, A.J.; Runhaar, H.A.C.; Gugushvili, Tamar; Sonderegger, Gabi; Leest, Van der Bart; Driessen, P.P.J.


    In this paper, we aim to better understand the factors that contribute to the substantive performance of EIA systems in low and middle income countries. Substantive performance is defined as the extent to which the EIA process contributes to the EIA objectives for the long term, namely environmen

  14. The influence of actor capacities on EIA system performance in low and middle income countries -Cases from Georgia and Ghana

    NARCIS (Netherlands)

    Kolhoff, Arend J.; Runhaar, Hens A C; Gugushvili, Tamar; Sonderegger, Gabi; Van der Leest, Bart; Driessen, Peter


    In this paper, we aim to better understand the factors that contribute to the substantive performance of EIA systems in low and middle income countries. Substantive performance is defined as the extent to which the EIA process contributes to the EIA objectives for the long term, namely environmental

  15. Development of EIA Issues in Canada and Practices in China

    Institute of Scientific and Technical Information of China (English)

    Dr. Robert C. Lao


    @@ 1 Introduction The requirement for conducting environmental impact assessment (EIA) for all economic and construction development projects and activities in Canada is based on the law. The federal government of Canada, and all provincial and territorial governments have developed relevant processes and procedures to meet this legal obligation. As early as in 1973, the federal Environmental Assessment and Review Process (EARP) was established, and in 1984 the Guidelines Order issued was by the federal cabinet which clarified roles and responsibilities of various parties and stakeholders for participating and/or implementing EARP.

  16. The need for subjectivity in EIA: discourse as a tool for sustainable development

    International Nuclear Information System (INIS)

    Subjectivity is often viewed as one of the shortcomings of environmental impact assessment (EIA). Politicized evaluations, narrow boundary setting, data gaps and simplified assumptions are frequently seen as problems in EIA that must be addressed. This paper takes a different approach to the issue. It views subjectivity as one of the positive attributes of the process that should be encouraged in order to promote sustainability and to inspire confidence in EIA. A satisfactory decision at the end of a specific EIA is not the only goal of the process. As a forum in which the public, proponents and regulators deliberate on the design and implementation of development plans, the creation of discourse around the pertinent issues at stake is also an important result. EIA promotes the development of values that foster greater social responsibility and has the capacity to increase the importance of long-term environmental considerations in decision-making

  17. EIA in the Baltic countries. The case of three oil terminals

    International Nuclear Information System (INIS)

    Environmental Impact Assessment (EIA) in the Baltic Countries: The Case of Three Oil Terminals is the second phase of a research and exchange project that has been going on between Baltic and Nordic experts on Environmental Impact Assessment since 1992. The objective of the projects is to contribute to the capability of the Baltic states in carrying out EIAs. By scrutinizing the processes of the EIAs carried out for three Baltic oil terminals, working groups consisting of both Nordic and Baltic EIA experts have sought to highlight the practical implications of the 'EIA vocabulary' eagerly taught by Western experts and perhaps even more eagerly studied by their 'Eastern' counterparts during the last few years. The three cases were: Lithuania, Oil Port of Klaipeda; Latvia, Oil Terminal in Liepaja; Estonia, Muuga Port. (au)

  18. AP calculus AB/BC

    CERN Document Server

    Schwartz, Stu


    All Access for the AP® Calculus AB & BC Exams Book + Web + Mobile Everything you need to prepare for the Advanced Placement® exam, in a study system built around you! There are many different ways to prepare for an Advanced Placement® exam. What's best for you depends on how much time you have to study and how comfortable you are with the subject matter. To score your highest, you need a system that can be customized to fit you: your schedule, your learning style, and your current level of knowledge. This book, and the free online tools that come with it, will help you personalize your AP® Cal

  19. ABS: Sequence alignment by scanning

    KAUST Repository

    Bonny, Mohamed Talal


    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  20. Studies of the distribution of intrathecally injected 125I-tetanus antitoxin-F(ab')2

    International Nuclear Information System (INIS)

    Overall F(ab')2 and antitetanus-f(ab')2 - fragments were labelled with 125I and injected into normal juvenile cats and adult rats. One group of rats was normal; in the other, unilateral local tetanus had been induced by injection of tetanus toxin into a M. gastrocnemius. The animals were sacrificed 24 h after the injection, and tissue samples were taken for histoautoradiography. 125I-antitetanus-F(ab')2 permeated into the extracellular space of the spinal cord, roots, and ganglia but not into the neuronal intracellular space. 125I-overall-F(ab') showed identical permeation behaviour. 125I-antitetanus-F(ab')2 reacted with tetanus toxin issuing from the motoneurons after injection, forming an immunocomplex around the motorneurons. The immunocomplex was not formed around pseudo-unipolar ganglian cells in the spinal ganglia even though some of the ganglian cells contained tetanus toxin, and 125I-antitetanus-F(ab')2 was present in the extracellular space. As an explanation, it was suggested that tetanus toxin does not permeate into the extracellular space through the membrane of the pseudo-unipolar ganglian cells so that immune reactions will not occur. These findings help to explain the widely divergent results of tetanus therapy by means of injection of tetanus antitoxin. Recommendations for future therapy measures are derived from the findings. (orig./MG)

  1. A Novel PET Imaging Using 64Cu-Labeled Monoclonal Antibody against Mesothelin Commonly Expressed on Cancer Cells

    Directory of Open Access Journals (Sweden)

    Kazuko Kobayashi


    Full Text Available Mesothelin (MSLN is a 40-kDa cell differentiation-associated glycoprotein appearing with carcinogenesis and is highly expressed in many human cancers, including the majority of pancreatic adenocarcinomas, ovarian cancers, and mesotheliomas, while its expression in normal tissue is limited to mesothelial cells lining the pleura, pericardium, and peritoneum. Clone 11-25 is a murine hybridoma secreting monoclonal antibody (mAb against human MSLN. In this study, we applied the 11-25 mAb to in vivo imaging to detect MSLN-expressing tumors. In in vitro and ex vivo immunochemical studies, we demonstrated specificity of 11-25 mAb to membranous MSLN expressed on several pancreatic cancer cells. We showed the accumulation of Alexa Fluor 750-labeled 11-25 mAb in MSLN-expressing tumor xenografts in athymic nude mice. Then, 11-25 mAb was labeled with 64Cu via a chelating agent DOTA and was used in both in vitro cell binding assay and in vivo positron emission tomography (PET imaging in the tumor-bearing mice. We confirmed that 64Cu-labeled 11-25 mAb highly accumulated in MSLN-expressing tumors as compared to MSLN-negative ones. The 64Cu-labeled 11-25 mAb is potentially useful as a PET probe capable of being used for wide range of tumors, rather than 18F-FDG that occasionally provides nonspecific accumulation into the inflammatory lesions.

  2. Experimental therapy of disseminated B-Cell lymphoma xenografts with 213Bi-labeled anti-CD74

    International Nuclear Information System (INIS)

    A 213Bi-labeled antibody to CD74 was evaluated as a therapeutic agent for B-cell lymphoma. The α-particle emission, with a half-life of 46 min, is appropriate for therapy of micrometastases. The labeled Ab retained full immunoreactivity, and was potent at single-cell kill of the Raji B-lymphoma cell line. Approximately 30 decays of cell-bound 213Bi was required for a cell kill of 99%, and dosimetry calculations suggested that the cGy dose delivered was sufficient to produce the level of toxicity observed. A non-reactive control Ab, labeled similarly, also produced toxicity, due to decays occurring in the medium, but was approximately 3-fold less potent than the reactive Ab. In a SCID mouse xenograft micrometastatic model, Ab injection at day 2 or day 5 after tumor inoculation resulted in strong, specific suppression of tumor growth, with some apparent cures

  3. Deuterium labeled cannabinoids

    International Nuclear Information System (INIS)

    Complex reactions involving ring opening, ring closure and rearrangements hamper complete understanding of the fragmentation processes in the mass spectrometric fragmentation patterns of cannabinoids. Specifically labelled compounds are very powerful tools for obtaining more insight into fragmentation mechanisms and ion structures and therefore the synthesis of specifically deuterated cannabinoids was undertaken. For this, it was necessary to investigate the preparation of cannabinoids, appropriately functionalized for specific introduction of deuterium atom labels. The results of mass spectrometry with these labelled cannabinoids are described. (Auth.)

  4. Labelling Fashion Markets


    Aspers, P.


    The present article discusses how an ethical and environmental labelling system can be implemented in fashion garment markets. Consumers act in markets that provide them with more information than their limited cognitive capacity allows them to handle. Ethical and environmental labelling in markets characterized by change, such as the fashion garment market, makes decision-making even more complicated. The ethical and environmental labelling system proposed here is designed to alleviate firms...

  5. Blood cell labelling

    International Nuclear Information System (INIS)

    The labelling of blood cells in vitro for subsequent in vivo studies was one of the earliest applications of radioactive tracers in clinical medicine and laid the foundations for many important contributions to the advancement of knowledge of human blood cell pathophysiology. The characteristics required for satisfactory clinical studies, the mechanisms of cell labelling, the problems of radiation or chemical damage to the labelled cells and some examples of modern clinical applications are described and discussed. (Author)

  6. Development of EIA for detection of Chlamydia trachomatis in genital specimens. (United States)

    Chomvarin, C; Chantarasuk, Y; Thongkrajai, P; Yutanawiboonchai, W; Waropastrakul, N


    A double antibody sandwich enzyme immunoassay (EIA) for chlamydial antigen detection was developed using a monoclonal antibody against lipopolysaccharide (LPS) of Chlamydia trachomatis as a coating antibody. Polyclonal rabbit antiserum against partially purified antigen from elementary body (EB) antibody and horse-radish peroxidase conjugated goat anti-rabbit antibody were used as the primary and secondary antibody respectively. The developed EIA could detect protein of partially purified EB at the lowest concentration of 250 ng/ml. The assay was evaluated against the cell culture (CC), DNA hybridization assay (PACE2 system: Gen-Probe, San Diego, CA, USA) and a commercial enzyme immunoassay (kEIA) (Bioquest, NSW, Australia). The sensitivity, specificity, positive and negative predictive values of the developed EIA (dEIA) were 87, 96.2, 80, 97.7 for the specimens from females and 90.9, 90.7, 71.4, 97.5 for the specimens from males repectively. Cross reaction was not found with Escherichia coli, Acinetobacter anitratus, beta-Streptococcus group A, Enterobacter spp, Enterococcus, Lactobacillus spp, Neisseria spp, but it was found with Candida albicans and herpes simplex virus type 1. The developed EIA can be applied successfully for both genders, particularly males. The cost per test is less than those for CC, kEIA and PACE2. PMID:11023074

  7. On labelled compounds nomenclature

    International Nuclear Information System (INIS)

    Different approaches of major labelled compounds producers to their nomenclature in technical and commercial documentation are discussed. Some draft options of a standard technical guide document for labelled compounds nomenclature rules are suggested. Such a document after due discussion by the experts will serve to unification of the labelled compounds nomenclature within the frame of the CMEA member-countries co-operation in this field. The suggested options are based on the general recommendations by the International Union of Pure and Applied Chemistry and incorporate some more accurate definitions originating from the labelled compounds production and application experience

  8. Auditing and control programs: putting EIA recommendations for ecological impacts prevention in practice


    Arce-Ruiz, Rosa M.


    If we examine the EIA process in different countries, it seems that it is linked to a previous phase of discussion of projects, through the administrative process.This previous stage is, in fact, one in which the project can be publicly discussed and the decisions about location, design, etc., are made, and one in which the preventive focus of the EIA can be applied. In consequence, the EIA process looks as if it were linked to the pre-construction period, although, in fact, it must be a cycl...

  9. The use of radiolabeled monoclonal antibodies for cell labeling in vivo

    International Nuclear Information System (INIS)

    The authors have evaluated the potential of in vivo cell surface labeling using radiolabeled monoclonal antibodies (MoAbs) directed against their surface antigens. Two MoAbs, a specific antibody (anti-Thy-1 OX7) and a nonspecific control antibody (anti-CEA) were coupled with DTPA, labeled with /sup 111/In and evaluated against rat thymocytes, marrow cells, and lymphoma cells (all known to be Thy-1 positive) both in vitro and in vivo. Enumeration of the cells which bound the radiolabeled MoAb was done by detecting the antibody on the cell surface with a Fl-F(ab')/sub 2/ goat anti-mouse IgG and analyzing fluorescence (F1) in a flow cytometer (FACS). The thymocytes, which could be labeled in whole blood, showed a labeling efficiency of 80-100%. The labeling, which could be inhibited by cold antibody, was stable up to 72 hours and did not interfere with either cell viability or functional integrity. Following IV injection of the MoAbs in normal rats, there was very good visualization of the bone marrow not seen with the control. Analysis of the marrow cells on the FACS showed that at two hours over 60% of the marrow cells were specifically labeled as against 2% for the control. Within 15 minutes of injecting /sup 111/In-OX7 into rats with lymphoma, 70% of the activity in blood was bound to circulating lymphoma cells. The ability to stably label, rapidly target, and image specific cell populations in vivo has wide ranging diagnostic and therapeutic implications

  10. Stable isotopes labelled compounds

    International Nuclear Information System (INIS)

    The catalogue on stable isotopes labelled compounds offers deuterium, nitrogen-15, and multiply labelled compounds. It includes: (1) conditions of sale and delivery, (2) the application of stable isotopes, (3) technical information, (4) product specifications, and (5) the complete delivery programme

  11. Labeling and Delinquency. (United States)

    Adams, Mike S.; Robertson, Craig T.; Gray-Ray, Phyllis; Ray, Melvin C.


    Index comprised of six contrasting descriptive adjectives was used to measure incarcerated youths' perceived negative labeling from the perspective of parents, teachers, and peers. Results provided partial support for hypothesis that juveniles who choose a greater number of negative labels will report more frequent delinquent involvement. Labeling…

  12. Carrying capacity based regional EIA in Orissa- a case study

    International Nuclear Information System (INIS)

    The development of an industrial complex in Orissa for iron and steel sector along with associated infrastructure may lead to all round development in the region with significant impact on the environment. Hence, carrying capacity based regional EIA is conducted to assess whether the environment is able to sustain such development activities. To assess the sustainability, release analysis is needed both from physical and living system. Whenever major industries are located in a region necessary secondary development also result including network of roads, railways with the transport load and all these have combined effect due to the releases and its consequences. The impact evaluation is dependent on the size, type of major industries with secondary developments. In the study region detailed base line data is generated and recommended methodology is followed to estimate supportive capacity and assimilative capacity

  13. Ab-Initio Molecular Dynamics

    CERN Document Server

    Kühne, Thomas D


    Computer simulations and molecular dynamics in particular, is a very powerful method to provide detailed and essentially exact informations of classical many-body problems. With the advent of \\textit{ab-initio} molecular dynamics, where the forces are computed on-the-fly by accurate electronic structure calculations, the scope of either method has been greatly extended. This new approach, which unifies Newton's and Schr\\"odinger's equations, allows for complex simulations without relying on any adjustable parameter. This review is intended to outline the basic principles as well as a survey of the field. Beginning with the derivation of Born-Oppenheimer molecular dynamics, the Car-Parrinello method as well as novel hybrid scheme that unifies best of either approach are discussed. The predictive power is demonstrated by a series of applications ranging from insulators to semiconductors and even metals in condensed phases.

  14. EIA cites importance of key world shipping routes

    International Nuclear Information System (INIS)

    A disruption of crude oil or products shipments through any of six world chokepoints would cause a spike in oil prices, the US Energy Information Administration (EIA) warns. The strategic importance of each major shipping lane varies because of differing oil volumes and access to other transportation routes. But nearly half of the 66 million b/d of oil consumed worldwide flows through one or more of these key tanker routes, involving: 14 million b/d through the Strait of Hormuz from the Persian Gulf to the Gulf of Oman and Arabian Sea; 7 million b/d through the Strait of Malacca from the northern Indian Ocean into the South China Sea and Pacific Ocean; 1.6 million b/d through the Bosporus from the Black Sea to the Mediterranean Sea; 900,000 b/d through the Suez Canal from the Red Sea to the Mediterranean Sea; 600,000 b/d through Rotterdam Harbor from the North Sea to Dutch and German refineries on or near the Rhine River; and 500,000 b/d through the Panama Canal from the Pacific Ocean to the Caribbean Sea. In today's highly interdependent oil markets, the mere perception of less secure oil supplies is enough to boost oil prices, EIA said. Growing oil and product tanker traffic is increasing the likelihood of supply disruptions through oil arteries because of bad weather, tanker collisions, or acts of piracy, terrorism, or war. What's more, the increasing age of the world tanker fleet and dependability of navigational equipment could increase chances of accidents and, therefore, oil supply disruptions

  15. Environmental value assessment in a multidisciplinary EIA setting

    International Nuclear Information System (INIS)

    Value assessment is a central element in an EIA for the understanding of the impacts of specified projects. The value assessment contains subjective elements and this may cause errors and difficulties in numeric value assessment methods. There is a need for transparent common criteria to promote discussion and understanding. A common criteria base already exists, but lack of communication between different management systems and different disciplines, all with different traditions in value assessment, makes the situation complex. In this article we have looked into the basic understanding of value linked to the investigation themes of natural environment, cultural heritage and society. The investigation themes linked to social science is difficult to incorporate into a common system, basically because they have less focus on land use and contain different value types. Much of the relevant literature about value assessment is linked to the assessment of sites of special interest as candidates for legal protection or conservation. In an EIA a much broader range of areas is introduced, including the 'every day landscape' with a lower and more general level of value. Together with a focus on mitigation and adjustments of plans, this results in a need for a more detailed value assessment scale than is normally in use today. We have suggested a new scale to ease communication between different disciplines and management systems. How we understand value is not constant over time, nor is the level of knowledge. This makes it necessary to sustain an ongoing debate on value assessment. The need for a dynamic value assessment system increases with the increasing use of database modelling, digital analysis of map data (GIS) etc. Lack of a ongoing value debate will rapidly lead to misleading and biased results

  16. Label Fusion Strategy Selection

    Directory of Open Access Journals (Sweden)

    Nicolas Robitaille


    Full Text Available Label fusion is used in medical image segmentation to combine several different labels of the same entity into a single discrete label, potentially more accurate, with respect to the exact, sought segmentation, than the best input element. Using simulated data, we compared three existing label fusion techniques—STAPLE, Voting, and Shape-Based Averaging (SBA—and observed that none could be considered superior depending on the dissimilarity between the input elements. We thus developed an empirical, hybrid technique called SVS, which selects the most appropriate technique to apply based on this dissimilarity. We evaluated the label fusion strategies on two- and three-dimensional simulated data and showed that SVS is superior to any of the three existing methods examined. On real data, we used SVS to perform fusions of 10 segmentations of the hippocampus and amygdala in 78 subjects from the ICBM dataset. SVS selected SBA in almost all cases, which was the most appropriate method overall.

  17. OR Specimen Labeling. (United States)

    Zervakis Brent, Mary Ann


    Mislabeled surgical specimens jeopardize patient safety and quality care. The purpose of this project was to determine whether labeling surgical specimens with two patient identifiers would result in an 80% reduction in specimen labeling errors within six months and a 100% reduction in errors within 12 months. Our failure mode effects analysis found that the lack of two patient identifiers per label was the most unsafe step in our specimen handling process. We piloted and implemented a new process in the OR using the Plan-Do-Check-Act conceptual framework. The audit process included collecting data and making direct observations to determine the sustainability of the process change; however, the leadership team halted the direct observation audit after four months. The total number of surgical specimen labeling errors was reduced by only 60% within six months and 62% within 12 months; therefore, the goal of the project was not met. However, OR specimen labeling errors were reduced. PMID:26849982

  18. Radioiodine and its labelled compounds

    International Nuclear Information System (INIS)

    Chemical characteristics and their nuclear characteristics, types of labelled molecules,labelling procedures, direct labelling with various oxidizing agents, indirect labelling with various conjugates attached to protein molecules, purification and quality control. Iodination damage.Safe handling of labelling procedures with iodine radioisotopes.Bibliography

  19. Application of EIA/SEA system in land use planning: Experience from Serbia

    Directory of Open Access Journals (Sweden)

    Stojanović Božidar


    Full Text Available This paper discusses the experience and current status of EIA/SEA procedures and assessment methodologies in Serbia, aiming to propose strategies that can lead to effective integration of the SEA in spatial planning. Institutional and practical problems with regard to the regulations of EIA/SEA were considered. Experience from the past decade shows that implementation of EIA system in Serbia has not been effective as expected. New legislation on EIA and SEA is harmonized with corresponding EU Directives. First steps in the application of the SEA show that the main issues are screening, scooping and decision making. According to the research results, it is suggested that extra evaluation processes should be incorporated into current assessment procedures to improve their scientific validity and integrity.

  20. Quality of environmental impact assessment (EIA) reports on biological pest control / Thea Henriette Carroll


    Carroll, Thea Henriette


    Decision making regarding the release of biological control agents for invasive species such as lantana, Lantana camara, requires the consideration and evaluation of environmental impact assessment (EIA) reports by a competent authority. Although various biological control agents have been authorised for release into the environment for the control of lantana, the quality of the EIA reports that form the basis for decision making has never been evaluated. The evaluation of the ...

  1. Nutrition Facts: Reading the Label (United States)

    ... My Go4Life Get Free Stuff Be a Partner Nutrition Facts: Reading the Label Reading labels can help ... of information on their labels or packaging about nutrition and food safety. Product dates . You might see ...

  2. The labelling of antibody anti-PBP2a with 99mTc

    International Nuclear Information System (INIS)

    Staphylococcus aureus is a major cause of life-threatening infections such as bacteraemia and endocarditis. Unfortunately, many strains of this bacterial species have become resistant to certain antibiotics, including methicillin and amoxicillin. These strains are known as methicillin-resistant S. aureus (MRSA). The penicillin binding protein 2a (PBP2a) is the enzyme responsible for conferring resistance p-lactams antibiotics for MRSA, being one promising molecule for therapy with mAb. However, besides the therapy, the methods of diagnosis are also inefficient because the diagnosis currently takes several days to produce a reliable result. Taking into account, the objective of this research was radiolabeling one anti-PBP2a mAb developed by Bio-Manguinhos/FioCruz-RJ, utilizing 99mTc, for in situ diagnostic of the infectious caused by MRSA. First, anti-PBP2a mAb was reduced utilizing 2-mecaptoethanol (2-ME) for generate sulphydryl groups (-SH) and after to be labeled with 99mTc. In this work, were utilized two techniques of direct method: Method 1, using tartrate and gentisic acid reagents, acting like transchelant and stabilizer agents, respectively; and Method 2, using one commercial kit of MDP. Besides the radiolabeling, the mAb reduced and mAb labeled with 99mTc were submitted to immunoreactivity analysis, with SDS-PAGE non-reducing, Immunoblotting, ELISA and neutralization assay in vitro methods. The quantity produced of sulphydryl groups by mAb was satisfactory, approximately 5 per mAb, utilizing 6.500:1 of 2-ME:mAb molar ratio. The better labeling method was Method 2, with labeling yield of 73.5%, and showed a good stability after 2 hours (73.2%). The better formulation was: 0.5 mg of mAb anti- PBP2a, 10 μU of MDP kit, after resuspended with 5 mL of saline, and 75.48 MBq (2.04 mCi) of 99mTc, reacting by 15 minutes. The labeled mAb maintained the immunoreactivity, utilizing immunologic and in vitro experiments. (author)

  3. Institutional challenges for EIA implementation in China: a case study of development versus environmental protection. (United States)

    Gu, Lixin; Sheate, William R


    This paper provides a complete case study analysis of environmental impact assessment (EIA) implementation in China from planning to legal challenge, which is typical but rarely reported. The analysis takes an historical perspective on the regulatory and institutional structures through which EIA has been implemented in China, in order to evaluate the extent to which EIA has matured over the last 10 years. The case study relates to a proposed recreation/tourist development at Dianshan Lake, a protected water resource for Shanghai. Legal and administrative challenge began in 1993, when the case was initiated with a letter from the public, and concluded in 1996, when the case was decided in a court judgment. More recent follow-up research indicates that many issues have continued to be problems for EIA implementation in China. Policy implications in terms of regulatory structure, institutional arrangement, EIA procedure, EIA practitioners, and public participation can be drawn, and lessons learned for both the government and the developers. The study emphasizes the problem of relying on reorientation of existing institutions to promote new (environmental) priorities. PMID:15983862

  4. The importance of context in delivering effective EIA: Case studies from East Africa

    International Nuclear Information System (INIS)

    This paper reviews and compares the condition of the environmental impact assessment (EIA) system in three countries in the East Africa region: Kenya, Rwanda and Tanzania. The criteria used for the evaluation and the comparison of each system are based on the elements of the legal, administrative and procedural frameworks, as well as the context in which they operate. These criteria are adapted from the evaluation and quality control criteria derived from a number of literature sources. The study reveals that the EIA systems of Kenya and Tanzania are at a similar stage in their development. The two countries, the first to introduce the EIA concept into their jurisdiction in this part of Africa, therefore have more experience than Rwanda in the practice of environmental impact assessment, where the legislation and process requires more time to mature both from the governmental and societal perspective. The analysis of the administrative and procedural frameworks highlights the weakness in the autonomy of the competent authority, in all three countries. Finally a major finding of this study is that the contextual set up i.e. the socio-economic and political situation plays an important role in the performance of an EIA system. The context in developing countries is very different from developed countries where the EIA concept originates. Interpreting EIA conditions in countries like Kenya, Rwanda and Tanzania requires that the analysis for determining the effectiveness of their systems should be undertaken within a relevant framework, taking into account the specific requirements of those countries.

  5. Temporal change of EIA asymmetry revealed by a beacon receiver network in Southeast Asia (United States)

    Watthanasangmechai, Kornyanat; Yamamoto, Mamoru; Saito, Akinori; Maruyama, Takashi; Yokoyama, Tatsuhiro; Nishioka, Michi; Ishii, Mamoru


    To reveal the temporal change of the equatorial ionization anomaly (EIA) asymmetry, a multipoint satellite-ground beacon experiment was conducted along the meridional plane of the Thailand-Indonesia sector. The observation includes one station near the magnetic equator and four stations at off-equator latitudes. This is the first EIA asymmetry study with high spatial resolution using GNU Radio Beacon Receiver (GRBR) observations in Southeast Asia. GRBR-total electron contents (TECs) from 97 polar-orbit satellite passes in March 2012 were analyzed in this study. Successive passes captured rapid evolution of EIA asymmetry, especially during geomagnetic disturbances. The penetrating electric fields that occur during geomagnetic disturbed days are not the cause of the asymmetry. Instead, high background TEC associated with an intense electric field empowers the neutral wind to produce severe asymmetry of the EIA. Such rapid evolution of EIA asymmetry was not seen during nighttime, when meridional wind mainly controlled the asymmetric structures. Additional data are necessary to identify the source of the variations, i.e., atmospheric waves. Precisely capturing the locations of the crests and the evolution of the asymmetry enhances understanding of the temporal change of EIA asymmetry at the local scale and leads to a future local modeling for TEC prediction in Southeast Asia.

  6. Radioactive labelled orgotein

    International Nuclear Information System (INIS)

    The preparation and use of radioactively labelled orgotein, i.e. water-soluble protein congeners in pure, injectable form, is described. This radiopharmaceutical is useful in scintigraphy, especially for visualization of the kidneys where the orgotein is rapidly concentrated. Details of the processes for labelling bovine orgotein with sup(99m)Tc, 60Co, 125I or 131I are specified. The pharmaceutical preparation of the labelled orgotein for intravenous and parenteral administration is also described. Examples using either sup(99m)TC or 125I-orgotein in scintiscanning dogs' kidneys are given. (UK)

  7. Clinical applications of cells labelling

    International Nuclear Information System (INIS)

    Blood cells labelled with radionuclides are reviewed and main applications are described. Red blood cell labelling by both random and specific principle. A table with most important clinical uses, 99mTc labelling of RBC are described pre tinning and in vivo reduction of Tc, in vitro labelling and administration of labelled RBC and in vivo modified technique. Labelled leucocytes with several 99mTc-complex radiopharmaceuticals by in vitro technique and specific monoclonal s for white cells(neutrofiles). Labelled platelets for clinical use and research by in vitro technique and in vivo labelling

  8. GINGA Observations of AB Doradus (United States)

    Vilhu, O.; Tsuru, T.; Collier Cameron, A.

    We report GINGA observations of the pre main sequence star AB Doradus (HD 36705), performed during 8 - 12 January, 1990. Some rotational modulation might be present. four X-ray flares were detected. Three of these events were similar to the EINSTEIN HRI-flare (Vilhu and Linsky, 1987), with decay times around 25 min. The last flare had long rise and decay times (100 min), resembling the EXOSAT flares observed by Collier Cameron (1988). The mean flare spectrum can be fitted by a thermal bremstrahlung with temperature 5.0 keV, or by a power-law model with photon index 2.2. The 3 upper limit of the Iron line equivalent width in the flare spectrum is 1 keV, weaker than predicted by thermal models. This Iron line anomaly was first discussed in the case of UX Ari by Tsuru et. al. (1989). However, normal equivalent widths can be derived from several EXOSAT spectra of active cool stars (Pallavicini and Tagliaferri, 1990). We discuss the possibility that the continuum from non-thermal electrons (producing also the microwave emission) could occasionally lower the apparent equivalent width. The mechanism works for reasonably low magnetic field strengths and electon power-law indexes. However, a large population of non-thermal electrons is needed (comparable to the thermal one). Stronger magnetic fields could explain the radio emission with less electrons, but then the non-thermal X-ray continuum remains small.

  9. FDA Online Label Repository (United States)

    U.S. Department of Health & Human Services — The drug labels and other drug-specific information on this Web site represent the most recent drug listing information companies have submitted to the Food and...

  10. Like your labels? (United States)

    Field, Michele


    The descriptive “conventions” used on food labels are always evolving. Today, however, the changes are so complicated (partly driven by legislation requiring disclosures about environmental impacts, health issues, and geographical provenance) that these labels more often baffle buyers than enlighten them. In a light-handed manner, the article points to how sometimes reading label language can be like deciphering runes—and how if we are familiar with the technical terms, we can find a literal meaning, but still not see the implications. The article could be ten times longer because food labels vary according to cultures—but all food-exporting cultures now take advantage of our short attention-span when faced with these texts. The question is whether less is more—and if so, in this contest for our attention, what “contestant” is voted off. PMID:21539053

  11. Certified Rule Labeling


    Nagele, Julian; Zankl, Harald


    The rule labeling heuristic aims to establish confluence of (left-)linear term rewrite systems via decreasing diagrams. We present a formalization of a confluence criterion based on the interplay of relative termination and the rule labeling in the theorem prover Isabelle. Moreover, we report on the integration of this result into the certifier CeTA, facilitating the checking of confluence certificates based on decreasing diagrams for the first time. The power of the method is illustrated by ...

  12. Labelling of Vincamine derivatives

    International Nuclear Information System (INIS)

    Tritium labelled Vincamine and ethyl apovincaminate (Cavinton) have been prepared on the bases of known stereospecific synthesis. High specific activity compounds were obtained by the catalytic tritiation of appropriate unsaturated starting compounds. When the structure of the unsaturated starting compounds was changed (even rather for from the reaction centre) instead of the catalytic addition of tritium a specific hydrogen-tritium exchange reaction was found to be the main labelling process

  13. Labelling of electricity

    International Nuclear Information System (INIS)

    This comprehensive report for the Swiss Federal Office of Energy (SFOE) presents a possible course of action to be taken to provide a means of declaring the sources of electrical power, as is foreseen in the draft of new Swiss electricity market legislation. The report presents the basic ideas behind the idea and defines the terms used such as labelling, certificates and declarations. Also, the legal situation in the European Union and in Switzerland is examined and a quantitative overview of electricity production and consumption is presented. Suggestions for a labelling scheme are made and some of the problems to be expected are looked at. The report also presents a series of examples of labelling schemes already implemented in other countries, such as Austria, Great Britain, Sweden and Germany. Tradable certificates and tracking systems are discussed as are initial quality labels like the Swiss 'Naturemade' label for green power. A concrete recommendation for the declaration and labelling of electricity in Switzerland is presented and various factors to be considered such as import/export, pumped storage, distribution losses, small-scale producers as well as the time-scales for introduction are discussed

  14. Evaluation of {sup 111}In labeled antibodies for SPECT imaging of mesothelin expressing tumors

    Energy Technology Data Exchange (ETDEWEB)

    Misri, Ripen; Saatchi, Katayoun [Faculty of Pharmaceutical Sciences, University of British Columbia, Vancouver, BC, V6T 1Z3 (Canada); Ng, Sylvia S.W. [Faculty of Pharmaceutical Sciences, University of British Columbia, Vancouver, BC, V6T 1Z3 (Canada); Advanced Therapeutics, British Columbia Cancer Agency, Vancouver BC V5Z 1G1 (Canada); Kumar, Ujendra [Faculty of Pharmaceutical Sciences, University of British Columbia, Vancouver, BC, V6T 1Z3 (Canada); Haefeli, Urs O., E-mail: [Faculty of Pharmaceutical Sciences, University of British Columbia, Vancouver, BC, V6T 1Z3 (Canada)


    Introduction: Mesothelin is expressed in many cancers, especially in mesothelioma and lung, pancreatic and ovarian cancers. In the present study, we evaluate {sup 111}In labeled antimesothelin antibodies as an imaging bioprobe for the SPECT imaging of mesothelin-expressing tumors. Methods: We radiolabeled the antimesothelin antibodies mAbMB and mAbK1 with {sup 111}In using the p-SCN-bn-DTPA chelator. The immunoreactivity, affinity (K{sub d}) and internalization properties of the resulting two {sup 111}In labeled antibodies were evaluated in vitro using mesothelin-expressing A431K5 cells. The biodistribution and microSPECT/CT imaging studies with {sup 111}In labeled antibodies were performed in mice bearing both mesothelin positive (A431K5) and mesothelin negative (A431) tumors. Results: In vitro studies demonstrated that {sup 111}In-mAbMB bound with a higher affinity (K{sub d}=3.6{+-}1.7 nM) to the mesothelin-expressing A431K5 cells than did the {sup 111}In-mAbK1 (K{sub d}=29.3{+-}2.3 nM). {sup 111}In-mAbMB was also internalized at a greater rate and extent into the A431K5 cells than was the {sup 111}In-mAbK1. Biodistribution studies showed that {sup 111}In-mAbMB was preferentially localized in A431K5 tumors when compared to A431 tumors. At the low dose, the peak A431K5 tumor uptake of 9.65{+-}2.65% ID/g (injected dose per gram) occurred at 48 h, while at high dose tumor uptake peaked with 14.29{+-}6.18% ID/g at 72 h. Non-specific localization of {sup 111}In-mAbMB was mainly observed in spleen.{sup 111}In-mAbK1 also showed superior localization in A431K5 tumors than in A431 tumors, but the peak uptake was only 3.04{+-}0.68% ID/g at 24 h. MicroSPECT/CT studies confirmed better visualization of A431K5 tumors with {sup 111}In-mAbMB, than with {sup 111}In-mAbK1. Conclusion: SPECT imaging of mesothelin expressing tumors was demonstrated successfully. Our findings indicate that the antimesothelin antibody mAbMB has the potential to be developed into a diagnostic agent

  15. AP calculus AB & BC crash course

    CERN Document Server

    Rosebush, J


    AP Calculus AB & BC Crash Course - Gets You a Higher Advanced Placement Score in Less Time Crash Course is perfect for the time-crunched student, the last-minute studier, or anyone who wants a refresher on the subject. AP Calculus AB & BC Crash Course gives you: Targeted, Focused Review - Study Only What You Need to Know Crash Course is based on an in-depth analysis of the AP Calculus AB & BC course description outline and actual AP test questions. It covers only the information tested on the exams, so you can make the most of your valuable study time. Written by experienced math teachers, our

  16. Streaming Label Learning for Modeling Labels on the Fly


    You, Shan; Xu, Chang; Wang, Yunhe; Xu, Chao; Tao, Dacheng


    It is challenging to handle a large volume of labels in multi-label learning. However, existing approaches explicitly or implicitly assume that all the labels in the learning process are given, which could be easily violated in changing environments. In this paper, we define and study streaming label learning (SLL), i.e., labels are arrived on the fly, to model newly arrived labels with the help of the knowledge learned from past labels. The core of SLL is to explore and exploit the relations...

  17. A computer-based system for environmental impact assessment (EIA) applications to energy power stations in Turkey: CEDINFO

    International Nuclear Information System (INIS)

    Environmental impact assessment (EIA) is a tool for decision makers to take into account the possible effects of a proposed project on the environment and is also a process for collecting the data related to a project design and project area. Different techniques are used for the EIA process. In recent years, including the design and development of databases, classification systems, computer models and expert systems have been used extensively in impact assessment studies. Knowledge-based systems referred to as expert systems and different computer-based systems are an emerging technology in information processing and are becoming increasingly useful tools in different applications areas including EIA studies. Their use for EIA has been quite limited in developing countries, because of the constraints on resources, particularly in expertise and data. In this study, a knowledge-based software-CEDINFO-developed by authors was introduced. CEDINFO to be used for EIA practices on energy-generating stations was designed based on the legal EIA process in Turkey. According to the EIA Regulation enacted in Turkey in 1993, energy-generating stations (thermal power station, hydraulic station, nuclear station) in different categories require mandatory EIA reports duly approved by The Ministry of Environment and Forestry before their construction. CEDINFO primarily aims to provide educational support for EIA practices and decision-makers on energy-generating stations

  18. Evaluation of the EIA system on the Island of Mauritius and development of an environmental monitoring plan framework

    International Nuclear Information System (INIS)

    The Environment Protection Act (EPA) in Mauritius provides for the application of an EIA license in respect of undertakings listed in its first schedule. Following the promulgation of the Act in June 1993, the Department of Environment (DOE) is issuing an average of 125 EIA licenses yearly. In general, the review exercise of an environmental impact assessment (EIA) is terminated once the license has been granted. The aim of this project was to evaluate the EIA system in Mauritius and to identify its weaknesses and strengths. One of the main weaknesses, besides the lack of EIA audits, is the absence of EIA follow-up monitoring. It is necessary to distinguish between monitoring done for regulatory purposes (compliance monitoring) and environmental monitoring related to the EIA. With the growth of the tourism industry on the island, coastal development projects have the potential to cause significant environmental impacts . A sample of EIA reports pertaining to this sector was assessed for its quality and follow-up mechanisms. Proposals for the contents of EIA Prediction Audits, Environmental Monitoring Plans (EMP) and the format for an EMP report are made

  19. Eco-labelling, competition and environment: Endogenization of labelling criteria


    Ben Youssef, Adel; Lahmandi-Ayed, Rim


    This paper suggests a modelling of the labelling procedure consistent with empirical observations, that allows the endogenous calculation of labelling criteria. The authority in charge of the labelling program chooses the level of labelling criteria so as to maximise the social surplus, anticipating competition between firms in environmental qualities and prices. While accounting simply for the informational role of labels, this model allows to understand observed behavior such as firms' igno...

  20. On online labeling with polynomially many labels

    Czech Academy of Sciences Publication Activity Database

    Babka, M.; Bulánek, Jan; Čunát, V.; Koucký, Michal; Saks, M.

    Berlin : Springer, 2012 - (Epstein, L.; Ferragina, P.), s. 121-132 ISBN 978-3-642-33089-6. - (Lecture Notes in Computer Science. 7501). [20th Annual European Symposium on Algorithms (ESA 2012). Ljubljana (SI), 10.09.2012-12.09.2012] R&D Projects: GA ČR GAP202/10/0854; GA AV ČR IAA100190902 Institutional support: RVO:67985840 Keywords : online labeling * file maintenance problem * lower bounds Subject RIV: BA - General Mathematics

  1. European consumers and nutrition labelling

    DEFF Research Database (Denmark)

    Wills, Josephine M.; Grunert, Klaus G.; Celemín, Laura Fernández;


    Nutrition labelling of food in Europe is not compulsory, unless a nutrition or health claim is made for the product. The European Commission is proposing mandatory nutrition labelling, even front of pack labelling with nutrition information. Yet, how widespread is nutrition labelling in the EU...

  2. Genetic algorithms for map labeling

    NARCIS (Netherlands)

    Dijk, Steven Ferdinand van


    Map labeling is the cartographic problem of placing the names of features (for example cities or rivers) on the map. A good labeling has no intersections between labels. Even basic versions of the problem are NP-hard. In addition, realistic map-labeling problems deal with many cartographic constr

  3. Off-Label Drug Use (United States)

    ... Your Local Offices Close + - Text Size Off-label Drug Use What is off-label drug use? In the United States new drugs are ... unapproved use of a drug. Is off-label drug use legal? The off-label use of FDA- ...


    Lifescience Database Archive (English)

    Full Text Available DREDR1ATRD29AB S000152 23-June-2006 (last modified) kehi Related to responsiveness ...dependent in the ABA-responsive expression of the rd29A in Arabidopsis; DRE; drought; water stress; oxidativ

  5. Imaging endocarditis with Tc-99m-labeled antibody--an experimental study: concise communication

    Energy Technology Data Exchange (ETDEWEB)

    Wong, D.W.; Dhawan, V.K.; Tanaka, T.; Mishkin, F.S.; Reese, I.C.; Thadepalli, H.


    The sensitivity and specificity of Tc-99m-labeled antibacterial antibody (Tc-99m Ab) for detecting bacterial endocarditis were evaluated in an experimental model. Rabbit-produced antistaphylococcal antibody was extracted using Rivanol and chemically labeled with Tc-99m. This Tc-99m Ab was injected intravenously in New Zealand rabbits 24 hr after producing Staphylococcus aureus endocarditis of the aortic valve. Imaging and tissue analyses were performed on the following day. All 11 animals developed S. aureus aortic-valve vegetations and showed increased uptake of Tc-99m Ab at the aortic valve, 118 times higher than at the uninfected tricuspid valve. Although high hepatic radioactivity and anatomic uncertainties interfered with in vivo delineation of these lesions, images of the excised hearts showed all affected valves. Two rabbits inoculated with Escherichia coli did not develop endocarditis and had little uptake of Tc-99m Ab, while six rabbits with enterococcal endocarditis had no uptake of the Tc-99m Ab in their vegetations. The findings suggest potential value of Tc-99m Ab on the rapid diagnosis of endocarditis.

  6. Imaging endocarditis with Tc-99m-labeled antibody--an experimental study: concise communication

    International Nuclear Information System (INIS)

    The sensitivity and specificity of Tc-99m-labeled antibacterial antibody (Tc-99m Ab) for detecting bacterial endocarditis were evaluated in an experimental model. Rabbit-produced antistaphylococcal antibody was extracted using Rivanol and chemically labeled with Tc-99m. This Tc-99m Ab was injected intravenously in New Zealand rabbits 24 hr after producing Staphylococcus aureus endocarditis of the aortic valve. Imaging and tissue analyses were performed on the following day. All 11 animals developed S. aureus aortic-valve vegetations and showed increased uptake of Tc-99m Ab at the aortic valve, 118 times higher than at the uninfected tricuspid valve. Although high hepatic radioactivity and anatomic uncertainties interfered with in vivo delineation of these lesions, images of the excised hearts showed all affected valves. Two rabbits inoculated with Escherichia coli did not develop endocarditis and had little uptake of Tc-99m Ab, while six rabbits with enterococcal endocarditis had no uptake of the Tc-99m Ab in their vegetations. The findings suggest potential value of Tc-99m Ab on the rapid diagnosis of endocarditis

  7. Radio labeling with preassigned frequencies.



    A radio labeling of a graph G is an assignment of pairwise distinct, positive integer labels to the vertices of G such that labels of adjacent vertices differ by at least $2$. The radio labeling problem (RL) consists in determining a radio labeling that minimizes the maximum label that is used (the so-called span of the labeling). RL is a well-studied problem, mainly motivated by frequency assignment problems in which transmitters are not allowed to operate on the same frequency channel. We c...

  8. Radioactive labelling of peptidic hormones

    International Nuclear Information System (INIS)

    The labelling of peptidic hormones requires stability, specificity and sensitivity of the label. Introduction of a radioactive atome is one way to satisfy these criteria. Several processes have been described to prepare radioactive TRF: synthesis of the peptide with labelled aminoacids or introduction of the label into the hormone. In that approach, tritium can be substituted in the imidazole ring, via precursors activating the proper carbon. Monoiodo TRF leads essentially to tritium labelling of the 5 positions whereas monoazo TRF allows the preparation of 3H TRF labelled in the 2 positions. Di-substituted TRF leads to labelling into the 2 and 5 carbons. Labelled analogs of TRF can be prepared with labelled iodine; further developments of peptide labelling, will be presented. In particular, the homolytic scission of the C-iodine, bond by photochemical activation. The nascent carbon radical can be stabilized by a tritiated scavenger. This approach eliminates the use of heavy metal catalysts

  9. Genetic labelling and application of the isoproturon-mineralizing Sphingomonas sp. strain SRS2 in soil and rhizosphere

    DEFF Research Database (Denmark)

    Kristensen, K.E.; Jacobsen, C.S.; Hansen, L.H.;


    AIMS: To construct a luxAB-labelled Sphingomonas sp. strain SRS2 maintaining the ability to mineralize the herbicide isoproturon and usable for monitoring the survival and distribution of strain SRS2 on plant roots in laboratory systems. METHODS AND RESULTS: We inserted the mini-Tn5-luxAB marker...... for monitoring colonization of barley roots. CONCLUSIONS: We successfully constructed a genetically labelled isoproturon-mineralizing-strain SRS2 and demonstrated its ability to survive in soil and its colonization of rhizosphere. SIGNIFICANCE AND IMPACT OF THE STUDY: The construction of a lux...... into strain SRS2 using conjugational mating. In the transconjugant mutants luciferase was produced in varying levels. The mutants showed significant differences in their ability to degrade isoproturon. One luxAB-labelled mutant maintained the ability to mineralize isoproturon and was therefore selected...

  10. Effective use of environmental impact assessments (EIAs) for geothermal development projects

    International Nuclear Information System (INIS)

    Both the developed and developing nations of the world would like to move toward a position of sustainable development while paying attention to the restoration of natural resources, improving the environment, and improving the quality of life. The impacts of geothermal development projects are generally positive. It is important, however, that the environmental issues associated with development be addressed in a systematic fashion. Drafted early in the project planning stage, a well-prepared Environmental Impact Assessment (EIA) can significantly add to the quality of the overall project. An EIA customarily ends with the decision to proceed with the project. The environmental analysis process could be more effective if regular monitoring, detailed in the EIA, continues during project implementation. Geothermal development EIAs should be analytic rather than encyclopedic, emphasizing the impacts most closely associated with energy sector development. Air quality, water resources and quality, geologic factors, and socioeconomic issues will invariably be the most important factors. The purpose of an EIA should not be to generate paperwork, but to enable superb response. The EIA should be intended to help public officials make decisions that are based on an understanding of environmental consequences and take proper actions. The EIA process has been defined in different ways throughout the world. In fact, it appears that no two countries have defined it in exactly the same way. Going hand in hand with the different approaches to the process is the wide variety of formats available. It is recommended that the world geothermal community work towards the adoption of a standard. The Latin American Energy Organization (OLADE) and the Inter-American Development Bank (IDB)(OLADE, 1993) prepared a guide that presents a comprehensive discussion of the environmental impacts and suggested mitigation alternatives associated with geothermal development projects. The OLADE guide

  11. Synthesis of labeled compounds

    International Nuclear Information System (INIS)

    Intermediate compounds labeled with 13C included methane, sodium cyanide, methanol, ethanol, and acetonitrile. A new method for synthesizing 15N-labeled 4-ethylsulfonyl-1-naphthalene-sulfonamide was developed. Studies were conducted on pathways to oleic-1-13C acid and a second pathway investigated was based on carbonation of 8-heptadecynylmagnesium bromide with CO2 to prepare sterolic acid. Biosynthetic preparations included glucose-13C from starch isolated from tobacco leaves following photosynthetic incubation with 13CO2 and galactose-13C from galactosylglycerol-13C from kelp. Research on growth of organisms emphasized photosynthetic growth of algae in which all cellular carbon is labeled. Preliminary experiments were performed to optimize the growth of Escherichia coli on sodium acetate-13C

  12. Fluorine-18 labelled compounds

    International Nuclear Information System (INIS)

    The work presented in this thesis deals with the problems involved in the adaption of reactor-produced fluorine-18 to the synthesis of 18F-labelled organic fluorine compounds. Several 18F-labelling reagents were prepared and successfully applied. The limitations to the synthetic possibilities of reactor-produced fluoride-18 become manifest in the last part of the thesis. An application to the synthesis of labelled aliphatic fluoro amino acids has appeared to be unsuccessful as yet, although some other synthetic approaches can be indicated. Seven journal articles (for which see the availability note) are used to compose the four chapters and three appendices. The connecting text gives a survey of known 18F-compounds and methods for preparing such compounds. (Auth.)

  13. Reform of the EIA process in Indonesia: improving the role of public involvement

    International Nuclear Information System (INIS)

    The implementation of Environmental Impact Assessment (EIA) as a planning tool has been utilised for a relatively long time in Indonesia. It was introduced formally through the Act No. 4/1982. Supporting regulation was established in 1986 when Government Regulation No. 29 was enacted. After developing the EIA system for 14 years, Indonesia finally recognized the importance of emphasizing public involvement in the EIA guidelines of 2000. EIA in the previous Indonesian regulations, i.e. Regulation No. 29/1986 and No. 51/1993, did not have provisions for direct public involvement. The Indonesian Government Regulation No. 27/1999 is currently accommodating the above issue. Guidelines for public announcement and public involvement have been introduced in a decree issued by the Head of Indonesia's Environmental Impact Management Agency No. KepDal 08/2000. This was officially enacted on 7 November 2000 in response to the demand for more public involvement, an issue that was ambiguous in the previous legislation. This paper discusses: the implementation of the new guidelines; what has been achieved; and the challenges during implementation. While the paper focuses its review on the Indonesian EIA system, Indonesia's experience is relevant to many other developing countries that are starting to adopt public involvement in their decision-making processes

  14. Comparison of DOTA and NODAGA as chelators for 64Cu-labeled immunoconjugates

    International Nuclear Information System (INIS)

    Introduction: Bifunctional chelators have been shown to impact the biodistribution of monoclonal antibody (mAb)-based imaging agents. Recently, radiolabeled 1,4,7-triazacyclononane,1-glutaric acid-4,7-acetic acid (NODAGA)-peptide complexes have demonstrated improved in vivo stability and performance compared to their 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) counterparts. Here, we investigated if similar utility could be achieved with mAbs and compared 64Cu-labeled DOTA and NODAGA-immunoconjugates for the detection of epithelial cell adhesion molecule (EpCAM) in a prostate cancer model. Methods: DOTA and NODAGA-immunoconjugates of an EpCAM targeting mAb (mAb7) were synthesized and radiolabeled with 64Cu (DOTA: 40 °C for 1 hr; NODAGA: 25 °C for 1 hr). The average number of chelators per mAb was quantified by isotopic dilution, and the biological activity of the immunoconjugates was evaluated by flow cytometry and ELISA. Radioligand assays were performed to compare cellular uptake and determine the dissociation constant (Kd) and maximum number of binding sites (Bmax) for the immunoconjugates using DsRed-transfected PC3-cells. A PC3-DsRed xenograft tumor model was established in nude mice and used to perform biodistribution studies to compare organ uptake and pharmacokinetics. Results: 64Cu-DOTA-mAb7 and 64Cu-NODAGA-mAb7 were prepared with chelator/protein ratios of 2–3 and obtained in comparable radiochemical yields ranging from 59 to 71%. Similar immunoreactivity was observed with both agents, and mock labeling studies indicated that incubation at room temperature or 40 °C did not affect potency. 64Cu-NODAGA-mAb7 demonstrated higher in vitro cellular uptake while 64Cu-DOTA-mAb7 had higher Kd and Bmax values. From the biodistribution data, we found similar tumor uptake (13.44 ± 1.21%ID/g and 13.24 ± 4.86%ID/g for 64Cu-DOTA-mAb7 and 64Cu-NODAGA-mAb7, respectively) for both agents at 24 hr, although normal prostate tissue was significantly

  15. Semantic Role Labeling

    CERN Document Server

    Palmer, Martha; Xue, Nianwen


    This book is aimed at providing an overview of several aspects of semantic role labeling. Chapter 1 begins with linguistic background on the definition of semantic roles and the controversies surrounding them. Chapter 2 describes how the theories have led to structured lexicons such as FrameNet, VerbNet and the PropBank Frame Files that in turn provide the basis for large scale semantic annotation of corpora. This data has facilitated the development of automatic semantic role labeling systems based on supervised machine learning techniques. Chapter 3 presents the general principles of applyin

  16. Integrating education, training and communication for public involvement in EIA

    International Nuclear Information System (INIS)

    We are going towards a globalized world, this involving the integration of every activity and every person. The public involvement in the development process is evident, taking into account that any objective will affect the people and the negative feedback could influence the result of the investment. Generally the public could be influenced by amplification of negative evaluated consequences, resulting psychosocial effects leading to illness or anxieties. This problem will be resolved by the public access to information provided by experts. A real-time interactive communication system is proposed as an open tool in order to facilitate decision-making by access to rapid and reliable information. The main task of the system is to collect, process, display and exchange the information relative to environmental impact assessment (EIA), to provide assistance, to receive specific opinions, being also proposed for public understanding of the field. The education and training integration will mitigate the barriers, which may inhibit the interaction and communication process. To increase learning will assure specialists-public interaction and a good information flow for knowledge exchange. The paper will outline key approaches in reaching agreement on the people educational process importance. The impact of development will be available to the public revealing the positive consequences, such as increased employment and income. An effective way to avoid negative reactions consists of the extensive consultation to identify the concerns and needs of the public, the access to suggestive and attractive programs for education and training. The system is developed as a modern information module, integrated into complex international management systems. It can be placed everywhere, everybody could access the facilities for education, world experience and training. Providing a real-time response to citizen concerns, the system represents an economic and rapid way to mitigate the

  17. Divergent practice in a converging system? The case of EIA in France and the UK

    International Nuclear Information System (INIS)

    This paper seeks to clarify the harmonisation objective of the European Union (EU) Environmental Impact Assessment (EIA) Directives and to highlight some of the implicit tensions and differing interpretations. It first provides an overview of Member States' (MSs) practice in EIA, in the context of the harmonisation objective, before focusing on the particular cases of the UK and France. The latter include studies of the legal context and practice of EIA. There are significant variations in legal harmonisation and in the 'spirit' of legislation and guidance, nor does the existence of common legal requirements necessarily equate with 'harmonised practice'. There are considerable variations in UK and French practice, reflecting a number of underlying factors--including attitude to the environment, institutional factors and the nature and perceptions of practitioners. Yet, while practice may be divergent, it may not be diverging, and recent actions such as the amended Directive are designed to encourage more convergence

  18. A method for the assessment of changes in environmental perception during an EIA process

    International Nuclear Information System (INIS)

    Changes in environmental perception during an EIA process among the general population (the public) and employees of the Port of Koper were measured. The method of measurement addresses the statistical significance of the influence of the content, form, mode, providers of environmental information, institutional constraint and other factors. Opinions about environmental issues were collected in both groups prior to and after the provision of information in the EIA process. The difference formed the basis for an assessment of how environmental information provided during an EIA process contributes to environmental perception. The results show that difference in opinions about the impact of the Port between the two groups became smaller when comparing the first and second survey. In relation to the opinions of the employees, institutional constraint was recognised

  19. Environmental agreements, EIA follow-up and aboriginal participation in environmental management: The Canadian experience

    International Nuclear Information System (INIS)

    During the last decade a number of environmental agreements (EAs) have been negotiated in Canada involving industry, government and Aboriginal peoples. This article draws on the Canadian experience to consider the potential of such negotiated agreements to address two issues widely recognised in academic and policy debates on environmental impact assessment (EIA) and environmental management. The first relates to the need to secure indigenous participation in environmental management of major projects that affect indigenous peoples. The second and broader issue involves the necessity for specific initiatives to ensure effective follow-up of EIA. The Canadian experience indicates that negotiated environmental agreements have considerable potential to address both issues. However, if this potential is to be realized, greater effort must be made to develop structures and processes specifically designed to encourage Aboriginal participation; and EAs must themselves provide the financial and other resource required to support EIA follow-up and Aboriginal participation

  20. Radioactively labelled porphyrin derivatives

    International Nuclear Information System (INIS)

    Radioactive labelling of guanidine bearing tetraphenylporphyrin and Dy-texaphyrin with 166Ho and 90Y is described. UV-VIS absorption spectrometry was used to describe porphyrin and texaphyrin, including their behaviour over a wide pH range. This technique also provided preliminary information about the complexation of holmium and yttrium with porphyrin and texaphyrin. The labelling yield of the macrocyclic molecules depends on the pH of the reaction mixture, metal-to-ligand ratio and time of incubation. The optimum reaction conditions for the formation of radioactive complexes of porphyrin and texaphyrin were determined by thin layer chromatography combined with beta activity measurement. The ability of porphyrin derivatives to bind anions was also examined. Our experiments were focused on perrhenate ion (ReO4-) because radiopharmaceuticals labeled with 186Re and 188Re play an important role in the therapy of many tumorous diseases. The possibility of using the ReO4- anion directly for labeling without reduction to a lower oxidation state can simplify considerably the preparation of the radiotherapeutic pharmaceuticals. Neither UV-Vis spectrometry nor TLC gave evidence of any incorporation of the ReO4- anion into the porphyrin ring

  1. Labeling of herbicide femesafen

    International Nuclear Information System (INIS)

    5-[2-chroo-4-(trifluoromethyl ) phenoxy]-N-(methyl sulphonyl )-2-niorobenzamide [femesafen] was labeled by six steps. Radio-chemical yield was 19.15%. TLC analysis of the final product showed that the radiochemical purity is not less than 99%. (authors)

  2. Waisda?: video labeling game

    NARCIS (Netherlands)

    Hildebrand, M.; Brinkerink, M.; Gligorov, R.; Steenbergen, M. van; Huijkman, J.; Oomen, J.


    The Waisda? video labeling game is a crowsourcing tool to collect user-generated metadata for video clips. It follows the paradigm of games-with-a-purpose, where two or more users play against each other by entering tags that describe the content of the video. Players score points by entering the sa

  3. Understanding Food Labels (United States)

    ... girls Eating healthy at restaurants Special food issues Vegetarian eating Eating for strong bones Quiz: Food Facts Links to more information girlshealth glossary home Home Nutrition Healthy eating for girls Understanding food labels Understanding ...

  4. Stabilization of labelled compounds

    International Nuclear Information System (INIS)

    This invention concerns a composition including a labelled compound, and the vitamin B 12. This vitamin gives a red colour to the solution and stabilize it radiochemically, allowing to transport the solution at ambient temperature and a storage at 4 degrees celsius. (N.C.). 5 refs

  5. Genetic algorithms for map labeling


    Dijk, Steven Ferdinand van


    Map labeling is the cartographic problem of placing the names of features (for example cities or rivers) on the map. A good labeling has no intersections between labels. Even basic versions of the problem are NP-hard. In addition, realistic map-labeling problems deal with many cartographic constraints, which pose more demands on how the labels should be placed in relation to their surroundings. For example, a label is preferably placed above and to the right of a city. These two aspects (comb...

  6. An analysis framework for characterizing and explaining development of EIA legislation in developing countries—Illustrated for Georgia, Ghana and Yemen

    International Nuclear Information System (INIS)

    Actors in the field of international development co-operation supporting the development of EIA legislation in developing countries often do not achieve the results envisaged. The performance of EIA in these countries often remains weak. One reason, we assume, is that often those actors support the establishment of overly ambitious EIA legislation that cannot achieve its objectives in the light of constraining contexts. To provide more effective support we need to better understand the enabling and constraining contextual factors that influence the development of EIA legislation and to which support actors should align itself. In this article a new analysis framework for classifying, characterizing and explaining the development of EIA legislation is described, measured in terms of ambition levels. Ambitions are defined as intentions the EIA authorities aim to fulfill, expressed in formal EIA legislation. Three country cases, Yemen, Georgia and Ghana are used to illustrate the usefulness of our framework and as a first test to refine the framework. We have formulated the following five hypotheses that complement and refine our analysis framework. One, EIA legislation may develop multilinearly in terms of ambition levels. Two, ambitions in EIA legislation seem to be influenced to a great extent by the power and capacity of, on the one hand, the environmental authorities supporting EIA and, on the other hand, the sector authorities hindering the development of EIA. Three, the political system is the most important context factor influencing the rules of policy-making and the power of the different actors involved. Four, the importance of context factors on the development of ambitions is dependent on the phase of EIA system development. Five, some ambitions seem to be influenced by particular factors; for instance the ambitions for the object of study seem to be influenced by the level of environmental awareness of the sector ministries and parliament. The analysis

  7. Positively charged templates for labeling internalizing antibodies: comparison of N-succinimidyl 5-iodo-3-pyridinecarboxylate and the D-amino acid peptide KRYRR

    Energy Technology Data Exchange (ETDEWEB)

    Foulon, Catherine F.; Welsh, Philip C.; Bigner, Darell D.; Zalutsky, Michael R. E-mail:


    Receptor-mediated internalization of monoclonal antibodies (mAbs), such as those specific for the epidermal growth factor receptor variant III (EGFRvIII), can lead to rapid loss of radioactivity from the target cell. In the current study, the anti-EGFRvIII mAb L8A4 was radioiodinated using two methods -N-succinimidyl 5-iodo-3-pyridinecarboxylate (SIPC) and via a D-amino acid peptide LysArgTyrArgArg (D-KRYRR). Paired-label internalization assays performed on EGFRvIII-expressing U87{delta}EGFR cells in vitro demonstrated that labeling L8A4 using D-KRYRR resulted in significantly higher retention of radioiodine in the intracellular compartment. In athymic mice with D256 human glioma xenografts, tumor uptake was similar for both labeling methods through 24 hr. However, an up to fourfold higher tumor retention was observed for mAb labeled with the D-amino acid peptide at later time points. Radiation absorbed dose calculations based on these biodistribution data indicated that L8A4 labeled using D-KRYRR exhibited better tumor-to-normal-organ radiation dose ratios, suggesting that this labeling method may be of particular value for labeling internalizing mAbs.

  8. Quality of Cultural Heritage in EIA; twenty years of experience in Norway

    International Nuclear Information System (INIS)

    The aim of this paper is to clarify and discuss how quality, relevance, attitudes, beliefs and transfer value act as underlying driving forces in the development of the Cultural Heritage theme in EIAs. One purpose is to identify and discuss some conditions that can better environmental assessment in order to increase the significance of EIA in decision-making with regard to Cultural Heritage. The main tools used are different research methods designed for analyses of quality and quality changes, primarily based on the relevant opinions of 160 people occupied with Cultural Heritage in EIA in Norway. The study is based on a review of 40 types of EIAs from 1991 to 2000, an online questionnaire to 319 (160 responded) individuals from 14 different backgrounds, and interviews with three institutions in Sweden and Denmark. The study confirms a steadily increasing quality on EIRs over time, parallel with an improvement of the way in which Cultural Heritage is treated in EIA. This is supported by both the interviews and the qualitative comments regarding the survey. Potential for improvements is shown to be a need for more detailed background material as well as more use of adequate methods. The survey shows the existence of a wide variety of negative views, attitudes and beliefs, but the consequences of this are difficult to evaluate. However, most certainly, negative attitudes and beliefs have not been powerful enough to be detrimental to the quality of Cultural Heritage component, as nothing in the study indicates that negative attitudes and myths are undermining the system of EIA. The study shows the importance of having on-going discussions on quality and quality change over time by people involved in EIA, and how this is a necessary condition for successful implementation and acceptance. Beliefs and negative attitudes can also be a catalyst for developing better practice and advancing new methodology. In addition, new EIA countries must be prepared for several years

  9. Spin labels. Applications in biology

    International Nuclear Information System (INIS)

    The main applications of spin labels in the study of biomembranes, enzymes, nucleic acids, in pharmacology, spin immunoassay are reviewed along with the fundamentals of the spin label method. 137 references. (author)

  10. Use the Nutrition Facts Label (United States)

    ... Features Spokespeople News Archive eNewsletters Calendar Use the Nutrition Facts Label You can help your family eat ... to some of their favorite foods. Use the Nutrition Facts label found on food packages to make ...

  11. Labeling lake water with tritium (United States)

    Frederick, B.J.


    A method of packaging tritiated water in a manner that facilitates safe handling in environmental labeling operations, and procedures followed in labeling a large body of water with a small volume of tritiated water are described. ?? 1963.

  12. Ab initio valence calculations in chemistry

    CERN Document Server

    Cook, D B


    Ab Initio Valence Calculations in Chemistry describes the theory and practice of ab initio valence calculations in chemistry and applies the ideas to a specific example, linear BeH2. Topics covered include the Schrödinger equation and the orbital approximation to atomic orbitals; molecular orbital and valence bond methods; practical molecular wave functions; and molecular integrals. Open shell systems, molecular symmetry, and localized descriptions of electronic structure are also discussed. This book is comprised of 13 chapters and begins by introducing the reader to the use of the Schrödinge

  13. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    Energy Technology Data Exchange (ETDEWEB)

    Souto, F.J.; Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Kmetyk, L.N. [Sandia National Labs., Albuquerque, NM (United States)


    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS.

  14. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    International Nuclear Information System (INIS)

    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS

  15. Food Labels Tell the Story! (United States)

    ... My World From the Label to the Table! Food Labels Tell the Story! What is in food? Food provides your body with all of the ... your food choices. Nutrition Facts—the Labels on Food Products Beginning in 1994, the US government began ...

  16. Pre-targeted tumor imaging with avidin-McAb and 99Tcm-DTPA-Biotin

    International Nuclear Information System (INIS)

    Objective: Biotin-avidin is used as pre-targeting system (BAS) in radioimmunoimaging in order to decrease radiation background and dose associated with the use of directly labelled McAb. The authors tried to use 99Tcm to substitute 111In to label DTPA-biotin to evaluate the value of the 99Tcm-DTPA-biotin in BAS. Methods: DTPA-biotin solution was mixed with SnCl2 and then fresh eluted 99Tcm. The solution incubated for 10 min at room temperature. Mice bearing lung tumor (LA-795) with and without metastases in lung underwent 3-step pre-targeting test. Briefly, biotin-C50 was injected first, then avidin and 99Tcm-DTPA-biotin was respectively given 1 day, 2 days later. Directly labelled C50 with 99Tcm was used as control agent. Results: The labelling yield of 99Tcm-DTPA-biotin was over 90%. The amount of SnCl2 was the key feature in labelling. The tumor could be seen at 2 h after injection of 99Tcm-DTPA-biotin with γ camera in 3- step groups. The tracer uptake in tumor was (1.35 +- 0.45)% ID/g at 2 h after injection, Tumor/Blood (T/B) was 5.86, T/Muscle (T/M) was 8.43. In control group which received 99Tcm-DTPA-biotin only, the T/B was 0.85, T/M 1.1. For the directly labelled C50, the T/B was 1.65, T/M was 2.0 at 8 h after injection. Conclusion: Avidin-biotin pre-targeting system can be labelled with 99Tcm, and the BAS can image the tumor as early as 2 h after injection

  17. Isotopically labelled benzodiazepines

    International Nuclear Information System (INIS)

    This paper reports on the benzodiazepines which are a class of therapeutic agents. Improvements in the analytical methodology in the areas of biochemistry and pharmacology were significant, particularly in the application of chromatographic and spectroscopic techniques. In addition, the discovery and subsequent development of tritium and carbon-14 as an analytical tool in the biological sciences were essentially post-world war II phenomena. Thus, as these new chemical entities were found to be biologically active, they could be prepared in labeled form for metabolic study, biological half-life determination (pharmacokinetics), tissue distribution study, etc. This use of tracer methodology has been liberally applied to the benzodiazepines and also more recently to the study of receptor-ligand interactions, in which tritium, carbon-11 or fluorine-18 isotopes have been used. The history of benzodiazepines as medicinal agents is indeed an interesting one; an integral part of that history is their use in just about every conceivable labeled form

  18. Nomenclature for labelled compounds

    International Nuclear Information System (INIS)

    This paper report on isotopically labelled compounds. The first indexing system for isotopically labelled organic compounds is generally credited to Boughton and named after him. An extension of his principles for designating compounds containing hydrogen isotopes has been part of the Chemical Abstracts Service index nomenclature system for many years. After close on five years labor the IUPAC sponsored Commission on Nomenclature of Organic Chemistry presented in 1979 their findings on Isotopically Modified Compounds. The system codified in their rules provides for recognition of various types of isotopic modification and is therefore of more general applicability. Concurrently the rules for the nomenclature of isotopically modified inorganic compounds are developed. These are to be seen as supplementing and extending the guidelines laid down in the IUPAC Inorganic Nomenclature Rules already published

  19. Improved age constraints for the AB Dor quadruple system - The binary nature of AB Dor B

    CERN Document Server

    Janson, M; Lenzen, R; Close, L; Nielsen, E; Hartung, M; Henning, T; Bouy, H; Janson, Markus; Brandner, Wolfgang; Lenzen, Rainer; Close, Laird; Nielsen, Eric; Hartung, Markus; Henning, Thomas; Bouy, Herve


    We present resolved NACO photometry of the close binary AB Dor B in H- and Ks-band. AB Dor B is itself known to be a wide binary companion to AB Dor A, which in turn has a very low-mass close companion named AB Dor C. These four known components make up the young and dynamically interesting system AB Dor, which will likely become a benchmark system for calibrating theoretical pre-main sequence evolutionary mass tracks for low-mass stars. However, for this purpose the actual age has to be known, and this subject has been a matter of discussion in the recent scientific literature. We compare our resolved photometry of AB Dor Ba and Bb with theoretical and empirical isochrones in order to constrain the age of the system. This leads to an age estimate of about 50 to 100 Myr. We discuss the implications of such an age range for the case of AB Dor C, and compare with other results in the literature.

  20. Environmental impact assessment (EIA) in development cooperation. A presentation of development challenges and research issues in developing countries and donor agencies

    Energy Technology Data Exchange (ETDEWEB)

    Kristoffersen, Harald


    This document discusses some development challenges and research needs related to environmental impact assessment (EIA) in development cooperation. After a general introduction to basic principles of EIA, the document deals with some general conditions for EIA in developing countries and in donor agencies. Through a presentation of experiences with EIA from selected donor agencies (with emphasis on NORAD) the report ends up with focusing on some research issues that may come up with recommendations for improving EIA practices in developing countries and donor agencies. 37 refs., 6 figs., 3 refs.

  1. Labelling, Deviance and Media


    Greer, C.


    Labelling theory is a perspective that emerged as a distinctive approach to criminology during the 1960s, and was a major seedbed of the radical and critical perspectives that became prominent in the 1970s. It represented the highpoint of an epistemological shift within the social sciences away from positivism – which had dominated criminological enquiry since the late-1800s – and toward an altogether more relativistic stance on the categories and concepts of crime and control. It inspired a ...

  2. Eco-labelling


    Kuna-Marszałek, Anetta


    Considering environmental protection requirements in business operations may, in the long run, determine if a lasting comparative advantage can be achieved. That is why our textbook, rich in case studies, identifies not only the threats a business may pose to the environment but stresses the ways of reducing its negative impact. It discusses, among other things, the concept of corporate social responsibility, environmental management systems, methods and the importance of eco-labelling goods ...

  3. Myocardial arterial spin labeling


    Kober, Frank; Jao, Terrence; Troalen, Thomas; Nayak, Krishna S.


    Arterial spin labeling (ASL) is a cardiovascular magnetic resonance (CMR) technique for mapping regional myocardial blood flow. It does not require any contrast agents, is compatible with stress testing, and can be performed repeatedly or even continuously. ASL-CMR has been performed with great success in small-animals, but sensitivity to date has been poor in large animals and humans and remains an active area of research. This review paper summarizes the development of ASL-CMR techniques, c...

  4. Radioimmunotherapy of infection with 213Bi-labeled antibodies


    Dadachova, Ekaterina


    Bismuth-213 (213Bi) (physical half-life 46 min) is a beta-emitter (97%) and an alpha-emitter (3%) which decays to short lived alpha-emitter Polonium-213 and could therefore be used as an in vivo generator of alpha particles with the energy of around 8 MeV. 213Bi has been successfully used during the last decade in both clinical and pre-clinical work for radioimmunotherapy (RIT) of cancer with 213Bi-labeled monoclonal antibodies (mAbs). RIT has been proposed as a novel techonology for treatmen...

  5. Experimental and ab initio study of the photofragmentation of DNA and RNA sugars

    International Nuclear Information System (INIS)

    The photoelectron-photoion-photoion coincidence method is used to measure the photodissociation of doubly charged D-ribose (C5H10O5), the RNA sugar molecules, and 2-deoxy-D-ribose (C5H10O4), the DNA sugar molecules, following normal Auger decay after initial C 1s and O 1s core ionizations. The fragment identification is facilitated by measuring isotopically labeled D-ribose, such as D-ribose deuterated at C(1), and with 13C at the C(5) position. Ab initio quantum chemistry calculations are used to gain further insight into the abundant appearance of the CHO+ fragment.

  6. 188Re-labelled anti-CD20 monoclonal antibody: Labelling and quality control studies

    International Nuclear Information System (INIS)

    Immunotherapy with human chimeric antibody rituximab (Rituxan, IDEC pharmaceuticals) has been a major advance in treatments of patients with CD20-positive B-cell non Hodgkin's lymphoma (NHL). Radioimmunotherapy (RIT) uses the targeting features of monoclonal antibody to deliver radiation from an attached readionuclide and it is an appeling concept that has received widespread attention. Here, we report our experience using rhenium-188 (188Re)- radiolabeled chimeric anti-CD20 antibody (rituximab). A stable antibody-labeling technique had been developed for 188Re. The 188Re-direct labeling of anti-CD20 monoclonal antibody, the methods for quality control: paper chromatography, instant thin layer chromatographysilica gel (ITLC-SG) and HPLC technique, the immunoreactivity and biological recognition of the target antigen assessment of the radiolabeled molecule, in vitro stability and the assessment of in vivo stability through biodistribution studies in normal WISTAR rats are described. For the direct radiolabeling, the reduction of monoclonal antibody (mAb) was performed with 2-mercaptoethanol (2-ME), based on Schwarz's method at a molar ratio 2000:1 (2- ME:mAb). By means of this method some of the disulfide bonds of the antibody are reduced to sulfhydryl groups (we obtained 4-5 groups) and these groups provide sites for the formation of very strong bond between the reduced rhenium and the antibody. The methodology used in this work has been tested in a phase I radioimmunotherapy clinical trial using the humanized mAb hR3 for loco-regional treatment of brain tumours. The labeling efficiency (> 95 %) of this method showed that the final product needs no further purification for clinical purposes (low level formation of colloidal species). In vitro stability studies of the labeled anti-CD20 were performed at room temperature at 4 h, 24 h and 48 h in cysteine, human serum and saline. In the presence of normal human serum, during the first 4h, transchelation of about 15

  7. Ab interno trabeculectomy: A comprehensive review

    Directory of Open Access Journals (Sweden)

    Ting Ting Liu


    Full Text Available PURPOSE To summarize the original literature on ab interno trabeculectomy with the Trabectome system and to review its efficacy and safety in the treatment of glaucoma. METHOD A literature search in PubMed was performed on ab interno trabeculectomy with the Trabectome system, and clinical relevant information was reviewed and summarized. RESULTS Ab interno trabeculectomy with the Trabectome system on average lowered intraocular pressure (IOP to the mid-teens, and decreased the number of required glaucoma medications. Greater preoperative IOP correlated to a greater percent reduction in IOP. The success rates varied among studies, and the definition of success differed by authors. Intraoperative blood reflux was found in nearly all cases. Incidences of early hypotony and IOP spikes were low. No cases of endophthalmitis, wound leak, aqueous misdirection, choroidal hemorrhage or effusions, and irreversible visual acuity decrease (≥2 Snellen lines have been reported. Available studies had a significant amount of data overlap. Only limited data on long-term results was available. There was no randomized controlled trial to date. CONCLUSIONS Ab interno trabeculectomy with the Trabectome system is an effective and safe surgical approach for patients with various types of open angle glaucoma. On average, the procedure at least in the short term lowers IOP to the mid teens regardless of preoperative IOP with or without the aid of topical medications.

  8. Reference: DREDR1ATRD29AB [PLACE

    Lifescience Database Archive (English)

    Full Text Available DREDR1ATRD29AB Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, N... ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590; ...

  9. Preparation of national standard product of Anti-TgAb and Anti-TpoAb in our laboratory

    International Nuclear Information System (INIS)

    Objective: To standardize the China-made quantitative immunoassay kits of Anti-TgAb and Anti-TpoAb with a national standdized product of Anti-TgAb and And-TpoAb developed in our laboratory. Methods and Results: Higher titer Anti - TgAb and Anti-TpoAb serum specimens were pooled and treated with centrifuging and filtering, then freeze-dried and packaged into 2ml anpoules for preparing the national standard candidate. The results of the collaborative study showed that, the immuno-activity of the Anti-TgAb was 3916 IU/Amp in term of the 65/093, and the immuno-activity of the Anti-TpoAb was 434 IU/Amp in term of the 66/387. Conclusion: On the basis of the present study, it is proposed that the candidate standard be established as the National Standard for Anti-TgAb and Anti-TpoAb for immunoassay, the immunoactivity of the Anti-TgAb 4000IU/Amp, and that of Anti - TpoAb is 430IU/Amp. A comparative study on the quality of immunoassay kits of Anti-TgAb and Anti-TpoAb by Axsym System, Immulite 1000, Modular Analytics El70, ADVIA Centaur Assay (the most commonly used types in China) is also presented. (authors)

  10. Mandated monitoring of post-project impacts in the Czech EIA

    International Nuclear Information System (INIS)

    Altogether, 801 documents of consent (50% of all) issued under the EIA Act No. 244/1992 by the competent authorities in the Czech Republic between 1993 and 2001 were studied. The aim of the analysis was to find and characterize conditions prescribing to the developer to perform ex-ante and ex-post monitoring of potential impacts of projects submitted for approval. It was found that each of the studied documents (standpoints) contained on average three to four conditions prescribing to collect data on various environmental factors during the preparation, implementation and/or operation phase of the development in question. The number of monitoring conditions contained in the standpoints issued by the Ministry of Environment as well as by the District Offices increased during the period studied from about two to five per project indicating a growing interest in and/or need to obtaining such data. Even though there is a good legal background for collecting monitoring data from implementation and operation phase of new developments, the Czech EIA Act (similarly as EIA acts in other countries) does not provide any practical background for this activity. Without relevant institutional, personal and financial support the possibility to impose post-project monitoring to the developer remains rather a challenge to, not advantage of the Czech EIA Act

  11. 30 CFR 250.227 - What environmental impact analysis (EIA) information must accompany the EP? (United States)


    ... harvest practices, recreation, recreational and commercial fishing (including typical fishing seasons... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What environmental impact analysis (EIA... and Information Contents of Exploration Plans (ep) § 250.227 What environmental impact analysis...

  12. Implementing the Espoo Convention in transboundary EIA between Germany and Poland

    International Nuclear Information System (INIS)

    Poland and Germany have a long common border which leads to the necessity to cooperate and consult each other in the case of large-scale projects or infrastructure measures likely to cause negative transboundary effects on the environment. There are already binding provisions for transboundary EIA. In the area of the UN Economic Commission for Europe (UNECE), transboundary EIA is intended to be legally binding for the Member States by the Espoo Convention which was ratified by Germany 8.8.2002 and by Poland 12.6.1997. Due to corresponding directives, the same is applicable in the context of the European Union. In German legislation, this issue is regulated by Art. 8 of the Federal EIA Act in regard to transboundary participation of administration and by Art. 9a in respect of transboundary public participation. However, these EIA regulations on transboundary participation do not surpass a certain detail level, as they have to be applied between Germany and all neighbouring states. Therefore both countries decided to agree on more detailed provisions in particular regarding procedural questions. During the 12th German-Polish Environmental Council, Germany and Poland reached an agreement on 11.4.2006 in Neuhardenberg/Brandenburg an agreement upon the implementation of the Espoo Convention, the so called Neuhardenberg Agreement. This article assesses the agreement under consideration of already existing law and discusses major improvements and problems

  13. 77 FR 35408 - Proposed Collection; Comment Request: Process Evaluation of the Early Independence Award (EIA... (United States)


    ... HUMAN SERVICES National Institutes of Health Proposed Collection; Comment Request: Process Evaluation of... approval. Proposed Collection: Title: Process Evaluation of the Early Independence Award (EIA) Program... Independence Principal 12 1 60 12 Investigator (phone interview--end of 1st year of award)...

  14. Direct labelling of monoclonal antibodies with 99Tcm. Assessment of labelling, stability, immunoreactivity and biodistribution

    International Nuclear Information System (INIS)

    Reduction of disulfide bonds to sulfhydryl groups for direct radiolabelling of monoclonal antibodies for immunoscintigraphic application continues to be of significant interest. Reducing agents that have been used are the following: stannous ion, 2-mercaptoethanol, dithiothreitol, dithioerythriol, and ascorbic acid. The radiolabelling of the reduced and purified antibody is performed via Sn2+ reduction of pertechnetate in the presence of an excess of a low-affinity chelating ligand. In a recent work the 2-mercaptoethanol (2-ME) reduction based method was studied by using different analytical and biological techniques. Human IgG (Sandoglobulin), anti-CEA MoAb (ior-1), and anti-granulocyte MoAb (MAK 47), were reduced with 2-ME at two different molar ratios. To determine the amount of contaminating mercaptoethanol which may have survived the gel-filtration step 14C-ME was used. The number of the free endogenous sulfhydryl groups generated by reduction was determined by Ellman's reagent; absorbance was measured at 412 nm. Within the quality assurance procedure of the 3 freeze dried kits the labelling efficiency, stability, pH, sterility, apyrogenicity, vial yield, syringe retention, filterable activity, free SH determination and animal distribution were studied again. After receiving permission from local ethics committee pilot human studies were initiated. Study protocols were also approved

  15. Linerless label device and method

    KAUST Repository

    Binladen, Abdulkari


    This apparatus and method for applying a linerless label to an end user product includes a device with a printer for printing on a face surface of a linerless label, and a release coat applicator for applying a release coat to the face surface of the label; another device including an unwinder unit (103) to unwind a roll of printed linerless label; a belt (108); a glue applicator (102) for applying glue to the belt; a nip roller (106) for contacting and applying pressure to the face surface of the linerless label such that the glue on the belt transfers to the back surface of the linerless label; at least one slitting knife 105) positioned downstream the belt and a rewinder unit (104) positioned downstream the slitting knife; and a third device which die cuts and applies the linerless label to an end user object.

  16. Label-Guided Graph Exploration with Adjustable Ratio of Labels

    CERN Document Server

    Zhang, Meng; Tang, Jijun


    The graph exploration problem is to visit all the nodes of a connected graph by a mobile entity, e.g., a robot. The robot has no a priori knowledge of the topology of the graph or of its size. Cohen et al. \\cite{Ilcinkas08} introduced label guided graph exploration which allows the system designer to add short labels to the graph nodes in a preprocessing stage; these labels can guide the robot in the exploration of the graph. In this paper, we address the problem of adjustable 1-bit label guided graph exploration. We focus on the labeling schemes that not only enable a robot to explore the graph but also allow the system designer to adjust the ratio of the number of different labels. This flexibility is necessary when maintaining different labels may have different costs or when the ratio is pre-specified. We present 1-bit labeling (two colors, namely black and white) schemes for this problem along with a labeling algorithm for generating the required labels. Given an $n$-node graph and a rational number $\\rh...

  17. On the Strain Rate Sensitivity of Abs and Abs Plus Fused Deposition Modeling Parts (United States)

    Vairis, A.; Petousis, M.; Vidakis, N.; Savvakis, K.


    In this work the effect of strain rate on the tensile strength of fused deposition modeling parts built with Acrylonitrile-butadiene-styrene (ABS) and ABS plus material is presented. ASTM D638-02a specimens were built with ABS and ABS plus and they were tested on a Schenck Trebel Co. tensile test machine at three different test speeds, equal, lower, and higher to the test speed required by the ASTM D638-02a standard. The experimental tensile strength results were compared and evaluated. The fracture surfaces of selected specimens were examined with a scanning electron microscope, to determine failure mode of the filament strands. It was found that, as the test speed increases, specimens develop higher tensile strength and have higher elastic modulus. Specimens tested in the highest speed of the experiment had on average about 10% higher elastic modulus and developed on average about 11% higher tensile strength.


    Institute of Scientific and Technical Information of China (English)

    Min-qiang Yu; Zhi-ping Zhou; De-yue Yan


    This work deals with the kinetics of co-condensation polymerization of AB2 and AB monomers, giving expressions of the two-dimensional molecular weight distribution function and the number/weight average molecular weights of the resulting copolymers. The two-dimensional molecular weight distribution depends on two indices, n and l, which are the respective numbers of AB2 and AB units in a copolymer species. The evolution of the two-dimensional weight and z distributions during the co-condensation polymerization has been evaluated systematically. Finally, the two-dimensional distribution was transformed into a one-dimensional molecular weight distribution with only one variable (the molecular weight of the products instead of the degree of polymerization). The calculated results show that the highly branched copolymer has a very broad molecular weight distribution when the co-condensation polymerization approaches completion.

  19. Leaching behaviour of the Swedish KBS-glasses ABS 39 and ABS 41

    International Nuclear Information System (INIS)

    The planned Swedish KBS glass corrosion investigation program comprises experiments with inactive glasses containing simulated waste, prolonged in-situ tests, the characterization of corrosion products, immiscibility studies, and corrosion experiments with hot glass. This presentation gives a short description of the entire program. It focuses thereafter on some recent leaching results with the inactive KBS glass qualities ABS 39 and ABS 41, which were leached in a manner similar to the PNL MCC-1 test procedure. 5 figures, 9 tables

  20. Thermomechanical properties of ABS/PA AND ABS/PC blends


    GUINAULT, Alain; Sollogoub, Cyrille


    International audience The significant increase of Waste Electric and Electronic Equipment (WEEE) has led to an important research in upgrading recycled engineering plastics by means of a blending technique. Classical twin-screw extrusion is compared to a new blending technique, where two polymers are combined together and then flow in several static mixers. This technique allows to obtain different morphologies of compatibilized ABS/PA or ABS/PC blends and the aim of this work is to evalu...

  1. AB077. Relationship of TPO-Ab and TSH with in vitro fertilization and embryo transfer


    Wang, Liyun


    Objective Study of thyroid peroxidase antibodies and thyroid stimulating effect on in vitro fertilization embryo transfer ending. Methods From March 2011 to October 2013 in the reproductive center in Qinghai Province People’s Hospital in vitro fertilization embryo transfer a total of 378 cycles were analyzed. (I) Basis for TPO-Ab grouping: research group is thyroid peroxidase antibody positive and thyroid function in patients with normal 69 cycles (TPO-Ab+ group), control group is thyroid per...

  2. A quantitative method to analyze the quality of EIA information in wind energy development and avian/bat assessments

    International Nuclear Information System (INIS)

    The environmental impact assessment (EIA) has been a tool for decision makers since the enactment of the National Environmental Policy Act (NEPA). Since that time, few analyses have been performed to verify the quality of information and content within EIAs. High quality information within assessments is vital in order for decision makers, stake holders, and the public to understand the potential impact of proposed actions on the ecosystem and wildlife species. Low quality information has been a major cause for litigation and economic loss. Since 1999, wind energy development has seen an exponential growth with unknown levels of impact on wildlife species, in particular bird and bat species. The purpose of this article is to: (1) develop, validate, and apply a quantitative index to review avian/bat assessment quality for wind energy EIAs; and (2) assess the trends and status of avian/bat assessment quality in a sample of wind energy EIAs. This research presents the development and testing of the Avian and Bat Assessment Quality Index (ABAQI), a new approach to quantify information quality of ecological assessments within wind energy development EIAs in relation to avian and bat species based on review areas and factors derived from 23 state wind/wildlife siting guidance documents. The ABAQI was tested through a review of 49 publicly available EIA documents and validated by identifying high variation in avian and bat assessments quality for wind energy developments. Of all the reviewed EIAs, 66% failed to provide high levels of preconstruction avian and bat survey information, compared to recommended factors from state guidelines. This suggests the need for greater consistency from recommended guidelines by state, and mandatory compliance by EIA preparers to avoid possible habitat and species loss, wind energy development shut down, and future lawsuits. - Highlights: ► We developed, validated, and applied a quantitative index to review avian/bat assessment quality

  3. Anti-CEA monoclonal antibody: technetium-99m labeling and the validation process of a scintigraphic animal model with a non-cellular antigenic implant. (United States)

    Sapienza, Marcelo Tatit; Marques, Fabio Luiz Navarro; Okamoto, Miriam Roseli Yoshie; Hironaka, Fausto Haruki; Buchpiguel, Carlos Alberto


    Animal models are currently used to verify the biodistribution of different radiopharmaceuticals before its clinical application in Nuclear Medicine; however, there may be some limitations. The utilization of labelled anti-tumor monoclonal antibodies (MoAb) in experimental models often requires implant of human antigens (usually a cellular implant), which cannot be achieved in immunocompetent animals. Our purpose was to label an anti-CEA MoAb with technetium-99m (99Tc) and to validate a simplified animal model using a noncellular antigenic implant. MoAb was directly labelled with 99mTc, after reduction with 2-mercaptoethanol. Labeling efficiency was checked by ascending chromatography and immunoreactive fraction was measured in plastic wells sensitized with the antigen. Radiopharmaceutical biodistribution was evaluated by dissection and scintigraphy in 5 mice groups; following the subcutaneous administration of Al(OH)3, CEA adsorbed Al(OH)2 and a control group evaluation. Labeling efficiency was 94+/-3%, which showed to be stable for 24 hr, with immunoreactive fraction above 50%. Invasive biodistribution evaluation showed prolonged blood retention, hepatic and renal uptake. A significant increase in uptake was observed in scintigraphic studies of animals with CEA-adsorbed Al(OH)3 implants compared with the other groups (p<0.05). The non-cellular antigenic implant model simplifies the pre-clinical evaluation of labelled MoAb. PMID:12146705

  4. Labelled compounds. (Pt. B)

    International Nuclear Information System (INIS)

    Since the end of World War II there has been a tremendous increase in the number of compounds that have been synthesized with radioactive or stable isotopes. They have found application in many diverse fields, so much so, that hardly a single area in pure and applied science has not benefited. Not surprisingly it has been reflected in appearance of related publications. The early proceedings of the Symposia on Advances in Trace Methodology were soon followed by various Euratom sponsored meetings in which methods of preparing and storing labelled compounds featured prominently. In due course a resurgence of interest in stable isotopes, brought about by their greater availability (also lower cost) and partly by development of new techniques such as gas chromatography - mass spectrometry (gc-ms), led to the publication of proceedings of several successful conferences. More recently conferences dealing with the synthesis and applications of isotopes and isotopically labelled compounds have been established on a regular basis. In addition to the proceedings of conferences and journal publications individuals left their mark by producing definitive texts, usually on specific nuclides. Only the classic two volume publication of Murray and Williams (Organic syntheses with isotopes, New York 1985), now over 30 years old and out of print, attempted to do justice to several nuclides. With the large amount of work that has been undertaken since then it seems unlikely that an updated edition could be produced. The alternative strategy was to ask scientists currently active to review specific areas and this is the approach adopted in the present series of monographs. In this way it is intended to cover the broad advances that have been made in the synthesis and applications of isotopes and isotopically labelled compounds in the physical and biomedical sciences. (author). refs.; figs.; tabs

  5. Waisda?: video labeling game


    Hildebrand, Michiel; Brinkerink, M.; Gligorov, R.; Steenbergen, Van; Huijkman, J.; Oomen, J.


    The Waisda? video labeling game is a crowsourcing tool to collect user-generated metadata for video clips. It follows the paradigm of games-with-a-purpose, where two or more users play against each other by entering tags that describe the content of the video. Players score points by entering the same tags as one of the other players. As a result each video that is played in the game is annotated with tags that are anchored to a time point in the video. Waisda? has been deployed in two projec...

  6. From Label to Practice

    DEFF Research Database (Denmark)

    Byrkjeflot, Haldor; Strandgaard, Jesper; Svejenova, Silviya


    This article examines the process of creation of new Nordic cuisine (NNC) as a culinary innovation, focusing on the main stages, actors, and mechanisms that shaped the new label and its practices and facilitated its diffusion in the region and internationally. Fast-paced diffusion was possible...... because NNC was conceived as an identity movement, triggered by active involvement of entrepreneurial leaders from the culinary profession, high-profile political supporters, legitimating scientists, disseminating media, and interpreting audiences. It was facilitated by three mechanisms: First, the use of...

  7. Labeled bile acids

    International Nuclear Information System (INIS)

    A general short procedure for the introduction of 13C to the side chain of bile acids is described. Suitable (Z)-pregn-17(20)-enes are key intermediates, while the isotope is introduced by an ene reaction with [1,2,3-13C3]-methyl propiolate. For the labeling with tritium, the unlabeled product of the ene synthesis, a Δsup(5,16,22)-triene was saturated selectively at 16,17 and 22,23 with tritium gas. (author)

  8. A Food Labeling (United States)

    ... " ﻗﺎﻧﻮن اﻟﺒﻄﺎﻗﺎت واﻟﺘﻮﻋﻴﺔ اﻟﻐﺬاﺋﻴﺔ " [ Nutrition Labeling and Education Act ... ﻟﻠﻌﺼﻴﺮ اﻟﻤﻜﻮن ﺑﺈﺿﺎﻓﺔ اﻟﻤﺎء إﻟﻰ ﺧﻼﺻﺔ ﻣﺮآﺰة : ﻳﺠﺮى اﻟﺤﺴﺎب ﻣﻦ ﺟﺪول Brix ﻓﻲ 21 CFR 101.30(h)(1) ...

  9. Towards Multi Label Text Classification through Label Propagation

    Directory of Open Access Journals (Sweden)

    Shweta C. Dharmadhikari


    Full Text Available Classifying text data has been an active area of research for a long time. Text document is multifaceted object and often inherently ambiguous by nature. Multi-label learning deals with such ambiguous object. Classification of such ambiguous text objects often makes task of classifier difficult while assigning relevant classes to input document. Traditional single label and multi class text classification paradigms cannot efficiently classify such multifaceted text corpus. Through our paper we are proposing a novel label propagation approach based on semi supervised learning for Multi Label Text Classification. Our proposed approach models the relationship between class labels and also effectively represents input text documents. We are using semi supervised learning technique for effective utilization of labeled and unlabeled data for classification. Our proposed approach promises better classification accuracy and handling of complexity and elaborated on the basis of standard datasets such as Enron, Slashdot and Bibtex.

  10. 76 FR 3584 - Disclosure of Cochineal Extract and Carmine in the Labeling of Wines, Distilled Spirits, and Malt... (United States)


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF THE TREASURY Alcohol and Tobacco Tax and Trade Bureau 27 CFR Parts 5 RIN 1513-AB79 Disclosure of Cochineal Extract and Carmine in the Labeling of Wines, Distilled Spirits, and Malt Beverages Correction In proposed...

  11. CNN: Single-label to Multi-label


    Wei, Yunchao; Xia, Wei; Huang, Junshi; Ni, Bingbing; Dong, Jian; Zhao, Yao; Yan, Shuicheng


    Convolutional Neural Network (CNN) has demonstrated promising performance in single-label image classification tasks. However, how CNN best copes with multi-label images still remains an open problem, mainly due to the complex underlying object layouts and insufficient multi-label training images. In this work, we propose a flexible deep CNN infrastructure, called Hypotheses-CNN-Pooling (HCP), where an arbitrary number of object segment hypotheses are taken as the inputs, then a shared CNN is...

  12. Label and Label-Free Detection Techniques for Protein Microarrays

    Directory of Open Access Journals (Sweden)

    Amir Syahir


    Full Text Available Protein microarray technology has gone through numerous innovative developments in recent decades. In this review, we focus on the development of protein detection methods embedded in the technology. Early microarrays utilized useful chromophores and versatile biochemical techniques dominated by high-throughput illumination. Recently, the realization of label-free techniques has been greatly advanced by the combination of knowledge in material sciences, computational design and nanofabrication. These rapidly advancing techniques aim to provide data without the intervention of label molecules. Here, we present a brief overview of this remarkable innovation from the perspectives of label and label-free techniques in transducing nano‑biological events.

  13. Radioimmunoimaging of human colon carcinoma xenografts in nude mice with 111In-labelled monoclonal antibody

    International Nuclear Information System (INIS)

    A nude mouse model bearing human colon carcinoma xenograft from human fresh surgical specimens was established. The anti-colon carcinoma monoclonal antibody 2C10 was labelled with 111In using bifunctional chelating agent DTPA. The labelled antibodies were injected intraperitoneally into the tumor-bearing mice. The tissue distribution of labelled antibody was studied and whole body scintigraphies were obtained with a γ camera at different times. 96 hours after administration, the tumor to muscle ratio was 10.48, tumor to blood ratio 3.94 and tumor to liver ratio 1.58. There were significant difference in T/N ratio between animals receiving the specific antibody and labelled unrelated mouse IgG. Imaging showed clear tumor pictures in all animals receiving the specific McAb, while the two animals receiving unrelated mouse IgG showed negative imaging

  14. Genetics Home Reference: GM2-gangliosidosis, AB variant (United States)

    ... of GM2-gangliosidosis, AB variant: Genetic Testing Registry: Tay-Sachs disease, variant AB These resources from MedlinePlus offer ... AB variant Activator Deficiency/GM2 Gangliosidosis Activator-deficient Tay-Sachs disease GM2 Activator Deficiency Disease GM2 gangliosidosis, type ...

  15. Investigation of high level of AsAb, EmAb in fertility female serum infected by chlamydia trachomatis

    International Nuclear Information System (INIS)

    Objective: To investigate the mechanism of chlamydia trachomatis. AsAb, EmAb in female fertility. Methods: LPS antigen of chlamydia in reproduction tract of fertility female was detected by monoclonal antibody and immunology chromatography; the content of AsAb, EmAb in serum of fertility female was detected by ELISA. Results: Infections rate of chlamydia trachomatis in fertility female was higher than that in the control AsAb, EmAb in serum of the fertility patients who were infected with chlamydia trachomatis showed a significant difference from that in the control group. Conclusion: The level of AsAb, EmAb increases in patients who have been infected with chlamydia trachomatis and these cytokines is involved in the course of female fertility

  16. Modeling the effects of labeling

    DEFF Research Database (Denmark)

    Juhl, Hans Jørn; Fjord, Thomas Ahle; Poulsen, Carsten Stig

    A new approach to evaluate the consequences of labeling is presented and applied to test the potential effect of a label on fresh fish. Labeling effects on quality perceptions and overall quality are studied. The empirical study is based on an experimental design and nearly 500 respondents partic...... participated in an in home test. The results indicate that catch time alone is not enough to work as an efficient predictor of actual perceived quality.......A new approach to evaluate the consequences of labeling is presented and applied to test the potential effect of a label on fresh fish. Labeling effects on quality perceptions and overall quality are studied. The empirical study is based on an experimental design and nearly 500 respondents...

  17. Edge colouring by total labellings

    DEFF Research Database (Denmark)

    Brandt, Stephan; Rautenbach, D.; Stiebitz, M.;


    We introduce the concept of an edge-colouring total k-labelling. This is a labelling of the vertices and the edges of a graph G with labels 1, 2, ..., k such that the weights of the edges define a proper edge colouring of G. Here the weight of an edge is the sum of its label and the labels of its...... two endvertices. We define χ (G) to be the smallest integer k for which G has an edge-colouring total k-labelling. This parameter has natural upper and lower bounds in terms of the maximum degree Δ of G : ⌈ (Δ + 1) / 2 ⌉ ≤ χ (G) ≤ Δ + 1. We improve the upper bound by 1 for every graph and prove χ (G...

  18. Ab initio mass tensor molecular dynamics


    Tsuchida, Eiji


    Mass tensor molecular dynamics was first introduced by Bennett [J. Comput. Phys. 19, 267 (1975)] for efficient sampling of phase space through the use of generalized atomic masses. Here, we show how to apply this method to ab initio molecular dynamics simulations with minimal computational overhead. Test calculations on liquid water show a threefold reduction in computational effort without making the fixed geometry approximation. We also present a simple recipe for estimating the optimal ato...

  19. Discovering chemistry with an ab initio nanoreactor


    Wang, Lee-Ping; Titov, Alexey; McGibbon, Robert; Liu, Fang; Pande, Vijay S.; Martínez, Todd J.


    Chemical understanding is driven by the experimental discovery of new compounds and reactivity, and is supported by theory and computation that provides detailed physical insight. While theoretical and computational studies have generally focused on specific processes or mechanistic hypotheses, recent methodological and computational advances harken the advent of their principal role in discovery. Here we report the development and application of the ab initio nanoreactor – a highly accelerat...

  20. Ab initio vel ex eventu. II (United States)

    Thiessen, P. A.; Treder, H.-J.

    Jedes initium wird durch experimenta crucis zum eventus. Jedes theoretisch interpretierbare ex-eventu-Resultat führt auf ein neues Initium. Gerade dies ist die gemeinsame Aussage von Atomistik, Quantenmechanik und Relativitätstheorie.Translated AbstractAb initio vel ex eventu. IIEvery initium becomes an eventus by experimenta crucis. Every theoretically interpretable ex-eventu result leads to a new initium. Right this is the joint assertion of atomism, quantum mechanics, and relativity.

  1. p-carboxyethyl-phenylglyoxal bis(n-methylthiosemicarbazone) (CE-DTS), a bifunctional chelating agent for Tc-99m labeled monoclonal antibody

    International Nuclear Information System (INIS)

    In the search for bifunctional chelating agents (BCA) with better affinity, selectivity and stability as for Tc-99m, synthesis of a novel BCA containing di-thio-semicarbazone as for Tc-99m chelating site has offered interesting characteristics for the labeling of macromolecules. In the present paper, monoclonal IgG (MoAb) against human thyroglobulin was selected as a model and conditions for coupling, labeling reactions were tested along with immunological reactivity. CE-DTS was coupled to MoAb by the azido method and effect of conjugation on the MoAb immunoreactivity was followed by RIA. When CE-DTS was coupled to MoAb at the molar ratio of 1:1, no loss of its original immunoreactivity was observed. Tc-99m labeling, using the stannous ion reducing method, indicated the reaction pH as being a determinant parameter. The reducing agent prepared in tartrate buffer (pH 3) offered high yield and stable Tc-99m-CE-DTS-MoAb, as evidence by HPLC. In vivo studies in mice indicated percent of injected dose and blood clearance alike the I-131-MoAb. This good labeled state of Tc-99m-CE-DTS-MoAb was also demonstrated by using second antibody reaction in serum of mice. The newly synthesized CE-DTS offered good basis for the Tc-99m labeling of monclonal antibodies with preserved immunological properties, as desirable for the radioimmunodetection. Work with tumor related monoclonal antibodies is under progress

  2. Aggregating Labels in Crowdsourcing Data


    Priisalu, Maria; Grey, Francois; Segal, Ben


    Project Specification Crowdsourcing is gaining popularity in academia with the launch of crowdsourcing platforms such as Crowdcrafting [Lombraña, 2015] and GeoTagX [UNOSAT, 2015]. There have been a number of proposed algorithms for the aggregation of true labels and a confusion matrix from crowdsourced labels for ordinal, nominal and binary labels. The work here consists of an implementation of the Dawid Skene [Dawid 1979] adaptation of the Expectation Maximization algorithm [D...

  3. Classification and Labelling for Biocides


    Rubbiani, Maristella


    CLP and biocides The EU Regulation (EC) No 1272/2008 on Classification, Labelling and Packaging of Substances and Mixtures, the CLP-Regulation, entered into force on 20th January, 2009. Since 1st December, 2010 the classification, labelling and packaging of substances has to comply with this Regulation. For mixtures, the rules of this Regulation are mandatory from 1st June, 2015; this means that until this date classification, labelling and packaging could either be carried out according to D...

  4. Co-Labeling for Multi-View Weakly Labeled Learning. (United States)

    Xu, Xinxing; Li, Wen; Xu, Dong; Tsang, Ivor W


    It is often expensive and time consuming to collect labeled training samples in many real-world applications. To reduce human effort on annotating training samples, many machine learning techniques (e.g., semi-supervised learning (SSL), multi-instance learning (MIL), etc.) have been studied to exploit weakly labeled training samples. Meanwhile, when the training data is represented with multiple types of features, many multi-view learning methods have shown that classifiers trained on different views can help each other to better utilize the unlabeled training samples for the SSL task. In this paper, we study a new learning problem called multi-view weakly labeled learning, in which we aim to develop a unified approach to learn robust classifiers by effectively utilizing different types of weakly labeled multi-view data from a broad range of tasks including SSL, MIL and relative outlier detection (ROD). We propose an effective approach called co-labeling to solve the multi-view weakly labeled learning problem. Specifically, we model the learning problem on each view as a weakly labeled learning problem, which aims to learn an optimal classifier from a set of pseudo-label vectors generated by using the classifiers trained from other views. Unlike traditional co-training approaches using a single pseudo-label vector for training each classifier, our co-labeling approach explores different strategies to utilize the predictions from different views, biases and iterations for generating the pseudo-label vectors, making our approach more robust for real-world applications. Moreover, to further improve the weakly labeled learning on each view, we also exploit the inherent group structure in the pseudo-label vectors generated from different strategies, which leads to a new multi-layer multiple kernel learning problem. Promising results for text-based image retrieval on the NUS-WIDE dataset as well as news classification and text categorization on several real-world multi

  5. Highly scalable Ab initio genomic motif identification

    KAUST Repository

    Marchand, Benoît


    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  6. Labelled molecules, modern research implements

    International Nuclear Information System (INIS)

    Details of the synthesis of carbon 14- and tritium-labelled molecules are examined. Although the methods used are those of classical organic chemistry the preparation of carbon 14-labelled molecules differs in some respects, most noticeably in the use of 14CO2 which requires very special handling techniques. For the tritium labelling of organic molecules the methods are somewhat different, very often involving exchange reactions. The following are described in turn: the so-called Wilzbach exchange method; exchange by catalysis in solution; catalytic hydrogenation with tritium; reductions with borotritides. Some applications of labelled molecules in organic chemistry, biochemistry and pharmacology are listed

  7. The radioactive labeling of monocytes

    International Nuclear Information System (INIS)

    With the aim of studying a possible relationship between circulating monocytes and Sternberg-Reed cells investigations were started on the specific labeling of monocytes. In this thesis the literature on the pertinent data has been reviewed and a series of experiments on the monocyte labeling procedure has been described. The principles of cell labeling with radioactive compounds were discussed. 1. Total separation of the particular cell population to be labeled and subsequent labeling with a non-specific radiopharmaceutical. 2. Specific cell labeling in a mixture of cell types based on a well defined affinity of the cell under study for the radiopharmaceutical used. Next the radionuclides that can be used for cell labeling purposes were discussed with special attention for 111In and its chelates. The principles of radiodosimetry were also discussed shortly. This section was focussed on the radiation dose the labeled cells receive because of the intracellular localized radioactivity. The radiation burden is high in comparison to amounts of radiation known to affect cell viability. A newly developed method for labeling monocytes specifically by phagocytosis of 111In-Fe-colloid without apparent loss of cells was described in detail. (Auth.)

  8. Addendum to report of the research co-ordination meeting on labelling techniques of biomolecules for targeted radiotherapy. Country report: Hungary. Preparation, quality control and animal testing of 125I and 131I labelled monoclonal antibody for radiotherapy

    International Nuclear Information System (INIS)

    Radiolabelled monoclonal antibodies (MoAbs) against tumour-associated antigens have been used to detect tumour deposits. Since gamma camera imaging of patients injected with radiolabelled MoAbs has demonstrated, selective tumour uptake of MoAbs, antibody-directed radiotherapy has gained greater interest. Prior to employing antibodies for radioimmunotherapy, their tumour and normal tissue uptake and pharmacokinetics as well as therapeutic efficacy in the animal tumour model must be determined. The therapeutic radiopharmaceuticals consist of two components the radionuclide (beta, alpha, Anger and conversion electron emitters) and the biological carrier (from peptide- to antibody). In the first step of our research program anti CEA MoAb inj. labelled with iodine-125 and 131I isotopes were used to study therapeutic efficacy in nude mice bearing human gastric adenocarcinoma xenografts

  9. English in Action (EIA) programme, Bangladesh: What’s this about using mobile phones in the classroom?


    Perez-Gore, Isabelle; Burton, Sonia


    This workshop presents an overview of English in Action’s (EIA) schools component, implemented by the Government of Bangladesh. EIA is a large-scale UKaid-funded English language development project, aiming to provide learning opportunities to 25 million people in Bangladesh. The project looks to enhance social and economic opportunities, including better access to jobs. The schools component is a professional development programme for Government teachers, introducing communicative teachi...

  10. Pharmacokinetics of the monoclonal antibody B72.3 and its fragments labeled with either 125I or 111In

    International Nuclear Information System (INIS)

    A comparison of the pharmacokinetics of intact B72.3 (a murine monoclonal antibody specific for human breast and colon carcinoma) with F(ab')2 and Fab fragments labeled with 111In and 125I was done in athymic mice bearing target (LS174T) and non-target (HCT-15) tumors. IgG B72.3 labeled with either isotype imaged LS174T. Biodistributions of both labels were similar in all organs except liver. F(ab')2 also imaged the LS174T tumor, while Fab bearing either isotype did not. The blood clearance was Fab greater than F(ab')2 greater than immunoglobulin G B72.3 for both isotopes. 111In-labeled fragments yielded large accumulations in the kidneys which persisted for 2 days. The different patterns of biodistribution for the various forms of B72.3 labeled with the two isotopes suggest that the most desirable combination of fragment and isotope will depend on the intended use

  11. Preparation and preclinical evaluation of 211At-labelled compounds for α-particle radiotherapy

    International Nuclear Information System (INIS)

    The present work demonstrate that significant therapeutic gain can be achieved with 211At-labelled MoAbs on single tumour cells and microscopic disease. Β-emitters are less effective on microscopic disease because of radiation dispersion, while longer halflives (e.g., 90Y and 131I) allow favourable therapeutic ratios to be reached in larger tumors. 211At-labelled MoAbs may therefore possibly be used in combination with β-emitting RIC in systemically delivered radioimunnotherapy. Larger tumor nodules are then irradiated effectively due to cross-fire of the longer ranged β-particles while the fraction of tumour cells distributed as single cells and micrometastases may be more effectively radiated with 211At-RIC. 76 refs

  12. 76 FR 75809 - Prior Label Approval System: Generic Label Approval (United States)


    ... the type of packaging material on which the label is printed; n. Brand name changes, provided that... poultry products will take effect January 1, 2012 (75 FR 82148, Dec. 29, 2010). These mandatory features..., location, and indication of final color. To obtain sketch label approval, domestic meat and...

  13. Laser labeling, a safe technology to label produce (United States)

    Laser labeling of fruits and vegetables is an alternative means to label produce. Low energy CO2 laser beams etch the surface showing the contrasting underlying layer. These etched surfaces can promote water loss and potentially allow for entry of decay organisms. The long-term effects of laser labe...

  14. Neutrophil labeling with [{sup 99m}Tc]-technetium stannous colloid is complement receptor 3-mediated and increases the neutrophil priming response to lipopolysaccharide

    Energy Technology Data Exchange (ETDEWEB)

    Gallagher, Hayley [School of Veterinary and Biomedical Sciences, James Cook University, Townsville, Queensland 4811 (Australia); Ramsay, Stuart C. [School of Medicine, James Cook University, Townsville, Queensland (Australia) and Townsville Nuclear Medicine, Mater Hospital, Townsville, Queensland 4812 (Australia)]. E-mail:; Barnes, Jodie [School of Veterinary and Biomedical Sciences, James Cook University, Townsville, Queensland 4811 (Australia); Maggs, Jacqueline [Department of Nuclear Medicine, Townsville Hospital, Townsville, Queensland 4814 (Australia); Cassidy, Nathan [Townsville Nuclear Medicine, Mater Hospital, Townsville, Queensland 4812 (Australia); Ketheesan, Natkunam [School of Veterinary and Biomedical Sciences, James Cook University, Townsville, Queensland 4811 (Australia); School of Medicine, James Cook University, Townsville, Queensland (Australia)


    Introduction: [{sup 99m}Tc]-technetium stannous colloid (TcSnC)-labeled white cells are used to image inflammation. Neutrophil labeling with TcSnC is probably phagocytic, but the phagocytic receptor involved is not known. We hypothesised that complement receptor 3 (CR3) plays a key role. Phagocytic labeling could theoretically result in neutrophil activation or priming, affecting the behaviour of labeled cells. Fluorescence-activated cell sorter (FACS) analysis side scatter measurements can assess neutrophil activation and priming. Methods: We tested whether TcSnC neutrophil labeling is CR3-mediated by assessing if neutrophil uptake of TcSnC was inhibited by a monoclonal antibody (mAb) directed at the CD11b component of CR3. We tested if TcSnC-labeled neutrophils show altered activation or priming status, comparing FACS side scatter in labeled and unlabeled neutrophils and examining the effect of lipopolysaccharide (LPS), a known priming agent. Results: Anti-CD11b mAb reduced neutrophil uptake of TcSnC in a dose-dependent fashion. Labeled neutrophils did not show significantly increased side scatter compared to controls. LPS significantly increased side scatter in control cells and labeled neutrophils. However, the increase was significantly greater in labeled neutrophils than unlabeled cells. Conclusions: Neutrophil labeling with TcSnC is related to the function of CR3, a receptor which plays a central role in phagocytosis. TcSnC labeling did not significantly activate or prime neutrophils. However, labeled neutrophils showed a greater priming response to LPS. This could result in labeled neutrophils demonstrating increased adhesion on activated endothelium at sites of infection.

  15. Neutrophil labeling with [99mTc]-technetium stannous colloid is complement receptor 3-mediated and increases the neutrophil priming response to lipopolysaccharide

    International Nuclear Information System (INIS)

    Introduction: [99mTc]-technetium stannous colloid (TcSnC)-labeled white cells are used to image inflammation. Neutrophil labeling with TcSnC is probably phagocytic, but the phagocytic receptor involved is not known. We hypothesised that complement receptor 3 (CR3) plays a key role. Phagocytic labeling could theoretically result in neutrophil activation or priming, affecting the behaviour of labeled cells. Fluorescence-activated cell sorter (FACS) analysis side scatter measurements can assess neutrophil activation and priming. Methods: We tested whether TcSnC neutrophil labeling is CR3-mediated by assessing if neutrophil uptake of TcSnC was inhibited by a monoclonal antibody (mAb) directed at the CD11b component of CR3. We tested if TcSnC-labeled neutrophils show altered activation or priming status, comparing FACS side scatter in labeled and unlabeled neutrophils and examining the effect of lipopolysaccharide (LPS), a known priming agent. Results: Anti-CD11b mAb reduced neutrophil uptake of TcSnC in a dose-dependent fashion. Labeled neutrophils did not show significantly increased side scatter compared to controls. LPS significantly increased side scatter in control cells and labeled neutrophils. However, the increase was significantly greater in labeled neutrophils than unlabeled cells. Conclusions: Neutrophil labeling with TcSnC is related to the function of CR3, a receptor which plays a central role in phagocytosis. TcSnC labeling did not significantly activate or prime neutrophils. However, labeled neutrophils showed a greater priming response to LPS. This could result in labeled neutrophils demonstrating increased adhesion on activated endothelium at sites of infection

  16. Horseradish peroxidase and antibody labeled gold nanoparticle probe for amplified immunoassay of ciguatoxin in fish samples based on capillary electrophoresis with electrochemical detection. (United States)

    Zhang, Zhaoxiang; Liu, Ying; Zhang, Chaoying; Luan, Wenxiu


    This paper describes a new amplified immunoassay with horseradish peroxidase (HRP) and antibody (Ab) labeled gold nanoparticles (AuNPs) probe hyphenated to capillary electrophoresis (CE) with electrochemical (EC) detection for ultrasensitive determination of ciguatoxin CTX1B. AuNPs were conjugated with HRP and Ab, and then incubated with limited amount of CTX1B to produce immunocomplex. The immunoreactive sample was injected into capillary for CE separation and EC detection. Enhanced sensitivity was obtained by adopting the AuNPs as carriers of HRP and Ab at high HRP/Ab molar ratio. The calibration curve of CTX1B was in the range of 0.06-90 ng/mL. The detection limit was 0.045 ng/mL, which is 38-fold lower than that of HPLC-MS method for CTX1B analysis. The proposed method was successfully applied for the quantification of CTX1B in contamined fish samples by simultaneously labeling Ab and HRP on AuNPs. The amplified IA with HRP and Ab labeled AuNPs probe hyphenated to CE and EC detection provides a sensitive analytical approach for the determination of trace ciguatoxin in complex samples. PMID:25637767

  17. Oxygen labelled CO2

    International Nuclear Information System (INIS)

    Tests were carried out as to whether additional information concerning pulmonary gas exchange could be obtained from the application of oxygen labelled carbon dioxide. Single breath experiments were performed on two healthy subjects with 0.1 percent C16O18O and 2.8 percent C18O2 in the inspiratory gas. Breath-hold time was varied between 0.5-20s in different experiments. The 18O-concentration of the end-expired gas bi-exponentially decreased with increasing breath-hold time. The high and low rate constants 4s-1 and 0.12s-1 for C18O2 and 2.5s-1 and 0.87s-1 for C16O18O were derived, respectively. These results, together with model calculations, suggest: 1) the rapid disappearance of C18O2 from the alveolar space is primarily limited by diffusion, so that this isotopic species can be applied to quantify pulmonary diffusing conditions; 2) the lower disappearance rate of C16O18O is caused by a lower equilibration kinetics in blood, so that this isotopic species offers a possibility to study carbonic anhydrase activity of the red cells in vivo; 3) the slow phase of label decay is influenced by both alveolar dead space and carbonic anhydrase activity of the pulmonary tissues. Pathological dead spaces are expected to be sensitively detectable by C16O18O as well as by C18O2. (author). 4 refs.; 4 figs

  18. Dead cells in melanoma tumors provide abundant antigen for targeted delivery of ionizing radiation by a mAb to melanin


    Dadachova, Ekaterina; Nosanchuk, Joshua D.; Shi, Li; Schweitzer, Andrew D.; Frenkel, Annie; Nosanchuk, Jerome S.; Casadevall, Arturo


    Melanoma is a cancer with a rising incidence, and metastatic disease is almost always lethal. We investigated the feasibility of targeting melanin, an intracellular melanocyte pigment, to deliver cytotoxic radiation to human melanoma cells in vivo by using a melanin-binding mAb (6D2). Nude mice bearing MNT1 pigmented human melanoma tumors were treated with mAb 6D2 labeled with 1.5 mCi (1 Ci = 37 GBq) of the β-emitter 188-Rhenium (188Re) and manifested inhibition of tumor growth and prolonged ...

  19. Tumor immunolocalization using {sup 124}I-iodine-labeled JAA-F11 antibody to Thomsen-Friedenreich alpha-linked antigen

    Energy Technology Data Exchange (ETDEWEB)

    Chaturvedi, Richa [Department of Biotechnical and Clinical Laboratory Sciences, University at Buffalo, StateUniversity of New York, Buffalo, NY 14214 (United States); Heimburg, Jamie [Department of Microbiology and Immunology, University at Buffalo, StateUniversity of New York, Buffalo, NY 14214 (United States); Yan, Jun; Koury, Stephen [Department of Biotechnical and Clinical Laboratory Sciences, University at Buffalo, StateUniversity of New York, Buffalo, NY 14214 (United States); Sajjad, Munawwar; Abdel-Nabi, Hani H. [Department of Nuclear Medicine, University at Buffalo, StateUniversity of New York, Buffalo, NY 14214 (United States); Rittenhouse-Olson, Kate [Department of Biotechnical and Clinical Laboratory Sciences, University at Buffalo, StateUniversity of New York, Buffalo, NY 14214 (United States); Department of Microbiology and Immunology, University at Buffalo, StateUniversity of New York, Buffalo, NY 14214 (United States)], E-mail:


    Clinical immunolocalization has been attempted by others with an anti-Thomsen-Friedenreich antigen (TF-Ag) mAb that bound both alpha- and beta-linked TF-Ag. In this report, {sup 124}I-labeled mAb JAA-F11 specific for alpha-linked TF-Ag showed higher tumor specificity in in vivo micro-positron emission tomography (micro-PET) of the mouse mammary adenocarcinoma line, 4T1, showing no preferential uptake by the kidney. Labeled product remained localized in the tumor for at least 20 days. Glycan array analysis showed structural specificity of the antibody.

  20. A generic approach to integrate biodiversity considerations in screening and scoping for EIA

    International Nuclear Information System (INIS)

    The Convention on Biological Diversity (CBD) requires parties to apply environmental impact assessment (EIA) to projects that potentially negatively impact on biodiversity. As members of the International Association of Impact Assessment, the authors have developed a conceptual framework to integrate biodiversity considerations in EIA. By defining biodiversity in terms of composition, structure, and key processes, and by describing the way in which human activities affect these so-called components of biodiversity, it is possible to assess the potential impacts of human activities on biodiversity. Furthermore, the authors have translated this conceptual framework in generic guidelines for screening and scoping in impact assessment. Countries can use these generic guidelines to further operationalise the framework within the existing national procedures for impact assessment. This paper is fully coherent and partly overlapping with the guidelines recently adopted by the CBD, but differs in the sense that it provides more scientific background and is less policy-oriented

  1. EIA model documentation: Petroleum Market Model of the National Energy Modeling System

    Energy Technology Data Exchange (ETDEWEB)



    The purpose of this report is to define the objectives of the Petroleum Market Model (PMM), describe its basic approach, and provide detail on how it works. This report is intended as a reference document for model analysts, users, and the public. Documentation of the model is in accordance with EIA`s legal obligation to provide adequate documentation in support of its models (Public Law 94-385, section 57.b.2). The PMM models petroleum refining activities, the marketing of products, the production of natural gas liquids and domestic methanol, projects petroleum provides and sources of supplies for meeting demand. In addition, the PMM estimates domestic refinery capacity expansion and fuel consumption.

  2. Session 3 report stake holder involvement, particularly in the environmental impact assessment (EIA)

    International Nuclear Information System (INIS)

    Owing much to the seating arrangements that allowed a range of Finnish stakeholders and FSC representatives to share eight small tables, discussions were quite active and hence produced the maximum output, given the time limitations. It should, first of all, be acknowledged that the highly interactive format chosen for the Workshop was a success. Session III focused on the Environmental Impact Assessment (EIA) and the involvement of a variety of stakeholders therein. As introduced by a majority of the plenary speakers prior to the discussion, the EIA formed an integral part of the application submitted by Posiva to the Finnish authorities for a decision in principle according to the Nuclear Energy Act. Reflecting the cross-section of stakeholders at each table, a number of different insights were introduced and discussed. At the end of the discussion, a facilitator for each table summarised the discussion and introduced the summaries in a short presentation. (author)

  3. Radioimmunoimaging of ovarian cancer with 131I labelled CEA monoclonal antibody

    International Nuclear Information System (INIS)

    Objective: To investigate radioimmunoimaging with 131I labelled CEA McAb and its value in diagnosis and treatment of ovarian cancer. Methods: CEA McAb was labelled with 131I by standard chloramine T procedure. The radiolabeled McAb was given intravenously to the patients. The scintigraphy was performed at different time. Results: In 105 patients with histopathology proved ovarian cancers, for 96 patients the lesions were well located with RII (true positives), for the remaining 9 patients, the results were false negative. 22/23 cases with RII diagnosed benign ovarian tumors were proved to be true negative by surgical pathology in RII. Of 96 ovarian cancers 87 were stratified into identical stages by surgical pathology all RII. 141/151 metastatic tumors were found in RII and the positive rate was as high as 93.4%. The smallest tumor defected by RII was of 1 cm in diameter. Conclusions: RII is as good as ultrasonography and CT in distinguishing benignancy and malignancy. The location, size and number of the lesions can also be determined with RII. RII of ovarian cancer with 131I-CEA McAb is valuable and helpful in early detection of ovarian cancer. It is also helpful for clinical staging, treatment programing and prognosticating

  4. Meat and Poultry Labeling Terms (United States)

    ... Food Standards and Labels: The Facts Labeling and Marketing Information [ Top of Page ] OVEN PREPARED: Product is fully cooked and ready to eat. [ Top of Page ] YOUNG TURKEY: Turkeys of either sex that are less than 8 months of age according to present regulations. [ Top of Page ] Last ...

  5. Nutrition Marketing on Food Labels (United States)

    Colby, Sarah E.; Johnson, LuAnn; Scheett, Angela; Hoverson, Bonita


    Objective: This research sought to determine how often nutrition marketing is used on labels of foods that are high in saturated fat, sodium, and/or sugar. Design and Setting: All items packaged with food labels (N = 56,900) in all 6 grocery stores in Grand Forks, ND were surveyed. Main Outcome Measure(s): Marketing strategy, nutrient label…





    Environmental issues can only be solved by coherent action at local, national and international levels, therefore understanding of the factors that influence the information exchange process is very important. The subject of investigation in this research is the influence of environmental information provided in the Environmental Impact Assessment (EIA) process on the level of knowledge concerning environmental issues in the local community. A survey of public opinion of the environmental imp...

  7. Comparative studies of antibody anti-CD20 labeled with 188Re

    International Nuclear Information System (INIS)

    Nuclear Medicine is an unique and important modality in oncology and the development of new tumor-targeted radiopharmaceuticals for both diagnosis and therapy is an area of interest for researchers. Rituximab (RTX) is a quimeric monoclonal antibody (mAb) (IgG 1) that specifically binds to CD20 antigen with high affinity and has been successfully used for the treatment of Non-Hodgkin Lymphoma (NHL) of cell B. The CD20 antigen is expressed over more than 90% of cell B NHL. Technetium-99m (99mTc) and rhenium-188 (188Re) are an attractive radionuclide pair for clinical use due to their favorable decay properties for diagnosis (99mTc: T1/2 = 6 h, γ radiation = 140 keV) and therapy (188Re: T1/2 = 17 h, maximum β energy = 2.12 MeV) and to their availability in the form of 99Mo/99mTc and 188W/188Re generators. The radionuclides can be conjugated to mAb using similar chemical procedures. The aim of this work was to study the labeling of anti-CD20 mAb (RTX) with 188Re using two techniques: the direct labeling method [188Re(V)] and the labeling method via the carbonyl nucleus [188Re(I)]. Besides the quality control, the radiolabeled mAb was submitted to in vivo, in vitro and ex vivo biological studies. For the direct labeling, RTX was reducing by incubation with 2-mercaptoethanol for generating sulphydryl groups (-SH) and further labeled with 188Re(V), in a study of several parameters in order to reach an optimized formulation. The labeling via the carbonyl nucleus both 99mTc and 188Re were employed through 2 different procedures: (1) labeling of intact RTX with 99mTc(I) and (2) reduced RTX (RTXred) labeled with 99mTc(I)/188Re(I). Also a parameter study was performed to obtain an optimized formulation. The quality control method for evaluating the radiochemical purity showed a good labeling yield (93%) for the direct method. The labeling method via carbonyl group, the results showed that the - SH groups of RTXred are a possible way of labeling. The formulation of 99m

  8. Undoing Gender Through Legislation and Schooling: the Case of AB 537 and AB 394 IN California, USA (United States)

    Knotts, Greg


    This article investigates California laws AB 537: The Student Safety and Violence Prevention Act of 2000, and the recently enacted AB 394: Safe Place to Learn Act. Both demand that gender identity and sexual orientation be added to the lexicon of anti-harassment protection in public education. However, despite these progressive measures, schools have an unconscious acceptance of heteronormativity and gendered norms, which undermines both the spirit and language of these laws. This paper examines how California schools can both change standard practices and realise the transformative social change that laws like AB 537 and AB 394 can instigate. I assert that the systemic implementation of these laws, through the adoption, enforcement and evaluation of existing AB 537 Task Force Recommendations, is necessary for their success. My second assertion is that AB 537 and AB 394 have the potential to change and reconstitute gender-based and heteronormative standards at school sites.

  9. A Better Carbon Footprint Label

    DEFF Research Database (Denmark)

    Thøgersen, John; Nielsen, Kristian S.


    expected, price and carbon footprint were negatively related to choice. Further, participants preferred organic to non-organic coffee and certification by a public authority. The effect of the carbon label is significantly stronger the more environmentally concerned the consumer is. Using colors to...... indicate relative carbon footprint significantly increases carbon label effectiveness. Hence, a carbon footprint label is more effective if it uses traffic light colors to communicate the product's relative performance.......Based on insights from behavioral economics, it is suggested to extend carbon footprint labeling with information about relative performance, using the well-known “traffic light” color scheme to communicate relative performance. To test this proposition, the impact of a carbon footprint label on...

  10. Sublinear distance labeling for sparse graphs

    DEFF Research Database (Denmark)

    Alstrup, Stephen; Dahlgaard, Søren; Knudsen, Mathias Bæk Tejs; Porat, Ely

    A distance labeling scheme labels the $n$ nodes of a graph with binary strings such that, given the labels of any two nodes, one can determine the distance in the graph between the two nodes by looking only at the labels. A $D$-preserving distance labeling scheme only returns precise distances be...

  11. 21 CFR 201.71 - Magnesium labeling. (United States)


    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Magnesium labeling. 201.71 Section 201.71 Food and... LABELING Labeling Requirements for Over-the-Counter Drugs § 201.71 Magnesium labeling. (a) The labeling of over-the-counter (OTC) drug products intended for oral ingestion shall contain the magnesium...

  12. An Investigation of the Factors Affecting Performance of Environmental Impact Assessment Practices (EIA in Pakistan

    Directory of Open Access Journals (Sweden)

    Shahbaz Hussain


    Full Text Available Environmental Impact Assessment is used to detect changes that a proposed project may have on environment. The intent of present study is to investigate impact of institutional capacity and legal framework on performance of Environmental Impact Assessment practices in Pakistan such as screening, scoping and mitigation, environmental management plan and reporting. Sample of 200 EIA professionals have been selected by using random sampling approach from all provinces of Pakistan. Data has been collected through structured questionnaire and analysed by using AMOS 19 (Analysis of Moment Structures software. Results of path analysis indicated that institutional capacity and legal framework have significant direct impact on performance of all EIA practices in Pakistan. Model fit statistics such as GFI, RMR, NFI, IFI, TLI, RFI, CFI indicate the fitness of research model in this context. It has been suggested that there must be relevant and sufficient human resources that can uplift institutional capacity and legal framework must be well implemented because it will lead to enhanced performance of EIA practices in Pakistan.

  13. Social Impact Assessment: The lesser sibling in the South African EIA process?

    International Nuclear Information System (INIS)

    Social Impact Assessment has developed as an integral but neglected component of EIA in South Africa since it became mandatory in 1997, and has therefore been referred to as the “orphan” or “lesser sibling” of EIA, as has SIA in the UK and the US. The aim of this paper is to test this claim by reviewing the quality of a sample of SIA reports, and also to establish whether there has been any improvement in quality following the introduction of revised EIA regulations in 2006. The results confirm that SIA can be called “the lesser sibling” due to the weak grades achieved in the quality review, but also reveal that there has been a slight and consistent improvement in quality, most likely driven by best practice considerations in the absence of prescriptive regulations for SIA. Suggestions and recommendations for addressing observed weakness in SIA performance are advanced. - Highlights: • The quality of a sample of SIA reports was evaluated using a review package. • SIA reports received mostly weak grades. • Limited improvement observed from first to second regulatory regime. • Improvements most likely due to best practice considerations

  14. Social Impact Assessment: The lesser sibling in the South African EIA process?

    Energy Technology Data Exchange (ETDEWEB)

    Hildebrandt, L., E-mail: [African Centre for Disaster Studies, Research Focus Area: Social Transformation, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa); Sandham, L.A., E-mail: [Environmental Assessment Research Group, School of Geo and Spatial Sciences, North-West University, Private Bag X6001, Potchefstroom, 2520 (South Africa)


    Social Impact Assessment has developed as an integral but neglected component of EIA in South Africa since it became mandatory in 1997, and has therefore been referred to as the “orphan” or “lesser sibling” of EIA, as has SIA in the UK and the US. The aim of this paper is to test this claim by reviewing the quality of a sample of SIA reports, and also to establish whether there has been any improvement in quality following the introduction of revised EIA regulations in 2006. The results confirm that SIA can be called “the lesser sibling” due to the weak grades achieved in the quality review, but also reveal that there has been a slight and consistent improvement in quality, most likely driven by best practice considerations in the absence of prescriptive regulations for SIA. Suggestions and recommendations for addressing observed weakness in SIA performance are advanced. - Highlights: • The quality of a sample of SIA reports was evaluated using a review package. • SIA reports received mostly weak grades. • Limited improvement observed from first to second regulatory regime. • Improvements most likely due to best practice considerations.

  15. Public hearings for EIAs in post-communist Bulgaria: do they work?

    International Nuclear Information System (INIS)

    The participatory practices required as part of the established systems of Environmental Impact Assessment (EIA) practiced in the United States, Canada, Western Europe as well as several international agencies are more recent to the countries of Eastern Europe. The most common official forum for citizen participation in EIAs is the public hearing, which can provide important benefits. However, public hearings have been criticized as exhibiting several problems that preclude meaningful citizen input. This research explores three cases of public hearings held for EIA projects in Bulgaria. It argues that the public participation process and the public hearing in particular share the same problems that have been observed in other countries (including the United States and Canada). At the same time, however, Bulgarian public hearings do provide important indirect benefits that can contribute to the capacity for democratic governance and an active civil society. In the face of substantial economic obstacles and dramatic governmental reforms the country has endured since the end of communism, forums such as the public hearing are important means to foster institutional restructuring of a newly democratized country

  16. Experimental study of biotin-avidin pretargeting technique for anti-CEA McAb radioimmunoimaging

    International Nuclear Information System (INIS)

    Biotin-avidin pretargeting technique was used in promoting the diagnostic efficacy of anti-CEA McAb radioimmunoimaging. CEA McAb was conjugated with biotin McAb (B-McAb), streptavidin (SA) was labeled with 131I (131I-SA) and DTPA-biotin with 111In(111In-DTPA-B). Experimental human colonic tumor bearing nude mice were used. Two step method: B-McAb was preinjected, followed by 131I SA 48h later, 24, 48, 96 and 120 h postinjection, γ-imaging and biodistribution were studied. Three step method: B-McAb was preinjected, followed by cold SA 24h later and 111In-DTPA-B another 24h later. 2,6,24 and 48h postinjection, γ-imaging and biodistribution were also studied. Two step method: T/NT of all organs in experimental group was significantly increased compared with controls. The blood T/NT in experimental group and control group at 24 and 120h was 1.11:0.42 and 8.58:3.51, respectively. Tumor % ID/g in all organs slightly decreased compared with direct group. In γ-imaging radioactivity has been accumulated in tumor site as early as 24h, while only slightly visualized or non-visualized in controls. Three step method: in experimental group the blood T/NT reached 4.19 at 2 h, whereas all was < 1.37 at each phase of controls, the T/NT of all organs was also higher in experimental grouped than in controls. The tumor % ID/g in experimental group was 9.72% at 2h and 3.65% at 48h whereas % ID/g in controls in all phases was <3.07. The tumor clearly visualized at 2h and clearer at 48h in γ-imaging. In controls, the tumor was slightly visualized also to early stage, but faded away later on. Biotin-avidin pretargeting technique can elevate the T/NT ratio and decrease the blood background. Early imaging was obtained with better imaging quality

  17. 汽车ABS/ASR/ACC集成化系统%Integrated ABS/ASR/ACC System for the Car

    Institute of Scientific and Technical Information of China (English)

    刘昭度; 卢江; 时开斌; 安巍


    叙述了ACC系统和ABS/ASR系统在改善汽车高速行驶主动安全性方面的功用,阐述了ACC系统是ABS/ASR系统功能的延伸、逻辑的发展及它们之间的内在联系,指出了在ABS/ASR的基础上只需增加测距装置和添加巡航控制子程序,就可方便地实现ABS/ASR/ACC集成化系统,并给出了集成化系统的控制框图和控制方法,论述了ABS/ASR/ACC集成化系统比孤立的ABS/ASR和ACC系统的优越性.%The individual functions of ACC and ABS/ASR are described in the improvements of active safety while the road vehicles travel at a high speed. Being a logic extension of and many inherent connections with ABS/BSR, ACC is easily integrated with ABS/ASR to form an integrated system by adding the headway distance*$-detecting device to the existing ABS/ASR system and expanding the ABS/ASR software. The algorithm flowcharts and control methods of the ABS/ASR/ACC are given. The advantages of the ABS/ASR/ACC system compared with those using the stand alone systems ABS, ASR and ACC are mentioned in details.

  18. Germacrene D Cyclization: An Ab Initio Investigation

    Directory of Open Access Journals (Sweden)

    William N. Setzer


    Full Text Available Essential oils that contain large concentrations of germacrene D are typically accompanied by cadinane sesquiterpenoids. The acid-catalyzed cyclization of germacrene D to give cadinane and selinane sesquiterpenes has been computationally investigated using both density functional (B3LYP/6-31G* and post Hartree-Fock (MP2/6-31G** ab initio methods. The calculated energies are in general agreement with experimentally observed product distributions, both from acid-catalyzed cyclizations as well as distribution of the compounds in essential oils.

  19. Ab initio calculations of material strength

    Czech Academy of Sciences Publication Activity Database

    Šob, Mojmír; Friák, Martin; Vitek, V.

    Tokyo : The Japan Society of Mechanical Engineers, 2003, s. 467-475. [International Symposium on Micro-Mechanical Engineering - Heat Transfer, Fluid Dynamics, Reliability and Mechanotronics.. Tsuchiura and Tsukuba (JP), 01.12.2003-03.12.2003] R&D Projects: GA AV ČR IAA1041302; GA ČR GA202/03/1351; GA MŠk OC 523.90 Institutional research plan: CEZ:AV0Z2041904 Keywords : ab initio calculations * electronic structure * theoretical tensile strength Subject RIV: BM - Solid Matter Physics ; Magnetism

  20. Ab Initio Molecular Dynamics: A Virtual Laboratory


    Hobbi Mobarhan, Milad


    In this thesis, we perform ab initio molecular dynamics (MD) simulations at the Hartree-Fock level, where the forces are computed on-the-fly using the Born-Oppenheimer approximation. The theory behind the Hartree-Fock method is discussed in detail and an implementation of this method based on Gaussian basis functions is explained. We also demonstrate how to calculate the analytic energy derivatives needed for obtaining the forces acting on the nuclei. Hartree-Fock calculations on the ground s...

  1. Asiakassuhdehallinnan kehityssuunnitelma : Case: Oy Combi Cool Ab


    Puikkonen, Touko


    Tässä insinöörityössä tutustuttiin Oy Combi Cool Ab:n asiakassuhdehallintaan ja siinä havaittuihin puutteisiin ja kehitystarpeisiin. Työn tarkoituksena oli luoda yritykselle ajan tasalla oleva asiakasrekisteri ja sen pohjalta kehittää asiakassuhdehallintaa etenkin myynnin, oston ja johdon henkilöstön tarpeita ajatellen muovaamalla siitä henkilöstön myynti- ja asiakaspalvelutyöskentelyä tehostava toimiva kokonaisuus. Combi Cool on vuonna 1985 perustettu kylmäalan tukkuliike, joka on vajaan 30 ...

  2. Testing Distributed ABS System with Fault Injection (United States)

    Trawczyński, Dawid; Sosnowski, Janusz; Gawkowski, Piotr

    The paper deals with the problem of adapting software implemented fault injection technique (SWIFI) to evaluate dependability of reactive microcontroller systems. We present an original methodology of disturbing controller operation and analyzing fault effects taking into account reactions of the controlled object and the impact of the system environment. Faults can be injected randomly (in space and time) or targeted at the most sensitive elements of the controller to check it at high stresses. This approach allows identifying rarely encountered problems, usually missed in classical approaches. The developed methodology has been used successfully to verify dependability of ABS system. Experimental results are commented in the paper.

  3. Intraspinal distribution and reaction in the grey matter with tetanus toxin of intracisternally injected anti-tetanus toxoid F(ab')2 fragments

    International Nuclear Information System (INIS)

    Anti-tetanus toxoid F(ab')2 fragments were purified using immune-affinity chromatography on tetanus toxoid-Sepharose. Fragments were labeled with 125I. Labeled or non-labeled fragments were injected into the intrathecal space of rats. The labeled fragments were found in the spinal cord outside but not inside neurons. Tetanus toxin was injected into a muscle and 36 h later labeled fragments were injected intracisternally. After another 24 h the label was elevated in the spinal cord half segments giving neural supply to the injected muscle and in these half-segments the label was concentrated around some α-motoneurons. [125I]Tetanus toxin was injected into a muscle and at different times thereafter non-labeled fragments were injected intracisternally. The development of hindlimb rigidity but not the accumulation of [125I]tetanus toxin in α-motoneurons was prevented by early intracisternal injection of fragments. Injection of fragments after the appearance of hindlimb rigidity did not revert the rigidity but prevented the further development of symptoms. (Auth.)

  4. Apoptosis and p53 are not involved in the anti-tumor efficacy of 125I-labeled monoclonal antibodies targeting the cell membrane

    International Nuclear Information System (INIS)

    Introduction: 125I-labeled monoclonal antibodies (125I-mAbs) can efficiently treat small solid tumors. Here, we investigated the role of apoptosis, autophagy and mitotic catastrophe in 125I-mAb toxicity in p53−/− and p53+/+ cancer cells. Methods: We exposed p53−/− and p53+/+ HCT116 cells to increasing activities of internalizing (cytoplasmic location) anti-HER1 125I-mAbs, or non-internalizing (cell surface location) anti-CEA 125I-mAbs. For each targeting model we established the relationship between survival and mean nucleus absorbed dose using the MIRD formalism. Results: In both p53−/− and p53+/+ HCT116 cells, anti-CEA 125I-mAbs were more cytotoxic per Gy than anti-HER1 125I-mAbs. Sensitivity to anti-CEA 125I-mAbs was p53-independent, while sensitivity to anti-HER1 125I-mAbs was higher in p53−/− HCT 116 cells, suggesting that they act through different signaling pathways. Apoptosis was only induced in p53+/+ HCT116 cells and could not explain cell membrane radiation sensitivity. Inhibition of autophagy did not modify the cell response to 125I-mAbs. By contrast, mitotic death was similarly induced in both p53−/− and p53+/+ HCT116 cells by the two types of 125I-mAbs. We also showed using medium transfer experiments that γ-H2AX foci were produced in bystander cells. Conclusion: Cell membrane sensitivity to 125I-mAbs is not mediated by apoptosis and is p53-independent. Bystander effects-mediated mitotic death could be involved in the efficacy of 125I-mAbs binding cell surface receptors

  5. Jatobal virus antigenic characterization by ELISA and neutralization test using EIA as indicator, on tissue culture

    Directory of Open Access Journals (Sweden)

    Luiz Tadeu M. Figueiredo


    Full Text Available A virus antigenic characterization methodology using an indirect method of antibody detection ELISA with virus-infected cultured cells as antigen and a micro virus neutralisation test using EIA (NT-EIA as an aid to reading were used for antigenic characterization of Jatobal (BeAn 423380. Jatobal virus was characterized as a Bunyaviridae, Bunyavirus genus, Simbu serogroup virus. ELISA using infected cultured cells as antigen is a sensitive and reliable method for identification of viruses and has many advantages over conventional antibody capture ELISA's and other tests: it eliminates solid phase coating with virus and laborious antigen preparation; it permits screening of large numbers of virus antisera faster and more easily than by CF, HAI, or plaque reduction NT. ELISA and NT using EIA as an aid to reading can be applicable to viruses which do not produce cytopathogenic effect. Both techniques are applicable to identification of viruses which grow in mosquito cells.A caracterização antigênica do vírus Jatobal (BeAn 423380 foi efetuada utilizando uma técnica de ELISA para deteccão de anticorpos que utiliza culturas celulares infectadas como antígeno e um micro teste de neutralização para vírus que utiliza o método imunoenzimático como auxiliar para a leitura dos resultados (NT-EIA. O vírus Jatobal foi caracterizado como um Bunyaviridae, gênero Bunyavirus, pertencente ao sorogrupo Simbu. A técnica de ELISA, utilizando culturas celulares infectadas como antígeno, trata-se de método sensível e confiável na identificação de agentes virais, possuindo muitas vantagens sobre ELISA convencionais e outros testes: elimina a preparação laboriosa de antígenos para o revestimento em fase sólida; permite que se teste de forma mais rápida e fácil que por CF, HAI e neutralização por redução de plaques um grande número de antisoros de vírus. ELISA e NT-EIA podem ser utilizados para a classificação de vírus que não produzem

  6. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... Under Control Figuring Out Food Labels Healthy Food Shopping If My Child Has Food Allergies, What Should ... for Parents Figuring Out Food Labels Smart Supermarket Shopping Figuring Out Fat and Calories Food Labels Contact ...

  7. The Inception and Evolution of EIA and Environmental Clearance Process – Laying Emphasis on Sustainable Development and Construction

    Directory of Open Access Journals (Sweden)

    Devarshi Tathagat


    Full Text Available EIA which stands for environmental impact assessment is a domain which encompasses almost all areas of environmental engineering. EIA and environmental clearance (EC are two things which MoEF, Govt. Of India has mandated for many categories of project before their commissioning. Buildings with built up area of more than 20000 metre square and townships with area more than 50 Ha or 150000 square metre of built up area comes under it. A thorough report is made for the possible outcomes of the project (‟s impact on surrounding environment. If the impact is within the limits as specified by MoEF and SEAC, it is sent for approval otherwise client is suggested to take corrective steps. Scope of the topic trespasses the boundaries of green house gas emissions and global warming, water and energy crises, carbon emission and sequestration, environmental pollution of various kind. It was EIA that brought in an element on environment in all projects. It lead to eco friendly and sustainable construction techniques which paved way for the concept of green building. Today EIA and environmental clearance are the only protectors of environment from the greeds of corporate sector across globe. If applied with stringency it will usher us to an era where any advancement will be apsolutely in tune with nature.This technical paper deals with the birth and growth of EIA in the world and in India. It deals with the processes that are involved in carrying out EIA for a project and subsequently providing it with environmental clearance. Also it emphasizes on how EIA led to a general awareness and paved way for the concept of sustainable construction.

  8. Elastic properties of intermetallic AB2 and AB5 hydrogen-absorbing compounds

    International Nuclear Information System (INIS)

    The elastic properties of AB2 and AB5 hydrogen-absorbing intermetallic compounds are reviewed. The relevance of these properties to hydrogen absorption is discussed briefly. In many cases the temperature dependence of the elastic constants of the AB2 compounds is anomalous in that the moduli do not decrease monotonically with increasing temperature. This unusual behavior appears to be associated with electronic structure effects in a number of cases. The absorption of hydrogen by polycrystalline TaV2 has a profound effect on the aggregate shear modulus, changing both the magnitude and temperature dependence significantly. This effect of hydrogen on the mechanical properties appears to occur via effects on the electronic structure. Few measurements of elastic properties have been reported for hydrogen-absorbing AB5 intermetallic compounds. The LaAlxNi5-x system has been investigated by means of measurements on polycrystals prepared by hot isostatic pressing. The moduli decrease about 8% as x increases from 0 to 1

  9. Biosorption of Acid Blue 290 (AB 290) and Acid Blue 324 (AB 324) dyes on Spirogyra rhizopus

    International Nuclear Information System (INIS)

    In this study, the biosorption of Acid Blue 290 and Acid Blue 324 on Spirogyra rhizopus, a green algae growing on fresh water, was studied with respect to initial pH, temperature, initial dye concentration and biosorbent concentration. The optimum initial pH and temperature values for AB 290 and AB 324 biosorption were found to be 2.0, 30 deg. C and 3.0, 25 deg. C, respectively. It was observed that the adsorbed AB 290 and AB 324 amounts increased with increasing the initial dye concentration up to 1500 and 750 mg/L, respectively. The Langmuir, Freundlich, Redlich-Peterson and Koble-Corrigan isotherm models were applied to the experimental equilibrium data and the isotherm constants were determined by using Polymath 4.1 software. The monolayer coverage capacities of S. rhizopus for AB 290 and AB 324 dyes were found as 1356.6 mg/g and 367.0 mg/g, respectively. The intraparticle diffusion model and the pseudo-second order kinetic model were applied to the experimental data in order to describe the removal mechanism of these acidic dyes by S. rhizopus. The pseudo-second order kinetic model described very well the biosorption kinetics of AB 290 and AB 324 dyes. Thermodynamic studies showed that the biosorption of AB 290 and AB 324 on S. rhizopus was exothermic in nature

  10. Ab initio non-relativistic spin dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Feizhi; Goings, Joshua J.; Li, Xiaosong, E-mail: [Department of Chemistry, University of Washington, Seattle, Washington 98195 (United States); Frisch, Michael J. [Gaussian, Inc., 340 Quinnipiac St, Bldg 40, Wallingford, Connecticut 06492 (United States)


    Many magnetic materials do not conform to the (anti-)ferromagnetic paradigm where all electronic spins are aligned to a global magnetization axis. Unfortunately, most electronic structure methods cannot describe such materials with noncollinear electron spin on account of formally requiring spin alignment. To overcome this limitation, it is necessary to generalize electronic structure methods and allow each electron spin to rotate freely. Here, we report the development of an ab initio time-dependent non-relativistic two-component spinor (TDN2C), which is a generalization of the time-dependent Hartree-Fock equations. Propagating the TDN2C equations in the time domain allows for the first-principles description of spin dynamics. A numerical tool based on the Hirshfeld partitioning scheme is developed to analyze the time-dependent spin magnetization. In this work, we also introduce the coupling between electron spin and a homogenous magnetic field into the TDN2C framework to simulate the response of the electronic spin degrees of freedom to an external magnetic field. This is illustrated for several model systems, including the spin-frustrated Li{sub 3} molecule. Exact agreement is found between numerical and analytic results for Larmor precession of hydrogen and lithium atoms. The TDN2C method paves the way for the ab initio description of molecular spin transport and spintronics in the time domain.

  11. Labelling GM-free Products

    DEFF Research Database (Denmark)

    Punt, Maarten; Venus, Thomas; Wesseler, Justus


    Food suppliers in the EU must comply with labelling regulations for genetically modified organisms (GMOs). However, excluded from mandatory labelling are food products derived from animals fed with GM feed (mainly GM soybean in the EU). Because of this labelling exemption, consumers are unable to...... limited. The results indicate that for switching to ‘GM-free’ production, long-term effects such as the creation of a positive image or differentiation from competitors are more important for dairy companies than short-term effects such as higher sales or profit....

  12. Sustainability labels on food products

    DEFF Research Database (Denmark)

    Grunert, Klaus G; Hieke, Sophie; Wills, Josephine


    This study investigates the relationship between consumer motivation, understanding and use of sustainability labels on food products (both environmental and ethical labels), which are increasingly appearing on food products. Data was collected by means of an online survey implemented in the UK...... types of information available on food labels or as use inferred from the results of a choice-based conjoint analysis. Hierarchical regression indicated that use is related to both motivation and understanding, and that both motivation, understanding and use are affected by demographic characteristics...

  13. New labels for radiation therapy

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Susumu; Mukai, Minoru; Kato, Hirotoshi (National Inst. of Radiological Sciences, Chiba (Japan))


    In simulating radiotherapy, the bone and trachea identified by plain X-P and the other organs, such as the esophagus and bladder, outlined by contrast medium have so far been used as labels. However, irradiation with a high therapeutic ratio is required for an intracorporeal insertion of artificial labels that are identified by X-ray fluoroscopy. For this purpose, metal clips and seed dummies are available, although they cause artifacts in CT scans. Therefore, the authors are using an acupuncture needle and lipiodol for tracing as new artificial labels, since both are identified by X-ray fluoroscopy and CT scan and create few artifacts. (J.P.N.).

  14. New labels for radiation therapy

    International Nuclear Information System (INIS)

    In simulating radiotherapy, the bone and trachea identified by plain X-P and the other organs, such as the esophagus and bladder, outlined by contrast medium have so far been used as labels. However, irradiation with a high therapeutic ratio is required for an intracorporeal insertion of artificial labels that are identified by X-ray fluoroscopy. For this purpose, metal clips and seed dummies are available, although they cause artifacts in CT scans. Therefore, the authors are using an acupuncture needle and lipiodol for tracing as new artificial labels, since both are identified by X-ray fluoroscopy and CT scan and create few artifacts. (J.P.N.)

  15. Ab initio no core full configuration approach for light nuclei (United States)

    Kim, Youngman; Shin, Ik Jae; Maris, Pieter; Vary, James P.; Forssén, Christian; Rotureau, Jimmy


    Comprehensive understanding of the structure and reactions of light nuclei poses theoretical and computational challenges. Still, a number of ab initio approaches have been developed to calculate the properties of atomic nuclei using fundamental interactions among nucleons. Among them, we work with the ab initio no core full configuration (NCFC) method and ab initio no core Gamow Shell Model (GSM). We first review these approaches and present some recent results.

  16. Workshop on automated beam steering and shaping (ABS). Proceedings

    International Nuclear Information System (INIS)

    A workshop on Automated Beam Steering and Shaping (ABS) was held at CERN in December 1998. This was the first workshop dedicated to this subject. The workshop had two major goals: to review the present status of ABS algorithms and systems around the world and to create a worldwide ABS community. These proceedings contain summary reports from all sessions, contributions from several presentations held at the workshop, and a complete set of abstracts for all presentations. (orig.)

  17. Temperature-dependent dissociation of homologous in-vivo produced complexes of 125I-des-AB fibrin monomers

    International Nuclear Information System (INIS)

    Des-AB fibrin monomers are prepared by incubation of fibrinogen with thrombin in the presence of aprotinin and EDTA. Plasma samples of rabbits taken at fixed time intervals show an exponential decrease of radioactivity after incorporation of fibrin monomers prepared by means of 125-I-labelled fibrinogen. The fibrin monomer complexes have been separated from the dimers or the fibrinogen by agarose gel filtration for the determination of radioactivity decrease in the various fractions. The results show a specific curve of degradation of the des-AB fibrin monomer complexes with an interpolated half-time of 13.5 hours. The experiments furthermore showed that these soluble fibrin monomer complexes will dissociate into equal parts of complexes of lower molecular weight and monomeric fibrin subsequent to a temperature increase from 200C to 370C. It can be assumed that this dissociation process favourably affects the capability of intravascular fibrin to act as a solubility promoting agent. (orig.)

  18. Labeling internalizing anti-epidermal growth factor receptor variant III monoclonal antibody with 177Lu: in vitro comparison of acyclic and macrocyclic ligands

    International Nuclear Information System (INIS)

    Introduction: The monoclonal antibody (mAb) L8A4, reactive with the epidermal growth factor receptor variant III (EGFRvIII), internalizes rapidly in glioma cells after receptor binding. Combining this tumor-specific mAb with the low-energy β-emitter 177Lu would be an attractive approach for brain tumor radioimmunotherapy, provided that trapping of the radionuclide in tumor cells after mAb intracellular processing could be maximized. Materials and Methods: L8A4 mAb was labeled with 177Lu using the acyclic ligands [(R)-2-amino-3-(4-isothiocyanatophenyl)propyl]-trans-(S,S) -cyclohexane-1,2-diamine-pentaacetic acid (CHX-A''-DTPA), 2-(4-isothiocyanatobenzyl)-diethylenetriaminepenta-acetic acid (pSCN-Bz-DTPA) and 2-(4-isothiocyanatobenzyl)-6-methyldiethylenetriaminepentaacetic acid (1B4M-DTPA), and the macrocyclic ligands S-2-(4-isothiocyanatobenzyl)-1,4,7,10-tetraazacyclododecane-tetraacetic acid (C-DOTA) and α-(5-isothiocyanato-2-methoxyphenyl)-1,4,7,10-tetraazacyclododecane-1,4,7, 10-tetraacetic acid (MeO-DOTA). Paired-label internalization and cellular processing assays were performed on EGFRvIII-expressing U87.ΔEGFR glioma cells over 24 h to directly compare 177Lu-labeled L8A4 to L8A4 labeled with 125I using either iodogen or N-succinimidyl 4-guanidinomethyl-3-[125I]iodobenzoate ([125I]SGMIB). In order to facilitate comparison of labeling methods, the primary parameter evaluated was the ratio of 177Lu to 125I activity retained in U87.ΔEGFR cells. Results: All chelates demonstrated higher retention of internalized activity compared with mAb labeled using iodogen, with 177Lu/125I ratios of >20 observed for the three DTPA chelates at 24 h. When compared to L8A4 labeled using SGMIB, except for MeO-DOTA, internalized activity for 125I was higher than 177Lu from 1-8 h with the opposite behavior observed thereafter. At 24 h, 177Lu/125I ratios were between 1.5 and 3, with higher values observed for the three DTPA chelates. Conclusions: The nature of the chelate used to

  19. Ising and Heisenberg models on ferrimagnetic AB sub 2 chains

    CERN Document Server

    Vitoriano, C; Raposo, E P


    We study the Ising and Heisenberg models on one-dimensional ferrimagnetic bipartite chains with the special AB sub 2 unit-cell topology and experimental motivation in inorganic and organic magnetic polymers. The spin-1/2 AB sub 2 Ising case is exactly solved in the presence of an external magnetic field. We also derive asymptotical low- and high-temperature limits of several thermodynamical quantities of the zero-field classical AB sub 2 Heisenberg model. Further, the quantum spin-1/2 AB sub 2 Heisenberg model in a field is studied using a mean-field approach.

  20. Quality control of labelled compounds

    International Nuclear Information System (INIS)

    Some advantages and disadvantages of methods used for quality control of organic labelled compounds (131I, 14C) are shortly discussed. The methods used are electrophoresis, ultraviolet and infrared spectrometry, radiogas and thin-layer chromatography. (author)

  1. UK and Italian EIA systems: A comparative study on management practice and performance in the construction industry

    International Nuclear Information System (INIS)

    This study evaluates and contrasts the management practice and the performance that characterise Environmental Impact Assessments (EIA) in Italy and in the UK. The methodology relies on the investigation of six carefully selected case studies, critically reviewed by referring to EIA and project design information, as well as collecting the opinion of key project participants. The study focuses on the construction industry and on specific key sectors like infrastructure for transport and renewable energy and commercial and tourism development. A main term of reference for the analyses has been established by critically reviewing international literature so as to outline common good practice, requirements for the enhancement of sustainability principles and typically incurred drawbacks. The proposed approach enhances transfer of knowledge and of experiences between the analyzed contexts and allows the provision of guidelines for practitioners. Distinctive differences between the UK and the Italian EIA systems have been detected for pivotal phases and elements of EIA, like screening, scoping, analysis of alternatives and of potential impacts, definition of mitigation strategies, review, decision making, public participation and follow up. - Highlights: ► The Italian and the UK Environmental Impact Assessment systems are compared. ► The research is centred on the construction industry. ► Issues and shortcomings are analysed by investigating six case studies. ► Integration of EIA with sustainability principles is appraised. ► General guidelines are provided to assist practitioners in the two national contexts.

  2. UK and Italian EIA systems: A comparative study on management practice and performance in the construction industry

    Energy Technology Data Exchange (ETDEWEB)

    Bassi, Andrea, E-mail: [University of Bath, Faculty of Engineering and Design, Claverton Down, Bath BA2 7AY (United Kingdom); Howard, Robert, E-mail: [Construction Communications, 8 Cotton& #x27; s Field, Dry Drayton, Cambridge CB23 8DG (United Kingdom); Geneletti, Davide, E-mail: [Sustainability Science Program, Harvard University, 79 JFK Street, Cambridge, MA 02138 (United States); Dept. of Civil and Environmental Engineering, University of Trento, Via Mesiano, 77 38123 Trento (Italy); Ferrari, Simone, E-mail: [Dept. BEST, Building Environment Science and Technology, Politecnico di Milano, Via Bonardi, 3 20133 Milano (Italy)


    This study evaluates and contrasts the management practice and the performance that characterise Environmental Impact Assessments (EIA) in Italy and in the UK. The methodology relies on the investigation of six carefully selected case studies, critically reviewed by referring to EIA and project design information, as well as collecting the opinion of key project participants. The study focuses on the construction industry and on specific key sectors like infrastructure for transport and renewable energy and commercial and tourism development. A main term of reference for the analyses has been established by critically reviewing international literature so as to outline common good practice, requirements for the enhancement of sustainability principles and typically incurred drawbacks. The proposed approach enhances transfer of knowledge and of experiences between the analyzed contexts and allows the provision of guidelines for practitioners. Distinctive differences between the UK and the Italian EIA systems have been detected for pivotal phases and elements of EIA, like screening, scoping, analysis of alternatives and of potential impacts, definition of mitigation strategies, review, decision making, public participation and follow up. - Highlights: Black-Right-Pointing-Pointer The Italian and the UK Environmental Impact Assessment systems are compared. Black-Right-Pointing-Pointer The research is centred on the construction industry. Black-Right-Pointing-Pointer Issues and shortcomings are analysed by investigating six case studies. Black-Right-Pointing-Pointer Integration of EIA with sustainability principles is appraised. Black-Right-Pointing-Pointer General guidelines are provided to assist practitioners in the two national contexts.

  3. LabeledIn: cataloging labeled indications for human drugs. (United States)

    Khare, Ritu; Li, Jiao; Lu, Zhiyong


    Drug-disease treatment relationships, i.e., which drug(s) are indicated to treat which disease(s), are among the most frequently sought information in PubMed®. Such information is useful for feeding the Google Knowledge Graph, designing computational methods to predict novel drug indications, and validating clinical information in EMRs. Given the importance and utility of this information, there have been several efforts to create repositories of drugs and their indications. However, existing resources are incomplete. Furthermore, they neither label indications in a structured way nor differentiate them by drug-specific properties such as dosage form, and thus do not support computer processing or semantic interoperability. More recently, several studies have proposed automatic methods to extract structured indications from drug descriptions; however, their performance is limited by natural language challenges in disease named entity recognition and indication selection. In response, we report LabeledIn: a human-reviewed, machine-readable and source-linked catalog of labeled indications for human drugs. More specifically, we describe our semi-automatic approach to derive LabeledIn from drug descriptions through human annotations with aids from automatic methods. As the data source, we use the drug labels (or package inserts) submitted to the FDA by drug manufacturers and made available in DailyMed. Our machine-assisted human annotation workflow comprises: (i) a grouping method to remove redundancy and identify representative drug labels to be used for human annotation, (ii) an automatic method to recognize and normalize mentions of diseases in drug labels as candidate indications, and (iii) a two-round annotation workflow for human experts to judge the pre-computed candidates and deliver the final gold standard. In this study, we focused on 250 highly accessed drugs in PubMed Health, a newly developed public web resource for consumers and clinicians on prevention

  4. An analysis framework for characterizing and explaining development of EIA legislation in developing countries-Illustrated for Georgia, Ghana and Yemen

    Energy Technology Data Exchange (ETDEWEB)

    Kolhoff, Arend J., E-mail: [Netherlands Commission for Environmental Assessment, P.O. Box 2345, 3500 GH Utrecht (Netherlands); Driessen, Peter P.J., E-mail: [Copernicus Institute of Sustainable Development, Utrecht University, P.O. Box 80115, 3508 TC (Netherlands); Runhaar, Hens A.C., E-mail: [Copernicus Institute of Sustainable Development, Utrecht University, P.O. Box 80115, 3508 TC (Netherlands)


    Actors in the field of international development co-operation supporting the development of EIA legislation in developing countries often do not achieve the results envisaged. The performance of EIA in these countries often remains weak. One reason, we assume, is that often those actors support the establishment of overly ambitious EIA legislation that cannot achieve its objectives in the light of constraining contexts. To provide more effective support we need to better understand the enabling and constraining contextual factors that influence the development of EIA legislation and to which support actors should align itself. In this article a new analysis framework for classifying, characterizing and explaining the development of EIA legislation is described, measured in terms of ambition levels. Ambitions are defined as intentions the EIA authorities aim to fulfill, expressed in formal EIA legislation. Three country cases, Yemen, Georgia and Ghana are used to illustrate the usefulness of our framework and as a first test to refine the framework. We have formulated the following five hypotheses that complement and refine our analysis framework. One, EIA legislation may develop multilinearly in terms of ambition levels. Two, ambitions in EIA legislation seem to be influenced to a great extent by the power and capacity of, on the one hand, the environmental authorities supporting EIA and, on the other hand, the sector authorities hindering the development of EIA. Three, the political system is the most important context factor influencing the rules of policy-making and the power of the different actors involved. Four, the importance of context factors on the development of ambitions is dependent on the phase of EIA system development. Five, some ambitions seem to be influenced by particular factors; for instance the ambitions for the object of study seem to be influenced by the level of environmental awareness of the sector ministries and parliament. The analysis

  5. Guiding ab initio calculations by alchemical derivatives (United States)

    to Baben, M.; Achenbach, J. O.; von Lilienfeld, O. A.


    We assess the concept of alchemical transformations for predicting how a further and not-tested change in composition would change materials properties. This might help to guide ab initio calculations through multidimensional property-composition spaces. Equilibrium volumes, bulk moduli, and relative lattice stability of fcc and bcc 4d transition metals Zr, Nb, Mo, Tc, Ru, Rh, Pd, and Ag are calculated using density functional theory. Alchemical derivatives predict qualitative trends in lattice stability while equilibrium volumes and bulk moduli are predicted with less than 9% and 28% deviation, respectively. Predicted changes in equilibrium volume and bulk moduli for binary and ternary mixtures of Rh-Pd-Ag are in qualitative agreement even for predicted bulk modulus changes as large as +100% or -50%. Based on these results, it is suggested that alchemical transformations could be meaningful for enhanced sampling in the context of virtual high-throughput materials screening projects.

  6. Ab Initio Path to Heavy Nuclei

    CERN Document Server

    Binder, Sven; Calci, Angelo; Roth, Robert


    We present the first ab initio calculations of nuclear ground states up into the domain of heavy nuclei, spanning the range from 16-O to 132-Sn based on two- plus three-nucleon interactions derived within chiral effective field theory. We employ the similarity renormalization group for preparing the Hamiltonian and use coupled-cluster theory to solve the many-body problem for nuclei with closed sub-shells. Through an analysis of theoretical uncertainties resulting from various truncations in this framework, we identify and eliminate the technical hurdles that previously inhibited the step beyond medium-mass nuclei, allowing for reliable validations of nuclear Hamiltonians in the heavy regime. Following this path we show that chiral Hamiltonians qualitatively reproduce the systematics of nuclear ground-state energies up to the neutron-rich Sn isotopes.

  7. Operator evolution for ab initio nuclear theory

    CERN Document Server

    Schuster, Micah D; Johnson, Calvin W; Jurgenson, Eric D; Navratil, Petr


    The past two decades have seen a revolution in ab initio calculations of nuclear properties. One key element has been the development of a rigorous effective interaction theory, applying unitary transformations to soften the nuclear Hamiltonian and hence accelerate the convergence as a function of the model space size. For consistency, however, one ought to apply the same transformation to other operators when calculating transitions and mean values from the eigenstates of the renormalized Hamiltonian. Working in a translationally-invariant harmonic oscillator basis for the two- and three-nucleon systems, we evolve the Hamiltonian, square-radius and total dipole strength operators by the similarity renormalization group (SRG). The inclusion of up to three-body matrix elements in the 4He nucleus all but completely restores the invariance of the expectation values under the transformation. We also consider a Gaussian operator with adjustable range and find at short ranges an increased contribution from such ind...

  8. Discovering chemistry with an ab initio nanoreactor (United States)

    Martinez, Todd

    Traditional approaches for modeling chemical reaction networks such as those involved in combustion have focused on identifying individual reactions and using theoretical approaches to explore the underlying mechanisms. Recent advances involving graphical processing units (GPUs), commodity products developed for the videogaming industry, have made it possible to consider a distinct approach wherein one attempts to discover chemical reactions and mechanisms. We provide a brief summary of these developments and then discuss the concept behind the ``ab initio nanoreactor'' which explores the space of possible chemical reactions and molecular species for a given stoichiometry. The nanoreactor concept is exemplified with an example to the Urey-Miller reaction network which has been previously advanced as a potential model for prebiotic chemistry. We briefly discuss some of the future directions envisioned for the development of this nanoreactor concept.

  9. Ab initio molar volumes and Gaussian radii. (United States)

    Parsons, Drew F; Ninham, Barry W


    Ab initio molar volumes are calculated and used to derive radii for ions and neutral molecules using a spatially diffuse model of the electron distribution with Gaussian spread. The Gaussian radii obtained can be used for computation of nonelectrostatic ion-ion dispersion forces that underlie Hofmeister specific ion effects. Equivalent hard-sphere radii are also derived, and these are in reasonable agreement with crystalline ionic radii. The Born electrostatic self-energy is derived for a Gaussian model of the electronic charge distribution. It is shown that the ionic volumes used in electrostatic calculations of strongly hydrated cosmotropic ions ought best to include the first hydration shell. Ionic volumes for weakly hydrated chaotropic metal cations should exclude electron overlap (in electrostatic calculations). Spherical radii are calculated as well as nonisotropic ellipsoidal radii for nonspherical ions, via their nonisotropic static polarizability tensors. PMID:19140766

  10. Ab initio alpha-alpha scattering. (United States)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G


    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  11. Ab initio alpha-alpha scattering (United States)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.


    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  12. Ablation dynamics in laser sclerotomy ab externo (United States)

    Brinkmann, Ralf; Droege, Gerit; Mohrenstecher, Dirk; Scheu, M.; Birngruber, Reginald


    Laser sclerostomy ab externo with flashlamp excited mid-IR laser systems emitting in the 2-3 micrometer spectral range is in phase II clinical trials. Although acutely high success rates were achieved, the restenosis rate after several months is about 40%. Laser pulses of several hundreds of microseconds, known to induce thermo-mechanical explosive evaporation were used for this procedure. We investigated the ablation dynamics in tissue and the cavitation bubble dynamics in water by means of an Er:YAG laser system to estimate the extent of mechanical damage zones in the sclera and in the anterior chamber, which may contribute to the clinical failure. We found substantial mechanical tissue deformation during the ablation process caused by the cavitation effects. Stress waves up to several bar generated by explosive evaporization were measured. The fast mechanical stretching and collapsing of the scleral tissue induced by cavitation resulted in tissue dissection as could be proved by flash photography and histology. The observed high restenosis might be a result of a subsequent enhanced wound healing process. Early fistula occlusions due to iris adherences, observed in about 20% of the clinical cases may be attributed to intraocular trauma induced by vapor bubble expansion through the anterior chamber after scleral perforation. An automatic feedback system minimizing adverse effects by steering and terminating the laser process during scleral fistulization is demonstrated. Moreover, a new approach in laser sclerostomy ab externo is presented using a cw-IR laser diode system emitting at the 1.94 micrometer mid-IR water absorption peak. This system was used in vitro and showed smaller damage zones compared to the pulsed laser radiation.

  13. A few viewpoints on an EIA in connection with the siting of an encapsulation facility and a repository for spent nuclear fuel

    International Nuclear Information System (INIS)

    It is argued that the EIA can not be performed by the proponent (in this case SKB), but rather by a body that does not represent a main party of the project scrutinized. Also, the EIA process must fulfill the demands on insight and participation that different parties are entitled to make. Adequate time and funding must be available to facilitate a serious participation

  14. Environmental Impact Assessment (EIA of Gas Pipeline Transmission (Case Study: Duzduzan – Ahar

    Directory of Open Access Journals (Sweden)

    Saeed Karimi


    Full Text Available The national gas transmission Ahar – Duzduzan, transmit fresh gas in the West north of Iran. According to Iran’s environmental regulation, construction and operation of pipelines is required EIA studies. Due to this linear project it is required to develop a particular EIA methodology on this kind of projects. Therefore at first we attempted to get a real knowledge about environmental endnotes of project with library and field studies. Along with reviewing the technical resources of the project, attempted to identify all of the construction and operation activities. Finally two methods of explanatory checklist and simplified matrix selected for EIA. In The construction phase 19 micro activities have evaluated in front of about 12 environmental factors (in the various environments. In the construction phase, activities such as; excavation, embankment and excavation show the greatest negative impact on the whole environment of area. And the most important activity with positive effects on the aforementioned factors is manpower recruitment. Also In the operation phase 15 micro activities have evaluated in front of about 15 environmental factors (in the various environments. In the Operation phase activities such as; grazing, vehicle traffic and wastewater production can have negative effects. Most positive impacts on environmental factors are revenue and welfare, employment levels, commerce and manning activities, immigration control and air quality. Most of the Operation phase effects are positive which involve; exploitation of gas or natural gas transportation and gas pipeline monitoring. According to the developed methodology it is necessary to use RS and GIS tools in the study current environment situation, routing environmental alternatives and make land use maps of transmission path. With regard to all issues presented in explanatory checklist of this project and also previous clauses from the standpoint of environmental compliance

  15. Mindboggle: Automated brain labeling with multiple atlases

    International Nuclear Information System (INIS)

    To make inferences about brain structures or activity across multiple individuals, one first needs to determine the structural correspondences across their image data. We have recently developed Mindboggle as a fully automated, feature-matching approach to assign anatomical labels to cortical structures and activity in human brain MRI data. Label assignment is based on structural correspondences between labeled atlases and unlabeled image data, where an atlas consists of a set of labels manually assigned to a single brain image. In the present work, we study the influence of using variable numbers of individual atlases to nonlinearly label human brain image data. Each brain image voxel of each of 20 human subjects is assigned a label by each of the remaining 19 atlases using Mindboggle. The most common label is selected and is given a confidence rating based on the number of atlases that assigned that label. The automatically assigned labels for each subject brain are compared with the manual labels for that subject (its atlas). Unlike recent approaches that transform subject data to a labeled, probabilistic atlas space (constructed from a database of atlases), Mindboggle labels a subject by each atlas in a database independently. When Mindboggle labels a human subject's brain image with at least four atlases, the resulting label agreement with coregistered manual labels is significantly higher than when only a single atlas is used. Different numbers of atlases provide significantly higher label agreements for individual brain regions. Increasing the number of reference brains used to automatically label a human subject brain improves labeling accuracy with respect to manually assigned labels. Mindboggle software can provide confidence measures for labels based on probabilistic assignment of labels and could be applied to large databases of brain images

  16. Dicty_cDB: FCL-AB06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AB06 (Link to dictyBase) - - - Contig-U15603-1 FCL-AB06P ...(Link to Original site) FCL-AB06F 694 FCL-AB06Z 573 FCL-AB06P 1267 - - Show FCL-AB06 Library FCL (Link to library) Clone ID FCL-...3-1 Original site URL Representative seq. ID FCL-AB06P (Link to Original site) Representative DNA sequence >FCL-AB06 (FCL-AB06Q) /CSM/FCL/FCL-...AB/FCL-AB06Q.Seq.d/ CAATTTTATCGGAACCATCAATTCATGCAGGTTCTGTATTTAGTATTAATTTAACCAAAT CTAGACA

  17. 49 CFR 172.407 - Label specifications. (United States)


    ... line outer border to meet the requirements of § 172.406(d) of this subpart. (c) Size. (1) Each diamond..., numbers, and border must be shown in black on a label except that— (i) White may be used on a label with a... the CORROSIVE label. (iii) White may be used for the symbol for the ORGANIC PEROXIDE label. (3)...

  18. A Case of Laptop Computer-Induced Erythema Ab Igne

    Directory of Open Access Journals (Sweden)

    Nurettin Özgür Doğan


    Full Text Available Erythema ab igne, also known as toasted skin syndrome, is a skin reaction characterized by reticulate erythema, brown pigmentation, and telangiectasia. In some cases, epidermal atrophy and scaling are also identified. The condition is usually caused by prolonged exposure to a source of heat or infrared radiation. Here, we report a case of erythema ab igne associated with laptop computer use.

  19. Kopplung von Dichtefunktional- und ab-initio-Methoden


    Goll, Erich


    Im Rahmen der Doktorarbeit wurde untersucht, inwieweit die Kopplung von Dichtefunktionalmethoden und ab-initio-Korrelationsmethoden der Quantenchemie eine Verbesserung bezüglich beider Grenzmethoden erbringt. Die Kopplung erfolgt durch eine Aufspaltung des interelektronischen Hamiltonoperators (abstoßende Coulombwechselwirkung). Die kurzreichweitige Wechselwirkung wird mit Dichtefunktionaltheorie behandelt, die langreichweitige mit Hilfe von ab-initio-Methoden. Diese Aufteilung soll dazu dien...

  20. Radio labeling with pre-assigned frequencies


    Bodlaender, H.L.; Broersma, H.J.; Fomin, F.V.; Pyatkin, A.V.; Woeginer, G.J.


    A radio labeling of a graph G is an assignment of pairwise distinct, positive integer labels to the vertices of G such that labels of adjacent vertices differ by at least 2. The radio labeling problem (RL) consists in determining a radio labeling that minimizes the maximum label that is used (the so-called span of the labeling). RL is a well-studied problem, mainly motivated by frequency assignment problems in which transmitters are not allowed to operate on the same frequency channel. We con...

  1. Radio labeling with pre-assigned frequencies


    Bodlaender, H.L.; Broersma, H.J.; Fomin, F.V.; Pyatkin, A.V.; Woeginger, G.J.


    A radio labeling of a graph $G$ is an assignment of pairwise distinct, positive integer labels to the vertices of $G$ such that labels of adjacent vertices differ by at least $2$. The radio labeling problem (\\mbox{\\sc RL}) consists in determining a radio labeling that minimizes the maximum label that is used (the so-called span of the labeling). \\mbox{\\sc RL} is a well-studied problem, mainly motivated by frequency assignment problems in which transmitters are not allowed to operate on the sa...

  2. Photoaffinity Labeling of Plasma Proteins

    Directory of Open Access Journals (Sweden)

    Masaki Otagiri


    Full Text Available Photoaffinity labeling is a powerful technique for identifying a target protein. A high degree of labeling specificity can be achieved with this method in comparison to chemical labeling. Human serum albumin (HSA and α1-acid glycoprotein (AGP are two plasma proteins that bind a variety of endogenous and exogenous substances. The ligand binding mechanism of these two proteins is complex. Fatty acids, which are known to be transported in plasma by HSA, cause conformational changes and participate in allosteric ligand binding to HSA. HSA undergoes an N-B transition, a conformational change at alkaline pH, that has been reported to result in increased ligand binding. Attempts have been made to investigate the impact of fatty acids and the N-B transition on ligand binding in HSA using ketoprofen and flunitrazepam as photolabeling agents. Meanwhile, plasma AGP is a mixture of genetic variants of the protein. The photolabeling of AGP with flunitrazepam has been utilized to shed light on the topology of the protein ligand binding site. Furthermore, a review of photoaffinity labeling performed on other major plasma proteins will also be discussed. Using a photoreactive natural ligand as a photolabeling agent to identify target protein in the plasma would reduce non-specific labeling.

  3. Radioisotope method for leucocyte labelling

    International Nuclear Information System (INIS)

    Whole blood leukocytes were labelled with 99mTc-sulphocolloid, which was selectively deposited in phagocytizing polymorphonuclear cells. To achieve optimal phagocytosis, the authors prepared 99mTc sulphocoloid from a Bulgarian kit. The required size of the colloid particles (1,2 μm) was achieved after 90-120 min storage at room temperature without rotation. Leucocytes were labelled by a proposed by the authors original method: to 10 ml heparinized blood 0,26-0,30 GB 99mTc sulphocolloid was added, incubated for 60 min; the free sulphocolloid was centrifuged in the syringe. The labelled cell sediment was suspended in physiological saline and re-injected. In a study of 16 patients on gamma camera, suspected of having inflammatory processes, the mean labelling effectiveness was 59%, similar to the one reported by other authors, who used similar technique and ready-made kits. Eight patients had positive finding, the inflammatory process in 7 being visualized as early as on hour 2 or 3 and in 1 on hour 24. The new method developed for specific leucocyte labelling with the use of Bulgarian kit may gain acceptance in the visualization of vague inflammatory processes. 3 figs., 4 refs

  4. 49 CFR 172.430 - POISON label. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false POISON label. 172.430 Section 172.430... SECURITY PLANS Labeling § 172.430 POISON label. (a) Except for size and color, the POISON label must be as follows: EC02MR91.029 (b) In addition to complying with § 172.407, the background on the POISON label...

  5. Nutrition Labeling Using a Computer Program (United States)

    Metzger, Lloyd E.

    The 1990 Nutrition Labeling and Education Act mandated nutritional labeling of most foods. As a result, a large portion of food analysis is performed for nutritional labeling purposes. A food labeling guide and links to the complete nutritional labeling regulations are available online at˜dms/flg-toc.html. However, interpretation of these regulations and the appropriate usage of rounding rules, available nutrient content claims, reference amounts, and serving size can be difficult.

  6. A new monoclonal antibody radiopharmaceutical for radioimmunoscintigraphy of breast cancer: direct labeling of antibody and its quality control

    Directory of Open Access Journals (Sweden)

    Mojtaba Salouti


    Full Text Available Radioimmunoscintigraphy (RIS has found widespread clinical application in tumor diagnosis. The antibody (Ab PR81 is a new murine anti-MUC1 monoclonal antibody (MAb against human breast carcinoma. In this study a very simple, rapid and efficient method for labeling of this MAb with 99mTc, particularly suitable for development of a ‘kit’is described. The reduction of Ab was performed with 2-mercaptoethanol (2-ME at a molar ratio of 2000:1 (2-ME:MAb and the reduced Ab was labeled with 99mTc via methylene diphosphonate (MDP as a transchelator. The labeling efficiency which was determined by instant thin layer chromatography (ITLC was 94.2%±2.3. Radiocolloides measured by cellulose nitrate electrophoresis were 2.5%±1.7. In vitro stability of the labeled product in human serum which was measured by gel filtration chromatography (FPLC was 70%±5.7 over 24 hr. The integrity of labeled MAb was checked by means of SDS-PAGE and no significant fragmentation was observed. The results of the cell-binding studies showed that both labeled and unlabeled PR81 were able to compete for binding to MCF 7 cells. Biodistribution studies were performed in normal BALB/c mice at 4 and 24 hrs post-injection and no important accumulation was observed in vital organs. These results show that the new radiopharmaceutical may be considered as a promising candidate for imaging of breast cancer.

  7. Effects of Cry1F and Cry34Ab1/35Ab1 on storage pests (United States)

    Two crystalline protoxins from Bacillus thuringiensis (Bt), Cry1Fa1 and Cry34Ab1/Cry35Ab1 (Cry1F, Cry34/35), were evaluated for efficacy against lepidopteran and coleopteran storage pests. Cry1F was tested against the lepidopterans Sitotroga cerealella (Angoumois grain moth) and colonies of the lep...

  8. Positron emitter labeled enzyme inhibitors

    International Nuclear Information System (INIS)

    This invention involves a new strategy for imagining and mapping enzyme activity in the living human and animal body using positron emitter-labeled suicide enzyme inactivators or inhibitors which become covalently bound to the enzyme as a result of enzymatic catalysis. Two such suicide inactivators for monoamine oxidase have been labeled with carbon-11 and used to map the enzyme subtypes in the living human and animal body using PET. By using positron emission tomography to image the distribution of radioactivity produced by the body penetrating radiation emitted by carbon-11, a map of functionally active monoamine oxidase activity is obtained. Clorgyline and L-deprenyl are suicide enzyme inhibitors and irreversibly inhibit monoamine oxidase. When these inhibitors are labeled with carbon-11 they provide selective probes for monoamine oxidase localization and reactivity in vivo using positron emission tomography

  9. Preparation of grafted ABS and compatibilization of r-PET/ABS blends by the grafted ABS%ABS接枝物的制备及其对r-PET/ABS的增容作用

    Institute of Scientific and Technical Information of China (English)

    陈智军; 王益龙; 郑辰


    Two kinds of grafted acrylonitrile-butadiene-styrene copolymer(ABS), i.e. maleic anhydride (MAH) grafted ABS(ABS-g-MAH) and glycidyl methacrylate (GMA) grafted ABS (ABS-g-GMA), were prepared via reactive extrusion and were used as compatibilizer for recycled polyethylene glycol terephthalate (r-PET)/ABS blends. The results show that ABS-g-MAH and ABS-g-GMA can greatly improve the impact strength of the blends. ABS-g-MAH is superior to ABS-g-GMA in compatibilization effect. The optimal compatibilization effect is acquired when the grafting ratio of ABS-g-MAH is 1.35% and the mass content of the copolymer is 5%. Under such conditions, the notched and unnotched *Charpy impact strength of the r-PET/ABS/ABS-g--MAH blends rise by 42% and 23%, respectively, in comparison with those of r-PET/ ABS. The observation by scanning electron microscope(SEM) shows that adding grafted ABS can make ABS be dispersed more homogeneously in the r-PET continuous phase and make particle size more even.%通过反应挤出法制备马来酸酐(MAH)接枝丙烯腈-丁二烯-苯乙烯三元共聚物(ABS)(ABS-g-MAH)和甲基丙烯酸缩水甘油酯(GMA)接枝ABS(ABS-g-GMA),将其用于增容回收聚对苯二甲酸乙二酯(PET)瓶片(r-PET)/ABS共混物,发现能显著提高其混物的冲击强度.ABS-g-MAH的增容效果优于ABS-g-GMA;ABS-g-MAH的接枝率为1.35%,w(ABS-g-MAH)为5%时对r-PET/ABS的增容作用最佳,此时r-PET/ABS/ABS-g-MAH的简支梁缺口冲击强度和无缺口冲击强度比r-PET/ABS分别提高了42%和23%.扫描电子显微镜观察表明,加入ABS接枝物能使ABS在r-PET连续相中的分散更均匀,粒径尺寸更均一.

  10. Avidin-biotin system radiolabelling with 153Sm and its experimental study in pre-targeting radioimmunoimaging with anti-CEA McAb

    International Nuclear Information System (INIS)

    Objective: To evaluate the usefulness of 153Sm labelled avidin-biotin system in pre-targeting radioimmunoimaging (RII)with anti-CEA McAb. Methods: Chelate DTPA-biotin (DB2) was first radiolabelled with 153Sm and then bound this 153Sm-DB2 to streptavidin (SA). The labelling of McAb with 153Sm was conducted using the bifunctional chelate cyclic DTPA anhydride (cDTPAa). Experimental studies were carried out in nude mice bearing human colon carcinoma. The authors established two- and three-step strategies for avidin-biotin system pre-targeting techniques. In three-step method A, tumor-bearing nude mice were first injected with McAb-biotin followed by cold avidin (Av) 2 days later and then 153Sm-DB2 1 day after. But in three-step method B, one group of mice was injected with McAb-SA followed by cold biotin 2 days later, and 4 h after biotin, by 153Sm-SA. While two-step protocols consisted of the injection of 153Sm-SA 48 h or 96 h after pre-targeting with McAb-bition (method A); and the injection of 153Sm-DB2 48 h after the use of McAb-SA (method B). SPECT imaging was performed and biodistribution was studied at 4, 24, 48 or 72 h after injection of 153Sm labelled compounds. Results: The authors' results showed that: 1) The three-step method A allowed faster blood clearance of the 153Sm-DB2 and yielded higher T/NT ratios (5.76 at 4 h and 12.94 at 24 h). 2) In the two-step method A, a significant accumulation of 153Sm-SA was observed in the tumor of nude mice which were injected 153Sm-SA 2 days after pre-targeting. The uptake in the tumor was also relatively high even in nude mice received 153Sm-SA 4 days after pre-targeting, demonstrating that the McAb-bition was still bound to the tumors and accessible to the 153Sm-SA even after long period of time. 3) Two- and three-step method A could increase the T/NT ratio in RII, shortening the imaging time (24 and 4 h, respectively). Conclusions: Aforementioned studies provide an experimental evidence for the improvement of pre

  11. Configuration spaces with summable labels


    Salvatore, Paolo


    Let M be an n-manifold, and let A be a space with a partial sum behaving as an n-fold loop sum. We define the space C(M;A) of configurations in M with summable labels in A via operad theory. Some examples are symmetric products, labelled configuration spaces, and spaces of rational curves. We show that C(I^n,dI^n;A) is an n-fold delooping of C(I^n;A), and for n=1 it is the classifying space by Stasheff. If M is compact, parallelizable, and A is path connected, then C(M;A) is homotopic to the ...

  12. Denture labeling: A new approach

    Directory of Open Access Journals (Sweden)

    Pardeep K Bansal


    Full Text Available The need for denture labeling is important for forensic and social reasons in case patients need to be identified individually. The importance of denture marking has long been acknowledged by the dental profession. Over the years, various denture marking systems have been reported in the literature, but none till date fulfills all the prescribed ADA specifications. A simple, easy, inexpensive procedure for marking accurate identification marks on dentures with a lead foil is described here. The label caring the patient information is incorporated in the acrylic resin during the denture processing.

  13. Structural and biophysical characterization of Bacillus thuringiensis insecticidal proteins Cry34Ab1 and Cry35Ab1.

    Directory of Open Access Journals (Sweden)

    Matthew S Kelker

    Full Text Available Bacillus thuringiensis strains are well known for the production of insecticidal proteins upon sporulation and these proteins are deposited in parasporal crystalline inclusions. The majority of these insect-specific toxins exhibit three domains in the mature toxin sequence. However, other Cry toxins are structurally and evolutionarily unrelated to this three-domain family and little is known of their three dimensional structures, limiting our understanding of their mechanisms of action and our ability to engineer the proteins to enhance their function. Among the non-three domain Cry toxins, the Cry34Ab1 and Cry35Ab1 proteins from B. thuringiensis strain PS149B1 are required to act together to produce toxicity to the western corn rootworm (WCR Diabrotica virgifera virgifera Le Conte via a pore forming mechanism of action. Cry34Ab1 is a protein of ∼14 kDa with features of the aegerolysin family (Pfam06355 of proteins that have known membrane disrupting activity, while Cry35Ab1 is a ∼44 kDa member of the toxin_10 family (Pfam05431 that includes other insecticidal proteins such as the binary toxin BinA/BinB. The Cry34Ab1/Cry35Ab1 proteins represent an important seed trait technology having been developed as insect resistance traits in commercialized corn hybrids for control of WCR. The structures of Cry34Ab1 and Cry35Ab1 have been elucidated to 2.15 Å and 1.80 Å resolution, respectively. The solution structures of the toxins were further studied by small angle X-ray scattering and native electrospray ion mobility mass spectrometry. We present here the first published structure from the aegerolysin protein domain family and the structural comparisons of Cry34Ab1 and Cry35Ab1 with other pore forming toxins.

  14. EIA model documentation: Petroleum market model of the national energy modeling system

    Energy Technology Data Exchange (ETDEWEB)



    The purpose of this report is to define the objectives of the Petroleum Market Model (PMM), describe its basic approach, and provide detail on how it works. This report is intended as a reference document for model analysts, users, and the public. Documentation of the model is in accordance with EIA`s legal obligation to provide adequate documentation in support of its models. The PMM models petroleum refining activities, the marketing of petroleum products to consumption regions, the production of natural gas liquids in gas processing plants, and domestic methanol production. The PMM projects petroleum product prices and sources of supply for meeting petroleum product demand. The sources of supply include crude oil, both domestic and imported; other inputs including alcohols and ethers; natural gas plant liquids production; petroleum product imports; and refinery processing gain. In addition, the PMM estimates domestic refinery capacity expansion and fuel consumption. Product prices are estimated at the Census division level and much of the refining activity information is at the Petroleum Administration for Defense (PAD) District level.

  15. Predicting short term (1 week to 6 months) fuel prices using EIA data

    International Nuclear Information System (INIS)

    Events in the oil market from August 1990 to February 1991 provide an excellent case study for understanding the relationship of oil inventories, product inventories, refinery utilization rates and the prices of crude oil and products. This paper presents a basic overview of how the system works and demonstrates how anyone can predict what will happen next using EIA weekly data. The system of analysis require only that one think logically about the factors involved. The system never fails because it is based on certain conditions which do not change, such as the limited capacity of refineries, storage and transportation facilities. As one becomes familiar with the general theory behind this type of analysis, it is possible to accurately predict the behavior of gasoline and diesel prices in separate areas of the US. Because the US is the primary user of crude oil, conditions in the US refining market also significantly influence the price of crude oil. These price fluctuations can also be anticipated by watching the EIA data

  16. Analysis of the radiochemical purity of DTPA-coupled anti-CEA monoclonal antibody labelled with samarium-153

    International Nuclear Information System (INIS)

    Objective: To establish a paper chromatography method for analyzing radiochemical purity of cyclic DTPA anhydride coupled anti-CEA monoclonal antibody (McAb) labelled with 153Sm. Methods: The separation efficacy of free 153Sm3+ and 153Sm-CEA McAb was determined with a variety of paper chromatograph systems. The optimal separation conditions were studied, and the result determined with this paper chromatography compared with that of Sephadex G-50 chromatograph. Results: The optimal separation condition of the paper chromatograph system was as follows: Tributyl phosphate: 2-butanone: ethyl acetate (V/V/V = 4/10/3) as solvent and No. 1 Xinhua filter paper immerged with 30% ammonium nitrate for 30 min. and then dried as carrier. The percentage of labelling field determined with this paper chromatography was consistent with that of Sephadex G-50 chromatograph. Conclusion: It is showed this method proves to be simple, convenient and can be rapidly performed

  17. Ab initio gene identification in metagenomic sequences. (United States)

    Zhu, Wenhan; Lomsadze, Alexandre; Borodovsky, Mark


    We describe an algorithm for gene identification in DNA sequences derived from shotgun sequencing of microbial communities. Accurate ab initio gene prediction in a short nucleotide sequence of anonymous origin is hampered by uncertainty in model parameters. While several machine learning approaches could be proposed to bypass this difficulty, one effective method is to estimate parameters from dependencies, formed in evolution, between frequencies of oligonucleotides in protein-coding regions and genome nucleotide composition. Original version of the method was proposed in 1999 and has been used since for (i) reconstructing codon frequency vector needed for gene finding in viral genomes and (ii) initializing parameters of self-training gene finding algorithms. With advent of new prokaryotic genomes en masse it became possible to enhance the original approach by using direct polynomial and logistic approximations of oligonucleotide frequencies, as well as by separating models for bacteria and archaea. These advances have increased the accuracy of model reconstruction and, subsequently, gene prediction. We describe the refined method and assess its accuracy on known prokaryotic genomes split into short sequences. Also, we show that as a result of application of the new method, several thousands of new genes could be added to existing annotations of several human and mouse gut metagenomes. PMID:20403810

  18. Ab initio two-component Ehrenfest dynamics

    International Nuclear Information System (INIS)

    We present an ab initio two-component Ehrenfest-based mixed quantum/classical molecular dynamics method to describe the effect of nuclear motion on the electron spin dynamics (and vice versa) in molecular systems. The two-component time-dependent non-collinear density functional theory is used for the propagation of spin-polarized electrons while the nuclei are treated classically. We use a three-time-step algorithm for the numerical integration of the coupled equations of motion, namely, the velocity Verlet for nuclear motion, the nuclear-position-dependent midpoint Fock update, and the modified midpoint and unitary transformation method for electronic propagation. As a test case, the method is applied to the dissociation of H2 and O2. In contrast to conventional Ehrenfest dynamics, this two-component approach provides a first principles description of the dynamics of non-collinear (e.g., spin-frustrated) magnetic materials, as well as the proper description of spin-state crossover, spin-rotation, and spin-flip dynamics by relaxing the constraint on spin configuration. This method also holds potential for applications to spin transport in molecular or even nanoscale magnetic devices

  19. Connected Component Labeling Using Components Neighbors-Scan Labeling Approach

    Directory of Open Access Journals (Sweden)

    Akmal Rakhmadi


    Full Text Available Problem statement: Many approaches have been proposed in previous such as the classic sequential connected components labeling algorithm which is relies on two subsequent raster-scans of a binary image. This method produced good performance in terms of accuracy, but because of the implementation of the image processing systems now requires faster process of the computer, the speed of this technique’s process has become an important issue. Approach: A computational approach, called components neighbors-scan labeling algorithm for connected component labeling was presented in this study. This algorithm required scanning through an image only once to label connected components. The algorithm started by scanning from the head of the component’s group, before tracing all the components neighbors by using the main component’s information. This algorithm had desirable characteristics, it is simple while promoted accuracy and low time consuming. By using a table of components, this approach also gave other advantages as the information for the next higher process. Results: The approach had been tested with a collection of binary images. In practically all cases, the technique had successfully given the desired result. Averagely, from the results the algorithm increased the speed around 67.4% from the two times scanning method. Conclusion: Conclusion from the comparison with the previous method, the approach of components neighbors-scan for connected component labeling promoted speed, accuracy and simplicity. The results showed that the approach has a good performance in terms of accuracy, the time consumed and the simplicity of the algorithm.

  20. Third party labeling and the consumer decision process: the case of the PGI European label


    Larceneux, Fabrice; Carpenter, Marie


    The objective of this research is to explore the decision-making process of consumers when faced with food products that have values-based labels. An experimental methodology was used to test the impact of a label of origin guaranteed by the European Union, the Protected Geographic Indications (PGI) label. Consumers' reactions to two different products were investigated with four different presentations: without a specific label, with a simple regional label, with both a regional label and th...

  1. On the hierarchical parallelization of ab initio simulations

    CERN Document Server

    Ruiz-Barragan, Sergi; Shiga, Motoyuki


    A hierarchical parallelization has been implemented in a new unified code PIMD-SMASH for ab initio simulation where the replicas and the Born-Oppenheimer forces are parallelized. It is demonstrated that ab initio path integral molecular dynamics simulations can be carried out very efficiently for systems up to a few tens of water molecules. The code was then used to study a Diels-Alder reaction of cyclopentadiene and butenone by ab initio string method. A reduction in the reaction energy barrier is found in the presence of hydrogen-bonded water, in accordance with experiment.

  2. Nutrition Marketing on Food Labels (United States)

    Nutrition marketing may influence purchasing behavior and thereby be a factor in the obesity epidemic. Very little peer-reviewed research has been published which investigates the relationship between nutrition marketing on food labels and consumer behavior. The purpose of this paper was to give an ...

  3. Improving the energy labelling scheme

    DEFF Research Database (Denmark)

    Gram-Hanssen, Kirsten; Christensen, Toke Haunstrup

    This report summarises the main results of an EU project on consumer response to energy labels in buildings. This report is mainly directed at Danish policy makers. The main focus is therefore on results that are relevant from a Danish point of view and on how they can be used to further strength...

  4. Listeria spp. in broiler flocks: recovery rates and species distribution investigated by conventional culture and the EiaFoss method

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård; Madsen, Mogens

    The occurrence of Listeria monocytogenes in samples from broiler houses and cloacal swabs taken at the abattoir was investigated. An automated immunobased method (EiaFoss) was used, and 42 samples were also analysed by conventional culture; both methods were based on a two-step selective enrichment...

  5. Seasonal dependence of the "forecast parameter" based on the EIA characteristics for the prediction of Equatorial Spread F (ESF

    Directory of Open Access Journals (Sweden)

    S. V. Thampi


    Full Text Available In an earlier study, Thampi et al. (2006 have shown that the strength and asymmetry of Equatorial Ionization Anomaly (EIA, obtained well ahead of the onset time of Equatorial Spread F (ESF have a definite role on the subsequent ESF activity, and a new "forecast parameter" has been identified for the prediction of ESF. This paper presents the observations of EIA strength and asymmetry from the Indian longitudes during the period from August 2005–March 2007. These observations are made using the line of sight Total Electron Content (TEC measured by a ground-based beacon receiver located at Trivandrum (8.5° N, 77° E, 0.5° N dip lat in India. It is seen that the seasonal variability of EIA strength and asymmetry are manifested in the latitudinal gradients obtained using the relative TEC measurements. As a consequence, the "forecast parameter" also displays a definite seasonal pattern. The seasonal variability of the EIA strength and asymmetry, and the "forecast parameter" are discussed in the present paper and a critical value for has been identified for each month/season. The likely "skill factor" of the new parameter is assessed using the data for a total of 122 days, and it is seen that when the estimated value of the "forecast parameter" exceeds the critical value, the ESF is seen to occur on more than 95% of cases.

  6. Immune status of health care workers to measles virus: evaluation of protective titers in four measles IgG EIAs

    NARCIS (Netherlands)

    Dorigo-Zetsma, J.W.; Hall, M.A.; Vreeswijk, J.; Vries, J.J. de; Vossen, A.C.; Hulscher, H.I. Ten; Kerkhof, J.; Smits, G.P.; Ruijs, W.L.M.; Koopmans, M.P.; Binnendijk, R.S. van


    BACKGROUND: Following the recognition of a measles case in a hospital in The Netherlands, health care workers (HCW) from the premises were screened by a commercial enzyme immunoassay (EIA) for measles IgG to identify persons at risk for measles. At least 10% of the HCW were tested measles IgG-negati

  7. Quantitation of imaging with I-131-F(ab')/sub 2/ fragments of monoclonal antibody in patients

    International Nuclear Information System (INIS)

    Iodine-131 labeled F(ab')/sub 2/ fragments of monoclonal antibody (IgG/sub 2a/ immunoglobulin with specificity for a cell surface antigen of colon carcinoma) have been used for quantitative imaging of tumor in 27 patients. Activity of I-131 F(ab')/sub 2/ fragments localized in tumor and in liver was quantitated using a modification of the method of Thomas SR, employing computer-acquired conjugate views (i.e. 180 opposed) to eliminate need for tumor or organ depth and tissue attenuation. The method was validated with an abdominal imaging phantom showing accuracy of +/- 10%. Quantitation indicates that activity reaches a peak in tumor at 48-72 hours and the ratio of activity in hepatic metastases to activity in liver peaks at approximately 72 hours. Mean activity in tumor was less than 0.01% of the administered dose per gram of tumor at any imaging time from 24 to 168 hours, while mean activity in surrounding liver was less than .002% of administered dose per gram of liver at any imaging time. Liver activity decreased monotonically with time, showing no peak activity. This non-invasive method of quantitating the distribution of F(ab')/sub 2/ fragments of monoclonal antibody in patients has proven accurate by comparison with phantom simulation. This type of quantitation is necessary for evaluating optimal imaging time, comparing relative utility of various antibodies and has use for therapeutic applications of monoclonal antibody fragments

  8. Treatment of HER2-positive breast carcinomatous meningitis with intrathecal administration of α-particle-emitting 211At-labeled trastuzumab

    International Nuclear Information System (INIS)

    Introduction: Carcinomatous meningitis (CM) is a devastating disease characterized by the dissemination of malignant tumor cells into the subarachnoid space along the brain and spine. Systemic treatment with monoclonal antibody (mAb) trastuzumab can be effective against HER2-positive systemic breast carcinoma but, like other therapies, is ineffective against CM. The goal of this study was to evaluate the therapeutic effect of α-particle emitting 211At-labeled trastuzumab following intrathecal administration in a rat model of breast carcinoma CM. Methods: Athymic rats were injected intrathecally with MCF-7/HER2-18 breast carcinoma cells through a surgically implanted indwelling intrathecal catheter. In Experiment 1, animals received 33 or 66 μCi 211At-labeled trastuzumab, cold trastuzumab or saline. In Experiment 2, animals were inoculated with a lower tumor burden and received 46 or 92 μCi 211At-labeled trastuzumab or saline. In Experiment 3, animals received 28 μCi 211At-labeled trastuzumab, 30 μCi 211At-labeled TPS3.2 control mAb or saline. Histopathological analysis of the neuroaxis was performed at the end of the study. Results: In Experiment 1, median survival increased from 21 days for the saline and cold trastuzumab groups to 45 and 48 days for 33 and 66 μCi 211At-labeled trastuzumab, respectively. In Experiment 2, median survival increased from 23 days for saline controls to 68 and 92 days for 46 and 92 μCi 211At-labeled trastuzumab, respectively. In Experiment 3, median survival increased from 20 days to 29 and 36 days for animals treated with 211At-labeled TPS3.2 and 211At-labeled trastuzumab, respectively. Long-term survivors were observed exclusively in the 211At-trastuzumab-treated groups. Conclusion: Intrathecal 211At-labeled trastuzumab shows promise as a treatment for patients with HER2-positive breast CM.

  9. The labeling debate in the United States. (United States)

    Marchant, Gary E; Cardineau, Guy A


    The mandatory labeling of genetically modified (GM) food has become the predominant policy issue concerning biotechnology in the United States. The controversy over GM labeling is being debated at several different levels and branches of government. At the federal level, the Food and Drug Administration, which has primary jurisdiction over food safety and labeling, has steadfastly refused to require labeling of GM foods since 1992 based on its conclusion that GM foods as a category present no unique or higher risks than other foods. Proposed legislation has been repeatedly introduced in the US. Congress over the years to mandate GM labeling, but has made very little progress. With federal labeling requirements apparently stalled, the main activity has switched to the state level, where numerous individual states are considering mandatory GM labeling, either through legislation or proposition. The debate over GM labeling, at both the federal and state levels, has focused on five issues: (1) public opinion; (2) the legality of labeling requirements; (3) the risks and benefits of GM foods; (4) the costs and burdens of GM labeling; and (5) consumer choice. While the pro-labeling forces argue that all of these factors weigh in favor of mandatory GM labeling, a more careful evaluation of the evidence finds that all five factors weigh decisively against mandatory GM labeling requirements. PMID:23982076

  10. Tensile deformation mechanisms of ABS/PMMA/EMA blends (United States)

    Wang, S. H.; Gao, J.; Lin, S. X.; Zhang, P.; Huang, J.; Xu, L. L.


    The tensile deformation mechanisms of acrylonitrile - butadiene - styrene (ABS) / polymethyl methacrylate (PMMA) blends toughened by ethylene methacrylate (EMA) copolymer was investigated by analysing the fracture morphology. ABS/PMMA was blended with EMA copolymer by melt mixing technique using co-rotating twin extruder. Tensile tests show that the elongation at break of ABS/PMMA blends can be efficiently improved with the increase in EMA content. Fracture morphology of ABS/PMMA/EMA blends reveals that the material yield induced by hollowing-out of EMA particles and its propagation into yield zone is the main toughening mechanism. Moreover, the appearance that EMA particles in the central area are given priority to hollowing-out may be related to the skin-core structure of the injection moulded parts caused by the different cooling rate between surface and inside in the process of injection moulding.

  11. Possibilities of implementing progesterone EIA test in the control of reproduction in dairy cows

    Directory of Open Access Journals (Sweden)

    Barna S. Tomislav,


    Full Text Available The aim of this study was to implement the progesterone EIA test, developed in our laboratory by using an anti-progesterone antibody (Yamaguchi University, Japan, in order to determine the optimal moment for artificial insemination (AI and to detect pregnancy in Holstein-Friesian cows according to the progesterone concentration in the whole milk. Also, the influence of β-carotene, applied at the day of insemination and human chorionic gonadotrophin applied on day 7 after AI on the progesterone level and the pregnancy rate were evaluated.For the accuracy of oestrus detection, the milk samples from 70 cows were collected on the day of insemination. Milk samples from 148 cows were collected 19-22 days following insemination for pregnancy check.After detection of naturally occurring oestrus (day 0 and AI, cows were divided into the following groups: group A (n = 19 was treated with 200 mg β-carotene (20 ml Carofertin® i.m. Alvetra u. Werfft Gmbh, Austria, group B (n = 17 was treated with 1 500 IU hCG i.m. (Schering-Plough, the Netherlands and control (non treated group C (n = 18. The milk samples for EIA progesterone concentration analysis were collected on the day of AI, the 14th and the 20th day of the oestrus cycle. Oestrus detection errors and inappropriate moments of insemination according to the progesterone concentration were detected in 22.86% animals (16/70. The test accuracy for non-pregnant cows was 90.48% (76/84. The accuracy of the progesterone test in pregnant cows was 75% (48/64. False positive results (high progesterone level, but the cows were not pregnant was detected in 25% of cows (16/64 as a result of a prolonged oestrus cycles, embrional mortality and endomethritis (10/16 cases. The treatment of cows with 1500 IU of hCG, on the day 7 of the oestrus cycle, resulted in statistically significant increase of progesterone concentration in the dioestrus (P 0.05.The EIA test developed in our laboratory could be used for accurate

  12. A Multi-Label Classification Approach Based on Correlations Among Labels

    Directory of Open Access Journals (Sweden)

    Raed Alazaidah


    Full Text Available Multi label classification is concerned with learning from a set of instances that are associated with a set of labels, that is, an instance could be associated with multiple labels at the same time. This task occurs frequently in application areas like text categorization, multimedia classification, bioinformatics, protein function classification and semantic scene classification. Current multi-label classification methods could be divided into two categories. The first is called problem transformation methods, which transform multi-label classification problem into single label classification problem, and then apply any single label classifier to solve the problem. The second category is called algorithm adaptation methods, which adapt an existing single label classification algorithm to handle multi-label data. In this paper, we propose a multi-label classification approach based on correlations among labels that use both problem transformation methods and algorithm adaptation methods. The approach begins with transforming multi-label dataset into a single label dataset using least frequent label criteria, and then applies the PART algorithm on the transformed dataset. The output of the approach is multi-labels rules. The approach also tries to get benefit from positive correlations among labels using predictive Apriori algorithm. The proposed approach has been evaluated using two multi-label datasets named (Emotions and Yeast and three evaluation measures (Accuracy, Hamming Loss, and Harmonic Mean. The experiments showed that the proposed approach has a fair accuracy in comparison to other related methods.

  13. Ab-initio study of thermoelectricity of layered tellurium compounds


    Ibarra Hernández, Wilfredo


    In this thesis, we explore the electronic, dynamic and thermoelectric properties of different tellurium-based compounds. We perform ab-initio calculations within the Vienna Ab-initio Simulation Package (VASP) that works in the framework of Density Functional Theory (DFT). For the thermoelectric properties, we use the Boltztrap code that solves the Boltzmann Transport Equations (BTE) for electrons within the Constant Relaxation Time Approximation (CRTA). This computational pa...

  14. Evaluation of the Urotest AB antibacterial substance detection test.


    Blondeau, J. M.; Yaschuk, Y; Galenzoski, D; Hrabok, D; Isaacson, M; Lee, L.(Department of Physics, Yale University, New Haven, CT, USA); Link, H; Walshaw, L


    The Urotest AB was used to detect antimicrobial substances in urine samples. Of 1022 urine specimens evaluated, Urotest AB detected inhibitors in 38.9%. Of 159 urine specimens from patients thought to be taking an antibiotic, inhibitors were detected in 80.5%. This test may help to explain culture negative urine samples from symptomatic patients, and could help elucidate treatment failures and the epidemiology of antibiotic resistance.

  15. Toward ab initio density functional theory for nuclei


    Drut, J. E.; Furnstahl, R. J.; Platter, L.


    We survey approaches to nonrelativistic density functional theory (DFT) for nuclei using progress toward ab initio DFT for Coulomb systems as a guide. Ab initio DFT starts with a microscopic Hamiltonian and is naturally formulated using orbital-based functionals, which generalize the conventional local-density-plus-gradients form. The orbitals satisfy single-particle equations with multiplicative (local) potentials. The DFT functionals can be developed starting from internucleon forces using ...

  16. Deriving conservation laws for ABS lattice equations from Lax pairs

    International Nuclear Information System (INIS)

    In this paper we derive infinitely many conservation laws for ABS lattice equations from their Lax pairs. These conservation laws can be algebraically expressed by means of some known polynomials. For each equation, the infinitely many conservation laws are not equivalent and are nontrivial. We also show that the (H1), (H2), (H3), (Q1), (Q2), (Q3) and (A1) equations in the ABS list share a generic discrete Riccati equation. (paper)

  17. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... Cerebral Palsy: Caring for Your Child All About Food Allergies How to Read a Nutrition Facts Label ( ... THIS TOPIC Keeping Portions Under Control Figuring Out Food Labels Healthy Food Shopping If My Child Has ...

  18. Preparation of 35S labelled thiosemicarbazone

    International Nuclear Information System (INIS)

    A 35S labelled thiosemicarbazone is prepared, on a millimole scale by reacting labelled thiocyanate with hydrazine sulfate in ethanolic medium. The hydrazine thiocyanate so formed is then condensed with aldehyde to form the thiosemicarbazone

  19. Preparation of methyl-3H labelled dimethylnitrosamine

    International Nuclear Information System (INIS)

    Tritium labelled dimethylamine was prepared from benzalmethylimine in reaction with methyl-3H iodide followed by hydrolysis. The product was converted with sodium nitrite in glacial acetic acid into labelled dimethylnitrosamine. The radiochemical yield was 85%. (author)

  20. Labelling schemes: From a consumer perspective

    DEFF Research Database (Denmark)

    Juhl, Hans Jørn; Stacey, Julia


    , their size etc. are studied before setting up a label scheme. A new labelling study was launched in 2000, the purpose of which is to: * improve the foundation for evaluating the value and effect of labelling schemes * improve the possibilities for pursuing an active consumer policy within the area * give......Labelling of food products attracts a lot of political attention these days. As a result of a number of food scandals, most European countries have acknowledged the need for more information and better protection of consumers. Labelling schemes are one way of informing and guiding consumers....... However, initiatives in relation to labelling schemes seldom take their point of departure in consumers' needs and expectations; and in many cases, the schemes are defined by the institutions guaranteeing the label. It is therefore interesting to study how consumers actually value labelling schemes...

  1. Ivabradine: A Review of Labeled and Off-Label Uses. (United States)

    Oliphant, Carrie S; Owens, Ryan E; Bolorunduro, Oluwaseyi B; Jha, Sunil K


    Ivabradine is a unique medication recently approved in the USA for the treatment of select heart failure patients. It was first approved for use in several countries around the world over a decade ago as an anti-anginal agent, with subsequent approval for use in heart failure patients. Since ivabradine has selective activity blocking the I f currents in the sinus node, it can reduce heart rate without appreciable effects on blood pressure. Given this heart-rate-specific effect, it has been investigated in many off-label indications as an alternative to traditional heart-rate-reducing medications such as beta blockers and calcium channel blockers. We conducted searches of PubMed and Google Scholar for ivabradine, heart failure, HFrEF, HFpEF, angina, coronary artery disease, inappropriate sinus tachycardia, postural orthostatic hypotension, coronary computed tomography angiography and atrial fibrillation. We reviewed and included studies, case reports, and case series published between 1980 and June 2016 if they provided information relevant to the practicing clinician. In many cases, larger clinical trials are needed to solidify the benefit of ivabradine, although studies indicate benefit in most therapeutic areas explored to date. The purpose of this paper is to review the current labeled and off-label uses of ivabradine, with a focus on clinical trial data. PMID:27405864

  2. 77 FR 12313 - Food Labeling Workshop; Public Workshop (United States)


    ..., (3) nutrition labeling requirements, (4) health and nutrition claims, and (5) special labeling issues... with labeling requirements, especially in light of growing concerns about obesity and food...

  3. 基于ABS的ABS/ASR集成液压系统设计%ABS/ASR Integrated Hydraulic System Based on ABS

    Institute of Scientific and Technical Information of China (English)

    马岳峰; 刘昭度; 吴利军; 王国业


    介绍一种基于JETTA GTX轿车ABS液压系统的ABS/ASR集成液压系统改造方案,该ABS/ASR集成液压系统在原有ABS液压系统的基础上增加较少的液压元件实现全部ABS功能和ASR制动干预控制功能,改造后的集成系统工作可靠,不影响原有的常规制动和ABS制动过程.

  4. Do Consumers Really Use Food Labels?


    Ward, Ronald W.; Jauregui, Carlos E.


    Ordered Probit models are used to estimate the probabilities of consumers reading food labels for harmful ingredients and for using labels to assist with food purchasing decisions. Demographics, health concerns, attitudes, and eating habits are shown to influence the likelihood of using food labels. Effects from over 25 variables are ranked in terms of their relative impacts on the use of food labels. Dieting, concerns about calories, foreign foods, and many other variable effects on the use ...

  5. Lymphoma imaging with a new technetium-99m labelled antibody, LL2

    Energy Technology Data Exchange (ETDEWEB)

    Murthy, S.; Sharkey, R.M.; Goldenberg, D.M.; Lee, R.E.; Pinsky, C.M.; Hansen, H.J.; Burger, K.; Swayne, L.C. (Center for Molecular Medicine and Immunology, Newark, NJ (United States) Garden State Cancer Center, Newark, NJ (United States) Immunomedics, Inc., Warren, NJ (United States) University Hospital, UMDNJ, Newark, NJ (United States). Dept. of Radiology Morristown Memorial Hospital, NJ (United States))


    The lesion detection capability of a new technetium-99m labelled B-cell lymphoma monoclonal antibody (MoAb) imaging agent, LL2, was evaluated in 8 patients with non-Hodgkin's lymphoma and 1 patient with chronic lymphocytic leukaemia. The MoAb kit consists of a 1-vial, 1-mg Fab' form of LL2 ready for instant labelling with technetium. The patients were injected with {proportional to}925 MBq (25 mCi) of {sup 99m}Tc-LL2 Fab' (1 mg), and planar and single photon emission tomography (SPET) studies were performed at 3-4 h post injection and at 24 h. There was no evidence of thyroid or stomach activity up to 24 h. Uniform splenic uptake was seen in all patients. Two non-lymphoma patients were also administered with the same agent and demonstrated a similar splenic distribution; therefore, splenic targeting was not scored as tumour-specific. A total of 29 from 48 tumour sites were detected by scintigraphy, including tumours of various grades and histological types. Excluding 1 patient who had a large tumour burden of over 500 g, 29 of 33 lesions were detected. One patient was free of disease at the time of the study and had a negative scan. Another patient showed excellent targeting of gallium-negative sites in the liver and bone. The bone involvement was not known prior to the antibody study and was subsequently confirmed by a bone scan. Additional sites of MoAb localization could not be followed in this group, since most patients went on to radioimmunotherapy immediately following the {sup 99m}Tc-LL2 study. However, these initial results suggest that this new {sup 99m}Tc-labelled antibody imaging kit should be further investigated for its potential role in the staging and follow-up of lymphoma patients. (orig.).

  6. 99mTc: Labeling Chemistry and Labeled Compounds (United States)

    Alberto, R.; Abram, U.

    This chapter reviews the radiopharmaceutical chemistry of technetium related to the synthesis of perfusion agents and to the labeling of receptor-binding biomolecules. To understand the limitations of technetium chemistry imposed by future application of the complexes in nuclear medicine, an introductory section analyzes the compulsory requirements to be considered when facing the incentive of introducing a novel radiopharmaceutical into the market. Requirements from chemistry, routine application, and market are discussed. In a subsequent section, commercially available 99mTc-based radiopharmaceuticals are treated. It covers the complexes in use for imaging the most important target organs such as heart, brain, or kidney. The commercially available radiopharmaceuticals fulfill the requirements outlined earlier and are discussed with this background. In a following section, the properties and perspectives of the different generations of radiopharmaceuticals are described in a general way, covering characteristics for perfusion agents and for receptor-specific molecules. Technetium chemistry for the synthesis of perfusion agents and the different labeling approaches for target-specific biomolecules are summarized. The review comprises a general introduction to the common approaches currently in use, employing the N x S4-x , [3+1] and 2-hydrazino-nicotinicacid (HYNIC) method as well as more recent strategies such as the carbonyl and the TcN approach. Direct labeling without the need of a bifunctional chelator is briefly reviewed as well. More particularly, recent developments in the labeling of concrete targeting molecules, the second generation of radiopharmaceuticals, is then discussed and prominent examples with antibodies/peptides, neuroreceptor targeting small molecules, myocardial imaging agents, vitamins, thymidine, and complexes relevant to multidrug resistance are given. In addition, a new approach toward peptide drug development is described. The section

  7. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... Cerebral Palsy: Caring for Your Child All About Food Allergies How to Read a Nutrition Facts Label (Video) KidsHealth > For Parents > How to Read a Nutrition Facts Label (Video) Print A A A Text Size ... MORE ON THIS TOPIC Keeping Portions Under Control Figuring Out Food Labels Healthy Food Shopping If My Child Has ...

  8. 40 CFR 211.105 - Label format. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Label format. 211.105 Section 211.105 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS PRODUCT NOISE LABELING General Provisions § 211.105 Label format. (a) Unless specified otherwise in other...

  9. 21 CFR 701.11 - Identity labeling. (United States)


    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Identity labeling. 701.11 Section 701.11 Food and... COSMETIC LABELING Package Form § 701.11 Identity labeling. (a) The principal display panel of a cosmetic in package form shall bear as one of its principal features a statement of the identity of the commodity....

  10. What determines consumer attention to nutrition labels?

    NARCIS (Netherlands)

    Bialkova, S.E.; Trijp, van J.C.M.


    To identify the key determinants of consumer attention to nutrition labels, visual search tasks (present – absent; one – two targets) were used as an effective experimental tool. The main manipulation concerned: set size (number of labels on front of pack); label characteristics (display size, posit

  11. 21 CFR 225.80 - Labeling. (United States)


    ... CURRENT GOOD MANUFACTURING PRACTICE FOR MEDICATED FEEDS Packaging and Labeling § 225.80 Labeling. (a... adhered to, will assure that the article is safe and effective for its intended purposes. (b)(1) Labels... medicated feed and includes adequate information for the safe and effective use of the medicated feed....

  12. 21 CFR 1271.250 - Labeling controls. (United States)


    ...) General. You must establish and maintain procedures to control the labeling of HCT/Ps. You must design these procedures to ensure proper HCT/P identification and to prevent mix-ups. (b) Verification.... Procedures must ensure that each HCT/P is labeled in accordance with all applicable labeling...

  13. The labelling of antibody anti-PBP2a with {sup 99m}Tc; Estudo de marcacao do anticorpo monoclonal anti-PBP2a com {sup 99m}Tc

    Energy Technology Data Exchange (ETDEWEB)

    Mororo, Janio da Silva


    Staphylococcus aureus is a major cause of life-threatening infections such as bacteraemia and endocarditis. Unfortunately, many strains of this bacterial species have become resistant to certain antibiotics, including methicillin and amoxicillin. These strains are known as methicillin-resistant S. aureus (MRSA). The penicillin binding protein 2a (PBP2a) is the enzyme responsible for conferring resistance p-lactams antibiotics for MRSA, being one promising molecule for therapy with mAb. However, besides the therapy, the methods of diagnosis are also inefficient because the diagnosis currently takes several days to produce a reliable result. Taking into account, the objective of this research was radiolabeling one anti-PBP2a mAb developed by Bio-Manguinhos/FioCruz-RJ, utilizing {sup 99m}Tc, for in situ diagnostic of the infectious caused by MRSA. First, anti-PBP2a mAb was reduced utilizing 2-mecaptoethanol (2-ME) for generate sulphydryl groups (-SH) and after to be labeled with {sup 99m}Tc. In this work, were utilized two techniques of direct method: Method 1, using tartrate and gentisic acid reagents, acting like transchelant and stabilizer agents, respectively; and Method 2, using one commercial kit of MDP. Besides the radiolabeling, the mAb reduced and mAb labeled with {sup 99m}Tc were submitted to immunoreactivity analysis, with SDS-PAGE non-reducing, Immunoblotting, ELISA and neutralization assay in vitro methods. The quantity produced of sulphydryl groups by mAb was satisfactory, approximately 5 per mAb, utilizing 6.500:1 of 2-ME:mAb molar ratio. The better labeling method was Method 2, with labeling yield of 73.5%, and showed a good stability after 2 hours (73.2%). The better formulation was: 0.5 mg of mAb anti- PBP2a, 10 {mu}U of MDP kit, after resuspended with 5 mL of saline, and 75.48 MBq (2.04 mCi) of {sup 99m}Tc, reacting by 15 minutes. The labeled mAb maintained the immunoreactivity, utilizing immunologic and in vitro experiments. (author)

  14. EIA scoping in England and Wales: Practitioner approaches, perspectives and constraints

    International Nuclear Information System (INIS)

    Scoping plays a critical role in shaping the nature and extent of the environmental information subsequently contained in an Environmental Impact Statement (EIS), yet it has been identified as an area of weakness in practice () and remains a poorly understood and under-researched component of EIA. This paper provides a detailed empirical investigation and assessment of recent scoping activity in England and Wales, in the context of evolving European Union (EU) regulations. Conceptual and contextual issues associated with scoping are outlined prior to the presentation of key findings, including: approaches to scoping; the assessment of significance; characteristics and influence of consultation; and perceived constraints to scoping. The paper concludes with an overview of findings, possible explanatory factors, and recommendations for future practice

  15. Environmental agreements in Canada : Aboriginal participation, EIA follow-up and environmental management of major projects

    Energy Technology Data Exchange (ETDEWEB)

    O' Faircheallaigh, C. [Griffith Univ., Brisbane (Australia). Dept. of Politics and Public Policy


    Attempts are now being made to address the historic marginalization of indigenous peoples from the management of resource projects located on their ancestral lands through the use of environmental agreements. However, the rapid pace of resource development in certain regions of Canada has meant that there is an increased need to ensure effective follow-up procedures for Environmental Impact Assessment (EIA) processes in order to achieve meaningful Aboriginal participation in the management of large-scale resource projects. Lack of effective follow-up has made it difficult for the relevant agencies to manage risks and uncertainties. This book discussed the use of new policy environmental agreements between industry, government, and Aboriginal peoples. Case studies where environmental agreements were used in the Northwest Territories, Alberta, and Newfoundland were presented in order to demonstrate their efficacy. It was concluded that structures and processes must be designed to encourage Aboriginal participation in consultation processes. refs., tabs.

  16. Ab Initio No-Core Shell Model

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, B R; Navratil, P; Vary, J P


    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory ({chi}EFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The

  17. Ab Initio No-Core Shell Model

    International Nuclear Information System (INIS)

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory (χEFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The resulting NN

  18. 201Tl labelled myocardium tomoscanning

    International Nuclear Information System (INIS)

    A new device, the J and P Tomoscanner, enables us to obtain the transverse scintigraphic section of any organ labelled by a single photon emitting radionuclide. For the time being, this technique has been used mainly for brain and liver studies. This work explores the ability of this tomograph to furnish sections of the 201Tl labelled myocardium by comparing them with the scintillation gamma-camera images. Towards this aim, witnesses and patients with documented anterior or lateral infarctus have been studied. Our actual results show a high correlation between the two explorations. But, by means of the section, both the site and size of the necrosis are visualized. However, only a single tomographic image was obtained in each patient because of the time necessary for its retranscription on paper. In the near future, when it will be possible to perform routinely several sections, a better size estimation will be possible

  19. Study of the viability of technetium-99m labeling of whole antimyosin antibody and its fragment: development of radiopharmaceutical for cardiac survey

    International Nuclear Information System (INIS)

    In the acute myocardium infarction, the myocytes cell membrane loses its integrity, allowing the influx of extracellular macromolecules such as circulating antibody into the damaged cell. The use of the specific antibodies against cardiac myosin labeled with 99mTc allows to determine the localization and extension of myocardial infarction. The purpose of this work was to study the viability of labeling of the antimyosin monoclonal antibody and its fragment F(ab')2 with 99mTc. Because of the high cost of antimyosin antibody, others antibodies were used to optimize the methodology and the best condition was used for antimyosin antibody. The intact antibody was cleaved by pepsin to produce F(ab')2 fragment. The F(ab')2 and the intact antibody were reduced by treatment with Dithiothreitol (DTT) and 2-Mercaptoethanol (2-ME) and labeled with 99mTc by direct method. Different concentrations of reductant, mixing conditions and incubation times were studied. In the standard condition, incubation at molar ratio 1:1000 (antibody:reducing agent) at room temperature for 30 minutes with continuous rotation (850 rpm), 13.28 - SH groups were formed per molecule. It was studied the influence of p H, of the concentration of stannous chloride (Sn2+) and incubation time in the labeling condition. The better radiochemical yield (90.06 +- 1.53%) was obtained using 2.5 μg of Sn2+ in p H 4.5 for 60 minutes. The labeling of the fragment F(ab')2 did not present satisfactory results because of the low yield of the digestion. After purification by PD-10, the biodistribution study was performed and showed that the intact antimyosin antibody labeled with 99mTc presented fast kinetic compatible with the biodistribution of an intact antibody labeled with 99mTc. Scintigraphy image of the animal with myocardial infarction was obtained and compared with the image of a normal animal. The studies allow to conclude that the use of fragment F(ab')2 are not viable, but the use of the labeled antimyosin

  20. Pharmaceuticals labelled with stable isotopes

    International Nuclear Information System (INIS)

    The relatively new field of pharmaceuticals labelled with stable isotopes is reviewed. Scientific, juridical, and ethical questions are discussed concerning the application of these pharmaceuticals in human medicine. 13C, 15N, and 2H are the stable isotopes mainly utilized in metabolic function tests. Methodical contributions are given to the application of 2H, 13C, and 15N pharmaceuticals showing new aspects and different states of development in the field under discussion. (author)

  1. Radioactively labelled vitamin B12

    International Nuclear Information System (INIS)

    A method is described for preparing radioactively labelled vitamin B 12 (cyanocobalamin) by reacting α-(5,6-dimethylbenzimidazolyl) hydrogenobamide with active (sup(57,58)Co) cobaltous ion. The latter may be in the form of cobaltous chloride or sulphate in aqueous or aqueous alcoholic medium. The reaction is effected by heating the reactants in darkness at pH 4 to 8. An excess of cyanide is added to convert the hydroxocobalamin formed to cyanocobalamin. (U.K.)

  2. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 Interactions with Western Corn Rootworm Midgut Membrane Binding Sites


    Huarong Li; Monica Olson; Gaofeng Lin; Timothy Hey; Sek Yee Tan; Narva, Kenneth E.


    BACKGROUND: Bacillus thuringiensis (Bt) Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry) proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interact...

  3. Comparisons of metallic clusters imbedded in the surface oxide of AB2, AB5, and A2B7 alloys

    International Nuclear Information System (INIS)

    Research highlights: Different growth mechanisms have been found on the metallic inclusions imbedded in the surface oxides of AB2, AN5, and A2B7. The high power performance has been correlated to the size and distribution of these inclusions. - Abstract: In order to clarify the relationship between the saturation magnetization of the activated metal hydride material and electrode performance, the specific power measured at both low temperature (-30 oC) and operating temperature (35 oC) of a nickel metal hydride battery were compared with magnetization measurements. It is found specific powers measured at both temperatures correlate well with the saturated magnetic susceptibility, which is proportional to the total amount of metallic nickel clusters distributed within the surface oxide layer after activation. Both the gas phase storage and electrochemical properties of the activated AB2, AB5, and A2B7 alloys were investigated. While the AB2 alloy has the highest storage capacity, it also has the lowest high-rate dischargeability among the three alloys. This suggests a competition between storage capacity and rate capability in these materials. In an alkaline etching experiment, it is established the saturation magnetization increases with etching time in these AB2, AB5, and A2B7 alloys. The saturation magnetization after a 4 h etches track the changes in the high-rate dischargeability. The increase is attributed to the growth in size of the metallic inclusions for the AB2 and Nd-A2B7 samples, and from an increase in the number of metallic inclusion in the case of AB5 and La-A2B7. Transmission electron microscope studies calibrate the size inferred from magnetic susceptibility studies and also the Ni-dominated FCC structure of the metallic clusters.

  4. Study on Exothermic Oxidation of Acrylonitrile-butadiene-styrene (ABS Resin Powder with Application to ABS Processing Safety

    Directory of Open Access Journals (Sweden)

    Jenq-Renn Chen


    Full Text Available Oxidative degradation of commercial grade ABS (Acrylonitrile-butadiene-styrene resin powders was studied by thermal analysis. The instabilities of ABS containing different polybutadiene (PB contents with respect to temperature were studied by Differential Scanning Calorimeter (DSC. Thermograms of isothermal test and dynamic scanning were performed. Three exothermic peaks were observed and related to auto-oxidation, degradation and oxidative decomposition, respectively. Onset temperature of the auto-oxidation was determined to be around 193 °C. However, threshold temperature of oxidation was found to be as low as 140 °C by DSC isothermal testing. Another scan of the powder after degeneration in air showed an onset temperature of 127 °C. Reactive hazards of ABS powders were verified to be the exothermic oxidation of unsaturated PB domains, not the SAN (poly(styrene-acrylonitrile matrix. Heat of oxidation was first determined to be 2,800 ± 40 J per gram of ABS or 4,720 ± 20 J per gram of PB. Thermal hazards of processing ABS powder are assessed by adiabatic temperature rise at process conditions. IR spectroscopy associated with heat of oxidation verified the oxidative mechanism, and these evidences excluded the heat source from the degradation of SAN. A specially prepared powder of ABS without adding anti-oxidant was analyzed by DSC for comparing the exothermic behaviors. Exothermic onset temperatures were determined to be 120 °C and 80 °C by dynamic scanning and isothermal test, respectively. The assessment successfully explained fires and explosions in an ABS powder dryer and an ABS extruder.

  5. NGOs Participation in the Swedish EIA Process to Establish a Nuclear Waste Disposal

    International Nuclear Information System (INIS)

    Swedish environmental NGOs have no complete consensus on the issue of nuclear waste management. However, concerning the demands on the the EIA process most of the opinions coincide. The following standpoints generally reflect those represented by MKG as interpreted by the author Continuation of nuclear waste production, also in connection with uranium mining, is inconsistent with sustainable development. The problems of nuclear waste management must be dealt with now and not left to an undecided future. However, this does not automatically mean that any final solution needs be implemented within a short period of time. Irrespective of storage or disposal method nuclear waste is a possible source for nuclear weapons for a very long time and must therefore be subject to long-term safeguards. Any storage or disposal must be designed considering the risk of intention or unintentional intrusion. The management of nuclear waste is a national task. The thus be performed on a national scale, not as now in the municipal and to some extent regional scale. The choice of method should precede the choice of site. The choice of method should be made according to a systematic process and considering functional conditions set up in advance. Different alternatives should be evaluated and compared according to strict long-term environmental standards that comply with sustainable development. This demands extensive information on more than one possible method. The choice of site should also be made according to a systematic process considering functional conditions set up in advance. A clear and understandable sieving process at a national scale should be performed to find the best possible site considering environmental conditions. Changes have to be made so that an independent body supervises the EIA process instead of the nuclear industry. This increases the chance that the choice of method and site gain legitimacy and acceptance in the eyes of ordinary citizens

  6. Road-corridor planning in the EIA procedure in Spain. A review of case studies

    International Nuclear Information System (INIS)

    The assessment of different alternatives in road-corridor planning must be based on a number of well-defined territorial variables that serve as decision making criteria, and this requires a high-quality preliminary environmental assessment study. In Spain the formal specifications for the technical requirements stipulate the constraints that must be considered in the early stages of defining road corridors, but not how they should be analyzed and ranked. As part of the feasibility study of a new road definition, the most common methodology is to establish different levels of Territorial Carrying Capacity (TCC) in the study area in order to summarize the territorial variables on thematic maps and to ease the tracing process of road-corridor layout alternatives. This paper explores the variables used in 22 road-construction projects conducted by the Ministry of Public Works that were subject to the Spanish EIA regulation and published between 2006 and 2008. The aim was to evaluate the quality of the methods applied and the homogeneity and suitability of the variables used for defining the TCC. The variables were clustered into physical, environmental, land-use and cultural constraints for the purpose of comparing the TCC values assigned in the studies reviewed. We found the average quality of the studies to be generally acceptable in terms of the justification of the methodology, the weighting and classification of the variables, and the creation of a synthesis map. Nevertheless, the methods for assessing the TCC are not sufficiently standardized; there is a lack of uniformity in the cartographic information sources and methodologies for the TCC valuation. -- Highlights: • We explore 22 road-corridor planning studies subjected to the Spanish EIA regulation. • We analyze the variables selected for defining territorial carrying capacity. • The quality of the studies is acceptable (methodology, variable weighting, mapping). • There is heterogeneity in the

  7. Road-corridor planning in the EIA procedure in Spain. A review of case studies

    Energy Technology Data Exchange (ETDEWEB)

    Loro, Manuel, E-mail: [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigación del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Arce, Rosa M., E-mail: [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigación del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Ortega, Emilio, E-mail: [Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigación del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Department of Construction and Rural Roads, Forestry Engineering School, Universidad Politécnica de Madrid, Ciudad Universitaria s/n, 28040 Madrid (Spain); and others


    The assessment of different alternatives in road-corridor planning must be based on a number of well-defined territorial variables that serve as decision making criteria, and this requires a high-quality preliminary environmental assessment study. In Spain the formal specifications for the technical requirements stipulate the constraints that must be considered in the early stages of defining road corridors, but not how they should be analyzed and ranked. As part of the feasibility study of a new road definition, the most common methodology is to establish different levels of Territorial Carrying Capacity (TCC) in the study area in order to summarize the territorial variables on thematic maps and to ease the tracing process of road-corridor layout alternatives. This paper explores the variables used in 22 road-construction projects conducted by the Ministry of Public Works that were subject to the Spanish EIA regulation and published between 2006 and 2008. The aim was to evaluate the quality of the methods applied and the homogeneity and suitability of the variables used for defining the TCC. The variables were clustered into physical, environmental, land-use and cultural constraints for the purpose of comparing the TCC values assigned in the studies reviewed. We found the average quality of the studies to be generally acceptable in terms of the justification of the methodology, the weighting and classification of the variables, and the creation of a synthesis map. Nevertheless, the methods for assessing the TCC are not sufficiently standardized; there is a lack of uniformity in the cartographic information sources and methodologies for the TCC valuation. -- Highlights: • We explore 22 road-corridor planning studies subjected to the Spanish EIA regulation. • We analyze the variables selected for defining territorial carrying capacity. • The quality of the studies is acceptable (methodology, variable weighting, mapping). • There is heterogeneity in the

  8. Preparation and in vitro evaluation of ''no-carrier-added'' 18F-labeled biotin

    International Nuclear Information System (INIS)

    This paper will describe the preparation of ''no-carrieradded'' 18F-labeled biotin where the radiolabel bound to an aromatic moiety is described. This has been accomplished by preparation of [18F]fluoro-benzylbromide (yield 20-30%) and its reaction with biotin-LC-hydrazide. This yielded ''no-carrier-added'' radiolabeled biotin (5-10%) which was then purified by reversed phase HPLC. The pure product was found to bind to avidin, thereby demonstrating retention of its biological integrity. Thus this product is potentially useful for imaging tumor tissue following injection of avidin coupled MoAbs. (author)

  9. Preparation and in vitro evaluation of ''no-carrier-added'' 18F-labeled biotin

    International Nuclear Information System (INIS)

    This paper will describe the preparation of ''no-carrieradded'' 18F-labeled biotin where the radiolabel bound to an aromatic moiety is described. This has been accomplished by preparation of [18F]fluorobenzylbromide (yield 20-30%) and its reaction with biotin-LC-hydrazide. This yielded ''nocarrier-added'' radiolabeled biotin(5-10%) which was then purified by reversed phase HPLC. The pure product was found to bind to avidin, thereby demonstrating retention of its biological integrity. Thus this product is potentially useful for imaging tumor tissue following injection of avidin coupled MoAbs. (Author)

  10. Biomolecule labelling by 186 Re

    International Nuclear Information System (INIS)

    The aim of this study is to develop and improve the existing radiolabelling techniques of peptides and monoclonal antibodies with 186 Re and 188 Re as potential agents for cancer targeted radiotherapy. We selected the following methods and techniques for direct labelling of peptides and monoclonal antibody: 1. Prereduction of -S-S- bridges of biomolecule to sulfhydryls using reducing agents: ascorbic acid, cysteine, active hydrogen, 2,3 dimercaptopropanol. The prereduction reactions are controlled by massic ratios of reduction agents/biomolecule, pH, temperature and time of incubation; 2. Reduction of 186 Re O4- stannous chloride in acid and alkaline pH; 3. Coupling reaction of 186 Re (red) with the biomolecule controlled by the time and temperature of incubation, the influence of pH regarding the binding of 186 Re to the biomolecules. The quality control was effected by chromatography techniques (paper and elution gel chromatography) on labeled biomolecule before and after purification. The elution gel chromatography was spectrophotometricaly monitored at 280 nm. In the same time the radioactivity of samples was measured using a gamma counter. All the results confirm in vitro stability of labeled biomolecule. The biological evaluation studies regarding accumulation and biological affinity will be controlled by scintigraphy method. Biodistribution studies will be effected to Walker tumor bearing animals at 4 and 24 hours after injections. (authors)

  11. Fate of the insecticidal Cry1Ab protein of GM crops in two agricultural soils as revealed by ¹⁴C-tracer studies. (United States)

    Valldor, Petra; Miethling-Graff, Rona; Martens, Rainer; Tebbe, Christoph C


    Insecticidal delta-endotoxins of Bacillus thuringiensis are among the most abundant recombinant proteins released by genetically modified (GM) crops into agricultural soils worldwide. However, there is still controversy about their degradation and accumulation in soils. In this study, (14)C-labelled Cry1Ab protein was applied to soil microcosms at two concentrations (14 and 50 μg g(-1) soil) to quantify the mineralization of Cry1Ab, its incorporation into the soil microbial biomass, and its persistence in two soils which strongly differed in their texture but not in silt or pH. Furthermore, ELISA was used to quantify Cry1Ab and its potential immunoreactive breakdown products in aqueous soil extracts. In both soils, (14)CO2-production was initially very high and then declined during a total monitoring period of up to 135 days. A total of 16 to 23 % of the (14)C activity was incorporated after 29 to 37 days into the soil microbial biomass, indicating that Cry1Ab protein was utilized by microorganisms as a growth substrate. Adsorption in the clay-rich soil was the most important factor limiting microbial degradation; as indicated by higher degradation rates in the more sandy soil, extremely low concentrations of immunoreactive Cry1Ab molecules in the soils' aqueous extracts and a higher amount of (14)C activity bound to the soil with more clay. Ecological risk assessments of Bt-crops should therefore consider that the very low concentrations of extractable Cry1Ab do not reflect the actual elimination of the protein from soils but that, on the other hand, desorbed proteins mineralize quickly due to efficient microbial degradation. PMID:25967657

  12. Use of Symbols in Labeling. Final rule. (United States)


    The Food and Drug Administration (FDA or the Agency) is issuing this final rule revising its medical device and certain biological product labeling regulations to explicitly allow for the optional inclusion of graphical representations of information, or symbols, in labeling (including labels) without adjacent explanatory text (referred to in this document as "stand-alone symbols") if certain requirements are met. The final rule also specifies that the use of symbols, accompanied by adjacent explanatory text continues to be permitted. FDA is also revising its prescription device labeling regulations to allow the use of the symbol statement "Rx only" or "[rx] only" in the labeling for prescription devices. PMID:27311137

  13. Eye tracking and nutrition label use

    DEFF Research Database (Denmark)

    Graham, Dan J.; Orquin, Jacob Lund; Visschers, Vivianne H.M.


    cameras monitoring consumer visual attention (i.e., eye tracking) has begun to identify ways in which label design could be modified to improve consumers’ ability to locate and effectively utilize nutrition information. The present paper reviews all published studies of nutrition label use that have......Nutrition labels on food packages are among the most prominent and far-reaching policy measures related to diet and have the capacity to promote healthy eating. Unfortunately, certain nutrition label characteristics may impede consumer detection and comprehension of labels. Research using precise...

  14. MicroPET/CT imaging of patient-derived pancreatic cancer xenografts implanted subcutaneously or orthotopically in NOD-scid mice using 64Cu-NOTA-panitumumab F(ab')2 fragments

    International Nuclear Information System (INIS)

    Introduction: Our objective was to study microPET/CT imaging of patient-derived pancreatic cancer xenografts in NOD-scid mice using F(ab')2 fragments of the fully-human anti-EGFR monoclonal antibody, panitumumab (Vectibix) labeled with 64Cu. More than 90% of pancreatic cancers are EGFR-positive. Methods: F(ab')2 fragments were produced by proteolytic digestion of panitumumab IgG or non-specific human IgG, purified by ultrafiltration then modified with NOTA chelators for complexing 64Cu. Panitumumab IgG and Fab fragments were similarly labeled with 64Cu. EGFR immunoreactivity was determined in competition and direct (saturation) cell binding assays. The biodistribution of 64Cu-labeled panitumumab IgG, F(ab')2 and Fab was compared in non-tumor-bearing Balb/c mice. MicroPET/CT and biodistribution studies were performed in NOD-scid mice engrafted subcutaneously (s.c.) or orthotopically with patient-derived OCIP23 pancreatic tumors, or in NOD-scid with s.c. PANC-1 human pancreatic cancer xenografts. Results: Panitumumab F(ab')2 fragments were produced in high purity (> 90%), derivitized with 3.2 ± 0.7 NOTA/F(ab')2, and labeled with 64Cu (0.3–3.6 MBq/μg). The binding of 64Cu-NOTA-panitumumab F(ab')2 to OCIP23 or PANC-1 cells was decreased significantly by an excess of panitumumab IgG. The Kd for binding of 64Cu-NOTA-panitumumab F(ab')2 to EGFR on PANC-1 cells was 0.14 ± 0.05 nmol/L. F(ab')2 fragments exhibited more suitable normal tissue distribution for tumor imaging with 64Cu than panitumumab IgG or Fab. Tumor uptake at 48 h post injection (p.i.) of 64Cu-NOTA-panitumumab F(ab')2 was 12.0 ± 0.9% injected dose/g (ID/g) in s.c. and 11.8 ± 0.9% ID/g in orthotopic OCIP23 tumors vs. 6.1 ± 1.1% ID/g in s.c. PANC-1 xenografts. Tumor/Blood (T/B) ratios were 5:1 to 9:1 for OCIP23 and 2.4:1 for PANC-1 tumors. Tumor uptake of 64Cu-NOTA-non-specific F(ab')2 in OCIP23 xenografts was 5-fold lower than 64Cu-panitumumab F(ab

  15. Tyr Phosphatase-Mediated P-ERK Inhibition Suppresses Senescence in EIA + v-raf Transformed Cells, Which, Paradoxically, Are Apoptosis-Protected in a MEK-Dependent Manner

    Directory of Open Access Journals (Sweden)

    Stefania De Vitis


    Full Text Available Activation of the Ras-Raf-extracellular signal-regulated kinase (ERK pathway causes not only proliferation and suppression of apoptosis but also the antioncogenic response of senescence. How these contrasting effects are reconciled to achieve cell transformation and cancer formation is poorly understood. In a system of two-step carcinogenesis (dedifferentiated PC EIA, transformed PC EIA-polyoma-middle T [PC EIA + Py] and PC EIA-v-raf [PC EIA + raf] cells], v-raf cooperated with EIA by virtue of a strong prosurvival effect, not elicited by Py-middle T, evident toward serum-deprivation-and H2O2-induced apoptosis. Apoptosis was detected by DNA fragmentation and annexin V staining. The prosurvival function of v-raf was, in part, mitogen-activated protein kinase/ERK kinase (MEK-dependent, as shown by pharmacological MEK inhibition. The MEK-dependent antiapoptotic effect of v-raf was exerted despite a lower level of P-ERK1/2 in EIA + raf cells with respect to EIA + Py/EIA cells, which was dependent on a high tyrosine phosphatase activity, as shown by orthovanadate blockade. An ERK1/2 tyrosine phosphatase was likely involved. The high tyrosine phosphatase activity was instrumental to the complete suppression of senescence, detected by β-galactosidase activity, because tyrosine phosphatase blockade induced senescence in EIA + raf but not in EIA + Py cells. High tyrosine phosphatase activity and evasion from senescence were confirmed in an anaplastic thyroid cancer cell line. Therefore, besides EIA, EIA + raf cells suppress senescence through a new mechanism, namely, phosphatase-mediated P-ERK1/2 inhibition, but, paradoxically, retain the oncogenic effects of the Raf-ERK pathway. We propose that the survival effect of Raf is not a function of absolute P-ERK1/2 levels at a given time but is rather dynamically dependent on greater variations after an apoptotic stimulus.

  16. The economics of GM food labels: An evaluation of mandatory labeling proposals in India


    Bansal, Sangeeta; Ramaswami, Bharat


    "Labeling of genetically modified (GM) foods is a contentious issue and internationally, there is sharp division whether such labeling ought to be mandatory. This debate has reached India where the government has proposed mandatory labeling. In this context, this paper evaluates the optimal regulatory approach to GM food labels. Mandatory labeling aims to provide greater information and correspondingly more informed consumer choice. However, even without such laws, markets have incentives to ...

  17. Sequential imaging of indium-111-labeled monoclonal antibody in human mammary tumors hosted in nude mice

    International Nuclear Information System (INIS)

    Using a bifunctional chelating agent, indium-111 was attached to a monoclonal antibody 10-3D2, specific for a 126-kilodalton phosphoglycoprotein antigen associated with human mammary carcinoma, and was then used to localize and visualize human mammary tumors hosted in nude mice. Simultaneous tumor concentration of In-111-10-3D2 was eight times greater than that of control I-125-MOPC-21. Uptake of F(ab')2 and Fab of 10-3D2 was also compared. The scintigrams demonstrated that intact antibody provided the best images. Control In-111-labeled MOPC-21 and plasma did not show specific localization in the tumor. Uptake of In-111-labeled 10-3D2 was also compared in two lines of human mammary tumors, BT-20 and HS-578T. Imaging with 10-3D2 was better for BT-20 than for HS-578T

  18. Dicty_cDB: FC-AB09 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available / Representative seq. ID ...FC-AB09F (Link to Original site) Representative DNA sequence >FC-AB09 (FC-AB09Q) /CSM/FC/FC-AB/FC-AB09Q.Seq....QNQKKKKKKKKKKKKKKKKKK Translated Amino Acid sequence (All Frames) Frame A: desashkqlckiynkihyliifinfvlvvdlyp...0.00 m_ : 1.00 72.0 %: nuclear 16.0 %: cytoplasmic 8.0 %: mitochondrial 4.0 %: cytoskeletal >> prediction fo...kkkrkktkpkekkkkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits)

  19. Detecting Adreno-Cortical Activity in Gorillas: A Comparison of Faecal Glucocorticoid Measures Using RIA Versus EIA

    Directory of Open Access Journals (Sweden)

    J.B. Nizeyi


    Full Text Available The conservation community is concerned that the remnants of highly endangered Mountain gorilla are being exposed to enormous stressors in their habitat but no assay has been validated to monitor stress markers in their fecal medium. Non specific ICN Corticosterone RIA and Munro Cortisol EIA were validated for measurement of free-ranging Mountain gorilla Faecal Glucocorticoids Metabolites (FGM to non-invasively detect effect of environmental stressors on the adrenocortical activity in gorillas. Parallelism and quantitative recovery of FGM showed that the RIA and EIA can reliably measure corticoid metabolites in this medium. High Performance Liquid Chromatography confirmed presence of FGM in faecal extracts. Peak immunoreactive metabolites constituting 35.43% of FGM measured by the RIA co-eluted with maximum corticosterone radioactivity, the EIA measured multiple immunoreactive peak metabolites which were less polar than the cortisol, corticosterone and DOC standard hormones. For Lowland gorilla, peak FGM eluted at fractions 27 and 53 under the 100% Isocratic gradient (San Diago protocol, and 20-80% Methanol gradient (National Zoo protocol respectively; while peak FGM eluted at fraction 8 and 47 in Mountain gorilla under 100% Isocratic and 20-80% Methanol gradients respectively. After injection of Lowland gorilla with long acting Adrenal Cortico-trophic Hormone (ACTH gel (150U Acthar Gel, urinary cortisol increased by 5-fold (p<0.05 within the first 6 h and then decreased to original values by 24 h. FGM were significantly elevated (p<0.05 between 72 and 96 h (RIA and between 48 and 120 h (EIA and there after decreased towards the pre-ACTH levels. Both assays detected a 2-fold increase in FGM 48 h post ACTH. Mean pre-ACTH and post- ACTH FGM amounts measured by RIA were 36 times (p<0.05 more than those measured by the EIA. For field application FGM were measure from three free-ranging Mountain gorilla individuals before and after chasing the

  20. Fluorescent labeling and tracking of nanoclay (United States)

    Diaz, Carlos A.; Xia, Yining; Rubino, Maria; Auras, Rafael; Jayaraman, Krishnamurthy; Hotchkiss, Joseph


    We report a methodology developed to detect and track stable fluorescent-labeled nanoclay, in polymer-clay nanocomposite films, and in a contact solvent after migration testing. Fluorescein-5-maleimide (fluorescein) or tetramethylrhodamine-5-maleimide (rhodamine) was covalently bonded to organically modified montmorillonite (o-MMT). Fluorescein- and rhodamine-labeled nanoclay showed good thermal stability up to 220 °C and the rhodamine-labeled nanoclay remained stable at 250 °C. Confocal laser scanning microscopy was used to confirm the tagging and to detect the fluorescent-labeled nanoclays in various systems.We report a methodology developed to detect and track stable fluorescent-labeled nanoclay, in polymer-clay nanocomposite films, and in a contact solvent after migration testing. Fluorescein-5-maleimide (fluorescein) or tetramethylrhodamine-5-maleimide (rhodamine) was covalently bonded to organically modified montmorillonite (o-MMT). Fluorescein- and rhodamine-labeled nanoclay showed good thermal stability up to 220 °C and the rhodamine-labeled nanoclay remained stable at 250 °C. Confocal laser scanning microscopy was used to confirm the tagging and to detect the fluorescent-labeled nanoclays in various systems. Electronic supplementary information (ESI) available: Additional information regarding production of nanocomposites, the silylation procedure, labeling of the nanoclays, characterization of the labels, thermal stability of the labels, and the migration test. See DOI: 10.1039/c2nr32978f

  1. 75 FR 29775 - Food Labeling Workshop; Public Workshop (United States)


    ... be discussed at the workshop include: (1) Mandatory label elements, (2) nutrition labeling... labeling and nutrition. FDA expects that participation in this public workshop will provide regulated... with labeling requirements, especially in light of growing concerns about obesity and food...

  2. Dengue virus growth, purification, and fluorescent labeling. (United States)

    Zhang, Summer; Chan, Kuan Rong; Tan, Hwee Cheng; Ooi, Eng Eong


    The early events of the dengue virus life cycle involve virus binding, internalization, trafficking, and fusion. Fluorescently labeled viruses can be used to visualize these early processes. As dengue virus has 180 identical copies of the envelope protein attached to the membrane surface and is surrounded by a lipid membrane, amine-reactive (Alexa Fluor) or lipophilic (DiD) dyes can be used for virus labeling. These dyes are highly photostable and are ideal for studies involving cellular uptake and endosomal transport. To improve virus labeling efficiency and minimize the nonspecific labeling of nonviral proteins, virus concentration and purification precede fluorescent labeling of dengue viruses. Besides using these viruses for single-particle tracking, DiD-labeled viruses can also be used to distinguish serotype-specific from cross-neutralizing antibodies. Here the details of virus concentration, purification, virus labeling, applications, and hints of troubleshooting are described. PMID:24696327

  3. Dicty_cDB: FCL-AB19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AB19 (Link to dictyBase) - - - Contig-U15232-1 FCL-AB19Z ...(Link to Original site) - - FCL-AB19Z 697 - - - - Show FCL-AB19 Library FCL (Link to library) Clone ID FCL-A... Representative seq. ID FCL-...AB19Z (Link to Original site) Representative DNA sequence >FCL-AB19 (FCL-AB19Q) /CSM/FCL/FCL-AB/FCL-...KLINFSIFQ* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value FCL-

  4. On randomized online labeling with polynomially many labels

    Czech Academy of Sciences Publication Activity Database

    Bulánek, Jan; Koucký, Michal; Saks, M.

    Berlin: Springer, 2013 - (Fomin, F.; Freivalds, R.; Kwiatkowska, M.; Peleg, D.), s. 291-302. (Lecture Notes in Computer Science. 7965). ISBN 978-3-642-39205-4. [International Colloquium, ICALP 2013 /40./. Riga (LT), 08.07.2013-12.07.2013] R&D Projects: GA AV ČR IAA100190902; GA ČR GBP202/12/G061 Institutional support: RVO:67985840 Keywords : online labeling * complexity Subject RIV: BA - General Mathematics

  5. Hydrogenation of AB5 and AB2 metal hydride alloys studied by in situ X-ray diffraction

    International Nuclear Information System (INIS)

    Highlights: • Hydrogenation process of an AB5 alloy and two AB2 alloys were studied by quasi in-situ XRD. • In both AB5 and AB2 metal alloy, hydrogen occupation sites on the half-plane were taken first. • In the C14/C15 mixed alloy, C14 phase is the main hydrogen storage phase with a lower equilibrium pressure. • In the C14/C15 mixed alloy, C15 phase is the catalyst hydrogen storage phase with a higher equilibrium pressure. • Small amount of C15 was hydrided first but not completed until C14 phase was fully hydrided. - Abstract: The evolution of lattice constants and abundances of metal (α) and metal hydride (β) phases during the hydrogenation process of an AB5 alloy with a CaCu5 crystal structure, an AB2 alloy with a predominating C14 structure, and a C14/C15-mixed AB2 alloy were reported. The preferred hydrogen insertion sites at different states of charge in both the α and β phases were studied based on the lattice parameter changes during hydrogenation. During the hydrogenation of the AB5 alloy, the ratio between lattice parameters a and c (a/c ratio) in the α phase decreases, stabilizes, and then decreases again while that in the β phase decreases and then stabilizes. The trends in unit cell volume changes are increasing, plateauing, and increasing again in the α phase and increasing followed by plateauing in the β phase as the hydrogenation level increases. In the C14-predominant AB2 alloy, the a/c ratio in the α phase increases at the beginning and then stabilizes while that in the β phase remains about the same and then increases during the addition of hydrogen. Moreover, the unit cell volume in the α phase increases slightly during hydrogenation, comparing to the increasing, decreasing, and then increasing trend in the β phase. In the C14/C15 mixed AB2 alloy, hydrogenation of the C15 phase starts at the beginning and promotes the hydrogenation of the C14 phase. The C14 phase, as the main hydrogen storage phase, completes hydrogenation

  6. CdSe/ZnS Quantum Dot-Labeled Lateral Flow Strips for Rapid and Quantitative Detection of Gastric Cancer Carbohydrate Antigen 72-4. (United States)

    Yan, Xinyu; Wang, Kan; Lu, Wenting; Qin, Weijian; Cui, Daxiang; He, Jinghua


    Carbohydrate antigen 72-4 (CA72-4) is an important biomarker associated closely with diagnosis and prognosis of early gastric cancer. How to realize quick, sensitive, specific, and quantitative detection of CA72-4 in clinical specimens has become a great requirement. Herein, we reported a CdSe/ZnS quantum dot-labeled lateral flow test strip combined with a charge-coupled device (CCD)-based reader was developed for rapid, sensitive, and quantitative detection of CA72-4. Two mouse monoclonal antibodies (mAbs) against CA72-4 were employed. One of them was coated as a test line, while another mAb was labeled with quantum dots and coated onto conjugate pad. The goat anti-mouse IgG was immobilized as a control line. After sample was added, a sandwich structure was formed with CA72-4 and these two mAbs. The fluorescent signal from quantum dots (QD)-labeled mAb in sandwich structure was related to the amount of detected CA72-4. A CCD-based reader was used to realize quantitative detection of CA72-4. Results showed that developed QD-labeled lateral flow strips to detect CA72-4 biomarker with the sensitivity of 2 IU/mL and 10 min detection time. One hundred sera samples from clinical patients with gastric cancer and healthy people were used to confirm specificity of this strip method; results showed that established strip method own 100 % reproducibility and 100 % specificity compared with Roche electrochemiluminescence assay results. In conclusion, CdSe/ZnS quantum dot-labeled lateral flow strips for detection of CA72-4 could realize rapid, sensitive, and specific detection of clinical samples and could own great potential in clinical translation in near future. PMID:26969591

  7. CdSe/ZnS Quantum Dot-Labeled Lateral Flow Strips for Rapid and Quantitative Detection of Gastric Cancer Carbohydrate Antigen 72-4 (United States)

    Yan, Xinyu; Wang, Kan; Lu, Wenting; Qin, Weijian; Cui, Daxiang; He, Jinghua


    Carbohydrate antigen 72-4 (CA72-4) is an important biomarker associated closely with diagnosis and prognosis of early gastric cancer. How to realize quick, sensitive, specific, and quantitative detection of CA72-4 in clinical specimens has become a great requirement. Herein, we reported a CdSe/ZnS quantum dot-labeled lateral flow test strip combined with a charge-coupled device (CCD)-based reader was developed for rapid, sensitive, and quantitative detection of CA72-4. Two mouse monoclonal antibodies (mAbs) against CA72-4 were employed. One of them was coated as a test line, while another mAb was labeled with quantum dots and coated onto conjugate pad. The goat anti-mouse IgG was immobilized as a control line. After sample was added, a sandwich structure was formed with CA72-4 and these two mAbs. The fluorescent signal from quantum dots (QD)-labeled mAb in sandwich structure was related to the amount of detected CA72-4. A CCD-based reader was used to realize quantitative detection of CA72-4. Results showed that developed QD-labeled lateral flow strips to detect CA72-4 biomarker with the sensitivity of 2 IU/mL and 10 min detection time. One hundred sera samples from clinical patients with gastric cancer and healthy people were used to confirm specificity of this strip method; results showed that established strip method own 100 % reproducibility and 100 % specificity compared with Roche electrochemiluminescence assay results. In conclusion, CdSe/ZnS quantum dot-labeled lateral flow strips for detection of CA72-4 could realize rapid, sensitive, and specific detection of clinical samples and could own great potential in clinical translation in near future.

  8. Study of the mechanical properties of recycled abs and recovery throught mixing with SEBS


    Peydro, M. A.; Juárez Varón, David; Samuel SANCHEZ-CABALLERO; Pla-Ferrando, R


    Recovery of recycled acrylonitrile butadiene styrene (ABS) through mixing with styrene-ethylene/butylene- styrene (SEBS) has been studied in this paper. To simulate recycled ABS, virgin ABS was processed through 5 cycles, at extreme processing temperatures, 220 oC and 260 oC. The virgin ABS, the virgin SEBS, the recycled ABS and the mixtures were mechanically characterized after the various cycles of reprocessing in order to evaluate their corresponding properties and correlate them with the...

  9. Ab Initio Studies of Stratospheric Ozone Depletion Chemistry (United States)

    Lee, Timothy J.; Head-Gordon, Martin; Langhoff, Stephen R. (Technical Monitor)


    An overview of the current understanding of ozone depletion chemistry, particularly with regards the formation of the so-called Antarctic ozone hole, will be presented together with an outline as to how ab initio quantum chemistry can be used to further our understanding of stratospheric chemistry. The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of fluorine, chlorine, bromine and nitrogen oxide species will be demonstrated by presentation of some example studies. The ab initio results will be shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the theoretical results are shown to fill in the gaps and to resolve experimental controversies. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of halogen oxide species will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of experimental studies.

  10. Hemoglobin Labeled by Radioactive Lysine (United States)

    Bale, W. F.; Yuile, C. L.; DeLaVergne, L.; Miller, L. L.; Whipple, G. H.


    This paper reports on the utilization of tagged epsilon carbon of DL-lysine by a dog both anemic and hypoproteinemic due to repeated bleeding plus a diet low in protein. The experiment extended over period of 234 days, a time sufficient to indicate an erythrocyte life span of at least 115 days based upon the rate of replacement of labeled red cell proteins. The proteins of broken down red cells seem not to be used with any great preference for the synthesis of new hemoglobin.

  11. Technetium-99m labelling of the IOR CEA 1 monoclonal antibody: evaluation of different methods

    International Nuclear Information System (INIS)

    Aim: The aim of this study was to investigate the in vivo and in vitro properties of 99mTc labelled monoclonal antibody, IOR CEA 1 when radiolabelled by different methods. Methods: To achieve that purpose IOR CEA was directly radiolabelled via 2-mercaptoethanol (2-Me) and stannous ion (SnCl2) reduction and indirectly via the 2-iminothiolane (2-Im) conjugation. The resulting 99mTc-MoAbs were analysed for number of free sulfhydryl groups, chemical and radiochemical purity (checked by HPLC and SDS PAGE), immunoreactivity and biological distribution in mice. Results: Experimental results indicated a similar radiochemical purity and immunoreactivity for direct labelling methods and a decrease of both for 2-Im method. 2-Me antibody reduction led to a high antibody fragmentation as indicated by non-denaturing SDS PAGE analysis. Nevertheless SnCl2 and 2-Im labels revealed lower in vivo stability. Conclusion: 99mTc-(2-Me) IOR CEA presented favourable in vitro and in vivo properties. Therefore this label was compared to 99mTc-monoclonal antibody BW 431/26. Similar characteristics were found. Clinical studies also revealed identical biodistribution profile. (orig.)

  12. The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves.

    Directory of Open Access Journals (Sweden)

    Rui An

    Full Text Available Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues. We are interested in dissecting these regulatory circuits genetically and report here the isolation of two Arabidopsis dominant mutants, abnormal shoot5-1D (abs5-1D and abs7-1D identified through activation tagging screens. Both abs5-1D and abs7-1D display an intriguing upwardly curly leaf phenotype. Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively. Protoplast transient expression assays confirmed that both ABS5/T5L1 and ABS7/MYB101 are targeted to the nucleus. Interestingly, the expression domains of auxin response reporter DR5::GUS were abnormal in leaves of abs5-1D and ABS5/T5L1 over-expression lines. Moreover, cotyledon venation analysis showed that more areoles and free-ending veins are formed in abs5-1D. We found that the epidermis-specific expressions of ABS5/T5L1 or ABS7/MYB101 driven by the Arabidopsis Meristem Layer 1 promoter (PAtML1 were sufficient to recapitulate the curly leaf phenotype of abs5-1D or abs7-1D. In addition, PAtML1::ABS5 lines exhibited similar changes in DR5::GUS expression patterns as those found in 35S-driven ABS5/T5L1 over-expression lines. Our work demonstrated that enhanced expressions of two transcription factors, ABS5/T5L1 and ABS7/MYB101, are able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis.

  13. Ab initio simulation of transport phenomena in rarefied gases. (United States)

    Sharipov, Felix; Strapasson, José L


    Ab initio potentials are implemented into the direct simulation Monte Carlo (DSMC) method. Such an implementation allows us to model transport phenomena in rarefied gases without any fitting parameter of intermolecular collisions usually extracted from experimental data. Applying the method proposed by Sharipov and Strapasson [Phys. Fluids 24, 011703 (2012)], the use of ab initio potentials in the DSMC requires the same computational efforts as the widely used potentials such as hard spheres, variable hard sphere, variable soft spheres, etc. At the same time, the ab initio potentials provide more reliable results than any other one. As an example, the transport coefficients of a binary mixture He-Ar, viz., viscosity, thermal conductivity, and thermal diffusion factor, have been calculated for several values of the mole fraction. PMID:23030889

  14. Detecting Adreno-Cortical Activity in Gorillas: A Comparison of Faecal Glucocorticoid Measures Using RIA Versus EIA


    J.B. Nizeyi; N. Czekala, S.L. Monfort, N. Taha, M. Cranfield, P. Linda and K. Gilardi


    The conservation community is concerned that the remnants of highly endangered Mountain gorilla are being exposed to enormous stressors in their habitat but no assay has been validated to monitor stress markers in their fecal medium. Non specific ICN Corticosterone RIA and Munro Cortisol EIA were validated for measurement of free-ranging Mountain gorilla Faecal Glucocorticoids Metabolites (FGM) to non-invasively detect effect of environmental stressors on the adrenocortical activity in gorill...

  15. A Conceptual Analysis of Environmental Justice Approaches: Procedural Environmental Justice in the EIA Process in South Africa and Zambia


    Towela Sambo, Pamela


    The Abstract of thesis submitted to the School of Law of The University of Manchester by Pamela Towela Sambo 7160514 for the Degree of Doctor of Philosophy (Ph.D.) in April 2012 is entitled “A Conceptual Analysis of Environmental Justice Approaches: Procedural Environmental Justice in the EIA Process in South Africa and Zambia.”This study argues that the basis of all environmental justice variations is the consideration of fairness, equity and justice in the environmental processes that resol...

  16. Assessment of the quality of selected EIA data series: uranium and nuclear power data from 1977 to 1983

    International Nuclear Information System (INIS)

    This report focuses on uranium exploration activity, uranium marketing activity, and capacity factors for nuclear power plants. These topics represented EIA's major data collections in the nuclear power area at the time this study was prepared. At the time the study was being prepared, EIA decided to revise its uranium data collections. This study focuses on those series that were candidates for change. The data series covered in this report represent commercial as opposed to military uses. The time period covered is from 1977 to 1983, but varies considerably, depending on the availability of the data. In any data collection and publication process, error can enter the estimates at various stages. Although data collectors expend considerable effort to reduce these errors, it is not possible to eliminate them completely. It is also not possible to quantify the combined effects of the various errors. The goal of this report is, therefore, to make the users aware of the stages at which error could enter the estimates so that they can better determine if these statistics are appropriate for their use. This report describes how the data series were obtained, how the data collection and tabulation procedures have changed over time, and how EIA series compare with other similar series. Chapter 2 gives an overview of the nuclear power industry and describes the points at which EIA collects data. Chapter 3 discusses selected data series on uranium exploration activity, and Chapters 4, 5, and 6 focus on uranium marketing activity. The final chapter discusses the capacity factor of nuclear power plants. 13 figures, 45 tables

  17. Surface Modification of AB2. and AB5 Hydrogen Storage Alloy Electrodes by the Hot-Charging Treatment

    Institute of Scientific and Technical Information of China (English)


    The effect of the hot-charging treatment on the performance ofAB2 and AB5 hydrogen storage alloy electrodes was investigated. The result showed that the treatment can markedly improve the voltage plateau ratio (VPR), the high rate discharge ability (HRDA), the diffusion coefficient of hydrogen DH and the discharge capacity of the AB2 hydrogen storage alloy electrode. The SEM analysis showed that the hot-charging treatment brings about a Ni-rich surface due to the dissolution of Zr oxides. It is also very helpful for the improvement of the kinetic properties of AB2 hydrogen storage alloy electrode because the microcracking o.f the surface results in fresh surface. This can be the basic modification treatment for NiMH battery used in electric vehicles (EVs) in the future. But for AB5 type alloys, the treatment has the disadvantage of impairing the comprehensive electrochemical properties, because the surface of the alloy may be corroded during the treatment. The mechanism of the surface modification of the electrode is also proposed.

  18. Stimulation of UvrD helicase by UvrAB. (United States)

    Atkinson, John; Guy, Colin P; Cadman, Chris J; Moolenaar, Geri F; Goosen, Nora; McGlynn, Peter


    Helicases play critical roles in all aspects of nucleic acid metabolism by catalyzing the remodeling of DNA and RNA structures. UvrD is an abundant helicase in Escherichia coli with well characterized functions in mismatch and nucleotide excision repair and a possible role in displacement of proteins such as RecA from single-stranded DNA. The mismatch repair protein MutL is known to stimulate UvrD. Here we show that the nucleotide excision repair proteins UvrA and UvrB can together stimulate UvrD-catalyzed unwinding of a range of DNA substrates containing strand discontinuities, including forked DNA substrates. The stimulation is specific for UvrD, as UvrAB failed to stimulate Rep helicase, a UvrD homologue. Moreover, although UvrAB can promote limited strand displacement, stimulation of UvrD did not require the strand displacement function of UvrAB. We conclude that UvrAB, like MutL, modulate UvrD helicase activity. This stimulation likely plays a role in DNA strand and protein displacement by UvrD in nucleotide excision repair. Promotion of UvrD-catalyzed unwinding of nicked duplexes by UvrAB may also explain the need for UvrAB and UvrD in Okazaki fragment processing in cells lacking DNA polymerase I. More generally, these data support the idea that helicase activity is regulated in vivo, with helicases acting as part of multisubunit complexes rather than in isolation. PMID:19208629

  19. Diagnosis of acute radiation disease by Enzyme Immune-Assay (EIA)

    International Nuclear Information System (INIS)

    Diagnosis of the acute radiation disease by the method of immune enzyme assay is a simple and efficient tool of evaluating and biological dosimetry and forecasting of development of the acute radiation defeats as at group of population so at individuals locating in the zone polluted by the radiation. We use as biological markers the group of essential radiotoxins - high molecular mass glycoprotein ( molecular mass - 200 - 250 kDa ) - radiation antigens (S.D.R. - specific radiation determinant ) accumulated in the lymphoid system, with epitopes specific to each form of radiation syndrome, after animals have been irradiated in doses inducing the development of the cerebral (1), toxic ( 2), gastrointestinal ( 3 ) and typical ( 4 ) forms of acute radiation sickness. These two phenomena allowed us to develop a technologies for diagnosis, prophylaxis and therapy of radiation disease - enzyme immune assay ( EIA ), anti radiation vaccine, anti radiation serum, method of immune - lymph - plasma-sorption. The important first step in effectiveness of therapy is an accurate assessment of severity of disease in early period after irradiation. The ideal markers for early and accurate assessment is high weight glycoprotein with specifics radiation induced features (S.D.R.) mentioned above. This biology active substance isolated from lymph can induct the symptoms of radiation syndrome without previously radiation when it is administrated intra-muscularly or intravenously to healthy animals. Enzyme immune assay (EIA) allowed researchers to indicate the significant levels of different forms of S.D.R. in peripheral blood of animals in first 24 hours after radiation. Indication of high level of S.D.R. -1 allowed to forecast a fast development of cerebral form of acute radiation disease. Determination of high levels of S.D.R.-2, S.D.R.-3 and S.D.R.-4 in peripheral blood allowed to recognize early periods of toxic, gastrointestinal and typical forms of acute radiation sickness

  20. The high speed buffer board: A SAIL EIA-485 communications accelerator card for the vector measuring current meter (United States)

    Singer, Robin; Butler, Douglas M.


    A High Speed Buffer Board (HSBB) was developed for the Vector Measuring Current Meter (VMCM) to implement the transmission of data at 9600 baud over an EIA-485 link. The HSBB significantly extends the VMCM communication functionality, which was previously limited to 300 baud transmission via 20mA current loop or FSK telemetry. The increased speed allows rapid sampling of a large number of current meters on a common cable and the EIA-485 circuitry, which was designed for low power operation, provides a useful multipoint communication method for data transmission over long cable lengths. SAIL protocol (IEEE 997) was utilized to coordinate data transfer by the instruments on a common link. An MC68HC11 microcontroller resides in the VMCM, buffering data it receives at 300 baud from the VMCM UART. In response to a jumper selectable SAIL address, the MC68HC11 offloads the data 9600 baud via EIA-485 to the SAIL controller. Synchronous data collection from many instruments is ensured by the SAIL synoptic set command and an embedded resynchronization/reset command. The low power consumption allows deployments of six months or more with a standard VMCM battery stack.

  1. Label transfer by measuring compactness. (United States)

    Varga, Robert; Nedevschi, Sergiu


    This paper presents a new automatic image annotation algorithm. First, we introduce a new similarity measure between images: compactness. This uses low level visual descriptors for determining the similarity between two images. Compactness shows how close test image features lie to training image feature cluster centers. The measure provides the core for a k-nearest neighbor type image annotation method. Afterward, a formalism for defining different transfer techniques is devised and several label transfer techniques are provided. The method as whole is evaluated on four image annotation benchmarks. The results on these sets validate the accuracy of the approach, which outperforms many state-of-the-art annotation methods. The method presented here requires a simple training process, efficiently combines different feature types and performs better than complex learning algorithms, even in this incipient form. The main contributions of this paper are the usage of compactness as a similarity measure that enables efficient low level feature comparison and an annotation algorithm based on label transfer. PMID:23955754

  2. Label Space Reduction in MPLS Networks: How Much Can A Single Stacked Label Do?

    DEFF Research Database (Denmark)

    Solano, Fernando; Stidsen, Thomas K.; Fabregat, Ramon;


    Most network operators have considered reducing LSR label spaces (number of labels used) as a way of simplifying management of underlaying virtual private networks (VPNs) and therefore reducing operational expenditure (OPEX). The IETF outlined the label merging feature in MPLS-allowing the config......Most network operators have considered reducing LSR label spaces (number of labels used) as a way of simplifying management of underlaying virtual private networks (VPNs) and therefore reducing operational expenditure (OPEX). The IETF outlined the label merging feature in MPLS...

  3. Link Label Prediction in Signed Citation Network

    KAUST Repository

    Akujuobi, Uchenna


    Link label prediction is the problem of predicting the missing labels or signs of all the unlabeled edges in a network. For signed networks, these labels can either be positive or negative. In recent years, different algorithms have been proposed such as using regression, trust propagation and matrix factorization. These approaches have tried to solve the problem of link label prediction by using ideas from social theories, where most of them predict a single missing label given that labels of other edges are known. However, in most real-world social graphs, the number of labeled edges is usually less than that of unlabeled edges. Therefore, predicting a single edge label at a time would require multiple runs and is more computationally demanding. In this thesis, we look at link label prediction problem on a signed citation network with missing edge labels. Our citation network consists of papers from three major machine learning and data mining conferences together with their references, and edges showing the relationship between them. An edge in our network is labeled either positive (dataset relevant) if the reference is based on the dataset used in the paper or negative otherwise. We present three approaches to predict the missing labels. The first approach converts the label prediction problem into a standard classification problem. We then, generate a set of features for each edge and then adopt Support Vector Machines in solving the classification problem. For the second approach, we formalize the graph such that the edges are represented as nodes with links showing similarities between them. We then adopt a label propagation method to propagate the labels on known nodes to those with unknown labels. In the third approach, we adopt a PageRank approach where we rank the nodes according to the number of incoming positive and negative edges, after which we set a threshold. Based on the ranks, we can infer an edge would be positive if it goes a node above the

  4. Simplest AB-Thermonuclear Space Propulsion and Electric Generator


    Bolonkin, Alexander


    The author applies, develops and researches mini-sized Micro- AB Thermonuclear Reactors for space propulsion and space power systems. These small engines directly convert the high speed charged particles produced in the thermonuclear reactor into vehicle thrust or vehicle electricity with maximum efficiency. The simplest AB-thermonuclear propulsion offered allows spaceships to reach speeds of 20,000 50,000 km/s (1/6 of light speed) for fuel ratio 0.1 and produces a huge amount of useful elect...

  5. Utveckling av ergoterapitjänster vid Helsingfors ergoterapi Ab


    Sandells, Linn


    Syftet med examensarbetet är att ta fram kvalitativa rekommendationer på ergoterapitjänster för barn i behov av särskilt stöd. Det har gjorts genom en processinriktad metod, rekommendationerna på ergoterapitjänster har tagits fram för Helsingfors ergoterapi Ab. Aktivitetsrättvisa är den teoretiska referensramen i arbetet. Den frågeställning som besvarats är vilka ergoterapitjänster kan rekommenderas till Helsingfors ergoterapi Ab. För att uppnå resultatet har materialinsamling och intervjuer ...

  6. Towards new horizons in ab initio nuclear structure theory

    International Nuclear Information System (INIS)

    We review recent advances in ab initio nuclear structure theory, which have changed the horizons of this field. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to further soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative QCD-based predictions are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (authors)

  7. Use of ab initio quantum chemical methods in battery technology

    Energy Technology Data Exchange (ETDEWEB)

    Deiss, E. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)


    Ab initio quantum chemistry can nowadays predict physical and chemical properties of molecules and solids. An attempt should be made to use this tool more widely for predicting technologically favourable materials. To demonstrate the use of ab initio quantum chemistry in battery technology, the theoretical energy density (energy per volume of active electrode material) and specific energy (energy per mass of active electrode material) of a rechargeable lithium-ion battery consisting of a graphite electrode and a nickel oxide electrode has been calculated with this method. (author) 1 fig., 1 tab., 7 refs.

  8. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    Directory of Open Access Journals (Sweden)

    G. Misra


    Full Text Available Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P, volume (V and temperature (T that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This ab initio method is extended to derive the equation of state for Mercuric Calcogenides. The present equation of state has also been tested for the prediction of End Point. The computed results compare well with Quantum statistical data.

  9. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    International Nuclear Information System (INIS)

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1962. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses (≥ 100 mrem/quarter) is for the whole of AB Atomenergi during this year 74. 2 manrem corresponding to about 50 mrem/year and person or 1 % of the maximum permissible dose. 32500 gamma films and 6200 neutron films have been evaluated. The total number of urine analyses is 2700 and of whole body measurements 10

  10. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    International Nuclear Information System (INIS)

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1963. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses during the year is for AB Atomenergi 64.2 manrem which, distributed over the whole company personnel, corresponds to about 40 mrem per year and person or about 1 % of the maximum permissible dose. 37800 gamma films and 6700 neutron films have been evaluated. The total number of urine analyses is 3603 and of whole body measurements 211

  11. Intern kontroll : - En studie om Schroff Scandinavia ABs interna kontroll


    Huldt, Martin; Björksved, Patrick


    Sammanfattning: ”Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll” Datum:  2014-06-11 Nivå: Kandidatuppsats i företagsekonomi, 15 ECTS Institution: Akademin för Ekonomi, Samhälle och Teknik, EST,                 Mälardalen Högskola Författare: Patrick Björksved, Martin Huldt Titel: Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll Handledare : Magnus Linderström Nyckelord: Intern kontroll, intern revision, intern styrning, COSO-modellen, Lean product...

  12. Bruksmakt och maktbruk : Robertsfors AB 1897-1968


    Holmström, Per


    This thesis studies seven strategic decisions made in the family-owned forestry company Robertsfors AB, in Northern Sweden. During the present century Ro­bertsfors AB has developed from a patriarchally concern controlled into a capi­talistic industrial company. This also meant a radical change in the decision­making process. Two factors were decisive in this process: the managing direc­tor's values, and altered power relationships both within the company and exter­nally in relation to e g sta...

  13. The optimal placement of up and ab – a comparison


    Dehé, Nicole


    The particle verb construction (PVC), also referred to in the literature as phrasal verb or separable complex verb, occurs in most if not all of the Germanic languages. The work presented here deals with a comparison of the transitive PVC in English and German. In English, the construction occurs in two alternating word orders (They called off the concert vs. They called the concert off ). In German, on the other hand, only one order is possible (Sie sagten das Konzert ab vs. *Sie sagten ab das...

  14. Recent achievements in ab initio modelling of liquid water

    CERN Document Server

    Khaliullin, Rustam Z


    The application of newly developed first-principle modeling techniques to liquid water deepens our understanding of the microscopic origins of its unusual macroscopic properties and behaviour. Here, we review two novel ab initio computational methods: second-generation Car-Parrinello molecular dynamics and decomposition analysis based on absolutely localized molecular orbitals. We show that these two methods in combination not only enable ab initio molecular dynamics simulations on previously inaccessible time and length scales, but also provide unprecedented insights into the nature of hydrogen bonding between water molecules. We discuss recent applications of these methods to water clusters and bulk water.

  15. Radiopharmaceutical potential of I-131 labelled diazepam

    International Nuclear Information System (INIS)

    In this study, diazepam is a derivative of the 1.4 benzodiazepine family that the most widely used drug as anticonvulsant agent has been labeled with I-131, as a new radiopharmaceutical and its radiopharmaceutical potential has been determined. Labeling of diazepam has been performed by iodogen method and optimum labeling conditions have been determined. Optimum reaction conditions are 1 mg for iodogen amount; 1-5 mg for diazepam amount, 15-20 minutes for reaction time and room temperature for reaction temperature. Specific activity of labeled compound was 0,15 Ci/mmol level. N-octanol/water ratio was found 1.9 for 131IDZ (131I labeled diazepam). In vivo experiments have been carried out to determine radiopharmaceutical potentials of labeled compound. Biodistribution studies on rats showed that 131IDZ have accumulated in kidneys, liver, lungs and brain tissues. Scintigraphic results taken with gamma camera on rabbits agree with biodistribution results of rats. (author)

  16. Irradiation test of bar code label

    International Nuclear Information System (INIS)

    The irradiation test of bar code label tagged on radioactive waste container was done to determine the effect of radiation. Low and medium radioactive waste is that below total activity of 4,000Bq/g according to the Korean nuclear law. The irradiation amount to radiate bar code label tagged on radioactive waste container was calculated by MCNP-4b computer code. The nuclide such as Co-60 and Cs-137 was assumed to contribute 50 % of total activity. Real irradiation amount for bar code label was finally calculated by the dimensions of the container and the bar code label. The identification of post and the physical deflection of irradiated bar code label was tested by the bar code reader. The coated bar code label was suitable to use on low and medium radioactive waste container

  17. Green power: naturemade - History of a label

    International Nuclear Information System (INIS)

    This article presents the history of the set of 'naturemade' labels that are used to designate power generated in facilities that use renewable energy. Electricity from hydropower, wind-power, biogas and solar energy plants that fulfil particular ecological conditions receives a special label, 'Naturemade Star'. 'Normal' hydropower can be awarded the 'Naturemade Basic' label. The development of the labels is discussed in the light of increasing liberalisation of European electricity markets and increasing sales of 'green power' by electricity utilities. The need for certification of production facilities and the founding of the label's certification authority, the 'Verein fuer umweltgerechte Elektrizitaet' (VUE), a society for the promotion of environment-friendly electricity, are discussed. Criticisms made by certain environmental protection organisations on the awarding of the 'Naturemade Basic' label to projects that in their opinion do not help protect the environment are quoted. The article is completed with an interview on the subject with Ursula Stocker from the VUE

  18. Modified procedure for labelling target cells in a europium release assay of natural killer cell activity. (United States)

    Pacifici, R; Di Carlo, S; Bacosi, A; Altieri, I; Pichini, S; Zuccaro, P


    Lanthanide europium chelated to diethylenetriaminopentaacetate (EuDTPA) can be used to label target cells such as tumor cells and lymphocytes (Blomberg et al., 1986a,b; Granberg et al., 1988). This procedure has permitted the development of new non-radioactive methods for the detection of target cell cytolysis by natural killer (NK) cells (Blomberg et al., 1986a,b), cytotoxic T lymphocytes (CTL) (Granberg et al., 1988) or complement-mediated cytolysis (Cui et al., 1992). However, we had no success with this method because of a lack of comparability between human NK cell activity simultaneously measured by a classical 51Cr release assay (Seaman et al., 1981) and EuDTPA release assay (Blomberg et al., 1986a). Furthermore, cell division and cell viability were significantly impaired by the suggested concentrations of EuCl3. In this paper, we present a modified non-cytotoxic method for target cell labelling with EuDTPA while cells are growing in culture medium. PMID:8486925

  19. Improving Recurrent Neural Networks For Sequence Labelling


    Dinarelli, Marco; Tellier, Isabelle


    In this paper we study different types of Recurrent Neural Networks (RNN) for sequence labeling tasks. We propose two new variants of RNNs integrating improvements for sequence labeling, and we compare them to the more traditional Elman and Jordan RNNs. We compare all models, either traditional or new, on four distinct tasks of sequence labeling: two on Spoken Language Understanding (ATIS and MEDIA); and two of POS tagging for the French Treebank (FTB) and the Penn Treebank (PTB) corpora. The...

  20. Alternative ways for private label manufacturing


    Kelemen, Zita; Némethné Tömő, Zsuzsa


    Private labels are a growing phenomenon globaly. retatlers become stronger and stronger by offering their own quality private label product for customers in all segments. Certainly they do not open factories to produce these items but rather search for dedicated private label producers or pressure branded goods manufacturers to produce it for them. The article deals with the strategic choiches manufacturers can have and suggest the necessary factors that need to be evaluated to decide on the ...

  1. Synthesis of carboxy-labelled 1-carnitine

    Energy Technology Data Exchange (ETDEWEB)

    Goodfellow, D.B.; Hoppel, C.L.; Turkaly, J.S. (Case Western Reserve Univ., Cleveland, OH (USA). School of Medicine)


    A method for the production of carboxy-labelled l-carnitine is described. The first step is the chemical synthesis of 4-N-trimethylammoniobutanoate (butyrobetaine) from the precursors 4-aminobutanoate and iodomethane. The second step involves the hydroxylation of butyrobetaine to form l-carnitine using butyrobetaine hydroxylase partially purified from bovine calf liver. The method also can be used to synthesize Me-labelled and uniformly-chain-labelled l-carnitine.

  2. Synthesis of carboxy-labelled 1-carnitine

    International Nuclear Information System (INIS)

    A method for the production of carboxy-labelled l-carnitine is described. The first step is the chemical synthesis of 4-N-trimethylammoniobutanoate (butyrobetaine) from the precursors 4-aminobutanoate and iodomethane. The second step involves the hydroxylation of butyrobetaine to form l-carnitine using butyrobetaine hydroxylase partially purified from bovine calf liver. The method also can be used to synthesize Me-labelled and uniformly-chain-labelled l-carnitine. (author)

  3. Applications of radioactively labelled nucleic acid probes

    International Nuclear Information System (INIS)

    Isotopically labelled nucleic acid probes are used extensively in many areas of molecular biology research. Several radioactive isotopes have been utilised for this purpose, with P-32 and S-35 proving the most popular. This contribution will highlight the factors dictating the choice of radioisotope and will describe techniques for in vitro labelling of nucleic acids. The experimental data presented will be focused on applications of labelled nucleic acids including DNA probe assays and DNA sequencing. (author). 9 refs., 2 figs., 4 tabs

  4. ML-MG: Multi-label Learning with Missing Labels Using a Mixed Graph

    KAUST Repository

    Wu, Baoyuan


    This work focuses on the problem of multi-label learning with missing labels (MLML), which aims to label each test instance with multiple class labels given training instances that have an incomplete/partial set of these labels (i.e. some of their labels are missing). To handle missing labels, we propose a unified model of label dependencies by constructing a mixed graph, which jointly incorporates (i) instance-level similarity and class co-occurrence as undirected edges and (ii) semantic label hierarchy as directed edges. Unlike most MLML methods, We formulate this learning problem transductively as a convex quadratic matrix optimization problem that encourages training label consistency and encodes both types of label dependencies (i.e. undirected and directed edges) using quadratic terms and hard linear constraints. The alternating direction method of multipliers (ADMM) can be used to exactly and efficiently solve this problem. To evaluate our proposed method, we consider two popular applications (image and video annotation), where the label hierarchy can be derived from Wordnet. Experimental results show that our method achieves a significant improvement over state-of-the-art methods in performance and robustness to missing labels.

  5. Comparative study of intact A7 MoAb and F(ab')2 fragments for radioimmunoimaging of human colon cancer in nude mice

    International Nuclear Information System (INIS)

    Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab')2 fragments were studied in human colon cancer (LS-174T)-bearing nude mouse. First of all, we examined the yield and the immunoreactivity of F(ab')2 fragments after treatment with ficin as a function of time. The yield of F(ab')2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab')2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab')2 was preferentially taken up by the tumor, was cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. In addition, the tumor image obtained at an early time using 131I-F(ab')2 was much superior in quality to that with intact 131I-A7 MoAb. The use of F(ab')2 fragments may be effective for tumor diagnosis and therapy. (author)

  6. GJ 282 AB (WDS 07400-0336 AB = BGH 3 AB) and GICLAS 112-29: A Very Wide System in Process of Dissociation (United States)

    Rica, F. M.; Benavides, R.


    Very wide binaries are interesting objects that shed light on the binary formation process and their dynamical evolution. Poveda et al. (2009) studied the possible physical relation of the near (14.2 pc) and wide (~58") binary star GJ 282 AB and the extremely wide (1.09º; ~55,000 AU) companion, NLTT 18149, and they concluded that this very wide system is in the process of dynamical disintegration. In this work, we confirm the same conclusion but using a different method. We first study dynamically GJ 282 AB, confirmed that it is a bound system and then we determine possible orbital solutions. Later, we calculate the relative velocity of NLTT 18149 with respect to the GJ 282 AB's center mass using their (U, V, W) galactocentric velocity. The relative velocity, Vrel = 1.98 ± 0.16 km s-1, is much larger than the escape velocity (0.25 ± 0.01 km s-1). Therefore, with a significance level of 11s, we also conclude that this very wide system is in a process of dynamical disintegration.

  7. Classifier Risk Estimation under Limited Labeling Resources


    Kumar, Anurag; Raj, Bhiksha


    In this paper we propose strategies for estimating performance of a classifier when labels cannot be obtained for the whole test set. The number of test instances which can be labeled is very small compared to the whole test data size. The goal then is to obtain a precise estimate of classifier performance using as little labeling resource as possible. Specifically, we try to answer, how to select a subset of the large test set for labeling such that the performance of a classifier estimated ...

  8. Novel Properties of Fuzzy Labeling Graphs


    Nagoor Gani, A.; Muhammad Akram; D. Rajalaxmi (a) Subahashini


    The concepts of fuzzy labeling and fuzzy magic labeling graph are introduced. Fuzzy magic labeling for some graphs like path, cycle, and star graph is defined. It is proved that every fuzzy magic graph is a fuzzy labeling graph, but the converse is not true. We have shown that the removal of a fuzzy bridge from a fuzzy magic cycle with odd nodes reduces the strength of a fuzzy magic cycle. Some properties related to fuzzy bridge and fuzzy cut node have also been discussed.

  9. Simultaneous segmentation and statistical label fusion (United States)

    Asman, Andrew J.; Landman, Bennett A.


    Labeling or segmentation of structures of interest in medical imaging plays an essential role in both clinical and scientific understanding. Two of the common techniques to obtain these labels are through either fully automated segmentation or through multi-atlas based segmentation and label fusion. Fully automated techniques often result in highly accurate segmentations but lack the robustness to be viable in many cases. On the other hand, label fusion techniques are often extremely robust, but lack the accuracy of automated algorithms for specific classes of problems. Herein, we propose to perform simultaneous automated segmentation and statistical label fusion through the reformulation of a generative model to include a linkage structure that explicitly estimates the complex global relationships between labels and intensities. These relationships are inferred from the atlas labels and intensities and applied to the target using a non-parametric approach. The novelty of this approach lies in the combination of previously exclusive techniques and attempts to combine the accuracy benefits of automated segmentation with the robustness of a multi-atlas based approach. The accuracy benefits of this simultaneous approach are assessed using a multi-label multi-atlas whole-brain segmentation experiment and the segmentation of the highly variable thyroid on computed tomography images. The results demonstrate that this technique has major benefits for certain types of problems and has the potential to provide a paradigm shift in which the lines between statistical label fusion and automated segmentation are dramatically blurred.

  10. Synthesis of tritium labelled 24-epibrassinolide

    Energy Technology Data Exchange (ETDEWEB)

    Kolbe, A.; Marquardt, V.; Adam, G. (Inst. of Plant Biochemistry Halle, Halle/Saale (Germany))


    Deuterium and tritium 5,7,7-tris-labelled 24-epibrassinolide were prepared by base catalyzed exchange reaction using 24-epicastasterone tetraacetate 1 or bis-isopropylidenedioxy-24-epicastasterone 8 and labelled water. Baeyer-Villiger oxidation of the obtained labelled 6-ketones 2 and 3 with CF[sub 3]CO[sub 3]H gave after alkaline deacetylation of the resulting 4 and 5 the desired tris-labelled 24-epibrassinolides 6 and 7, respectively, or starting from 9 under simultaneous oxidation and deprotection in one step the same final products. (author).

  11. (d,1)-total labelling of graphs


    Havet, Frédéric; Yu, Min-Li


    A $(d,1)$-total labelling of a graph $G$ is an assignment of integers to $V(G)\\cup E(G)$ such that: (i) any two adjacent vertices of $G$ receive distinct integers, (ii) any two adjacent edges of $G$ receive distinct integers, and (iii) a vertex and its incident edge receive integers that differ by at least $d$ in absolute value. The {\\it span} of a $(d,1)$-total labelling is the maximum difference between two labels. The minimum span of a $(d,1)$-total labelling of $G$ is denoted by $\\lambda_...

  12. Radioactivity measuring system of labelled biopolymers

    International Nuclear Information System (INIS)

    System for determining the radioactivity of labelled biopolymers, comprising a bank of containers filled with aqueous solutions of biological samples containing biopolymers. This system features an electric drive to move the bank of containers step by step; a device for the acid precipitation of the biopolymers which sends determined amounts of co-precipitant and diatom suspension in an acid solution to the containers containing a biological sample; a system for taking precipitated samples from the containers; a system for filtering the precipitated biopolymers carrying out successive filterings; placing the deposit into suspension; dissolving the biopolymers and sending the labelled mixture labelled by the scintillation labeller to the detection chamber

  13. Extending Modal Transition Systems with Structured Labels

    DEFF Research Database (Denmark)

    Bauer, Sebastian S.; Juhl, Line; Larsen, Kim Guldstrand; Legay, Axel; Srba, Jiri


    We introduce a novel formalism of label-structured modal transition systems that combines the classical may/must modalities on transitions with structured labels that represent quantitative aspects of the model. On the one hand, the specification formalism is general enough to include models like...... weighted modal transition systems and allows the system developers to employ more complex label refinement than in the previously studied theories. On the other hand, the formalism maintains the desirable properties required by any specification theory supporting compositional reasoning. In particular, we...... study modal and thorough refinement, determinization, parallel composition, conjunction, quotient, and logical characterization of label-structured modal transition systems....

  14. Stable isotope labeled L-tryptophan

    International Nuclear Information System (INIS)

    Stable isotope labeled L-tryptophan is an application of nucleus technology in amino acids. Progresses in stable isotope labeled L-tryptophan in recent years are reviewed.. In the respect of synthesis, in addition to the methods of organic synthesis and isotope exchange, the microbial technology which has the advantage of U-label and construct has been used widely. In the respect of applications, stable isotope labeled L-tryptophan as trace has been used widely in yields of medicine, biology and chemistry et al. Along with the development of protein engineering, molecular biology and peptide drugs, they will have a fine future. (authors)

  15. Comparison of IgG and F(ab'){sub 2} fragments of bispecific anti-RCC x anti-DTIn-1 antibody for pretargeting purposes

    Energy Technology Data Exchange (ETDEWEB)

    Schaijk, Frank G. van; Boerman, Otto C.; Soede, Annemieke C.; Corstens, Frans H.M. [Radboud University Nijmegen Medical Centre, Department of Nuclear Medicine, P.O. Box 9101, Nijmegen (Netherlands); McBride, William J. [Immunomedics, Inc., Morris Plains, NJ (United States); Goldenberg, David M. [Immunomedics, Inc., Morris Plains, NJ (United States); Center for Molecular Medicine and Immunology, Garden State Cancer Center, Belleville, NJ (United States); Oosterwijk, Egbert [Radboud University Nijmegen Medical Center, Department of Urology, Nijmegen (Netherlands); Ludwig Institute for Cancer Research, New York, NY (United States)


    An effective pretargeting strategy was developed for renal cell carcinoma (RCC) based on a biologically produced bispecific monoclonal antibody: anti-RCC x anti-DTPA(In) (bsMAb: G250 x DTIn-1). Tumour uptake of a {sup 111}In-labelled bivalent peptide after pretargeting with bsMAb G250 x DTIn-1 was relatively high compared with that in other pretargeting systems using chemically coupled F(ab'){sub 2} fragments. Here, we investigated the effect of the bsMAb form in the pretargeting strategy. To determine the optimal interval between the administration of each of the bsMAb forms and the {sup 111}In-labelled bivalent peptide, the biodistribution of the radioiodinated bsMAb forms was studied in athymic mice with subcutaneous SK-RC-1 RCC tumours. Since tumour targeting of the radiolabelled peptide depends on the bsMAb form and dose, a bsMAb dose escalation study was carried out for both bsMAb forms. Under optimised conditions, the biodistribution of the {sup 111}In label in mice with pretargeted RCC was determined from 4 h up to 7 days p.i. The optimal interval between the two administrations was 72 h for the bsMAb IgG and 4 h for the bsMAb F(ab'){sub 2}. The optimal bsMAb dose for intact IgG was 67 pmol and the optimal bsMAb F(ab'){sub 2} dose was 200 pmol. Targeting of the pretargeted RCC with 4 pmol {sup 111}In-labelled bivalent peptide revealed high tumour uptake with both bsMAb forms. With the pretargeting strategy, using either bsMAb IgG or bsMAb F(ab'){sub 2}, very efficient peptide targeting of the tumour was obtained. Uptake and retention of the radiolabel in the tumour with the pretargeting approach are not affected by the bsMAb form used. (orig.)

  16. Ab initio calculations of mechanical properties: Methods and applications

    Czech Academy of Sciences Publication Activity Database

    Pokluda, J.; Černý, Miroslav; Šob, Mojmír; Umeno, Y.


    Roč. 73, AUG (2015), s. 127-158. ISSN 0079-6425 R&D Projects: GA ČR(CZ) GAP108/12/0311 Institutional support: RVO:68081723 Keywords : Ab initio methods * Elastic moduli * Intrinsic hardness * Stability analysis * Theoretical strength * Intrinsic brittleness/ductility Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 27.417, year: 2014

  17. Discovery of New Substrates for LuxAB Bacterial Bioluminescence. (United States)

    Jiang, Tianyu; Wang, Weishan; Wu, Xingkang; Wu, Wenxiao; Bai, Haixiu; Ma, Zhao; Shen, Yuemao; Yang, Keqian; Li, Minyong


    In this article, four novel substrates with long halftime have been designed and synthesized successfully for luxAB bacterial bioluminescence. After in vitro and in vivo biological evaluation, these molecules can emit obvious bioluminescence emission with known bacterial luciferase, thus indicating a new promising approach to developing the bacterial bioluminescent system. PMID:26896339

  18. Cyanogen Azide. Ionization Potentials and Ab Initio SCF MO Calculation

    DEFF Research Database (Denmark)

    Bak, Börge; Jansen, Peter; Stafast, Herbert


    The Ne(I) and He(I) photoelectron(PE) spectra of cyanogen azide, NCN3, have been recorded at high resolution. Their interpretation is achieved by comparison with the PE spectrum of HN3 and an ab initio LCGO SCF MO calculation. Deviations from Koopmans' theorem of quite different magnitudes are fo...

  19. Relaxation of Small Molecules: an ab initio Study

    Institute of Scientific and Technical Information of China (English)

    CAO Yi-Gang; JIAO Zheng-Kuan; A. Antons; K. Schroeder; S. Blügel2


    Using an ab initio total energy and force method, we have relaxed several group IV and group V elementalclusters, in detail the arsenic and antimony dimers, silicon, phosphorus, arsenic and antimony tetramers. The obtainedbond lengths and cohesive energies are more accurate than other calculating methods, and in excellent agreement withthe experimental results.

  20. Relaxation of Small Molecules:an ab initio Study

    Institute of Scientific and Technical Information of China (English)

    CAOYi-Gang; A.Antons; 等


    Using an ab inito total energy and force method,we have relaxed several group IV and group V elemental clusters,in detail the arsenic and antimony dimers,silicon,phosphorus,arsenic and antimony tetraners,The obtained bond lengths and cohesive energies are more accurate than other calculating methods,and in excellent agreement with the experimental results.

  1. Ab initio study of phase equilibria in TiCx

    DEFF Research Database (Denmark)

    Korzhavyi, P.A.; Pourovskii, L.V.; Hugosson, H.W.;


    The phase diagram for the vacancy-ordered structures in the substoichiometric TiCx (x = 0.5-1.0) has been established from Monte Carlo simulations with the long-range pair and multisite effective interactions obtained from ab initio calculations. Three ordered superstructures of vacancies (Ti2C, ...

  2. Environmentally friendly process for nickel electroplating of ABS (United States)

    Bazzaoui, M.; Martins, J. I.; Bazzaoui, E. A.; Albourine, A.


    Nickel electroplating of acrylonitrile butadiene styrene (ABS) plastic has been achieved successfully without any chromium or palladium pretreatment. Once the ABS is coated with polypyrrole (PPy), the sample may be electroplated. The process is fast, economic and involves three stages. Firstly, chemical deposition of PPy on ABS, secondly, copper deposition and finally nickel electroplating. A homogenous and adherent PPy has been synthesized chemically on ABS plate by using pyrrole as monomer and iron (III) chloride as oxidant. Copper and nickel were deposited galvanostatically from industrial plating baths. The metallic coatings were homogeneous and the adherence was estimated at 100%. The thickness of copper and nickel depend on the electrolysis time. As the current density increases, the Cu and Ni thickness raises. This result was confirmed from SEM characterization and RX map. The Ni coating is characterized by a globular structure with globules of different sizes. Energy dispersive X-ray spectroscopy (EDS) analysis shows the presence of Ni with some amount of carbon and oxygen due to the nickel oxides and contaminant from the bath solution.

  3. A-B Distinction in a Sample of Prominent Psychotherapists (United States)

    Geller, Jesse D.; Berzins, Juris I.


    A sample of prominent psychotherapists were asked to fill out the A-B therapist "type" scale and comment on their possible differential effectiveness in treating schizoid/schizophrenic versus neurotic patients. The data suggest that B therapists desire and seek more complex and exciting sensory-cognitive inputs during therapy hours than A…

  4. AB 1725 Model Accountability System. California Community Colleges. Revised. (United States)

    California Community Colleges, Sacramento. Board of Governors.

    This report proposes a model accountability system for the California community colleges to comply with the directives of Assembly Bill 1725 (AB 1725). The purpose of the accountability system is to provide colleges and districts, the board of governors, and the California legislature with information that will allow for the continued improvement…

  5. Ultra-Low Voltage Class AB Switched Current Memory Cell

    DEFF Research Database (Denmark)

    Igor, Mucha


    This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with...

  6. Synthesis and labelling of epidepride

    International Nuclear Information System (INIS)

    S-(-)-N-[(1-ethyl-2-pyrrolidinyl) methyl]-5-iodo-2,3-dimethoxybenzamide (proposed generic name, epidepride) is a very potent dopamine D2 antagonist. It was synthesized by five steps from 3-methoxysalicylic acid. [131I]epidepride was obtained in 97.3% radiochemical yields from the corresponding 5-(tributyltin) derivative using hydrogen peroxide as the oxidant. The aryltin precursor was prepared from non-labelled epidepride by palladium-catalyzed stannylene using bis (tri-n-butyltin) in triethylamine. [131I] epidepride was stable under 4 degree C, and partition coefficient was 72.3 at pH 7.40. The biodistribution study in rats exhibited high localization in the striatum of the brain with the striatum/cerebellum ratio reaching 237/1 at 320 min postinjection. All these results suggest that [131I] epidepride may be used widely as a useful dopamine D2 receptor imaging agent for SPECT

  7. Synthesis and labelling of epidepride

    Institute of Scientific and Technical Information of China (English)


    S-(-)-N-[(1-ethyl-2-pyrrolidinyl)methyl]-5-iodo-2,3-dimethoxybenzamide (proposed generic name, epidepride) is a very potent dopamine D2 antagonist. It was synthesized by five steps from 3-methoxysalicylic acid. [131I]epidepride was obtained in 97.3% radiochemical yields from the corresponding 5-(tributyltin) derivative using hydrogen peroxide as the oxidant. The aryltin precursor was prepared from non-labelled epidepride by palladium-catalyzed stannylation using bis(tri-n-butyltin) in triethylamine. [131I]epidepride was stable under 4℃, and partition coefficient was 72.3 at pH 7.40. The biodistribution study in rats exihibited high localization in the striatum of the brain with the striatum/cerebellum ratio reaching 237/1 at 320 min postinjection.All these results suggest that[131I]epidepride may be usedd widely as a useful dopamineD2 receptor imaging agent for SPECT.

  8. Principles of food product labelling

    Directory of Open Access Journals (Sweden)

    Krystyna Krysztofiak


    Full Text Available The purpose of the label of the food product is to provide information on ingredients and additionally on its origin, production method, storage conditions, date tagging, as well as to enable to identify the producer or distributor of this product. Legal regulations precisely give instructions on the range and the way of the presentation of these data, so they could be clear and understandable for the average consumer. Since 25th of November 2005, the information about allergens’ presence must be placed on the label, regardless of their content in the product (Directive 2003/89/WE... 2003 – Off. J. L 308: 15-18. The Regulation (WE No 1924/2006 about placing the nutritional information and medicinal claims concerning foods (Regulation (WE No 1924/2006... 2006 a is valid in all countries of European Union since 1st of July 2007 (Off. J. L 404: 9-25. It coordinates the legislative, executive and administrative regulations connected with this labelling. According to these regulations, “nutritional information” states, suggests or gives to understand that the food product has special properties concerning its ingredients. Those statements are of type: “the source of...”, “no... content”, “high content of...”, “low content of...”, “reduced content of...” with reference to calorie or selected ingredients’ content. “Medicinal claims” state, suggest or give to understand, that there is a connection between the food product or one of its ingredients and the health condition of the consumer. First type of these medicinal claims refers to the influence of the ingredient on the physiology. Such a statement is based on generally accepted scientific conclusions and could be properly understood by the average consumer, e.g. “calcium takes part in the process of building of strong bones”. “Statements about decreasing the risk of a disease” give information, that food product or one of its ingredients efficiently

  9. GIS - Based data presentation and interactive communication system for public involvement in EIA

    International Nuclear Information System (INIS)

    The data presentation and interactive communication system has as main task to integrate technical and administrative information, as well as to ensure an efficient public participation. The system can achieve desired inter-operability between specialists, government and public in decision-making and environmental impact assessment (EIA). It incorporates different modules relative to specific types of parameters and authorities involved. The GIS-based system provides mapping, database, automatic information collection and advanced presentation techniques. It includes a graphically oriented executive support, which has the ability to present information by geographical representation of the zones on the map. The public opinion is taking into account by consideration of alternatives and providing access to the monitoring of environmental effects. The system offers an effective way to avoid negative reactions by interactive communication based on real-time information exchange. The system can be integrated into national or international management systems, being a useful tool for an efficient communication, handling and exchanging a vast amount of information. (authors)

  10. EEJ and EIA variations during modeling substorms with different onset moments (United States)

    Klimenko, V. V.; Klimenko, M. V.


    This paper presents the simulations of four modeling substorms with different moment of substorm onset at 00:00 UT, 06:00 UT, 12:00 UT, and 18:00 UT for spring equinoctial conditions in solar activity minimum. Such investigation provides opportunity to examine the longitudinal dependence of ionospheric response to geomagnetic substorms. Model runs were performed using modified Global Self-consistent Model of the Thermosphere, Ionosphere and Protonosphere (GSM TIP). We analyzed GSM TIP simulated global distributions of foF2, low latitude electric field and ionospheric currents at geomagnetic equator and their disturbances at different UT moments substorms. We considered in more detail the variations in equatorial ionization anomaly, equatorial electrojet and counter equatorial electrojet during substorms. It is shown that: (1) the effects in EIA, EEJ and CEJ strongly depend on the substorm onset moment; (2) disturbances in equatorial zonal current density during substorm has significant longitudinal dependence; (3) the observed controversy on the equatorial ionospheric electric field signature of substorms can depend on the substorm onset moments, i.e., on the longitudinal variability in parameters of the thermosphere-ionosphere system.

  11. EIA model documentation: Petroleum market model of the national energy modeling system

    International Nuclear Information System (INIS)

    The purpose of this report is to define the objectives of the Petroleum Market Model (PMM), describe its basic approach, and provide detail on how it works. This report is intended as a reference document for model analysts, users, and the public. Documentation of the model is in accordance with EIA's legal obligation to provide adequate documentation in support of its models. The PMM models petroleum refining activities, the marketing of petroleum products to consumption regions, the production of natural gas liquids in gas processing plants, and domestic methanol production. The PMM projects petroleum product prices and sources of supply for meeting petroleum product demand. The sources of supply include crude oil, both domestic and imported; other inputs including alcohols and ethers; natural gas plant liquids production; petroleum product imports; and refinery processing gain. In addition, the PMM estimates domestic refinery capacity expansion and fuel consumption. Product prices are estimated at the Census division level and much of the refining activity information is at the Petroleum Administration for Defense (PAD) District level

  12. Comparing GIS-based habitat models for applications in EIA and SEA

    International Nuclear Information System (INIS)

    Land use changes, urbanisation and infrastructure developments in particular, cause fragmentation of natural habitats and threaten biodiversity. Tools and measures must be adapted to assess and remedy the potential effects on biodiversity caused by human activities and developments. Within physical planning, environmental impact assessment (EIA) and strategic environmental assessment (SEA) play important roles in the prediction and assessment of biodiversity-related impacts from planned developments. However, adapted prediction tools to forecast and quantify potential impacts on biodiversity components are lacking. This study tested and compared four different GIS-based habitat models and assessed their relevance for applications in environmental assessment. The models were implemented in the Stockholm region in central Sweden and applied to data on the crested tit (Parus cristatus), a sedentary bird species of coniferous forest. All four models performed well and allowed the distribution of suitable habitats for the crested tit in the Stockholm region to be predicted. The models were also used to predict and quantify habitat loss for two regional development scenarios. The study highlighted the importance of model selection in impact prediction. Criteria that are relevant for the choice of model for predicting impacts on biodiversity were identified and discussed. Finally, the importance of environmental assessment for the preservation of biodiversity within the general frame of biodiversity conservation is emphasised.

  13. Perceived barriers and motives to reading nutrition label among label ‘non-users’ in Croatia


    Ranilović, Jasmina; Colić Barić, Irena


    The purpose of this paper is to examine barriers and motives associated with reading nutrition information among label ‘non-users’ in Croatia and relationship with demographic and health factors of recruited sample.Label ‘non-users’ are subjects reported that had never or do not know or wish to tell aboutreading nutrition label during food purchasing (n=375) and were recruited from representative sample telephone interviewed Croatian, for assessing nutrition label attitudes. It is found that ...

  14. Chain store management through private labels strategy

    Directory of Open Access Journals (Sweden)

    Martina Sopta


    Full Text Available The purpose of this paper is to examine the market shares of private labels in the European Union and on the global market, and to compare the results of the analysis with the level of presence of private labels on the Croatian market. Moreover, through the application of macro and microeconomic tools, the author tried to estimate the future trends of private labels in Croatia.For the purpose of the paper secondary and primary data was used in the research. Relevant scientific and professional literature of local and foreign authors was analyzed. In addition, a few recent research studies were analyzed and their results compared. Field research has been conducted by the survey method, with 225 respondents included in the intentional sample.The main hypothesis of the paper based on research is that, in total sales, private labels are gaining a growing share in all markets, regardless of the development level of those markets. Alongside the main hypothesis of the work, three supporting hypotheses were tested to see which private labels are a good alternative to other brands on the world market. Private labels are generally developed on generic products. The third supporting hypothesis starts from the assumption that the investments in the promotion of private labels are negligible, resulting in lower prices of thoseproducts. The results of research and analyses in the work indicate that the position of private labels will strengthen internationally, as part of the process of liberalization and globalization of trade flows. In the process of purchase of private labels the positioning of the point of sale and price have an increasing contribution. With the concentration of commerce in chain stores, the share of private labels grows, approaching a half of the total sales in some countries. Considering the Croatian market, according to the international product life cycle theory, the share of private labels in the total sales will grow in the future

  15. Portion Size Labeling and Intended Soft Drink Consumption: The Impact of Labeling Format and Size Portfolio (United States)

    Vermeer, Willemijn M.; Steenhuis, Ingrid H. M.; Leeuwis, Franca H.; Bos, Arjan E. R.; de Boer, Michiel; Seidell, Jacob C.


    Objective: To assess what portion size labeling "format" is most promising in helping consumers selecting appropriate soft drink sizes, and whether labeling impact depends on the size portfolio. Methods: An experimental study was conducted in fast-food restaurants in which 2 labeling formats (ie, reference portion size and small/medium/large…

  16. To Label or Not to Label: The Special Education Question for African Americans (United States)

    Gold, Moniqueka E.; Richards, Heraldo


    Over the years, the benefits of categorically identifying and labeling students with disabilities have been debated on many grounds, particularly when it comes to labeling African-American children who many argue are over-labeled or disproportionately represented in selected categories such as learning disabilities. In this article, the authors…

  17. Radioimmunoimaging of non-small cell lung cancer with [sup 111]In- and [sup 99m]Tc-labeled monoclonal anti-CEA antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Kairemo, K.J.A. (Dept. of Clinical Chemistry, Helsinki Univ. Central Hospital (Finland)); Aronen, H.J. (Dept. of Radiology, Helsinki Univ. Central Hospital (Finland)); Liewendahl, K. (Dept. of Clinical Chemistry, Helsinki Univ. Central Hospital (Finland)); Paavonen, T. (Dept. of Pathology, Helsinki Univ. Central Hospital (Finland)); Heikkonen, J.J. (Dept. of Radiotherapy and Oncology, Helsinki Univ. Central Hospital (Finland)); Virkkunen, P. (Dept. of Radiotherapy and Oncology, Helsinki Univ. Central Hospital (Finland)); Maeki-Hokkonen, H. (Dept. of Radiotherapy and Oncology, Helsinki Univ. Central Hospital (Finland)); Karonen, S.L. (Dept. of Clinical Chemistry, Helsinki Univ. Central Hospital (Finland)); Brownell, A.L. (Dept. of Clinical Chemistry, Helsinki Univ. Central Hospital (Finland)); Maentylae, M.J. (Dept. of Radiotherapy and Oncology, Helsinki Univ. Central Hospital (Finland))


    Radiolabeled monoclonal anti-CEA antibodies were used for radioimmunolocalization (RIL) of non-small cell lung cancer; in 30 patients with [sup 111]In labeled anti CEA F(ab')[sub 2] fragment (BW 431/31) and in 16 with [sup 99m]Tc-labeled intact MoAb (BW 431/26). RIL results were compared with those of other imaging modalities. Paraffin sections from some patients were also studied immunohistochemically using anti-CEA antibody. Patients with [sup 111]In labeled MoAB were imaged twice 1-4 days after injection and for image enhancement pulmonary and liver/spleen subtraction were performed. Twenty-seven of 28 primary tumors were positive and metastases were detected in all patients. The total number of lesions was 78 of which 61 (78%) could be detected by RIL. For verification CT was applied to the study of 46 lesions detected by RIL. We found 6 unknown lesions subsequently verified histologically. Using subtraction techniques we detected 9 lesions in 4 patients, later verified as plumonary metastases, not detected in unprocessed images. Pleural, mediastinal and pericardial lesions were also better delineated in subtracted images than in unprocessed images. Imaging of non-small cell lung cancer with [sup 99m]Tc-labeled MoAB was performed twice 4-24 h after injection. RIL results were compared with other imaging methods; CT US, conventional radiography, and immunohistochemistry. Twelve out of 16 patients with suspected or known lung cancer had positive immunoscintigrams; 19 of 25 lesions could be detected by RIL. There were 5 false positive and 2 true negative findings. Immunoperoxidase (IP) stainings of paraffin sections of the tumours from 7 patients were performed using two different anti-CEA antibodies; BW 431/26 and ZCEA[sub 1]. None of the seven tumors examined by immunohistochemistry were negative when stained by BW 431/26, which was the antibody used for immunoscintigraphy. (orig.).

  18. Durable donor engraftment after radioimmunotherapy using α-emitter astatine-211-labeled anti-CD45 antibody for conditioning in allogeneic hematopoietic cell transplantation. (United States)

    Chen, Yun; Kornblit, Brian; Hamlin, Donald K; Sale, George E; Santos, Erlinda B; Wilbur, D Scott; Storer, Barry E; Storb, Rainer; Sandmaier, Brenda M


    To reduce toxicity associated with external γ-beam radiation, we investigated radioimmunotherapy with an anti-CD45 mAb labeled with the α-emitter, astatine-211 ((211)At), as a conditioning regimen in dog leukocyte antigen-identical hematopoietic cell transplantation (HCT). Dose-finding studies in 6 dogs treated with 100 to 618 μCi/kg (211)At-labeled anti-CD45 mAb (0.5 mg/kg) without HCT rescue demonstrated dose-dependent myelosuppression with subsequent autologous recovery, and transient liver toxicity in dogs treated with (211)At doses less than or equal to 405 μCi/kg. Higher doses of (211)At induced clinical liver failure. Subsequently, 8 dogs were conditioned with 155 to 625 μCi/kg (211)At-labeled anti-CD45 mAb (0.5 mg/kg) before HCT with dog leukocyte antigen-identical bone marrow followed by a short course of cyclosporine and mycophenolate mofetil immunosuppression. Neutropenia (1-146 cells/μL), lymphopenia (0-270 cells/μL), and thrombocytopenia (1500-6560 platelets/μL) with prompt recovery was observed. Seven dogs had long-term donor mononuclear cell chimerism (19%-58%), whereas 1 dog treated with the lowest (211)At dose (155 μCi/kg) had low donor mononuclear cell chimerism (5%). At the end of follow-up (18-53 weeks), only transient liver toxicity and no renal toxicity had been observed. In conclusion, conditioning with (211)At-labeled anti-CD45 mAb is safe and efficacious and provides a platform for future clinical trials of nonmyeloablative transplantation with radioimmunotherapy-based conditioning. PMID:22134165

  19. A análise dos impactos socioeconômicos na estruturação do EIA/RIMA: a importância da Abordagem Humanista para a Sustentabilidade The analysis of socio-economic impacts on the structure of EIA / RIMA: the importance of humanist approach to sustainability

    Directory of Open Access Journals (Sweden)

    Leandro Carlos Dias Conde


    Full Text Available DOI: 10.5902/198346597686O presente trabalho trata da defesa da abordagem humanista na estruturação da análise de Impacto Ambiental (EIA e do seu Relatório de Impacto Ambiental (RIMA, no que concerne aos impactos socioeconômicos abordados, por compreender que a abordagem convencional não dá conta das demandas sociais, pois somente esta nova abordagem dará, de fato, o caráter sustentável da EIA/RIMA. The present work deals with the defense of the humanistic approach in structuring the analysis of Environmental Impact Assessment (EIA and its Environmental Impact Report (RIMA in relation to socioeconomic impacts addressed to realize that the conventional approach does not account social demands, as only this new approach will in fact the sustainable nature of the EIA / RIMA.

  20. A sandwich-type immunosensor using Pd–Pt nanocrystals as labels for sensitive detection of human tissue polypeptide antigen

    International Nuclear Information System (INIS)

    A sandwich-type immunosensor was developed for the detection of human tissue polypeptide antigen (hTPA). In this work, a graphene sheet (GS) was synthesized to modify the surface of a glassy carbon electrode (GCE), and Pd–Pt bimetallic nanocrystals were used as secondary-antibody (Ab2) labels for the fabrication of the immunosensor. The amperometric response of the immunosensor for catalyzing hydrogen peroxide (H2O2) was recorded. And electrochemical impedance spectroscopy was used to characterize the fabrication process of the immunosensor. The anti-human tissue polypeptide antigen primary antibody (Ab1) was immobilized onto the GS modified GCE via cross-linking with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and N-hydroxysuccinimide (EDC/NHS). With Ab1 immobilized onto the GS modified GCE and Ab2 linked on Pd–Pt bimetallic nanocrystals, the immunosensor demonstrated a wide linear range (0.0050–15 ng ml−1), a low detection limit (1.2 pg ml−1), good reproducibility, good selectivity and acceptable stability. This design strategy may provide many potential applications in the detection of other cancer biomarkers. (paper)

  1. Radioimmunoscintigraphy of experimental internal carotid arterial thrombi in dogs with 99mTc-labelled monoclonal anti-activated platelet antibody SZ-51

    International Nuclear Information System (INIS)

    The capacity of McAbSZ-51, which is specific for an α-granule membrane protein (GMP-140) expressed on the surface of activated platelets, to bind to the grafted human thrombus in rabbits was studied. The feasibility of imaging thrombus with 99mTc-labelled McAbSZ-51 in the internal carotid artery of dog was also explored. The results showed that McAbSZ-51 could bind to the grafted human thrombus in rabbits. The thrombus in internal carotid artery was clearly discerned at 2 to 6 h after injection of 99mTc-SZ-51, with the optimal imaging time at 2 to 4 h after injection. The radioactivity ratio of thrombus to blood was 6.03 +- 1.09 at 6 to 8 h after injection. It is thus concluded that by using the 99mTc-labelled McAbSZ-51, the early and specific detection of thrombi formed in vivo was fairly possible and feasible. (3 figs., 1 tab.)

  2. A network signal amplification strategy of ultrasensitive photoelectrochemical immunosensing carcinoembryonic antigen based on CdSe/melamine network as label. (United States)

    Li, Jiaojiao; Zhang, Yong; Kuang, Xuan; Wang, Zhiling; Wei, Qin


    Taking advantage of CdSe/melamine network as label and Au-TiO2 as substrate, this work developed a novel kind of signal amplification strategy for fabricating photoelectrochemical (PEC) immunoassay. The melamine, a star-shaped triamino molecule, was firstly used for readily capturing CdSe QDs and forming a CdSe/melamine network, which was formed through strong interactions between the carboxyl groups of TGA-stabilized CdSe QDs and the three amino groups of each melamine molecule. In this strategy, the primary antibody (Ab1) was immobilized onto Au-TiO2 substrate, which made the photoelectric conversion efficiency increase significantly. After the formed Ab2-CdSe/melamine network labels were captured onto the electrode surface via the specific antibody-antigen interaction, the photoelectric activity could be further enhanced via the interaction between the Au-TiO2 substrate and CdSe/melamine network. Due to this amplification of PEC signals and the special structure of the label, the fabricated PEC immunosensor was applied for sensitive and specific detection of cancer biomarker carcinoembryonic antigen (CEA), and displayed a wide linear range (0.005-1000ngmL(-1)) and low detection limit (5pgmL(-1)). In addition, the immunosensor was performed with good stability and reproducibility, and the results to analyze human serum samples were satisfactory. PMID:27281106

  3. Preclinical evaluation of copper-67 labelled anti-MUC1 mucin antibody C595 for therapeutic use in bladder cancer

    International Nuclear Information System (INIS)

    Transitional cell carcinoma of the bladder is the fifth commonest cause of death from cancer in men in the United Kingdom. Most patients present early with superficial disease, though with current treatment up to 20% progress to invasive disease, which has a poor prognosis. Better local treatments are required to limit this tumour progression. The ease of access to the bladder via a catheter provides the ideal opportunity for antibody (Ab) targeted therapy. We have previously shown that indium-111 labelled anti-MUC1 mucin Ab C595 selectively localises to bladder tumours after intravesical administration. We have selected copper-67 as an alternative radiolabel with suitable physical characteristics for radioimmunotherapy. This communication demonstrates that C595 can be reproducibly labelled with 67Cu and that the radioimmunoconjugate is both stable and maintains high immunoreactivity. Pilot studies on cystectomy specimens in a novel ex vivo system and in one patient confirmed the ability of this conjugate to localise to tumour after intravesical administration. On the basis of these studies we are now in a position to study the intravesical administration of 67Cu-labelled C595 in patients with bladder cancer with a view to a therapeutic trial. (orig.). With 4 figs., 1 tab

  4. Protective mAbs and Cross-Reactive mAbs Raised by Immunization with Engineered Marburg Virus GPs.

    Directory of Open Access Journals (Sweden)

    Marnie L Fusco


    Full Text Available The filoviruses, which include the marburg- and ebolaviruses, have caused multiple outbreaks among humans this decade. Antibodies against the filovirus surface glycoprotein (GP have been shown to provide life-saving therapy in nonhuman primates, but such antibodies are generally virus-specific. Many monoclonal antibodies (mAbs have been described against Ebola virus. In contrast, relatively few have been described against Marburg virus. Here we present ten mAbs elicited by immunization of mice using recombinant mucin-deleted GPs from different Marburg virus (MARV strains. Surprisingly, two of the mAbs raised against MARV GP also cross-react with the mucin-deleted GP cores of all tested ebolaviruses (Ebola, Sudan, Bundibugyo, Reston, but these epitopes are masked differently by the mucin-like domains themselves. The most efficacious mAbs in this panel were found to recognize a novel "wing" feature on the GP2 subunit that is unique to Marburg and does not exist in Ebola. Two of these anti-wing antibodies confer 90 and 100% protection, respectively, one hour post-exposure in mice challenged with MARV.

  5. On the Complexity of Labeled Oriented Trees

    Indian Academy of Sciences (India)

    Stephan Rosebrock


    We define a notion of complexity for labeled oriented trees (LOTs) related to the bridge number in knot theory and prove that LOTs of complexity 2 are aspherical. We also present a class of LOTs of higher complexity which is aspherical, give an upper bound for the complexity of labeled oriented intervals and study the complexity of torus knots.

  6. China Cotton label to be generalized

    Institute of Scientific and Technical Information of China (English)


    "China Cotton"authorization press conference was held in Beijing on October 11. China Cotton Association granted authorization to the first four enterprises, allowing them to use the label of China Cotton on their qualified products. Shandong Lanyan Group, Beijing Miantian Textile Co., Ltd are among the fi rst companies authorized to use China Cotton label.

  7. Eco-Labeling Perspectives amongst Malaysian Consumers

    Directory of Open Access Journals (Sweden)

    Nik Ramli Nik Abdul Rashid


    Full Text Available This study explores the Malaysian consumers’ trust of an eco-label and the influence it has in their choice for the corresponding environment friendly product. Taking into consideration the infancy stage of the Malaysia green marketing initiative, traditional approach to evaluating local consumer receptiveness to the eco-label might not be suitable. This paper approaches the introduction of eco-label with two perspectives in mind. Firstly, while earlier studies from the western scholars use eco-label as a part of the augmented product, this study introduces eco-label as a separate moderating variable. Secondly, the choice of employees working in ISO14001 certified organizations as the population explore a potentially conducive place to initiate a systematic effort in developing a green consumer community. The result is very encouraging. This study has shown that, with some exposure to environmental related experiences Malaysian consumer would indeed react positively to the eco-label. In fact, for situation that requires them to consider environmental aspects of a product that they wish to purchase, the eco-label will definitely be the crucial factor that will push them to make the right purchase choice. Key words: Eco-label; Environmental attitude; Knowledge of Environmental Issues; Green Products; Environmental Management System

  8. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... Lessons? Visit KidsHealth in the Classroom What Other Parents Are Reading Upsetting News Reports? What to Say ... Read a Nutrition Facts Label (Video) KidsHealth > For Parents > How to Read a Nutrition Facts Label (Video) ...

  9. The anatomy of a laser label (United States)

    Laser labeling of fruits and vegetables is an efficient alternative to adhesive tags. The advantages of this system are numerous. In general the label consists of alphanumerical characters formed by laser generated pinhole depressions that penetrate the produce’s surface creating visible markings. H...

  10. Do European consumers use nutrition labels?

    DEFF Research Database (Denmark)

    Wills, Josephine M.; Grunert, Klaus G.; Celemín, Laura Fernández;


    Nutrition labelling on food packages becomes more and more widespread in the European Union. Such information is not compulsory, unless a nutrition or health claim is made. However, how do consumers use nutrition information? Two European studies are currently assessing whether nutrition...... knowledge about nutrition and are able to use nutrition labels to identify healthier products within a category....

  11. 10 CFR 20.1904 - Labeling containers. (United States)


    ... 10 Energy 1 2010-01-01 2010-01-01 false Labeling containers. 20.1904 Section 20.1904 Energy....1904 Labeling containers. (a) The licensee shall ensure that each container of licensed material bears... handling or using the containers, or working in the vicinity of the containers, to take precautions...

  12. 21 CFR 331.80 - Professional labeling. (United States)


    ... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS FOR HUMAN USE ANTACID PRODUCTS FOR OVER-THE-COUNTER (OTC) HUMAN USE Labeling § 331.80 Professional labeling... low phosphate diet to prevent formation of phosphate urinary stones, through the reduction...

  13. Synthesis of tritium-labeled fosfomycin

    Energy Technology Data Exchange (ETDEWEB)

    Mertel, H.E.; Meriwether, H.T. (Merck Sharp and Dohme Research Labs., Rahway, NJ (USA))


    Tritium gas was used as a labeling agent for the preparation of (1,2-/sup 3/H)fosfomycin. Introduction of tritium into a precursor, the synthesis including resolution of the intermediate racemic 1,2-epoxypropylphosphonic acid, and preparation of both amine and calcium salts of the labeled antibiotic are described.

  14. 9 CFR 101.4 - Labeling terminology. (United States)


    ... Labeling terminology. Terms pertaining to identification and packaging of biological products shall mean: (a) Label. All written, graphic, or printed matter: (1) Upon or attached to a final container of a... other written, printed, or graphic matter accompanying the final container. (c) Final container....

  15. How to Read a Nutrition Facts Label

    Medline Plus

    Full Text Available ... Growth How to Read a Nutrition Facts Label (Video) KidsHealth > For Parents > How to Read a Nutrition Facts Label (Video) Print A A A Text Size en español Cómo leer las etiquetas de datos nutricionales (video) For Teens For Kids For Parents MORE ON ...



    Veyssiere, Luc; Giannakas, Konstantinos


    This paper systematically analyzes the strategic effects of national regulatory decisions on labeling of GM products and identifies the determinants of the non-cooperative Nash equilibrium labeling regimes in a small number of producing countries that compete for access in the world market for an agricultural product.

  17. 21 CFR 1271.370 - Labeling. (United States)


    ...) You must label each HCT/P made available for distribution clearly and accurately. (b) The following information must appear on the HCT/P label: (1) Distinct identification code affixed to the HCT/P container, and assigned in accordance with § 1271.290(c); (2) Description of the type of HCT/P; (3)...

  18. Comparative studies of antibody anti-CD20 labeled with {sup 188}Re; Estudo comparativo da marcacao do anticorpo anti-CD20 com {sup 188}Re

    Energy Technology Data Exchange (ETDEWEB)

    Dias, Carla Roberta de Barros Rodrigues


    Nuclear Medicine is an unique and important modality in oncology and the development of new tumor-targeted radiopharmaceuticals for both diagnosis and therapy is an area of interest for researchers. Rituximab (RTX) is a quimeric monoclonal antibody (mAb) (IgG 1) that specifically binds to CD20 antigen with high affinity and has been successfully used for the treatment of Non-Hodgkin Lymphoma (NHL) of cell B. The CD20 antigen is expressed over more than 90% of cell B NHL. Technetium-99m ({sup 99m}Tc) and rhenium-188 ({sup 188}Re) are an attractive radionuclide pair for clinical use due to their favorable decay properties for diagnosis ({sup 99m}Tc: T{sub 1/2} = 6 h, {gamma} radiation = 140 keV) and therapy ({sup 188}Re: T{sub 1/2} = 17 h, maximum {beta} energy = 2.12 MeV) and to their availability in the form of {sup 99}Mo/{sup 99}mTc and {sup 188}W/{sup 188}Re generators. The radionuclides can be conjugated to mAb using similar chemical procedures. The aim of this work was to study the labeling of anti-CD20 mAb (RTX) with {sup 188}Re using two techniques: the direct labeling method [{sup 188}Re(V)] and the labeling method via the carbonyl nucleus [{sup 188}Re(I)]. Besides the quality control, the radiolabeled mAb was submitted to in vivo, in vitro and ex vivo biological studies. For the direct labeling, RTX was reducing by incubation with 2-mercaptoethanol for generating sulphydryl groups (-SH) and further labeled with {sup 188}Re(V), in a study of several parameters in order to reach an optimized formulation. The labeling via the carbonyl nucleus both {sup 99}mTc and {sup 188}Re were employed through 2 different procedures: (1) labeling of intact RTX with {sup 99}mTc(I) and (2) reduced RTX (RTX{sub red}) labeled with {sup 99}mTc(I)/{sup 188}Re(I). Also a parameter study was performed to obtain an optimized formulation. The quality control method for evaluating the radiochemical purity showed a good labeling yield (93%) for the direct method. The labeling method

  19. Traffic light labelling: traduzindo a rotulagem de alimentos Traffic light labeling: translating food labeling


    Giovana Longo-Silva; Maysa Helena de Aguiar Toloni; José Augusto de Aguiar Carrazedo Taddei


    OBJETIVO: Apresentar uma adaptação do Traffic Light Labelling, ou "Semáforo Nutricional", adotado no Reino Unido e outros países da Europa, às normas vigentes no Brasil e classificar produtos industrializados comercializados no país. MÉTODOS: Esta ferramenta baseia-se na utilização das cores do semáforo para valorar concentrações de gorduras total, saturada e trans, açúcar, sódio e fibra correspondente a 100g ou 100mL do produto. O sinal vermelho indica que o nutriente está presente em quanti...

  20. Energy labeling for electric fans in Malaysia

    International Nuclear Information System (INIS)

    To reduce energy consumption in the residential sector, Malaysia Energy Commission is considering implementing energy labels for household electrical appliances including electric fans in 2005. The purpose of the energy labels is to provide the consumers a guideline to compare the size, features, price and efficiency of the appliance. This paper discusses the energy label for electric fans in this country based on Malaysian Standards developed by a technical committee that reviewed the performance of household electrical appliances. This study includes methodology for the calculation of the energy efficiency star rating and projected energy usage, performance requirements, details of the energy label and the requirements for the valid application in Malaysia. The label also can be adopted for other household electrical appliances with only slight modifications